#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CSMD2	114784	hgsc.bcm.edu	37	1	34112388	34112388	+	Missense_Mutation	SNP	C	C	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr1:34112388C>A	ENST00000373380.1	-	8	1473	c.1253G>T	c.(1252-1254)cGg>cTg	p.R418L	CSMD2_ENST00000373388.2_5'UTR|CSMD2_ENST00000373381.4_Missense_Mutation_p.R1545L			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1505	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GAGAGAGTCCCGTCCGTCGTA	0.547																																					p.R1505L		Atlas-SNP	.											.	CSMD2	946	.	0			c.G4514T						PASS	.						52.0	49.0	50.0					1																	34112388		2203	4300	6503	SO:0001583	missense	114784	exon29			GAGTCCCGTCCGT	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.1253G>T	chr1.hg19:g.34112388C>A	ENSP00000362478:p.Arg418Leu	74.0	0.0	.		54.0	4.0	.	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373380.1	hg19		.	.	.	.	.	.	.	.	.	.	C	14.49	2.551842	0.45487	.	.	ENSG00000121904	ENST00000373381;ENST00000373380	T;T	0.17370	2.28;2.28	5.95	2.84	0.33178	CUB (5);	0.303339	0.31747	N	0.007126	T	0.06142	0.0159	N	0.04387	-0.21	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.09377	0.001;0.004;0.004	T	0.28267	-1.0049	10	0.23891	T	0.37	.	4.0978	0.09998	0.175:0.3786:0.3631:0.0833	.	418;1505;1545	Q7Z408-2;Q7Z408;E7EUA6	.;CSMD2_HUMAN;.	L	1545;418	ENSP00000362479:R1545L;ENSP00000362478:R418L	ENSP00000241312:R1505L	R	-	2	0	CSMD2	33884975	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	3.988000	0.56951	0.856000	0.35383	0.655000	0.94253	CGG	.	.	.	none		0.547	CSMD2-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000030635.4	NM_052896	
SASS6	163786	hgsc.bcm.edu	37	1	100572938	100572938	+	Missense_Mutation	SNP	C	C	G			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr1:100572938C>G	ENST00000287482.5	-	11	1458	c.1318G>C	c.(1318-1320)Gag>Cag	p.E440Q	SASS6_ENST00000462159.1_5'UTR|SASS6_ENST00000535161.1_Missense_Mutation_p.E273Q	NM_194292.1	NP_919268.1	Q6UVJ0	SAS6_HUMAN	spindle assembly 6 homolog (C. elegans)	440					centriole replication (GO:0007099)|centrosome duplication (GO:0051298)	centriole (GO:0005814)|centrosome (GO:0005813)|deuterosome (GO:0098536)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	19		all_epithelial(167;4.58e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.085)|all cancers(265;0.139)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.197)		ACCTCTTGCTCTTTAATTCGA	0.294																																					p.E440Q		Atlas-SNP	.											.	SASS6	61	.	0			c.G1318C						PASS	.						57.0	53.0	54.0					1																	100572938		2201	4289	6490	SO:0001583	missense	163786	exon11			CTTGCTCTTTAAT	AL834265	CCDS764.1	1p21.3	2008-02-05			ENSG00000156876	ENSG00000156876			25403	protein-coding gene	gene with protein product		609321				15665853, 14654843	Standard	NM_194292		Approved	DKFZp761A078, SAS-6, FLJ22097, SAS6	uc001dsu.3	Q6UVJ0	OTTHUMG00000010754	ENST00000287482.5:c.1318G>C	chr1.hg19:g.100572938C>G	ENSP00000287482:p.Glu440Gln	143.0	0.0	.		88.0	13.0	.	NM_194292	D3DT55|Q8N3K0	Missense_Mutation	SNP	ENST00000287482.5	hg19	CCDS764.1	.	.	.	.	.	.	.	.	.	.	C	12.02	1.812823	0.32053	.	.	ENSG00000156876	ENST00000287482;ENST00000539329;ENST00000535161	T;T	0.29397	1.57;1.57	5.38	5.38	0.77491	.	0.047861	0.85682	D	0.000000	T	0.23451	0.0567	L	0.60455	1.87	0.58432	D	0.999999	P	0.41546	0.754	B	0.39339	0.297	T	0.02743	-1.1116	10	0.35671	T	0.21	-9.3422	19.1244	0.93376	0.0:1.0:0.0:0.0	.	440	Q6UVJ0	SAS6_HUMAN	Q	440;413;273	ENSP00000287482:E440Q;ENSP00000440169:E273Q	ENSP00000287482:E440Q	E	-	1	0	SASS6	100345526	1.000000	0.71417	1.000000	0.80357	0.064000	0.16182	5.050000	0.64251	2.515000	0.84797	0.585000	0.79938	GAG	.	.	.	none		0.294	SASS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029656.2	NM_194292	
RPTN	126638	hgsc.bcm.edu	37	1	152127802	152127802	+	Missense_Mutation	SNP	T	T	C			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr1:152127802T>C	ENST00000316073.3	-	3	1837	c.1773A>G	c.(1771-1773)atA>atG	p.I591M		NM_001122965.1	NP_001116437.1	Q6XPR3	RPTN_HUMAN	repetin	591	Gln-rich.					cornified envelope (GO:0001533)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|endometrium(14)|kidney(2)|large_intestine(1)|lung(32)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	59						TTTGCCCTTGTATTTCCCCAG	0.453																																					p.I591M		Atlas-SNP	.											.	RPTN	123	.	0			c.A1773G						PASS	.						371.0	334.0	345.0					1																	152127802		1568	3582	5150	SO:0001583	missense	126638	exon3			CCCTTGTATTTCC	AK096436	CCDS41397.1	1q21.3	2013-01-10			ENSG00000215853	ENSG00000215853		"""EF-hand domain containing"""	26809	protein-coding gene	gene with protein product		613259				15854042	Standard	NM_001122965		Approved	FLJ39117	uc001ezs.1	Q6XPR3	OTTHUMG00000154095	ENST00000316073.3:c.1773A>G	chr1.hg19:g.152127802T>C	ENSP00000317895:p.Ile591Met	594.0	0.0	.		769.0	224.0	.	NM_001122965	B7ZBZ3	Missense_Mutation	SNP	ENST00000316073.3	hg19	CCDS41397.1	.	.	.	.	.	.	.	.	.	.	T	2.328	-0.353972	0.05173	.	.	ENSG00000215853	ENST00000316073;ENST00000541545	T	0.13307	2.6	3.14	1.75	0.24633	.	.	.	.	.	T	0.01765	0.0056	N	0.08118	0	0.09310	N	1	P	0.41265	0.744	B	0.36608	0.229	T	0.42413	-0.9453	9	0.32370	T	0.25	0.0237	6.2084	0.20615	0.3116:0.0:0.0:0.6884	.	591	Q6XPR3	RPTN_HUMAN	M	591;246	ENSP00000317895:I591M	ENSP00000317895:I591M	I	-	3	3	RPTN	150394426	0.005000	0.15991	0.015000	0.15790	0.332000	0.28634	-0.725000	0.04942	0.119000	0.18210	0.450000	0.29827	ATA	.	.	.	none		0.453	RPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333867.1	XM_371312	
FAM129A	116496	hgsc.bcm.edu	37	1	184767228	184767228	+	Missense_Mutation	SNP	C	C	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr1:184767228C>A	ENST00000367511.3	-	13	1844	c.1651G>T	c.(1651-1653)Gat>Tat	p.D551Y	FAM129A_ENST00000487074.1_5'UTR	NM_052966.2	NP_443198.1	Q9BZQ8	NIBAN_HUMAN	family with sequence similarity 129, member A	551					negative regulation of protein phosphorylation (GO:0001933)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(6)|liver(1)|lung(22)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	45						AGAGTTTCATCAAGCAGGATC	0.453																																					p.D551Y		Atlas-SNP	.											.	FAM129A	98	.	0			c.G1651T						PASS	.						87.0	78.0	81.0					1																	184767228		2203	4300	6503	SO:0001583	missense	116496	exon13			TTTCATCAAGCAG	AF288391	CCDS1364.1	1q25	2008-10-08	2006-11-23	2006-11-23	ENSG00000135842	ENSG00000135842			16784	protein-coding gene	gene with protein product	"""cell growth inhibiting protein 39"""		"""chromosome 1 open reading frame 24"""	C1orf24		15085203, 16444351	Standard	NM_052966		Approved	NIBAN, GIG39	uc001gra.4	Q9BZQ8	OTTHUMG00000035388	ENST00000367511.3:c.1651G>T	chr1.hg19:g.184767228C>A	ENSP00000356481:p.Asp551Tyr	69.0	0.0	.		87.0	8.0	.	NM_052966	Q2TTR2|Q5TEM8|Q8TEI5|Q9H593|Q9H9Y8|Q9HCB9	Missense_Mutation	SNP	ENST00000367511.3	hg19	CCDS1364.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.62|16.62	3.173955|3.173955	0.57692|0.57692	.|.	.|.	ENSG00000135842|ENSG00000135842	ENST00000367511|ENST00000417056	T|.	0.13307|.	2.6|.	5.37|5.37	4.44|4.44	0.53790|0.53790	.|.	0.408987|.	0.29225|.	N|.	0.012780|.	T|.	0.63189|.	0.2490|.	L|L	0.54323|0.54323	1.7|1.7	0.34170|0.34170	D|D	0.669652|0.669652	D;D|.	0.89917|.	0.986;1.0|.	P;D|.	0.73380|.	0.742;0.98|.	T|.	0.71794|.	-0.4485|.	10|.	0.72032|.	D|.	0.01|.	-7.0804|-7.0804	14.591|14.591	0.68365|0.68365	0.0:0.8548:0.1452:0.0|0.0:0.8548:0.1452:0.0	.|.	82;551|.	Q5TEY9;Q9BZQ8|.	.;NIBAN_HUMAN|.	Y|L	551|82	ENSP00000356481:D551Y|.	ENSP00000356481:D551Y|.	D|X	-|-	1|2	0|2	FAM129A|FAM129A	183033851|183033851	0.876000|0.876000	0.30132|0.30132	0.985000|0.985000	0.45067|0.45067	0.994000|0.994000	0.84299|0.84299	2.463000|2.463000	0.45058|0.45058	1.233000|1.233000	0.43693|0.43693	0.655000|0.655000	0.94253|0.94253	GAT|TGA	.	.	.	none		0.453	FAM129A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085786.1		
PTPN14	5784	hgsc.bcm.edu	37	1	214557259	214557259	+	Missense_Mutation	SNP	T	T	C			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr1:214557259T>C	ENST00000366956.5	-	13	2133	c.1939A>G	c.(1939-1941)Aac>Gac	p.N647D	PTPN14_ENST00000543945.1_3'UTR	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14	647					lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)			NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		ACCATGCTGTTCATCACCTCC	0.662																																					p.N647D	Colon(92;557 1424 24372 34121 40073)	Atlas-SNP	.											.	PTPN14	168	.	0			c.A1939G						PASS	.						50.0	42.0	45.0					1																	214557259		2203	4300	6503	SO:0001583	missense	5784	exon13			TGCTGTTCATCAC	X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.1939A>G	chr1.hg19:g.214557259T>C	ENSP00000355923:p.Asn647Asp	71.0	0.0	.		169.0	55.0	.	NM_005401	Q5VSI0	Missense_Mutation	SNP	ENST00000366956.5	hg19	CCDS1514.1	.	.	.	.	.	.	.	.	.	.	T	14.65	2.600155	0.46423	.	.	ENSG00000152104	ENST00000366956	T	0.66815	-0.23	5.66	4.43	0.53597	.	0.373344	0.33217	N	0.005146	T	0.45458	0.1343	N	0.08118	0	0.80722	D	1	B	0.12630	0.006	B	0.10450	0.005	T	0.35525	-0.9785	10	0.62326	D	0.03	.	9.7306	0.40359	0.0:0.1:0.0:0.9	.	647	Q15678	PTN14_HUMAN	D	647	ENSP00000355923:N647D	ENSP00000355923:N647D	N	-	1	0	PTPN14	212623882	1.000000	0.71417	0.970000	0.41538	0.991000	0.79684	3.785000	0.55424	0.847000	0.35167	0.455000	0.32223	AAC	.	.	.	none		0.662	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089918.2	NM_005401	
MARC1	64757	hgsc.bcm.edu	37	1	220971317	220971317	+	Silent	SNP	G	G	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr1:220971317G>A	ENST00000366910.5	+	4	900	c.714G>A	c.(712-714)agG>agA	p.R238R	MARC1_ENST00000496110.1_3'UTR	NM_022746.3	NP_073583.3	Q5VT66	MARC1_HUMAN	mitochondrial amidoxime reducing component 1	238	MOSC. {ECO:0000255|PROSITE- ProRule:PRU00670}.				detoxification of nitrogen compound (GO:0051410)|nitrate metabolic process (GO:0042126)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	molybdenum ion binding (GO:0030151)|molybdopterin cofactor binding (GO:0043546)|nitrate reductase activity (GO:0008940)|pyridoxal phosphate binding (GO:0030170)										CCAACTTCAGGCCCAATATTG	0.443																																					p.R238R		Atlas-SNP	.											.	.	.	.	0			c.G714A						PASS	.						168.0	167.0	167.0					1																	220971317		2203	4300	6503	SO:0001819	synonymous_variant	64757	exon4			CTTCAGGCCCAAT	AK026043	CCDS1526.1	1q41	2011-11-02	2011-11-02	2011-11-02	ENSG00000186205	ENSG00000186205			26189	protein-coding gene	gene with protein product		614126	"""MOCO sulphurase C-terminal domain containing 1"""	MOSC1		11886751	Standard	NM_022746		Approved	FLJ22390	uc001hms.3	Q5VT66	OTTHUMG00000037353	ENST00000366910.5:c.714G>A	chr1.hg19:g.220971317G>A		376.0	0.0	.		498.0	119.0	.	NM_022746	A8K447|B2D078|Q5VVS9|Q5VVT0|Q5VVT1|Q8N9P5|Q96FN8|Q9H6C7	Silent	SNP	ENST00000366910.5	hg19	CCDS1526.1	.	.	.	.	.	.	.	.	.	.	G	2.055	-0.416878	0.04766	.	.	ENSG00000186205	ENST00000407981	.	.	.	4.95	3.04	0.35103	.	.	.	.	.	T	0.47875	0.1469	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.39057	-0.9632	4	.	.	.	-19.1717	4.6342	0.12516	0.2726:0.1776:0.5497:0.0	.	.	.	.	T	147	.	.	A	+	1	0	MOSC1	219037940	0.990000	0.36364	0.996000	0.52242	0.079000	0.17450	0.098000	0.15189	1.211000	0.43351	0.655000	0.94253	GCC	.	.	.	none		0.443	MARC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090904.1	NM_022746	
SLC35F3	148641	hgsc.bcm.edu	37	1	234458910	234458910	+	Missense_Mutation	SNP	A	A	T			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr1:234458910A>T	ENST00000366617.3	+	7	1415	c.1187A>T	c.(1186-1188)gAg>gTg	p.E396V	SLC35F3_ENST00000366618.3_Missense_Mutation_p.E465V			Q8IY50	S35F3_HUMAN	solute carrier family 35, member F3	396					thiamine transport (GO:0015888)	integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|urinary_tract(1)	32	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)			AAGAAGGAGGAGCCTGCAGAG	0.587											OREG0014330	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E465V		Atlas-SNP	.											.	SLC35F3	81	.	0			c.A1394T						PASS	.						74.0	73.0	74.0					1																	234458910		2203	4300	6503	SO:0001583	missense	148641	exon8			AGGAGGAGCCTGC		CCDS1600.1, CCDS73050.1	1q42.3	2013-05-22			ENSG00000183780	ENSG00000183780		"""Solute carriers"""	23616	protein-coding gene	gene with protein product							Standard	XM_005273070		Approved	FLJ37712	uc001hvy.1	Q8IY50	OTTHUMG00000037929	ENST00000366617.3:c.1187A>T	chr1.hg19:g.234458910A>T	ENSP00000355576:p.Glu396Val	160.0	0.0	.	2373	281.0	36.0	.	NM_173508	Q5TDD6|Q8N9C9	Missense_Mutation	SNP	ENST00000366617.3	hg19		.	.	.	.	.	.	.	.	.	.	A	25.5	4.643874	0.87859	.	.	ENSG00000183780	ENST00000366618;ENST00000366617	T;T	0.53857	0.6;0.62	5.62	5.62	0.85841	.	0.214041	0.48767	D	0.000163	T	0.58623	0.2135	L	0.50333	1.59	0.51482	D	0.999922	D;D	0.57571	0.966;0.98	P;P	0.51229	0.543;0.663	T	0.61983	-0.6950	10	0.59425	D	0.04	-20.2302	15.7908	0.78364	1.0:0.0:0.0:0.0	.	396;465	Q8IY50;Q8IY50-2	S35F3_HUMAN;.	V	465;396	ENSP00000355577:E465V;ENSP00000355576:E396V	ENSP00000355576:E396V	E	+	2	0	SLC35F3	232525533	1.000000	0.71417	0.996000	0.52242	0.989000	0.77384	8.954000	0.93051	2.132000	0.65825	0.402000	0.26972	GAG	.	.	.	none		0.587	SLC35F3-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000128322.1	NM_173508	
RAB11FIP5	26056	hgsc.bcm.edu	37	2	73315269	73315269	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr2:73315269C>T	ENST00000258098.6	-	3	1717	c.1477G>A	c.(1477-1479)Gcc>Acc	p.A493T	RAB11FIP5_ENST00000493523.2_5'UTR	NM_015470.2	NP_056285.1	Q9BXF6	RFIP5_HUMAN	RAB11 family interacting protein 5 (class I)	493					cellular response to acidic pH (GO:0071468)|insulin secretion involved in cellular response to glucose stimulus (GO:0035773)|protein transport (GO:0015031)|regulated secretory pathway (GO:0045055)|regulation of protein localization to cell surface (GO:2000008)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|recycling endosome (GO:0055037)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)			biliary_tract(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	23						TGTGGGGAGGCCCCCAGGATG	0.607																																					p.A493T		Atlas-SNP	.											.	RAB11FIP5	66	.	0			c.G1477A						PASS	.						69.0	74.0	72.0					2																	73315269		2203	4300	6503	SO:0001583	missense	26056	exon3			GGGAGGCCCCCAG	AF334812	CCDS1923.1	2p13	2008-02-05			ENSG00000135631	ENSG00000135631			24845	protein-coding gene	gene with protein product		605536				10048485, 11163216	Standard	NM_015470		Approved	GAF1, KIAA0857, RIP11, pp75	uc002sis.4	Q9BXF6	OTTHUMG00000129779	ENST00000258098.6:c.1477G>A	chr2.hg19:g.73315269C>T	ENSP00000258098:p.Ala493Thr	249.0	0.0	.		484.0	55.0	.	NM_015470	O94939|Q9P0M1	Missense_Mutation	SNP	ENST00000258098.6	hg19	CCDS1923.1	.	.	.	.	.	.	.	.	.	.	C	16.78	3.217658	0.58560	.	.	ENSG00000135631	ENST00000258098	T	0.50548	0.74	4.52	4.52	0.55395	.	0.334564	0.25935	N	0.027344	T	0.50905	0.1643	N	0.19112	0.55	0.34421	D	0.697508	D;D	0.63880	0.993;0.993	D;D	0.74674	0.971;0.984	T	0.55780	-0.8087	10	0.23891	T	0.37	-11.0892	14.4444	0.67340	0.0:1.0:0.0:0.0	.	493;493	Q9BXF6;Q2Z1P3	RFIP5_HUMAN;.	T	493	ENSP00000258098:A493T	ENSP00000258098:A493T	A	-	1	0	RAB11FIP5	73168777	0.002000	0.14202	0.992000	0.48379	0.966000	0.64601	-0.184000	0.09698	2.527000	0.85204	0.491000	0.48974	GCC	.	.	.	none		0.607	RAB11FIP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251995.1	NM_015470	
FAM124B	79843	hgsc.bcm.edu	37	2	225266233	225266233	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr2:225266233C>T	ENST00000409685.3	-	1	518	c.253G>A	c.(253-255)Gtc>Atc	p.V85I	FAM124B_ENST00000243806.2_Missense_Mutation_p.V85I|FAM124B_ENST00000389874.3_Missense_Mutation_p.V85I	NM_001122779.1	NP_001116251.1	Q9H5Z6	F124B_HUMAN	family with sequence similarity 124B	85								p.V85I(2)		endometrium(2)|large_intestine(2)|lung(7)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	16		Renal(207;0.0112)|all_lung(227;0.0126)|Lung NSC(271;0.0161)|all_hematologic(139;0.138)		Epithelial(121;4.4e-10)|all cancers(144;2.02e-07)|Lung(261;0.00766)|LUSC - Lung squamous cell carcinoma(224;0.00825)		GAGTCCAGGACGCGAAATAGC	0.552																																					p.V85I		Atlas-SNP	.											FAM124B_ENST00000409685,NS,carcinoma,0,4	FAM124B	71	.	2	Substitution - Missense(2)	endometrium(2)	c.G253A						PASS	.						59.0	57.0	58.0					2																	225266233		2203	4300	6503	SO:0001583	missense	79843	exon1			CCAGGACGCGAAA	AK075126	CCDS2461.1, CCDS46527.1	2q36.2	2008-02-05			ENSG00000124019	ENSG00000124019			26224	protein-coding gene	gene with protein product						12477932	Standard	NM_001122779		Approved	FLJ22746	uc002vnx.3	Q9H5Z6	OTTHUMG00000133168	ENST00000409685.3:c.253G>A	chr2.hg19:g.225266233C>T	ENSP00000386895:p.Val85Ile	105.0	0.0	.		145.0	20.0	.	NM_024785	A6NNC7|Q8NBZ4|Q8TAV7	Missense_Mutation	SNP	ENST00000409685.3	hg19	CCDS46527.1	.	.	.	.	.	.	.	.	.	.	C	4.854	0.158738	0.09236	.	.	ENSG00000124019	ENST00000389874;ENST00000409685;ENST00000243806	T;T;T	0.46063	0.88;0.88;0.88	5.69	1.32	0.21799	.	0.311841	0.33691	N	0.004645	T	0.30510	0.0767	L	0.42686	1.345	0.09310	N	1	B;B	0.21452	0.056;0.004	B;B	0.17433	0.018;0.003	T	0.18871	-1.0323	10	0.44086	T	0.13	-7.8837	7.6061	0.28103	0.0:0.574:0.22:0.206	.	85;85	Q9H5Z6;Q9H5Z6-2	F124B_HUMAN;.	I	85	ENSP00000374524:V85I;ENSP00000386895:V85I;ENSP00000243806:V85I	ENSP00000243806:V85I	V	-	1	0	FAM124B	224974477	0.625000	0.27111	0.000000	0.03702	0.001000	0.01503	1.550000	0.36223	0.332000	0.23536	-0.137000	0.14449	GTC	.	.	.	none		0.552	FAM124B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330873.1	NM_024785	
PFKFB4	5210	hgsc.bcm.edu	37	3	48577177	48577177	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr3:48577177C>A	ENST00000232375.3	-	5	518	c.406G>T	c.(406-408)Gaa>Taa	p.E136*	PFKFB4_ENST00000490115.1_5'UTR|PFKFB4_ENST00000541519.1_Nonsense_Mutation_p.E102*|PFKFB4_ENST00000416568.1_Nonsense_Mutation_p.E136*|PFKFB4_ENST00000536104.1_Nonsense_Mutation_p.E125*|PFKFB4_ENST00000545984.1_Missense_Mutation_p.E113D|PFKFB4_ENST00000383734.2_Nonsense_Mutation_p.E136*	NM_004567.2	NP_004558.1	Q16877	F264_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4	136	6-phosphofructo-2-kinase.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)			breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|urinary_tract(1)	14				BRCA - Breast invasive adenocarcinoma(193;0.0003)|KIRC - Kidney renal clear cell carcinoma(197;0.00596)|Kidney(197;0.00684)		GCTCTCCGTTCTCGGGTGGTG	0.567																																					p.E136X		Atlas-SNP	.											.	PFKFB4	39	.	0			c.G406T						PASS	.						114.0	107.0	109.0					3																	48577177		2203	4300	6503	SO:0001587	stop_gained	5210	exon5			TCCGTTCTCGGGT	BC010269	CCDS2771.1	3p22-p21	2004-03-02			ENSG00000114268	ENSG00000114268			8875	protein-coding gene	gene with protein product		605320				8830046, 10095107	Standard	NM_004567		Approved		uc003ctv.3	Q16877	OTTHUMG00000133528	ENST00000232375.3:c.406G>T	chr3.hg19:g.48577177C>A	ENSP00000232375:p.Glu136*	143.0	0.0	.		124.0	49.0	.	NM_004567	Q5S3G5|Q5XLC2|Q64EX5	Nonsense_Mutation	SNP	ENST00000232375.3	hg19	CCDS2771.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.32|15.32	2.797337|2.797337	0.50208|0.50208	.|.	.|.	ENSG00000114268|ENSG00000114268	ENST00000545984|ENST00000232375;ENST00000536104;ENST00000416568;ENST00000383734;ENST00000541519;ENST00000452531;ENST00000412035	.|.	.|.	.|.	4.62|4.62	4.62|4.62	0.57501|0.57501	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|.	0.63307|.	0.2500|.	.|.	.|.	.|.	0.31708|0.31708	N|N	0.639831|0.639831	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.71906|.	-0.4451|.	6|.	0.02654|0.87932	T|D	1|0	-15.7704|-15.7704	15.0132|15.0132	0.71565|0.71565	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	D|X	113|136;125;136;136;102;125;102	.|.	ENSP00000437844:E113D|ENSP00000232375:E136X	E|E	-|-	3|1	2|0	PFKFB4|PFKFB4	48552181|48552181	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.769000|0.769000	0.43574|0.43574	7.645000|7.645000	0.83430|0.83430	2.419000|2.419000	0.82065|0.82065	0.467000|0.467000	0.42956|0.42956	GAG|GAA	.	.	.	none		0.567	PFKFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257503.2	NM_004567	
TKT	7086	hgsc.bcm.edu	37	3	53264627	53264627	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr3:53264627C>T	ENST00000462138.1	-	8	1041	c.953G>A	c.(952-954)cGc>cAc	p.R318H	TKT_ENST00000461139.1_5'UTR|TKT_ENST00000296289.6_Missense_Mutation_p.R271H|TKT_ENST00000423525.2_Missense_Mutation_p.R318H|TKT_ENST00000423516.1_Missense_Mutation_p.R326H			P29401	TKT_HUMAN	transketolase	318					carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|glyceraldehyde-3-phosphate biosynthetic process (GO:0046166)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, non-oxidative branch (GO:0009052)|regulation of growth (GO:0040008)|small molecule metabolic process (GO:0044281)|xylulose biosynthetic process (GO:0005999)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|peroxisome (GO:0005777)|vesicle (GO:0031982)	cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|transketolase activity (GO:0004802)			endometrium(5)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17		Prostate(884;0.0959)		BRCA - Breast invasive adenocarcinoma(193;0.000159)|OV - Ovarian serous cystadenocarcinoma(275;0.000314)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)		GTAGGCCTTGCGGGTGGCTAT	0.587																																					p.R326H	Colon(133;1506 2347 35238 42177)	Atlas-SNP	.											.	TKT	38	.	0			c.G977A						PASS	.						59.0	56.0	57.0					3																	53264627		2203	4300	6503	SO:0001583	missense	7086	exon9			GCCTTGCGGGTGG		CCDS2871.1, CCDS58834.1	3p14.3	2008-07-31	2008-07-31		ENSG00000163931	ENSG00000163931	2.2.1.1		11834	protein-coding gene	gene with protein product	"""Wernicke-Korsakoff syndrome"""	606781				1567394	Standard	NM_001064		Approved		uc011beq.2	P29401	OTTHUMG00000158192	ENST00000462138.1:c.953G>A	chr3.hg19:g.53264627C>T	ENSP00000417773:p.Arg318His	72.0	0.0	.		98.0	6.0	.	NM_001258028	A8K089|B4DE31|E7EPA7|Q8TBA3|Q96HH3	Missense_Mutation	SNP	ENST00000462138.1	hg19	CCDS2871.1	.	.	.	.	.	.	.	.	.	.	C	35	5.563617	0.96527	.	.	ENSG00000163931	ENST00000462138;ENST00000423525;ENST00000423516;ENST00000296289;ENST00000414014	D;D;D;D	0.92965	-3.14;-3.14;-3.14;-3.14	5.69	5.69	0.88448	Transketolase-like, pyrimidine-binding domain (2);	0.047547	0.85682	D	0.000000	D	0.97763	0.9266	H	0.97682	4.055	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.72338	0.963;0.977;0.971	D	0.98701	1.0700	10	0.87932	D	0	-15.8701	19.8045	0.96525	0.0:1.0:0.0:0.0	.	326;235;318	E7EPA7;B3KSI4;P29401	.;.;TKT_HUMAN	H	318;318;326;271;152	ENSP00000417773:R318H;ENSP00000405455:R318H;ENSP00000391481:R326H;ENSP00000296289:R271H	ENSP00000296289:R271H	R	-	2	0	TKT	53239667	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.676000	0.91093	0.655000	0.94253	CGC	.	.	.	none		0.587	TKT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350356.1		
PPP4R2	151987	hgsc.bcm.edu	37	3	73110176	73110176	+	Missense_Mutation	SNP	T	T	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr3:73110176T>A	ENST00000356692.5	+	5	637	c.384T>A	c.(382-384)aaT>aaA	p.N128K	PPP4R2_ENST00000394284.3_Missense_Mutation_p.N71K|EBLN2_ENST00000533473.1_5'Flank|PPP4R2_ENST00000295862.9_Missense_Mutation_p.N72K			Q9NY27	PP4R2_HUMAN	protein phosphatase 4, regulatory subunit 2	128					cellular protein modification process (GO:0006464)|hematopoietic progenitor cell differentiation (GO:0002244)|mRNA processing (GO:0006397)|regulation of catalytic activity (GO:0050790)|regulation of double-strand break repair via homologous recombination (GO:0010569)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)	protein binding, bridging (GO:0030674)|protein phosphatase type 4 regulator activity (GO:0030362)			breast(2)|endometrium(1)|large_intestine(1)|lung(3)|skin(2)|stomach(1)|urinary_tract(2)	12		Prostate(10;0.0187)|Lung SC(41;0.236)		Epithelial(33;1.76e-07)|BRCA - Breast invasive adenocarcinoma(55;9.42e-05)|LUSC - Lung squamous cell carcinoma(21;0.00211)|Lung(16;0.00643)|KIRC - Kidney renal clear cell carcinoma(39;0.0164)|Kidney(39;0.0193)|OV - Ovarian serous cystadenocarcinoma(275;0.031)		TATTGCAGAATGTGATGGTTG	0.259																																					p.N128K		Atlas-SNP	.											.	PPP4R2	30	.	0			c.T384A						PASS	.						102.0	96.0	98.0					3																	73110176		2199	4292	6491	SO:0001583	missense	151987	exon5			GCAGAATGTGATG	AJ271448	CCDS2917.1	3q29	2010-06-18			ENSG00000163605	ENSG00000163605		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	18296	protein-coding gene	gene with protein product		613822				10769191	Standard	NM_174907		Approved		uc003dph.1	Q9NY27	OTTHUMG00000158816	ENST00000356692.5:c.384T>A	chr3.hg19:g.73110176T>A	ENSP00000349124:p.Asn128Lys	68.0	0.0	.		34.0	8.0	.	NM_174907	A8K1I6|Q2TAJ9|Q498B8|Q8WXX6	Missense_Mutation	SNP	ENST00000356692.5	hg19	CCDS2917.1	.	.	.	.	.	.	.	.	.	.	T	17.55	3.417029	0.62511	.	.	ENSG00000163605	ENST00000356692;ENST00000488810;ENST00000394284;ENST00000295862	T;T;T;T	0.54071	0.59;0.59;0.59;0.59	4.96	2.54	0.30619	.	0.000000	0.85682	D	0.000000	T	0.57036	0.2026	M	0.86178	2.8	0.80722	D	1	P;P	0.39903	0.694;0.505	B;B	0.41374	0.353;0.355	T	0.59467	-0.7449	10	0.72032	D	0.01	.	9.3514	0.38140	0.0:0.1471:0.0:0.8529	.	71;128	Q9NY27-2;Q9NY27	.;PP4R2_HUMAN	K	128;128;71;72	ENSP00000349124:N128K;ENSP00000418750:N128K;ENSP00000377825:N71K;ENSP00000295862:N72K	ENSP00000295862:N72K	N	+	3	2	PPP4R2	73192866	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	3.134000	0.50538	0.329000	0.23460	-0.297000	0.09499	AAT	.	.	.	none		0.259	PPP4R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352321.1	NM_174907	
MED12L	116931	hgsc.bcm.edu	37	3	151072983	151072983	+	Missense_Mutation	SNP	C	C	T	rs200848773		TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr3:151072983C>T	ENST00000474524.1	+	16	2406	c.2368C>T	c.(2368-2370)Ctc>Ttc	p.L790F	MED12L_ENST00000273432.4_Missense_Mutation_p.L650F|P2RY12_ENST00000302632.3_Intron|MED12L_ENST00000491549.1_3'UTR	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	790						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			GTTCACTAAACTCCAGCTCCT	0.358																																					p.L790F		Atlas-SNP	.											.	MED12L	271	.	0			c.C2368T						PASS	.						103.0	104.0	103.0					3																	151072983		2203	4300	6503	SO:0001583	missense	116931	exon16			ACTAAACTCCAGC	AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.2368C>T	chr3.hg19:g.151072983C>T	ENSP00000417235:p.Leu790Phe	151.0	0.0	.		61.0	17.0	.	NM_053002	Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Missense_Mutation	SNP	ENST00000474524.1	hg19	CCDS33876.1	.	.	.	.	.	.	.	.	.	.	C	3.897	-0.022893	0.07634	.	.	ENSG00000144893	ENST00000474524;ENST00000273432	T;T	0.71341	-0.56;-0.56	5.35	5.35	0.76521	.	0.059800	0.64402	D	0.000002	T	0.31918	0.0812	N	0.00186	-1.895	0.80722	D	1	B;B	0.15141	0.006;0.012	B;B	0.17098	0.017;0.012	T	0.46830	-0.9163	10	0.11182	T	0.66	-18.4403	12.407	0.55445	0.0:0.922:0.0:0.078	.	650;790	F8WAE6;Q86YW9	.;MD12L_HUMAN	F	790;650	ENSP00000417235:L790F;ENSP00000273432:L650F	ENSP00000273432:L650F	L	+	1	0	MED12L	152555673	1.000000	0.71417	1.000000	0.80357	0.545000	0.35147	3.177000	0.50871	2.656000	0.90262	0.650000	0.86243	CTC	.	C|0.999;G|0.001	.	alt		0.358	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357707.2	NM_053002	
HIST1H2BL	8340	hgsc.bcm.edu	37	6	27775403	27775403	+	Silent	SNP	C	C	T	rs141648774		TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr6:27775403C>T	ENST00000377401.2	-	1	306	c.282G>A	c.(280-282)gaG>gaA	p.E94E	HIST1H3H_ENST00000369163.2_5'Flank|HIST1H2AI_ENST00000358739.3_5'Flank	NM_003519.3	NP_003510.1	Q99880	H2B1L_HUMAN	histone cluster 1, H2bl	94					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(7)|urinary_tract(1)	12						CGGTCTGGATCTCCCTGGAGG	0.617																																					p.E94E		Atlas-SNP	.											.	HIST1H2BL	48	.	0			c.G282A						PASS	.						92.0	94.0	93.0					6																	27775403		2203	4300	6503	SO:0001819	synonymous_variant	8340	exon1			CTGGATCTCCCTG	Z83740	CCDS4625.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000185130	ENSG00000185130		"""Histones / Replication-dependent"""	4748	protein-coding gene	gene with protein product		602800	"""H2B histone family, member C"", ""histone 1, H2bl"""	H2BFC		9439656, 12408966	Standard	NM_003519		Approved	H2B/c, dJ97D16.4	uc003njl.3	Q99880	OTTHUMG00000014485	ENST00000377401.2:c.282G>A	chr6.hg19:g.27775403C>T		176.0	0.0	.		197.0	143.0	.	NM_003519	B2R5A3|Q52LW9	Silent	SNP	ENST00000377401.2	hg19	CCDS4625.1																																																																																			.	C|1.000;A|0.000	.	alt		0.617	HIST1H2BL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040153.1	NM_003519	
MLIP	90523	hgsc.bcm.edu	37	6	53989447	53989447	+	Silent	SNP	T	T	C			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr6:53989447T>C	ENST00000274897.5	+	3	509	c.396T>C	c.(394-396)atT>atC	p.I132I	MLIP_ENST00000511744.1_3'UTR|MLIP_ENST00000514921.1_Silent_p.I132I|MLIP_ENST00000509997.1_Silent_p.I80I|MLIP_ENST00000370876.2_Silent_p.I70I|MLIP_ENST00000502396.1_Silent_p.I143I|MLIP_ENST00000370877.2_Silent_p.I80I|MLIP_ENST00000358276.5_Silent_p.I126I	NM_138569.2	NP_612636.2	Q5VWP3	MLIP_HUMAN	muscular LMNA-interacting protein	132						nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|PML body (GO:0016605)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(16)|ovary(8)|skin(4)|stomach(1)|urinary_tract(1)	34						ATGTCCTTATTGTGGACTCCG	0.502																																					p.I132I		Atlas-SNP	.											.	MLIP	84	.	0			c.T396C						PASS	.						100.0	99.0	100.0					6																	53989447		2203	4300	6503	SO:0001819	synonymous_variant	90523	exon3			CCTTATTGTGGAC	AK055530	CCDS4954.1, CCDS64448.1, CCDS64449.1	6p12.2-p12.1	2011-04-29	2011-04-29	2011-04-29	ENSG00000146147	ENSG00000146147			21355	protein-coding gene	gene with protein product	"""muscle-enriched A-type lamin interacting protein"""	614106	"""chromosome 6 open reading frame 142"""	C6orf142		21498514	Standard	NM_138569		Approved	MGC18257	uc011dxa.2	Q5VWP3	OTTHUMG00000014891	ENST00000274897.5:c.396T>C	chr6.hg19:g.53989447T>C		250.0	0.0	.		166.0	127.0	.	NM_138569	B7Z2N0|D6RE05|Q96H08|Q96NF7	Silent	SNP	ENST00000274897.5	hg19	CCDS4954.1																																																																																			.	.	.	none		0.502	MLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040979.3	NM_138569	
NOS3	4846	hgsc.bcm.edu	37	7	150698913	150698913	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr7:150698913G>A	ENST00000484524.1	+	12	1507	c.1507G>A	c.(1507-1509)Gtg>Atg	p.V503M	NOS3_ENST00000297494.3_Missense_Mutation_p.V503M|NOS3_ENST00000461406.1_Missense_Mutation_p.V297M|NOS3_ENST00000467517.1_Missense_Mutation_p.V503M	NM_001160111.1	NP_001153583.1	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)	0					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CCGCAGCGCCGTGAAGATCTC	0.642																																					p.V503M		Atlas-SNP	.											.	NOS3	131	.	0			c.G1507A						PASS	.						53.0	51.0	52.0					7																	150698913		2203	4300	6503	SO:0001583	missense	4846	exon12			AGCGCCGTGAAGA		CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000484524.1:c.1507G>A	chr7.hg19:g.150698913G>A	ENSP00000420215:p.Val503Met	148.0	0.0	.		174.0	53.0	.	NM_001160111	Q495E5	Missense_Mutation	SNP	ENST00000484524.1	hg19	CCDS55182.1	.	.	.	.	.	.	.	.	.	.	G	19.87	3.907322	0.72868	.	.	ENSG00000164867	ENST00000297494;ENST00000461406;ENST00000484524;ENST00000467517	T;T;T;T	0.17691	4.46;4.33;2.67;2.26	4.8	4.8	0.61643	.	0.000000	0.48767	D	0.000162	T	0.48660	0.1512	M	0.89414	3.03	0.58432	D	0.99999	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.79784	0.98;0.98;0.991;0.993;0.991	T	0.58869	-0.7560	10	0.87932	D	0	-4.5235	15.7394	0.77876	0.0:0.0:1.0:0.0	.	503;503;503;297;503	A0S0A6;E9PFR2;A0S0A8;E7ESA7;P29474	.;.;.;.;NOS3_HUMAN	M	503;297;503;503	ENSP00000297494:V503M;ENSP00000417143:V297M;ENSP00000420215:V503M;ENSP00000420551:V503M	ENSP00000297494:V503M	V	+	1	0	NOS3	150329846	1.000000	0.71417	0.946000	0.38457	0.522000	0.34438	9.261000	0.95576	2.376000	0.81061	0.655000	0.94253	GTG	.	.	.	none		0.642	NOS3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351550.1	NM_000603	
OXR1	55074	hgsc.bcm.edu	37	8	107752622	107752622	+	Missense_Mutation	SNP	T	T	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr8:107752622T>A	ENST00000442977.2	+	13	2317	c.2218T>A	c.(2218-2220)Tat>Aat	p.Y740N	OXR1_ENST00000312046.6_Missense_Mutation_p.Y705N|OXR1_ENST00000445937.1_Missense_Mutation_p.Y712N|OXR1_ENST00000531443.1_Missense_Mutation_p.Y712N|OXR1_ENST00000452423.2_Missense_Mutation_p.Y160N|OXR1_ENST00000297447.6_Missense_Mutation_p.Y109N|OXR1_ENST00000521592.1_De_novo_Start_OutOfFrame|OXR1_ENST00000517566.2_Missense_Mutation_p.Y739N|OXR1_ENST00000449762.2_Missense_Mutation_p.Y82N	NM_001198532.1	NP_001185461.1	Q8N573	OXR1_HUMAN	oxidation resistance 1	740	TLD.				adult walking behavior (GO:0007628)|cellular response to hydroperoxide (GO:0071447)|negative regulation of neuron apoptotic process (GO:0043524)|response to oxidative stress (GO:0006979)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)	oxidoreductase activity (GO:0016491)			NS(2)|breast(2)|endometrium(2)|large_intestine(9)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)			GACTCTTGTTTATGGTACTGG	0.383																																					p.Y740N		Atlas-SNP	.											.	OXR1	190	.	0			c.T2218A						PASS	.						129.0	119.0	122.0					8																	107752622		2203	4300	6503	SO:0001583	missense	55074	exon13			CTTGTTTATGGTA	AF309387	CCDS6304.2, CCDS47909.1, CCDS56547.1, CCDS56548.1, CCDS56549.1, CCDS56550.1	8q23	2013-03-14			ENSG00000164830	ENSG00000164830			15822	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 3"""	605609				11114193	Standard	NM_181354		Approved	TLDC3	uc011lht.2	Q8N573	OTTHUMG00000167682	ENST00000442977.2:c.2218T>A	chr8.hg19:g.107752622T>A	ENSP00000405424:p.Tyr740Asn	234.0	0.0	.		75.0	11.0	.	NM_001198532	A6NK11|A8KA34|B3KXL1|B7Z402|B7Z8N5|D3HIS6|Q3LIB5|Q6ZVK9|Q8N8V0|Q9H266|Q9NWC7	Missense_Mutation	SNP	ENST00000442977.2	hg19	CCDS56548.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.4|25.4	4.629261|4.629261	0.87560|0.87560	.|.	.|.	ENSG00000164830|ENSG00000164830	ENST00000519415|ENST00000445937;ENST00000531443;ENST00000517566;ENST00000452423;ENST00000442977;ENST00000312046;ENST00000449762;ENST00000297447	.|T;T;T;T;T;T;T;T	.|0.54279	.|0.58;0.58;0.58;0.58;0.58;0.58;0.58;0.58	5.48|5.48	5.48|5.48	0.80851|0.80851	.|TLDc (2);	.|0.054965	.|0.85682	.|D	.|0.000000	T|T	0.82204|0.82204	0.4986|0.4986	H|H	0.97540|0.97540	4.025|4.025	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D	.|0.89917	.|0.999;0.999;1.0;0.999;0.992;0.998	.|D;D;D;D;D;D	.|0.81914	.|0.991;0.987;0.995;0.977;0.942;0.983	D|D	0.88810|0.88810	0.3291|0.3291	5|10	.|0.87932	.|D	.|0	-15.1603|-15.1603	15.5747|15.5747	0.76368|0.76368	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|705;740;739;82;109;712	.|Q8N573-2;Q8N573;D3HIS6;B7Z8N5;Q8N573-4;Q8N573-5	.|.;OXR1_HUMAN;.;.;.;.	L|N	383|712;712;739;160;740;705;82;109	.|ENSP00000402918:Y712N;ENSP00000431966:Y712N;ENSP00000429205:Y739N;ENSP00000395032:Y160N;ENSP00000405424:Y740N;ENSP00000311026:Y705N;ENSP00000408659:Y82N;ENSP00000297447:Y109N	.|ENSP00000297447:Y109N	F|Y	+|+	3|1	2|0	OXR1|OXR1	107821798|107821798	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	8.040000|8.040000	0.89188|0.89188	2.066000|2.066000	0.61787|0.61787	0.533000|0.533000	0.62120|0.62120	TTT|TAT	.	.	.	none		0.383	OXR1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_181354	
AKNA	80709	hgsc.bcm.edu	37	9	117139726	117139726	+	Missense_Mutation	SNP	T	T	C	rs371041163		TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr9:117139726T>C	ENST00000307564.4	-	3	522	c.361A>G	c.(361-363)Act>Gct	p.T121A	AKNA_ENST00000223791.3_5'Flank|AKNA_ENST00000374088.3_Missense_Mutation_p.T121A|AKNA_ENST00000374075.5_Missense_Mutation_p.T40A|AKNA_ENST00000312033.3_Missense_Mutation_p.T121A	NM_030767.4	NP_110394.3	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	121					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(7)|liver(2)|lung(22)|ovary(4)|stomach(2)	51						TCCTCTTCAGTCATGTCCAGC	0.602																																					p.T121A		Atlas-SNP	.											.	AKNA	119	.	0			c.A361G						PASS	.						44.0	45.0	45.0					9																	117139726		2203	4300	6503	SO:0001583	missense	80709	exon3			CTTCAGTCATGTC	AK024431	CCDS6805.1	9q32	2008-02-05			ENSG00000106948	ENSG00000106948			24108	protein-coding gene	gene with protein product		605729				11268217, 11853319	Standard	NM_030767		Approved	KIAA1968	uc004bis.3	Q7Z591	OTTHUMG00000020538	ENST00000307564.4:c.361A>G	chr9.hg19:g.117139726T>C	ENSP00000303769:p.Thr121Ala	129.0	0.0	.		163.0	84.0	.	NM_030767	Q05BK5|Q5T535|Q5T536|Q5T537|Q64FX6|Q64FX7|Q64FX8|Q64FY2|Q6ZMK0|Q6ZNL2|Q6ZTX0|Q8TET1|Q8TF33|Q96RR9|Q9H7P7	Missense_Mutation	SNP	ENST00000307564.4	hg19	CCDS6805.1	.	.	.	.	.	.	.	.	.	.	T	17.95	3.512748	0.64522	.	.	ENSG00000106948	ENST00000307564;ENST00000374088;ENST00000374075;ENST00000312033;ENST00000394574	T;T;T;T	0.32272	2.69;2.69;2.7;1.46	4.58	0.597	0.17504	.	0.519095	0.16285	N	0.221162	T	0.18759	0.0450	L	0.27053	0.805	0.80722	D	1	B;B;B	0.33807	0.22;0.075;0.426	B;B;B	0.37692	0.208;0.035;0.256	T	0.06954	-1.0798	10	0.34782	T	0.22	-4.4222	3.703	0.08390	0.3391:0.1032:0.0:0.5577	.	121;121;40	Q7Z591-6;Q7Z591;Q7Z591-2	.;AKNA_HUMAN;.	A	121;121;40;121;121	ENSP00000303769:T121A;ENSP00000363201:T121A;ENSP00000363188:T40A;ENSP00000309222:T121A	ENSP00000303769:T121A	T	-	1	0	AKNA	116179547	0.975000	0.34042	0.174000	0.22961	0.155000	0.21991	0.491000	0.22419	0.172000	0.19760	0.379000	0.24179	ACT	.	.	.	alt		0.602	AKNA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053767.2	NM_030767	
BRINP1	1620	hgsc.bcm.edu	37	9	121930244	121930244	+	Silent	SNP	C	C	T	rs370346617		TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr9:121930244C>T	ENST00000265922.3	-	8	1865	c.1404G>A	c.(1402-1404)tcG>tcA	p.S468S	BRINP1_ENST00000482797.1_Intron	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	468					cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)											CGCTCCGCTCCGAGTCCACGT	0.592																																					p.S468S		Atlas-SNP	.											.	DBC1	194	.	0			c.G1404A						PASS	.	C		1,4405	2.1+/-5.4	0,1,2202	149.0	122.0	131.0		1404	0.4	1.0	9		131	0,8600		0,0,4300	no	coding-synonymous	DBC1	NM_014618.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		468/762	121930244	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	1620	exon8			CCGCTCCGAGTCC	AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.1404G>A	chr9.hg19:g.121930244C>T		92.0	0.0	.		107.0	26.0	.	NM_014618	Q6IPV6|Q6P1A0|Q8WU22	Silent	SNP	ENST00000265922.3	hg19	CCDS6822.1																																																																																			.	.	.	weak		0.592	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055440.2	NM_014618	
GTPBP4	23560	hgsc.bcm.edu	37	10	1043230	1043230	+	Silent	SNP	G	G	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr10:1043230G>A	ENST00000360803.4	+	5	625	c.543G>A	c.(541-543)aaG>aaA	p.K181K	GTPBP4_ENST00000538293.1_Silent_p.K65K|GTPBP4_ENST00000491635.1_3'UTR|GTPBP4_ENST00000545048.1_Silent_p.K134K	NM_012341.2	NP_036473.2	Q9BZE4	NOG1_HUMAN	GTP binding protein 4	181	OBG-type G. {ECO:0000255|PROSITE- ProRule:PRU01047}.				GTP catabolic process (GO:0006184)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of collagen binding (GO:0033342)|negative regulation of DNA replication (GO:0008156)|negative regulation of protein ubiquitination (GO:0031397)|osteoblast differentiation (GO:0001649)|protein stabilization (GO:0050821)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|ribosome biogenesis (GO:0042254)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(1)	21		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.0814)	Epithelial(11;0.0513)|all cancers(11;0.135)|OV - Ovarian serous cystadenocarcinoma(14;0.173)		ATGTTGGGAAGTCCAGCTTCA	0.443																																					p.K181K		Atlas-SNP	.											.	GTPBP4	57	.	0			c.G543A						PASS	.						180.0	169.0	172.0					10																	1043230		2203	4300	6503	SO:0001819	synonymous_variant	23560	exon5			TGGGAAGTCCAGC	AK001548	CCDS31132.1	10p15-p14	2007-07-27			ENSG00000107937	ENSG00000107937			21535	protein-coding gene	gene with protein product	"""G protein-binding protein CRFG"", "" GTP-binding protein"""					11316846	Standard	NM_012341		Approved	CRFG, NGB, FLJ10690, FLJ10686, NOG1	uc001ift.3	Q9BZE4	OTTHUMG00000017538	ENST00000360803.4:c.543G>A	chr10.hg19:g.1043230G>A		390.0	1.0	.		456.0	204.0	.	NM_012341	B3KMC5|B4DY13|B7Z7A3|O95446|Q5T3R8|Q9NVJ8	Silent	SNP	ENST00000360803.4	hg19	CCDS31132.1																																																																																			.	.	.	none		0.443	GTPBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046412.1	NM_012341	
PIK3C2A	5286	hgsc.bcm.edu	37	11	17190402	17190402	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr11:17190402G>A	ENST00000265970.7	-	1	886	c.887C>T	c.(886-888)tCa>tTa	p.S296L	PIK3C2A_ENST00000531428.1_Intron|PIK3C2A_ENST00000540361.1_Intron	NM_002645.2	NP_002636.2	O00443	P3C2A_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha	296					clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|exocytosis (GO:0006887)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|small molecule metabolic process (GO:0044281)|vascular smooth muscle contraction (GO:0014829)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol binding (GO:0035091)			central_nervous_system(4)|endometrium(5)|kidney(5)|large_intestine(7)|lung(24)|ovary(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	58						TAGCAAACTTGAAACATTTTT	0.393																																					p.S296L		Atlas-SNP	.											.	PIK3C2A	148	.	0			c.C887T						PASS	.						176.0	170.0	172.0					11																	17190402		2200	4293	6493	SO:0001583	missense	5286	exon1			AAACTTGAAACAT	Y13367	CCDS7824.1	11p15.5-p14	2012-07-13	2012-07-13			ENSG00000011405	2.7.1.154		8971	protein-coding gene	gene with protein product		603601	"""phosphoinositide-3-kinase, class 2, alpha polypeptide"""			9337861	Standard	NM_002645		Approved	PI3K-C2alpha	uc001mmq.4	O00443		ENST00000265970.7:c.887C>T	chr11.hg19:g.17190402G>A	ENSP00000265970:p.Ser296Leu	276.0	0.0	.		278.0	59.0	.	NM_002645	B0LPH2|B4E2G4|Q14CQ9	Missense_Mutation	SNP	ENST00000265970.7	hg19	CCDS7824.1	.	.	.	.	.	.	.	.	.	.	G	10.03	1.239126	0.22711	.	.	ENSG00000011405	ENST00000265970;ENST00000544896	T	0.62639	0.01	5.49	5.49	0.81192	.	1.281530	0.04815	N	0.435973	T	0.54838	0.1883	N	0.19112	0.55	0.54753	D	0.999987	B;B	0.26258	0.145;0.0	B;B	0.21708	0.036;0.0	T	0.09422	-1.0675	10	0.51188	T	0.08	-3.6563	15.6995	0.77533	0.0:0.137:0.863:0.0	.	296;296	F5H5W9;O00443	.;P3C2A_HUMAN	L	296	ENSP00000265970:S296L	ENSP00000265970:S296L	S	-	2	0	PIK3C2A	17146978	0.228000	0.23718	0.359000	0.25824	0.485000	0.33311	1.793000	0.38764	2.570000	0.86706	0.563000	0.77884	TCA	.	.	.	none		0.393	PIK3C2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387553.1	NM_002645	
MS4A12	54860	hgsc.bcm.edu	37	11	60268545	60268545	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr11:60268545C>T	ENST00000016913.4	+	3	361	c.304C>T	c.(304-306)Cac>Tac	p.H102Y	MS4A12_ENST00000537076.1_Intron	NM_017716.2	NP_060186.2	Q9NXJ0	M4A12_HUMAN	membrane-spanning 4-domains, subfamily A, member 12	102						integral component of membrane (GO:0016021)				breast(1)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)	17						TGGATTGATGCACATTGGTTT	0.373																																					p.H102Y		Atlas-SNP	.											.	MS4A12	44	.	0			c.C304T						PASS	.						292.0	286.0	288.0					11																	60268545		2203	4300	6503	SO:0001583	missense	54860	exon3			TTGATGCACATTG	AK000224	CCDS7988.1, CCDS53638.1	11q12	2008-03-25				ENSG00000071203			13370	protein-coding gene	gene with protein product		606550				11401424, 11486273	Standard	NM_017716		Approved	Ms4a10, FLJ20217	uc001npr.3	Q9NXJ0		ENST00000016913.4:c.304C>T	chr11.hg19:g.60268545C>T	ENSP00000016913:p.His102Tyr	591.0	0.0	.		298.0	44.0	.	NM_017716	F5GX98|Q8N6L4	Missense_Mutation	SNP	ENST00000016913.4	hg19	CCDS7988.1	.	.	.	.	.	.	.	.	.	.	C	13.57	2.277327	0.40294	.	.	ENSG00000071203	ENST00000016913;ENST00000530007	T;T	0.58506	4.27;0.33	5.14	5.14	0.70334	.	0.454353	0.25506	N	0.030212	T	0.66177	0.2763	L	0.55990	1.75	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.62243	-0.6895	10	0.02654	T	1	.	14.0807	0.64919	0.0:1.0:0.0:0.0	.	102	Q9NXJ0	M4A12_HUMAN	Y	102	ENSP00000016913:H102Y;ENSP00000434783:H102Y	ENSP00000016913:H102Y	H	+	1	0	MS4A12	60025121	0.679000	0.27596	0.572000	0.28498	0.095000	0.18619	2.340000	0.43974	2.375000	0.81037	0.462000	0.41574	CAC	.	.	.	none		0.373	MS4A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383627.1		
VWCE	220001	hgsc.bcm.edu	37	11	61026692	61026692	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr11:61026692C>A	ENST00000335613.5	-	20	2709	c.2323G>T	c.(2323-2325)Gag>Tag	p.E775*	VWCE_ENST00000535710.1_Nonsense_Mutation_p.E240*	NM_152718.2	NP_689931.2	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	775						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						ACAGGGGCCTCAGTGTCTCCA	0.567																																					p.E775X		Atlas-SNP	.											.	VWCE	84	.	0			c.G2323T						PASS	.						40.0	42.0	41.0					11																	61026692		2203	4299	6502	SO:0001587	stop_gained	220001	exon20			GGGCCTCAGTGTC	AK056571	CCDS8002.1	11q12.2	2006-08-04			ENSG00000167992	ENSG00000167992			26487	protein-coding gene	gene with protein product		611115				12869306	Standard	NM_152718		Approved	URG11, FLJ32009, VWC1	uc001nra.3	Q96DN2	OTTHUMG00000168208	ENST00000335613.5:c.2323G>T	chr11.hg19:g.61026692C>A	ENSP00000334186:p.Glu775*	117.0	0.0	.		112.0	22.0	.	NM_152718	A5PKV0|Q7Z7L6|Q86WK8	Nonsense_Mutation	SNP	ENST00000335613.5	hg19	CCDS8002.1	.	.	.	.	.	.	.	.	.	.	C	37	6.304859	0.97458	.	.	ENSG00000167992	ENST00000335613;ENST00000535710	.	.	.	4.63	-0.214	0.13161	.	0.840398	0.09913	N	0.739540	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	3.1614	0.06521	0.1831:0.4481:0.0:0.3689	.	.	.	.	X	775;240	.	ENSP00000334186:E775X	E	-	1	0	VWCE	60783268	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.666000	0.05280	0.047000	0.15862	-0.982000	0.02568	GAG	.	.	.	none		0.567	VWCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398811.1	NM_152718	
M6PR	4074	hgsc.bcm.edu	37	12	9096395	9096395	+	Splice_Site	SNP	A	A	G			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr12:9096395A>G	ENST00000000412.3	-	4	922		c.e4+1			NM_002355.3	NP_002346.1	P20645	MPRD_HUMAN	mannose-6-phosphate receptor (cation dependent)						endosome to lysosome transport (GO:0008333)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	mannose binding (GO:0005537)|mannose transmembrane transporter activity (GO:0015578)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(1)	11		Hepatocellular(102;0.137)		BRCA - Breast invasive adenocarcinoma(232;0.0146)	Alglucosidase alfa(DB01272)	AGGGTGCCTCACCGCTAGGGT	0.527																																					.		Atlas-SNP	.											.	M6PR	33	.	0			c.453+2T>C						PASS	.						79.0	64.0	69.0					12																	9096395		2203	4300	6503	SO:0001630	splice_region_variant	4074	exon5			TGCCTCACCGCTA		CCDS8598.1, CCDS73440.1	12p13.31	2013-09-20			ENSG00000003056	ENSG00000003056			6752	protein-coding gene	gene with protein product		154540					Standard	NM_002355		Approved		uc001qvf.3	P20645	OTTHUMG00000168276	ENST00000000412.3:c.453+1T>C	chr12.hg19:g.9096395A>G		150.0	0.0	.		100.0	18.0	.	NM_002355	A8K528|D3DUV5	Splice_Site	SNP	ENST00000000412.3	hg19	CCDS8598.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.111457	0.77210	.	.	ENSG00000003056	ENST00000000412;ENST00000537621	.	.	.	5.71	5.71	0.89125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6658	0.77227	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	M6PR	8987662	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.075000	0.76798	2.191000	0.70037	0.528000	0.53228	.	.	.	.	none		0.527	M6PR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399130.1		Intron
MEIS2	4212	hgsc.bcm.edu	37	15	37184626	37184626	+	Missense_Mutation	SNP	C	C	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr15:37184626C>A	ENST00000561208.1	-	12	1600	c.1182G>T	c.(1180-1182)caG>caT	p.Q394H	MEIS2_ENST00000559408.1_5'Flank|MEIS2_ENST00000444725.1_3'UTR|MEIS2_ENST00000397620.2_3'UTR|MEIS2_ENST00000557796.2_3'UTR|MEIS2_ENST00000382766.2_Missense_Mutation_p.Q387H|MEIS2_ENST00000340545.5_3'UTR|MEIS2_ENST00000338564.5_Missense_Mutation_p.Q387H|MEIS2_ENST00000559085.1_3'UTR|MEIS2_ENST00000397624.3_3'UTR|MEIS2_ENST00000219869.9_3'UTR|MEIS2_ENST00000424352.2_3'UTR			O14770	MEIS2_HUMAN	Meis homeobox 2	394	Transcriptional activation domain.				eye development (GO:0001654)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas development (GO:0031016)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to growth factor (GO:0070848)|response to mechanical stimulus (GO:0009612)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	36		all_epithelial(112;9.77e-14)|Lung NSC(122;1.42e-09)|all_lung(180;2.2e-08)|Ovarian(310;0.134)|Melanoma(134;0.155)		all cancers(64;9.33e-21)|GBM - Glioblastoma multiforme(113;1.71e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0288)		TAGGACCACCCTGAGAAACGT	0.458																																					p.Q394H		Atlas-SNP	.											MEIS2,right_lower_lobe,carcinoma,0,1	MEIS2	99	.	0			c.G1182T						PASS	.						187.0	188.0	188.0					15																	37184626		2201	4297	6498	SO:0001583	missense	4212	exon12			ACCACCCTGAGAA	AF017418	CCDS10044.1, CCDS10045.1, CCDS42014.1, CCDS45217.1, CCDS45218.1, CCDS45219.1, CCDS45220.1	15q14	2011-06-20	2007-02-15		ENSG00000134138	ENSG00000134138		"""Homeoboxes / TALE class"""	7001	protein-coding gene	gene with protein product		601740	"""Meis (mouse) homolog 2"", ""Meis1, myeloid ecotropic viral integration site 1 homolog 2 (mouse)"""			9383298	Standard	NM_172315		Approved	MRG1, HsT18361	uc001zjr.4	O14770	OTTHUMG00000129781	ENST00000561208.1:c.1182G>T	chr15.hg19:g.37184626C>A	ENSP00000453793:p.Gln394His	591.0	1.0	.		214.0	59.0	.	NM_170675	A6NJI5|A8MWD5|B3KP98|B3KPQ6|Q96DI2|Q96KI4|Q96KI5|Q9NRS1|Q9NRS2|Q9NRS3	Missense_Mutation	SNP	ENST00000561208.1	hg19	CCDS10044.1	.	.	.	.	.	.	.	.	.	.	C	11.46	1.645203	0.29246	.	.	ENSG00000134138	ENST00000314177;ENST00000338564;ENST00000382766	D;D	0.86627	-2.15;-2.15	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.78046	0.4222	N	0.12182	0.205	0.80722	D	1	B;B;B;B	0.13145	0.001;0.002;0.001;0.007	B;B;B;B	0.13407	0.002;0.002;0.002;0.009	T	0.71087	-0.4694	10	0.22706	T	0.39	-1.914	18.9968	0.92817	0.0:1.0:0.0:0.0	.	387;394;374;90	O14770-4;O14770;B7Z6F6;Q6V703	.;MEIS2_HUMAN;.;.	H	394;387;387	ENSP00000341400:Q387H;ENSP00000372216:Q387H	ENSP00000326296:Q394H	Q	-	3	2	MEIS2	34971918	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.801000	0.69115	2.705000	0.92388	0.655000	0.94253	CAG	.	.	.	none		0.458	MEIS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252003.2	NM_170677	
CRISPLD2	83716	hgsc.bcm.edu	37	16	84940197	84940197	+	Silent	SNP	G	G	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr16:84940197G>A	ENST00000262424.5	+	15	1667	c.1443G>A	c.(1441-1443)ctG>ctA	p.L481L	CRISPLD2_ENST00000567845.1_Silent_p.L480L	NM_031476.3	NP_113664.1	Q9H0B8	CRLD2_HUMAN	cysteine-rich secretory protein LCCL domain containing 2	481	LCCL 2. {ECO:0000255|PROSITE- ProRule:PRU00123}.				extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|lung development (GO:0030324)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|transport vesicle (GO:0030133)	heparin binding (GO:0008201)			endometrium(3)|large_intestine(5)|lung(8)|prostate(1)|stomach(1)	18						TTTTCAGCCTGGGGACTCCTC	0.597																																					p.L481L		Atlas-SNP	.											.	CRISPLD2	36	.	0			c.G1443A						PASS	.						54.0	58.0	57.0					16																	84940197		2199	4300	6499	SO:0001819	synonymous_variant	83716	exon15			CAGCCTGGGGACT	AL136861	CCDS10949.1	16q24.1	2008-02-05	2005-02-16	2005-02-16	ENSG00000103196	ENSG00000103196			25248	protein-coding gene	gene with protein product		612434	"""LCCL domain containing cysteine-rich secretory protein 2"""	LCRISP2		11230166	Standard	NM_031476		Approved	DKFZP434B044	uc010voh.1	Q9H0B8	OTTHUMG00000137644	ENST00000262424.5:c.1443G>A	chr16.hg19:g.84940197G>A		256.0	0.0	.		282.0	59.0	.	NM_031476	D3DUM0|Q6P590|Q6UWH0|Q6UXC6|Q96IB1|Q96K61	Silent	SNP	ENST00000262424.5	hg19	CCDS10949.1																																																																																			.	.	.	none		0.597	CRISPLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269086.2	NM_031476	
NGFR	4804	hgsc.bcm.edu	37	17	47588006	47588006	+	Silent	SNP	G	G	T			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr17:47588006G>T	ENST00000172229.3	+	4	926	c.801G>T	c.(799-801)gtG>gtT	p.V267V	RP5-1029K10.2_ENST00000514506.1_RNA|NGFR_ENST00000504201.1_Silent_p.V173V	NM_002507.3	NP_002498.1	P08138	TNR16_HUMAN	nerve growth factor receptor	267					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|detection of temperature stimulus (GO:0016048)|glucose homeostasis (GO:0042593)|hair follicle morphogenesis (GO:0031069)|intracellular protein transport (GO:0006886)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell cycle (GO:0045786)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of hair follicle development (GO:0051799)|nerve development (GO:0021675)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of axonogenesis (GO:0050772)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of odontogenesis of dentin-containing tooth (GO:0042488)|regulation of axonogenesis (GO:0050770)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cell surface (GO:0009986)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	death receptor activity (GO:0005035)|Rab GTPase binding (GO:0017137)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)	17	all_cancers(4;1.45e-13)|Breast(4;6.34e-28)|all_epithelial(4;4.95e-17)					TGGGCCTTGTGGCCTACATAG	0.577																																					p.V267V		Atlas-SNP	.											.	NGFR	46	.	0			c.G801T						PASS	.						112.0	101.0	105.0					17																	47588006		2203	4300	6503	SO:0001819	synonymous_variant	4804	exon4			CCTTGTGGCCTAC	M14764	CCDS11549.1	17q21-q22	2013-05-22	2010-04-28		ENSG00000064300	ENSG00000064300		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	7809	protein-coding gene	gene with protein product	"""low affinity nerve growth factor receptor"", ""TNFR superfamily, member 16"""	162010	"""nerve growth factor receptor (TNFR superfamily, member 16)"""			3022937, 3006050	Standard	NM_002507		Approved	TNFRSF16, CD271, p75NTR	uc002ioz.4	P08138	OTTHUMG00000161495	ENST00000172229.3:c.801G>T	chr17.hg19:g.47588006G>T		205.0	0.0	.		333.0	56.0	.	NM_002507	B2R961|B4E096	Silent	SNP	ENST00000172229.3	hg19	CCDS11549.1																																																																																			.	.	.	none		0.577	NGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365150.1		
HRC	3270	hgsc.bcm.edu	37	19	49657602	49657602	+	Missense_Mutation	SNP	C	C	T	rs146437807		TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr19:49657602C>T	ENST00000252825.4	-	1	1079	c.893G>A	c.(892-894)cGa>cAa	p.R298Q	HRC_ENST00000595625.1_Missense_Mutation_p.R298Q	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	298	4 X tandem repeats, acidic.|6 X approximate tandem repeats.				cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		TTCATGGCTTCGGTGCCTGTG	0.527																																					p.R298Q	Melanoma(37;75 1097 24567 25669 30645)	Atlas-SNP	.											.	HRC	85	.	0			c.G893A						PASS	.						155.0	124.0	134.0					19																	49657602		2203	4300	6503	SO:0001583	missense	3270	exon1			TGGCTTCGGTGCC		CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.893G>A	chr19.hg19:g.49657602C>T	ENSP00000252825:p.Arg298Gln	95.0	0.0	.		164.0	88.0	.	NM_002152	Q504Y6	Missense_Mutation	SNP	ENST00000252825.4	hg19	CCDS12759.1	.	.	.	.	.	.	.	.	.	.	C	8.156	0.788501	0.16258	.	.	ENSG00000130528	ENST00000252825;ENST00000434964	T	0.27890	1.64	3.12	-4.41	0.03590	.	.	.	.	.	T	0.13543	0.0328	N	0.16307	0.4	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.40098	-0.9581	9	0.07990	T	0.79	-0.3586	8.5526	0.33460	0.0:0.435:0.0:0.565	.	298	P23327	SRCH_HUMAN	Q	298;268	ENSP00000252825:R298Q	ENSP00000252825:R298Q	R	-	2	0	HRC	54349414	0.000000	0.05858	0.007000	0.13788	0.005000	0.04900	-4.228000	0.00270	-0.724000	0.04908	-0.368000	0.07277	CGA	.	.	.	weak		0.527	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465649.1	NM_002152	
MAOB	4129	hgsc.bcm.edu	37	X	43655071	43655071	+	Missense_Mutation	SNP	C	C	A	rs143144504		TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chrX:43655071C>A	ENST00000378069.4	-	7	830	c.683G>T	c.(682-684)cGa>cTa	p.R228L	MAOB_ENST00000536181.1_Missense_Mutation_p.R212L|MAOB_ENST00000538942.1_Missense_Mutation_p.R212L|MAOB_ENST00000487544.1_5'Flank	NM_000898.4	NP_000889.3	P27338	AOFB_HUMAN	monoamine oxidase B	228					negative regulation of serotonin secretion (GO:0014063)|positive regulation of dopamine metabolic process (GO:0045964)|response to aluminum ion (GO:0010044)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|primary amine oxidase activity (GO:0008131)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(2)|skin(5)	21					Amantadine(DB00915)|Amphetamine(DB00182)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Procaine(DB00721)|Rasagiline(DB01367)|Selegiline(DB01037)|Sertraline(DB01104)|Tranylcypromine(DB00752)|Zonisamide(DB00909)	CAGCTTCACTCGGTCTCCAAG	0.478																																					p.R228L		Atlas-SNP	.											.	MAOB	52	.	0			c.G683T						PASS	.						152.0	126.0	135.0					X																	43655071		2203	4300	6503	SO:0001583	missense	4129	exon7			TTCACTCGGTCTC		CCDS14261.1	Xp11.4-p11.3	2008-02-05			ENSG00000069535	ENSG00000069535	1.4.3.4		6834	protein-coding gene	gene with protein product		309860					Standard	NM_000898		Approved		uc004dfz.4	P27338	OTTHUMG00000021388	ENST00000378069.4:c.683G>T	chrX.hg19:g.43655071C>A	ENSP00000367309:p.Arg228Leu	103.0	0.0	.		117.0	6.0	.	NM_000898	B2R6R3|B7Z5H3|D3DWC3|Q7Z6S2	Missense_Mutation	SNP	ENST00000378069.4	hg19	CCDS14261.1	.	.	.	.	.	.	.	.	.	.	C	14.05	2.420375	0.42918	.	.	ENSG00000069535	ENST00000378069;ENST00000536181;ENST00000538942	T;T;T	0.10477	2.87;2.87;2.87	5.29	3.53	0.40419	Amine oxidase (1);	0.127637	0.53938	D	0.000045	T	0.16171	0.0389	M	0.84683	2.71	0.58432	D	0.999996	B;B	0.23316	0.083;0.007	B;B	0.25140	0.058;0.037	T	0.01810	-1.1269	10	0.40728	T	0.16	-3.8481	7.0564	0.25102	0.1391:0.7088:0.0:0.1521	.	212;228	B7Z5H3;P27338	.;AOFB_HUMAN	L	228;212;212	ENSP00000367309:R228L;ENSP00000441613:R212L;ENSP00000442240:R212L	ENSP00000367309:R228L	R	-	2	0	MAOB	43540015	0.561000	0.26578	0.751000	0.31187	0.638000	0.38207	1.705000	0.37867	0.550000	0.28991	0.529000	0.55759	CGA	.	C|1.000;T|0.000	.	alt		0.478	MAOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056303.1	NM_000898	
EPG5	57724	hgsc.bcm.edu	37	18	43514887	43514888	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr18:43514887_43514888insA	ENST00000282041.5	-	11	2178_2179	c.2144_2145insT	c.(2143-2145)ctgfs	p.L715fs		NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	715					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						TTTGCACAGACAGAGTCCCAAA	0.495																																					p.L715fs		Atlas-INDEL	.											.	EPG5	199	.	0			c.2145_2146insT						PASS	.																																			SO:0001589	frameshift_variant	57724	exon11			.	AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.2145dupT	chr18.hg19:g.43514888_43514888dupA	ENSP00000282041:p.Leu715fs	123.0	0.0	0		151.0	34.0	0.225166	NM_020964	A2BDF3|Q9H8C8	Frame_Shift_Ins	INS	ENST00000282041.5	hg19	CCDS11926.2																																																																																			.	.	.	none		0.495	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445081.1	NM_020964	
HAVCR1	26762	hgsc.bcm.edu	37	5	156482352	156482362	+	Frame_Shift_Del	DEL	AATAGCTTATA	AATAGCTTATA	-	rs111358310	byFrequency	TCGA-AL-3466-01A-01D-1252-08	TCGA-AL-3466-10A-01D-1252-08	AATAGCTTATA	AATAGCTTATA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75de0b05-e8e7-4591-99ef-c50d0772ca3b	656d840f-c095-487f-9c3a-712f21c7cdc8	g.chr5:156482352_156482362delAATAGCTTATA	ENST00000339252.3	-	2	761_771	c.229_239delTATAAGCTATT	c.(229-240)tataagctattgfs	p.YKLL77fs	HAVCR1_ENST00000523175.1_Frame_Shift_Del_p.YKLL77fs|HAVCR1_ENST00000544197.1_Frame_Shift_Del_p.YKLL77fs|HAVCR1_ENST00000522693.1_Frame_Shift_Del_p.YKLL77fs|HAVCR1_ENST00000425854.1_Frame_Shift_Del_p.YKLL77fs	NM_012206.2	NP_036338.2	Q96D42	HAVR1_HUMAN	hepatitis A virus cellular receptor 1	0	Ig-like V-type.				viral process (GO:0016032)	integral component of membrane (GO:0016021)	virus receptor activity (GO:0001618)			endometrium(3)|large_intestine(2)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AAGGTCCCCCAATAGCTTATAGCGTGTGTCC	0.479																																					p.77_80del		Atlas-INDEL	.											.	HAVCR1	84	.	0			c.230_240del						PASS	.																																			SO:0001589	frameshift_variant	26762	exon3			.	AF043724	CCDS43392.1	5q33.2	2014-01-14			ENSG00000113249	ENSG00000113249		"""Immunoglobulin superfamily / V-set domain containing"""	17866	protein-coding gene	gene with protein product	"""T-cell immunoglobulin mucin family member 1"""	606518				9658108, 11725301	Standard	NM_012206		Approved	HAVCR-1, TIM-1, TIM1, HAVCR, TIMD1	uc021ygj.1	Q96D42	OTTHUMG00000163466	ENST00000339252.3:c.229_239delTATAAGCTATT	chr5.hg19:g.156482352_156482362delAATAGCTTATA	ENSP00000344844:p.Tyr77fs	128.0	0.0	0		271.0	52.0	0.191882	NM_001099414	O43656	Frame_Shift_Del	DEL	ENST00000339252.3	hg19	CCDS43392.1																																																																																			.	.	.	none		0.479	HAVCR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373698.1		
