#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ADAM15	8751	hgsc.bcm.edu	37	1	155032387	155032387	+	Missense_Mutation	SNP	A	A	T			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr1:155032387A>T	ENST00000356955.2	+	17	2106	c.2005A>T	c.(2005-2007)Agc>Tgc	p.S669C	ADAM15_ENST00000359280.4_Missense_Mutation_p.S669C|ADAM15_ENST00000449910.2_Missense_Mutation_p.S669C|ADAM15_ENST00000360674.4_Missense_Mutation_p.S669C|ADAM15_ENST00000368410.2_Missense_Mutation_p.S375C|ADAM15_ENST00000355956.2_Missense_Mutation_p.S669C|ADAM15_ENST00000531455.1_Missense_Mutation_p.S679C|ADAM15_ENST00000368412.3_Missense_Mutation_p.S669C|ADAM15_ENST00000472434.1_3'UTR|ADAM15_ENST00000368413.1_Missense_Mutation_p.S375C|ADAM15_ENST00000271836.6_Missense_Mutation_p.S669C	NM_207197.2	NP_997080.1	Q13444	ADA15_HUMAN	ADAM metallopeptidase domain 15	669	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.				angiogenesis (GO:0001525)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of receptor binding (GO:1900121)|protein kinase C signaling (GO:0070528)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(5)|urinary_tract(1)	39	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			GGTCTGTGACAGCAACAGGCA	0.557																																					p.S679C		Atlas-SNP	.											.	ADAM15	92	.	0			c.A2035T						PASS	.						143.0	141.0	142.0					1																	155032387		2203	4300	6503	SO:0001583	missense	8751	exon17			TGTGACAGCAACA	U46005	CCDS1084.1, CCDS1085.1, CCDS1086.1, CCDS1087.1, CCDS1088.1, CCDS44236.1, CCDS58031.1, CCDS58032.1, CCDS60282.1	1q21.3	2008-02-05	2007-06-04		ENSG00000143537	ENSG00000143537		"""ADAM metallopeptidase domain containing"""	193	protein-coding gene	gene with protein product	"""metargidin"""	605548	"""a disintegrin and metalloproteinase domain 15 (metargidin)"""			9516430	Standard	NM_003815		Approved	MDC15	uc001fgr.2	Q13444	OTTHUMG00000013898	ENST00000356955.2:c.2005A>T	chr1.hg19:g.155032387A>T	ENSP00000349436:p.Ser669Cys	406.0	0.0	.		458.0	179.0	.	NM_001261464	B3KQU5|B4DLB5|B4DMH8|E9PN65|Q13493|Q53XQ0|Q5SR68|Q5SR69|Q6R267|Q71S61|Q71S62|Q71S63|Q71S64|Q71S65|Q71S66|Q71S67|Q71S68|Q71S69|Q96C78|U3KQL5	Missense_Mutation	SNP	ENST00000356955.2	hg19	CCDS1087.1	.	.	.	.	.	.	.	.	.	.	A	25.6	4.657238	0.88154	.	.	ENSG00000143537	ENST00000356955;ENST00000449910;ENST00000359280;ENST00000360674;ENST00000368412;ENST00000355956;ENST00000368410;ENST00000271836;ENST00000368413;ENST00000531455	D;D;D;D;D;D;D;D;D;D	0.88741	-2.42;-2.42;-2.42;-2.42;-2.42;-2.42;-2.42;-2.42;-2.42;-2.42	5.55	5.55	0.83447	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.53938	D	0.000051	D	0.94798	0.8320	M	0.91717	3.235	0.80722	D	1	D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;0.999;1.0;1.0;1.0;0.998;0.999;1.0	D;D;D;D;D;D;D;D;D;D	0.85130	0.986;0.971;0.981;0.969;0.994;0.994;0.997;0.967;0.989;0.986	D	0.95706	0.8753	10	0.87932	D	0	.	13.6954	0.62575	1.0:0.0:0.0:0.0	.	679;686;669;669;669;669;669;669;669;666	E9PN65;B7Z390;Q13444-10;Q13444-2;Q13444-4;Q13444-5;Q13444-3;Q13444-9;Q13444;Q59GF2	.;.;.;.;.;.;.;.;ADA15_HUMAN;.	C	669;669;669;669;669;669;375;669;375;679	ENSP00000349436:S669C;ENSP00000403843:S669C;ENSP00000352226:S669C;ENSP00000353892:S669C;ENSP00000357397:S669C;ENSP00000348227:S669C;ENSP00000357395:S375C;ENSP00000271836:S669C;ENSP00000357398:S375C;ENSP00000432927:S679C	ENSP00000271836:S669C	S	+	1	0	ADAM15	153299011	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.114000	0.89570	2.333000	0.79357	0.533000	0.62120	AGC	.	.	.	none		0.557	ADAM15-019	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387168.1	NM_003815	
ASH1L	55870	hgsc.bcm.edu	37	1	155408153	155408153	+	Silent	SNP	T	T	A	rs369367522		TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr1:155408153T>A	ENST00000368346.3	-	5	6432	c.5793A>T	c.(5791-5793)ccA>ccT	p.P1931P	ASH1L_ENST00000392403.3_Silent_p.P1931P			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	1931					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			CCTCTGGTAATGGCTTCTGCT	0.363																																					p.P1931P		Atlas-SNP	.											.	ASH1L	279	.	0			c.A5793T						PASS	.						145.0	142.0	143.0					1																	155408153		2203	4300	6503	SO:0001819	synonymous_variant	55870	exon5			TGGTAATGGCTTC	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.5793A>T	chr1.hg19:g.155408153T>A		331.0	0.0	.		228.0	76.0	.	NM_018489	Q59GP1|Q5T714|Q5T715|Q9P2C7	Silent	SNP	ENST00000368346.3	hg19																																																																																				.	.	.	none		0.363	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489	
ISG20L2	81875	hgsc.bcm.edu	37	1	156693972	156693972	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr1:156693972G>A	ENST00000313146.6	-	2	1698	c.916C>T	c.(916-918)Ctc>Ttc	p.L306F	ISG20L2_ENST00000368219.1_Missense_Mutation_p.L306F|ISG20L2_ENST00000472824.2_5'UTR	NM_030980.1	NP_112242.1	Q9H9L3	I20L2_HUMAN	interferon stimulated exonuclease gene 20kDa-like 2	306	Exonuclease.				ribosome biogenesis (GO:0042254)	nucleus (GO:0005634)	exonuclease activity (GO:0004527)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	16	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TTCTTGGTGAGATGCTTCAGA	0.587																																					p.L306F		Atlas-SNP	.											.	ISG20L2	43	.	0			c.C916T						PASS	.						116.0	115.0	116.0					1																	156693972		2203	4300	6503	SO:0001583	missense	81875	exon2			TGGTGAGATGCTT	AK095697	CCDS1153.1	1q23.1	2013-10-11			ENSG00000143319	ENSG00000143319			25745	protein-coding gene	gene with protein product		611930				18065403	Standard	NM_030980		Approved	FLJ12671	uc001fps.1	Q9H9L3	OTTHUMG00000041301	ENST00000313146.6:c.916C>T	chr1.hg19:g.156693972G>A	ENSP00000323424:p.Leu306Phe	239.0	0.0	.		226.0	21.0	.	NM_030980	D3DVC6|Q64KA2	Missense_Mutation	SNP	ENST00000313146.6	hg19	CCDS1153.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.787888	0.90367	.	.	ENSG00000143319	ENST00000313146;ENST00000368219	T;T	0.34472	1.36;1.36	5.73	4.81	0.61882	Exonuclease (1);Exonuclease, RNase T/DNA polymerase III (1);Ribonuclease H-like (1);	0.146642	0.47093	D	0.000259	T	0.67618	0.2912	H	0.97291	3.975	0.58432	D	0.999995	D	0.76494	0.999	D	0.70227	0.968	T	0.78502	-0.2179	10	0.87932	D	0	-18.3136	13.9197	0.63923	0.0752:0.0:0.9248:0.0	.	306	Q9H9L3	I20L2_HUMAN	F	306	ENSP00000323424:L306F;ENSP00000357202:L306F	ENSP00000323424:L306F	L	-	1	0	ISG20L2	154960596	1.000000	0.71417	0.964000	0.40570	0.954000	0.61252	5.268000	0.65536	2.722000	0.93159	0.655000	0.94253	CTC	.	.	.	none		0.587	ISG20L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098969.1	NM_030980	
IGSF9	57549	hgsc.bcm.edu	37	1	159898194	159898194	+	Missense_Mutation	SNP	G	G	T	rs374964822	byFrequency	TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr1:159898194G>T	ENST00000368094.1	-	19	3181	c.2984C>A	c.(2983-2985)cCt>cAt	p.P995H	TAGLN2_ENST00000478033.1_5'Flank|TAGLN2_ENST00000368097.4_5'Flank|IGSF9_ENST00000361509.3_Missense_Mutation_p.P979H|IGSF9_ENST00000493195.1_5'UTR	NM_001135050.1	NP_001128522.1	Q9P2J2	TUTLA_HUMAN	immunoglobulin superfamily, member 9	995					dendrite development (GO:0016358)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(17)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_hematologic(112;0.0597)	Breast(1374;0.000126)	BRCA - Breast invasive adenocarcinoma(70;0.111)			GGCTGTGTAAGGGGGCTCTGC	0.647																																					p.P995H		Atlas-SNP	.											.	IGSF9	123	.	0			c.C2984A						PASS	.						12.0	14.0	13.0					1																	159898194		2189	4271	6460	SO:0001583	missense	57549	exon19			GTGTAAGGGGGCT	AB037776	CCDS1190.1, CCDS44254.1	1q22-q23	2013-02-11			ENSG00000085552	ENSG00000085552		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	18132	protein-coding gene	gene with protein product		609738				11991715	Standard	NM_020789		Approved	KIAA1355, Nrt1, IGSF9A	uc001fur.2	Q9P2J2	OTTHUMG00000022794	ENST00000368094.1:c.2984C>A	chr1.hg19:g.159898194G>T	ENSP00000357073:p.Pro995His	26.0	0.0	.		15.0	8.0	.	NM_001135050		Missense_Mutation	SNP	ENST00000368094.1	hg19	CCDS44254.1	.	.	.	.	.	.	.	.	.	.	g	8.178	0.793234	0.16327	.	.	ENSG00000085552	ENST00000361509;ENST00000368094;ENST00000198587	T;T	0.68181	-0.31;-0.23	4.21	2.34	0.29019	.	0.791526	0.10306	U	0.690564	T	0.32376	0.0827	N	0.19112	0.55	0.20873	N	0.999834	P;P	0.46327	0.876;0.876	B;B	0.43360	0.417;0.237	T	0.07046	-1.0793	9	.	.	.	-0.7754	8.3059	0.32042	0.1977:0.0:0.8023:0.0	.	995;533	Q9P2J2;C9JI81	TUTLA_HUMAN;.	H	979;995;533	ENSP00000355049:P979H;ENSP00000357073:P995H	.	P	-	2	0	IGSF9	158164818	0.440000	0.25618	0.583000	0.28640	0.038000	0.13279	1.608000	0.36847	0.426000	0.26116	-0.119000	0.15052	CCT	.	.	.	none		0.647	IGSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059115.1	NM_020789	
PROX1	5629	hgsc.bcm.edu	37	1	214178606	214178606	+	Silent	SNP	C	C	T	rs369204553	byFrequency	TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr1:214178606C>T	ENST00000366958.4	+	3	2432	c.1824C>T	c.(1822-1824)tcC>tcT	p.S608S	PROX1_ENST00000435016.1_Silent_p.S608S|PROX1_ENST00000261454.4_Silent_p.S608S|PROX1_ENST00000498508.2_Silent_p.S608S	NM_001270616.1	NP_001257545.1	Q92786	PROX1_HUMAN	prospero homeobox 1	608					aorta smooth muscle tissue morphogenesis (GO:0060414)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|brain development (GO:0007420)|cell fate determination (GO:0001709)|cerebellar granule cell differentiation (GO:0021707)|dentate gyrus development (GO:0021542)|dorsal spinal cord development (GO:0021516)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocardium formation (GO:0060214)|hepatocyte cell migration (GO:0002194)|hepatocyte differentiation (GO:0070365)|hepatocyte proliferation (GO:0072574)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lens fiber cell morphogenesis (GO:0070309)|liver development (GO:0001889)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of cell proliferation (GO:0008285)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|olfactory placode formation (GO:0030910)|optic placode formation involved in camera-type eye formation (GO:0046619)|otic placode formation (GO:0043049)|pancreas development (GO:0031016)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell cycle checkpoint (GO:1901978)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of forebrain neuron differentiation (GO:2000979)|positive regulation of heart growth (GO:0060421)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of gene expression (GO:0010468)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to nutrient levels (GO:0031667)|retina morphogenesis in camera-type eye (GO:0060042)|skeletal muscle thin filament assembly (GO:0030240)|venous blood vessel morphogenesis (GO:0048845)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DBD domain binding (GO:0050692)|DNA binding (GO:0003677)|LBD domain binding (GO:0050693)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)	p.S608S(2)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|prostate(2)|skin(4)	47				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		CCTACTTCTCCGACGTAAAGG	0.378													C|||	3	0.000599042	0.0	0.0	5008	,	,		20446	0.0		0.0	False		,,,				2504	0.0031				p.S608S		Atlas-SNP	.											PROX1,NS,carcinoma,0,2	PROX1	124	.	2	Substitution - coding silent(2)	prostate(1)|endometrium(1)	c.C1824T						PASS	.	C		1,4405	2.1+/-5.4	0,1,2202	96.0	94.0	94.0		1824	-7.2	0.9	1		94	0,8600		0,0,4300	no	coding-synonymous	PROX1	NM_002763.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		608/738	214178606	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	5629	exon3			CTTCTCCGACGTA	U44060	CCDS31021.1	1q41	2011-06-20	2007-06-01		ENSG00000117707	ENSG00000117707		"""Homeoboxes / PROS class"""	9459	protein-coding gene	gene with protein product		601546	"""prospero-related homeobox 1"""			8812486	Standard	NM_002763		Approved		uc001hkg.2	Q92786	OTTHUMG00000036946	ENST00000366958.4:c.1824C>T	chr1.hg19:g.214178606C>T		148.0	0.0	.		91.0	29.0	.	NM_001270616	A6NK29|A8K2B1|Q5SW76|Q8TB91	Silent	SNP	ENST00000366958.4	hg19	CCDS31021.1																																																																																			.	.	.	none		0.378	PROX1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089727.6	NM_002763	
BPNT1	10380	hgsc.bcm.edu	37	1	220232235	220232235	+	Missense_Mutation	SNP	T	T	C			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr1:220232235T>C	ENST00000469520.2	-	10	1327	c.878A>G	c.(877-879)tAc>tGc	p.Y293C	BPNT1_ENST00000544404.1_Missense_Mutation_p.Y238C|BPNT1_ENST00000414869.2_Missense_Mutation_p.Y257C|BPNT1_ENST00000354807.3_Intron|BPNT1_ENST00000322067.7_Missense_Mutation_p.Y293C			O95861	BPNT1_HUMAN	3'(2'), 5'-bisphosphate nucleotidase 1	293					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|dephosphorylation (GO:0016311)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|phosphatidylinositol phosphorylation (GO:0046854)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	3'(2'),5'-bisphosphate nucleotidase activity (GO:0008441)|inositol-1,4-bisphosphate 1-phosphatase activity (GO:0004441)|magnesium ion binding (GO:0000287)			breast(1)|endometrium(1)|large_intestine(1)|lung(9)|ovary(1)|skin(1)	14				GBM - Glioblastoma multiforme(131;0.0558)		GCTTGCATAGTAGTCATAATT	0.463																																					p.Y293C		Atlas-SNP	.											.	BPNT1	29	.	0			c.A878G						PASS	.						176.0	166.0	169.0					1																	220232235		1915	4149	6064	SO:0001583	missense	10380	exon9			GCATAGTAGTCAT	AF125042	CCDS41469.1, CCDS65787.1, CCDS65788.1	1q42	2008-02-05			ENSG00000162813	ENSG00000162813	3.1.3.7		1096	protein-coding gene	gene with protein product		604053				10224133	Standard	XM_005272998		Approved		uc001hma.3	O95861	OTTHUMG00000037435	ENST00000469520.2:c.878A>G	chr1.hg19:g.220232235T>C	ENSP00000446828:p.Tyr293Cys	383.0	0.0	.		268.0	74.0	.	NM_006085	A8K7C8|B4DPS5|B4DUS9|D3DTA9|Q8WVL5|Q9UGJ3	Missense_Mutation	SNP	ENST00000469520.2	hg19	CCDS41469.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.266127	0.80358	.	.	ENSG00000162813	ENST00000322067;ENST00000469520;ENST00000544404;ENST00000414869	T;T;T;T	0.50813	0.73;0.73;0.73;0.73	5.41	5.41	0.78517	.	.	.	.	.	T	0.65228	0.2671	M	0.67953	2.075	0.80722	D	1	P;D	0.67145	0.951;0.996	P;D	0.66602	0.886;0.945	T	0.65438	-0.6168	9	0.42905	T	0.14	.	15.7585	0.78058	0.0:0.0:0.0:1.0	.	257;293	B4DUS9;O95861	.;BPNT1_HUMAN	C	293;293;238;257	ENSP00000318852:Y293C;ENSP00000446828:Y293C;ENSP00000444398:Y238C;ENSP00000410348:Y257C	ENSP00000318852:Y293C	Y	-	2	0	BPNT1	218298858	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.164000	0.71885	2.191000	0.70037	0.528000	0.53228	TAC	.	.	.	none		0.463	BPNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091137.2	NM_006085	
PRKCE	5581	hgsc.bcm.edu	37	2	46372319	46372319	+	Silent	SNP	T	T	C			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr2:46372319T>C	ENST00000306156.3	+	12	2007	c.1680T>C	c.(1678-1680)aaT>aaC	p.N560N		NM_005400.2	NP_005391.1	Q02156	KPCE_HUMAN	protein kinase C, epsilon	560	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to ethanol (GO:0071361)|cellular response to hypoxia (GO:0071456)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|locomotory exploration behavior (GO:0035641)|macrophage activation involved in immune response (GO:0002281)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cellular glucuronidation (GO:2001031)|positive regulation of cytokinesis (GO:0032467)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of insulin secretion (GO:0032024)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|release of sequestered calcium ion into cytosol (GO:0051209)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|TRAM-dependent toll-like receptor 4 signaling pathway (GO:0035669)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|ethanol binding (GO:0035276)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|receptor activator activity (GO:0030546)|signal transducer activity (GO:0004871)		MBOAT2/PRKCE(2)	breast(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(13)|ovary(3)|upper_aerodigestive_tract(2)	34		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)		Tamoxifen(DB00675)	GGATTCTGAATGGTGTGACGA	0.537																																					p.N560N		Atlas-SNP	.											.	PRKCE	58	.	0			c.T1680C						PASS	.						176.0	173.0	174.0					2																	46372319		2114	4130	6244	SO:0001819	synonymous_variant	5581	exon12			TCTGAATGGTGTG		CCDS1824.1	2p21	2009-07-10			ENSG00000171132	ENSG00000171132	2.7.11.1		9401	protein-coding gene	gene with protein product		176975				1382605, 7877991	Standard	NM_005400		Approved		uc002rut.3	Q02156	OTTHUMG00000128817	ENST00000306156.3:c.1680T>C	chr2.hg19:g.46372319T>C		264.0	1.0	.		266.0	108.0	.	NM_005400	B0LPH7|Q32MQ3|Q53SL4|Q53SM5|Q9UE81	Silent	SNP	ENST00000306156.3	hg19	CCDS1824.1																																																																																			.	.	.	none		0.537	PRKCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250751.2		
DCTN1	1639	hgsc.bcm.edu	37	2	74589259	74589259	+	Missense_Mutation	SNP	G	G	C			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr2:74589259G>C	ENST00000361874.3	-	31	3936	c.3619C>G	c.(3619-3621)Ctc>Gtc	p.L1207V	DCTN1_ENST00000409567.3_Missense_Mutation_p.L1182V|DCTN1_ENST00000407639.2_Missense_Mutation_p.L1073V|RP11-287D1.3_ENST00000451608.2_Missense_Mutation_p.L120V|DCTN1_ENST00000409868.1_Missense_Mutation_p.L1185V|DCTN1_ENST00000394003.3_Missense_Mutation_p.L1200V|DCTN1_ENST00000409240.1_Missense_Mutation_p.L1165V|DCTN1_ENST00000409438.1_Missense_Mutation_p.L1068V	NM_004082.4	NP_004073.2	Q14203	DCTN1_HUMAN	dynactin 1	1207					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|microtubule-based transport (GO:0010970)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nervous system development (GO:0007399)	cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(1)|skin(3)	45						GTCTCCTTGAGGACCTCATCC	0.557																																					p.L1207V		Atlas-SNP	.											.	DCTN1	110	.	0			c.C3619G						PASS	.						99.0	81.0	87.0					2																	74589259		2203	4300	6503	SO:0001583	missense	1639	exon31			CCTTGAGGACCTC		CCDS1939.1, CCDS46341.1, CCDS46342.1, CCDS54368.1, CCDS54369.1	2p13	2014-09-17	2010-06-24		ENSG00000204843	ENSG00000204843			2711	protein-coding gene	gene with protein product	"""p150 glued homolog (Drosophila)"""	601143	"""dynactin 1 (p150, Glued (Drosophila) homolog)"""			1828535	Standard	NM_001190836		Approved		uc002skx.3	Q14203	OTTHUMG00000129963	ENST00000361874.3:c.3619C>G	chr2.hg19:g.74589259G>C	ENSP00000354791:p.Leu1207Val	89.0	0.0	.		80.0	41.0	.	NM_004082	A8MY36|B4DM45|E9PFS5|E9PGE1|G5E9H4|O95296|Q6IQ37|Q9BRM9|Q9UIU1|Q9UIU2	Missense_Mutation	SNP	ENST00000361874.3	hg19	CCDS1939.1	.	.	.	.	.	.	.	.	.	.	G	11.74	1.729642	0.30684	.	.	ENSG00000204843	ENST00000361874;ENST00000394003;ENST00000393999;ENST00000407639;ENST00000409438;ENST00000409240;ENST00000409868;ENST00000409567	T;T;T;T;T;T;T	0.77620	-0.7;-0.89;-0.7;-0.71;-1.11;-0.9;-0.89	5.24	3.05	0.35203	.	0.486591	0.15698	N	0.249059	T	0.53110	0.1776	N	0.08118	0	0.41825	D	0.990044	B;B;B;B;B;B;B	0.18968	0.009;0.0;0.003;0.032;0.022;0.006;0.025	B;B;B;B;B;B;B	0.21708	0.004;0.002;0.003;0.021;0.014;0.006;0.036	T	0.39014	-0.9634	10	0.15952	T	0.53	-0.2731	4.924	0.13883	0.1277:0.0:0.4745:0.3979	.	1182;1165;1207;1200;1073;1068;1190	E9PGE1;E9PFS5;Q14203;A8MY36;Q14203-2;G5E9H4;A8MWX9	.;.;DCTN1_HUMAN;.;.;.;.	V	1207;1200;1190;1073;1068;1165;1185;1182	ENSP00000354791:L1207V;ENSP00000377571:L1200V;ENSP00000384844:L1073V;ENSP00000387270:L1068V;ENSP00000386406:L1165V;ENSP00000387327:L1185V;ENSP00000386843:L1182V	ENSP00000354791:L1207V	L	-	1	0	DCTN1	74442767	0.998000	0.40836	1.000000	0.80357	0.966000	0.64601	2.517000	0.45529	1.057000	0.40506	0.491000	0.48974	CTC	.	.	.	none		0.557	DCTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252227.3	NM_004082	
RGPD3	653489	hgsc.bcm.edu	37	2	107049613	107049613	+	Silent	SNP	A	A	G			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr2:107049613A>G	ENST00000409886.3	-	16	2421	c.2334T>C	c.(2332-2334)caT>caC	p.H778H	RGPD3_ENST00000304514.7_Silent_p.H778H	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	778					protein targeting to Golgi (GO:0000042)			p.H778Q(2)		breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						ATGGTGTAGAATGTTTTATTT	0.353																																					p.H778H		Atlas-SNP	.											RGPD3_ENST00000304514,NS,carcinoma,0,2	RGPD3	316	.	2	Substitution - Missense(2)	lung(2)	c.T2334C						PASS	.						8.0	17.0	14.0					2																	107049613		632	1470	2102	SO:0001819	synonymous_variant	653489	exon16			TGTAGAATGTTTT		CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.2334T>C	chr2.hg19:g.107049613A>G		593.0	0.0	.		381.0	104.0	.	NM_001144013	B8ZZM4	Silent	SNP	ENST00000409886.3	hg19	CCDS46379.1																																																																																			.	.	.	none		0.353	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000329975.1	XM_929931	
DPP10	57628	hgsc.bcm.edu	37	2	116598392	116598392	+	Missense_Mutation	SNP	C	C	A	rs201639501		TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr2:116598392C>A	ENST00000410059.1	+	25	2729	c.2249C>A	c.(2248-2250)aCt>aAt	p.T750N	DPP10_ENST00000310323.8_Missense_Mutation_p.T743N|DPP10_ENST00000409163.1_Missense_Mutation_p.T700N|DPP10_ENST00000393147.2_Missense_Mutation_p.T754N	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	750						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						GTGAATTATACTATGCAGGTA	0.358																																					p.T754N		Atlas-SNP	.											.	DPP10	415	.	0			c.C2261A						PASS	.						96.0	94.0	94.0					2																	116598392		2203	4300	6503	SO:0001583	missense	57628	exon25			ATTATACTATGCA	AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.2249C>A	chr2.hg19:g.116598392C>A	ENSP00000386565:p.Thr750Asn	109.0	0.0	.		74.0	34.0	.	NM_001178034	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	ENST00000410059.1	hg19	CCDS46400.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.635056	0.87760	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393147;ENST00000310323	T;T;T;T	0.46451	0.87;0.87;0.87;0.87	5.99	5.99	0.97316	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);	0.056130	0.64402	D	0.000001	T	0.53883	0.1824	L	0.31294	0.92	0.54753	D	0.999989	D;D;D;D	0.67145	0.995;0.978;0.996;0.996	D;P;D;D	0.68621	0.931;0.832;0.959;0.959	T	0.44937	-0.9295	10	0.37606	T	0.19	-19.3701	19.4659	0.94939	0.0:1.0:0.0:0.0	.	743;754;746;750	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	N	750;700;754;743	ENSP00000386565:T750N;ENSP00000387038:T700N;ENSP00000376855:T754N;ENSP00000309066:T743N	ENSP00000309066:T743N	T	+	2	0	DPP10	116314862	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.723000	0.74742	2.840000	0.97914	0.655000	0.94253	ACT	.	C|0.999;G|0.001	.	alt		0.358	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868	
ITGB6	3694	hgsc.bcm.edu	37	2	160982928	160982928	+	Silent	SNP	T	T	C			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr2:160982928T>C	ENST00000283249.2	-	11	2082	c.1845A>G	c.(1843-1845)gaA>gaG	p.E615E	ITGB6_ENST00000409967.2_Intron|ITGB6_ENST00000428609.2_Silent_p.E573E|ITGB6_ENST00000409872.1_Silent_p.E615E	NM_001282353.1|NM_001282354.1|NM_001282388.1	NP_001269282.1|NP_001269283.1|NP_001269317.1	P18564	ITB6_HUMAN	integrin, beta 6	615	Cysteine-rich tandem repeats.				cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|multicellular organismal development (GO:0007275)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23						TAGGACATCGTTCACAGGTTG	0.502																																					p.E615E		Atlas-SNP	.											.	ITGB6	68	.	0			c.A1845G						PASS	.						97.0	85.0	89.0					2																	160982928		2203	4300	6503	SO:0001819	synonymous_variant	3694	exon11			ACATCGTTCACAG		CCDS2212.1, CCDS63040.1, CCDS74596.1, CCDS74597.1	2q24.2	2010-03-23			ENSG00000115221	ENSG00000115221		"""Integrins"""	6161	protein-coding gene	gene with protein product		147558				1729173, 8120056	Standard	NM_001282353		Approved		uc002ubh.2	P18564	OTTHUMG00000132026	ENST00000283249.2:c.1845A>G	chr2.hg19:g.160982928T>C		149.0	0.0	.		161.0	15.0	.	NM_000888	B2R9W5|C9JA97|Q0VA95|Q16500|Q53RG5|Q53RR6	Silent	SNP	ENST00000283249.2	hg19	CCDS2212.1																																																																																			.	.	.	none		0.502	ITGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255036.1	NM_000888	
ACADL	33	hgsc.bcm.edu	37	2	211081149	211081149	+	Missense_Mutation	SNP	T	T	C			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr2:211081149T>C	ENST00000233710.3	-	4	685	c.458A>G	c.(457-459)cAg>cGg	p.Q153R	AC006994.2_ENST00000412065.1_RNA	NM_001608.3	NP_001599.1	P28330	ACADL_HUMAN	acyl-CoA dehydrogenase, long chain	153					carnitine catabolic process (GO:0042413)|carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid catabolic process (GO:0044242)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|long-chain fatty acid catabolic process (GO:0042758)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of fatty acid oxidation (GO:0046322)|oxidation-reduction process (GO:0055114)|protein homotetramerization (GO:0051289)|regulation of cholesterol metabolic process (GO:0090181)|small molecule metabolic process (GO:0044281)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|fatty-acyl-CoA binding (GO:0000062)|flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)|palmitoyl-CoA oxidase activity (GO:0016401)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	14		Renal(323;0.202)		Epithelial(149;0.00631)|Lung(261;0.0438)|LUSC - Lung squamous cell carcinoma(261;0.0466)|all cancers(144;0.0621)		GTGCTTAATCTGTTCTTCTGA	0.383																																					p.Q153R		Atlas-SNP	.											.	ACADL	38	.	0			c.A458G						PASS	.						161.0	149.0	153.0					2																	211081149		2203	4300	6503	SO:0001583	missense	33	exon4			TTAATCTGTTCTT	M74096	CCDS2389.1	2q34	2012-07-13	2010-04-30		ENSG00000115361	ENSG00000115361	1.3.99.13		88	protein-coding gene	gene with protein product		609576	"""acyl-Coenzyme A dehydrogenase, long chain"""			1774065	Standard	NM_001608		Approved	LCAD, ACAD4	uc002vdz.4	P28330	OTTHUMG00000132989	ENST00000233710.3:c.458A>G	chr2.hg19:g.211081149T>C	ENSP00000233710:p.Gln153Arg	258.0	0.0	.		68.0	22.0	.	NM_001608	B2R8T3|Q8IUN8	Missense_Mutation	SNP	ENST00000233710.3	hg19	CCDS2389.1	.	.	.	.	.	.	.	.	.	.	T	25.7	4.667847	0.88348	.	.	ENSG00000115361	ENST00000233710	D	0.99869	-7.33	5.63	5.63	0.86233	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA dehydrogenase, N-terminal (1);Acyl-CoA dehydrogenase/oxidase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99921	0.9963	H	0.99026	4.405	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.96051	0.9031	10	0.72032	D	0.01	.	16.1307	0.81436	0.0:0.0:0.0:1.0	.	153	P28330	ACADL_HUMAN	R	153	ENSP00000233710:Q153R	ENSP00000233710:Q153R	Q	-	2	0	ACADL	210789394	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.422000	0.80217	2.263000	0.75096	0.533000	0.62120	CAG	.	.	.	none		0.383	ACADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256561.2	NM_001608	
BARD1	580	hgsc.bcm.edu	37	2	215593624	215593624	+	Missense_Mutation	SNP	T	T	G			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr2:215593624T>G	ENST00000260947.4	-	11	2244	c.2110A>C	c.(2110-2112)Agt>Cgt	p.S704R	BARD1_ENST00000432456.1_Missense_Mutation_p.S75R|BARD1_ENST00000449967.2_Silent_p.S558S	NM_000465.2|NM_001282543.1|NM_001282545.1|NM_001282548.1	NP_000456.2|NP_001269472.1|NP_001269474.1|NP_001269477.1	Q99728	BARD1_HUMAN	BRCA1 associated RING domain 1	704	BRCT 2. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|negative regulation of mRNA 3'-end processing (GO:0031441)|negative regulation of protein export from nucleus (GO:0046826)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein catabolic process (GO:0045732)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of phosphorylation (GO:0042325)|tissue homeostasis (GO:0001894)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	kinase binding (GO:0019900)|ligase activity (GO:0016874)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(14)|prostate(4)|upper_aerodigestive_tract(1)	35		Renal(323;0.0243)		Epithelial(149;3.2e-06)|all cancers(144;0.000461)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		GGCTTTCTACTGAGGATCTGG	0.493									Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																												p.S704R		Atlas-SNP	.											.	BARD1	138	.	0			c.A2110C						PASS	.						144.0	111.0	122.0					2																	215593624		2203	4300	6503	SO:0001583	missense	580	exon11	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	TTCTACTGAGGAT		CCDS2397.1, CCDS74645.1, CCDS74646.1, CCDS74647.1, CCDS74648.1	2q34-q35	2013-01-10			ENSG00000138376	ENSG00000138376		"""Ankyrin repeat domain containing"""	952	protein-coding gene	gene with protein product		601593				8944023, 9425226, 15159397	Standard	NM_001282548		Approved		uc002veu.2	Q99728	OTTHUMG00000133016	ENST00000260947.4:c.2110A>C	chr2.hg19:g.215593624T>G	ENSP00000260947:p.Ser704Arg	107.0	0.0	.		59.0	36.0	.	NM_000465	F6MDH7|F6MDH8|F6MDH9|O43574|Q53SS5	Missense_Mutation	SNP	ENST00000260947.4	hg19	CCDS2397.1	.	.	.	.	.	.	.	.	.	.	T	12.86	2.064962	0.36470	.	.	ENSG00000138376	ENST00000260947;ENST00000432456	T;T	0.73363	-0.74;1.95	5.81	5.81	0.92471	BRCT (3);	0.268513	0.40908	N	0.000992	T	0.60431	0.2268	L	0.36672	1.1	0.80722	D	1	B	0.15930	0.015	B	0.09377	0.004	T	0.56269	-0.8007	10	0.25106	T	0.35	-7.0699	6.3187	0.21204	0.1431:0.0794:0.0:0.7775	.	704	Q99728	BARD1_HUMAN	R	704;75	ENSP00000260947:S704R;ENSP00000405020:S75R	ENSP00000260947:S704R	S	-	1	0	BARD1	215301869	0.102000	0.21896	0.975000	0.42487	0.984000	0.73092	0.357000	0.20199	2.217000	0.71921	0.482000	0.46254	AGT	.	.	.	none		0.493	BARD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256602.1	NM_000465	
STK25	10494	hgsc.bcm.edu	37	2	242437690	242437690	+	Missense_Mutation	SNP	C	C	A			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr2:242437690C>A	ENST00000316586.4	-	9	1341	c.992G>T	c.(991-993)aGc>aTc	p.S331I	STK25_ENST00000405585.1_Missense_Mutation_p.S254I|STK25_ENST00000478403.1_5'UTR|STK25_ENST00000405883.3_Missense_Mutation_p.S254I|STK25_ENST00000543554.1_Missense_Mutation_p.S237I|STK25_ENST00000403346.3_Missense_Mutation_p.S331I|STK25_ENST00000535007.1_Missense_Mutation_p.S237I|STK25_ENST00000401869.1_Missense_Mutation_p.S331I	NM_001271977.1|NM_001271978.1|NM_001282308.1	NP_001258906.1|NP_001258907.1|NP_001269237.1	O00506	STK25_HUMAN	serine/threonine kinase 25	331					establishment or maintenance of cell polarity (GO:0007163)|Golgi localization (GO:0051645)|positive regulation of axonogenesis (GO:0050772)|response to oxidative stress (GO:0006979)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|kidney(1)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	10		all_cancers(19;2.09e-34)|all_epithelial(40;2.09e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Ovarian(221;0.069)|Lung NSC(271;0.0886)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.2)		Epithelial(32;8.24e-34)|all cancers(36;3.46e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.6e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.1e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0839)		GTGAAGCTTGCTGTGTGGACT	0.652																																					p.S331I	NSCLC(99;1100 1566 7679 28647 48345)	Atlas-SNP	.											.	STK25	32	.	0			c.G992T						PASS	.						152.0	134.0	140.0					2																	242437690		2203	4300	6503	SO:0001583	missense	10494	exon9			AGCTTGCTGTGTG	D63780	CCDS2549.1, CCDS63199.1, CCDS63200.1	2q37.3	2010-06-25	2010-06-25		ENSG00000115694	ENSG00000115694			11404	protein-coding gene	gene with protein product		602255	"""serine/threonine kinase 25 (Ste20, yeast homolog)"""			8887545, 9160885, 15037601	Standard	NM_001271977		Approved	SOK1, YSK1	uc002wbp.4	O00506	OTTHUMG00000133408	ENST00000316586.4:c.992G>T	chr2.hg19:g.242437690C>A	ENSP00000325748:p.Ser331Ile	228.0	0.0	.		237.0	10.0	.	NM_006374	A8K6Z3|A8K7D2|B7Z9K1|Q15522|Q5BJF1	Missense_Mutation	SNP	ENST00000316586.4	hg19	CCDS2549.1	.	.	.	.	.	.	.	.	.	.	C	13.08	2.130649	0.37630	.	.	ENSG00000115694	ENST00000316586;ENST00000403346;ENST00000401869;ENST00000405883;ENST00000545437;ENST00000405585;ENST00000543554;ENST00000535007	T;T;T;T;T;T;T	0.36520	1.25;1.25;1.25;1.25;1.25;1.25;1.25	4.97	2.17	0.27698	.	0.191571	0.56097	D	0.000038	T	0.23370	0.0565	L	0.29908	0.895	0.48236	D	0.99961	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.06405	0.002;0.002;0.001	T	0.05131	-1.0904	10	0.41790	T	0.15	.	7.7734	0.29021	0.0:0.6788:0.0:0.3212	.	257;254;331	B4DVS7;A8K6Z3;O00506	.;.;STK25_HUMAN	I	331;331;331;254;237;254;237;237	ENSP00000325748:S331I;ENSP00000384162:S331I;ENSP00000385687:S331I;ENSP00000384444:S254I;ENSP00000385541:S254I;ENSP00000444886:S237I;ENSP00000446008:S237I	ENSP00000325748:S331I	S	-	2	0	STK25	242086363	1.000000	0.71417	0.996000	0.52242	0.991000	0.79684	0.472000	0.22116	0.629000	0.30376	0.561000	0.74099	AGC	.	.	.	none		0.652	STK25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257265.4	NM_006374	
BHLHE40	8553	hgsc.bcm.edu	37	3	5024904	5024904	+	Missense_Mutation	SNP	A	A	T			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr3:5024904A>T	ENST00000256495.3	+	5	1369	c.766A>T	c.(766-768)Agt>Tgt	p.S256C		NM_003670.2	NP_003661.1	O14503	BHE40_HUMAN	basic helix-loop-helix family, member e40	256					circadian regulation of gene expression (GO:0032922)|entrainment of circadian clock by photoperiod (GO:0043153)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|MRF binding (GO:0043426)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(2)	12						CGACTTGCGCAGTGAGCAGCC	0.572																																					p.S256C		Atlas-SNP	.											.	BHLHE40	35	.	0			c.A766T						PASS	.						69.0	64.0	66.0					3																	5024904		2203	4300	6503	SO:0001583	missense	8553	exon5			TTGCGCAGTGAGC	AB004066	CCDS2565.1	3p26	2009-01-12	2009-01-12	2009-01-12	ENSG00000134107	ENSG00000134107		"""Basic helix-loop-helix proteins"""	1046	protein-coding gene	gene with protein product	"""differentially expressed in chondrocytes 1"", "" differentiated embryo chondrocyte expressed gene 1"""	604256	"""basic helix-loop-helix domain containing, class B, 2"""	STRA13, BHLHB2		9240428, 10449910, 18557763	Standard	NM_003670		Approved	DEC1, bHLHe40	uc003bqf.3	O14503	OTTHUMG00000119035	ENST00000256495.3:c.766A>T	chr3.hg19:g.5024904A>T	ENSP00000256495:p.Ser256Cys	98.0	0.0	.		146.0	92.0	.	NM_003670	Q96TD3	Missense_Mutation	SNP	ENST00000256495.3	hg19	CCDS2565.1	.	.	.	.	.	.	.	.	.	.	A	6.428	0.447160	0.12223	.	.	ENSG00000134107	ENST00000256495	T	0.65364	-0.15	5.2	-2.51	0.06365	.	1.437920	0.04279	N	0.343497	T	0.49047	0.1534	L	0.34521	1.04	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.41502	-0.9505	10	0.62326	D	0.03	.	6.2929	0.21069	0.1557:0.0922:0.6603:0.0918	.	256	O14503	BHE40_HUMAN	C	256	ENSP00000256495:S256C	ENSP00000256495:S256C	S	+	1	0	BHLHE40	4999904	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	0.454000	0.21827	-0.536000	0.06298	-0.290000	0.09829	AGT	.	.	.	none		0.572	BHLHE40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239244.2	NM_003670	
SLC6A6	6533	hgsc.bcm.edu	37	3	14508150	14508150	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr3:14508150G>A	ENST00000454876.2	+	7	1188	c.859G>A	c.(859-861)Gac>Aac	p.D287N	SLC6A6_ENST00000360861.3_Missense_Mutation_p.D287N			P31641	SC6A6_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 6	287					amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|taurine transport (GO:0015734)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|taurine binding (GO:0030977)|taurine:sodium symporter activity (GO:0005369)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(2)	28						CCGCCTTGAGGACCCACAGGT	0.642																																					p.D287N		Atlas-SNP	.											.	SLC6A6	58	.	0			c.G859A						PASS	.						60.0	56.0	57.0					3																	14508150		2203	4300	6503	SO:0001583	missense	6533	exon7			CTTGAGGACCCAC		CCDS33705.1, CCDS46765.1	3p25.1	2013-07-19	2013-07-19		ENSG00000131389	ENSG00000131389		"""Solute carriers"""	11052	protein-coding gene	gene with protein product	"""taurine transporter"""	186854	"""solute carrier family 6 (neurotransmitter transporter, taurine), member 6"""			8010975, 8382624	Standard	XM_006713307		Approved	TAUT	uc010heg.4	P31641	OTTHUMG00000155525	ENST00000454876.2:c.859G>A	chr3.hg19:g.14508150G>A	ENSP00000398063:p.Asp287Asn	121.0	0.0	.		191.0	115.0	.	NM_003043	B2RNU7|Q9BRI2|Q9BXB0	Missense_Mutation	SNP	ENST00000454876.2	hg19	CCDS33705.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.616123	0.87359	.	.	ENSG00000131389	ENST00000454876;ENST00000360861	T;T	0.74526	-0.85;-0.85	4.55	4.55	0.56014	.	0.047664	0.85682	D	0.000000	T	0.76709	0.4025	L	0.42487	1.325	0.80722	D	1	P	0.44044	0.825	P	0.50934	0.654	T	0.77264	-0.2652	10	0.42905	T	0.14	.	17.6676	0.88207	0.0:0.0:1.0:0.0	.	287	P31641	SC6A6_HUMAN	N	287	ENSP00000398063:D287N;ENSP00000354107:D287N	ENSP00000354107:D287N	D	+	1	0	SLC6A6	14483154	1.000000	0.71417	0.994000	0.49952	0.928000	0.56348	7.696000	0.84270	2.241000	0.73720	0.491000	0.48974	GAC	.	.	.	none		0.642	SLC6A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340507.1	NM_003043	
BAP1	8314	hgsc.bcm.edu	37	3	52441417	52441417	+	Silent	SNP	G	G	C			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr3:52441417G>C	ENST00000460680.1	-	6	906	c.435C>G	c.(433-435)gcC>gcG	p.A145A	BAP1_ENST00000296288.5_Silent_p.A145A	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0	Interaction with HIP2.				anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		CCACACACCTGGCATGGCTAT	0.547			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.A145A	GBM(101;493 1458 7992 21037 25532)	Atlas-SNP	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	.	BAP1	371	.	0			c.C435G						PASS	.						88.0	92.0	91.0					3																	52441417		2203	4300	6503	SO:0001819	synonymous_variant	8314	exon6			ACACCTGGCATGG	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.435C>G	chr3.hg19:g.52441417G>C		191.0	0.0	.		235.0	68.0	.	NM_004656	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Silent	SNP	ENST00000460680.1	hg19	CCDS2853.1																																																																																			.	.	.	none		0.547	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		
PDZRN3	23024	hgsc.bcm.edu	37	3	73432828	73432828	+	Silent	SNP	C	C	T			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr3:73432828C>T	ENST00000263666.4	-	10	3003	c.2889G>A	c.(2887-2889)gcG>gcA	p.A963A	PDZRN3_ENST00000466780.1_Silent_p.A620A|PDZRN3_ENST00000462146.2_Silent_p.A620A|PDZRN3_ENST00000466348.1_5'Flank|PDZRN3_ENST00000479530.1_Silent_p.A680A|PDZRN3_ENST00000535920.1_Silent_p.A685A	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	963					neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A963A(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		TCTCGCTCACCGCGTCGTCGT	0.672																																					p.A963A		Atlas-SNP	.											PDZRN3,rectum,carcinoma,0,2	PDZRN3	196	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2889A						PASS	.						75.0	72.0	73.0					3																	73432828		2203	4300	6503	SO:0001819	synonymous_variant	23024	exon10			GCTCACCGCGTCG	AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.2889G>A	chr3.hg19:g.73432828C>T		147.0	0.0	.		278.0	79.0	.	NM_015009	A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Silent	SNP	ENST00000263666.4	hg19	CCDS33789.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	5.192|5.192	0.220967|0.220967	0.09863|0.09863	.|.	.|.	ENSG00000121440|ENSG00000121440	ENST00000416926|ENST00000494559	.|.	.|.	.|.	5.21|5.21	-1.55|-1.55	0.08558|0.08558	.|.	.|.	.|.	.|.	.|.	T|T	0.80149|0.80149	0.4570|0.4570	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.78157|0.78157	-0.2313|-0.2313	5|4	0.09590|.	T|.	0.72|.	.|.	25.5553|25.5553	0.99994|0.99994	0.0:0.1209:0.8791:0.0|0.0:0.1209:0.8791:0.0	.|.	.|.	.|.	.|.	S|Q	683|279	.|.	ENSP00000392657:G683S|.	G|R	-|-	1|2	0|0	PDZRN3|PDZRN3	73515518|73515518	0.370000|0.370000	0.25047|0.25047	0.008000|0.008000	0.14137|0.14137	0.813000|0.813000	0.45954|0.45954	-0.257000|-0.257000	0.08745|0.08745	-0.749000|-0.749000	0.04747|0.04747	0.563000|0.563000	0.77884|0.77884	GGT|CGG	.	.	.	none		0.672	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352460.1	XM_041363	
SLC2A2	6514	hgsc.bcm.edu	37	3	170732492	170732492	+	Missense_Mutation	SNP	A	A	G			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr3:170732492A>G	ENST00000314251.3	-	3	216	c.137T>C	c.(136-138)tTg>tCg	p.L46S	SLC2A2_ENST00000382808.4_Intron	NM_000340.1	NP_000331.1	P11168	GTR2_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 2	46					carbohydrate metabolic process (GO:0005975)|endocrine pancreas development (GO:0031018)|energy reserve metabolic process (GO:0006112)|glucose transport (GO:0015758)|hexose transmembrane transport (GO:0035428)|hexose transport (GO:0008645)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	brush border (GO:0005903)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	D-glucose transmembrane transporter activity (GO:0055056)|dehydroascorbic acid transporter activity (GO:0033300)|glucose transmembrane transporter activity (GO:0005355)|hexose transmembrane transporter activity (GO:0015149)			central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(22;1.41e-19)|all_lung(20;1.59e-15)|Lung NSC(18;7.08e-15)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;1.1e-14)|Lung(28;2.99e-14)		Streptozocin(DB00428)	TGGAACACCCAAAACATGTCT	0.333																																					p.L46S		Atlas-SNP	.											.	SLC2A2	71	.	0			c.T137C	GRCh37	CD972446	SLC2A2	D		PASS	.						124.0	124.0	124.0					3																	170732492		2203	4300	6503	SO:0001583	missense	6514	exon3			ACACCCAAAACAT	J03810	CCDS3215.1	3q26.2-q27	2013-05-22			ENSG00000163581	ENSG00000163581		"""Solute carriers"""	11006	protein-coding gene	gene with protein product		138160		GLUT2		1852621	Standard	NM_000340		Approved		uc003fhe.1	P11168	OTTHUMG00000158997	ENST00000314251.3:c.137T>C	chr3.hg19:g.170732492A>G	ENSP00000323568:p.Leu46Ser	238.0	0.0	.		201.0	53.0	.	NM_000340	A8K481|B2R936|B7Z547|F8W8V8|Q9UCW9	Missense_Mutation	SNP	ENST00000314251.3	hg19	CCDS3215.1	.	.	.	.	.	.	.	.	.	.	A	16.72	3.200977	0.58234	.	.	ENSG00000163581	ENST00000314251	D	0.84589	-1.87	5.84	5.84	0.93424	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.207774	0.41500	D	0.000861	D	0.88768	0.6526	M	0.89840	3.065	0.80722	D	1	P	0.37423	0.594	B	0.40982	0.345	D	0.87926	0.2707	10	0.30854	T	0.27	.	14.4575	0.67425	1.0:0.0:0.0:0.0	.	46	P11168	GTR2_HUMAN	S	46	ENSP00000323568:L46S	ENSP00000323568:L46S	L	-	2	0	SLC2A2	172215186	1.000000	0.71417	0.703000	0.30354	0.233000	0.25261	6.862000	0.75484	2.243000	0.73865	0.533000	0.62120	TTG	.	.	.	none		0.333	SLC2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352834.1	NM_000340	
EIF2B5	8893	hgsc.bcm.edu	37	3	183861938	183861938	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr3:183861938G>A	ENST00000273783.3	+	14	2043	c.1921G>A	c.(1921-1923)Gac>Aac	p.D641N	EIF2B5_ENST00000444495.1_Missense_Mutation_p.D641N	NM_003907.2	NP_003898.2	Q13144	EI2BE_HUMAN	eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa	641	W2. {ECO:0000255|PROSITE- ProRule:PRU00695}.				astrocyte development (GO:0014002)|astrocyte differentiation (GO:0048708)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|gene expression (GO:0010467)|myelination (GO:0042552)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|ovarian follicle development (GO:0001541)|positive regulation of GTPase activity (GO:0043547)|positive regulation of translational initiation (GO:0045948)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)|nucleus (GO:0005634)	guanyl-nucleotide exchange factor activity (GO:0005085)|translation initiation factor activity (GO:0003743)|translation initiation factor binding (GO:0031369)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(9)|ovary(5)|urinary_tract(1)	27	all_cancers(143;7.59e-11)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			GCGCGCAGCCGACCATTTGGA	0.473																																					p.D641N		Atlas-SNP	.											EIF2B5,NS,carcinoma,0,1	EIF2B5	62	.	0			c.G1921A						PASS	.						157.0	158.0	158.0					3																	183861938		2203	4300	6503	SO:0001583	missense	8893	exon14			GCAGCCGACCATT	U23028	CCDS3252.1	3q27.3	2006-07-18	2002-08-29		ENSG00000145191	ENSG00000145191			3261	protein-coding gene	gene with protein product		603945	"""eukaryotic translation initiation factor 2B, subunit 5 (epsilon, 82kD)"""			8688466	Standard	NM_003907		Approved	EIF2Bepsilon, EIF-2B	uc003fmp.3	Q13144	OTTHUMG00000156840	ENST00000273783.3:c.1921G>A	chr3.hg19:g.183861938G>A	ENSP00000273783:p.Asp641Asn	410.0	1.0	.		515.0	142.0	.	NM_003907	Q541Z1|Q96D04	Missense_Mutation	SNP	ENST00000273783.3	hg19	CCDS3252.1	.	.	.	.	.	.	.	.	.	.	g	21.4	4.137002	0.77775	.	.	ENSG00000145191	ENST00000273783;ENST00000444495	T;T	0.81330	-1.48;-1.48	5.83	5.83	0.93111	eIF4-gamma/eIF5/eIF2-epsilon (3);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.000000	0.85682	D	0.000000	D	0.89753	0.6806	M	0.82056	2.57	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.71414	0.966;0.973	D	0.86277	0.1665	10	0.22109	T	0.4	.	20.1218	0.97964	0.0:0.0:1.0:0.0	.	641;641	E9PC74;Q13144	.;EI2BE_HUMAN	N	641	ENSP00000273783:D641N;ENSP00000409142:D641N	ENSP00000273783:D641N	D	+	1	0	EIF2B5	185344632	1.000000	0.71417	1.000000	0.80357	0.248000	0.25809	9.095000	0.94175	2.763000	0.94921	0.561000	0.74099	GAC	.	.	.	none		0.473	EIF2B5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346168.1		
CD180	4064	hgsc.bcm.edu	37	5	66479676	66479676	+	Missense_Mutation	SNP	T	T	C			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr5:66479676T>C	ENST00000256447.4	-	3	1152	c.995A>G	c.(994-996)cAt>cGt	p.H332R		NM_005582.2	NP_005573.2	Q99467	CD180_HUMAN	CD180 molecule	332					B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(2)|kidney(7)|large_intestine(12)|liver(1)|lung(8)|ovary(1)|stomach(2)	34		Lung NSC(167;4.94e-05)|Prostate(74;0.00601)|Ovarian(174;0.0654)|Breast(144;0.198)|Colorectal(97;0.234)		Lung(70;0.0046)		TTGATCGAAATGATTTACACT	0.448																																					p.H332R		Atlas-SNP	.											.	CD180	78	.	0			c.A995G						PASS	.						112.0	108.0	109.0					5																	66479676		2203	4300	6503	SO:0001583	missense	4064	exon3			TCGAAATGATTTA	D83597	CCDS3992.1	5q12	2008-02-05	2006-03-28	2005-06-07	ENSG00000134061	ENSG00000134061		"""CD molecules"""	6726	protein-coding gene	gene with protein product		602226	"""lymphocyte antigen 64 (mouse) homolog, radioprotective, 105kD"", ""CD180 antigen"""	LY64		9763566, 8975706	Standard	NM_005582		Approved	RP105, Ly78	uc003juy.2	Q99467	OTTHUMG00000131229	ENST00000256447.4:c.995A>G	chr5.hg19:g.66479676T>C	ENSP00000256447:p.His332Arg	286.0	1.0	.		210.0	89.0	.	NM_005582	B2R7Z7|Q32MM5	Missense_Mutation	SNP	ENST00000256447.4	hg19	CCDS3992.1	.	.	.	.	.	.	.	.	.	.	T	0.320	-0.962736	0.02249	.	.	ENSG00000134061	ENST00000256447	T	0.22945	1.93	4.93	-6.2	0.02072	.	2.214440	0.01592	N	0.021638	T	0.08358	0.0208	N	0.02685	-0.53	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.19778	-1.0295	10	0.12430	T	0.62	.	3.8381	0.08903	0.0947:0.3857:0.1905:0.3291	.	332	Q99467	CD180_HUMAN	R	332	ENSP00000256447:H332R	ENSP00000256447:H332R	H	-	2	0	CD180	66515432	0.000000	0.05858	0.000000	0.03702	0.455000	0.32408	-1.582000	0.02117	-0.862000	0.04089	0.528000	0.53228	CAT	.	.	.	none		0.448	CD180-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253973.2	NM_005582	
SPINK5	11005	hgsc.bcm.edu	37	5	147505159	147505159	+	Intron	SNP	G	G	T			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr5:147505159G>T	ENST00000256084.7	+	29	2781				SPINK5_ENST00000359874.3_Missense_Mutation_p.V938F	NM_006846.3	NP_006837.2	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5						anagen (GO:0042640)|epidermal cell differentiation (GO:0009913)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|hair cell differentiation (GO:0035315)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of immune response (GO:0050777)|negative regulation of proteolysis (GO:0045861)|negative regulation of serine-type peptidase activity (GO:1902572)|regulation of cell adhesion (GO:0030155)|regulation of T cell differentiation (GO:0045580)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(8)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTTGGCCTCTGTTGCCAGGAT	0.453																																					p.V938F		Atlas-SNP	.											.	SPINK5	245	.	0			c.G2812T						PASS	.						81.0	72.0	75.0					5																	147505159		1568	3582	5150	SO:0001627	intron_variant	11005	exon29			GCCTCTGTTGCCA	AJ228139	CCDS43382.1, CCDS47300.1, CCDS47301.1	5q31-q32	2014-09-17	2005-08-17		ENSG00000133710	ENSG00000133710		"""Serine peptidase inhibitors, Kazal type"""	15464	protein-coding gene	gene with protein product	"""lymphoepithelial Kazal-type-related inhibitor"""	605010	"""serine protease inhibitor, Kazal type 5"""			10419450	Standard	NM_001127698		Approved	VAKTI, LEKTI, LETKI, NETS, NS, FLJ21544, FLJ97536, FLJ97596, FLJ99794, DKFZp686K19184	uc003loy.2	Q9NQ38	OTTHUMG00000134305	ENST00000256084.7:c.2740-127G>T	chr5.hg19:g.147505159G>T		100.0	0.0	.		57.0	27.0	.	NM_001127698	A8MYE8|B7WPB7|D6REN5|O75770|Q3LX95|Q3LX96|Q3LX97|Q96PP2|Q96PP3	Missense_Mutation	SNP	ENST00000256084.7	hg19	CCDS43382.1	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.647508	0.00792	.	.	ENSG00000133710	ENST00000359874	T	0.48836	0.8	4.84	-6.57	0.01842	.	3.884710	0.00531	N	0.000217	T	0.33352	0.0860	.	.	.	0.09310	N	1	B	0.20052	0.041	B	0.28553	0.091	T	0.21895	-1.0232	9	0.36615	T	0.2	2.1949	6.42	0.21738	0.3875:0.236:0.3766:0.0	.	938	Q9NQ38-3	.	F	938	ENSP00000352936:V938F	ENSP00000352936:V938F	V	+	1	0	SPINK5	147485352	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	-1.352000	0.02619	-1.402000	0.02056	-0.889000	0.02933	GTT	.	.	.	none		0.453	SPINK5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000259215.2	NM_001127698	
MSH5	4439	hgsc.bcm.edu	37	6	31712029	31712029	+	Silent	SNP	A	A	G			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr6:31712029A>G	ENST00000375755.3	+	7	886	c.600A>G	c.(598-600)gaA>gaG	p.E200E	MSH5_ENST00000375750.3_Silent_p.E200E|MSH5_ENST00000375740.3_Silent_p.E217E|MSH5_ENST00000375703.3_Silent_p.E200E|MSH5_ENST00000431848.2_5'Flank|MSH5_ENST00000534153.4_Silent_p.E217E|MSH5_ENST00000375742.3_Silent_p.E217E|MSH5-SAPCD1_ENST00000493662.2_Silent_p.E217E|MSH5_ENST00000482280.1_3'UTR	NM_002441.4	NP_002432.1	O43196	MSH5_HUMAN	mutS homolog 5	200					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)			breast(1)|ovary(2)|skin(2)	5						TTGAACTGGAAGACTATAATG	0.502								Direct reversal of damage;Mismatch excision repair (MMR)																													p.E217E		Atlas-SNP	.											.	MSH5	108	.	0			c.A651G						PASS	.						100.0	100.0	100.0					6																	31712029		2203	4300	6503	SO:0001819	synonymous_variant	4439	exon7			ACTGGAAGACTAT	AF070071	CCDS4720.1, CCDS34409.1, CCDS34410.1, CCDS34409.2	6p21.3	2013-09-12	2013-09-12		ENSG00000204410	ENSG00000204410			7328	protein-coding gene	gene with protein product		603382	"""mutS (E. coli) homolog 5"", ""mutS homolog 5 (E. coli)"""			9740671, 9787078, 17977839	Standard	NM_002441		Approved		uc011hbg.2	O43196	OTTHUMG00000167551	ENST00000375755.3:c.600A>G	chr6.hg19:g.31712029A>G		211.0	0.0	.		195.0	63.0	.	NM_025259	B0V033|B0V034|O60586|Q5BLU9|Q5SSR1|Q8IW44|Q9BQC7	Silent	SNP	ENST00000375755.3	hg19	CCDS4720.1																																																																																			.	.	.	none		0.502	MSH5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076243.4		
LRRC1	55227	hgsc.bcm.edu	37	6	53787458	53787458	+	Missense_Mutation	SNP	C	C	A			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr6:53787458C>A	ENST00000370888.1	+	14	1719	c.1442C>A	c.(1441-1443)cCa>cAa	p.P481Q	RP3-523E19.2_ENST00000474641.2_RNA	NM_018214.4	NP_060684.4	Q9BTT6	LRRC1_HUMAN	leucine rich repeat containing 1	481						cytoplasm (GO:0005737)|membrane (GO:0016020)				cervix(1)|endometrium(3)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20	Lung NSC(77;0.0147)			BRCA - Breast invasive adenocarcinoma(397;0.0745)		CGAGCCACTCCACACCCAGGG	0.408																																					p.P481Q		Atlas-SNP	.											.	LRRC1	59	.	0			c.C1442A						PASS	.						145.0	144.0	144.0					6																	53787458		1898	4118	6016	SO:0001583	missense	55227	exon14			CCACTCCACACCC	AF332199	CCDS4953.2	6p12.2	2014-07-30	2003-11-19		ENSG00000137269	ENSG00000137269			14307	protein-coding gene	gene with protein product		608195	"""leucine-rich repeat-containing 1"""				Standard	NM_018214		Approved	dJ523E19.1, LANO, FLJ10775, FLJ11834	uc003pcd.1	Q9BTT6	OTTHUMG00000014885	ENST00000370888.1:c.1442C>A	chr6.hg19:g.53787458C>A	ENSP00000359925:p.Pro481Gln	237.0	0.0	.		214.0	189.0	.	NM_018214	Q5TGN3|Q9HAC0|Q9NVF1	Missense_Mutation	SNP	ENST00000370888.1	hg19	CCDS4953.2	.	.	.	.	.	.	.	.	.	.	C	23.5	4.429142	0.83776	.	.	ENSG00000137269	ENST00000370888	T	0.77358	-1.09	5.91	5.91	0.95273	.	0.059723	0.64402	D	0.000002	D	0.87505	0.6194	M	0.79123	2.44	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.87812	0.2632	10	0.87932	D	0	.	19.2934	0.94112	0.0:1.0:0.0:0.0	.	481	Q9BTT6	LRRC1_HUMAN	Q	481	ENSP00000359925:P481Q	ENSP00000359925:P481Q	P	+	2	0	LRRC1	53895417	1.000000	0.71417	0.980000	0.43619	0.992000	0.81027	7.394000	0.79862	2.808000	0.96608	0.655000	0.94253	CCA	.	.	.	none		0.408	LRRC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040970.2	NM_025168	
BAI3	577	hgsc.bcm.edu	37	6	69759168	69759168	+	Missense_Mutation	SNP	G	G	C	rs267601102		TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr6:69759168G>C	ENST00000370598.1	+	15	3084	c.2263G>C	c.(2263-2265)Gat>Cat	p.D755H		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	755					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.D755N(2)		NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				TCTAGAATTAGATGAATCATC	0.289																																					p.D755H		Atlas-SNP	.											BAI3,colon,carcinoma,-1,3	BAI3	451	.	2	Substitution - Missense(2)	skin(2)	c.G2263C						PASS	.						62.0	61.0	62.0					6																	69759168		2202	4295	6497	SO:0001583	missense	577	exon15			GAATTAGATGAAT	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.2263G>C	chr6.hg19:g.69759168G>C	ENSP00000359630:p.Asp755His	112.0	0.0	.		27.0	2.0	.	NM_001704	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	ENST00000370598.1	hg19	CCDS4968.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.097887	0.76870	.	.	ENSG00000135298	ENST00000370598	T	0.22134	1.97	5.3	5.3	0.74995	Domain of unknown function DUF3497 (1);	0.055134	0.64402	D	0.000001	T	0.32436	0.0829	L	0.58810	1.83	0.80722	D	1	P	0.50819	0.939	P	0.57548	0.823	T	0.03945	-1.0990	10	0.87932	D	0	.	19.3983	0.94617	0.0:0.0:1.0:0.0	.	755	O60242	BAI3_HUMAN	H	755	ENSP00000359630:D755H	ENSP00000359630:D755H	D	+	1	0	BAI3	69815889	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.425000	0.73370	2.650000	0.89964	0.650000	0.86243	GAT	.	.	.	none		0.289	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1		
ARL4A	10124	hgsc.bcm.edu	37	7	12728407	12728407	+	Missense_Mutation	SNP	G	G	C			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr7:12728407G>C	ENST00000396663.1	+	2	1010	c.528G>C	c.(526-528)aaG>aaC	p.K176N	ARL4A_ENST00000396662.1_Missense_Mutation_p.K176N|ARL4A_ENST00000404894.1_Missense_Mutation_p.K176N|ARL4A_ENST00000356797.3_Missense_Mutation_p.K176N|ARL4A_ENST00000396664.2_Missense_Mutation_p.K176N	NM_001037164.2|NM_001195396.1|NM_005738.4|NM_212460.3	NP_001032241.1|NP_001182325.1|NP_005729.1|NP_997625.1	P40617	ARL4A_HUMAN	ADP-ribosylation factor-like 4A	176					brown fat cell differentiation (GO:0050873)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)			NS(2)|lung(3)|ovary(1)	6				UCEC - Uterine corpus endometrioid carcinoma (126;0.176)		ATGGCCTAAAGGAAGGACTTG	0.368																																					p.K176N		Atlas-SNP	.											.	ARL4A	15	.	0			c.G528C						PASS	.						58.0	57.0	58.0					7																	12728407		2203	4294	6497	SO:0001583	missense	10124	exon2			CCTAAAGGAAGGA	U73960	CCDS5359.1	7p21.3	2014-05-09	2005-11-03	2005-11-03	ENSG00000122644	ENSG00000122644		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	695	protein-coding gene	gene with protein product		604786	"""ADP-ribosylation factor-like 4"""	ARL4			Standard	NM_212460		Approved		uc003ssq.3	P40617	OTTHUMG00000023374	ENST00000396663.1:c.528G>C	chr7.hg19:g.12728407G>C	ENSP00000379898:p.Lys176Asn	197.0	0.0	.		168.0	70.0	.	NM_001037164	A4D119|P80418|Q49AF5	Missense_Mutation	SNP	ENST00000396663.1	hg19	CCDS5359.1	.	.	.	.	.	.	.	.	.	.	G	9.982	1.228338	0.22542	.	.	ENSG00000122644	ENST00000396662;ENST00000356797;ENST00000396664;ENST00000396663;ENST00000404894	D;D;D;D;D	0.82619	-1.63;-1.63;-1.63;-1.63;-1.63	4.52	2.56	0.30785	.	0.309199	0.29730	N	0.011351	T	0.66752	0.2821	N	0.20610	0.595	0.38338	D	0.943985	B	0.33000	0.393	B	0.31101	0.124	T	0.67894	-0.5552	10	0.87932	D	0	.	5.1052	0.14781	0.2333:0.1757:0.591:0.0	.	176	P40617	ARL4A_HUMAN	N	176	ENSP00000379897:K176N;ENSP00000349250:K176N;ENSP00000379899:K176N;ENSP00000379898:K176N;ENSP00000385236:K176N	ENSP00000349250:K176N	K	+	3	2	ARL4A	12694932	0.997000	0.39634	0.999000	0.59377	0.980000	0.70556	0.531000	0.23052	1.232000	0.43678	0.650000	0.86243	AAG	.	.	.	none		0.368	ARL4A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326036.1	NM_005738	
CAMK2B	816	hgsc.bcm.edu	37	7	44259810	44259810	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr7:44259810C>T	ENST00000395749.2	-	23	1928	c.1852G>A	c.(1852-1854)Gct>Act	p.A618T	CAMK2B_ENST00000440254.2_Missense_Mutation_p.A494T|CAMK2B_ENST00000489429.1_5'UTR|CAMK2B_ENST00000358707.3_Missense_Mutation_p.A455T|CAMK2B_ENST00000502837.2_3'UTR|CAMK2B_ENST00000395747.2_Missense_Mutation_p.A470T|CAMK2B_ENST00000258682.6_Missense_Mutation_p.A469T|CAMK2B_ENST00000346990.4_Missense_Mutation_p.A401T|CAMK2B_ENST00000350811.3_Missense_Mutation_p.A494T|CAMK2B_ENST00000353625.4_Missense_Mutation_p.A431T|CAMK2B_ENST00000347193.4_Missense_Mutation_p.A444T|CAMK2B_ENST00000457475.1_Missense_Mutation_p.A470T	NM_001220.4	NP_001211.3	Q13554	KCC2B_HUMAN	calcium/calmodulin-dependent protein kinase II beta	618					activation of meiosis involved in egg activation (GO:0060466)|calcium ion transport (GO:0006816)|cytokine-mediated signaling pathway (GO:0019221)|G1/S transition of mitotic cell cycle (GO:0000082)|inhibitory G-protein coupled receptor phosphorylation (GO:0002030)|interferon-gamma-mediated signaling pathway (GO:0060333)|neuromuscular process controlling balance (GO:0050885)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of neuron projection development (GO:0010976)|positive regulation of synapse maturation (GO:0090129)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of calcium ion transport (GO:0051924)|regulation of dendritic spine development (GO:0060998)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of skeletal muscle adaptation (GO:0014733)|regulation of synapse structural plasticity (GO:0051823)|regulation of synaptic transmission, cholinergic (GO:0032222)|response to cadmium ion (GO:0046686)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)	18						CGGATGTAAGCGATGCAGGCG	0.652																																					p.A618T		Atlas-SNP	.											.	CAMK2B	56	.	0			c.G1852A						PASS	.						100.0	63.0	76.0					7																	44259810		2203	4300	6503	SO:0001583	missense	816	exon23			TGTAAGCGATGCA	U50358	CCDS5483.1, CCDS5484.1, CCDS5485.1, CCDS5486.1, CCDS5487.1, CCDS5488.1, CCDS5489.1, CCDS43573.1	7p14.3-p14.1	2008-10-30	2008-10-30		ENSG00000058404	ENSG00000058404			1461	protein-coding gene	gene with protein product	"""CaM-kinase II beta chain"", ""calcium/calmodulin-dependent protein kinase type II beta chain"", ""CaM kinase II beta subunit"", ""proline rich calmodulin-dependent protein kinase"""	607707	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II beta"""	CAMKB			Standard	NM_172079		Approved	CAM2, CAMK2	uc003tkq.2	Q13554	OTTHUMG00000023491	ENST00000395749.2:c.1852G>A	chr7.hg19:g.44259810C>T	ENSP00000379098:p.Ala618Thr	45.0	0.0	.		76.0	8.0	.	NM_001220	A4D2K0|A4D2K1|A4D2K2|A4D2K3|A4D2K4|A4D2K5|A4D2K6|O95437|O95438|O95599|Q9UGH7|Q9UGH8|Q9UGH9|Q9UNX0|Q9UNX7|Q9UP00|Q9Y5N4|Q9Y6F4	Missense_Mutation	SNP	ENST00000395749.2	hg19	CCDS5483.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.432187	0.83776	.	.	ENSG00000058404	ENST00000350811;ENST00000457475;ENST00000395749;ENST00000425809;ENST00000440254;ENST00000358707;ENST00000353625;ENST00000347193;ENST00000346990;ENST00000258682;ENST00000395747	T;T;T;T;T;T;T;T;T;T;T	0.58940	0.3;0.3;0.3;0.3;0.3;0.3;0.3;0.3;0.3;0.3;0.3	4.43	4.43	0.53597	Calcium/calmodulin-dependent protein kinase II, association-domain (1);	.	.	.	.	T	0.70937	0.3281	L	0.52905	1.665	0.80722	D	1	D;D;D;D;D;D;D;D;D;D	0.89917	0.968;1.0;0.987;1.0;1.0;0.974;0.988;1.0;0.999;1.0	P;D;P;D;D;P;P;D;P;D	0.91635	0.592;0.993;0.773;0.999;0.994;0.715;0.467;0.998;0.824;0.998	T	0.70608	-0.4825	9	0.40728	T	0.16	.	15.9546	0.79876	0.0:1.0:0.0:0.0	.	469;401;431;455;444;469;470;618;494;618	Q13554-8;Q13554-7;Q13554-4;Q13554-3;Q13554-6;A4D2K5;Q13554-5;Q13554;Q13554-2;A4D2J9	.;.;.;.;.;.;.;KCC2B_HUMAN;.;.	T	494;470;618;136;494;455;431;444;401;469;470	ENSP00000326375:A494T;ENSP00000390292:A470T;ENSP00000379098:A618T;ENSP00000410445:A136T;ENSP00000397937:A494T;ENSP00000351542:A455T;ENSP00000326427:A431T;ENSP00000326544:A444T;ENSP00000326518:A401T;ENSP00000258682:A469T;ENSP00000379096:A470T	ENSP00000258682:A469T	A	-	1	0	CAMK2B	44226335	1.000000	0.71417	1.000000	0.80357	0.579000	0.36224	7.303000	0.78871	2.305000	0.77605	0.462000	0.41574	GCT	.	.	.	none		0.652	CAMK2B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251138.2	NM_172084	
LANCL2	55915	hgsc.bcm.edu	37	7	55459595	55459595	+	Missense_Mutation	SNP	G	G	C			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr7:55459595G>C	ENST00000254770.2	+	2	892	c.314G>C	c.(313-315)gGc>gCc	p.G105A		NM_018697.3	NP_061167.1	Q9NS86	LANC2_HUMAN	LanC lantibiotic synthetase component C-like 2 (bacterial)	105					negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of abscisic acid-activated signaling pathway (GO:0009789)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|GTP binding (GO:0005525)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(2)|lung(11)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	25	Breast(14;0.0379)		Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00128)|Epithelial(13;0.0706)			GCTTATACTGGCTGGACAGGT	0.393																																					p.G105A		Atlas-SNP	.											.	LANCL2	54	.	0			c.G314C						PASS	.						93.0	96.0	95.0					7																	55459595		2203	4300	6503	SO:0001583	missense	55915	exon2			ATACTGGCTGGAC	AJ278245	CCDS5517.1	7q31.1-q31.33	2008-07-18	2001-12-04		ENSG00000132434	ENSG00000132434			6509	protein-coding gene	gene with protein product	"""testis-specific adriamycin sensitivity protein"", ""G protein-coupled receptor 69B"""	612919	"""LanC (bacterial lantibiotic synthetase component C)-like 2"""	GPR69B		11762191	Standard	NM_018697		Approved	TASP	uc003tqp.3	Q9NS86	OTTHUMG00000023779	ENST00000254770.2:c.314G>C	chr7.hg19:g.55459595G>C	ENSP00000254770:p.Gly105Ala	142.0	0.0	.		214.0	34.0	.	NM_018697	B2R8D4|Q6NSL4|Q8TCQ3|Q9BSR1	Missense_Mutation	SNP	ENST00000254770.2	hg19	CCDS5517.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.661548	0.88154	.	.	ENSG00000132434	ENST00000254770	D	0.91631	-2.88	5.79	5.79	0.91817	Six-hairpin glycosidase-like (1);	0.000000	0.85682	D	0.000000	D	0.97046	0.9035	M	0.91612	3.225	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97510	1.0066	10	0.87932	D	0	.	18.5771	0.91159	0.0:0.0:1.0:0.0	.	105	Q9NS86	LANC2_HUMAN	A	105	ENSP00000254770:G105A	ENSP00000254770:G105A	G	+	2	0	LANCL2	55427089	1.000000	0.71417	0.983000	0.44433	0.808000	0.45660	9.150000	0.94667	2.727000	0.93392	0.655000	0.94253	GGC	.	.	.	none		0.393	LANCL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251459.1	NM_018697	
ABCB1	5243	hgsc.bcm.edu	37	7	87148688	87148688	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr7:87148688C>T	ENST00000265724.3	-	24	3298	c.2881G>A	c.(2881-2883)Gcc>Acc	p.A961T	ABCB1_ENST00000543898.1_Missense_Mutation_p.A897T|ABCB1_ENST00000488737.2_5'UTR	NM_000927.4	NP_000918.2	P08183	MDR1_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 1	961	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				drug transmembrane transport (GO:0006855)|G2/M transition of mitotic cell cycle (GO:0000086)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|stem cell proliferation (GO:0072089)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(14)|kidney(9)|large_intestine(14)|lung(48)|ovary(4)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	111	Esophageal squamous(14;0.00164)				Acebutolol(DB01193)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Adenosine triphosphate(DB00171)|ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Albendazole(DB00518)|Alfentanil(DB00802)|Alitretinoin(DB00523)|Amantadine(DB00915)|Aminohippurate(DB00345)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Amsacrine(DB00276)|Apixaban(DB06605)|Arsenic trioxide(DB01169)|Astemizole(DB00637)|Atazanavir(DB01072)|Atenolol(DB00335)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzocaine(DB01086)|Bepridil(DB01244)|Betamethasone(DB00443)|Biperiden(DB00810)|Boceprevir(DB08873)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Bromocriptine(DB01200)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Canagliflozin(DB08907)|Candesartan(DB00796)|Captopril(DB01197)|Carbamazepine(DB00564)|Carfilzomib(DB08889)|Carvedilol(DB01136)|Caspofungin(DB00520)|Chloroquine(DB00608)|Chlorpromazine(DB00477)|Chlorpropamide(DB00672)|Chlorprothixene(DB01239)|Cilazapril(DB01340)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisplatin(DB00515)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Clofazimine(DB00845)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabigatran etexilate(DB06695)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dipyridamole(DB00975)|Docetaxel(DB01248)|Domperidone(DB01184)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Dronedarone(DB04855)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Etravirine(DB06414)|Ezetimibe(DB00973)|Felodipine(DB01023)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fidaxomicin(DB08874)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluticasone furoate(DB08906)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gemcitabine(DB00441)|Glyburide(DB01016)|Gramicidin D(DB00027)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Imatinib(DB00619)|Imipramine(DB00458)|Indacaterol(DB05039)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketoconazole(DB01026)|Lamivudine(DB00709)|Lamotrigine(DB00555)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lenalidomide(DB00480)|Levetiracetam(DB01202)|Levofloxacin(DB01137)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Liothyronine(DB00279)|Liotrix(DB01583)|Lisinopril(DB00722)|Lomitapide(DB08827)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Mannitol(DB00742)|Maprotiline(DB00934)|Mebendazole(DB00643)|Mefloquine(DB00358)|Megestrol acetate(DB00351)|Meprobamate(DB00371)|Methadone(DB00333)|Methotrexate(DB00563)|Methylprednisolone(DB00959)|Metoprolol(DB00264)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mitomycin(DB00305)|Mitoxantrone(DB01204)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nadolol(DB01203)|Naloxone(DB01183)|Naltrexone(DB00704)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Neostigmine(DB01400)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nizatidine(DB00585)|Norethindrone(DB00717)|Olanzapine(DB00334)|Omeprazole(DB00338)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paroxetine(DB00715)|Pazopanib(DB06589)|Perindopril(DB00790)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Pitavastatin(DB08860)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pravastatin(DB00175)|Prazosin(DB00457)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Progesterone(DB00396)|Promethazine(DB01069)|Propafenone(DB01182)|Propranolol(DB00571)|Protriptyline(DB00344)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reboxetine(DB00234)|Regorafenib(DB08896)|Reserpine(DB00206)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Roxithromycin(DB00778)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Scopolamine(DB00747)|Selegiline(DB01037)|Sertraline(DB01104)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|SOFOSBUVIR(DB08934)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Streptozocin(DB00428)|Sulfinpyrazone(DB01138)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telaprevir(DB05521)|Telmisartan(DB00966)|Temsirolimus(DB06287)|Terazosin(DB01162)|Testosterone(DB00624)|Ticagrelor(DB08816)|Timolol(DB00373)|Tolvaptan(DB06212)|Topotecan(DB01030)|Toremifene(DB00539)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Vecuronium(DB01339)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voacamine(DB04877)|Zidovudine(DB00495)	ACCAAGTAGGCTCCAAACCGG	0.383																																					p.A961T		Atlas-SNP	.											.	ABCB1	263	.	0			c.G2881A						PASS	.						98.0	89.0	92.0					7																	87148688		2203	4300	6503	SO:0001583	missense	5243	exon24			AGTAGGCTCCAAA	M14758	CCDS5608.1	7q21.12	2012-03-14	2004-05-12		ENSG00000085563	ENSG00000085563		"""CD molecules"", ""ATP binding cassette transporters / subfamily B"""	40	protein-coding gene	gene with protein product	"""multidrug resistance protein 1"""	171050	"""colchicin sensitivity"""	PGY1, MDR1, CLCS		3027054	Standard	NM_000927		Approved	P-gp, CD243, GP170, ABC20	uc003uiz.2	P08183	OTTHUMG00000023393	ENST00000265724.3:c.2881G>A	chr7.hg19:g.87148688C>T	ENSP00000265724:p.Ala961Thr	140.0	0.0	.		104.0	40.0	.	NM_000927	A8K294|B5AK60|Q12755|Q14812	Missense_Mutation	SNP	ENST00000265724.3	hg19	CCDS5608.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.171264	0.78452	.	.	ENSG00000085563	ENST00000543174;ENST00000265724;ENST00000543898	D;D	0.89123	-2.47;-2.47	5.79	5.79	0.91817	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.047985	0.85682	D	0.000000	D	0.93501	0.7926	M	0.88640	2.97	0.54753	D	0.999982	B;P	0.45348	0.225;0.856	B;P	0.48598	0.116;0.583	D	0.94005	0.7279	10	0.66056	D	0.02	-19.2761	20.0366	0.97561	0.0:1.0:0.0:0.0	.	897;961	B5AK60;P08183	.;MDR1_HUMAN	T	742;961;897	ENSP00000265724:A961T;ENSP00000444095:A897T	ENSP00000265724:A961T	A	-	1	0	ABCB1	86986624	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	5.801000	0.69115	2.736000	0.93811	0.561000	0.74099	GCC	.	.	.	none		0.383	ABCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335444.2	NM_000927	
CALD1	800	hgsc.bcm.edu	37	7	134618538	134618538	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr7:134618538G>A	ENST00000361675.2	+	5	1247	c.1018G>A	c.(1018-1020)Gag>Aag	p.E340K	CALD1_ENST00000417172.1_Intron|CALD1_ENST00000495522.1_Intron|CALD1_ENST00000422748.1_Intron|CALD1_ENST00000361388.2_Intron|CALD1_ENST00000424922.1_Intron|CALD1_ENST00000361901.2_Intron|CALD1_ENST00000543443.1_Intron|CALD1_ENST00000393118.2_Intron			Q05682	CALD1_HUMAN	caldesmon 1	340	3 X 14 AA tandem repeats of E-E-E-K-R-A- A-E-E-R-Q-R-I-K.				cellular component movement (GO:0006928)|muscle contraction (GO:0006936)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|calmodulin binding (GO:0005516)|tropomyosin binding (GO:0005523)	p.E340K(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(15)|lung(10)	43						aagggcagcagaggagaggca	0.527																																					p.E340K		Atlas-SNP	.											CALD1,NS,carcinoma,0,1	CALD1	150	.	1	Substitution - Missense(1)	endometrium(1)	c.G1018A						PASS	.																																			SO:0001583	missense	800	exon5			GCAGCAGAGGAGA	M64110	CCDS5834.1, CCDS5835.1, CCDS5836.1, CCDS47716.1, CCDS47717.1, CCDS5836.2	7q33	2007-04-23			ENSG00000122786	ENSG00000122786			1441	protein-coding gene	gene with protein product		114213				1885618	Standard	NM_004342		Approved	CDM, H-CAD, L-CAD	uc003vrz.3	Q05682	OTTHUMG00000155407	ENST00000361675.2:c.1018G>A	chr7.hg19:g.134618538G>A	ENSP00000354826:p.Glu340Lys	14.0	0.0	.		31.0	2.0	.	NM_033138	A8K0X1|Q13978|Q13979|Q14741|Q14742|Q9UD91	Missense_Mutation	SNP	ENST00000361675.2	hg19	CCDS5835.1	.	.	.	.	.	.	.	.	.	.	G	0.886	-0.727229	0.03158	.	.	ENSG00000122786	ENST00000361675	T	0.40225	1.04	3.67	1.57	0.23409	.	.	.	.	.	T	0.31104	0.0786	L	0.29908	0.895	0.80722	D	1	P	0.47253	0.892	P	0.45681	0.49	T	0.02639	-1.1130	8	.	.	.	.	7.2358	0.26070	0.0:0.1886:0.6169:0.1946	.	340	Q05682	CALD1_HUMAN	K	340	ENSP00000354826:E340K	.	E	+	1	0	CALD1	134269078	1.000000	0.71417	0.018000	0.16275	0.194000	0.23727	3.554000	0.53720	-0.013000	0.14199	0.462000	0.41574	GAG	.	.	.	none		0.527	CALD1-005	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339939.1	NM_033138	
TMEM67	91147	hgsc.bcm.edu	37	8	94792858	94792858	+	Missense_Mutation	SNP	A	A	C			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr8:94792858A>C	ENST00000453321.3	+	8	810	c.752A>C	c.(751-753)aAt>aCt	p.N251T	TMEM67_ENST00000425545.2_3'UTR|TMEM67_ENST00000409623.3_Missense_Mutation_p.N170T	NM_153704.5	NP_714915.3	Q5HYA8	MKS3_HUMAN	transmembrane protein 67	251				N -> S (in Ref. 1; BAG52507). {ECO:0000305}.	cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of centrosome duplication (GO:0010826)	centrosome (GO:0005813)|ciliary membrane (GO:0060170)|cytoplasmic vesicle membrane (GO:0030659)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)	filamin binding (GO:0031005)|unfolded protein binding (GO:0051082)			breast(3)|endometrium(8)|kidney(5)|large_intestine(4)|liver(2)|lung(15)|ovary(2)|skin(1)|urinary_tract(1)	41	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.00896)			GCTCTTGGAAATATGTGTGTG	0.363																																					p.N251T		Atlas-SNP	.											.	TMEM67	187	.	0			c.A752C						PASS	.						257.0	245.0	249.0					8																	94792858		2203	4300	6503	SO:0001583	missense	91147	exon8			TTGGAAATATGTG	BX648768	CCDS6258.2, CCDS47893.1	8q22.1	2014-09-17			ENSG00000164953	ENSG00000164953			28396	protein-coding gene	gene with protein product	"""Meckelin"""	609884	"""Meckel syndrome, type 3"""	MKS3		12384791, 16415887, 19508969	Standard	NM_153704		Approved	MGC26979, JBTS6, NPHP11	uc011lgk.2	Q5HYA8	OTTHUMG00000153119	ENST00000453321.3:c.752A>C	chr8.hg19:g.94792858A>C	ENSP00000389998:p.Asn251Thr	444.0	1.0	.		291.0	134.0	.	NM_153704	B3KRU5|B3KT47|G5E9H2|Q3ZCX3|Q7Z5T8|Q8IZ06	Missense_Mutation	SNP	ENST00000453321.3	hg19	CCDS6258.2	.	.	.	.	.	.	.	.	.	.	A	25.0	4.588377	0.86851	.	.	ENSG00000164953	ENST00000452276;ENST00000453321;ENST00000409623	D;D;D	0.99167	-5.51;-5.51;-5.51	5.86	5.86	0.93980	.	0.091847	0.64402	D	0.000001	D	0.99318	0.9761	M	0.86028	2.79	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99150	1.0858	10	0.87932	D	0	-22.3661	16.2559	0.82517	1.0:0.0:0.0:0.0	.	251;170	Q5HYA8;G5E9H2	MKS3_HUMAN;.	T	148;251;170	ENSP00000388671:N148T;ENSP00000389998:N251T;ENSP00000386966:N170T	ENSP00000314488:N241T	N	+	2	0	TMEM67	94862034	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.629000	0.90983	2.239000	0.73571	0.528000	0.53228	AAT	.	.	.	none		0.363	TMEM67-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329641.2	NM_153704	
ZNF658	26149	hgsc.bcm.edu	37	9	40774146	40774146	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr9:40774146C>A	ENST00000602553.1	-	5	1423	c.1129G>T	c.(1129-1131)Gaa>Taa	p.E377*	ZNF658_ENST00000441795.1_Nonsense_Mutation_p.E375*|ZNF658_ENST00000377626.3_Nonsense_Mutation_p.E377*			Q5TYW1	ZN658_HUMAN	zinc finger protein 658	377					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	46				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		AATTTATCTTCTGTGTGAATT	0.403																																					p.E377X		Atlas-SNP	.											.	ZNF658	100	.	0			c.G1129T						PASS	.						205.0	209.0	207.0					9																	40774146		2203	4300	6503	SO:0001587	stop_gained	26149	exon5			TATCTTCTGTGTG	AA482262	CCDS75846.1	9p13.1	2013-01-08			ENSG00000196409	ENSG00000274349		"""Zinc fingers, C2H2-type"", ""-"""	25226	protein-coding gene	gene with protein product							Standard	NM_033160		Approved	MGC35232, DKFZp572C163, FLJ32813	uc004abs.2	Q5TYW1	OTTHUMG00000013392	ENST00000602553.1:c.1129G>T	chr9.hg19:g.40774146C>A	ENSP00000473484:p.Glu377*	701.0	0.0	.		251.0	105.0	.	NM_033160	Q6PIP3|Q96M55|Q9H9S6|Q9UG02	Nonsense_Mutation	SNP	ENST00000602553.1	hg19	CCDS35023.1	.	.	.	.	.	.	.	.	.	.	c	28.0	4.885852	0.91814	.	.	ENSG00000196409	ENST00000441795;ENST00000377626	.	.	.	1.96	0.962	0.19643	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	8.0678	0.30672	0.0:0.7452:0.2548:0.0	.	.	.	.	X	375;377	.	ENSP00000366853:E377X	E	-	1	0	ZNF658	40764146	0.022000	0.18835	0.016000	0.15963	0.058000	0.15608	1.461000	0.35255	0.360000	0.24265	0.384000	0.25694	GAA	.	.	.	none		0.403	ZNF658-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467800.1	NM_033160	
COL5A1	1289	hgsc.bcm.edu	37	9	137714852	137714852	+	Silent	SNP	T	T	C			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr9:137714852T>C	ENST00000371817.3	+	60	5031	c.4617T>C	c.(4615-4617)ccT>ccC	p.P1539P		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	1539	Triple-helical region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		AGGGTCCGCCTGGTCCAAAAG	0.657																																					p.P1539P		Atlas-SNP	.											.	COL5A1	323	.	0			c.T4617C						PASS	.						101.0	77.0	85.0					9																	137714852		2203	4300	6503	SO:0001819	synonymous_variant	1289	exon60			TCCGCCTGGTCCA	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.4617T>C	chr9.hg19:g.137714852T>C		53.0	0.0	.		61.0	12.0	.	NM_000093	Q15094|Q5SUX4	Silent	SNP	ENST00000371817.3	hg19	CCDS6982.1																																																																																			.	.	.	none		0.657	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093	
ZNF503	84858	hgsc.bcm.edu	37	10	77159027	77159027	+	Missense_Mutation	SNP	G	G	T			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr10:77159027G>T	ENST00000372524.4	-	2	1907	c.1421C>A	c.(1420-1422)cCg>cAg	p.P474Q	ZNF503_ENST00000535216.1_Missense_Mutation_p.P474Q|ZNF503-AS2_ENST00000466942.2_RNA|RP11-399K21.11_ENST00000418818.2_lincRNA	NM_032772.4	NP_116161.2	Q96F45	ZN503_HUMAN	zinc finger protein 503	474	Ala-rich.				G1 to G0 transition involved in cell differentiation (GO:0070315)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|neural precursor cell proliferation (GO:0061351)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			lung(4)|ovary(1)|skin(1)	6	all_cancers(46;0.105)|all_epithelial(25;0.00449)|Prostate(51;0.0112)|Ovarian(15;0.088)					ACCGTGCAGCGGGTGCGTGGG	0.721																																					p.P474Q		Atlas-SNP	.											.	ZNF503	25	.	0			c.C1421A						PASS	.						10.0	13.0	12.0					10																	77159027		2191	4274	6465	SO:0001583	missense	84858	exon2			TGCAGCGGGTGCG	AK127647	CCDS7350.1	10q22.3	2011-02-09			ENSG00000165655	ENSG00000165655		"""Zinc fingers, C2H2-type"""	23589	protein-coding gene	gene with protein product		613902				12477932	Standard	NM_032772		Approved	FLJ45745, MGC2555	uc001jxg.3	Q96F45	OTTHUMG00000018526	ENST00000372524.4:c.1421C>A	chr10.hg19:g.77159027G>T	ENSP00000361602:p.Pro474Gln	20.0	0.0	.		50.0	32.0	.	NM_032772	Q8NAC5|Q96E25|Q96IJ0	Missense_Mutation	SNP	ENST00000372524.4	hg19	CCDS7350.1	.	.	.	.	.	.	.	.	.	.	G	16.38	3.106906	0.56291	.	.	ENSG00000165655	ENST00000372524;ENST00000535216;ENST00000372516	T;T	0.49432	0.78;0.78	4.45	3.54	0.40534	.	0.119276	0.64402	D	0.000019	T	0.57272	0.2042	M	0.69358	2.11	0.46416	D	0.999039	D	0.65815	0.995	P	0.56865	0.808	T	0.59716	-0.7402	10	0.66056	D	0.02	-17.0629	9.0142	0.36159	0.0794:0.0:0.7743:0.1463	.	474	Q96F45	ZN503_HUMAN	Q	474;474;437	ENSP00000361602:P474Q;ENSP00000438988:P474Q	ENSP00000361594:P437Q	P	-	2	0	ZNF503	76829033	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.106000	0.71511	1.088000	0.41272	0.643000	0.83706	CCG	.	.	.	none		0.721	ZNF503-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048826.1	NM_032772	
CTBP2	1488	hgsc.bcm.edu	37	10	126715159	126715159	+	Intron	SNP	A	A	G	rs529129641|rs372118432	byFrequency	TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr10:126715159A>G	ENST00000337195.5	-	3	458				CTBP2_ENST00000494626.2_Intron|CTBP2_ENST00000309035.6_Silent_p.A390A|CTBP2_ENST00000411419.2_Intron|CTBP2_ENST00000531469.1_Intron	NM_001329.2	NP_001320.1	P56545	CTBP2_HUMAN	C-terminal binding protein 2						negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cell junction (GO:0030054)|nucleus (GO:0005634)|synapse (GO:0045202)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)		TCTGCAGAGGAGCCGCAGCGC	0.701																																					p.A390A		Atlas-SNP	.											.,1	CTBP2	100	.	0			c.T1170C						PASS	.						9.0	7.0	8.0					10																	126715159		2126	4169	6295	SO:0001627	intron_variant	1488	exon1			CAGAGGAGCCGCA	AF016507	CCDS7643.1, CCDS7644.1	10q26.13	2008-08-01			ENSG00000175029	ENSG00000175029			2495	protein-coding gene	gene with protein product		602619				9479502, 11864595	Standard	NM_022802		Approved	ribeye	uc001lie.4	P56545	OTTHUMG00000019224	ENST00000337195.5:c.58+12406T>C	chr10.hg19:g.126715159A>G		4.0	0.0	.		15.0	3.0	.	NM_022802	A8K2X5|D3DRF5|O43449|Q5SQP7|Q69YI3|Q86SV0|Q9H2T8	Silent	SNP	ENST00000337195.5	hg19	CCDS7643.1																																																																																			.	.	.	none		0.701	CTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050900.3	NM_001083914	
KNDC1	85442	hgsc.bcm.edu	37	10	135009191	135009191	+	Missense_Mutation	SNP	G	G	A	rs541722509		TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr10:135009191G>A	ENST00000304613.3	+	10	1621	c.1600G>A	c.(1600-1602)Gtt>Att	p.V534I	KNDC1_ENST00000368572.2_Missense_Mutation_p.V534I|KNDC1_ENST00000368571.2_Missense_Mutation_p.V469I			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	534	KIND 2. {ECO:0000255|PROSITE- ProRule:PRU00709}.				cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		TGTGGCCGCCGTTCTGTGGAC	0.667													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15057	0.0		0.0	False		,,,				2504	0.0				p.V534I		Atlas-SNP	.											.	KNDC1	155	.	0			c.G1600A						PASS	.						48.0	44.0	45.0					10																	135009191		2202	4300	6502	SO:0001583	missense	85442	exon10			GCCGCCGTTCTGT	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.1600G>A	chr10.hg19:g.135009191G>A	ENSP00000304437:p.Val534Ile	44.0	0.0	.		55.0	21.0	.	NM_152643	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	SNP	ENST00000304613.3	hg19	CCDS7674.1	.	.	.	.	.	.	.	.	.	.	G	10.94	1.494320	0.26774	.	.	ENSG00000171798	ENST00000304613;ENST00000368572;ENST00000368571	T;T;T	0.41400	1.0;1.0;1.0	4.63	2.32	0.28847	KIND (2);	0.189090	0.34067	N	0.004291	T	0.24851	0.0603	L	0.45581	1.43	0.38564	D	0.949782	P;B	0.45428	0.858;0.221	B;B	0.32928	0.155;0.051	T	0.08806	-1.0704	10	0.32370	T	0.25	-39.5659	4.8812	0.13681	0.3953:0.0:0.6047:0.0	.	469;534	Q76NI1-2;Q76NI1	.;VKIND_HUMAN	I	534;534;469	ENSP00000304437:V534I;ENSP00000357561:V534I;ENSP00000357560:V469I	ENSP00000304437:V534I	V	+	1	0	KNDC1	134859181	0.108000	0.22018	0.624000	0.29186	0.129000	0.20672	1.040000	0.30278	1.085000	0.41206	0.306000	0.20318	GTT	.	.	.	none		0.667	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
OR5P2	120065	hgsc.bcm.edu	37	11	7817940	7817940	+	Missense_Mutation	SNP	A	A	T			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr11:7817940A>T	ENST00000329434.2	-	1	580	c.550T>A	c.(550-552)Tcc>Acc	p.S184T	RP11-35J10.5_ENST00000527565.1_lincRNA	NM_153444.1	NP_703145.1	Q8WZ92	OR5P2_HUMAN	olfactory receptor, family 5, subfamily P, member 2	184						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)	22				Epithelial(150;8.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TCAGAACAGGAGAGTTCAAGT	0.398																																					p.S184T		Atlas-SNP	.											.	OR5P2	68	.	0			c.T550A						PASS	.						72.0	83.0	80.0					11																	7817940		2102	4292	6394	SO:0001583	missense	120065	exon1			AACAGGAGAGTTC	AF173006	CCDS7782.1	11p15.4	2012-08-09			ENSG00000183303	ENSG00000183303		"""GPCR / Class A : Olfactory receptors"""	14783	protein-coding gene	gene with protein product							Standard	NM_153444		Approved	JCG3	uc001mfp.1	Q8WZ92	OTTHUMG00000165668	ENST00000329434.2:c.550T>A	chr11.hg19:g.7817940A>T	ENSP00000331823:p.Ser184Thr	128.0	0.0	.		82.0	31.0	.	NM_153444	Q3MIS8	Missense_Mutation	SNP	ENST00000329434.2	hg19	CCDS7782.1	.	.	.	.	.	.	.	.	.	.	A	12.70	2.016481	0.35606	.	.	ENSG00000183303	ENST00000329434	T	0.00282	8.31	5.5	5.5	0.81552	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000005	T	0.00468	0.0015	M	0.78637	2.42	0.29905	N	0.824079	P	0.40000	0.698	P	0.48524	0.58	T	0.31110	-0.9955	10	0.52906	T	0.07	-52.8073	13.6117	0.62083	1.0:0.0:0.0:0.0	.	184	Q8WZ92	OR5P2_HUMAN	T	184	ENSP00000331823:S184T	ENSP00000331823:S184T	S	-	1	0	OR5P2	7774516	0.339000	0.24784	0.995000	0.50966	0.033000	0.12548	0.825000	0.27393	2.313000	0.78055	0.454000	0.30748	TCC	.	.	.	none		0.398	OR5P2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385696.1	NM_153444	
NXF1	10482	hgsc.bcm.edu	37	11	62567921	62567921	+	Missense_Mutation	SNP	A	A	G			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr11:62567921A>G	ENST00000532297.1	-	11	1573	c.944T>C	c.(943-945)cTg>cCg	p.L315P	NXF1_ENST00000439713.2_Missense_Mutation_p.L315P|NXF1_ENST00000531131.1_Missense_Mutation_p.L178P|NXF1_ENST00000294172.2_Missense_Mutation_p.L315P|NXF1_ENST00000531709.2_Missense_Mutation_p.L315P			Q9UBU9	NXF1_HUMAN	nuclear RNA export factor 1	315					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear inclusion body (GO:0042405)|nuclear pore (GO:0005643)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(9)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TTCTAGCTTCAGCCCCTTTAT	0.547																																					p.L315P		Atlas-SNP	.											.	NXF1	67	.	0			c.T944C						PASS	.						150.0	105.0	120.0					11																	62567921		2201	4299	6500	SO:0001583	missense	10482	exon10			AGCTTCAGCCCCT	AF112880	CCDS8037.1, CCDS44629.1	11q12-q13	2008-07-21			ENSG00000162231	ENSG00000162231			8071	protein-coding gene	gene with protein product	"""tip associating protein"""	602647				9175835, 9660949	Standard	NM_001081491		Approved	TAP, Mex67, DKFZp667O0311	uc001nvf.1	Q9UBU9	OTTHUMG00000167612	ENST00000532297.1:c.944T>C	chr11.hg19:g.62567921A>G	ENSP00000436679:p.Leu315Pro	92.0	0.0	.		80.0	27.0	.	NM_006362	B4E269|Q99799|Q9UQL2	Missense_Mutation	SNP	ENST00000532297.1	hg19	CCDS8037.1	.	.	.	.	.	.	.	.	.	.	A	16.72	3.200863	0.58234	.	.	ENSG00000162231	ENST00000294172;ENST00000532297;ENST00000530875;ENST00000439713	T;T;T;T	0.56941	0.43;0.43;0.43;0.43	4.91	3.78	0.43462	.	0.074476	0.56097	D	0.000032	T	0.78622	0.4312	H	0.96996	3.92	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.91635	0.998;0.975;0.997;0.999	T	0.80160	-0.1498	10	0.49607	T	0.09	-11.668	8.613	0.33815	0.9087:0.0:0.0913:0.0	.	178;358;328;315	B4E227;E9PIN3;Q59E96;Q9UBU9	.;.;.;NXF1_HUMAN	P	315;315;358;315	ENSP00000294172:L315P;ENSP00000436679:L315P;ENSP00000435742:L358P;ENSP00000408864:L315P	ENSP00000294172:L315P	L	-	2	0	NXF1	62324497	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	8.818000	0.91991	0.902000	0.36520	0.528000	0.53228	CTG	.	.	.	none		0.547	NXF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395365.2	NM_006362	
LTBR	4055	hgsc.bcm.edu	37	12	6494285	6494285	+	Silent	SNP	C	C	T			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr12:6494285C>T	ENST00000228918.4	+	3	617	c.291C>T	c.(289-291)atC>atT	p.I97I	LTBR_ENST00000543190.1_5'UTR|LTBR_ENST00000546296.1_3'UTR|LTBR_ENST00000541102.1_5'UTR|LTBR_ENST00000539925.1_Silent_p.I78I	NM_002342.2	NP_002333.1	P36941	TNR3_HUMAN	lymphotoxin beta receptor (TNFR superfamily, member 3)	97					apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of JNK cascade (GO:0046330)|signal transduction (GO:0007165)|viral process (GO:0016032)	integral component of membrane (GO:0016021)	identical protein binding (GO:0042802)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|cervix(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)	15						ACCTGACCATCTGCCAGCTGT	0.617																																					p.I97I		Atlas-SNP	.											.	LTBR	30	.	0			c.C291T						PASS	.						152.0	142.0	145.0					12																	6494285		2203	4300	6503	SO:0001819	synonymous_variant	4055	exon3			GACCATCTGCCAG	L04270	CCDS8544.1, CCDS59233.1	12p13	2013-05-22				ENSG00000111321		"""Tumor necrosis factor receptor superfamily"""	6718	protein-coding gene	gene with protein product		600979		D12S370		8171323, 8486360	Standard	NM_002342		Approved	TNFCR, TNFR-RP, TNFR2-RP, TNF-R-III, TNFRSF3	uc001qny.2	P36941		ENST00000228918.4:c.291C>T	chr12.hg19:g.6494285C>T		280.0	0.0	.		446.0	261.0	.	NM_002342	B7Z1D2|D3DUR2|F5GXE7	Silent	SNP	ENST00000228918.4	hg19	CCDS8544.1																																																																																			.	.	.	none		0.617	LTBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399422.1		
TM7SF3	51768	hgsc.bcm.edu	37	12	27156249	27156249	+	Missense_Mutation	SNP	G	G	T			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr12:27156249G>T	ENST00000343028.4	-	2	391	c.166C>A	c.(166-168)Cat>Aat	p.H56N	TM7SF3_ENST00000542667.1_Intron	NM_016551.2	NP_057635.1	Q9NS93	TM7S3_HUMAN	transmembrane 7 superfamily member 3	56						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	18	Colorectal(261;0.0847)					GAAATATCATGCAAAATAGCT	0.343																																					p.H56N		Atlas-SNP	.											.	TM7SF3	41	.	0			c.C166A						PASS	.						61.0	58.0	59.0					12																	27156249		2203	4297	6500	SO:0001583	missense	51768	exon2			TATCATGCAAAAT	AB032470	CCDS8710.1	12q11-q12	2012-08-10			ENSG00000064115	ENSG00000064115			23049	protein-coding gene	gene with protein product		605181				10828615	Standard	NM_016551		Approved		uc010sjl.2	Q9NS93	OTTHUMG00000169243	ENST00000343028.4:c.166C>A	chr12.hg19:g.27156249G>T	ENSP00000342322:p.His56Asn	103.0	0.0	.		65.0	23.0	.	NM_016551	B3KMZ3|Q9NUS4	Missense_Mutation	SNP	ENST00000343028.4	hg19	CCDS8710.1	.	.	.	.	.	.	.	.	.	.	G	11.88	1.771441	0.31320	.	.	ENSG00000064115	ENST00000343028;ENST00000512808;ENST00000545600	T	0.28255	1.62	5.57	5.57	0.84162	.	0.502867	0.22125	N	0.064269	T	0.20170	0.0485	N	0.22421	0.69	0.20074	N	0.999935	B	0.21520	0.057	B	0.15870	0.014	T	0.11348	-1.0591	10	0.19590	T	0.45	-2.76	12.4317	0.55577	0.0:0.0:0.8326:0.1674	.	56	Q9NS93	TM7S3_HUMAN	N	56;35;61	ENSP00000342322:H56N	ENSP00000342322:H56N	H	-	1	0	TM7SF3	27047516	0.757000	0.28394	0.164000	0.22755	0.847000	0.48162	1.951000	0.40333	2.788000	0.95919	0.650000	0.86243	CAT	.	.	.	none		0.343	TM7SF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403033.1	NM_016551	
TIMELESS	8914	hgsc.bcm.edu	37	12	56822670	56822670	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr12:56822670C>T	ENST00000553532.1	-	11	1451	c.1301G>A	c.(1300-1302)cGc>cAc	p.R434H	TIMELESS_ENST00000229201.4_Missense_Mutation_p.R433H|TIMELESS_ENST00000554616.1_Intron					timeless circadian clock											NS(1)|breast(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(8)|lung(14)|ovary(7)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	49						CACTCACCGGCGTGCCCAGGA	0.517																																					p.R434H		Atlas-SNP	.											.	TIMELESS	107	.	0			c.G1301A						PASS	.						88.0	77.0	81.0					12																	56822670		2203	4300	6503	SO:0001583	missense	8914	exon11			CACCGGCGTGCCC	AF098162	CCDS8918.1	12q13.3	2012-12-14	2012-12-14		ENSG00000111602	ENSG00000111602			11813	protein-coding gene	gene with protein product	"""Tof1 homolog (S. cerevisiae)"", ""timeless circadian clock 1"""	603887	"""timeless (Drosophila) homolog"", ""timeless homolog (Drosophila)"""			9856465	Standard	NM_003920		Approved	hTIM, TIM, TIM1	uc001slf.2	Q9UNS1	OTTHUMG00000170600	ENST00000553532.1:c.1301G>A	chr12.hg19:g.56822670C>T	ENSP00000450607:p.Arg434His	90.0	0.0	.		116.0	32.0	.	NM_003920		Missense_Mutation	SNP	ENST00000553532.1	hg19	CCDS8918.1	.	.	.	.	.	.	.	.	.	.	C	32	5.163112	0.94727	.	.	ENSG00000111602	ENST00000229201;ENST00000553532	T;T	0.10005	2.92;2.93	4.95	4.95	0.65309	.	0.057662	0.64402	D	0.000001	T	0.32645	0.0836	M	0.83012	2.62	0.80722	D	1	D;D	0.76494	0.999;0.999	P;P	0.58780	0.845;0.704	T	0.12243	-1.0555	10	0.51188	T	0.08	.	17.3351	0.87278	0.0:1.0:0.0:0.0	.	433;434	Q9UNS1-2;Q9UNS1	.;TIM_HUMAN	H	433;434	ENSP00000229201:R433H;ENSP00000450607:R434H	ENSP00000229201:R434H	R	-	2	0	TIMELESS	55108937	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.503000	0.81632	2.454000	0.82982	0.462000	0.41574	CGC	.	.	.	none		0.517	TIMELESS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409771.1	NM_003920	
GRIP1	23426	hgsc.bcm.edu	37	12	66765685	66765685	+	Missense_Mutation	SNP	G	G	A	rs367781032		TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr12:66765685G>A	ENST00000398016.3	-	22	2713	c.2645C>T	c.(2644-2646)aCg>aTg	p.T882M	GRIP1_ENST00000359742.4_Missense_Mutation_p.T934M|GRIP1_ENST00000286445.7_Missense_Mutation_p.T919M	NM_021150.3	NP_066973.2	Q96DT0	LEG12_HUMAN	glutamate receptor interacting protein 1	0					intrinsic apoptotic signaling pathway (GO:0097193)	nucleus (GO:0005634)	lactose binding (GO:0030395)	p.T882K(1)		NS(3)|breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(19)|ovary(2)|prostate(2)|skin(1)	50			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		CAAACTCATCGTGCTCCCCGA	0.512																																					p.T882M		Atlas-SNP	.											GRIP1,NS,carcinoma,0,1	GRIP1	106	.	1	Substitution - Missense(1)	lung(1)	c.C2645T						PASS	.	G	MET/THR,MET/THR	0,4056		0,0,2028	53.0	57.0	56.0		2600,2645	6.1	1.0	12		56	2,8392		0,2,4195	no	missense,missense	GRIP1	NM_001178074.1,NM_021150.3	81,81	0,2,6223	AA,AG,GG		0.0238,0.0,0.0161	benign,benign	867/1062,882/1077	66765685	2,12448	2028	4197	6225	SO:0001583	missense	23426	exon22			CTCATCGTGCTCC	AJ133439	CCDS41807.1	12q13.13	2008-05-02			ENSG00000155974	ENSG00000155974			18708	protein-coding gene	gene with protein product		604597				10197531	Standard	NM_021150		Approved		uc001stk.3	Q9Y3R0	OTTHUMG00000169019	ENST00000398016.3:c.2645C>T	chr12.hg19:g.66765685G>A	ENSP00000381098:p.Thr882Met	133.0	0.0	.		187.0	51.0	.	NM_021150	B2R9N2|G5E970|Q96DS9|Q96PR9|Q9H258|Q9H259|Q9NZ02	Missense_Mutation	SNP	ENST00000398016.3	hg19	CCDS41807.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.77|13.77	2.337198|2.337198	0.41398|0.41398	0.0|0.0	2.38E-4|2.38E-4	ENSG00000155974|ENSG00000155974	ENST00000538164|ENST00000398016;ENST00000359742;ENST00000286445;ENST00000538211;ENST00000540433;ENST00000536215	.|T;T;T;T;T;T	.|0.79352	.|-1.26;-1.26;-1.26;-1.26;-1.26;-1.26	6.07|6.07	6.07|6.07	0.98685|0.98685	.|.	.|0.147302	.|0.64402	.|D	.|0.000014	.|D	.|0.84633	.|0.5515	L|L	0.56769|0.56769	1.78|1.78	0.46185|0.46185	D|D	0.998915|0.998915	.|B;D;B;D	.|0.61080	.|0.11;0.981;0.405;0.989	.|B;P;B;P	.|0.57283	.|0.04;0.563;0.058;0.817	.|T	.|0.82078	.|-0.0635	.|9	.|.	.|.	.|.	-13.6657|-13.6657	20.6593|20.6593	0.99626|0.99626	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|867;934;882;919	.|F5H4N6;Q9Y3R0;Q9Y3R0-3;Q9Y3R0-2	.|.;GRIP1_HUMAN;.;.	X|M	734|882;934;919;867;826;759	.|ENSP00000381098:T882M;ENSP00000352780:T934M;ENSP00000286445:T919M;ENSP00000446047:T867M;ENSP00000446024:T826M;ENSP00000446011:T759M	.|.	R|T	-|-	1|2	2|0	GRIP1|GRIP1	65051952|65051952	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.717000|0.717000	0.41224|0.41224	5.059000|5.059000	0.64306|0.64306	2.885000|2.885000	0.99019|0.99019	0.655000|0.655000	0.94253|0.94253	CGA|ACG	.	.	.	weak		0.512	GRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401975.2		
SSH1	54434	hgsc.bcm.edu	37	12	109182194	109182194	+	Missense_Mutation	SNP	T	T	A			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr12:109182194T>A	ENST00000326495.5	-	15	2813	c.2720A>T	c.(2719-2721)cAc>cTc	p.H907L	SSH1_ENST00000360239.3_Missense_Mutation_p.H595L	NM_018984.3	NP_061857.3	Q8WYL5	SSH1_HUMAN	slingshot protein phosphatase 1	907	Interaction with YWHAG.				actin cytoskeleton organization (GO:0030036)|cell morphogenesis (GO:0000902)|cellular response to ATP (GO:0071318)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of cellular protein metabolic process (GO:0032268)|regulation of lamellipodium assembly (GO:0010591)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						ACTACTGGTGTGGTCCAGGCG	0.587																																					p.H907L		Atlas-SNP	.											.	SSH1	144	.	0			c.A2720T						PASS	.						37.0	39.0	38.0					12																	109182194		2190	4270	6460	SO:0001583	missense	54434	exon15			CTGGTGTGGTCCA	BC062341	CCDS9121.1, CCDS53825.1, CCDS55882.1	12q24.12	2013-03-05	2013-03-05			ENSG00000084112		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30579	protein-coding gene	gene with protein product		606778	"""slingshot homolog 1 (Drosophila)"""			10718198, 11832213	Standard	NM_018984		Approved	KIAA1298	uc001tnm.3	Q8WYL5	OTTHUMG00000169371	ENST00000326495.5:c.2720A>T	chr12.hg19:g.109182194T>A	ENSP00000315713:p.His907Leu	94.0	0.0	.		200.0	133.0	.	NM_018984	Q6P6C0|Q8N9A7|Q8WYL3|Q8WYL4|Q9P2P8	Missense_Mutation	SNP	ENST00000326495.5	hg19	CCDS9121.1	.	.	.	.	.	.	.	.	.	.	T	13.84	2.357131	0.41801	.	.	ENSG00000084112	ENST00000360239;ENST00000326495	T;T	0.12147	2.84;2.71	5.64	4.43	0.53597	.	0.418583	0.26345	N	0.024917	T	0.32526	0.0832	M	0.62723	1.935	0.36858	D	0.888238	P;D	0.89917	0.842;1.0	P;D	0.83275	0.477;0.996	T	0.26916	-1.0089	10	0.66056	D	0.02	-33.6502	11.6178	0.51099	0.1332:0.0:0.0:0.8668	.	907;595	Q8WYL5;Q8WYL5-4	SSH1_HUMAN;.	L	595;907	ENSP00000353374:H595L;ENSP00000315713:H907L	ENSP00000315713:H907L	H	-	2	0	SSH1	107706323	1.000000	0.71417	0.999000	0.59377	0.775000	0.43874	1.902000	0.39848	2.160000	0.67779	0.528000	0.53228	CAC	.	.	.	none		0.587	SSH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000403724.1	NM_018984	
KIAA0586	9786	hgsc.bcm.edu	37	14	58949256	58949256	+	Silent	SNP	C	C	T			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr14:58949256C>T	ENST00000556134.1	+	22	3199	c.2925C>T	c.(2923-2925)ctC>ctT	p.L975L	KIAA0586_ENST00000261244.5_Silent_p.L914L|KIAA0586_ENST00000354386.6_Silent_p.L1043L|KIAA0586_ENST00000423743.3_Silent_p.L946L|KIAA0586_ENST00000538571.2_3'UTR	NM_001244190.1|NM_001244193.1	NP_001231119.1|NP_001231122.1	Q9BVV6	TALD3_HUMAN	KIAA0586	975					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|regulation of establishment of protein localization (GO:0070201)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				endometrium(4)|kidney(6)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GTGGCGCCCTCCAGCTTTTTG	0.378																																					p.L1043L		Atlas-SNP	.											.	KIAA0586	180	.	0			c.C3129T						PASS	.						51.0	49.0	49.0					14																	58949256		1851	4103	5954	SO:0001819	synonymous_variant	9786	exon23			CGCCCTCCAGCTT	AB011158	CCDS45115.1, CCDS58320.1, CCDS58321.1, CCDS58322.1, CCDS73639.1	14q23.1	2012-12-06			ENSG00000100578	ENSG00000100578			19960	protein-coding gene	gene with protein product		610178				16702409	Standard	NM_014749		Approved	Talpid3	uc010trr.2	Q9BVV6	OTTHUMG00000171141	ENST00000556134.1:c.2925C>T	chr14.hg19:g.58949256C>T		77.0	0.0	.		55.0	26.0	.	NM_001244189	B4DZB6|E7EWM8|J3KQH9|O60328|Q6NYC6|Q6UV20	Silent	SNP	ENST00000556134.1	hg19	CCDS58321.1																																																																																			.	.	.	none		0.378	KIAA0586-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000411887.1	NM_014749	
TRIP11	9321	hgsc.bcm.edu	37	14	92491671	92491671	+	Missense_Mutation	SNP	G	G	C			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr14:92491671G>C	ENST00000267622.4	-	3	668	c.295C>G	c.(295-297)Caa>Gaa	p.Q99E		NM_004239.3	NP_004230.2	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	99					protein targeting to Golgi (GO:0000042)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular septum development (GO:0003281)	acrosomal membrane (GO:0002080)|cis-Golgi network (GO:0005801)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(2)|endometrium(1)|kidney(8)|large_intestine(12)|lung(17)|ovary(7)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	58				COAD - Colon adenocarcinoma(157;0.223)		TGTTGAAGTTGATTTCGGTAA	0.308			T	PDGFRB	AML																																p.Q99E	Ovarian(84;609 1888 9852 42686)	Atlas-SNP	.		Dom	yes		14	14q31-q32	9321	thyroid hormone receptor interactor 11		L	.	TRIP11	184	.	0			c.C295G						PASS	.						189.0	161.0	170.0					14																	92491671		2203	4299	6502	SO:0001583	missense	9321	exon3			GAAGTTGATTTCG	L40380	CCDS9899.1	14q31-q32	2008-05-02				ENSG00000100815			12305	protein-coding gene	gene with protein product		604505				7776974, 9373237	Standard	NM_004239		Approved	CEV14, Trip230, GMAP-210	uc001xzy.3	Q15643		ENST00000267622.4:c.295C>G	chr14.hg19:g.92491671G>C	ENSP00000267622:p.Gln99Glu	116.0	0.0	.		53.0	28.0	.	NM_004239	B2RUT2|O14689|O15154|O95949	Missense_Mutation	SNP	ENST00000267622.4	hg19	CCDS9899.1	.	.	.	.	.	.	.	.	.	.	g	10.13	1.265895	0.23136	.	.	ENSG00000100815	ENST00000267622	T	0.65732	-0.17	5.5	4.6	0.57074	.	0.159691	0.45606	N	0.000356	T	0.57519	0.2059	L	0.55481	1.735	0.32399	N	0.552188	B	0.09022	0.002	B	0.11329	0.006	T	0.60110	-0.7327	10	0.20046	T	0.44	.	16.3096	0.82864	0.0:0.1325:0.8675:0.0	.	99	Q15643	TRIPB_HUMAN	E	99	ENSP00000267622:Q99E	ENSP00000267622:Q99E	Q	-	1	0	TRIP11	91561424	1.000000	0.71417	0.026000	0.17262	0.472000	0.32918	3.533000	0.53561	1.303000	0.44873	0.563000	0.77884	CAA	.	.	.	none		0.308	TRIP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411823.1		
USP3	9960	hgsc.bcm.edu	37	15	63882867	63882867	+	Missense_Mutation	SNP	T	T	G			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr15:63882867T>G	ENST00000380324.3	+	15	1534	c.1405T>G	c.(1405-1407)Tct>Gct	p.S469A	USP3_ENST00000539772.1_Missense_Mutation_p.S220A|USP3-AS1_ENST00000560962.1_RNA|USP3-AS1_ENST00000561191.1_RNA|USP3_ENST00000268049.7_Missense_Mutation_p.S447A|USP3-AS1_ENST00000559861.1_RNA|USP3_ENST00000558285.1_Missense_Mutation_p.S452A|USP3-AS1_ENST00000561256.1_RNA|USP3-AS1_ENST00000560622.1_RNA|USP3-AS1_ENST00000560350.1_RNA|USP3-AS1_ENST00000559357.1_RNA|USP3_ENST00000559711.1_Missense_Mutation_p.S380A|USP3_ENST00000558218.1_3'UTR|USP3-AS1_ENST00000558831.1_RNA|USP3_ENST00000540797.1_Missense_Mutation_p.S425A|USP3-AS1_ENST00000559737.1_RNA	NM_006537.3	NP_006528.2	Q9Y6I4	UBP3_HUMAN	ubiquitin specific peptidase 3	469	USP.				DNA repair (GO:0006281)|histone deubiquitination (GO:0016578)|mitotic cell cycle (GO:0000278)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	nuclear chromatin (GO:0000790)	histone binding (GO:0042393)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(7)|lung(4)	14				GBM - Glioblastoma multiforme(80;0.0187)		CAGGGTTGGTTCTGGACATTA	0.403																																					p.S469A		Atlas-SNP	.											.	USP3	37	.	0			c.T1405G						PASS	.						119.0	113.0	115.0					15																	63882867		2203	4300	6503	SO:0001583	missense	9960	exon15			GTTGGTTCTGGAC	AF073344	CCDS32265.1, CCDS58370.1	15q22.3	2008-04-11	2005-08-08			ENSG00000140455		"""Ubiquitin-specific peptidases"""	12626	protein-coding gene	gene with protein product		604728	"""ubiquitin specific protease 3"""			12838346	Standard	NM_006537		Approved		uc002amf.4	Q9Y6I4		ENST00000380324.3:c.1405T>G	chr15.hg19:g.63882867T>G	ENSP00000369681:p.Ser469Ala	179.0	0.0	.		207.0	79.0	.	NM_006537	B4DVU5|F5H1A6|Q8WVD0	Missense_Mutation	SNP	ENST00000380324.3	hg19	CCDS32265.1	.	.	.	.	.	.	.	.	.	.	T	18.13	3.555531	0.65425	.	.	ENSG00000140455	ENST00000540797;ENST00000380324;ENST00000268049;ENST00000539772;ENST00000538686	T;T;T;T	0.33438	1.41;1.41;1.41;1.41	6.07	6.07	0.98685	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2, conserved site (1);Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.29093	0.0723	L	0.48174	1.505	0.58432	D	0.999999	B;B;B;B	0.29378	0.204;0.243;0.131;0.243	B;B;B;B	0.28849	0.058;0.095;0.078;0.078	T	0.06303	-1.0834	10	0.15066	T	0.55	.	16.6288	0.85011	0.0:0.0:0.0:1.0	.	425;425;447;469	F5H1A6;B4DVU5;Q6JHV3;Q9Y6I4	.;.;.;UBP3_HUMAN	A	425;469;447;220;300	ENSP00000445828:S425A;ENSP00000369681:S469A;ENSP00000268049:S447A;ENSP00000445642:S220A	ENSP00000268049:S447A	S	+	1	0	USP3	61669920	1.000000	0.71417	0.995000	0.50966	0.957000	0.61999	8.012000	0.88631	2.326000	0.78906	0.533000	0.62120	TCT	.	.	.	none		0.403	USP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417773.1		
CRTC3	64784	hgsc.bcm.edu	37	15	91161146	91161146	+	Missense_Mutation	SNP	G	G	C			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr15:91161146G>C	ENST00000268184.6	+	8	649	c.645G>C	c.(643-645)gaG>gaC	p.E215D	CRTC3_ENST00000420329.2_Missense_Mutation_p.E215D|RP11-387D10.2_ENST00000559531.1_RNA			Q6UUV7	CRTC3_HUMAN	CREB regulated transcription coactivator 3	215					energy homeostasis (GO:0097009)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of lipid catabolic process (GO:0050995)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cAMP response element binding protein binding (GO:0008140)		CRTC3/MAML2(26)	breast(1)|endometrium(4)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	20	Melanoma(11;0.00551)|Lung NSC(78;0.0931)|all_lung(78;0.163)		BRCA - Breast invasive adenocarcinoma(143;0.0745)			TGAAAGAAGAGAATCTGTTAA	0.473			T	MAML2	salivary gland mucoepidermoid																																p.E215D		Atlas-SNP	.		Dom	yes		15	15q26.1	64784	CREB regulated transcription coactivator 3		E	.	CRTC3	47	.	0			c.G645C						PASS	.						96.0	87.0	90.0					15																	91161146		2198	4298	6496	SO:0001583	missense	64784	exon8			AGAAGAGAATCTG		CCDS32331.1, CCDS45348.1	15q26.1	2005-11-24				ENSG00000140577			26148	protein-coding gene	gene with protein product		608986				14536081, 14506290	Standard	NM_022769		Approved	FLJ21868	uc002bpp.4	Q6UUV7		ENST00000268184.6:c.645G>C	chr15.hg19:g.91161146G>C	ENSP00000268184:p.Glu215Asp	99.0	0.0	.		102.0	42.0	.	NM_022769	Q6DK61|Q6DK62|Q8NF38|Q9H6U2	Missense_Mutation	SNP	ENST00000268184.6	hg19	CCDS32331.1	.	.	.	.	.	.	.	.	.	.	G	18.97	3.735287	0.69189	.	.	ENSG00000140577	ENST00000437186;ENST00000268184;ENST00000420329	T;T	0.47528	0.84;0.84	5.12	1.05	0.20165	Transducer of regulated CREB activity, middle domain (1);	0.179858	0.47093	D	0.000248	T	0.47192	0.1432	L	0.44542	1.39	0.47123	D	0.999322	P;P	0.37370	0.592;0.537	P;P	0.51516	0.672;0.542	T	0.32903	-0.9889	10	0.39692	T	0.17	-15.2878	5.8106	0.18463	0.2477:0.1421:0.6102:0.0	.	215;215	Q6UUV7;Q6UUV7-3	CRTC3_HUMAN;.	D	179;215;215	ENSP00000268184:E215D;ENSP00000416573:E215D	ENSP00000268184:E215D	E	+	3	2	CRTC3	88962150	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.158000	0.31737	0.318000	0.23185	0.467000	0.42956	GAG	.	.	.	none		0.473	CRTC3-001	KNOWN	NAGNAG_splice_site|non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417716.2	NM_022769	
CACNA1H	8912	hgsc.bcm.edu	37	16	1263882	1263882	+	Missense_Mutation	SNP	T	T	C			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr16:1263882T>C	ENST00000348261.5	+	27	5128	c.4880T>C	c.(4879-4881)aTc>aCc	p.I1627T	CACNA1H_ENST00000358590.4_Missense_Mutation_p.I1621T|CACNA1H_ENST00000565831.1_Missense_Mutation_p.I1621T	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	1627					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	ACCTTCATCATCTGTGTCAAC	0.637																																					p.I1627T		Atlas-SNP	.											.	CACNA1H	317	.	0			c.T4880C						PASS	.						77.0	76.0	76.0					16																	1263882		2103	4238	6341	SO:0001583	missense	8912	exon27			TCATCATCTGTGT	AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.4880T>C	chr16.hg19:g.1263882T>C	ENSP00000334198:p.Ile1627Thr	20.0	0.0	.		34.0	21.0	.	NM_021098	B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	ENST00000348261.5	hg19	CCDS45375.1	.	.	.	.	.	.	.	.	.	.	T	18.38	3.611627	0.66558	.	.	ENSG00000196557	ENST00000348261;ENST00000358590	D;D	0.98192	-4.78;-4.78	3.99	3.99	0.46301	.	0.000000	0.85682	D	0.000000	D	0.98950	0.9643	M	0.89904	3.07	0.49798	D	0.999823	D;D;D;D;P	0.89917	0.999;1.0;0.998;0.999;0.893	P;D;D;D;P	0.79108	0.895;0.992;0.964;0.986;0.626	D	0.99449	1.0940	10	0.87932	D	0	.	12.4929	0.55909	0.0:0.0:0.0:1.0	.	373;362;368;1621;1627	A2SX38;A2SX35;A2SX37;O95180-2;O95180	.;.;.;.;CAC1H_HUMAN	T	1627;1621	ENSP00000334198:I1627T;ENSP00000351401:I1621T	ENSP00000334198:I1627T	I	+	2	0	CACNA1H	1203883	1.000000	0.71417	0.955000	0.39395	0.467000	0.32768	7.236000	0.78154	1.807000	0.52817	0.482000	0.46254	ATC	.	.	.	none		0.637	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421601.1	NM_001005407	
SRCAP	10847	hgsc.bcm.edu	37	16	30736125	30736125	+	Missense_Mutation	SNP	C	C	G	rs371358460		TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr16:30736125C>G	ENST00000262518.4	+	25	5765	c.5380C>G	c.(5380-5382)Cca>Gca	p.P1794A	SRCAP_ENST00000344771.4_Missense_Mutation_p.P1636A|SRCAP_ENST00000395059.2_Missense_Mutation_p.P1732A	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	1794	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			gagccctgccccagttcctac	0.652																																					p.P1794A		Atlas-SNP	.											.	SRCAP	298	.	0			c.C5380G						PASS	.	C	ALA/PRO	0,4394		0,0,2197	47.0	41.0	43.0		5380	3.9	0.9	16		43	1,8597	1.2+/-3.3	0,1,4298	no	missense	SRCAP	NM_006662.2	27	0,1,6495	GG,GC,CC		0.0116,0.0,0.0077	benign	1794/3231	30736125	1,12991	2197	4299	6496	SO:0001583	missense	10847	exon25			CCTGCCCCAGTTC	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.5380C>G	chr16.hg19:g.30736125C>G	ENSP00000262518:p.Pro1794Ala	49.0	0.0	.		98.0	32.0	.	NM_006662	B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	ENST00000262518.4	hg19	CCDS10689.2	.	.	.	.	.	.	.	.	.	.	C	9.997	1.232471	0.22626	0.0	1.16E-4	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	D;D;D	0.92446	-2.7;-2.96;-3.04	5.81	3.86	0.44501	.	0.131464	0.35207	N	0.003362	D	0.83170	0.5196	N	0.19112	0.55	0.23533	N	0.997471	B;B;B	0.12630	0.002;0.006;0.001	B;B;B	0.10450	0.005;0.005;0.002	T	0.72944	-0.4138	10	0.54805	T	0.06	-6.3761	5.5202	0.16927	0.0:0.664:0.1649:0.1711	.	1636;1732;1794	Q6ZRS2-3;Q6ZRS2-2;Q6ZRS2	.;.;SRCAP_HUMAN	A	1794;1732;1636	ENSP00000262518:P1794A;ENSP00000378499:P1732A;ENSP00000343042:P1636A	ENSP00000262518:P1794A	P	+	1	0	SRCAP	30643626	0.022000	0.18835	0.931000	0.37212	0.814000	0.46013	2.321000	0.43805	1.458000	0.47871	0.655000	0.94253	CCA	.	.	.	weak		0.652	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
NEK8	284086	hgsc.bcm.edu	37	17	27067537	27067537	+	Missense_Mutation	SNP	C	C	G			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr17:27067537C>G	ENST00000268766.6	+	11	1508	c.1474C>G	c.(1474-1476)Ccc>Gcc	p.P492A	AC010761.6_ENST00000582536.1_RNA|AC010761.6_ENST00000584779.1_RNA	NM_178170.2	NP_835464.1	Q86SG6	NEK8_HUMAN	NIMA-related kinase 8	492					organ morphogenesis (GO:0009887)|regulation of hippo signaling (GO:0035330)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|primary cilium (GO:0072372)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Lung NSC(42;0.0158)					GGTGCCCATGCCCCCAGGACA	0.567																																					p.P492A	NSCLC(6;19 293 14866 25253 49845)	Atlas-SNP	.											.	NEK8	76	.	0			c.C1474G						PASS	.						103.0	96.0	99.0					17																	27067537		2203	4300	6503	SO:0001583	missense	284086	exon11			CCCATGCCCCCAG	AY267371	CCDS32597.1	17q11.1	2012-11-15	2012-11-15			ENSG00000160602			13387	protein-coding gene	gene with protein product		609799	"""NIMA (never in mitosis gene a)- related kinase 8"""			18199800	Standard	NM_178170		Approved	NPHP9	uc002hcp.3	Q86SG6		ENST00000268766.6:c.1474C>G	chr17.hg19:g.27067537C>G	ENSP00000268766:p.Pro492Ala	202.0	0.0	.		324.0	87.0	.	NM_178170	A6NIC5|Q14CL7|Q2M1S6|Q8NDH1	Missense_Mutation	SNP	ENST00000268766.6	hg19	CCDS32597.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.947298	0.73672	.	.	ENSG00000160602	ENST00000268766	T	0.80824	-1.42	5.36	4.37	0.52481	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.108661	0.64402	N	0.000005	D	0.89979	0.6872	M	0.84683	2.71	0.53688	D	0.999979	D	0.89917	1.0	D	0.76071	0.987	D	0.90846	0.4727	10	0.52906	T	0.07	.	14.7766	0.69736	0.0:0.8496:0.1504:0.0	.	492	Q86SG6	NEK8_HUMAN	A	492	ENSP00000268766:P492A	ENSP00000268766:P492A	P	+	1	0	NEK8	24091664	1.000000	0.71417	0.913000	0.36048	0.984000	0.73092	3.608000	0.54109	1.218000	0.43458	0.555000	0.69702	CCC	.	.	.	none		0.567	NEK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446467.2		
CACNB1	782	hgsc.bcm.edu	37	17	37331566	37331566	+	Silent	SNP	C	C	T			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr17:37331566C>T	ENST00000394303.3	-	14	1884	c.1677G>A	c.(1675-1677)ctG>ctA	p.L559L	RP5-906A24.2_ENST00000579256.1_RNA	NM_000723.4	NP_000714.3	Q02641	CACB1_HUMAN	calcium channel, voltage-dependent, beta 1 subunit	559				L -> M (in Ref. 3; AAA36167). {ECO:0000305}.	axon guidance (GO:0007411)|protein targeting to membrane (GO:0006612)|transport (GO:0006810)	sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	16					Dronedarone(DB04855)|Ibutilide(DB00308)|Magnesium Sulfate(DB00653)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	GGTTGTCGGTCAGCTCTTCCT	0.662											OREG0024371	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L559L	Esophageal Squamous(5;100 366 38393 41452 45827)	Atlas-SNP	.											.	CACNB1	89	.	0			c.G1677A						PASS	.						145.0	161.0	156.0					17																	37331566		1894	4098	5992	SO:0001819	synonymous_variant	782	exon14			GTCGGTCAGCTCT		CCDS11334.1, CCDS42311.1, CCDS45665.1	17q21-q22	2013-03-20			ENSG00000067191	ENSG00000067191		"""Calcium channel subunits"""	1401	protein-coding gene	gene with protein product		114207		CACNLB1		8381767, 8395940	Standard	NM_000723		Approved		uc002hrm.2	Q02641	OTTHUMG00000133217	ENST00000394303.3:c.1677G>A	chr17.hg19:g.37331566C>T		575.0	1.0	.	869	853.0	268.0	.	NM_000723	A8K114|O15331|Q02639|Q02640|Q8N3X9|Q9C085|Q9UD79	Silent	SNP	ENST00000394303.3	hg19	CCDS42311.1																																																																																			.	.	.	none		0.662	CACNB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256945.3		
CDC6	990	hgsc.bcm.edu	37	17	38447499	38447499	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr17:38447499C>T	ENST00000209728.4	+	3	839	c.368C>T	c.(367-369)tCa>tTa	p.S123L		NM_001254.3	NP_001245.1	Q99741	CDC6_HUMAN	cell division cycle 6	123					DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|positive regulation of chromosome segregation (GO:0051984)|positive regulation of cytokinesis (GO:0032467)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|traversing start control point of mitotic cell cycle (GO:0007089)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|kinase binding (GO:0019900)|nucleotide binding (GO:0000166)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|stomach(2)|urinary_tract(1)	21						ATACTTTCTTCAGTTAGAAAA	0.373																																					p.S123L		Atlas-SNP	.											.	CDC6	53	.	0			c.C368T						PASS	.						80.0	77.0	78.0					17																	38447499		2203	4300	6503	SO:0001583	missense	990	exon3			TTTCTTCAGTTAG	U77949	CCDS11365.1	17q21.3	2013-01-17	2013-01-17		ENSG00000094804	ENSG00000094804			1744	protein-coding gene	gene with protein product		602627	"""CDC6 (cell division cycle 6, S. cerevisiae) homolog"", ""CDC6 cell division cycle 6 homolog (S. cerevisiae)"", ""cell division cycle 6 homolog (S. cerevisiae)"""	CDC18L		8990175, 9566895	Standard	NM_001254		Approved		uc002huj.1	Q99741	OTTHUMG00000133324	ENST00000209728.4:c.368C>T	chr17.hg19:g.38447499C>T	ENSP00000209728:p.Ser123Leu	123.0	0.0	.		184.0	108.0	.	NM_001254	Q8TB30	Missense_Mutation	SNP	ENST00000209728.4	hg19	CCDS11365.1	.	.	.	.	.	.	.	.	.	.	C	15.04	2.715080	0.48622	.	.	ENSG00000094804	ENST00000209728	T	0.52295	0.67	5.34	5.34	0.76211	.	0.815336	0.11356	N	0.572480	T	0.50103	0.1596	M	0.63428	1.95	0.09310	N	1	B	0.17852	0.024	B	0.08055	0.003	T	0.36016	-0.9765	10	0.32370	T	0.25	-0.9791	18.3299	0.90264	0.0:1.0:0.0:0.0	.	123	Q99741	CDC6_HUMAN	L	123	ENSP00000209728:S123L	ENSP00000209728:S123L	S	+	2	0	CDC6	35701025	0.320000	0.24616	0.023000	0.16930	0.065000	0.16274	3.873000	0.56093	2.937000	0.99478	0.650000	0.86243	TCA	.	.	.	none		0.373	CDC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257129.1		
KCNJ2	3759	hgsc.bcm.edu	37	17	68171425	68171425	+	Missense_Mutation	SNP	G	G	A	rs199473653		TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr17:68171425G>A	ENST00000243457.3	+	2	628	c.245G>A	c.(244-246)cGg>cAg	p.R82Q	KCNJ2_ENST00000535240.1_Missense_Mutation_p.R82Q	NM_000891.2	NP_000882.1	P63252	KCNJ2_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 2	82					cardiac muscle cell action potential involved in contraction (GO:0086002)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|magnesium ion transport (GO:0015693)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion import (GO:0010107)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of resting membrane potential (GO:0060075)|regulation of skeletal muscle contraction via regulation of action potential (GO:0014861)|relaxation of cardiac muscle (GO:0055119)|relaxation of skeletal muscle (GO:0090076)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of membrane (GO:0031224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|voltage-gated potassium channel activity involved in cardiac muscle cell action potential repolarization (GO:0086008)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(13)|skin(1)|urinary_tract(1)	25	Breast(10;1.64e-08)					ATTCGCTGGCGGTGGATGCTG	0.512																																					p.R82Q		Atlas-SNP	.											.	KCNJ2	74	.	0			c.G245A	GRCh37	CM053932	KCNJ2	M		PASS	.						220.0	164.0	183.0					17																	68171425		2203	4300	6503	SO:0001583	missense	3759	exon2			GCTGGCGGTGGAT	AF011904	CCDS11688.1	17q24.3	2014-09-17				ENSG00000123700		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6263	protein-coding gene	gene with protein product		600681				7696590, 11240146, 16382105	Standard	NM_000891		Approved	Kir2.1, IRK1, LQT7	uc002jir.3	P63252		ENST00000243457.3:c.245G>A	chr17.hg19:g.68171425G>A	ENSP00000243457:p.Arg82Gln	256.0	0.0	.		310.0	108.0	.	NM_000891	O15110|P48049	Missense_Mutation	SNP	ENST00000243457.3	hg19	CCDS11688.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.689148	0.88735	.	.	ENSG00000123700	ENST00000535240;ENST00000243457	D;D	0.95788	-3.81;-3.81	5.66	5.66	0.87406	Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);	0.000000	0.85682	D	0.000000	D	0.98692	0.9561	H	0.96889	3.9	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99379	1.0922	9	.	.	.	.	19.7433	0.96241	0.0:0.0:1.0:0.0	.	82	P63252	IRK2_HUMAN	Q	82	ENSP00000441848:R82Q;ENSP00000243457:R82Q	.	R	+	2	0	KCNJ2	65683020	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.869000	0.99810	2.662000	0.90505	0.555000	0.69702	CGG	.	.	.	weak		0.512	KCNJ2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450889.1	NM_000891	
RAB37	326624	hgsc.bcm.edu	37	17	72736931	72736931	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr17:72736931G>A	ENST00000392613.5	+	2	174	c.118G>A	c.(118-120)Gtc>Atc	p.V40I	RAB37_ENST00000340415.3_Intron|RAB37_ENST00000392615.5_Intron|RAB37_ENST00000392614.4_Missense_Mutation_p.V45I|RAB37_ENST00000402449.4_Intron|RAB37_ENST00000392612.3_Intron|RAB37_ENST00000392610.1_Missense_Mutation_p.V40I|RAB37_ENST00000528438.1_Missense_Mutation_p.V13I	NM_001006638.2	NP_001006639.1	Q96AX2	RAB37_HUMAN	RAB37, member RAS oncogene family	40					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|secretory granule (GO:0030141)	GTP binding (GO:0005525)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	12						AGACACAGGCGTCGGCAAAAC	0.567																																					p.V45I		Atlas-SNP	.											.	RAB37	69	.	0			c.G133A						PASS	.						153.0	154.0	153.0					17																	72736931		2203	4300	6503	SO:0001583	missense	326624	exon2			ACAGGCGTCGGCA	BC040547	CCDS11703.1, CCDS32722.1, CCDS54161.1, CCDS54162.1	17q25.2	2008-02-05			ENSG00000172794	ENSG00000172794		"""RAB, member RAS oncogene"""	30268	protein-coding gene	gene with protein product		609956				10722846	Standard	NM_175738		Approved		uc002jlk.3	Q96AX2	OTTHUMG00000134282	ENST00000392613.5:c.118G>A	chr17.hg19:g.72736931G>A	ENSP00000376389:p.Val40Ile	351.0	0.0	.		508.0	34.0	.	NM_001163989	A8MXF5|A8MYT0|Q8IWA7	Missense_Mutation	SNP	ENST00000392613.5	hg19	CCDS32722.1	.	.	.	.	.	.	.	.	.	.	G	19.29	3.799506	0.70567	.	.	ENSG00000172794	ENST00000528438;ENST00000392614;ENST00000392613;ENST00000533530;ENST00000392610	D;D;D;D	0.82081	-1.57;-1.57;-1.57;-1.57	5.27	5.27	0.74061	Small GTP-binding protein domain (1);	0.072360	0.53938	D	0.000052	D	0.91442	0.7299	M	0.93241	3.395	0.80722	D	1	P;P	0.50369	0.739;0.934	P;P	0.52627	0.503;0.704	D	0.93664	0.6984	10	0.87932	D	0	.	17.663	0.88197	0.0:0.0:1.0:0.0	.	45;40	A8MYT0;Q96AX2	.;RAB37_HUMAN	I	13;45;40;40;40	ENSP00000432086:V13I;ENSP00000376390:V45I;ENSP00000376389:V40I;ENSP00000376387:V40I	ENSP00000376387:V40I	V	+	1	0	RAB37	70248526	1.000000	0.71417	0.992000	0.48379	0.052000	0.14988	9.248000	0.95456	2.469000	0.83416	0.561000	0.74099	GTC	.	.	.	none		0.567	RAB37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258872.2	NM_175738	
ACOX1	51	hgsc.bcm.edu	37	17	73945931	73945931	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr17:73945931C>T	ENST00000301608.4	-	10	1406	c.1346G>A	c.(1345-1347)tGt>tAt	p.C449Y	ACOX1_ENST00000293217.5_Missense_Mutation_p.C449Y|ACOX1_ENST00000537812.1_Missense_Mutation_p.C411Y	NM_007292.5	NP_009223.2	Q15067	ACOX1_HUMAN	acyl-CoA oxidase 1, palmitoyl	449				C -> R (in Ref. 2; AAA18595). {ECO:0000305}.	alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|fatty acid oxidation (GO:0019395)|generation of precursor metabolites and energy (GO:0006091)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|peroxisome fission (GO:0016559)|positive regulation of cholesterol homeostasis (GO:2000189)|prostaglandin metabolic process (GO:0006693)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)|FAD binding (GO:0071949)|fatty acid binding (GO:0005504)|flavin adenine dinucleotide binding (GO:0050660)|palmitoyl-CoA oxidase activity (GO:0016401)|PDZ domain binding (GO:0030165)|protein N-terminus binding (GO:0047485)|receptor binding (GO:0005102)			large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(1)	14					Flavin adenine dinucleotide(DB03147)	CACCATGCCACACACCAACTT	0.468																																					p.C449Y		Atlas-SNP	.											.	ACOX1	85	.	0			c.G1346A						PASS	.						123.0	101.0	108.0					17																	73945931		2203	4300	6503	SO:0001583	missense	51	exon10			ATGCCACACACCA	U03254	CCDS11734.1, CCDS11735.1	17q25.1	2012-10-04	2010-04-30		ENSG00000161533	ENSG00000161533	1.3.3.6		119	protein-coding gene	gene with protein product		609751	"""acyl-Coenzyme A oxidase 1, palmitoyl"""			8159712	Standard	NM_007292		Approved	PALMCOX	uc002jqe.3	Q15067	OTTHUMG00000180027	ENST00000301608.4:c.1346G>A	chr17.hg19:g.73945931C>T	ENSP00000301608:p.Cys449Tyr	138.0	0.0	.		178.0	100.0	.	NM_007292	A8K6X8|A8KAA0|B4DK61|F5GYQ8|Q12863|Q15068|Q15101|Q16131|Q7Z3W5|Q9UD31	Missense_Mutation	SNP	ENST00000301608.4	hg19	CCDS11735.1	.	.	.	.	.	.	.	.	.	.	C	8.054	0.766632	0.15983	.	.	ENSG00000161533	ENST00000301608;ENST00000293217;ENST00000537812;ENST00000539791;ENST00000538781	T;T;T	0.69175	-0.38;-0.38;-0.38	5.9	2.59	0.31030	Acyl-CoA dehydrogenase/oxidase C-terminal (1);	0.983847	0.08367	N	0.956805	T	0.45856	0.1363	N	0.14661	0.345	0.20074	N	0.999931	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.28839	-1.0031	10	0.18276	T	0.48	-0.6261	6.3539	0.21390	0.0:0.5984:0.1198:0.2817	.	381;411;449;449	F5H0M0;F5GYQ8;Q15067;Q15067-2	.;.;ACOX1_HUMAN;.	Y	449;449;411;449;381	ENSP00000301608:C449Y;ENSP00000293217:C449Y;ENSP00000441257:C411Y	ENSP00000293217:C449Y	C	-	2	0	ACOX1	71457526	0.001000	0.12720	0.520000	0.27837	0.349000	0.29174	1.001000	0.29783	0.314000	0.23086	-0.157000	0.13467	TGT	.	.	.	none		0.468	ACOX1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439503.1		
GAREM	64762	hgsc.bcm.edu	37	18	29867890	29867890	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr18:29867890G>A	ENST00000269209.6	-	4	673	c.670C>T	c.(670-672)Ccc>Tcc	p.P224S	GAREM_ENST00000578619.1_5'UTR|GAREM_ENST00000399218.4_Missense_Mutation_p.P224S|RP11-344B2.2_ENST00000579580.1_RNA			Q9H706	GAREM_HUMAN	GRB2 associated, regulator of MAPK1	224	CABIT.				cellular response to epidermal growth factor stimulus (GO:0071364)|epidermal growth factor receptor signaling pathway (GO:0007173)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)										AGTTCCAGGGGACTTCGGGTG	0.522																																					p.P224S		Atlas-SNP	.											.	.	.	.	0			c.C670T						PASS	.						135.0	114.0	121.0					18																	29867890		2203	4300	6503	SO:0001583	missense	64762	exon4			CCAGGGGACTTCG	AK025263	CCDS11905.1, CCDS56057.1	18q12.1	2012-11-30	2012-11-30	2012-11-30	ENSG00000141441	ENSG00000141441			26136	protein-coding gene	gene with protein product	"""Grb2-associated and regulator of Erk/MAPK"""		"""chromosome 18 open reading frame 11"", ""family with sequence similarity 59, member A"""	C18orf11, FAM59A		19509291	Standard	NM_001242409		Approved	FLJ21610	uc002kxl.3	Q9H706	OTTHUMG00000132273	ENST00000269209.6:c.670C>T	chr18.hg19:g.29867890G>A	ENSP00000269209:p.Pro224Ser	187.0	0.0	.		139.0	55.0	.	NM_022751	Q0VAG3|Q0VAG4|Q8ND03|Q9BSF5	Missense_Mutation	SNP	ENST00000269209.6	hg19	CCDS56057.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.672770	0.88445	.	.	ENSG00000141441	ENST00000399218;ENST00000269209	T;T	0.15487	2.42;2.42	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.43366	0.1244	M	0.69823	2.125	0.80722	D	1	D;D	0.71674	0.998;0.997	D;D	0.66351	0.93;0.943	T	0.20672	-1.0268	10	0.72032	D	0.01	-23.7807	20.1095	0.97908	0.0:0.0:1.0:0.0	.	224;224	Q9H706;Q9H706-3	FA59A_HUMAN;.	S	224	ENSP00000382165:P224S;ENSP00000269209:P224S	ENSP00000269209:P224S	P	-	1	0	FAM59A	28121888	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	9.357000	0.97099	2.831000	0.97527	0.655000	0.94253	CCC	.	.	.	none		0.522	GAREM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255365.1	NM_022751	
HMSD	284293	hgsc.bcm.edu	37	18	61621714	61621714	+	Missense_Mutation	SNP	A	A	G			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr18:61621714A>G	ENST00000408945.3	+	3	347	c.145A>G	c.(145-147)Att>Gtt	p.I49V	HMSD_ENST00000526932.1_Silent_p.Q14Q|HMSD_ENST00000481726.1_3'UTR	NM_001123366.1	NP_001116838.1	A8MTL9	HMSD_HUMAN	histocompatibility (minor) serpin domain containing	49						extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			kidney(1)|large_intestine(2)|lung(2)|stomach(1)	6						TCTTGTTGCAATTAACAGAAC	0.348																																					p.I49V		Atlas-SNP	.											.	HMSD	16	.	0			c.A145G						PASS	.						151.0	141.0	144.0					18																	61621714		1568	3582	5150	SO:0001583	missense	284293	exon3			GTTGCAATTAACA	AC009802	CCDS42441.1	18q21.33	2008-02-04			ENSG00000221887	ENSG00000221887			23037	protein-coding gene	gene with protein product		612086		C18orf53		17409267	Standard	NM_001123366		Approved	ACC-6	uc010dqj.3	A8MTL9	OTTHUMG00000060593	ENST00000408945.3:c.145A>G	chr18.hg19:g.61621714A>G	ENSP00000386207:p.Ile49Val	269.0	0.0	.		156.0	13.0	.	NM_001123366		Missense_Mutation	SNP	ENST00000408945.3	hg19	CCDS42441.1	.	.	.	.	.	.	.	.	.	.	A	0.059	-1.229197	0.01518	.	.	ENSG00000221887	ENST00000408945	D	0.84442	-1.85	3.19	-5.08	0.02929	Serpin domain (2);	.	.	.	.	T	0.67277	0.2876	N	0.10809	0.05	0.27000	N	0.964924	B	0.15930	0.015	B	0.28139	0.086	T	0.57376	-0.7822	9	0.08599	T	0.76	.	10.4449	0.44488	0.6618:0.0:0.3382:0.0	.	49	A8MTL9	HMSD_HUMAN	V	49	ENSP00000386207:I49V	ENSP00000386207:I49V	I	+	1	0	HMSD	59772694	0.078000	0.21339	0.000000	0.03702	0.000000	0.00434	0.203000	0.17315	-1.378000	0.02120	-1.411000	0.01122	ATT	.	.	.	none		0.348	HMSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134010.2	XM_209104	
COL5A3	50509	hgsc.bcm.edu	37	19	10096525	10096525	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr19:10096525C>T	ENST00000264828.3	-	31	2484	c.2399G>A	c.(2398-2400)gGa>gAa	p.G800E		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	800	Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			TACCTTAGGTCCAGGGCGTCC	0.582																																					p.G800E		Atlas-SNP	.											.	COL5A3	243	.	0			c.G2399A						PASS	.						121.0	138.0	132.0					19																	10096525		2203	4300	6503	SO:0001583	missense	50509	exon31			TTAGGTCCAGGGC	AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.2399G>A	chr19.hg19:g.10096525C>T	ENSP00000264828:p.Gly800Glu	571.0	1.0	.		473.0	258.0	.	NM_015719	Q9NZQ6	Missense_Mutation	SNP	ENST00000264828.3	hg19	CCDS12222.1	.	.	.	.	.	.	.	.	.	.	C	16.90	3.250158	0.59212	.	.	ENSG00000080573	ENST00000264828	D	0.96992	-4.2	4.6	4.6	0.57074	.	0.075366	0.51477	U	0.000084	D	0.98520	0.9506	M	0.93550	3.43	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99620	1.0983	10	0.87932	D	0	.	15.2861	0.73828	0.0:1.0:0.0:0.0	.	800	P25940	CO5A3_HUMAN	E	800	ENSP00000264828:G800E	ENSP00000264828:G800E	G	-	2	0	COL5A3	9957525	1.000000	0.71417	0.999000	0.59377	0.220000	0.24768	6.386000	0.73186	2.267000	0.75376	0.462000	0.41574	GGA	.	.	.	none		0.582	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315788.1	NM_015719	
SMARCA4	6597	hgsc.bcm.edu	37	19	11141551	11141551	+	Missense_Mutation	SNP	C	C	G	rs573885719		TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr19:11141551C>G	ENST00000429416.3	+	26	3809	c.3528C>G	c.(3526-3528)agC>agG	p.S1176R	SMARCA4_ENST00000358026.2_Missense_Mutation_p.S1176R|SMARCA4_ENST00000413806.3_Missense_Mutation_p.S1176R|SMARCA4_ENST00000590574.1_Missense_Mutation_p.S1176R|SMARCA4_ENST00000450717.3_Missense_Mutation_p.S1176R|SMARCA4_ENST00000589677.1_Missense_Mutation_p.S1176R|SMARCA4_ENST00000344626.4_Missense_Mutation_p.S1176R|SMARCA4_ENST00000444061.3_Missense_Mutation_p.S1176R|SMARCA4_ENST00000541122.2_Missense_Mutation_p.S1176R	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	1176	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				TTTTTGACAGCGACTGGAATC	0.622			"""F, N, Mis"""		NSCLC																																p.S1176R		Atlas-SNP	.		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	.	SMARCA4	502	.	1	Unknown(1)	lung(1)	c.C3528G						PASS	.						23.0	23.0	23.0					19																	11141551		2200	4298	6498	SO:0001583	missense	6597	exon25			TGACAGCGACTGG	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.3528C>G	chr19.hg19:g.11141551C>G	ENSP00000395654:p.Ser1176Arg	22.0	0.0	.		37.0	19.0	.	NM_003072	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	hg19	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	C	17.39	3.376857	0.61735	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	D;D;D;D;D;D;D	0.96651	-4.08;-4.08;-4.08;-4.08;-4.08;-4.08;-4.08	4.59	-2.64	0.06114	Helicase, C-terminal (3);	0.099658	0.64402	D	0.000003	D	0.97198	0.9084	M	0.78285	2.405	0.51482	D	0.999927	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.95549	0.8619	10	0.87932	D	0	-24.9368	11.693	0.51527	0.0:0.1538:0.0:0.8462	.	1176;1176;1176;1176;1176;396;1176;1176	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;B4E0F1;A7E2E1;P51532	.;.;.;.;.;.;.;SMCA4_HUMAN	R	1176;1176;1240;1176;1176;1176;1176;1176	ENSP00000395654:S1176R;ENSP00000350720:S1176R;ENSP00000343896:S1176R;ENSP00000445036:S1176R;ENSP00000392837:S1176R;ENSP00000397783:S1176R;ENSP00000414727:S1176R	ENSP00000343896:S1176R	S	+	3	2	SMARCA4	11002551	0.002000	0.14202	0.983000	0.44433	0.991000	0.79684	-1.403000	0.02497	-0.701000	0.05063	0.563000	0.77884	AGC	.	.	.	none		0.622	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072	
PLEKHG2	64857	hgsc.bcm.edu	37	19	39915323	39915323	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr19:39915323C>T	ENST00000409794.3	+	19	4400	c.3550C>T	c.(3550-3552)Cca>Tca	p.P1184S	PLEKHG2_ENST00000458508.2_Missense_Mutation_p.P1125S|PLEKHG2_ENST00000409797.2_Intron|PLEKHG2_ENST00000378550.1_Intron|CTB-60E11.4_ENST00000601124.1_lincRNA|PLEKHG2_ENST00000425673.1_Missense_Mutation_p.P1155S	NM_022835.2	NP_073746.2	Q9H7P9	PKHG2_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 2	1184	Pro-rich.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|pancreas(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	40	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			ACTTCCGGAGCCAAGCCTTAC	0.562																																					p.P1184S		Atlas-SNP	.											.	PLEKHG2	329	.	0			c.C3550T						PASS	.						137.0	138.0	138.0					19																	39915323		2203	4300	6503	SO:0001583	missense	64857	exon19			CCGGAGCCAAGCC	AK024429	CCDS33022.2	19q13.2	2013-01-11			ENSG00000090924	ENSG00000090924		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	29515	protein-coding gene	gene with protein product		611893				11839748, 18045877	Standard	NM_022835		Approved	CLG, FLJ00018, ARHGEF42	uc010xuz.2	Q9H7P9	OTTHUMG00000152570	ENST00000409794.3:c.3550C>T	chr19.hg19:g.39915323C>T	ENSP00000386733:p.Pro1184Ser	292.0	0.0	.		319.0	126.0	.	NM_022835	B8ZZK6|C9J0Y4|Q6DHV6|Q96BU2|Q96D18|Q9H699	Missense_Mutation	SNP	ENST00000409794.3	hg19	CCDS33022.2	.	.	.	.	.	.	.	.	.	.	C	11.34	1.610668	0.28712	.	.	ENSG00000090924	ENST00000409794;ENST00000425673;ENST00000458508	T;T;T	0.69040	-0.24;-0.27;-0.37	4.07	1.85	0.25348	.	1.332870	0.05347	N	0.531168	T	0.52108	0.1714	L	0.39898	1.24	0.09310	N	1	B;B;B	0.33694	0.403;0.281;0.421	B;B;B	0.25291	0.059;0.027;0.026	T	0.42565	-0.9444	9	.	.	.	.	4.6767	0.12715	0.0:0.6467:0.2297:0.1236	.	1155;1184;1125	Q9H7P9-3;Q9H7P9;E7ESZ3	.;PKHG2_HUMAN;.	S	1184;1155;1125	ENSP00000386733:P1184S;ENSP00000392906:P1155S;ENSP00000408857:P1125S	.	P	+	1	0	PLEKHG2	44607163	0.006000	0.16342	0.064000	0.19789	0.058000	0.15608	0.781000	0.26774	0.976000	0.38417	0.511000	0.50034	CCA	.	.	.	none		0.562	PLEKHG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326802.1	NM_022835	
MEGF8	1954	hgsc.bcm.edu	37	19	42872696	42872696	+	Silent	SNP	T	T	C			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr19:42872696T>C	ENST00000251268.6	+	36	6363	c.6363T>C	c.(6361-6363)tgT>tgC	p.C2121C	MEGF8_ENST00000378073.4_5'Flank|MEGF8_ENST00000334370.4_Silent_p.C2054C	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	2121	PSI 7.				BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				CCCTGGGCTGTGCTCAGGCAA	0.697																																					p.C2121C		Atlas-SNP	.											.	MEGF8	358	.	0			c.T6363C						PASS	.						10.0	10.0	10.0					19																	42872696		2193	4277	6470	SO:0001819	synonymous_variant	1954	exon36			GGGCTGTGCTCAG	AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.6363T>C	chr19.hg19:g.42872696T>C		28.0	0.0	.		29.0	13.0	.	NM_001271938	A8KAY0|O75097	Silent	SNP	ENST00000251268.6	hg19																																																																																				.	.	.	none		0.697	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000463854.1	NM_001410	
PPP1R12C	54776	hgsc.bcm.edu	37	19	55603617	55603617	+	Silent	SNP	G	G	C			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr19:55603617G>C	ENST00000263433.3	-	19	2148	c.2133C>G	c.(2131-2133)ctC>ctG	p.L711L	PPP1R12C_ENST00000376393.2_Silent_p.L648L|PPP1R12C_ENST00000435544.2_Silent_p.L636L	NM_001271618.1|NM_017607.2	NP_001258547.1|NP_060077.1			protein phosphatase 1, regulatory subunit 12C											central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	22			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		GCTCCACCTTGAGCTGCGCCA	0.692																																					p.L711L		Atlas-SNP	.											.	PPP1R12C	46	.	0			c.C2133G						PASS	.						9.0	9.0	9.0					19																	55603617		2170	4262	6432	SO:0001819	synonymous_variant	54776	exon19			CACCTTGAGCTGC	AF312028	CCDS12916.1	19q13.42	2013-01-10	2011-10-04		ENSG00000125503	ENSG00000125503		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14947	protein-coding gene	gene with protein product	"""myosin-binding subunit 85"""	613245	"""leukocyte receptor cluster (LRC) member 3"", ""protein phosphatase 1, regulatory (inhibitor) subunit 12C"""	LENG3		11399775	Standard	NM_017607		Approved	DKFZP434D0412, p84, MBS85, p85	uc002qix.4	Q9BZL4		ENST00000263433.3:c.2133C>G	chr19.hg19:g.55603617G>C		16.0	0.0	.		18.0	5.0	.	NM_017607		Silent	SNP	ENST00000263433.3	hg19	CCDS12916.1																																																																																			.	.	.	none		0.692	PPP1R12C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451814.2	NM_017607	
FASTKD5	60493	hgsc.bcm.edu	37	20	3128940	3128940	+	Silent	SNP	A	A	G			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr20:3128940A>G	ENST00000380266.3	-	2	1098	c.777T>C	c.(775-777)ccT>ccC	p.P259P	UBOX5_ENST00000348031.2_Intron|UBOX5_ENST00000217173.2_Intron|UBOX5-AS1_ENST00000446537.1_RNA	NM_021826.4	NP_068598.1	Q7L8L6	FAKD5_HUMAN	FAST kinase domains 5	259					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(2)|endometrium(2)|large_intestine(2)|lung(8)|prostate(2)|skin(1)|urinary_tract(2)	19						TTAAAAACCTAGGTACTTTGC	0.393																																					p.P259P		Atlas-SNP	.											.	FASTKD5	63	.	0			c.T777C						PASS	.						44.0	46.0	45.0					20																	3128940		2200	4300	6500	SO:0001819	synonymous_variant	60493	exon2			AAACCTAGGTACT	BC007413	CCDS13048.1	20p13	2006-07-07			ENSG00000215251	ENSG00000215251			25790	protein-coding gene	gene with protein product		614272				11347906	Standard	NM_021826		Approved	FLJ13149	uc002whz.4	Q7L8L6	OTTHUMG00000031727	ENST00000380266.3:c.777T>C	chr20.hg19:g.3128940A>G		126.0	0.0	.		122.0	36.0	.	NM_021826	Q96JN3|Q9H5D1|Q9H8Y3	Silent	SNP	ENST00000380266.3	hg19	CCDS13048.1																																																																																			.	.	.	none		0.393	FASTKD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077701.2	NM_021826	
ZHX3	23051	hgsc.bcm.edu	37	20	39831715	39831715	+	Silent	SNP	G	G	T			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr20:39831715G>T	ENST00000309060.3	-	4	2257	c.1842C>A	c.(1840-1842)acC>acA	p.T614T	ZHX3_ENST00000540170.1_Silent_p.T614T|ZHX3_ENST00000544979.2_Silent_p.T614T|ZHX3_ENST00000559234.1_Silent_p.T614T|ZHX3_ENST00000558993.1_Intron|ZHX3_ENST00000557816.1_Intron|ZHX3_ENST00000432768.2_Silent_p.T614T|ZHX3_ENST00000560361.1_Silent_p.T614T			Q9H4I2	ZHX3_HUMAN	zinc fingers and homeoboxes 3	614					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of osteoblast differentiation (GO:0045669)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(2)|kidney(5)|large_intestine(8)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		Myeloproliferative disorder(115;0.00425)				CCTTGTATTTGGTTGGTGTGA	0.537																																					p.T614T		Atlas-SNP	.											.	ZHX3	78	.	0			c.C1842A						PASS	.						161.0	151.0	154.0					20																	39831715		2203	4300	6503	SO:0001819	synonymous_variant	23051	exon3			GTATTTGGTTGGT	AB007855	CCDS13315.1	20q12	2012-03-09	2004-01-29	2004-01-30	ENSG00000174306	ENSG00000174306		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	15935	protein-coding gene	gene with protein product		609598	"""triple homeobox 1"""	TIX1		9455477	Standard	XM_005260343		Approved	KIAA0395	uc002xjs.1	Q9H4I2	OTTHUMG00000032481	ENST00000309060.3:c.1842C>A	chr20.hg19:g.39831715G>T		164.0	0.0	.		281.0	176.0	.	NM_015035	E1P5W5|F5H820|O43145|Q6NUJ7	Silent	SNP	ENST00000309060.3	hg19	CCDS13315.1	.	.	.	.	.	.	.	.	.	.	G	4.135	0.023393	0.08006	.	.	ENSG00000174306	ENST00000421422	.	.	.	6.06	3.94	0.45596	.	.	.	.	.	T	0.60715	0.2290	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58719	-0.7587	4	.	.	.	-16.3993	10.5172	0.44896	0.0731:0.0:0.7373:0.1895	.	.	.	.	K	323	.	.	Q	-	1	0	ZHX3	39265129	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.636000	0.24644	1.567000	0.49668	0.650000	0.86243	CAA	.	.	.	none		0.537	ZHX3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079262.3	NM_015035	
DSCAM	1826	hgsc.bcm.edu	37	21	41710196	41710196	+	Missense_Mutation	SNP	T	T	C			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr21:41710196T>C	ENST00000400454.1	-	8	2092	c.1615A>G	c.(1615-1617)Aag>Gag	p.K539E		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	539	Ig-like C2-type 6.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				TTAGAGTTCTTGTACCATTTA	0.438																																					p.K539E	Melanoma(134;970 1778 1785 21664 32388)	Atlas-SNP	.											.	DSCAM	347	.	0			c.A1615G						PASS	.						179.0	171.0	173.0					21																	41710196		1946	4147	6093	SO:0001583	missense	1826	exon8			AGTTCTTGTACCA	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.1615A>G	chr21.hg19:g.41710196T>C	ENSP00000383303:p.Lys539Glu	235.0	0.0	.		103.0	80.0	.	NM_001271534	O60468	Missense_Mutation	SNP	ENST00000400454.1	hg19	CCDS42929.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.204393	0.79127	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.81330	-1.48;-1.48	5.77	5.77	0.91146	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.93048	0.7787	H	0.97291	3.975	0.43489	D	0.995729	D	0.64830	0.994	D	0.64506	0.926	D	0.95287	0.8391	10	0.72032	D	0.01	.	16.0742	0.80958	0.0:0.0:0.0:1.0	.	539	O60469	DSCAM_HUMAN	E	539;291	ENSP00000383303:K539E;ENSP00000385342:K291E	ENSP00000383303:K539E	K	-	1	0	DSCAM	40632066	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.028000	0.70889	2.198000	0.70561	0.533000	0.62120	AAG	.	.	.	none		0.438	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
IGLL5	100423062	hgsc.bcm.edu	37	22	23237695	23237695	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr22:23237695C>T	ENST00000526893.1	+	3	740	c.466C>T	c.(466-468)Ccc>Tcc	p.P156S	IGLC1_ENST00000390321.2_RNA|IGLJ1_ENST00000390320.2_RNA|IGLL5_ENST00000532223.2_Missense_Mutation_p.P157S|IGLL5_ENST00000531372.1_3'UTR	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	156	C region (By similarity to lambda light- chain).|Ig-like C1-type.					extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						AGATGGCAGCCCCGTCAAGGC	0.597																																					p.P156S		Atlas-SNP	.											.	IGLL5	26	.	0			c.C466T						PASS	.						76.0	80.0	79.0					22																	23237695		2202	4295	6497	SO:0001583	missense	100423062	exon3			GGCAGCCCCGTCA	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.466C>T	chr22.hg19:g.23237695C>T	ENSP00000431254:p.Pro156Ser	48.0	0.0	.		54.0	21.0	.	NM_001178126		Missense_Mutation	SNP	ENST00000526893.1	hg19	CCDS54506.1	.	.	.	.	.	.	.	.	.	.	C	3.861	-0.029965	0.07543	.	.	ENSG00000254709	ENST00000532223;ENST00000526893	T;T	0.02837	4.14;4.14	3.54	-7.09	0.01553	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	.	.	.	.	T	0.02688	0.0081	L	0.42632	1.34	0.09310	N	0.999998	B	0.10296	0.003	B	0.19946	0.027	T	0.37291	-0.9712	9	0.72032	D	0.01	.	5.0659	0.14582	0.1683:0.4504:0.2909:0.0904	.	156	B9A064	IGLL5_HUMAN	S	157;156	ENSP00000436353:P157S;ENSP00000431254:P156S	ENSP00000431254:P156S	P	+	1	0	IGLL5	21567695	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.956000	0.00326	-4.369000	0.00053	-1.188000	0.01700	CCC	.	.	.	none		0.597	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
EIF4ENIF1	56478	hgsc.bcm.edu	37	22	31837941	31837941	+	Silent	SNP	T	T	C			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr22:31837941T>C	ENST00000397525.1	-	17	2593	c.2370A>G	c.(2368-2370)agA>agG	p.R790R	EIF4ENIF1_ENST00000344710.5_Silent_p.R616R|EIF4ENIF1_ENST00000330125.5_Silent_p.R790R|EIF4ENIF1_ENST00000397523.1_Silent_p.R766R|EIF4ENIF1_ENST00000382180.2_Silent_p.R445R|EIF4ENIF1_ENST00000441289.1_5'Flank	NM_001164501.1	NP_001157973.1	Q9NRA8	4ET_HUMAN	eukaryotic translation initiation factor 4E nuclear import factor 1	790						cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						TGGGTGTTTTTCTCCCAGTTG	0.527																																					p.R790R		Atlas-SNP	.											.	EIF4ENIF1	80	.	0			c.A2370G						PASS	.						321.0	298.0	306.0					22																	31837941		2203	4300	6503	SO:0001819	synonymous_variant	56478	exon17			TGTTTTTCTCCCA	AF240775	CCDS13898.1, CCDS54520.1	22q11.2	2007-01-16			ENSG00000184708	ENSG00000184708			16687	protein-coding gene	gene with protein product		607445				10856257	Standard	NM_019843		Approved	4E-T, FLJ21601, Clast4, 2610509L04Rik	uc003akz.2	Q9NRA8	OTTHUMG00000030793	ENST00000397525.1:c.2370A>G	chr22.hg19:g.31837941T>C		185.0	0.0	.		184.0	19.0	.	NM_019843	B1AKL2|B1AKL3|B2RBF1|Q8NCF2|Q9H708	Silent	SNP	ENST00000397525.1	hg19	CCDS13898.1																																																																																			.	.	.	none		0.527	EIF4ENIF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127926.1	NM_019843	
CELSR1	9620	hgsc.bcm.edu	37	22	46931045	46931045	+	Missense_Mutation	SNP	T	T	C			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr22:46931045T>C	ENST00000262738.3	-	1	2022	c.2023A>G	c.(2023-2025)Atc>Gtc	p.I675V	CELSR1_ENST00000395964.1_Missense_Mutation_p.I675V|CELSR1_ENST00000497509.1_5'Flank	NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	675	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		AGCACCGTGATGGACACGCTG	0.657																																					p.I675V		Atlas-SNP	.											.	CELSR1	242	.	0			c.A2023G						PASS	.						33.0	23.0	26.0					22																	46931045		2198	4299	6497	SO:0001583	missense	9620	exon1			CCGTGATGGACAC	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.2023A>G	chr22.hg19:g.46931045T>C	ENSP00000262738:p.Ile675Val	26.0	0.0	.		43.0	13.0	.	NM_014246	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	ENST00000262738.3	hg19	CCDS14076.1	.	.	.	.	.	.	.	.	.	.	T	0.117	-1.131052	0.01756	.	.	ENSG00000075275	ENST00000262738;ENST00000395964	T;T	0.48522	0.81;1.31	4.51	2.38	0.29361	Cadherin (5);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.64402	U	0.000002	T	0.25975	0.0633	N	0.20845	0.615	0.32913	D	0.514725	B	0.31040	0.305	B	0.33750	0.169	T	0.35400	-0.9790	10	0.05436	T	0.98	.	7.9257	0.29872	0.0:0.1734:0.0:0.8266	.	675	Q9NYQ6	CELR1_HUMAN	V	675	ENSP00000262738:I675V;ENSP00000379293:I675V	ENSP00000262738:I675V	I	-	1	0	CELSR1	45309709	1.000000	0.71417	1.000000	0.80357	0.779000	0.44077	1.649000	0.37281	0.608000	0.30000	0.254000	0.18369	ATC	.	.	.	none		0.657	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318037.1	NM_014246	
MBTPS2	51360	hgsc.bcm.edu	37	X	21857904	21857904	+	Missense_Mutation	SNP	T	T	C			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chrX:21857904T>C	ENST00000379484.5	+	1	151	c.52T>C	c.(52-54)Tac>Cac	p.Y18H	MBTPS2_ENST00000465888.1_3'UTR|MBTPS2_ENST00000365779.2_Missense_Mutation_p.Y18H	NM_015884.3	NP_056968.1	O43462	MBTP2_HUMAN	membrane-bound transcription factor peptidase, site 2	18					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cholesterol metabolic process (GO:0008203)|endoplasmic reticulum unfolded protein response (GO:0030968)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|endometrium(3)|large_intestine(3)|lung(13)|ovary(1)|skin(2)	24						GACTGTCGTCTACCTGACCGA	0.672																																					p.Y18H		Atlas-SNP	.											.	MBTPS2	52	.	0			c.T52C						PASS	.						116.0	50.0	72.0					X																	21857904		2196	4291	6487	SO:0001583	missense	51360	exon1			GTCGTCTACCTGA	AF019612	CCDS14201.1	Xp22.12-p22.11	2014-02-03	2005-08-17		ENSG00000012174	ENSG00000012174			15455	protein-coding gene	gene with protein product		300294	"""membrane-bound transcription factor protease, site 2"", ""keratosis follicularis spinulosa decalvans"""	KFSD		9847074, 9659902, 20672378	Standard	NM_015884		Approved	S2P	uc004dae.3	O43462	OTTHUMG00000021237	ENST00000379484.5:c.52T>C	chrX.hg19:g.21857904T>C	ENSP00000368798:p.Tyr18His	9.0	0.0	.		5.0	5.0	.	NM_015884	Q9UM70|Q9UMD3	Missense_Mutation	SNP	ENST00000379484.5	hg19	CCDS14201.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.095893	0.76870	.	.	ENSG00000012174	ENST00000379484;ENST00000365779	D;D	0.94280	-3.39;-2.25	5.29	5.29	0.74685	.	0.121945	0.56097	D	0.000021	D	0.95582	0.8564	M	0.62723	1.935	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.83275	0.996;0.946;0.946	D	0.95070	0.8203	10	0.42905	T	0.14	-7.7197	13.24	0.59992	0.0:0.0:0.0:1.0	.	18;18;18	A8KA68;O43462;B9ZVQ3	.;MBTP2_HUMAN;.	H	18	ENSP00000368798:Y18H;ENSP00000368796:Y18H	ENSP00000368796:Y18H	Y	+	1	0	MBTPS2	21767825	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	5.780000	0.68956	1.768000	0.52137	0.486000	0.48141	TAC	.	.	.	none		0.672	MBTPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056026.1		
SPIN3	169981	hgsc.bcm.edu	37	X	57021007	57021007	+	Missense_Mutation	SNP	G	G	C			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chrX:57021007G>C	ENST00000374919.3	-	2	696	c.374C>G	c.(373-375)gCa>gGa	p.A125G		NM_001010862.2	NP_001010862.2	Q5JUX0	SPIN3_HUMAN	spindlin family, member 3	125					gamete generation (GO:0007276)					central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)	4						CATTATTTCTGCCAAGTGTGT	0.418																																					p.A125G		Atlas-SNP	.											.	SPIN3	33	.	0			c.C374G						PASS	.						144.0	141.0	142.0					X																	57021007		2073	4205	6278	SO:0001583	missense	169981	exon2			ATTTCTGCCAAGT	AL832091	CCDS43963.1	Xp11.22	2008-02-05			ENSG00000204271	ENSG00000204271			27272	protein-coding gene	gene with protein product							Standard	NM_001010862		Approved		uc004dux.1	Q5JUX0	OTTHUMG00000021677	ENST00000374919.3:c.374C>G	chrX.hg19:g.57021007G>C	ENSP00000364054:p.Ala125Gly	287.0	0.0	.		217.0	11.0	.	NM_001010862	B2RUW3|B7Z8W2|Q8N5D9	Missense_Mutation	SNP	ENST00000374919.3	hg19	CCDS43963.1	.	.	.	.	.	.	.	.	.	.	G	6.700	0.497740	0.12762	.	.	ENSG00000204271	ENST00000374919	T	0.52057	0.68	2.3	1.43	0.22495	.	0.090478	0.42548	U	0.000686	T	0.46268	0.1384	M	0.81497	2.545	0.31005	N	0.719843	B	0.18610	0.029	B	0.21708	0.036	T	0.52419	-0.8578	10	0.87932	D	0	-0.3707	6.6117	0.22755	0.1624:0.0:0.8376:0.0	.	125	Q5JUX0	SPIN3_HUMAN	G	125	ENSP00000364054:A125G	ENSP00000364054:A125G	A	-	2	0	SPIN3	57037732	1.000000	0.71417	0.072000	0.20136	0.179000	0.23085	3.759000	0.55227	0.418000	0.25898	0.600000	0.82982	GCA	.	.	.	none		0.418	SPIN3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056908.1	XM_093024	
MT-ND1	4535	hgsc.bcm.edu	37	M	3890	3890	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chrM:3890G>A	ENST00000361390.2	+	1	584	c.584G>A	c.(583-585)cGa>cAa	p.R195Q	MT-CO1_ENST00000361624.2_5'Flank|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-ND2_ENST00000361453.3_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1	195					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	AGAGACCAACCGAACCCCCTT	0.512																																					p.R195Q		Atlas-SNP	.											.	.	.	.	0			c.G584A						PASS	.																																			SO:0001583	missense	10625	exon1			CCAACCGAACCCC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886		ENST00000361390.2:c.584G>A	chrM.hg19:g.3890G>A	ENSP00000354687:p.Arg195Gln	10.0	0.0	.		111.0	105.0	.	ENST00000361390	C0JKH6|Q37523	Missense_Mutation	SNP	ENST00000361390.2	hg19																																																																																				.	.	.	none		0.512	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024026	
MT-CO3	4514	hgsc.bcm.edu	37	M	9612	9612	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chrM:9612G>A	ENST00000362079.2	+	1	406	c.406G>A	c.(406-408)Gta>Ata	p.V136I	MT-TL2_ENST00000387456.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-ND4_ENST00000361381.2_5'Flank|MT-TR_ENST00000387439.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-TS2_ENST00000387449.1_RNA			P00414	COX3_HUMAN	mitochondrially encoded cytochrome c oxidase III	136					aerobic electron transport chain (GO:0019646)|cellular metabolic process (GO:0044237)|respiratory chain complex IV assembly (GO:0008535)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)			breast(1)|endometrium(10)|kidney(14)|lung(1)|urinary_tract(1)	27						TAAACACATCCGTATTACTCG	0.483																																					p.V136M		Atlas-SNP	.											.	.	.	.	0			c.G406A						PASS	.																																			SO:0001583	missense	5742	exon1			ACATCCGTATTAC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198938	ENSG00000198938		"""Mitochondrial respiratory chain complex / Complex IV"""	7422	protein-coding gene	gene with protein product		516050	"""cytochrome c oxidase III"""	MTCO3			Standard			Approved	COX3, COIII, CO3		P00414		ENST00000362079.2:c.406G>A	chrM.hg19:g.9612G>A	ENSP00000354982:p.Val136Ile	11.0	0.0	.		79.0	8.0	.	ENST00000362079	Q14Y83	Missense_Mutation	SNP	ENST00000362079.2	hg19																																																																																				.	.	.	none		0.483	MT-CO3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024032	
MT-ND5	4540	hgsc.bcm.edu	37	M	12640	12640	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chrM:12640G>A	ENST00000361567.2	+	1	304	c.304G>A	c.(304-306)Gaa>Aaa	p.E102K	MT-TL2_ENST00000387456.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	102					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						GGTCCATCATAGAATTCTCAC	0.373																																					p.E102K		Atlas-SNP	.											.	.	.	.	0			c.G304A						PASS	.																																			SO:0001583	missense	0	exon1			ATCATAGAATTCT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.304G>A	chrM.hg19:g.12640G>A	ENSP00000354813:p.Glu102Lys	15.0	0.0	.		61.0	7.0	.	ENST00000361567	Q34773|Q8WCY3	Missense_Mutation	SNP	ENST00000361567.2	hg19																																																																																				.	.	.	none		0.373	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
MT-ND6	4541	hgsc.bcm.edu	37	M	14348	14348	+	Missense_Mutation	SNP	T	T	C			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chrM:14348T>C	ENST00000361681.2	-	1	325	c.326A>G	c.(325-327)tAt>tGt	p.Y109C	MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA			P03923	NU6M_HUMAN	mitochondrially encoded NADH dehydrogenase 6	109					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain (GO:0070469)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(10)|kidney(17)|urinary_tract(1)	29						CCACCCCATCATACTCTTTCA	0.498																																					p.Y109C		Atlas-SNP	.											.	.	.	.	0			c.A326G						PASS	.																																			SO:0001583	missense	0	exon1			CCATCATACTCTT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198695	ENSG00000198695	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7462	protein-coding gene	gene with protein product	"""complex I ND6 subunit"", ""NADH-ubiquinone oxidoreductase chain 6"""	516006	"""NADH dehydrogenase 6"""	MTND6			Standard			Approved	NAD6, ND6		P03923		ENST00000361681.2:c.326A>G	chrM.hg19:g.14348T>C	ENSP00000354665:p.Tyr109Cys	19.0	0.0	.		91.0	6.0	.	ENST00000361681	Q34774|Q8HG30	Missense_Mutation	SNP	ENST00000361681.2	hg19																																																																																				.	.	.	none		0.498	MT-ND6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024037	
BPNT1	10380	hgsc.bcm.edu	37	1	220232228	220232229	+	Frame_Shift_Ins	INS	-	-	GCATA			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr1:220232228_220232229insGCATA	ENST00000469520.2	-	10	1333_1334	c.884_885insTATGC	c.(883-885)gcafs	p.-295fs	BPNT1_ENST00000544404.1_Frame_Shift_Ins_p.-240fs|BPNT1_ENST00000414869.2_Frame_Shift_Ins_p.-259fs|BPNT1_ENST00000354807.3_Intron|BPNT1_ENST00000322067.7_Frame_Shift_Ins_p.-295fs			O95861	BPNT1_HUMAN	3'(2'), 5'-bisphosphate nucleotidase 1						3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|dephosphorylation (GO:0016311)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|phosphatidylinositol phosphorylation (GO:0046854)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	3'(2'),5'-bisphosphate nucleotidase activity (GO:0008441)|inositol-1,4-bisphosphate 1-phosphatase activity (GO:0004441)|magnesium ion binding (GO:0000287)			breast(1)|endometrium(1)|large_intestine(1)|lung(9)|ovary(1)|skin(1)	14				GBM - Glioblastoma multiforme(131;0.0558)		GAACTCGGCTTGCATAGTAGTC	0.46																																					p.A295fs		Atlas-INDEL	.											.	BPNT1	29	.	0			c.885_886insTATGC						PASS	.																																			SO:0001589	frameshift_variant	10380	exon9			.	AF125042	CCDS41469.1, CCDS65787.1, CCDS65788.1	1q42	2008-02-05			ENSG00000162813	ENSG00000162813	3.1.3.7		1096	protein-coding gene	gene with protein product		604053				10224133	Standard	XM_005272998		Approved		uc001hma.3	O95861	OTTHUMG00000037435	ENST00000469520.2:c.880_884dupTATGC	chr1.hg19:g.220232229_220232233dupGCATA	ENSP00000446828:p.Ala295fs	413.0	0.0	0		296.0	28.0	0.0945946	NM_006085	A8K7C8|B4DPS5|B4DUS9|D3DTA9|Q8WVL5|Q9UGJ3	Frame_Shift_Ins	INS	ENST00000469520.2	hg19	CCDS41469.1																																																																																			.	.	.	none		0.460	BPNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091137.2	NM_006085	
DDX5	1655	hgsc.bcm.edu	37	17	62500099	62500102	+	Splice_Site	DEL	ACAG	ACAG	-			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	ACAG	ACAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr17:62500099_62500102delACAG	ENST00000225792.5	-	4	841_843	c.440_442delCTGT	c.(439-444)tctgta>tta	p.SV147fs	DDX5_ENST00000580026.1_5'Flank|MIR5047_ENST00000579212.1_RNA|DDX5_ENST00000578804.1_Splice_Site_p.SV147fs|DDX5_ENST00000450599.2_Intron|CEP95_ENST00000556440.2_5'Flank	NM_004396.3	NP_004387.1	P17844	DDX5_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 5	147	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cell growth (GO:0016049)|circadian rhythm (GO:0007623)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of osteoblast differentiation (GO:0045667)|regulation of skeletal muscle cell differentiation (GO:2001014)|regulation of viral genome replication (GO:0045069)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA helicase activity (GO:0003724)|transcription coactivator activity (GO:0003713)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	19	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			TCCCAAACTTACAGACAATGTTTT	0.397			T	ETV4	prostate																																p.147_147del	NSCLC(22;406 813 4871 19580 40307)	Atlas-INDEL	.		Dom	yes		17	17q21	1655	DEAD (Asp-Glu-Ala-Asp) box polypeptide 5		E	.	DDX5	101	.	0			c.441_441del						PASS	.																																			SO:0001630	splice_region_variant	1655	exon4			.	AF015812	CCDS11659.1	17q21	2012-07-27	2012-02-23		ENSG00000108654	ENSG00000108654		"""DEAD-boxes"""	2746	protein-coding gene	gene with protein product		180630	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 5 (RNA helicase, 68kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 5"""	HLR1, G17P1		22156369, 18698352	Standard	NM_004396		Approved	p68	uc002jek.2	P17844	OTTHUMG00000178936	ENST00000225792.5:c.441+1CTGT>-	chr17.hg19:g.62500099_62500102delACAG		294.0	0.0	0		179.0	45.0	0.251397	NM_004396	B4DLW8|B5BU21|D3DU32|E7ETL9|O75681|Q53Y61	Frame_Shift_Del	DEL	ENST00000225792.5	hg19	CCDS11659.1																																																																																			.	.	.	none		0.397	DDX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444030.1	NM_004396	Frame_Shift_Del
KCNS2	3788	hgsc.bcm.edu	37	8	99441466	99441466	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr8:99441466delA	ENST00000287042.4	+	2	1609	c.1259delA	c.(1258-1260)caafs	p.Q420fs	KCNS2_ENST00000521839.1_Frame_Shift_Del_p.Q420fs	NM_020697.2	NP_065748.1	Q9ULS6	KCNS2_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2	420					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			autonomic_ganglia(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	31	Breast(36;2.4e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.0448)			TACCGGCGCCAAAAGCAACTT	0.498																																					p.Q420fs	Pancreas(138;844 2489 9202 24627)	Atlas-INDEL	.											.	KCNS2	93	.	0			c.1258delC						PASS	.						116.0	116.0	116.0					8																	99441466		2203	4300	6503	SO:0001589	frameshift_variant	3788	exon2			.	AB032970	CCDS6279.1	8q22	2011-07-05			ENSG00000156486	ENSG00000156486		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6301	protein-coding gene	gene with protein product		602906				9305895, 16382104	Standard	NM_020697		Approved	Kv9.2	uc003yin.3	Q9ULS6	OTTHUMG00000044337	ENST00000287042.4:c.1259delA	chr8.hg19:g.99441466delA	ENSP00000287042:p.Gln420fs	273.0	0.0	0		271.0	114.0	0.420664	NM_020697	A8KAN1	Frame_Shift_Del	DEL	ENST00000287042.4	hg19	CCDS6279.1																																																																																			.	.	.	none		0.498	KCNS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103134.1	NM_020697	
CD248	57124	hgsc.bcm.edu	37	11	66082566	66082566	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr11:66082566delT	ENST00000311330.3	-	1	1949	c.1933delA	c.(1933-1935)atcfs	p.I645fs	RP11-867G23.13_ENST00000534065.1_RNA	NM_020404.2	NP_065137.1	Q9HCU0	CD248_HUMAN	CD248 molecule, endosialin	645	Pro-rich.				anatomical structure regression (GO:0060033)|cell migration (GO:0016477)|lymph node development (GO:0048535)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	26						TCCCTTGGGATTTGGGGGGCT	0.657																																					p.I645fs		Atlas-INDEL	.											.	CD248	69	.	0			c.1934delT						PASS	.						33.0	37.0	36.0					11																	66082566		2199	4291	6490	SO:0001589	frameshift_variant	57124	exon1			.	AF279142	CCDS8134.1	11q13	2006-04-12	2006-03-28	2005-02-11	ENSG00000174807	ENSG00000174807		"""CD molecules"""	18219	protein-coding gene	gene with protein product	"""endosialin"", ""tumor endothelial marker 1"""	606064	"""CD164 sialomucin-like 1"", ""CD248 antigen, endosialin"""	CD164L1		10947988, 11084048	Standard	NM_020404		Approved	TEM1	uc001ohm.1	Q9HCU0	OTTHUMG00000167073	ENST00000311330.3:c.1933delA	chr11.hg19:g.66082566delT	ENSP00000308117:p.Ile645fs	143.0	0.0	0		148.0	64.0	0.432432	NM_020404	Q2M2V5|Q3SX55|Q96KB6	Frame_Shift_Del	DEL	ENST00000311330.3	hg19	CCDS8134.1																																																																																			.	.	.	none		0.657	CD248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392922.2	NM_020404	
EIF5	1983	hgsc.bcm.edu	37	14	103807312	103807312	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr14:103807312delA	ENST00000216554.3	+	12	1895	c.1219delA	c.(1219-1221)aagfs	p.K407fs	EIF5_ENST00000558506.1_Frame_Shift_Del_p.K407fs|EIF5_ENST00000392715.2_Frame_Shift_Del_p.K407fs	NM_001969.4	NP_001960.2	P55010	IF5_HUMAN	eukaryotic translation initiation factor 5	407					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|regulation of translational initiation (GO:0006446)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(3)|kidney(2)|large_intestine(3)|lung(5)|pancreas(2)|skin(2)|upper_aerodigestive_tract(1)	18		Melanoma(154;0.155)	Epithelial(46;0.182)			GGTGTATTCGAAGGCTGCCAG	0.378																																					p.S406fs		Atlas-INDEL	.											.	EIF5	40	.	0			c.1218delG						PASS	.						133.0	112.0	119.0					14																	103807312		2203	4300	6503	SO:0001589	frameshift_variant	1983	exon11			.	U49436	CCDS9980.1	14q32.32	2006-05-11				ENSG00000100664			3299	protein-coding gene	gene with protein product		601710				8663286	Standard	NM_001969		Approved		uc001ymq.4	P55010		ENST00000216554.3:c.1219delA	chr14.hg19:g.103807312delA	ENSP00000216554:p.Lys407fs	118.0	0.0	0		54.0	16.0	0.296296	NM_183004	Q53XB3|Q9H5N2|Q9UG48	Frame_Shift_Del	DEL	ENST00000216554.3	hg19	CCDS9980.1																																																																																			.	.	.	none		0.378	EIF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415329.2	NM_001969	
ZNF17	7565	hgsc.bcm.edu	37	19	57931956	57931959	+	Frame_Shift_Del	DEL	TTCT	TTCT	-			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	TTCT	TTCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr19:57931956_57931959delTTCT	ENST00000601808.1	+	3	1309_1312	c.1096_1099delTTCT	c.(1096-1101)ttctttfs	p.FF366fs	ZNF17_ENST00000307658.7_Frame_Shift_Del_p.FF368fs|AC004076.7_ENST00000597410.1_Intron	NM_006959.2	NP_008890.2	P17021	ZNF17_HUMAN	zinc finger protein 17	366					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0234)|GBM - Glioblastoma multiforme(193;0.000426)|Lung(386;0.176)		ATGTGGGAAATTCTTTATGGACAG	0.387																																					p.365_366del	Melanoma(149;1637 1853 29914 42869 44988)	Atlas-INDEL	.											.	ZNF17	49	.	0			c.1095_1098del						PASS	.																																			SO:0001589	frameshift_variant	7565	exon3			.	X52341	CCDS42636.1	19q13.43	2013-01-08	2006-05-10			ENSG00000186272		"""Zinc fingers, C2H2-type"", ""-"""	12958	protein-coding gene	gene with protein product			"""zinc finger protein 17 (HPF3, KOX 10)"""			2115127, 2014798	Standard	NM_006959		Approved	HPF3, KOX10, KIAA1947, FLJ40864, FLJ46058, FLJ46615	uc002qoo.1	P17021		ENST00000601808.1:c.1096_1099delTTCT	chr19.hg19:g.57931956_57931959delTTCT	ENSP00000471905:p.Phe366fs	245.0	0.0	0		145.0	15.0	0.103448	NM_006959	B3KXU2|B3KY20|Q8N7M1|Q8N893|Q8TF54	Frame_Shift_Del	DEL	ENST00000601808.1	hg19	CCDS42636.1																																																																																			.	.	.	none		0.387	ZNF17-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466384.1	NM_006959	
NXF1	10482	hgsc.bcm.edu	37	11	62567920	62567921	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr11:62567920_62567921insG	ENST00000532297.1	-	11	1573_1574	c.944_945insC	c.(943-945)ctgfs	p.L315fs	NXF1_ENST00000439713.2_Frame_Shift_Ins_p.L315fs|NXF1_ENST00000531131.1_Frame_Shift_Ins_p.L178fs|NXF1_ENST00000294172.2_Frame_Shift_Ins_p.L315fs|NXF1_ENST00000531709.2_Frame_Shift_Ins_p.L315fs			Q9UBU9	NXF1_HUMAN	nuclear RNA export factor 1	315					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear inclusion body (GO:0042405)|nuclear pore (GO:0005643)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(9)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CTTCTAGCTTCAGCCCCTTTAT	0.55																																					p.L315fs		Atlas-INDEL	.											.	NXF1	67	.	0			c.945_946insC						PASS	.																																			SO:0001589	frameshift_variant	10482	exon10			.	AF112880	CCDS8037.1, CCDS44629.1	11q12-q13	2008-07-21			ENSG00000162231	ENSG00000162231			8071	protein-coding gene	gene with protein product	"""tip associating protein"""	602647				9175835, 9660949	Standard	NM_001081491		Approved	TAP, Mex67, DKFZp667O0311	uc001nvf.1	Q9UBU9	OTTHUMG00000167612	ENST00000532297.1:c.944_945insC	chr11.hg19:g.62567920_62567921insG	ENSP00000436679:p.Leu315fs	95.0	0.0	0		87.0	23.0	0.264368	NM_006362	B4E269|Q99799|Q9UQL2	Frame_Shift_Ins	INS	ENST00000532297.1	hg19	CCDS8037.1																																																																																			.	.	.	none		0.550	NXF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395365.2	NM_006362	
ATP7B	540	hgsc.bcm.edu	37	13	52548120	52548120	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr13:52548120delT	ENST00000242839.4	-	2	1392	c.1236delA	c.(1234-1236)gaafs	p.E412fs	ATP7B_ENST00000482841.1_5'UTR|ATP7B_ENST00000400366.3_Frame_Shift_Del_p.E301fs|ATP7B_ENST00000344297.5_Frame_Shift_Del_p.E412fs|ATP7B_ENST00000418097.2_Frame_Shift_Del_p.E412fs|ATP7B_ENST00000400370.3_Frame_Shift_Del_p.E412fs|ATP7B_ENST00000542656.1_Frame_Shift_Del_p.E380fs|ATP7B_ENST00000448424.2_Frame_Shift_Del_p.E412fs	NM_000053.3	NP_000044.2	P35670	ATP7B_HUMAN	ATPase, Cu++ transporting, beta polypeptide	412	HMA 4. {ECO:0000255|PROSITE- ProRule:PRU00280}.				cellular copper ion homeostasis (GO:0006878)|cellular zinc ion homeostasis (GO:0006882)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|intracellular copper ion transport (GO:0015680)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|response to copper ion (GO:0046688)|sequestering of calcium ion (GO:0051208)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|mitochondrion (GO:0005739)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper-exporting ATPase activity (GO:0004008)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(23)|ovary(1)|prostate(3)|skin(4)|stomach(2)	55		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)	Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	CAGCTCTGAGTTCTTCTGGGC	0.468									Wilson disease																												p.L413fs		Atlas-INDEL	.											.	ATP7B	123	.	0			c.1237delC						PASS	.						105.0	101.0	102.0					13																	52548120		1930	4134	6064	SO:0001589	frameshift_variant	540	exon2	Familial Cancer Database		.	U11700	CCDS41892.1, CCDS45049.1, CCDS58293.1	13q14.3	2012-10-22	2005-11-29		ENSG00000123191	ENSG00000123191	3.6.3.4	"""ATPases / P-type"""	870	protein-coding gene	gene with protein product	"""Wilson disease"", ""copper pump 2"", ""copper-transporting ATPase 2"""	606882	"""ATPase, Cu++ transporting, beta polypeptide (Wilson disease)"""	WND		8298641, 8298639	Standard	NM_000053		Approved		uc001vfw.2	P35670	OTTHUMG00000017406	ENST00000242839.4:c.1236delA	chr13.hg19:g.52548120delT	ENSP00000242839:p.Glu412fs	163.0	0.0	0		147.0	59.0	0.401361	NM_000053	Q16318|Q16319|Q4U3V3|Q59FJ9|Q5T7X7	Frame_Shift_Del	DEL	ENST00000242839.4	hg19	CCDS41892.1																																																																																			.	.	.	none		0.468	ATP7B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045981.1	NM_000053	
LY9	4063	hgsc.bcm.edu	37	1	160771585	160771585	+	Intron	DEL	T	T	-			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr1:160771585delT	ENST00000263285.6	+	2	484				LY9_ENST00000471816.1_Intron|LY9_ENST00000368039.2_Frame_Shift_Del_p.F154fs|LY9_ENST00000341032.4_Intron|LY9_ENST00000368037.5_Intron|LY9_ENST00000392203.4_Intron|LY9_ENST00000368040.1_Intron|LY9_ENST00000368041.2_Intron			Q9HBG7	LY9_HUMAN	lymphocyte antigen 9						cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			cccagcaccatttattgaaaa	0.473																																					p.P153fs		Atlas-INDEL	.											.	LY9	115	.	0			c.459delA						PASS	.						84.0	92.0	89.0					1																	160771585		2203	4300	6503	SO:0001627	intron_variant	4063	exon3			.	L42621	CCDS30916.1, CCDS30917.1, CCDS65695.1, CCDS65696.1	1q23.3	2013-01-11			ENSG00000122224	ENSG00000122224		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6730	protein-coding gene	gene with protein product		600684				8537117, 7797269	Standard	NM_001261457		Approved	CD229, mLY9, SLAMF3, hly9	uc001fwu.4	Q9HBG7	OTTHUMG00000024007	ENST00000263285.6:c.454+1713T>-	chr1.hg19:g.160771585delT		251.0	0.0	0		284.0	121.0	0.426056	NM_001033667	A8K7N3|Q14775|Q5VYI3|Q6P2J4|Q9H4N5|Q9NQ24	Frame_Shift_Del	DEL	ENST00000263285.6	hg19	CCDS30916.1																																																																																			.	.	.	none		0.473	LY9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060457.3	NM_002348	
NR2F2	7026	hgsc.bcm.edu	37	15	96875754	96875755	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr15:96875754_96875755insT	ENST00000394166.3	+	1	1809_1810	c.420_421insT	c.(421-423)aaafs	p.K141fs	NR2F2_ENST00000421109.2_Intron|MIR1469_ENST00000410719.1_RNA|NR2F2_ENST00000453270.2_5'Flank|NR2F2_ENST00000394171.2_5'Flank	NM_021005.3	NP_066285.1	P24468	COT2_HUMAN	nuclear receptor subfamily 2, group F, member 2	141	Interaction with ZFPM2. {ECO:0000250}.				anterior/posterior pattern specification (GO:0009952)|blood vessel morphogenesis (GO:0048514)|fertilization (GO:0009566)|forebrain development (GO:0030900)|intracellular receptor signaling pathway (GO:0030522)|limb development (GO:0060173)|lipid metabolic process (GO:0006629)|maternal placenta development (GO:0001893)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron migration (GO:0001764)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|radial pattern formation (GO:0009956)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to estradiol (GO:0032355)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|liver(2)|lung(3)|ovary(2)|urinary_tract(1)	17	Lung NSC(78;0.0186)|Melanoma(26;0.0195)|all_lung(78;0.0297)		OV - Ovarian serous cystadenocarcinoma(32;0.0856)			AAAAGTGCCTCAAAGTGGGCAT	0.604																																					p.L140fs		Atlas-INDEL	.											.	NR2F2	35	.	0			c.420_421insT						PASS	.																																			SO:0001589	frameshift_variant	7026	exon1			.	M64497	CCDS10375.1, CCDS45358.1, CCDS45359.1	15q26	2013-01-16			ENSG00000185551	ENSG00000185551		"""Nuclear hormone receptors"""	7976	protein-coding gene	gene with protein product		107773		ARP1, TFCOUP2		8530078, 11544252	Standard	NM_021005		Approved	COUP-TFII, COUPTFB, SVP40, NF-E3	uc010uri.2	P24468	OTTHUMG00000149848	Exception_encountered	chr15.hg19:g.96875754_96875755insT	ENSP00000377721:p.Lys141fs	72.0	0.0	0		87.0	23.0	0.264368	NM_021005	B4DQJ2|B6ZGU1|Q03754|Q3KQR7	Frame_Shift_Ins	INS	ENST00000394166.3	hg19	CCDS10375.1																																																																																			.	.	.	none		0.604	NR2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313534.1		
OR2J3	442186	hgsc.bcm.edu	37	6	29080474	29080475	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	TT	TT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr6:29080474_29080475delTT	ENST00000377169.1	+	1	807_808	c.807_808delTT	c.(805-810)aattctfs	p.S270fs		NM_001005216.2	NP_001005216.2	O76001	OR2J3_HUMAN	olfactory receptor, family 2, subfamily J, member 3	270						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(5)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	24						CATCAGGAAATTCTCAAGATCA	0.441																																					p.269_269del		Atlas-INDEL	.											.	OR2J3	53	.	0			c.806_807del						PASS	.																																			SO:0001589	frameshift_variant	442186	exon1			.		CCDS43433.1	6p22.2-p21.31	2012-08-09			ENSG00000204701	ENSG00000204701		"""GPCR / Class A : Olfactory receptors"""	8261	protein-coding gene	gene with protein product		615016					Standard	NM_001005216		Approved	OR6-6	uc011dll.2	O76001	OTTHUMG00000031092	ENST00000377169.1:c.807_808delTT	chr6.hg19:g.29080474_29080475delTT	ENSP00000366374:p.Ser270fs	216.0	0.0	0		89.0	79.0	0.88764	NM_001005216	B0UY52|B9EH11|Q5SUJ7|Q6IF25|Q96R15|Q9GZK5|Q9GZL4|Q9GZL5	Frame_Shift_Del	DEL	ENST00000377169.1	hg19	CCDS43433.1																																																																																			.	.	.	none		0.441	OR2J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076132.2		
PCSK2	5126	hgsc.bcm.edu	37	20	17207956	17207957	+	In_Frame_Ins	INS	-	-	GGT			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr20:17207956_17207957insGGT	ENST00000262545.2	+	1	321_322	c.6_7insGGT	c.(7-9)ggt>GGTggt	p.3_3G>GG	PCSK2_ENST00000377899.1_Intron|PCSK2_ENST00000536609.1_In_Frame_Ins_p.3_3G>GG	NM_002594.3	NP_002585.2	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	3					cellular protein metabolic process (GO:0044267)|embryo development (GO:0009790)|enkephalin processing (GO:0034230)|insulin processing (GO:0030070)|islet amyloid polypeptide processing (GO:0034231)|nervous system development (GO:0007399)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	dendrite (GO:0030425)|extracellular space (GO:0005615)|membrane (GO:0016020)|perikaryon (GO:0043204)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|lung(17)|ovary(3)|pancreas(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	53					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	GAAGGATGAAGGGTGGTTGTGT	0.53																																					p.K2delinsKG		Atlas-INDEL	.											.	PCSK2	112	.	0			c.6_7insGGT						PASS	.																																			SO:0001652	inframe_insertion	5126	exon1			.	AK312341	CCDS13125.1, CCDS56179.1, CCDS56180.1	20p11.2	2008-08-01			ENSG00000125851	ENSG00000125851			8744	protein-coding gene	gene with protein product	"""neuroendocrine convertase 2"", ""KEX2-like endoprotease 2"""	162151		NEC2		1765368	Standard	NM_001201528		Approved	PC2, SPC2	uc002wpm.3	P16519	OTTHUMG00000031941	ENST00000262545.2:c.10_12dupGGT	chr20.hg19:g.17207960_17207962dupGGT	ENSP00000262545:p.Gly4dup	193.0	0.0	0		218.0	92.0	0.422018	NM_002594	B1ANH9|B4DFQ3|Q14927|Q5JYQ1|Q8IWA8|Q9NQG3|Q9NUG1|Q9UJC6	In_Frame_Ins	INS	ENST00000262545.2	hg19	CCDS13125.1																																																																																			.	.	.	none		0.530	PCSK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078120.2	NM_002594	
POLDIP3	84271	hgsc.bcm.edu	37	22	42998037	42998037	+	Frame_Shift_Del	DEL	G	G	-	rs569033722		TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr22:42998037delG	ENST00000252115.5	-	3	580	c.476delC	c.(475-477)ccafs	p.P159fs	POLDIP3_ENST00000451060.2_Frame_Shift_Del_p.P3fs|POLDIP3_ENST00000339677.6_Intron|POLDIP3_ENST00000491021.1_5'UTR|POLDIP3_ENST00000348657.2_Intron	NM_032311.3	NP_115687.2	Q9BY77	PDIP3_HUMAN	polymerase (DNA-directed), delta interacting protein 3	159					poly(A)+ mRNA export from nucleus (GO:0016973)|positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(3)|upper_aerodigestive_tract(1)	16						GGGATGAAGTGGTGCCATGGC	0.498																																					p.P159fs	Ovarian(52;967 1128 5875 19997 42537)	Atlas-INDEL	.											.	POLDIP3	58	.	0			c.477delA						PASS	.						245.0	211.0	222.0					22																	42998037		2203	4300	6503	SO:0001589	frameshift_variant	84271	exon3			.		CCDS14038.1, CCDS14039.1, CCDS74873.1	22q13.31	2013-02-12			ENSG00000100227	ENSG00000100227		"""RNA binding motif (RRM) containing"""	23782	protein-coding gene	gene with protein product		611520				12522211	Standard	NM_032311		Approved	PDIP46, KIAA1649	uc003bcu.3	Q9BY77	OTTHUMG00000150887	ENST00000252115.5:c.476delC	chr22.hg19:g.42998037delG	ENSP00000252115:p.Pro159fs	243.0	0.0	0		201.0	80.0	0.39801	NM_032311	A8K6F8|A8K6V9|Q009A7|Q5H972|Q6PGN6|Q7Z6Z0|Q9NSP5|Q9NSP6	Frame_Shift_Del	DEL	ENST00000252115.5	hg19	CCDS14038.1																																																																																			.	.	.	none		0.498	POLDIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320433.1	NM_032311	
SPATA31D1	389763	hgsc.bcm.edu	37	9	84609703	84609703	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AL-3468-01A-01D-1252-08	TCGA-AL-3468-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3ace8906-6fda-48fe-8e46-4140e9ed7fce	e04284b9-b5a9-481b-b1bb-0377a566a154	g.chr9:84609703delA	ENST00000344803.2	+	4	4365	c.4318delA	c.(4318-4320)aaafs	p.K1440fs		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	1440					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GGGGCTTGGGAAAGCTCAGCA	0.552																																					p.G1439fs		Atlas-INDEL	.											.	.	.	.	0			c.4317delG						PASS	.						41.0	41.0	41.0					9																	84609703		1915	4112	6027	SO:0001589	frameshift_variant	389763	exon4			.		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.4318delA	chr9.hg19:g.84609703delA	ENSP00000341988:p.Lys1440fs	87.0	0.0	0		85.0	29.0	0.341176	NM_001001670		Frame_Shift_Del	DEL	ENST00000344803.2	hg19	CCDS47986.1																																																																																			.	.	.	none		0.552	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670	
