#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ABCC3	8714	hgsc.bcm.edu	37	17	48735824	48735824	+	Missense_Mutation	SNP	T	T	C			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr17:48735824T>C	ENST00000285238.8	+	6	721	c.641T>C	c.(640-642)tTt>tCt	p.F214S	ABCC3_ENST00000427699.1_Missense_Mutation_p.F214S	NM_003786.3	NP_003777.2	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 3	214					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Doxorubicin(DB00997)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indomethacin(DB00328)|Lamivudine(DB00709)|Leucovorin(DB00650)|Methotrexate(DB00563)|Metyrapone(DB01011)|Nifedipine(DB01115)|Omeprazole(DB00338)|Phenobarbital(DB01174)|Probenecid(DB01032)|Rifampicin(DB01045)|Sulfinpyrazone(DB01138)|Verapamil(DB00661)|Vincristine(DB00541)	AGCGCTGGCTTTCTCTCCCGC	0.572																																																	0													135.0	123.0	127.0					17																	48735824		2203	4300	6503	SO:0001583	missense	8714			Y17151	CCDS32681.1, CCDS45739.1	17q21	2012-03-14			ENSG00000108846	ENSG00000108846		"""ATP binding cassette transporters / subfamily C"""	54	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter 2"""	604323				8894702, 9827529	Standard	NM_003786		Approved	MRP3, cMOAT2, EST90757, MLP2, MOAT-D	uc002isl.3	O15438	OTTHUMG00000162245	ENST00000285238.8:c.641T>C	17.37:g.48735824T>C	ENSP00000285238:p.Phe214Ser		B2RPA9|D3DTX9|O60265|O60922|O75621|O95078|O95289|O95290|Q86X85|Q9UN52	Missense_Mutation	SNP	ENST00000285238.8	37	CCDS32681.1	.	.	.	.	.	.	.	.	.	.	T	32	5.117683	0.94385	.	.	ENSG00000108846	ENST00000427699;ENST00000285238	D;D	0.92965	-3.14;-3.14	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	D	0.97012	0.9024	M	0.93016	3.37	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.991	D	0.97875	1.0288	10	0.87932	D	0	-34.2511	16.0249	0.80536	0.0:0.0:0.0:1.0	.	214;214	O15438;O15438-5	MRP3_HUMAN;.	S	214	ENSP00000395160:F214S;ENSP00000285238:F214S	ENSP00000285238:F214S	F	+	2	0	ABCC3	46090823	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.575000	0.82447	2.270000	0.75569	0.459000	0.35465	TTT		0.572	ABCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368083.2		NM_020038	
ADCY2	108	hgsc.bcm.edu	37	5	7706890	7706890	+	Silent	SNP	C	C	T			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr5:7706890C>T	ENST00000338316.4	+	8	1232	c.1143C>T	c.(1141-1143)aaC>aaT	p.N381N	ADCY2_ENST00000537121.1_Silent_p.N201N|RP11-711G10.1_ENST00000514105.2_RNA	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	381					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						TTGATATCAACATGCGCGTGG	0.468																																																	0													273.0	240.0	251.0					5																	7706890		2203	4300	6503	SO:0001819	synonymous_variant	108			AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.1143C>T	5.37:g.7706890C>T			B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Silent	SNP	ENST00000338316.4	37	CCDS3872.2																																																																																				0.468	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2		NM_020546	
AGPAT5	55326	hgsc.bcm.edu	37	8	6588326	6588326	+	Missense_Mutation	SNP	G	G	T			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr8:6588326G>T	ENST00000285518.6	+	3	696	c.384G>T	c.(382-384)ttG>ttT	p.L128F		NM_018361.3	NP_060831.2	Q9NUQ2	PLCE_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 5	128					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|hematopoietic progenitor cell differentiation (GO:0002244)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)		AGPAT5/MCPH1(2)	endometrium(2)|kidney(2)|large_intestine(4)|lung(3)	11			STAD - Stomach adenocarcinoma(24;0.0578)	READ - Rectum adenocarcinoma(644;0.156)|COAD - Colon adenocarcinoma(149;0.191)		GGCTGCCATTGTATGGGTGTT	0.398																																																	0													264.0	228.0	241.0					8																	6588326		2203	4300	6503	SO:0001583	missense	55326			AF375789	CCDS34796.1	8p23.1	2013-02-05	2013-02-05		ENSG00000155189	ENSG00000155189	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	20886	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, epsilon"""	614796	"""1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon)"""				Standard	NM_018361		Approved	FLJ11210, LPAAT-e, LPAAT-epsilon	uc003wqo.3	Q9NUQ2	OTTHUMG00000163656	ENST00000285518.6:c.384G>T	8.37:g.6588326G>T	ENSP00000285518:p.Leu128Phe		Q8IZ47|Q9BQG4	Missense_Mutation	SNP	ENST00000285518.6	37	CCDS34796.1	.	.	.	.	.	.	.	.	.	.	G	14.18	2.457468	0.43634	.	.	ENSG00000155189	ENST00000285518	D	0.94000	-3.33	5.82	1.92	0.25849	Phospholipid/glycerol acyltransferase (2);	0.000000	0.64402	D	0.000001	D	0.91586	0.7342	L	0.41079	1.255	0.58432	D	0.999992	P	0.43633	0.813	P	0.54664	0.758	D	0.86897	0.2052	10	0.36615	T	0.2	0.1614	5.6271	0.17488	0.2206:0.2674:0.512:0.0	.	128	Q9NUQ2	PLCE_HUMAN	F	128	ENSP00000285518:L128F	ENSP00000285518:L128F	L	+	3	2	AGPAT5	6575734	1.000000	0.71417	0.887000	0.34795	0.222000	0.24845	0.888000	0.28268	0.357000	0.24183	0.557000	0.71058	TTG		0.398	AGPAT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374684.1		NM_018361	
ALDH3B2	222	hgsc.bcm.edu;ucsc.edu	37	11	67431199	67431199	+	Missense_Mutation	SNP	C	C	T	rs180859869		TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr11:67431199C>T	ENST00000349015.3	-	9	1345	c.907G>A	c.(907-909)Ggc>Agc	p.G303S	ALDH3B2_ENST00000530069.1_Missense_Mutation_p.G303S|ALDH3B2_ENST00000531881.1_5'Flank	NM_000695.3	NP_000686	P48448	AL3B2_HUMAN	aldehyde dehydrogenase 3 family, member B2	303					alcohol metabolic process (GO:0006066)|ethanol catabolic process (GO:0006068)|lipid metabolic process (GO:0006629)		3-chloroallyl aldehyde dehydrogenase activity (GO:0004028)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|prostate(2)|stomach(1)|urinary_tract(1)	18						CCAAAGCTGCCGCTGCTGGTC	0.597													C|||	1	0.000199681	0.0	0.0	5008	,	,		19517	0.001		0.0	False		,,,				2504	0.0																0													87.0	75.0	79.0					11																	67431199		2200	4294	6494	SO:0001583	missense	222			U37519	CCDS31622.1	11q13.2	2014-09-04			ENSG00000132746	ENSG00000132746	1.2.1.5	"""Aldehyde dehydrogenases"""	411	protein-coding gene	gene with protein product	"""aldehyde dehydrogenase 8"", ""acetaldehyde dehydrogenase 8"""	601917		ALDH8		8890755, 9161417	Standard	NM_000695		Approved		uc001oms.3	P48448	OTTHUMG00000167284	ENST00000349015.3:c.907G>A	11.37:g.67431199C>T	ENSP00000255084:p.Gly303Ser		Q53Y98|Q8NAL5|Q96IB2	Missense_Mutation	SNP	ENST00000349015.3	37	CCDS31622.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	26.0	4.692677	0.88735	.	.	ENSG00000132746	ENST00000530069;ENST00000349015	D;D	0.86627	-2.15;-2.15	3.71	3.71	0.42584	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.061067	0.64402	U	0.000004	D	0.95604	0.8571	H	0.96889	3.9	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97298	0.9929	10	0.87932	D	0	.	15.6351	0.76946	0.0:1.0:0.0:0.0	.	303	P48448	AL3B2_HUMAN	S	303	ENSP00000431595:G303S;ENSP00000255084:G303S	ENSP00000255084:G303S	G	-	1	0	ALDH3B2	67187775	0.998000	0.40836	0.084000	0.20598	0.034000	0.12701	4.279000	0.58953	2.063000	0.61619	0.561000	0.74099	GGC		0.597	ALDH3B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394004.1		NM_000695	
ANKRD28	23243	hgsc.bcm.edu	37	3	15755032	15755032	+	Splice_Site	SNP	A	A	G			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr3:15755032A>G	ENST00000399451.2	-	10	1468		c.e10+1		ANKRD28_ENST00000383777.1_Splice_Site|ANKRD28_ENST00000497037.1_Splice_Site	NM_001195098.1|NM_001195099.1|NM_015199.3	NP_001182027.1|NP_001182028.1|NP_056014.2	O15084	ANR28_HUMAN	ankyrin repeat domain 28							nucleus (GO:0005634)				breast(2)|endometrium(1)|large_intestine(2)|prostate(1)	6						GTAAGTACTTACTTTGCAGTG	0.433																																																	0													153.0	144.0	147.0					3																	15755032		1957	4144	6101	SO:0001630	splice_region_variant	23243			AY367056	CCDS46769.1, CCDS74908.1	3p25.1	2013-01-10			ENSG00000206560	ENSG00000206560		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	29024	protein-coding gene	gene with protein product	"""phosphatase interactor targeting K protein"", ""protein phosphatase 6 ankyrin repeat subunit A"", ""protein phosphatase 1, regulatory subunit 65"""	611122				9205841	Standard	NM_015199		Approved	KIAA0379, PITK, PP6-ARS-A, PPP1R65	uc003caj.1	O15084	OTTHUMG00000155379	ENST00000399451.2:c.1100+1T>C	3.37:g.15755032A>G			B4DES5|Q1WWL4|Q29RW6|Q3B857|Q6ULS0|Q6ZT57	Splice_Site	SNP	ENST00000399451.2	37	CCDS46769.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.388815	0.82902	.	.	ENSG00000206560	ENST00000399451;ENST00000383777;ENST00000412318	.	.	.	5.29	5.29	0.74685	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.0989	0.65042	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ANKRD28	15730036	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.168000	0.94781	2.130000	0.65690	0.533000	0.62120	.		0.433	ANKRD28-003	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339758.1		NM_015199	Intron
AOX1	316	hgsc.bcm.edu	37	2	201474078	201474078	+	Missense_Mutation	SNP	A	A	C			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr2:201474078A>C	ENST00000374700.2	+	12	1335	c.1094A>C	c.(1093-1095)gAt>gCt	p.D365A	AOX1_ENST00000485106.1_3'UTR	NM_001159.3	NP_001150.3	Q06278	AOXA_HUMAN	aldehyde oxidase 1	365	FAD-binding PCMH-type. {ECO:0000255|PROSITE-ProRule:PRU00718}.				inflammatory response (GO:0006954)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	2 iron, 2 sulfur cluster binding (GO:0051537)|aldehyde oxidase activity (GO:0004031)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|NAD binding (GO:0051287)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)			breast(5)|endometrium(3)|kidney(4)|large_intestine(13)|lung(38)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	81					Allopurinol(DB00437)|Aminocaproic Acid(DB00513)|Brimonidine(DB00484)|Famciclovir(DB00426)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Pyrazinamide(DB00339)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	AGGCATCCAGATTCAGATCTG	0.368																																																	0													91.0	86.0	88.0					2																	201474078		2203	4300	6503	SO:0001583	missense	316			AF017060	CCDS33360.1	2q33	2008-05-20			ENSG00000138356	ENSG00000138356			553	protein-coding gene	gene with protein product		602841				7570184	Standard	NM_001159		Approved	AO, AOH1	uc002uvx.3	Q06278	OTTHUMG00000154536	ENST00000374700.2:c.1094A>C	2.37:g.201474078A>C	ENSP00000363832:p.Asp365Ala		O14765|Q53RR8|Q53TV3|Q9BYF0|Q9UPG6	Missense_Mutation	SNP	ENST00000374700.2	37	CCDS33360.1	.	.	.	.	.	.	.	.	.	.	A	3.646	-0.072546	0.07228	.	.	ENSG00000138356	ENST00000374700	T	0.20069	2.1	5.48	2.91	0.33838	FAD-binding, type 2 (2);CO dehydrogenase flavoprotein-like, FAD-binding, subdomain 2 (1);Molybdopterin dehydrogenase, FAD-binding (1);	0.239168	0.41097	D	0.000951	T	0.13372	0.0324	L	0.27053	0.805	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.17561	-1.0365	10	0.49607	T	0.09	-3.8774	7.5572	0.27831	0.6228:0.2738:0.0:0.1034	.	365	Q06278	ADO_HUMAN	A	365	ENSP00000363832:D365A	ENSP00000363832:D365A	D	+	2	0	AOX1	201182323	0.959000	0.32827	0.815000	0.32552	0.001000	0.01503	2.234000	0.43035	0.899000	0.36444	-0.490000	0.04691	GAT		0.368	AOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335844.1		NM_001159	
ATP1A3	478	hgsc.bcm.edu;ucsc.edu	37	19	42473672	42473672	+	Missense_Mutation	SNP	A	A	G			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr19:42473672A>G	ENST00000302102.5	-	19	2753	c.2603T>C	c.(2602-2604)tTc>tCc	p.F868S	ATP1A3_ENST00000545399.1_Missense_Mutation_p.F881S|ATP1A3_ENST00000602133.1_Missense_Mutation_p.F838S|ATP1A3_ENST00000543770.1_Missense_Mutation_p.F879S	NM_152296.4	NP_689509.1	P13637	AT1A3_HUMAN	ATPase, Na+/K+ transporting, alpha 3 polypeptide	868					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|memory (GO:0007613)|potassium ion import (GO:0010107)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	axon (GO:0030424)|dendritic spine head (GO:0044327)|dendritic spine neck (GO:0044326)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(19)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	52						GCCGGGCAAGAAGCCATTTTC	0.572																																																	0													101.0	98.0	99.0					19																	42473672		2203	4300	6503	SO:0001583	missense	478				CCDS12594.1, CCDS58663.1, CCDS58664.1	19q13.2	2012-10-22			ENSG00000105409	ENSG00000105409	3.6.3.9	"""ATPases / P-type"""	801	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-3"", ""sodium pump subunit alpha-3"", ""sodium-potassium ATPase catalytic subunit alpha-3"""	182350	"""dystonia 12"""	DYT12		17282997	Standard	NM_152296		Approved		uc002osh.4	P13637	OTTHUMG00000137384	ENST00000302102.5:c.2603T>C	19.37:g.42473672A>G	ENSP00000302397:p.Phe868Ser		B7Z2T0|B7Z401|F5H6J6|Q16732|Q16735|Q969K5	Missense_Mutation	SNP	ENST00000302102.5	37	CCDS12594.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.095684	0.76870	.	.	ENSG00000105409	ENST00000302102;ENST00000441343;ENST00000545399;ENST00000368080;ENST00000535899;ENST00000543770	D;D;D;D	0.89485	-2.52;-2.52;-2.52;-2.52	3.92	3.92	0.45320	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.96337	0.8805	H	0.98629	4.285	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.998;0.999;0.999	D	0.96723	0.9534	10	0.87932	D	0	.	11.063	0.47959	1.0:0.0:0.0:0.0	.	881;879;868;868	B7Z2T0;F5H6J6;E9PC51;P13637	.;.;.;AT1A3_HUMAN	S	868;868;881;838;612;879	ENSP00000302397:F868S;ENSP00000411503:F868S;ENSP00000444688:F881S;ENSP00000437577:F879S	ENSP00000302397:F868S	F	-	2	0	ATP1A3	47165512	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	9.139000	0.94554	1.797000	0.52628	0.379000	0.24179	TTC		0.572	ATP1A3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268107.1		NM_152296	
BCAM	4059	hgsc.bcm.edu	37	19	45322915	45322915	+	Silent	SNP	T	T	A			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr19:45322915T>A	ENST00000270233.6	+	13	1717	c.1695T>A	c.(1693-1695)gtT>gtA	p.V565V	BCAM_ENST00000589651.1_Silent_p.V565V	NM_001013257.2|NM_005581.4	NP_001013275.1|NP_005572.2	P50895	BCAM_HUMAN	basal cell adhesion molecule (Lutheran blood group)	565					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	laminin binding (GO:0043236)|laminin receptor activity (GO:0005055)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)				TCCTCGTCGTTGCTGTCTTCT	0.667																																																	0													42.0	40.0	40.0					19																	45322915		2202	4296	6498	SO:0001819	synonymous_variant	4059			X83425	CCDS12644.1, CCDS42575.1	19q12-q13	2014-07-18	2006-02-23	2006-01-12		ENSG00000187244		"""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6722	protein-coding gene	gene with protein product		612773	"""Lutheran blood group (Auberger b antigen included)"", ""basal cell adhesion molecule (Lu and Au blood groups)"""	LU			Standard	NM_005581		Approved	CD239	uc002ozu.4	P50895		ENST00000270233.6:c.1695T>A	19.37:g.45322915T>A			A8MYF9|A9YWT5|A9YWT6|Q86VC7	Silent	SNP	ENST00000270233.6	37	CCDS12644.1																																																																																				0.667	BCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453220.1		NM_005581	
BTRC	8945	hgsc.bcm.edu	37	10	103294568	103294568	+	Missense_Mutation	SNP	T	T	G			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr10:103294568T>G	ENST00000370187.3	+	10	1366	c.1248T>G	c.(1246-1248)atT>atG	p.I416M	BTRC_ENST00000393441.4_Missense_Mutation_p.I375M|BTRC_ENST00000408038.2_Missense_Mutation_p.I380M	NM_033637.3	NP_378663.1	Q9Y297	FBW1A_HUMAN	beta-transducin repeat containing E3 ubiquitin protein ligase	416					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cellular response to organic cyclic compound (GO:0071407)|G2/M transition of mitotic cell cycle (GO:0000086)|mammary gland epithelial cell proliferation (GO:0033598)|mitotic cell cycle (GO:0000278)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.I416M(1)		endometrium(4)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	27		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)		CAACTGACATTACCCTCCGGA	0.483																																																	1	Substitution - Missense(1)	large_intestine(1)											254.0	218.0	230.0					10																	103294568		2203	4300	6503	SO:0001583	missense	8945			Y14153	CCDS7511.1, CCDS7512.1, CCDS73183.1	10q24.32	2013-01-10	2012-02-23		ENSG00000166167	ENSG00000166167		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1144	protein-coding gene	gene with protein product		603482	"""beta-transducin repeat containing"""			9660940, 10331953, 18354483	Standard	NM_033637		Approved	bTrCP, betaTrCP, FBXW1A, Fwd1, beta-TrCP1, bTrCP1	uc001kta.4	Q9Y297	OTTHUMG00000018932	ENST00000370187.3:c.1248T>G	10.37:g.103294568T>G	ENSP00000359206:p.Ile416Met		B5MD49|Q5W141|Q5W142|Q9Y213	Missense_Mutation	SNP	ENST00000370187.3	37	CCDS7512.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.089199	0.76756	.	.	ENSG00000166167	ENST00000370187;ENST00000393441;ENST00000408038	T;T;T	0.61510	1.15;1.15;0.1	5.69	-7.31	0.01441	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.64402	D	0.000001	T	0.46678	0.1405	N	0.04880	-0.145	0.58432	D	0.999995	P;P;D	0.69078	0.577;0.699;0.997	P;P;D	0.76071	0.553;0.554;0.987	T	0.63924	-0.6527	10	0.51188	T	0.08	-12.033	11.9141	0.52755	0.0786:0.7796:0.0:0.1418	.	390;380;416	B7Z3H4;Q9Y297-2;Q9Y297	.;.;FBW1A_HUMAN	M	416;375;380	ENSP00000359206:I416M;ENSP00000377088:I375M;ENSP00000385339:I380M	ENSP00000359206:I416M	I	+	3	3	BTRC	103284558	0.003000	0.15002	0.758000	0.31321	0.991000	0.79684	-1.137000	0.03219	-1.481000	0.01863	-0.250000	0.11733	ATT		0.483	BTRC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049936.1		NM_033637	
C1orf216	127703	hgsc.bcm.edu;ucsc.edu	37	1	36181451	36181451	+	Missense_Mutation	SNP	C	C	T			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr1:36181451C>T	ENST00000270815.4	-	2	1242	c.472G>A	c.(472-474)Gag>Aag	p.E158K	C1orf216_ENST00000503824.1_5'Flank	NM_152374.1	NP_689587.1	Q8TAB5	CA216_HUMAN	chromosome 1 open reading frame 216	158										kidney(2)|lung(3)|skin(2)|urinary_tract(1)	8		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.196)				TTGTAGCGCTCCTGGACTTGT	0.632											OREG0013357	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													148.0	142.0	144.0					1																	36181451		2203	4300	6503	SO:0001583	missense	127703			AK096303	CCDS395.1	1p34.3	2007-08-10			ENSG00000142686	ENSG00000142686			26800	protein-coding gene	gene with protein product						12477932	Standard	NM_152374		Approved	FLJ38984	uc001bzh.1	Q8TAB5	OTTHUMG00000004167	ENST00000270815.4:c.472G>A	1.37:g.36181451C>T	ENSP00000425166:p.Glu158Lys	861	D3DPS1|Q8N8N6	Missense_Mutation	SNP	ENST00000270815.4	37	CCDS395.1	.	.	.	.	.	.	.	.	.	.	C	29.5	5.013200	0.93346	.	.	ENSG00000142686	ENST00000270815;ENST00000422623	.	.	.	5.32	5.32	0.75619	.	0.000000	0.64402	D	0.000001	T	0.64450	0.2599	L	0.59436	1.845	0.58432	D	0.999998	P	0.51537	0.946	P	0.52758	0.708	T	0.65635	-0.6120	9	0.49607	T	0.09	-17.6381	13.3148	0.60401	0.0:0.9242:0.0:0.0758	.	158	Q8TAB5	CA216_HUMAN	K	158;128	.	ENSP00000425166:E158K	E	-	1	0	C1orf216	35954038	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	4.284000	0.58983	2.486000	0.83907	0.561000	0.74099	GAG		0.632	C1orf216-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012013.3		NM_152374	
CARD8	22900	hgsc.bcm.edu	37	19	48715114	48715114	+	Silent	SNP	C	C	A			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr19:48715114C>A	ENST00000359009.4	-	10	1461	c.1149G>T	c.(1147-1149)gtG>gtT	p.V383V	CARD8_ENST00000521613.1_Silent_p.V439V|CARD8_ENST00000519940.1_Silent_p.V489V|ZNF114_ENST00000597695.1_Intron|CARD8_ENST00000357778.5_Intron|CARD8_ENST00000520753.1_3'UTR|CARD8_ENST00000520153.1_Silent_p.V439V|CARD8_ENST00000520015.1_3'UTR|CARD8_ENST00000391898.3_Silent_p.V489V|CTC-453G23.8_ENST00000595201.1_RNA|CARD8_ENST00000447740.2_Silent_p.V439V			Q9Y2G2	CARD8_HUMAN	caspase recruitment domain family, member 8	383	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)|NLRP3 inflammasome complex (GO:0072559)|nucleus (GO:0005634)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|NACHT domain binding (GO:0032089)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(4)|lung(8)|prostate(1)|skin(1)	15		all_lung(116;0.000112)|Lung NSC(112;0.000192)|all_epithelial(76;0.000349)|all_neural(266;0.0228)|Ovarian(192;0.113)|Prostate(7;0.184)		OV - Ovarian serous cystadenocarcinoma(262;0.000112)|all cancers(93;0.000293)|Epithelial(262;0.0129)|GBM - Glioblastoma multiforme(486;0.0336)		TTTCCTGCTCCACCAGCTCCT	0.542																																																	0													260.0	244.0	249.0					19																	48715114		2203	4300	6503	SO:0001819	synonymous_variant	22900			AB023172	CCDS12712.1, CCDS12712.2, CCDS54287.1, CCDS54288.1, CCDS54289.1	19q13.33	2011-05-24			ENSG00000105483	ENSG00000105483			17057	protein-coding gene	gene with protein product		609051				10231032, 11408476	Standard	NM_001184900		Approved	TUCAN, KIAA0955, CARDINAL, NDPP, Dakar	uc010xzj.2	Q9Y2G2	OTTHUMG00000165047	ENST00000359009.4:c.1149G>T	19.37:g.48715114C>A			B5KVR6|B7Z496|B7Z4A2|E9PEM7|G3XAM9|Q6PGP8|Q96P82	Silent	SNP	ENST00000359009.4	37																																																																																					0.542	CARD8-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding			NM_014959	
CDC27	996	hgsc.bcm.edu	37	17	45216160	45216160	+	Missense_Mutation	SNP	A	A	C	rs199626169		TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr17:45216160A>C	ENST00000066544.3	-	13	1742	c.1649T>G	c.(1648-1650)gTt>gGt	p.V550G	CDC27_ENST00000446365.2_Missense_Mutation_p.V489G|CDC27_ENST00000531206.1_Missense_Mutation_p.V556G|CDC27_ENST00000527547.1_Missense_Mutation_p.V549G	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	550					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.V550G(1)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TGAAAGAGCAACATCTTTTTG	0.353																																																	1	Substitution - Missense(1)	ovary(1)											46.0	52.0	50.0					17																	45216160		2202	4298	6500	SO:0001583	missense	996			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.1649T>G	17.37:g.45216160A>C	ENSP00000066544:p.Val550Gly		G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	A	24.9	4.578520	0.86645	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547	T;T;T;T	0.69306	-0.39;-0.39;-0.12;-0.38	5.57	5.57	0.84162	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.81197	0.4772	M	0.78637	2.42	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.74023	0.964;0.982;0.982;0.964	D	0.83770	0.0219	10	0.87932	D	0	-17.0982	13.6948	0.62572	1.0:0.0:0.0:0.0	.	489;549;556;550	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	G	550;556;489;549	ENSP00000066544:V550G;ENSP00000434614:V556G;ENSP00000392802:V489G;ENSP00000437339:V549G	ENSP00000066544:V550G	V	-	2	0	CDC27	42571159	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.962000	0.93254	2.117000	0.64856	0.528000	0.53228	GTT		0.353	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2			
CFTR	1080	hgsc.bcm.edu	37	7	117188850	117188850	+	Silent	SNP	G	G	T	rs79074685	byFrequency	TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr7:117188850G>T	ENST00000003084.6	+	10	1497	c.1365G>T	c.(1363-1365)gcG>gcT	p.A455A	CFTR_ENST00000454343.1_Intron	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	455	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.		A -> E (in CF). {ECO:0000269|PubMed:9401006}.		cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	AGTTGTTGGCGGTTGCTGGAT	0.388									Cystic Fibrosis																																								0			GRCh37	CD024716	CFTR	D	rs79074685						31.0	32.0	32.0					7																	117188850		2203	4300	6503	SO:0001819	synonymous_variant	1080	Familial Cancer Database	CF	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.1365G>T	7.37:g.117188850G>T			Q20BG8|Q20BH2|Q2I0A1|Q2I102	Silent	SNP	ENST00000003084.6	37	CCDS5773.1																																																																																				0.388	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059397.3		NM_000492	
COPS6	10980	hgsc.bcm.edu;ucsc.edu	37	7	99689085	99689086	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr7:99689085_99689086delCT	ENST00000303904.3	+	9	822_823	c.785_786delCT	c.(784-786)gctfs	p.A262fs	MIR93_ENST00000385024.1_RNA|MIR106B_ENST00000385301.1_RNA|MIR25_ENST00000384816.1_RNA|COPS6_ENST00000418625.1_Frame_Shift_Del_p.A261fs	NM_006833.4	NP_006824.2	Q7L5N1	CSN6_HUMAN	COP9 signalosome subunit 6	262	Interaction with Vpr.				cullin deneddylation (GO:0010388)|viral process (GO:0016032)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)		p.A262G(1)		breast(1)|endometrium(3)|large_intestine(4)|lung(2)|prostate(1)|stomach(1)	12	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			GAGGCCTATGCTCTGTGTCACT	0.505																																																	1	Substitution - Missense(1)	endometrium(1)																																								SO:0001589	frameshift_variant	10980			BC002520	CCDS5682.1	7q22.1	2013-03-14	2013-03-14		ENSG00000168090	ENSG00000168090			21749	protein-coding gene	gene with protein product	"""COP9 subunit 6 (MOV34 homolog, 34 kD)"""	614729	"""COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis)"""			12477932	Standard	NM_006833		Approved	MOV34-34KD, CSN6	uc003usu.3	Q7L5N1	OTTHUMG00000154632	ENST00000303904.3:c.785_786delCT	7.37:g.99689087_99689088delCT	ENSP00000304102:p.Ala262fs		A4D2A3|O15387	Frame_Shift_Del	DEL	ENST00000303904.3	37	CCDS5682.1																																																																																				0.505	COPS6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000336412.3		NM_006833	
CNOT4	4850	hgsc.bcm.edu;ucsc.edu	37	7	135095315	135095315	+	Silent	SNP	A	A	T			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr7:135095315A>T	ENST00000315544.5	-	7	1050	c.771T>A	c.(769-771)ggT>ggA	p.G257G	CNOT4_ENST00000451834.1_Silent_p.G257G|CNOT4_ENST00000423368.2_Silent_p.G257G|CNOT4_ENST00000541284.1_Silent_p.G257G|CNOT4_ENST00000361528.4_Silent_p.G257G|CNOT4_ENST00000356162.4_Silent_p.G257G|CNOT4_ENST00000428680.2_Silent_p.G257G|CNOT4_ENST00000414802.1_Silent_p.G257G	NM_001190848.1	NP_001177777.1	O95628	CNOT4_HUMAN	CCR4-NOT transcription complex, subunit 4	257					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|protein autoubiquitination (GO:0051865)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)	22						TATCAACTGAACCCGTAGATA	0.338																																					Ovarian(51;766 1130 5502 35047 50875)												0													125.0	122.0	123.0					7																	135095315		1830	4079	5909	SO:0001819	synonymous_variant	4850			AF180475	CCDS43650.1, CCDS47719.1, CCDS55164.1, CCDS55165.1, CCDS55166.1, CCDS55167.1	7q33	2013-09-19			ENSG00000080802	ENSG00000080802		"""RNA binding motif (RRM) containing"""	7880	protein-coding gene	gene with protein product		604911		NOT4		10637334	Standard	NM_013316		Approved	CLONE243, NOT4H	uc011kpy.2	O95628	OTTHUMG00000155568	ENST00000315544.5:c.771T>A	7.37:g.135095315A>T			B7Z6I4|E7ET38|F8VQP3|O95339|O95627|Q8IYM7|Q8NCL0|Q9NPQ1|Q9NZN6	Silent	SNP	ENST00000315544.5	37	CCDS55166.1																																																																																				0.338	CNOT4-201	KNOWN	basic|CCDS	protein_coding	protein_coding			NM_013316	
CSNK2A2	1459	hgsc.bcm.edu;ucsc.edu	37	16	58220677	58220677	+	Missense_Mutation	SNP	G	G	C			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr16:58220677G>C	ENST00000262506.3	-	3	483	c.300C>G	c.(298-300)gaC>gaG	p.D100E	CSNK2A2_ENST00000566813.1_5'UTR	NM_001896.2	NP_001887.1	P19784	CSK22_HUMAN	casein kinase 2, alpha prime polypeptide	100	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|mitotic cell cycle (GO:0000278)|mitotic spindle checkpoint (GO:0071174)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)	1						CCTTTACAGTGTCAATCAGCT	0.433																																					Melanoma(54;119 1219 18349 35700 39738)												0													158.0	145.0	149.0					16																	58220677		2198	4300	6498	SO:0001583	missense	1459			M55268	CCDS10794.1	16q21	2013-01-17			ENSG00000070770	ENSG00000070770			2459	protein-coding gene	gene with protein product		115442				2174700, 1766873	Standard	NM_001896		Approved	CSNK2A1	uc002enc.3	P19784	OTTHUMG00000133488	ENST00000262506.3:c.300C>G	16.37:g.58220677G>C	ENSP00000262506:p.Asp100Glu			Missense_Mutation	SNP	ENST00000262506.3	37	CCDS10794.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.214070	0.79352	.	.	ENSG00000070770	ENST00000262506	T	0.07688	3.17	6.01	5.06	0.68205	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.21509	0.0518	L	0.50333	1.59	0.80722	D	1	P	0.40553	0.721	P	0.57204	0.815	T	0.00348	-1.1799	10	0.72032	D	0.01	-3.9358	14.329	0.66541	0.0704:0.0:0.9296:0.0	.	100	P19784	CSK22_HUMAN	E	100	ENSP00000262506:D100E	ENSP00000262506:D100E	D	-	3	2	CSNK2A2	56778178	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.202000	0.58446	1.565000	0.49641	0.650000	0.86243	GAC		0.433	CSNK2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257386.2		NM_001896	
DNAH12	201625	hgsc.bcm.edu	37	3	57389197	57389197	+	Missense_Mutation	SNP	G	G	C			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr3:57389197G>C	ENST00000351747.2	-	43	6910	c.6730C>G	c.(6730-6732)Cga>Gga	p.R2244G	DNAH12_ENST00000344804.4_5'Flank	NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	2244	AAA 4. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						TTTAGAACTCGACATATTCTT	0.333																																																	0													129.0	104.0	112.0					3																	57389197		692	1591	2283	SO:0001583	missense	201625			U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.6730C>G	3.37:g.57389197G>C	ENSP00000295937:p.Arg2244Gly		A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Missense_Mutation	SNP	ENST00000351747.2	37		.	.	.	.	.	.	.	.	.	.	G	17.60	3.430094	0.62844	.	.	ENSG00000174844	ENST00000351747;ENST00000495027	T;T	0.57107	0.42;0.42	5.72	3.86	0.44501	Dynein heavy chain, P-loop containing D4 domain (1);	.	.	.	.	T	0.78059	0.4224	H	0.95712	3.71	0.80722	D	1	D	0.55172	0.97	P	0.60236	0.871	D	0.85130	0.0974	9	0.87932	D	0	.	15.2055	0.73175	0.0:0.0:0.7575:0.2425	.	2244	Q6ZR08	DYH12_HUMAN	G	2244;2263	ENSP00000295937:R2244G;ENSP00000418137:R2263G	ENSP00000295937:R2244G	R	-	1	2	DNAH12	57364237	1.000000	0.71417	0.992000	0.48379	0.997000	0.91878	7.727000	0.84838	0.818000	0.34468	0.655000	0.94253	CGA		0.333	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_178504	
DNAH8	1769	hgsc.bcm.edu;ucsc.edu	37	6	38997960	38997960	+	Missense_Mutation	SNP	C	C	T			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr6:38997960C>T	ENST00000359357.3	+	91	13519	c.13265C>T	c.(13264-13266)cCc>cTc	p.P4422L	DNAH8_ENST00000441566.1_Missense_Mutation_p.P4386L			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	4422					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						GAATCCACCCCCAAGGTACTC	0.502											OREG0017409	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													135.0	129.0	131.0					6																	38997960		2203	4300	6503	SO:0001583	missense	1769			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.13265C>T	6.37:g.38997960C>T	ENSP00000352312:p.Pro4422Leu	882	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	37		.	.	.	.	.	.	.	.	.	.	C	31	5.077772	0.94000	.	.	ENSG00000124721	ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.07444	3.19;3.19;3.19	5.56	5.56	0.83823	Dynein heavy chain (1);	0.065832	0.64402	D	0.000009	T	0.21022	0.0506	M	0.80422	2.495	0.80722	D	1	D	0.60575	0.988	P	0.62560	0.904	T	0.01149	-1.1436	10	0.30854	T	0.27	.	19.5354	0.95251	0.0:1.0:0.0:0.0	.	4422	Q96JB1	DYH8_HUMAN	L	4627;4422;4386	ENSP00000333363:P4627L;ENSP00000352312:P4422L;ENSP00000402294:P4386L	ENSP00000333363:P4627L	P	+	2	0	DNAH8	39105938	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.594000	0.61041	2.635000	0.89317	0.650000	0.86243	CCC		0.502	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1		NM_001206927	
DPY19L1	23333	hgsc.bcm.edu	37	7	35057542	35057542	+	Missense_Mutation	SNP	A	A	C	rs530132538		TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr7:35057542A>C	ENST00000310974.4	-	3	288	c.144T>G	c.(142-144)ttT>ttG	p.F48L		NM_015283.1	NP_056098.1	Q2PZI1	D19L1_HUMAN	dpy-19-like 1 (C. elegans)	48						integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity, transferring glycosyl groups (GO:0016757)			endometrium(3)|kidney(5)|large_intestine(8)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	31						AGAGGTGAGAAAAATGACGGT	0.318																																																	0													79.0	79.0	79.0					7																	35057542		1959	4198	6157	SO:0001583	missense	23333			AB020684	CCDS43567.1	7p14.3-p14.2	2006-04-26			ENSG00000173852	ENSG00000173852			22205	protein-coding gene	gene with protein product		613892					Standard	NM_015283		Approved	KIAA0877	uc003tem.4	Q2PZI1	OTTHUMG00000154888	ENST00000310974.4:c.144T>G	7.37:g.35057542A>C	ENSP00000308695:p.Phe48Leu		O94954|Q4G151	Missense_Mutation	SNP	ENST00000310974.4	37	CCDS43567.1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.642796	0.87859	.	.	ENSG00000173852	ENST00000310974	T	0.56275	0.47	5.17	3.97	0.46021	.	0.000000	0.85682	U	0.000000	T	0.72606	0.3481	M	0.86028	2.79	0.53005	D	0.999963	D	0.63046	0.992	D	0.76071	0.987	T	0.75010	-0.3468	10	0.66056	D	0.02	-17.0684	10.6925	0.45879	0.923:0.0:0.077:0.0	.	48	Q2PZI1	D19L1_HUMAN	L	48	ENSP00000308695:F48L	ENSP00000308695:F48L	F	-	3	2	DPY19L1	35024067	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.744000	0.62118	0.874000	0.35823	0.477000	0.44152	TTT		0.318	DPY19L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337506.1			
EFHD1	80303	hgsc.bcm.edu	37	2	233527579	233527579	+	Missense_Mutation	SNP	G	G	A			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr2:233527579G>A	ENST00000264059.3	+	2	847	c.370G>A	c.(370-372)Gcc>Acc	p.A124T	EFHD1_ENST00000409613.1_Missense_Mutation_p.A28T|EFHD1_ENST00000409708.1_Missense_Mutation_p.A12T|EFHD1_ENST00000410095.1_Missense_Mutation_p.A12T	NM_025202.3	NP_079478.1	Q9BUP0	EFHD1_HUMAN	EF-hand domain family, member D1	124	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				neuron projection development (GO:0031175)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|large_intestine(2)|lung(3)	7		all_hematologic(139;0.0123)|Acute lymphoblastic leukemia(138;0.0182)|Breast(86;0.0199)|Renal(207;0.025)		Epithelial(121;2.08e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000383)|LUSC - Lung squamous cell carcinoma(224;0.00825)|Lung(119;0.0101)		GAAGCTGGGGGCCCCCCAGAC	0.602																																																	0													71.0	75.0	74.0					2																	233527579		2203	4300	6503	SO:0001583	missense	80303				CCDS2497.1, CCDS58755.1	2q37.1	2014-07-01	2005-01-25		ENSG00000115468	ENSG00000115468		"""EF-hand domain containing"""	29556	protein-coding gene	gene with protein product	"""swiprosin-2"""	611617	"""EF hand domain containing 1"""			21244694	Standard	NM_025202		Approved	FLJ13612	uc002vtc.3	Q9BUP0	OTTHUMG00000133263	ENST00000264059.3:c.370G>A	2.37:g.233527579G>A	ENSP00000264059:p.Ala124Thr		B2RD83|E9PFH3|Q9BTF8|Q9H8I2|Q9HBQ0	Missense_Mutation	SNP	ENST00000264059.3	37	CCDS2497.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.149656	0.78001	.	.	ENSG00000115468	ENST00000409613;ENST00000264059;ENST00000540187;ENST00000409708;ENST00000427698;ENST00000410095	T;T;T;T;T	0.52983	0.64;0.64;0.64;0.64;0.64	4.98	4.98	0.66077	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.43875	0.1267	N	0.14661	0.345	0.80722	D	1	B;P	0.46859	0.103;0.885	B;P	0.51297	0.062;0.665	T	0.36065	-0.9763	10	0.34782	T	0.22	-16.4997	17.4183	0.87507	0.0:0.0:1.0:0.0	.	28;124	E9PFH3;Q9BUP0	.;EFHD1_HUMAN	T	28;124;27;12;12;12	ENSP00000386556:A28T;ENSP00000264059:A124T;ENSP00000386243:A12T;ENSP00000401073:A12T;ENSP00000386685:A12T	ENSP00000264059:A124T	A	+	1	0	EFHD1	233235823	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.460000	0.97641	2.585000	0.87301	0.462000	0.41574	GCC		0.602	EFHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257040.2		NM_025202	
FAM105A	54491	hgsc.bcm.edu	37	5	14602319	14602319	+	Missense_Mutation	SNP	C	C	A	rs144733724		TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr5:14602319C>A	ENST00000274217.3	+	5	496	c.376C>A	c.(376-378)Cac>Aac	p.H126N		NM_019018.2	NP_061891.1	Q9NUU6	F105A_HUMAN	family with sequence similarity 105, member A	126										large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	Lung NSC(4;0.00592)					TTGGCGGCATCACATTAAATG	0.343																																																	0								C	ASN/HIS	1,4405	2.1+/-5.4	0,1,2202	102.0	98.0	99.0		376	4.7	0.1	5	dbSNP_134	99	0,8600		0,0,4300	yes	missense	FAM105A	NM_019018.2	68	0,1,6502	AA,AC,CC		0.0,0.0227,0.0077	benign	126/357	14602319	1,13005	2203	4300	6503	SO:0001583	missense	54491				CCDS3884.1	5p15.2	2014-02-24			ENSG00000145569	ENSG00000145569		"""OTU domain containing"""	25629	protein-coding gene	gene with protein product						12477932	Standard	NM_019018		Approved	FLJ11127, NET20	uc003jfj.3	Q9NUU6	OTTHUMG00000131056	ENST00000274217.3:c.376C>A	5.37:g.14602319C>A	ENSP00000274217:p.His126Asn		Q53H50|Q9H037	Missense_Mutation	SNP	ENST00000274217.3	37	CCDS3884.1	.	.	.	.	.	.	.	.	.	.	C	10.54	1.380014	0.24944	2.27E-4	0.0	ENSG00000145569	ENST00000274217	T	0.17691	2.26	4.7	4.7	0.59300	.	0.236225	0.36628	N	0.002490	T	0.17916	0.0430	L	0.51422	1.61	0.24338	N	0.994979	P	0.35272	0.493	B	0.36845	0.234	T	0.13045	-1.0524	10	0.20519	T	0.43	-13.5922	14.5074	0.67762	0.0:0.8527:0.1473:0.0	.	126	Q9NUU6	F105A_HUMAN	N	126	ENSP00000274217:H126N	ENSP00000274217:H126N	H	+	1	0	FAM105A	14655319	0.222000	0.23652	0.146000	0.22360	0.994000	0.84299	3.961000	0.56759	2.311000	0.77944	0.555000	0.69702	CAC		0.343	FAM105A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253710.1		NM_019018	
FANCM	57697	hgsc.bcm.edu	37	14	45658098	45658098	+	Missense_Mutation	SNP	G	G	T			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr14:45658098G>T	ENST00000267430.5	+	20	4958	c.4873G>T	c.(4873-4875)Gtt>Ttt	p.V1625F	FANCM_ENST00000542564.2_Missense_Mutation_p.V1599F	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	1625					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						AGAAGTTTGTGTTGATTTTAA	0.328								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																																								0													84.0	86.0	86.0					14																	45658098		2203	4297	6500	SO:0001583	missense	57697	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.4873G>T	14.37:g.45658098G>T	ENSP00000267430:p.Val1625Phe		B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Missense_Mutation	SNP	ENST00000267430.5	37	CCDS32070.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.40|14.40	2.524603|2.524603	0.44969|0.44969	.|.	.|.	ENSG00000187790|ENSG00000187790	ENST00000554809|ENST00000267430;ENST00000542564;ENST00000556250	T|T;T;T	0.76968|0.77620	-1.06|-1.11;-1.11;-1.11	5.67|5.67	2.79|2.79	0.32731|0.32731	.|.	.|0.634340	.|0.16681	.|N	.|0.203956	T|T	0.74238|0.74238	0.3690|0.3690	M|M	0.70595|0.70595	2.14|2.14	0.32696|0.32696	N|N	0.513477|0.513477	.|B;B	.|0.21753	.|0.06;0.015	.|B;B	.|0.20384	.|0.029;0.01	T|T	0.76008|0.76008	-0.3116|-0.3116	6|10	.|0.54805	.|T	.|0.06	.|.	9.3837|9.3837	0.38329|0.38329	0.2981:0.0:0.7019:0.0|0.2981:0.0:0.7019:0.0	.|.	.|1599;1625	.|B2RTQ9;Q8IYD8	.|.;FANCM_HUMAN	F|F	557|1625;1599;1141	ENSP00000450632:C557F|ENSP00000267430:V1625F;ENSP00000442493:V1599F;ENSP00000452033:V1141F	.|ENSP00000267430:V1625F	C|V	+|+	2|1	0|0	FANCM|FANCM	44727848|44727848	0.984000|0.984000	0.35163|0.35163	0.992000|0.992000	0.48379|0.48379	0.994000|0.994000	0.84299|0.84299	1.503000|1.503000	0.35715|0.35715	0.851000|0.851000	0.35264|0.35264	0.650000|0.650000	0.86243|0.86243	TGT|GTT		0.328	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1		XM_048128	
FAT3	120114	hgsc.bcm.edu	37	11	92600266	92600266	+	Silent	SNP	G	G	A	rs75649640	byFrequency	TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr11:92600266G>A	ENST00000298047.6	+	21	12035	c.12018G>A	c.(12016-12018)gcG>gcA	p.A4006A	FAT3_ENST00000525166.1_Silent_p.A3856A|FAT3_ENST00000533797.1_Silent_p.A341A|FAT3_ENST00000409404.2_Silent_p.A4006A			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	4006	Laminin G-like. {ECO:0000255|PROSITE- ProRule:PRU00122}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GCAGCTTCGCGGAGGTGGTGG	0.667										TCGA Ovarian(4;0.039)			G|||	329	0.0656949	0.0492	0.0418	5008	,	,		17013	0.0139		0.0716	False		,,,				2504	0.1524																0								G		175,3883		6,163,1860	10.0	12.0	11.0		12018	-6.6	0.9	11	dbSNP_132	11	630,7706		26,578,3564	no	coding-synonymous	FAT3	NM_001008781.2		32,741,5424	AA,AG,GG		7.5576,4.3125,6.4951		4006/4558	92600266	805,11589	2029	4168	6197	SO:0001819	synonymous_variant	120114			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.12018G>A	11.37:g.92600266G>A			B5MDB0|Q96AU6	Silent	SNP	ENST00000298047.6	37																																																																																					0.667	FAT3-201	KNOWN	basic	protein_coding	protein_coding			NM_001008781	
GLT8D2	83468	hgsc.bcm.edu	37	12	104387233	104387233	+	Missense_Mutation	SNP	T	T	C	rs145520946	byFrequency	TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr12:104387233T>C	ENST00000360814.4	-	10	1222	c.817A>G	c.(817-819)Atg>Gtg	p.M273V	GLT8D2_ENST00000546436.1_Missense_Mutation_p.M273V|GLT8D2_ENST00000548660.1_Missense_Mutation_p.M273V	NM_031302.3	NP_112592.1	Q9H1C3	GL8D2_HUMAN	glycosyltransferase 8 domain containing 2	273						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			kidney(3)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)	16						ACAATCAGCATTGGGGAGGTG	0.453													T|||	4	0.000798722	0.0	0.0029	5008	,	,		17687	0.0		0.002	False		,,,				2504	0.0																0								T	VAL/MET	16,4390	23.3+/-48.9	0,16,2187	58.0	59.0	59.0		817	4.3	1.0	12	dbSNP_134	59	94,8506	51.5+/-111.7	0,94,4206	yes	missense	GLT8D2	NM_031302.3	21	0,110,6393	CC,CT,TT		1.093,0.3631,0.8458	probably-damaging	273/350	104387233	110,12896	2203	4300	6503	SO:0001583	missense	83468			BC022343	CCDS9096.1	12q23.3	2013-02-22			ENSG00000120820	ENSG00000120820		"""Glycosyltransferase family 8 domain containing"""	24890	protein-coding gene	gene with protein product							Standard	NM_031302		Approved	FLJ31494	uc001tkh.1	Q9H1C3	OTTHUMG00000170120	ENST00000360814.4:c.817A>G	12.37:g.104387233T>C	ENSP00000354053:p.Met273Val		Q96KA2	Missense_Mutation	SNP	ENST00000360814.4	37	CCDS9096.1	3	0.0013736263736263737	0	0.0	2	0.0055248618784530384	0	0.0	1	0.0013192612137203166	T	17.81	3.480617	0.63849	0.003631	0.01093	ENSG00000120820	ENST00000360814;ENST00000546436;ENST00000548660	T;T;T	0.21543	2.0;2.0;2.0	5.44	4.26	0.50523	.	0.034666	0.85682	D	0.000000	T	0.30823	0.0777	L	0.61387	1.9	0.80722	D	1	D	0.59357	0.985	D	0.72338	0.977	T	0.08351	-1.0726	10	0.16896	T	0.51	.	12.3653	0.55224	0.0:0.0:0.1412:0.8588	.	273	Q9H1C3	GL8D2_HUMAN	V	273	ENSP00000354053:M273V;ENSP00000449750:M273V;ENSP00000447450:M273V	ENSP00000354053:M273V	M	-	1	0	GLT8D2	102911363	1.000000	0.71417	0.971000	0.41717	0.997000	0.91878	4.214000	0.58527	0.869000	0.35703	0.533000	0.62120	ATG		0.453	GLT8D2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407371.1		NM_031302	
GREB1	9687	hgsc.bcm.edu	37	2	11777871	11777871	+	Silent	SNP	G	G	A			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr2:11777871G>A	ENST00000381486.2	+	31	5676	c.5376G>A	c.(5374-5376)ccG>ccA	p.P1792P	GREB1_ENST00000234142.5_Silent_p.P1792P|GREB1_ENST00000396123.1_Silent_p.P790P	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	1792						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		CGGTCGTGCCGGCCCAGTACA	0.657																																					Ovarian(39;850 945 2785 23371 33093)												0													52.0	59.0	56.0					2																	11777871		2109	4212	6321	SO:0001819	synonymous_variant	9687				CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.5376G>A	2.37:g.11777871G>A			A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Silent	SNP	ENST00000381486.2	37	CCDS42655.1																																																																																				0.657	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1		NM_014668	
GTSE1	51512	hgsc.bcm.edu	37	22	46719127	46719127	+	Silent	SNP	A	A	G			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr22:46719127A>G	ENST00000454366.1	+	8	1685	c.1473A>G	c.(1471-1473)gcA>gcG	p.A491A		NM_016426.6	NP_057510	Q9NYZ3	GTSE1_HUMAN	G-2 and S-phase expressed 1	472					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|microtubule-based process (GO:0007017)	cytoplasmic microtubule (GO:0005881)|membrane (GO:0016020)				NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	27		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00462)		TTTCGCGGGCACAGCGGCCGC	0.547																																					GBM(153;542 1915 12487 29016 50495)												0													155.0	150.0	152.0					22																	46719127		2203	4300	6503	SO:0001819	synonymous_variant	51512			AF223408	CCDS14074.2	22q13.2-q13.3	2008-06-10			ENSG00000075218	ENSG00000075218			13698	protein-coding gene	gene with protein product		607477				10974554, 10984615, 12750368	Standard	NM_016426		Approved	GTSE-1, B99	uc011aqy.2	Q9NYZ3	OTTHUMG00000150486	ENST00000454366.1:c.1473A>G	22.37:g.46719127A>G			B0QYM3|Q20WK2|Q53GX5|Q5R3I6|Q6DHX4|Q9BRE0|Q9UGZ9|Q9Y557	Silent	SNP	ENST00000454366.1	37	CCDS14074.2																																																																																				0.547	GTSE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318360.2		NM_016426	
GUSB	2990	hgsc.bcm.edu;ucsc.edu	37	7	65441161	65441161	+	Silent	SNP	C	C	T			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr7:65441161C>T	ENST00000304895.4	-	5	883	c.753G>A	c.(751-753)aaG>aaA	p.K251K	GUSB_ENST00000476486.1_5'UTR|GUSB_ENST00000421103.1_Intron|GUSB_ENST00000345660.6_Silent_p.K251K	NM_000181.3	NP_000172.2	P08236	BGLR_HUMAN	glucuronidase, beta	251					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	beta-glucuronidase activity (GO:0004566)			breast(1)|cervix(2)|kidney(2)|large_intestine(4)|lung(10)|skin(1)	20						GGTTACTGCCCTTGACAGAGA	0.542																																																	0													63.0	53.0	56.0					7																	65441161		2203	4300	6503	SO:0001819	synonymous_variant	2990			M15182	CCDS5530.1, CCDS64665.1	7q11.21	2012-10-02			ENSG00000169919	ENSG00000169919	3.2.1.31		4696	protein-coding gene	gene with protein product		611499				3468507	Standard	NM_000181		Approved		uc003tun.3	P08236	OTTHUMG00000023735	ENST00000304895.4:c.753G>A	7.37:g.65441161C>T			B4E1F6|E9PCV0|Q549U0|Q96CL9	Silent	SNP	ENST00000304895.4	37	CCDS5530.1																																																																																				0.542	GUSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251637.3		NM_000181	
HIF3A	64344	hgsc.bcm.edu	37	19	46828841	46828841	+	Missense_Mutation	SNP	T	T	A			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr19:46828841T>A	ENST00000377670.4	+	11	1416	c.1385T>A	c.(1384-1386)cTc>cAc	p.L462H	HIF3A_ENST00000420102.2_Missense_Mutation_p.L411H|AC007193.10_ENST00000596807.1_RNA|HIF3A_ENST00000244303.6_Missense_Mutation_p.L393H|HIF3A_ENST00000472815.1_Missense_Mutation_p.L393H|HIF3A_ENST00000300862.3_Missense_Mutation_p.L460H|HIF3A_ENST00000600383.1_Missense_Mutation_p.L393H|HIF3A_ENST00000339613.2_Missense_Mutation_p.L406H	NM_152795.3	NP_690008.2	Q9Y2N7	HIF3A_HUMAN	hypoxia inducible factor 3, alpha subunit	462	NTAD.|ODD.				cellular response to hypoxia (GO:0071456)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(14)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	33		Ovarian(192;0.00965)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00204)|all cancers(93;0.0107)|GBM - Glioblastoma multiforme(486;0.0489)|Epithelial(262;0.136)		GTGCACAGACTCTTCACCTCC	0.512																																																	0													158.0	156.0	157.0					19																	46828841		2203	4300	6503	SO:0001583	missense	64344			AK027725	CCDS12681.2, CCDS12682.1, CCDS42580.1, CCDS42580.2	19q13	2013-05-21			ENSG00000124440	ENSG00000124440		"""Basic helix-loop-helix proteins"""	15825	protein-coding gene	gene with protein product		609976				11573933, 11734856	Standard	NM_152794		Approved	IPAS, MOP7, PASD7, bHLHe17	uc002peh.3	Q9Y2N7	OTTHUMG00000141296	ENST00000377670.4:c.1385T>A	19.37:g.46828841T>A	ENSP00000366898:p.Leu462His		B0M185|B4DNA2|Q58A43|Q66K72|Q8WXA1|Q96K34|Q9H7Z9|Q9HAI2	Missense_Mutation	SNP	ENST00000377670.4	37	CCDS12681.2	.	.	.	.	.	.	.	.	.	.	T	14.93	2.682713	0.47991	.	.	ENSG00000124440	ENST00000244302;ENST00000377670;ENST00000244303;ENST00000339613;ENST00000291300;ENST00000300862;ENST00000420102	T;T;T;T;T	0.78481	-0.36;-1.16;-0.49;-0.36;-1.18	4.47	2.36	0.29203	.	1.222120	0.06194	N	0.681989	T	0.76147	0.3947	L	0.27053	0.805	0.09310	N	1	D;P;D;P;D;P;P	0.67145	0.996;0.947;0.969;0.947;0.979;0.948;0.947	P;B;P;B;B;B;B	0.56216	0.794;0.322;0.614;0.439;0.41;0.41;0.237	T	0.61860	-0.6976	10	0.62326	D	0.03	.	6.2081	0.20613	0.0:0.2133:0.0:0.7867	.	411;393;460;411;406;462;462	F5H884;B4DNA2;Q9Y2N7-2;B4DSD9;A8MPQ1;Q9Y2N7;B0M185	.;.;.;.;.;HIF3A_HUMAN;.	H	462;462;393;406;406;460;411	ENSP00000366898:L462H;ENSP00000244303:L393H;ENSP00000341877:L406H;ENSP00000300862:L460H;ENSP00000407771:L411H	ENSP00000244302:L462H	L	+	2	0	HIF3A	51520681	0.012000	0.17670	0.033000	0.17914	0.243000	0.25628	0.936000	0.28938	0.322000	0.23283	0.528000	0.53228	CTC		0.512	HIF3A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280556.3			
KALRN	8997	hgsc.bcm.edu	37	3	124369683	124369683	+	Missense_Mutation	SNP	G	G	C			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr3:124369683G>C	ENST00000291478.5	+	5	762	c.599G>C	c.(598-600)aGc>aCc	p.S200T	KALRN_ENST00000459915.1_5'UTR|KALRN_ENST00000360013.3_Missense_Mutation_p.S1897T|KALRN_ENST00000393496.1_Missense_Mutation_p.S238T|KALRN_ENST00000428018.2_Missense_Mutation_p.S168T	NM_007064.3	NP_008995.2	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	1896					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						TACCGGGGGAGCTTGAAAGAC	0.512																																																	0													79.0	83.0	82.0					3																	124369683		2203	4300	6503	SO:0001583	missense	8997			U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000291478.5:c.599G>C	3.37:g.124369683G>C	ENSP00000291478:p.Ser200Thr		A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	ENST00000291478.5	37	CCDS3028.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.15|13.15	2.152632|2.152632	0.38021|0.38021	.|.	.|.	ENSG00000160145|ENSG00000160145	ENST00000354186|ENST00000360013;ENST00000393496;ENST00000291478;ENST00000454902;ENST00000428018	.|T;T;T;T	.|0.61274	.|0.14;0.66;0.16;0.12	4.83|4.83	3.94|3.94	0.45596|0.45596	.|.	.|0.679004	.|0.15272	.|N	.|0.271183	T|T	0.52645|0.52645	0.1747|0.1747	M|M	0.71036|0.71036	2.16|2.16	0.35179|0.35179	D|D	0.772302|0.772302	.|B;B;B	.|0.26002	.|0.135;0.095;0.139	.|B;B;B	.|0.24155	.|0.026;0.051;0.018	T|T	0.55860|0.55860	-0.8074|-0.8074	5|10	.|0.21540	.|T	.|0.41	.|.	8.6777|8.6777	0.34189|0.34189	0.0811:0.1535:0.7654:0.0|0.0811:0.1535:0.7654:0.0	.|.	.|200;238;1896	.|C9JQ37;O60229-5;O60229	.|.;.;KALRN_HUMAN	P|T	1866|1897;238;200;168;168	.|ENSP00000353109:S1897T;ENSP00000377134:S238T;ENSP00000291478:S200T;ENSP00000402419:S168T	.|ENSP00000291478:S200T	A|S	+|+	1|2	0|0	KALRN|KALRN	125852373|125852373	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	3.461000|3.461000	0.53035|0.53035	1.216000|1.216000	0.43427|0.43427	0.655000|0.655000	0.94253|0.94253	GCT|AGC		0.512	KALRN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000246891.5		NM_003947	
LRRC66	339977	hgsc.bcm.edu;ucsc.edu	37	4	52862202	52862202	+	Missense_Mutation	SNP	T	T	G			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr4:52862202T>G	ENST00000343457.3	-	4	992	c.986A>C	c.(985-987)cAc>cCc	p.H329P		NM_001024611.1	NP_001019782.1	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	329						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(8)|lung(34)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	58						AATGCCCGTGTGCCTTCCTCC	0.567																																																	0													36.0	36.0	36.0					4																	52862202		1877	4107	5984	SO:0001583	missense	339977			BC040414	CCDS43229.1	4q12	2008-08-08			ENSG00000188993	ENSG00000188993			34299	protein-coding gene	gene with protein product							Standard	XM_005265739		Approved		uc003gzi.3	Q68CR7	OTTHUMG00000160623	ENST00000343457.3:c.986A>C	4.37:g.52862202T>G	ENSP00000341944:p.His329Pro			Missense_Mutation	SNP	ENST00000343457.3	37	CCDS43229.1	.	.	.	.	.	.	.	.	.	.	T	9.935	1.215839	0.22373	.	.	ENSG00000188993	ENST00000343457	T	0.43688	0.94	3.89	-7.78	0.01223	.	4.753160	0.00166	N	0.000004	T	0.23014	0.0556	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.13072	-1.0523	10	0.36615	T	0.2	2.1279	7.2746	0.26277	0.0:0.1861:0.5423:0.2716	.	329	Q68CR7	LRC66_HUMAN	P	329	ENSP00000341944:H329P	ENSP00000341944:H329P	H	-	2	0	LRRC66	52556959	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.361000	0.02597	-1.517000	0.01780	-0.353000	0.07706	CAC		0.567	LRRC66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361473.1		NM_001024611	
MED12L	116931	hgsc.bcm.edu	37	3	151134118	151134118	+	Missense_Mutation	SNP	C	C	T			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr3:151134118C>T	ENST00000474524.1	+	41	6249	c.6211C>T	c.(6211-6213)Ccc>Tcc	p.P2071S	MED12L_ENST00000273432.4_Intron	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	2071	Gln-rich.					mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			gccccagcagccccagcccca	0.542																																																	0													24.0	28.0	26.0					3																	151134118		2203	4300	6503	SO:0001583	missense	116931			AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.6211C>T	3.37:g.151134118C>T	ENSP00000417235:p.Pro2071Ser		Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Missense_Mutation	SNP	ENST00000474524.1	37	CCDS33876.1	.	.	.	.	.	.	.	.	.	.	C	5.552	0.286812	0.10513	.	.	ENSG00000144893	ENST00000474524	T	0.56275	0.47	4.45	2.59	0.31030	.	2.084100	0.02523	U	0.092786	T	0.32941	0.0846	N	0.08118	0	0.80722	D	1	B	0.15930	0.015	B	0.19946	0.027	T	0.30937	-0.9961	10	0.08179	T	0.78	0.3584	8.0466	0.30553	0.1733:0.6458:0.1809:0.0	.	2071	Q86YW9	MD12L_HUMAN	S	2071	ENSP00000417235:P2071S	ENSP00000417235:P2071S	P	+	1	0	MED12L	152616808	0.875000	0.30112	0.997000	0.53966	0.972000	0.66771	0.249000	0.18216	0.459000	0.27016	0.591000	0.81541	CCC		0.542	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357707.2		NM_053002	
MICAL3	57553	hgsc.bcm.edu	37	22	18304890	18304890	+	Silent	SNP	A	A	G			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr22:18304890A>G	ENST00000441493.2	-	24	3706	c.3354T>C	c.(3352-3354)cgT>cgC	p.R1118R		NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	1118	Glu-rich.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		GGCACGGCAAACGCAGCTCTC	0.617																																																	0													70.0	77.0	74.0					22																	18304890		2137	4235	6372	SO:0001819	synonymous_variant	57553			AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.3354T>C	22.37:g.18304890A>G			B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Silent	SNP	ENST00000441493.2	37	CCDS46659.1	.	.	.	.	.	.	.	.	.	.	A	4.695	0.129204	0.08981	.	.	ENSG00000093100	ENST00000252134	.	.	.	3.91	-1.58	0.08479	.	.	.	.	.	T	0.18759	0.0450	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24728	-1.0152	4	.	.	.	.	1.1819	0.01846	0.2343:0.1692:0.425:0.1716	.	.	.	.	A	100	.	.	V	-	2	0	XXbac-B461K10.4	16684890	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.027000	0.12371	-0.066000	0.12998	-0.375000	0.07067	GTT		0.617	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1			
NEUROD1	4760	hgsc.bcm.edu	37	2	182542619	182542619	+	Silent	SNP	G	G	C			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr2:182542619G>C	ENST00000295108.3	-	2	1426	c.969C>G	c.(967-969)gcC>gcG	p.A323A	NEUROD1_ENST00000496876.1_Intron|CERKL_ENST00000479558.1_Intron	NM_002500.4	NP_002491.2	Q13562	NDF1_HUMAN	neuronal differentiation 1	323					amacrine cell differentiation (GO:0035881)|anterior/posterior pattern specification (GO:0009952)|cellular response to glucose stimulus (GO:0071333)|cerebellum development (GO:0021549)|dentate gyrus development (GO:0021542)|embryonic organ morphogenesis (GO:0048562)|endocrine pancreas development (GO:0031018)|enteroendocrine cell differentiation (GO:0035883)|glucose homeostasis (GO:0042593)|inner ear development (GO:0048839)|insulin secretion (GO:0030073)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neurogenesis (GO:0022008)|nitric oxide mediated signal transduction (GO:0007263)|nucleocytoplasmic transport (GO:0006913)|pancreatic A cell fate commitment (GO:0003326)|pancreatic PP cell fate commitment (GO:0003329)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle arrest (GO:0071156)|regulation of insulin secretion (GO:0050796)|regulation of intestinal epithelial structure maintenance (GO:0060730)|response to drug (GO:0042493)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|protein heterodimerization activity (GO:0046982)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25			OV - Ovarian serous cystadenocarcinoma(117;0.088)			CGCAGCGAGGGGCAGCGGTGC	0.507																																																	0													91.0	92.0	92.0					2																	182542619		2203	4300	6503	SO:0001819	synonymous_variant	4760			U50823	CCDS2283.1	2q32	2013-05-21	2012-02-22		ENSG00000162992	ENSG00000162992		"""Basic helix-loop-helix proteins"""	7762	protein-coding gene	gene with protein product	"""beta-cell E-box transactivator 2"", ""neurogenic helix-loop-helix protein NEUROD"""	601724	"""neurogenic differentiation 1"""	NEUROD		7754368, 8786144	Standard	NM_002500		Approved	BETA2, BHF-1, NeuroD, bHLHa3, MODY6	uc002uof.4	Q13562	OTTHUMG00000132583	ENST00000295108.3:c.969C>G	2.37:g.182542619G>C			B2R9I8|F1T0E1|O00343|Q13340|Q5U095|Q96TH0|Q99455|Q9UEC8	Silent	SNP	ENST00000295108.3	37	CCDS2283.1																																																																																				0.507	NEUROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255792.2		NM_002500	
NIPBL	25836	hgsc.bcm.edu	37	5	37051934	37051934	+	Silent	SNP	C	C	T			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr5:37051934C>T	ENST00000282516.8	+	41	7507	c.7008C>T	c.(7006-7008)aaC>aaT	p.N2336N	NIPBL_ENST00000448238.2_Silent_p.N2336N	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	2336					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			CTATGCGGAACAAGGCTGATC	0.318																																																	0													82.0	87.0	85.0					5																	37051934		2203	4300	6503	SO:0001819	synonymous_variant	25836			AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.7008C>T	5.37:g.37051934C>T			Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Silent	SNP	ENST00000282516.8	37	CCDS3920.1																																																																																				0.318	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1		NM_015384	
NR2C1	7181	hgsc.bcm.edu	37	12	95445694	95445694	+	Missense_Mutation	SNP	C	C	A			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr12:95445694C>A	ENST00000333003.5	-	8	1139	c.809G>T	c.(808-810)aGt>aTt	p.S270I	NR2C1_ENST00000330677.7_Missense_Mutation_p.S270I|NR2C1_ENST00000393101.3_Missense_Mutation_p.S270I|NR2C1_ENST00000545833.1_5'UTR	NM_003297.3	NP_003288.2	P13056	NR2C1_HUMAN	nuclear receptor subfamily 2, group C, member 1	270					gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	DNA binding (GO:0003677)|receptor activity (GO:0004872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)	13						GGCCAATGTACTTAAATCTCC	0.294																																																	0													59.0	60.0	60.0					12																	95445694		2203	4300	6503	SO:0001583	missense	7181			M29960	CCDS9051.1, CCDS41821.1, CCDS44953.1	12q22	2013-01-16				ENSG00000120798		"""Nuclear hormone receptors"""	7971	protein-coding gene	gene with protein product		601529		TR2		2597158	Standard	NM_001032287		Approved	TR2-11	uc001tdm.5	P13056	OTTHUMG00000170131	ENST00000333003.5:c.809G>T	12.37:g.95445694C>A	ENSP00000333275:p.Ser270Ile		A8K5K4|Q15625|Q15626	Missense_Mutation	SNP	ENST00000333003.5	37	CCDS9051.1	.	.	.	.	.	.	.	.	.	.	C	18.99	3.740832	0.69304	.	.	ENSG00000120798	ENST00000333003;ENST00000393101;ENST00000330677	D;D;D	0.91843	-2.92;-2.73;-2.72	5.6	5.6	0.85130	Nuclear hormone receptor, ligand-binding (1);	0.166804	0.64402	D	0.000003	D	0.94768	0.8311	M	0.64997	1.995	0.52099	D	0.999944	D;D;P;P	0.60575	0.979;0.988;0.905;0.895	P;P;P;P	0.58331	0.692;0.837;0.603;0.48	D	0.94880	0.8038	10	0.72032	D	0.01	.	19.6128	0.95616	0.0:1.0:0.0:0.0	.	270;270;270;270	B6ZGT7;P13056-3;P13056-2;P13056	.;.;.;NR2C1_HUMAN	I	270	ENSP00000333275:S270I;ENSP00000376813:S270I;ENSP00000328843:S270I	ENSP00000328843:S270I	S	-	2	0	NR2C1	93969825	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	7.315000	0.78998	2.635000	0.89317	0.655000	0.94253	AGT		0.294	NR2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407565.2		NM_003297	
ONECUT1	3175	hgsc.bcm.edu	37	15	53049880	53049880	+	Missense_Mutation	SNP	A	A	T			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr15:53049880A>T	ENST00000305901.5	-	2	1397	c.1270T>A	c.(1270-1272)Ttg>Atg	p.L424M	ONECUT1_ENST00000560699.2_Silent_p.G64G|ONECUT1_ENST00000561401.2_5'UTR	NM_004498.2	NP_004489.1	Q9UBC0	HNF6_HUMAN	one cut homeobox 1	424					B cell differentiation (GO:0030183)|cell fate commitment (GO:0045165)|cilium assembly (GO:0042384)|endocrine pancreas development (GO:0031018)|endoderm development (GO:0007492)|epithelial cell development (GO:0002064)|glucose metabolic process (GO:0006006)|liver development (GO:0001889)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)|regulation of transcription, DNA-templated (GO:0006355)|spleen development (GO:0048536)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)|skin(1)	17				all cancers(107;0.0708)		CTCAGCTCCAACCCCAGCTGC	0.493																																																	0													162.0	151.0	155.0					15																	53049880		2194	4293	6487	SO:0001583	missense	3175			U77975	CCDS10150.1	15q21.3	2012-03-09	2007-07-16		ENSG00000169856	ENSG00000169856		"""Homeoboxes / CUT class"""	8138	protein-coding gene	gene with protein product		604164	"""one cut domain, family member 1"""	HNF6, HNF6A		8887657, 8790352	Standard	NM_004498		Approved	HNF-6	uc002aci.2	Q9UBC0	OTTHUMG00000131899	ENST00000305901.5:c.1270T>A	15.37:g.53049880A>T	ENSP00000302630:p.Leu424Met		B2RTV4|Q99744|Q9UMR6	Missense_Mutation	SNP	ENST00000305901.5	37	CCDS10150.1	.	.	.	.	.	.	.	.	.	.	A	15.93	2.979276	0.53827	.	.	ENSG00000169856	ENST00000305901	D	0.98296	-4.85	6.16	1.4	0.22301	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.98648	0.9547	M	0.86178	2.8	0.80722	D	1	P	0.51537	0.946	D	0.77557	0.99	D	0.98237	1.0486	10	0.87932	D	0	-9.1088	8.9906	0.36022	0.6465:0.0:0.3535:0.0	.	424	Q9UBC0	HNF6_HUMAN	M	424	ENSP00000302630:L424M	ENSP00000302630:L424M	L	-	1	2	ONECUT1	50837172	1.000000	0.71417	0.974000	0.42286	0.981000	0.71138	2.779000	0.47734	-0.005000	0.14395	-0.263000	0.10527	TTG		0.493	ONECUT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254849.2			
OTOA	146183	hgsc.bcm.edu	37	16	21712268	21712268	+	Missense_Mutation	SNP	C	C	G			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr16:21712268C>G	ENST00000286149.4	+	10	901	c.900C>G	c.(898-900)atC>atG	p.I300M	OTOA_ENST00000388958.3_Missense_Mutation_p.I300M|OTOA_ENST00000388956.4_Missense_Mutation_p.I221M			Q7RTW8	OTOAN_HUMAN	otoancorin	300					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)	46				GBM - Glioblastoma multiforme(48;0.0414)		TCTATGACATCACACCTGAGC	0.527																																																	0													104.0	87.0	93.0					16																	21712268		2199	4300	6499	SO:0001583	missense	146183			AK057335	CCDS10600.2, CCDS32403.1, CCDS53994.1	16p12.2	2009-08-18	2002-07-05		ENSG00000155719	ENSG00000155719			16378	protein-coding gene	gene with protein product	"""cancer/testis antigen 108"""	607038	"""deafness, autosomal recessive 22"""	DFNB22		11972037, 19088187	Standard	NM_170664		Approved	CT108	uc002djh.3	Q7RTW8	OTTHUMG00000090721	ENST00000286149.4:c.900C>G	16.37:g.21712268C>G	ENSP00000286149:p.Ile300Met		A1L3A8|A2VDI0|B3KWU3|E9PF51|Q8NA86|Q96M76	Missense_Mutation	SNP	ENST00000286149.4	37		.	.	.	.	.	.	.	.	.	.	C	14.87	2.663632	0.47572	.	.	ENSG00000155719	ENST00000388958;ENST00000286149;ENST00000388956	T;T;T	0.80994	-1.44;-1.44;-1.44	5.41	4.45	0.53987	.	0.197912	0.43919	D	0.000510	D	0.84129	0.5404	M	0.64997	1.995	0.80722	D	1	D;P	0.58970	0.984;0.943	P;P	0.58454	0.839;0.839	D	0.83724	0.0194	10	0.48119	T	0.1	-9.3735	9.4324	0.38617	0.1624:0.6808:0.1567:0.0	.	221;300	B3KWU3;E9PF51	.;.	M	300;300;221	ENSP00000373610:I300M;ENSP00000286149:I300M;ENSP00000373608:I221M	ENSP00000286149:I300M	I	+	3	3	OTOA	21619769	1.000000	0.71417	0.997000	0.53966	0.682000	0.39822	1.177000	0.31969	1.387000	0.46486	0.650000	0.86243	ATC		0.527	OTOA-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000430021.1			
PCNXL3	399909	hgsc.bcm.edu	37	11	65384727	65384727	+	Silent	SNP	C	C	T	rs12790427	byFrequency	TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr11:65384727C>T	ENST00000355703.3	+	3	887	c.348C>T	c.(346-348)ccC>ccT	p.P116P		NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)	116						integral component of membrane (GO:0016021)		p.P116P(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						CCAGGGACCCCGGAGTGGAGA	0.542													C|||	1482	0.295927	0.2648	0.4236	5008	,	,		20205	0.4226		0.1968	False		,,,				2504	0.2188																1	Substitution - coding silent(1)	stomach(1)						C		958,3066		117,724,1171	35.0	38.0	37.0		348	-4.4	1.0	11	dbSNP_121	37	1638,6686		156,1326,2680	no	coding-synonymous	PCNXL3	NM_032223.2		273,2050,3851	TT,TC,CC		19.678,23.8072,21.0236		116/2035	65384727	2596,9752	2012	4162	6174	SO:0001819	synonymous_variant	399909			BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539	ENST00000355703.3:c.348C>T	11.37:g.65384727C>T			Q6MZN8	Silent	SNP	ENST00000355703.3	37	CCDS44650.1																																																																																				0.542	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390321.1		NM_032223	
PPP1R9B	84687	hgsc.bcm.edu	37	17	48226734	48226734	+	Missense_Mutation	SNP	G	G	T			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr17:48226734G>T	ENST00000316878.6	-	3	1141	c.1139C>A	c.(1138-1140)tCc>tAc	p.S380Y	PPP1R9B_ENST00000501501.2_5'UTR	NM_032595.3	NP_115984.3	Q96SB3	NEB2_HUMAN	protein phosphatase 1, regulatory subunit 9B	380					actin filament organization (GO:0007015)|calcium-mediated signaling (GO:0019722)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to morphine (GO:0071315)|dendrite development (GO:0016358)|filopodium assembly (GO:0046847)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of cell proliferation (GO:0042127)|regulation of exit from mitosis (GO:0007096)|regulation of opioid receptor signaling pathway (GO:2000474)|regulation of protein phosphorylation (GO:0001932)|RNA splicing (GO:0008380)	cell junction (GO:0030054)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|protein phosphatase type 1 complex (GO:0000164)|ruffle membrane (GO:0032587)|synapse (GO:0045202)	protein phosphatase 1 binding (GO:0008157)|protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	8						CTCCTTCTTGGATTCATCTAC	0.692																																																	0													29.0	33.0	32.0					17																	48226734		1943	4118	6061	SO:0001583	missense	84687			AJ401189	CCDS74102.1	17q21.33	2013-01-31	2011-10-04	2001-07-02	ENSG00000108819	ENSG00000108819		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9298	protein-coding gene	gene with protein product	"""spinophilin"", ""Neurabin-2"""	603325	"""protein phosphatase 1, regulatory subunit 9B, spinophilin"", ""protein phosphatase 1, regulatory (inhibitor) subunit 9B"""	PPP1R6, PPP1R9		9275233	Standard	NM_032595		Approved	Spn, SPINO	uc002iqh.4	Q96SB3	OTTHUMG00000162008	ENST00000316878.6:c.1139C>A	17.37:g.48226734G>T	ENSP00000475417:p.Ser380Tyr		Q8TCR9	Missense_Mutation	SNP	ENST00000316878.6	37																																																																																					0.692	PPP1R9B-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_032595	
PVRL3	25945	hgsc.bcm.edu	37	3	110831084	110831084	+	Missense_Mutation	SNP	T	T	C			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr3:110831084T>C	ENST00000485303.1	+	2	643	c.368T>C	c.(367-369)tTt>tCt	p.F123S	PVRL3_ENST00000319792.3_Missense_Mutation_p.F123S|PVRL3_ENST00000493615.1_Missense_Mutation_p.F100S|PVRL3_ENST00000488016.1_3'UTR	NM_001243286.1|NM_015480.2	NP_001230215.1|NP_056295.1	Q9NQS3	PVRL3_HUMAN	poliovirus receptor-related 3	123	Ig-like V-type.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|fertilization (GO:0009566)|homophilic cell adhesion (GO:0007156)|lens morphogenesis in camera-type eye (GO:0002089)|retina morphogenesis in camera-type eye (GO:0060042)|single organismal cell-cell adhesion (GO:0016337)	apical junction complex (GO:0043296)|cell-cell adherens junction (GO:0005913)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	cell adhesion molecule binding (GO:0050839)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(3)	19						AGAGTCTTGTTTAAAAATTAC	0.388																																																	0													115.0	111.0	113.0					3																	110831084		2203	4300	6503	SO:0001583	missense	25945			AF282874	CCDS2957.1, CCDS58842.1, CCDS58843.1	3q13	2013-01-29			ENSG00000177707	ENSG00000177707		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17664	protein-coding gene	gene with protein product		607147				11024295	Standard	NM_015480		Approved	nectin-3, PPR3, PVRR3, DKFZP566B0846, CDw113, CD113	uc003dxt.2	Q9NQS3	OTTHUMG00000159239	ENST00000485303.1:c.368T>C	3.37:g.110831084T>C	ENSP00000418070:p.Phe123Ser		E9PFR0|Q6NVZ3|Q8NC05|Q8WVU4|Q9BVA9|Q9Y412	Missense_Mutation	SNP	ENST00000485303.1	37	CCDS2957.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.567933	0.86439	.	.	ENSG00000177707	ENST00000461477;ENST00000485303;ENST00000319792;ENST00000493615;ENST00000481766	D;D;D;D;D	0.94650	-3.48;-3.48;-3.48;-3.48;-3.48	5.43	5.43	0.79202	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.96839	0.8968	M	0.77712	2.385	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.74674	0.984;0.981	D	0.97332	0.9951	10	0.87932	D	0	.	13.7177	0.62708	0.0:0.0:0.0:1.0	.	100;123	E9PFR0;Q9NQS3	.;PVRL3_HUMAN	S	76;123;123;100;108	ENSP00000418327:F76S;ENSP00000418070:F123S;ENSP00000321514:F123S;ENSP00000420579:F100S;ENSP00000420479:F108S	ENSP00000321514:F123S	F	+	2	0	PVRL3	112313774	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.643000	0.74334	2.181000	0.69327	0.533000	0.62120	TTT		0.388	PVRL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354045.1		NM_015480	
RCC2	55920	hgsc.bcm.edu	37	1	17743003	17743003	+	Silent	SNP	T	T	A			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr1:17743003T>A	ENST00000375436.4	-	8	1186	c.999A>T	c.(997-999)cgA>cgT	p.R333R	AC004824.1_ENST00000583469.1_RNA|RCC2_ENST00000375433.3_Silent_p.R333R	NM_018715.3	NP_061185.1	Q9P258	RCC2_HUMAN	regulator of chromosome condensation 2	333					chromosome passenger complex localization to kinetochore (GO:0072356)|endosome organization (GO:0007032)|focal adhesion assembly (GO:0048041)|integrin-mediated signaling pathway (GO:0007229)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of GTPase activity (GO:0034260)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of attachment of spindle microtubules to kinetochore (GO:0051987)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|regulation of cell migration (GO:0030334)	chromosome, centromeric core domain (GO:0034506)|cytosol (GO:0005829)|microtubule (GO:0005874)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|Rac GTPase binding (GO:0048365)			breast(2)|endometrium(1)|kidney(3)|large_intestine(7)|lung(4)	17		Colorectal(325;0.000147)|Breast(348;0.00122)|Renal(390;0.00145)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00492)|BRCA - Breast invasive adenocarcinoma(304;7.69e-06)|COAD - Colon adenocarcinoma(227;1.19e-05)|Kidney(64;0.000189)|KIRC - Kidney renal clear cell carcinoma(64;0.00273)|STAD - Stomach adenocarcinoma(196;0.0135)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.19)		AGGCCACGTCTCGTACAACCA	0.527																																																	0													111.0	88.0	96.0					1																	17743003		2203	4300	6503	SO:0001819	synonymous_variant	55920				CCDS181.1	1p36.13	2010-05-05			ENSG00000179051	ENSG00000179051			30297	protein-coding gene	gene with protein product		609587				10819331, 12919680	Standard	NM_018715		Approved	TD-60	uc001bal.3	Q9P258	OTTHUMG00000002513	ENST00000375436.4:c.999A>T	1.37:g.17743003T>A			Q8IVL9|Q9BSN6|Q9NPV8	Silent	SNP	ENST00000375436.4	37	CCDS181.1																																																																																				0.527	RCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007144.1		NM_018715	
SH3GL1	6455	hgsc.bcm.edu	37	19	4363420	4363420	+	Silent	SNP	G	G	A			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr19:4363420G>A	ENST00000269886.3	-	7	853	c.675C>T	c.(673-675)taC>taT	p.Y225Y	AC007292.6_ENST00000594444.1_RNA|SH3GL1_ENST00000598564.1_Silent_p.Y161Y|SH3GL1_ENST00000417295.2_Silent_p.Y177Y	NM_003025.3	NP_003016.1	Q99961	SH3G1_HUMAN	SH3-domain GRB2-like 1	225	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.|Interaction with ARC. {ECO:0000250}.				central nervous system development (GO:0007417)|endocytosis (GO:0006897)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|endosome (GO:0005768)|membrane (GO:0016020)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			NS(1)|endometrium(2)|kidney(16)|large_intestine(3)|lung(2)|ovary(2)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0152)|STAD - Stomach adenocarcinoma(1328;0.182)		CCTGCCGGTGGTAGTCCAGCT	0.657			T	MLL	AL																																NSCLC(94;1152 2133 30346 33362)			Dom	yes		19	19p13.3	6455	SH3-domain GRB2-like 1 (EEN)		L	0													33.0	26.0	28.0					19																	4363420		2202	4299	6501	SO:0001819	synonymous_variant	6455				CCDS32874.1, CCDS56076.1, CCDS59335.1	19p13.3	2008-07-22							10830	protein-coding gene	gene with protein product	"""extra 11-19 leukemia fusion"", ""fusion partner of MLL"", ""SH3-containing Grb-2-like 1 protein"", ""SH3-containing protein EEN"", ""SH3 domain GRB2-like 1"""	601768				9169142	Standard	NM_003025		Approved	SH3P8, SH3D2B, CNSA1, EEN, MGC111371	uc002maj.3	Q99961		ENST00000269886.3:c.675C>T	19.37:g.4363420G>A			B4DRA1|E7EVZ4|M0QZV5|Q99668	Silent	SNP	ENST00000269886.3	37	CCDS32874.1																																																																																				0.657	SH3GL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458302.1		NM_003025	
SIN3A	25942	hgsc.bcm.edu	37	15	75702579	75702579	+	Silent	SNP	A	A	G			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr15:75702579A>G	ENST00000394947.3	-	7	1371	c.1057T>C	c.(1057-1059)Ttg>Ctg	p.L353L	SIN3A_ENST00000360439.4_Silent_p.L353L|SIN3A_ENST00000394949.4_Silent_p.L353L	NM_001145358.1	NP_001138830.1			SIN3 transcription regulator family member A											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	63						TGCTCTGTCAATGCTGGAGTG	0.448																																																	0													106.0	102.0	103.0					15																	75702579		2197	4294	6491	SO:0001819	synonymous_variant	25942			AK027559	CCDS10279.1	15q22.33	2013-08-21	2013-08-21		ENSG00000169375	ENSG00000169375			19353	protein-coding gene	gene with protein product		607776	"""SIN3 homolog A, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog A (yeast)"""			10773092, 7601471	Standard	NM_001145357		Approved	KIAA0700, DKFZP434K2235	uc002bai.3	Q96ST3	OTTHUMG00000142834	ENST00000394947.3:c.1057T>C	15.37:g.75702579A>G				Silent	SNP	ENST00000394947.3	37	CCDS10279.1																																																																																				0.448	SIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286469.1		NM_015477	
SLC4A4	8671	hgsc.bcm.edu	37	4	72423512	72423512	+	Missense_Mutation	SNP	A	A	T			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr4:72423512A>T	ENST00000264485.5	+	22	2964	c.2847A>T	c.(2845-2847)agA>agT	p.R949S	SLC4A4_ENST00000340595.3_Missense_Mutation_p.R905S|SLC4A4_ENST00000425175.1_Missense_Mutation_p.R949S|SLC4A4_ENST00000351898.6_Missense_Mutation_p.R865S	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	949					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	CTCTGCGCAGAGTCCACCTGT	0.512																																																	0													160.0	127.0	138.0					4																	72423512		2203	4300	6503	SO:0001583	missense	8671			AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.2847A>T	4.37:g.72423512A>T	ENSP00000264485:p.Arg949Ser		C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Missense_Mutation	SNP	ENST00000264485.5	37	CCDS43236.1	.	.	.	.	.	.	.	.	.	.	A	27.3	4.814829	0.90790	.	.	ENSG00000080493	ENST00000264485;ENST00000425175;ENST00000351898;ENST00000340595	D;D;T;D	0.81908	-1.55;-1.55;-0.85;-1.55	5.95	-1.15	0.09709	Bicarbonate transporter, C-terminal (1);	0.094442	0.64402	D	0.000002	D	0.86727	0.6002	M	0.84156	2.68	0.53005	D	0.99996	D;P;D;D	0.63046	0.992;0.917;0.98;0.963	D;P;P;P	0.63113	0.911;0.774;0.856;0.864	T	0.83115	-0.0121	10	0.87932	D	0	.	3.9475	0.09355	0.3927:0.0:0.3311:0.2762	.	949;865;905;949	A5JJ20;Q9Y6R1-4;Q9Y6R1-2;Q9Y6R1	.;.;.;S4A4_HUMAN	S	949;949;865;905	ENSP00000264485:R949S;ENSP00000393557:R949S;ENSP00000307349:R865S;ENSP00000344272:R905S	ENSP00000264485:R949S	R	+	3	2	SLC4A4	72642376	0.803000	0.28956	1.000000	0.80357	0.983000	0.72400	-0.001000	0.12947	0.154000	0.19237	-0.376000	0.06991	AGA		0.512	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362090.1		NM_003759	
SPG21	51324	hgsc.bcm.edu;ucsc.edu	37	15	65266968	65266968	+	Missense_Mutation	SNP	T	T	C			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr15:65266968T>C	ENST00000204566.2	-	5	719	c.424A>G	c.(424-426)Atc>Gtc	p.I142V	SPG21_ENST00000433215.2_Missense_Mutation_p.I142V|SPG21_ENST00000559199.1_5'UTR|SPG21_ENST00000416889.2_Missense_Mutation_p.I115V|SPG21_ENST00000560564.1_5'Flank	NM_016630.3	NP_057714.1	Q9NZD8	SPG21_HUMAN	spastic paraplegia 21 (autosomal recessive, Mast syndrome)	142					antigen receptor-mediated signaling pathway (GO:0050851)|cell death (GO:0008219)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network transport vesicle (GO:0030140)	CD4 receptor binding (GO:0042609)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|urinary_tract(1)	10						TGGTTGAAGATAGAGGTGTCA	0.378																																																	0													113.0	114.0	114.0					15																	65266968		2202	4299	6501	SO:0001583	missense	51324			AF208861	CCDS10198.1, CCDS45279.1	15q21-q22	2008-02-05	2007-04-23		ENSG00000090487	ENSG00000090487			20373	protein-coding gene	gene with protein product	"""maspardin"""	608181				11113139, 14564668	Standard	XM_006720564		Approved	ACP33, GL010, BM-019, MAST	uc002aoe.3	Q9NZD8	OTTHUMG00000133098	ENST00000204566.2:c.424A>G	15.37:g.65266968T>C	ENSP00000204566:p.Ile142Val		B4DW44|Q6ZMB6	Missense_Mutation	SNP	ENST00000204566.2	37	CCDS10198.1	.	.	.	.	.	.	.	.	.	.	T	9.674	1.147489	0.21288	.	.	ENSG00000090487	ENST00000204566;ENST00000416889;ENST00000433215	T;T;T	0.67345	-0.26;-0.26;-0.26	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.36771	0.0979	N	0.00996	-1.065	0.80722	D	1	B;B	0.13145	0.007;0.005	B;B	0.15052	0.007;0.012	T	0.38972	-0.9636	10	0.15066	T	0.55	-24.5999	14.8284	0.70130	0.0:0.0:0.0:1.0	.	115;142	Q9NZD8-2;Q9NZD8	.;SPG21_HUMAN	V	142;115;142	ENSP00000204566:I142V;ENSP00000394846:I115V;ENSP00000404111:I142V	ENSP00000204566:I142V	I	-	1	0	SPG21	63054021	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	7.898000	0.87363	2.191000	0.70037	0.528000	0.53228	ATC		0.378	SPG21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256758.3		NM_016630	
SSPO	23145	hgsc.bcm.edu;ucsc.edu	37	7	149502986	149502986	+	RNA	SNP	A	A	G			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr7:149502986A>G	ENST00000378016.2	+	0	8490							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			TGGCAGTGCCAAGCATCTGGG	0.622																																																	0													42.0	47.0	45.0					7																	149502986		2144	4254	6398			23145			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149502986A>G			Q76B61	Silent	SNP	ENST00000378016.2	37																																																																																					0.622	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript				
STXBP3	6814	hgsc.bcm.edu	37	1	109325070	109325070	+	Missense_Mutation	SNP	A	A	G			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr1:109325070A>G	ENST00000370008.3	+	10	886	c.836A>G	c.(835-837)gAg>gGg	p.E279G		NM_007269.2	NP_009200.2	O00186	STXB3_HUMAN	syntaxin binding protein 3	279					blood coagulation (GO:0007596)|membrane organization (GO:0061024)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|neutrophil degranulation (GO:0043312)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein heterooligomerization (GO:0051291)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin binding (GO:0019905)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(3)|urinary_tract(1)	13		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0386)|Lung(183;0.104)|COAD - Colon adenocarcinoma(174;0.137)|Epithelial(280;0.231)		AAAGAAAAGGAGGCCATCCTT	0.333																																																	0													100.0	98.0	99.0					1																	109325070		2203	4300	6503	SO:0001583	missense	6814			D63506	CCDS790.1	1p13.3	2008-02-05			ENSG00000116266	ENSG00000116266			11446	protein-coding gene	gene with protein product		608339				10194441	Standard	NM_007269		Approved	UNC-18C	uc001dvy.3	O00186	OTTHUMG00000011122	ENST00000370008.3:c.836A>G	1.37:g.109325070A>G	ENSP00000359025:p.Glu279Gly		A8K269|A8K5K7|Q53FW1|Q86YJ3|Q9UPD7	Missense_Mutation	SNP	ENST00000370008.3	37	CCDS790.1	.	.	.	.	.	.	.	.	.	.	A	31	5.091938	0.94149	.	.	ENSG00000116266	ENST00000370008	T	0.79141	-1.24	5.56	5.56	0.83823	.	0.103414	0.64402	N	0.000004	D	0.86016	0.5832	M	0.85373	2.75	0.80722	D	1	D	0.69078	0.997	D	0.63793	0.918	D	0.88776	0.3267	10	0.87932	D	0	-22.3667	15.3769	0.74615	1.0:0.0:0.0:0.0	.	279	O00186	STXB3_HUMAN	G	279	ENSP00000359025:E279G	ENSP00000359025:E279G	E	+	2	0	STXBP3	109126593	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.138000	0.77305	2.100000	0.63781	0.528000	0.53228	GAG		0.333	STXBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030591.1		NM_007269	
SYNPO2	171024	hgsc.bcm.edu	37	4	119948178	119948178	+	Silent	SNP	C	C	T			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr4:119948178C>T	ENST00000429713.2	+	3	836	c.654C>T	c.(652-654)ctC>ctT	p.L218L	SYNPO2_ENST00000434046.2_Silent_p.L218L|SYNPO2_ENST00000307142.4_Silent_p.L218L|SYNPO2_ENST00000448416.2_Intron	NM_001128933.1	NP_001122405.1	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	218						actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						TAGTGGCTCTCCCGGGAGCTG	0.517																																																	0													38.0	44.0	42.0					4																	119948178		2203	4300	6503	SO:0001819	synonymous_variant	171024			AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000429713.2:c.654C>T	4.37:g.119948178C>T			B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Silent	SNP	ENST00000429713.2	37	CCDS47129.1	.	.	.	.	.	.	.	.	.	.	C	3.135	-0.177574	0.06380	.	.	ENSG00000172403	ENST00000504178	.	.	.	5.21	5.21	0.72293	.	.	.	.	.	T	0.73651	0.3614	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.72327	-0.4327	4	.	.	.	-4.658	17.2979	0.87174	0.0:1.0:0.0:0.0	.	.	.	.	S	170	.	.	P	+	1	0	SYNPO2	120167626	0.811000	0.29063	1.000000	0.80357	0.293000	0.27360	1.509000	0.35780	2.586000	0.87340	0.557000	0.71058	CCC		0.517	SYNPO2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364020.1			
TEP1	7011	hgsc.bcm.edu	37	14	20864870	20864870	+	Missense_Mutation	SNP	G	G	T			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr14:20864870G>T	ENST00000262715.5	-	10	1609	c.1569C>A	c.(1567-1569)ttC>ttA	p.F523L	TEP1_ENST00000556935.1_Missense_Mutation_p.F415L	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	523	TROVE. {ECO:0000255|PROSITE- ProRule:PRU00343}.				RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		GCATGGCCATGAAGGGAAGCT	0.517																																																	0													94.0	81.0	85.0					14																	20864870		2203	4300	6503	SO:0001583	missense	7011				CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.1569C>A	14.37:g.20864870G>T	ENSP00000262715:p.Phe523Leu		A0AUV9	Missense_Mutation	SNP	ENST00000262715.5	37	CCDS9548.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.134965	0.77662	.	.	ENSG00000129566	ENST00000262715;ENST00000359243;ENST00000556935	T;T	0.12672	2.66;2.66	5.59	3.76	0.43208	TROVE (2);	0.215910	0.47852	D	0.000207	T	0.24774	0.0601	M	0.78456	2.415	0.80722	D	1	P;P	0.46859	0.705;0.885	B;P	0.48770	0.359;0.589	T	0.02758	-1.1114	10	0.56958	D	0.05	-14.0963	10.5094	0.44853	0.1592:0.0:0.8408:0.0	.	415;523	G3V5X7;Q99973	.;TEP1_HUMAN	L	523;523;415	ENSP00000262715:F523L;ENSP00000452574:F415L	ENSP00000262715:F523L	F	-	3	2	TEP1	19934710	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.541000	0.45735	1.367000	0.46095	0.655000	0.94253	TTC		0.517	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073563.2		NM_007110	
TGIF1	7050	hgsc.bcm.edu	37	18	3447755	3447755	+	Missense_Mutation	SNP	A	A	C			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr18:3447755A>C	ENST00000548489.2	+	1	149	c.18A>C	c.(16-18)aaA>aaC	p.K6N	TGIF1_ENST00000577543.1_5'Flank|TGIF1_ENST00000405385.3_5'Flank|TGIF1_ENST00000551402.1_5'Flank|TGIF1_ENST00000407501.2_5'Flank|TGIF1_ENST00000343820.5_5'Flank|TGIF1_ENST00000401449.1_Intron	NM_173207.1	NP_775299.1	Q15583	TGIF1_HUMAN	TGFB-induced factor homeobox 1	0					determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|negative regulation of cell proliferation (GO:0008285)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nodal signaling pathway (GO:0038092)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of neuron differentiation (GO:0045666)|regulation of gastrulation (GO:0010470)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			cervix(1)|endometrium(3)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	13	Esophageal squamous(4;0.0859)	Colorectal(8;0.0104)				GCTCGGGCAAAAGTTGTGCAT	0.483																																																	0													132.0	123.0	126.0					18																	3447755		2203	4300	6503	SO:0001583	missense	7050			X89750	CCDS11832.1, CCDS11833.1, CCDS11834.1, CCDS11835.1	18p11.31	2011-06-20	2007-01-30	2007-01-30	ENSG00000177426	ENSG00000177426		"""Homeoboxes / TALE class"""	11776	protein-coding gene	gene with protein product		602630	"""TGFB-induced factor (TALE family homeobox)"""	HPE4, TGIF		8537382, 10835638	Standard	NM_173211		Approved		uc002klz.3	Q15583	OTTHUMG00000131511	ENST00000548489.2:c.18A>C	18.37:g.3447755A>C	ENSP00000447747:p.Lys6Asn		A6NE42|A6NLU7|F8VZB6|Q6ICR0|Q8N5X9|Q9NRS0	Missense_Mutation	SNP	ENST00000548489.2	37	CCDS11832.1	.	.	.	.	.	.	.	.	.	.	A	12.92	2.081520	0.36758	.	.	ENSG00000177426	ENST00000548489	T	0.53640	0.61	4.77	0.811	0.18739	.	.	.	.	.	T	0.24890	0.0604	.	.	.	0.19575	N	0.999965	B	0.15473	0.013	B	0.14023	0.01	T	0.20907	-1.0261	8	0.18710	T	0.47	.	3.3369	0.07105	0.6403:0.0:0.1902:0.1696	.	6	F8VZB6	.	N	6	ENSP00000447747:K6N	ENSP00000447747:K6N	K	+	3	2	TGIF1	3437755	0.000000	0.05858	0.003000	0.11579	0.038000	0.13279	0.323000	0.19593	0.052000	0.16007	0.329000	0.21502	AAA		0.483	TGIF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254366.4		NM_170695	
TLR5	7100	hgsc.bcm.edu;ucsc.edu	37	1	223284977	223284977	+	Missense_Mutation	SNP	T	T	C			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr1:223284977T>C	ENST00000540964.1	-	4	1858	c.1397A>G	c.(1396-1398)gAt>gGt	p.D466G	TLR5_ENST00000342210.6_Missense_Mutation_p.D466G			O60602	TLR5_HUMAN	toll-like receptor 5	466			Missing (in 10% of the population; abolishes flagellin signaling; associated with resistance to SLEB1). {ECO:0000269|PubMed:14623910}.		cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|regulation of cytokine secretion (GO:0050707)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor signaling pathway (GO:0002224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				GBM - Glioblastoma multiforme(131;0.0851)		AGGGGTTTGATCTCCACTACA	0.418																																																	0													82.0	85.0	84.0					1																	223284977		2203	4300	6503	SO:0001583	missense	7100				CCDS31033.1	1q32.3-q42	2014-01-29			ENSG00000187554	ENSG00000187554			11851	protein-coding gene	gene with protein product	"""Toll/interleukin-1 receptor-like protein 3"""	603031	"""systemic lupus erythematosus susceptibility 1"""	SLEB1		9435236, 16027372	Standard	NM_003268		Approved	TIL3, FLJ10052, MGC126430, MGC126431	uc001hnw.2	O60602	OTTHUMG00000037937	ENST00000540964.1:c.1397A>G	1.37:g.223284977T>C	ENSP00000440643:p.Asp466Gly		B1AZ05|B3Y633|B9VJ63|D1CS80|D3DTB8|O15456|Q32MI2|Q32MI3	Missense_Mutation	SNP	ENST00000540964.1	37	CCDS31033.1	.	.	.	.	.	.	.	.	.	.	T	0.325	-0.959357	0.02267	.	.	ENSG00000187554	ENST00000540964;ENST00000366881;ENST00000342210	T;T;T	0.38240	1.15;1.15;1.15	5.49	-11.0	0.00169	.	2.808200	0.01124	N	0.005840	T	0.13157	0.0319	N	0.03115	-0.41	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.25467	-1.0131	10	0.05721	T	0.95	.	12.4716	0.55790	0.0:0.1442:0.2186:0.6373	.	466	O60602	TLR5_HUMAN	G	466	ENSP00000440643:D466G;ENSP00000355846:D466G;ENSP00000340089:D466G	ENSP00000340089:D466G	D	-	2	0	TLR5	221351600	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.678000	0.01942	-2.688000	0.00405	-0.864000	0.03007	GAT		0.418	TLR5-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_003268	
TMEM45B	120224	hgsc.bcm.edu	37	11	129728512	129728512	+	Missense_Mutation	SNP	G	G	A			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr11:129728512G>A	ENST00000524567.1	+	6	1041	c.760G>A	c.(760-762)Gga>Aga	p.G254R	TMEM45B_ENST00000281441.3_Missense_Mutation_p.G254R			Q96B21	TM45B_HUMAN	transmembrane protein 45B	254						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|stomach(1)	12	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.012)|Lung(977;0.179)|LUSC - Lung squamous cell carcinoma(976;0.189)		AGAAATCATTGGAATTCAGAA	0.478																																																	0													57.0	57.0	57.0					11																	129728512		2201	4296	6497	SO:0001583	missense	120224			AK098106	CCDS8482.1	11q24.3	2008-02-05				ENSG00000151715			25194	protein-coding gene	gene with protein product						12477932	Standard	NM_138788		Approved	BC016153, FLJ40787	uc001qfe.1	Q96B21		ENST00000524567.1:c.760G>A	11.37:g.129728512G>A	ENSP00000436293:p.Gly254Arg		A8K2L8	Missense_Mutation	SNP	ENST00000524567.1	37	CCDS8482.1	.	.	.	.	.	.	.	.	.	.	G	16.82	3.229428	0.58777	.	.	ENSG00000151715	ENST00000281441;ENST00000524567	T;T	0.31769	1.48;1.48	5.81	5.81	0.92471	.	0.141247	0.64402	D	0.000004	T	0.24736	0.0600	L	0.27053	0.805	0.58432	D	0.999997	P	0.41546	0.754	B	0.36504	0.226	T	0.01824	-1.1266	10	0.39692	T	0.17	-4.6077	18.6464	0.91411	0.0:0.0:1.0:0.0	.	254	Q96B21	TM45B_HUMAN	R	254	ENSP00000281441:G254R;ENSP00000436293:G254R	ENSP00000281441:G254R	G	+	1	0	TMEM45B	129233722	1.000000	0.71417	1.000000	0.80357	0.613000	0.37349	4.283000	0.58977	2.746000	0.94184	0.655000	0.94253	GGA		0.478	TMEM45B-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386062.1		NM_138788	
TRIP12	9320	hgsc.bcm.edu	37	2	230675716	230675716	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr2:230675716G>A	ENST00000283943.5	-	14	2135	c.1957C>T	c.(1957-1959)Caa>Taa	p.Q653*	TRIP12_ENST00000543084.1_Intron|TRIP12_ENST00000389044.4_Nonsense_Mutation_p.Q701*|TRIP12_ENST00000389045.3_Nonsense_Mutation_p.Q356*	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	653					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		AACAGCTGTTGAACATTTGTA	0.378																																																	0													64.0	65.0	65.0					2																	230675716		2203	4300	6503	SO:0001587	stop_gained	9320			L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.1957C>T	2.37:g.230675716G>A	ENSP00000283943:p.Gln653*		D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Nonsense_Mutation	SNP	ENST00000283943.5	37	CCDS33391.1	.	.	.	.	.	.	.	.	.	.	G	39	7.838859	0.98519	.	.	ENSG00000153827	ENST00000283943;ENST00000389045;ENST00000389044	.	.	.	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	19.5388	0.95266	0.0:0.0:1.0:0.0	.	.	.	.	X	653;356;701	.	ENSP00000283943:Q653X	Q	-	1	0	TRIP12	230383960	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.767000	0.98960	2.622000	0.88805	0.650000	0.86243	CAA		0.378	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3		NM_004238	
UBTF	7343	hgsc.bcm.edu	37	17	42286826	42286826	+	Missense_Mutation	SNP	A	A	G			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr17:42286826A>G	ENST00000302904.4	-	17	2291	c.1799T>C	c.(1798-1800)aTc>aCc	p.I600T	UBTF_ENST00000533177.1_Missense_Mutation_p.I563T|UBTF_ENST00000343638.5_Missense_Mutation_p.I563T|UBTF_ENST00000393606.3_Missense_Mutation_p.I563T|UBTF_ENST00000527034.1_Missense_Mutation_p.I563T|CTB-175E5.7_ENST00000586560.1_RNA|UBTF_ENST00000526094.1_Missense_Mutation_p.I563T|UBTF_ENST00000529383.1_Missense_Mutation_p.I600T|UBTF_ENST00000436088.1_Missense_Mutation_p.I600T			P17480	UBF1_HUMAN	upstream binding transcription factor, RNA polymerase I	600					chromatin silencing at rDNA (GO:0000183)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(9)|lung(10)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.114)		GCGACTGCCGATCTCCACCAT	0.597																																																	0													64.0	56.0	59.0					17																	42286826		2203	4300	6503	SO:0001583	missense	7343			BC042297	CCDS11480.1, CCDS42346.1	17q21.31	2014-03-25			ENSG00000108312	ENSG00000108312			12511	protein-coding gene	gene with protein product		600673				9126496	Standard	NM_001076683		Approved	UBF, NOR-90, UBF1, UBF2	uc010czs.3	P17480	OTTHUMG00000167585	ENST00000302904.4:c.1799T>C	17.37:g.42286826A>G	ENSP00000302640:p.Ile600Thr		A8K6R8	Missense_Mutation	SNP	ENST00000302904.4	37	CCDS11480.1	.	.	.	.	.	.	.	.	.	.	A	16.96	3.265116	0.59431	.	.	ENSG00000108312	ENST00000343638;ENST00000302904;ENST00000527034;ENST00000533177;ENST00000436088;ENST00000393606;ENST00000526094;ENST00000529383;ENST00000529373	T;T;T;T;T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;0.84;0.84;0.84;0.84;0.84	5.16	5.16	0.70880	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (3);	0.000000	0.85682	D	0.000000	T	0.63319	0.2501	L	0.49126	1.545	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.983;0.999	T	0.66701	-0.5857	10	0.87932	D	0	-13.4499	14.6919	0.69093	1.0:0.0:0.0:0.0	.	563;563;600	E9PKP7;P17480-2;P17480	.;.;UBF1_HUMAN	T	563;600;563;563;600;563;563;600;187	ENSP00000345297:I563T;ENSP00000302640:I600T;ENSP00000431539:I563T;ENSP00000437180:I563T;ENSP00000390669:I600T;ENSP00000377231:I563T;ENSP00000432925:I563T;ENSP00000435708:I600T;ENSP00000431295:I187T	ENSP00000302640:I600T	I	-	2	0	UBTF	39642352	1.000000	0.71417	0.932000	0.37286	0.238000	0.25445	7.248000	0.78268	1.952000	0.56665	0.379000	0.24179	ATC		0.597	UBTF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395205.1		NM_014233	
UGP2	7360	hgsc.bcm.edu;ucsc.edu	37	2	64083539	64083539	+	Missense_Mutation	SNP	T	T	C			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr2:64083539T>C	ENST00000337130.5	+	2	595	c.119T>C	c.(118-120)cTc>cCc	p.L40P	UGP2_ENST00000467648.2_Missense_Mutation_p.L29P|UGP2_ENST00000394417.2_Missense_Mutation_p.L29P|UGP2_ENST00000445915.2_Missense_Mutation_p.L49P|UGP2_ENST00000487469.1_Intron	NM_006759.3	NP_006750.3	Q16851	UGPA_HUMAN	UDP-glucose pyrophosphorylase 2	40					carbohydrate metabolic process (GO:0005975)|cellular glucuronidation (GO:0052695)|glucose 1-phosphate metabolic process (GO:0019255)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|small molecule metabolic process (GO:0044281)|UDP-glucose metabolic process (GO:0006011)|UDP-glucuronate biosynthetic process (GO:0006065)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	glucose binding (GO:0005536)|metal ion binding (GO:0046872)|pyrimidine ribonucleotide binding (GO:0032557)|UTP:glucose-1-phosphate uridylyltransferase activity (GO:0003983)			endometrium(2)|kidney(1)|large_intestine(8)|lung(6)|prostate(1)	18						GAAAAAATACTCACCACAGCA	0.463																																																	0													180.0	184.0	183.0					2																	64083539		2203	4300	6503	SO:0001583	missense	7360				CCDS1875.1, CCDS42690.1	2p14-p13	2012-10-02			ENSG00000169764	ENSG00000169764	2.7.7.9		12527	protein-coding gene	gene with protein product		191760	"""UDP-glucose pyrophosphorylase 1"""	UGP1			Standard	NM_006759		Approved	UGPP1	uc002scm.3	Q16851	OTTHUMG00000129513	ENST00000337130.5:c.119T>C	2.37:g.64083539T>C	ENSP00000338703:p.Leu40Pro		Q07131|Q0P6K2|Q86Y81|Q9BU15	Missense_Mutation	SNP	ENST00000337130.5	37	CCDS1875.1	.	.	.	.	.	.	.	.	.	.	T	17.87	3.495797	0.64186	.	.	ENSG00000169764	ENST00000394417;ENST00000484142;ENST00000482668;ENST00000467648;ENST00000480679;ENST00000337130;ENST00000488245;ENST00000497883;ENST00000445915;ENST00000475462;ENST00000491621;ENST00000472047	T;T;T;T;T	0.20332	2.08;2.08;2.19;2.08;2.08	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.18676	0.0448	L	0.29908	0.895	0.80722	D	1	B;B	0.12013	0.005;0.005	B;B	0.15870	0.014;0.006	T	0.02081	-1.1217	10	0.45353	T	0.12	-51.4235	15.6264	0.76863	0.0:0.0:0.0:1.0	.	49;40	E7EUC7;Q16851	.;UGPA_HUMAN	P	29;40;29;29;29;40;29;32;49;29;29;29	ENSP00000377939:L29P;ENSP00000420793:L29P;ENSP00000338703:L40P;ENSP00000411803:L49P;ENSP00000420342:L29P	ENSP00000338703:L40P	L	+	2	0	UGP2	63937043	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.479000	0.73600	2.333000	0.79357	0.533000	0.62120	CTC		0.463	UGP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251688.1		NM_006759	
USP10	9100	hgsc.bcm.edu	37	16	84773939	84773939	+	Missense_Mutation	SNP	C	C	G	rs202025437		TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr16:84773939C>G	ENST00000219473.7	+	3	228	c.115C>G	c.(115-117)Ctg>Gtg	p.L39V	USP10_ENST00000570191.1_Missense_Mutation_p.L43V|USP10_ENST00000562743.1_3'UTR	NM_001272075.1|NM_005153.2	NP_001259004.1|NP_005144.2	Q14694	UBP10_HUMAN	ubiquitin specific peptidase 10	39	Interaction with p53/TP53.				autophagy (GO:0006914)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA repair (GO:0006281)|protein deubiquitination (GO:0016579)|regulation of autophagy (GO:0010506)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(3)|kidney(1)|large_intestine(7)|lung(3)|prostate(1)|stomach(1)|urinary_tract(1)	17						TGGAACAGTTCTGTGTGGCAC	0.428													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20831	0.0		0.0	False		,,,				2504	0.0																0													148.0	142.0	144.0					16																	84773939		1904	4129	6033	SO:0001583	missense	9100			D80012	CCDS45537.1, CCDS62004.1	16q	2008-03-25	2005-08-08			ENSG00000103194		"""Ubiquitin-specific peptidases"""	12608	protein-coding gene	gene with protein product		609818	"""ubiquitin specific protease 10"""			12838346	Standard	NM_005153		Approved	UBPO, KIAA0190	uc002fii.3	Q14694		ENST00000219473.7:c.115C>G	16.37:g.84773939C>G	ENSP00000219473:p.Leu39Val		B2RDJ8|B4DS84|Q9BWG7|Q9NSL7	Missense_Mutation	SNP	ENST00000219473.7	37	CCDS45537.1	150	0.06868131868131869	50	0.1016260162601626	15	0.04143646408839779	36	0.06293706293706294	49	0.06464379947229551	C	10.85	1.467863	0.26335	.	.	ENSG00000103194	ENST00000219473	T	0.06849	3.25	5.54	3.33	0.38152	.	0.935443	0.08386	U	0.953665	T	0.00241	0.0007	L	0.43152	1.355	0.24015	N	0.996163	B;B	0.24368	0.102;0.062	B;B	0.23852	0.049;0.022	T	0.42766	-0.9432	10	0.33940	T	0.23	-6.7854	5.3595	0.16079	0.0:0.6505:0.0:0.3495	.	43;39	Q14694-3;Q14694	.;UBP10_HUMAN	V	39	ENSP00000219473:L39V	ENSP00000219473:L39V	L	+	1	2	USP10	83331440	0.187000	0.23238	0.913000	0.36048	0.940000	0.58332	0.177000	0.16801	0.702000	0.31825	0.655000	0.94253	CTG		0.428	USP10-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433660.1			
ZC3H12A	80149	hgsc.bcm.edu	37	1	37949076	37949076	+	Missense_Mutation	SNP	G	G	C			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr1:37949076G>C	ENST00000373087.6	+	6	1780	c.1664G>C	c.(1663-1665)aGc>aCc	p.S555T		NM_025079.2	NP_079355.2			zinc finger CCCH-type containing 12A									p.S555N(1)		NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GAGCAGGCCAGCGTGTATACT	0.682																																																	1	Substitution - Missense(1)	ovary(1)											53.0	61.0	58.0					1																	37949076		2203	4300	6503	SO:0001583	missense	80149				CCDS417.1	1p34.3	2012-07-05			ENSG00000163874	ENSG00000163874		"""Zinc fingers, CCCH-type domain containing"""	26259	protein-coding gene	gene with protein product	"""MCP induced protein 1"""	610562				18178554, 22055188	Standard	NM_025079		Approved	FLJ23231, MCPIP1	uc001cbb.4	Q5D1E8	OTTHUMG00000004221	ENST00000373087.6:c.1664G>C	1.37:g.37949076G>C	ENSP00000362179:p.Ser555Thr			Missense_Mutation	SNP	ENST00000373087.6	37	CCDS417.1	.	.	.	.	.	.	.	.	.	.	G	8.188	0.795326	0.16327	.	.	ENSG00000163874	ENST00000373087;ENST00000373082	T	0.47528	0.84	5.29	3.41	0.39046	.	0.602001	0.19720	N	0.107604	T	0.36744	0.0978	L	0.50333	1.59	0.09310	N	1	P;B	0.37276	0.589;0.156	B;B	0.30316	0.114;0.023	T	0.30179	-0.9987	10	0.52906	T	0.07	-4.0199	9.5555	0.39337	0.2687:0.0:0.7313:0.0	.	350;555	B3KSD3;Q5D1E8	.;ZC12A_HUMAN	T	555	ENSP00000362179:S555T	ENSP00000362174:S555T	S	+	2	0	ZC3H12A	37721663	0.989000	0.36119	0.959000	0.39883	0.964000	0.63967	0.923000	0.28757	1.224000	0.43551	0.561000	0.74099	AGC		0.682	ZC3H12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012154.2		NM_025079	
ZFYVE27	118813	hgsc.bcm.edu	37	10	99510142	99510142	+	Missense_Mutation	SNP	A	A	T			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr10:99510142A>T	ENST00000393677.4	+	7	923	c.719A>T	c.(718-720)gAg>gTg	p.E240V	ZFYVE27_ENST00000453958.2_Missense_Mutation_p.E240V|ZFYVE27_ENST00000337540.7_Missense_Mutation_p.E208V|ZFYVE27_ENST00000356257.4_Missense_Mutation_p.E240V|ZFYVE27_ENST00000370613.3_Missense_Mutation_p.E122V|ZFYVE27_ENST00000357540.4_Missense_Mutation_p.E154V|ZFYVE27_ENST00000370610.3_Missense_Mutation_p.E142V|ZFYVE27_ENST00000359980.3_Missense_Mutation_p.E240V	NM_144588.6	NP_653189.3	Q5T4F4	ZFY27_HUMAN	zinc finger, FYVE domain containing 27	240					cell death (GO:0008219)|neuron projection development (GO:0031175)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein localization to plasma membrane (GO:0072659)	axon (GO:0030424)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|recycling endosome membrane (GO:0055038)	metal ion binding (GO:0046872)	p.E240G(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	8		Colorectal(252;0.0846)		Epithelial(162;7.08e-10)|all cancers(201;5.18e-08)		AAGCAGGAAGAGCATGCCTTT	0.552																																																	1	Substitution - Missense(1)	ovary(1)											129.0	101.0	111.0					10																	99510142		2203	4300	6503	SO:0001583	missense	118813			BC030621	CCDS31263.1, CCDS31264.1, CCDS53562.1, CCDS53563.1, CCDS53564.1, CCDS53565.1	10q24.2	2013-09-11			ENSG00000155256	ENSG00000155256		"""Zinc fingers, FYVE domain containing"""	26559	protein-coding gene	gene with protein product	"""protrudin"""	610243				14702039	Standard	NM_144588		Approved	FLJ32919, SPG33	uc001kol.2	Q5T4F4	OTTHUMG00000018867	ENST00000393677.4:c.719A>T	10.37:g.99510142A>T	ENSP00000377282:p.Glu240Val		B7Z3S0|B7Z404|B7Z626|G8JLC3|G8JLF0|J3KP98|Q5T4F1|Q5T4F2|Q5T4F3|Q8N1K0|Q8N6D6|Q8NCA0|Q8NDE4|Q96M08	Missense_Mutation	SNP	ENST00000393677.4	37	CCDS31263.1	.	.	.	.	.	.	.	.	.	.	A	13.75	2.330204	0.41297	.	.	ENSG00000155256	ENST00000337540;ENST00000357540;ENST00000370613;ENST00000370610;ENST00000393677;ENST00000453958;ENST00000359980;ENST00000356257;ENST00000423811	T;T;T;T;T;T;T	0.52057	0.73;0.68;1.3;1.29;1.29;1.24;1.26	5.51	1.76	0.24704	.	0.718423	0.14760	N	0.300038	T	0.28699	0.0711	N	0.24115	0.695	0.20074	N	0.999935	B;B;B;B;B;B;B	0.11235	0.0;0.0;0.003;0.004;0.0;0.0;0.0	B;B;B;B;B;B;B	0.11329	0.002;0.002;0.004;0.006;0.001;0.005;0.0	T	0.12967	-1.0527	10	0.35671	T	0.21	-2.8834	5.0708	0.14606	0.6986:0.0:0.1626:0.1388	.	208;142;122;154;240;240;240	B7Z404;B7Z3S0;B7Z626;Q5T4F4-5;Q5T4F4-3;Q5T4F4-2;Q5T4F4	.;.;.;.;.;.;ZFY27_HUMAN	V	208;154;122;142;240;240;240;240;218	ENSP00000337993:E208V;ENSP00000359642:E142V;ENSP00000377282:E240V;ENSP00000401580:E240V;ENSP00000353069:E240V;ENSP00000348593:E240V;ENSP00000409594:E218V	ENSP00000337993:E208V	E	+	2	0	ZFYVE27	99500132	0.987000	0.35691	0.736000	0.30914	0.862000	0.49288	2.260000	0.43267	0.935000	0.37341	0.459000	0.35465	GAG		0.552	ZFYVE27-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049745.2		NM_144588	
ZNFX1	57169	hgsc.bcm.edu	37	20	47886860	47886860	+	Missense_Mutation	SNP	C	C	T			TCGA-AK-3461-01A-02D-1361-10	TCGA-AK-3461-10A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	d173f94f-7c73-4d87-a536-9bb8fea88017	1db1d58a-85dc-4471-9c76-9e5d6d46aba7	g.chr20:47886860C>T	ENST00000396105.1	-	3	1735	c.1489G>A	c.(1489-1491)Gtc>Atc	p.V497I	ZNFX1_ENST00000371752.1_Missense_Mutation_p.V497I|ZNFX1_ENST00000371754.4_Missense_Mutation_p.V497I	NM_021035.2	NP_066363.1	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	497							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(8)|kidney(7)|large_intestine(15)|liver(1)|lung(17)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	60			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			GAGGGCTGGACCTCTGCTAGC	0.517																																																	0													79.0	76.0	77.0					20																	47886860		2203	4300	6503	SO:0001583	missense	57169			AK022641	CCDS13417.1	20q13.13	2014-02-12			ENSG00000124201	ENSG00000124201			29271	protein-coding gene	gene with protein product						10718198	Standard	NM_021035		Approved	KIAA1404, FLJ11277	uc002xui.3	Q9P2E3	OTTHUMG00000032696	ENST00000396105.1:c.1489G>A	20.37:g.47886860C>T	ENSP00000379412:p.Val497Ile		Q9BQM7|Q9BQM8|Q9H8C1|Q9H9S2|Q9NUM1|Q9NWW1	Missense_Mutation	SNP	ENST00000396105.1	37	CCDS13417.1	.	.	.	.	.	.	.	.	.	.	C	4.756	0.140522	0.09083	.	.	ENSG00000124201	ENST00000396106;ENST00000371754;ENST00000371752;ENST00000396105;ENST00000371744;ENST00000455070	D;D;D;T;T	0.86097	-1.74;-2.07;-2.07;-0.65;-1.38	5.85	3.92	0.45320	.	0.326118	0.33419	N	0.004927	T	0.69333	0.3099	N	0.13140	0.3	0.30941	N	0.725832	B	0.10296	0.003	B	0.09377	0.004	T	0.61426	-0.7065	10	0.16896	T	0.51	-16.7721	8.4611	0.32927	0.0:0.7666:0.0:0.2334	.	497	Q9P2E3	ZNFX1_HUMAN	I	497;497;497;497;497;301	ENSP00000360819:V497I;ENSP00000360817:V497I;ENSP00000379412:V497I;ENSP00000360809:V497I;ENSP00000413800:V301I	ENSP00000360809:V497I	V	-	1	0	ZNFX1	47320267	0.097000	0.21791	0.908000	0.35775	0.919000	0.55068	0.571000	0.23669	1.480000	0.48289	0.655000	0.94253	GTC		0.517	ZNFX1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079647.2		NM_021035	
