#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
GRIK3	2899	hgsc.bcm.edu	37	1	37307384	37307384	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr1:37307384C>T	ENST00000373091.3	-	10	1499	c.1483G>A	c.(1483-1485)Gat>Aat	p.D495N	GRIK3_ENST00000373093.4_Missense_Mutation_p.D495N	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	495					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)			breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				CCCTTGTCATCCTGTGCCCCG	0.597																																					p.D495N		Atlas-SNP	.											.	GRIK3	195	.	0			c.G1483A						PASS	.						176.0	151.0	159.0					1																	37307384		2203	4300	6503	SO:0001583	missense	2899	exon10			TGTCATCCTGTGC	U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.1483G>A	chr1.hg19:g.37307384C>T	ENSP00000362183:p.Asp495Asn	245.0	0.0	.		371.0	177.0	.	NM_000831	A9Z1Z8|B1AMS6|Q13004|Q16136	Missense_Mutation	SNP	ENST00000373091.3	hg19	CCDS416.1	.	.	.	.	.	.	.	.	.	.	C	5.820	0.335627	0.11013	.	.	ENSG00000163873	ENST00000373091;ENST00000373093	T;T	0.76060	-0.99;-0.99	4.86	4.86	0.63082	Glutamate receptor, L-glutamate/glycine-binding (2);Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	T	0.60932	0.2307	N	0.20881	0.62	0.54753	D	0.999986	B;B	0.06786	0.001;0.001	B;B	0.09377	0.004;0.004	T	0.57312	-0.7833	10	0.09338	T	0.73	.	18.3613	0.90375	0.0:1.0:0.0:0.0	.	495;495	A9Z1Z8;Q13003	.;GRIK3_HUMAN	N	495	ENSP00000362183:D495N;ENSP00000362185:D495N	ENSP00000362183:D495N	D	-	1	0	GRIK3	37079971	1.000000	0.71417	0.993000	0.49108	0.530000	0.34684	4.928000	0.63447	2.398000	0.81561	0.591000	0.81541	GAT	.	.	.	none		0.597	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012053.1	NM_000831	
CRTC2	200186	hgsc.bcm.edu	37	1	153924730	153924730	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr1:153924730G>A	ENST00000368633.1	-	10	888	c.761C>T	c.(760-762)cCa>cTa	p.P254L	CRTC2_ENST00000476883.1_5'Flank|CRTC2_ENST00000368630.3_Intron	NM_181715.2	NP_859066.1	Q53ET0	CRTC2_HUMAN	CREB regulated transcription coactivator 2	254					gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|histone H3-K9 acetylation (GO:0043970)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	cAMP response element binding protein binding (GO:0008140)			NS(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	27	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GTCAGGAGATGGAAAGATGCT	0.552																																					p.P254L		Atlas-SNP	.											.	CRTC2	58	.	0			c.C761T						PASS	.						57.0	62.0	60.0					1																	153924730		2203	4300	6503	SO:0001583	missense	200186	exon10			GGAGATGGAAAGA	AY360172	CCDS30875.1	1q21.3	2008-02-05			ENSG00000160741	ENSG00000160741			27301	protein-coding gene	gene with protein product		608972				14506290, 14536081	Standard	NM_181715		Approved	TORC2	uc021pab.1	Q53ET0	OTTHUMG00000037156	ENST00000368633.1:c.761C>T	chr1.hg19:g.153924730G>A	ENSP00000357622:p.Pro254Leu	117.0	0.0	.		176.0	72.0	.	NM_181715	Q6UUV8|Q7Z3X7|Q8N332	Missense_Mutation	SNP	ENST00000368633.1	hg19	CCDS30875.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.966111	0.74131	.	.	ENSG00000160741	ENST00000368633	T	0.71817	-0.6	4.67	3.76	0.43208	Transducer of regulated CREB activity, middle domain (1);	0.213044	0.40554	N	0.001070	T	0.76385	0.3980	M	0.80332	2.49	0.51767	D	0.999939	D	0.58970	0.984	D	0.62955	0.909	T	0.80086	-0.1529	10	0.87932	D	0	-3.0813	10.3415	0.43882	0.0961:0.0:0.9039:0.0	.	254	Q53ET0	CRTC2_HUMAN	L	254	ENSP00000357622:P254L	ENSP00000357622:P254L	P	-	2	0	CRTC2	152191354	1.000000	0.71417	0.961000	0.40146	0.979000	0.70002	6.923000	0.75817	1.195000	0.43115	0.455000	0.32223	CCA	.	.	.	none		0.552	CRTC2-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090272.3	NM_181715	
HAPLN2	60484	hgsc.bcm.edu	37	1	156593855	156593855	+	Silent	SNP	C	C	T			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr1:156593855C>T	ENST00000255039.1	+	4	749	c.342C>T	c.(340-342)gtC>gtT	p.V114V		NM_021817.2	NP_068589.1	Q9GZV7	HPLN2_HUMAN	hyaluronan and proteoglycan link protein 2	114	Ig-like V-type.				cell adhesion (GO:0007155)|establishment of blood-nerve barrier (GO:0008065)|extracellular matrix assembly (GO:0085029)	proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			NS(1)|endometrium(2)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(1)	7	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CCTCCCTGGTCATCGCGGGCG	0.692																																					p.V114V		Atlas-SNP	.											.	HAPLN2	20	.	0			c.C342T						PASS	.						30.0	29.0	30.0					1																	156593855		2191	4256	6447	SO:0001819	synonymous_variant	60484	exon4			CCTGGTCATCGCG	AB049054	CCDS1148.1	1q23.1	2013-01-11			ENSG00000132702	ENSG00000132702		"""Immunoglobulin superfamily / V-set domain containing"""	17410	protein-coding gene	gene with protein product	"""brain link protein 1"""					11027579, 11873941	Standard	NM_021817		Approved	BRAL1	uc001fpn.1	Q9GZV7	OTTHUMG00000033205	ENST00000255039.1:c.342C>T	chr1.hg19:g.156593855C>T		53.0	0.0	.		76.0	45.0	.	NM_021817	Q5T3J0	Silent	SNP	ENST00000255039.1	hg19	CCDS1148.1																																																																																			.	.	.	none		0.692	HAPLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081039.1	NM_021817	
USH2A	7399	hgsc.bcm.edu	37	1	216073458	216073458	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr1:216073458C>T	ENST00000307340.3	-	40	7939	c.7553G>A	c.(7552-7554)aGt>aAt	p.S2518N	USH2A_ENST00000366943.2_Missense_Mutation_p.S2518N|RP5-1111A8.3_ENST00000414995.1_RNA	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2518	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ACTATGTGCACTGCCAAATCC	0.423										HNSCC(13;0.011)																											p.S2518N		Atlas-SNP	.											.	USH2A	1168	.	0			c.G7553A						PASS	.						146.0	120.0	129.0					1																	216073458		2203	4300	6503	SO:0001583	missense	7399	exon40			TGTGCACTGCCAA	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.7553G>A	chr1.hg19:g.216073458C>T	ENSP00000305941:p.Ser2518Asn	217.0	0.0	.		34.0	17.0	.	NM_206933	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	hg19	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	C	15.26	2.781126	0.49891	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.54071	0.59;0.59	6.16	4.3	0.51218	Fibronectin, type III (5);Immunoglobulin-like fold (1);	0.558407	0.16087	N	0.230233	T	0.47783	0.1464	L	0.46157	1.445	0.09310	N	1	P	0.43231	0.801	P	0.46419	0.516	T	0.33727	-0.9857	10	0.32370	T	0.25	.	4.9527	0.14023	0.0:0.5906:0.1598:0.2496	.	2518	O75445	USH2A_HUMAN	N	2518	ENSP00000305941:S2518N;ENSP00000355910:S2518N	ENSP00000305941:S2518N	S	-	2	0	USH2A	214140081	0.558000	0.26554	0.182000	0.23118	0.991000	0.79684	1.002000	0.29796	0.923000	0.37045	0.650000	0.86243	AGT	.	.	.	none		0.423	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
TSGA10	80705	hgsc.bcm.edu	37	2	99689479	99689479	+	Splice_Site	SNP	A	A	C			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr2:99689479A>C	ENST00000393483.3	-	13	1783		c.e13+1		TSGA10_ENST00000355053.4_Splice_Site|TSGA10_ENST00000410001.1_Splice_Site|TSGA10_ENST00000539964.1_Splice_Site|TSGA10_ENST00000542655.1_Intron|TSGA10_ENST00000478090.1_Splice_Site	NM_025244.2	NP_079520.1	Q9BZW7	TSG10_HUMAN	testis specific, 10						cell projection assembly (GO:0030031)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|membrane (GO:0016020)|motile cilium (GO:0031514)|neuron projection (GO:0043005)|nucleus (GO:0005634)				NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	34						CGACTGATTTACCTTGATGCC	0.353																																					.		Atlas-SNP	.											.	TSGA10	81	.	0			c.938+2T>G						PASS	.						158.0	136.0	144.0					2																	99689479		2203	4300	6503	SO:0001630	splice_region_variant	80705	exon14			TGATTTACCTTGA	AF254756	CCDS2037.1	2q11.2	2009-08-06			ENSG00000135951	ENSG00000135951			14927	protein-coding gene	gene with protein product	"""cancer/testis antigen 79"""	607166				11179690	Standard	NM_025244		Approved	CEP4L, CT79	uc002szi.4	Q9BZW7	OTTHUMG00000130637	ENST00000393483.3:c.938+1T>G	chr2.hg19:g.99689479A>C		405.0	0.0	.		212.0	105.0	.	NM_025244	B7Z925|D3DVH7|Q8NEP0|Q9BWX0	Splice_Site	SNP	ENST00000393483.3	hg19	CCDS2037.1	.	.	.	.	.	.	.	.	.	.	A	17.47	3.398383	0.62177	.	.	ENSG00000135951	ENST00000393483;ENST00000410001;ENST00000355053;ENST00000539964;ENST00000409564;ENST00000393482	.	.	.	4.94	4.94	0.65067	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.9136	0.47122	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TSGA10	99055911	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	5.076000	0.64413	2.092000	0.63282	0.477000	0.44152	.	.	.	.	none		0.353	TSGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253125.1	NM_182911	Intron
SLC25A12	8604	hgsc.bcm.edu	37	2	172647961	172647961	+	Splice_Site	SNP	C	C	G			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr2:172647961C>G	ENST00000422440.2	-	15	1622	c.1585G>C	c.(1585-1587)Ggt>Cgt	p.G529R	SLC25A12_ENST00000392592.4_Splice_Site_p.G422R	NM_003705.4	NP_003696.2	O75746	CMC1_HUMAN	solute carrier family 25 (aspartate/glutamate carrier), member 12	529					aspartate transport (GO:0015810)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|L-glutamate transport (GO:0015813)|malate-aspartate shuttle (GO:0043490)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|upper_aerodigestive_tract(1)	23			OV - Ovarian serous cystadenocarcinoma(117;0.216)		L-Aspartic Acid(DB00128)	TTGTAGTTACCTGCCATGGCT	0.353																																					p.G529R		Atlas-SNP	.											.	SLC25A12	59	.	0			c.G1585C						PASS	.						68.0	70.0	69.0					2																	172647961		2203	4300	6503	SO:0001630	splice_region_variant	8604	exon15			AGTTACCTGCCAT	Y14494	CCDS33327.1	2q24	2013-05-22	2012-03-29		ENSG00000115840	ENSG00000115840		"""Solute carriers"", ""EF-hand domain containing"""	10982	protein-coding gene	gene with protein product		603667	"""solute carrier family 25 (mitochondrial carrier, Aralar), member 12"""			9722566, 10702666, 11566871	Standard	NM_003705		Approved	Aralar	uc002uhh.3	O75746	OTTHUMG00000134290	ENST00000422440.2:c.1585+1G>C	chr2.hg19:g.172647961C>G		191.0	0.0	.		146.0	60.0	.	NM_003705	B3KR64|Q96AM8	Missense_Mutation	SNP	ENST00000422440.2	hg19	CCDS33327.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.952520	0.92660	.	.	ENSG00000115840	ENST00000422440;ENST00000392592	D;D	0.85339	-1.97;-1.97	5.92	5.92	0.95590	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.95242	0.8457	H	0.95712	3.71	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	D	0.95808	0.8839	9	.	.	.	-13.0108	20.3206	0.98668	0.0:1.0:0.0:0.0	.	422;529	B3KR64;O75746	.;CMC1_HUMAN	R	529;422	ENSP00000388658:G529R;ENSP00000376371:G422R	.	G	-	1	0	SLC25A12	172356207	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.784000	0.85713	2.809000	0.96659	0.655000	0.94253	GGT	.	.	.	none		0.353	SLC25A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259010.2	NM_003705	Missense_Mutation
SF3B1	23451	hgsc.bcm.edu	37	2	198260814	198260814	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr2:198260814C>T	ENST00000335508.6	-	23	3596	c.3505G>A	c.(3505-3507)Gta>Ata	p.V1169I		NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	1169					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)			NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			AACGGTGTTACGGCATAAATG	0.323			Mis		myelodysplastic syndrome																																p.V1169I		Atlas-SNP	.		Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	.	SF3B1	1038	.	0			c.G3505A						PASS	.						111.0	108.0	109.0					2																	198260814		2203	4300	6503	SO:0001583	missense	23451	exon23			GTGTTACGGCATA	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.3505G>A	chr2.hg19:g.198260814C>T	ENSP00000335321:p.Val1169Ile	322.0	0.0	.		105.0	43.0	.	NM_012433	E9PCH3	Missense_Mutation	SNP	ENST00000335508.6	hg19	CCDS33356.1	.	.	.	.	.	.	.	.	.	.	C	14.40	2.524051	0.44866	.	.	ENSG00000115524	ENST00000335508	T	0.63744	-0.06	5.11	5.11	0.69529	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.58949	0.2158	L	0.50847	1.595	0.80722	D	1	D	0.56035	0.974	B	0.42361	0.385	T	0.57289	-0.7837	10	0.24483	T	0.36	.	19.0887	0.93217	0.0:1.0:0.0:0.0	.	1169	O75533	SF3B1_HUMAN	I	1169	ENSP00000335321:V1169I	ENSP00000335321:V1169I	V	-	1	0	SF3B1	197969059	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.534000	0.82004	2.826000	0.97356	0.655000	0.94253	GTA	.	.	.	none		0.323	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		
ITIH3	3699	hgsc.bcm.edu	37	3	52830615	52830615	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr3:52830615C>T	ENST00000449956.2	+	3	239	c.233C>T	c.(232-234)tCc>tTc	p.S78F	ITIH3_ENST00000416872.2_Missense_Mutation_p.S78F	NM_002217.3	NP_002208.3	Q06033	ITIH3_HUMAN	inter-alpha-trypsin inhibitor heavy chain 3	78	VIT. {ECO:0000255|PROSITE- ProRule:PRU00801}.				hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(6)|ovary(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		AAGGAGGTTTCCTTTGATGTG	0.562																																					p.S78F		Atlas-SNP	.											.	ITIH3	132	.	0			c.C233T						PASS	.						76.0	82.0	80.0					3																	52830615		2122	4276	6398	SO:0001583	missense	3699	exon3			AGGTTTCCTTTGA		CCDS46845.1	3p21.1	2011-10-26	2011-10-26		ENSG00000162267	ENSG00000162267			6168	protein-coding gene	gene with protein product	"""pre-alpha (globulin) inhibitor, H3 polypeptide"", ""inter-alpha-trypsin inhibitor heavy chain H3"""	146650	"""inter-alpha (globulin) inhibitor, H3 polypeptide"", ""inter-alpha (globulin) inhibitor H3"""			2465147, 10100603	Standard	NM_002217		Approved	H3P	uc003dfv.2	Q06033	OTTHUMG00000158956	ENST00000449956.2:c.233C>T	chr3.hg19:g.52830615C>T	ENSP00000415769:p.Ser78Phe	42.0	0.0	.		48.0	18.0	.	NM_002217	Q3B7H5|Q53F06|Q6LAM2|Q99085	Missense_Mutation	SNP	ENST00000449956.2	hg19	CCDS46845.1	.	.	.	.	.	.	.	.	.	.	C	7.116	0.576936	0.13686	.	.	ENSG00000162267	ENST00000398670;ENST00000536431;ENST00000273291;ENST00000416872;ENST00000449956	T;T	0.23552	1.9;1.9	4.43	2.45	0.29901	Vault protein inter-alpha-trypsin (2);Vault protein inter-alpha-trypsin, metazoa (1);	0.175288	0.50627	N	0.000112	T	0.10423	0.0255	N	0.10972	0.075	0.35532	D	0.802333	B;B	0.06786	0.001;0.001	B;B	0.13407	0.002;0.009	T	0.15694	-1.0428	10	0.17369	T	0.5	-12.815	4.7553	0.13080	0.0:0.6593:0.0:0.3407	.	78;78	E7ET33;Q06033	.;ITIH3_HUMAN	F	78;78;73;78;78	ENSP00000413922:S78F;ENSP00000415769:S78F	ENSP00000273291:S73F	S	+	2	0	ITIH3	52805655	0.000000	0.05858	0.973000	0.42090	0.946000	0.59487	-0.476000	0.06591	1.088000	0.41272	0.591000	0.81541	TCC	.	.	.	none		0.562	ITIH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352668.2	NM_002217	
ZNF654	55279	hgsc.bcm.edu	37	3	88190087	88190087	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr3:88190087A>T	ENST00000309495.5	+	1	1834	c.1627A>T	c.(1627-1629)Aga>Tga	p.R543*	CGGBP1_ENST00000462901.1_Intron	NM_018293.2	NP_060763.2	Q8IZM8	ZN654_HUMAN	zinc finger protein 654	543					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|large_intestine(2)|lung(1)|ovary(2)|pancreas(1)|prostate(3)	12		Lung NSC(201;0.0283)		UCEC - Uterine corpus endometrioid carcinoma (27;0.194)|LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00661)		ATCAGTGAAAAGATTAAGATG	0.383																																					p.R543X		Atlas-SNP	.											.	ZNF654	56	.	0			c.A1627T						PASS	.						77.0	71.0	73.0					3																	88190087		1854	4098	5952	SO:0001587	stop_gained	55279	exon1			GTGAAAAGATTAA	AF543494	CCDS46874.1	3p11.1	2005-01-10			ENSG00000175105	ENSG00000175105			25612	protein-coding gene	gene with protein product							Standard	NM_018293		Approved	FLJ10997, FLJ21142	uc003dqv.3	Q8IZM8	OTTHUMG00000159097	ENST00000309495.5:c.1627A>T	chr3.hg19:g.88190087A>T	ENSP00000312141:p.Arg543*	119.0	0.0	.		19.0	6.0	.	NM_018293	Q9H791|Q9NV14	Nonsense_Mutation	SNP	ENST00000309495.5	hg19	CCDS46874.1	.	.	.	.	.	.	.	.	.	.	a	39	7.456045	0.98296	.	.	ENSG00000175105	ENST00000309495	.	.	.	5.48	5.48	0.80851	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.7425	0.69467	1.0:0.0:0.0:0.0	.	.	.	.	X	543	.	ENSP00000312141:R543X	R	+	1	2	ZNF654	88272777	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.207000	0.72159	2.069000	0.61940	0.468000	0.43344	AGA	.	.	.	none		0.383	ZNF654-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353285.2	NM_018293	
LYAR	55646	hgsc.bcm.edu	37	4	4276342	4276342	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr4:4276342C>T	ENST00000343470.4	-	7	824	c.584G>A	c.(583-585)cGg>cAg	p.R195Q	LYAR_ENST00000452476.1_Missense_Mutation_p.R195Q	NM_017816.2	NP_060286	Q9NX58	LYAR_HUMAN	Ly1 antibody reactive	195	Lys-rich.					nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(6)|liver(2)|lung(5)|ovary(1)|prostate(1)	17				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		tttcttctgccgttcttcctt	0.438																																					p.R195Q		Atlas-SNP	.											.	LYAR	36	.	0			c.G584A						PASS	.						138.0	128.0	132.0					4																	4276342		2203	4300	6503	SO:0001583	missense	55646	exon7			TTCTGCCGTTCTT	AL136750	CCDS3374.1	4p16.3	2013-01-10	2012-12-07		ENSG00000145220	ENSG00000145220		"""Zinc fingers, C2HC-type containing"""	26021	protein-coding gene	gene with protein product			"""Ly1 antibody reactive homolog (mouse)"""			11230166, 8491376	Standard	NM_001145725		Approved	ZC2HC2, ZLYAR	uc003ght.3	Q9NX58	OTTHUMG00000125477	ENST00000343470.4:c.584G>A	chr4.hg19:g.4276342C>T	ENSP00000345917:p.Arg195Gln	256.0	0.0	.		301.0	137.0	.	NM_017816	D3DVS4|Q6FI78|Q9NYS1	Missense_Mutation	SNP	ENST00000343470.4	hg19	CCDS3374.1	.	.	.	.	.	.	.	.	.	.	C	12.94	2.089165	0.36855	.	.	ENSG00000145220	ENST00000343470;ENST00000452476	T;T	0.32753	1.44;1.44	5.19	5.19	0.71726	.	0.286976	0.36338	N	0.002645	T	0.30230	0.0758	M	0.72894	2.215	0.46222	D	0.998937	P	0.48503	0.911	B	0.31946	0.138	T	0.33523	-0.9865	10	0.44086	T	0.13	-12.7208	16.5728	0.84629	0.0:1.0:0.0:0.0	.	195	Q9NX58	LYAR_HUMAN	Q	195	ENSP00000345917:R195Q;ENSP00000397367:R195Q	ENSP00000345917:R195Q	R	-	2	0	LYAR	4327243	1.000000	0.71417	0.986000	0.45419	0.130000	0.20726	2.673000	0.46858	2.571000	0.86741	0.655000	0.94253	CGG	.	.	.	none		0.438	LYAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246800.2	NM_017816	
NSUN7	79730	hgsc.bcm.edu	37	4	40810405	40810405	+	Missense_Mutation	SNP	G	G	C			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr4:40810405G>C	ENST00000381782.2	+	12	2101	c.1606G>C	c.(1606-1608)Ggt>Cgt	p.G536R	NSUN7_ENST00000316607.5_3'UTR	NM_024677.4	NP_078953	Q8NE18	NSUN7_HUMAN	NOP2/Sun domain family, member 7	536							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|cervix(1)|large_intestine(1)|lung(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	12						GATTGAGTTGGGTAAATCATC	0.428																																					p.G536R		Atlas-SNP	.											.	NSUN7	70	.	0			c.G1606C						PASS	.						81.0	67.0	71.0					4																	40810405		692	1591	2283	SO:0001583	missense	79730	exon12			GAGTTGGGTAAAT	BC036568	CCDS3461.2	4p14	2013-10-11	2009-11-23		ENSG00000179299	ENSG00000179299		"""NOP2/Sun domain containing"""	25857	protein-coding gene	gene with protein product			"""NOL1/NOP2/Sun domain family, member 7"""			17442852	Standard	NM_024677		Approved	FLJ14001	uc003gvj.4	Q8NE18	OTTHUMG00000128597	ENST00000381782.2:c.1606G>C	chr4.hg19:g.40810405G>C	ENSP00000371201:p.Gly536Arg	162.0	0.0	.		145.0	63.0	.	NM_024677	C9JI19|Q8N9K8|Q9H815	Missense_Mutation	SNP	ENST00000381782.2	hg19	CCDS3461.2	.	.	.	.	.	.	.	.	.	.	G	15.27	2.783124	0.49891	.	.	ENSG00000179299	ENST00000381782	T	0.14640	2.49	5.6	3.87	0.44632	.	0.804730	0.11512	N	0.556627	T	0.11623	0.0283	L	0.47716	1.5	0.09310	N	0.999999	P	0.48089	0.905	B	0.39258	0.295	T	0.16837	-1.0389	10	0.31617	T	0.26	-7.9775	6.9881	0.24739	0.1529:0.1439:0.7032:0.0	.	536	Q8NE18	NSUN7_HUMAN	R	536	ENSP00000371201:G536R	ENSP00000371201:G536R	G	+	1	0	NSUN7	40505162	0.935000	0.31712	0.983000	0.44433	0.993000	0.82548	2.018000	0.40991	1.364000	0.46038	0.591000	0.81541	GGT	.	.	.	none		0.428	NSUN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250454.2	NM_024677	
INTU	27152	hgsc.bcm.edu	37	4	128564929	128564929	+	Missense_Mutation	SNP	A	A	G			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr4:128564929A>G	ENST00000335251.6	+	2	503	c.400A>G	c.(400-402)Aat>Gat	p.N134D	INTU_ENST00000296461.5_Missense_Mutation_p.N134D	NM_015693.3	NP_056508.2	Q9ULD6	INTU_HUMAN	inturned planar cell polarity protein	134					cilium assembly (GO:0042384)|hair follicle morphogenesis (GO:0031069)|keratinocyte differentiation (GO:0030216)|limb development (GO:0060173)|negative regulation of cell division (GO:0051782)|negative regulation of keratinocyte proliferation (GO:0010839)|nervous system development (GO:0007399)|positive regulation of smoothened signaling pathway (GO:0045880)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord dorsal/ventral patterning (GO:0021513)	cytoplasm (GO:0005737)				breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	43						AAAAAATAGCAATGACAATGG	0.358																																					p.N134D		Atlas-SNP	.											.	INTU	92	.	0			c.A400G						PASS	.						69.0	71.0	71.0					4																	128564929		2203	4300	6503	SO:0001583	missense	27152	exon2			AATAGCAATGACA	BC051698	CCDS34061.1	4q28.2	2013-03-05	2013-03-05	2006-10-24	ENSG00000164066	ENSG00000164066			29239	protein-coding gene	gene with protein product		610621	"""PDZ domain containing 6"", ""inturned planar cell polarity effector homolog (Drosophila)"""	PDZK6, PDZD6		10574462, 21761479	Standard	NM_015693		Approved	KIAA1284	uc003ifk.2	Q9ULD6	OTTHUMG00000161202	ENST00000335251.6:c.400A>G	chr4.hg19:g.128564929A>G	ENSP00000334003:p.Asn134Asp	167.0	0.0	.		36.0	17.0	.	NM_015693	A1L4N5|D6RAE6|D6RBT4|Q4W5I8|Q86V55	Missense_Mutation	SNP	ENST00000335251.6	hg19	CCDS34061.1	.	.	.	.	.	.	.	.	.	.	A	1.750	-0.489422	0.04352	.	.	ENSG00000164066	ENST00000504491;ENST00000335251;ENST00000296461	T	0.44083	0.93	5.1	2.61	0.31194	.	0.890844	0.09986	N	0.730400	T	0.24736	0.0600	N	0.22421	0.69	0.22127	N	0.999348	B	0.06786	0.001	B	0.04013	0.001	T	0.25152	-1.0140	10	0.25751	T	0.34	-1.097	2.9593	0.05887	0.5157:0.2769:0.0738:0.1336	.	134	Q9ULD6	PDZD6_HUMAN	D	115;134;134	ENSP00000296461:N134D	ENSP00000296461:N134D	N	+	1	0	INTU	128784379	0.341000	0.24801	0.129000	0.21949	0.028000	0.11728	2.259000	0.43259	0.393000	0.25203	0.533000	0.62120	AAT	.	.	.	none		0.358	INTU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364147.2	XM_371707	
PSD2	84249	hgsc.bcm.edu	37	5	139193773	139193773	+	Silent	SNP	T	T	C			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr5:139193773T>C	ENST00000274710.3	+	4	1045	c.840T>C	c.(838-840)gaT>gaC	p.D280D		NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	280	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCTGAAGGATGGCCTGTCAG	0.632																																					p.D280D		Atlas-SNP	.											.	PSD2	88	.	0			c.T840C						PASS	.						108.0	101.0	103.0					5																	139193773		2203	4300	6503	SO:0001819	synonymous_variant	84249	exon4			GAAGGATGGCCTG	AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.840T>C	chr5.hg19:g.139193773T>C		329.0	0.0	.		577.0	261.0	.	NM_032289	D3DQD3|Q8N3J8	Silent	SNP	ENST00000274710.3	hg19	CCDS4216.1																																																																																			.	.	.	none		0.632	PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251339.1	NM_032289	
SLC25A2	83884	hgsc.bcm.edu	37	5	140683030	140683030	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr5:140683030G>A	ENST00000239451.4	-	1	582	c.403C>T	c.(403-405)Cag>Tag	p.Q135*		NM_031947.2	NP_114153.1	Q9BXI2	ORNT2_HUMAN	solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 2	135					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|urea cycle (GO:0000050)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				breast(3)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	19		all_lung(500;0.000249)|Lung NSC(810;0.0011)|Ovarian(839;0.00556)|Breast(839;0.0173)|all_hematologic(541;0.152)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.00204)	L-Ornithine(DB00129)	TACATGGTCTGTAGCCGGCAC	0.522																																					p.Q135X		Atlas-SNP	.											.	SLC25A2	68	.	0			c.C403T						PASS	.						100.0	108.0	105.0					5																	140683030		2203	4300	6503	SO:0001587	stop_gained	83884	exon1			TGGTCTGTAGCCG	AF332005	CCDS4258.1	5q31.3	2013-05-22			ENSG00000120329	ENSG00000120329		"""Solute carriers"""	22921	protein-coding gene	gene with protein product		608157				11004451	Standard	NM_031947		Approved	ORNT2	uc003ljf.3	Q9BXI2	OTTHUMG00000129604	ENST00000239451.4:c.403C>T	chr5.hg19:g.140683030G>A	ENSP00000239451:p.Gln135*	353.0	1.0	.		503.0	204.0	.	NM_031947	Q496C1|Q6XUI0|Q8NFZ2	Nonsense_Mutation	SNP	ENST00000239451.4	hg19	CCDS4258.1	.	.	.	.	.	.	.	.	.	.	G	33	5.250551	0.95305	.	.	ENSG00000120329	ENST00000239451	.	.	.	3.78	3.78	0.43462	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-5.487	13.9383	0.64039	0.0:0.0:1.0:0.0	.	.	.	.	X	135	.	ENSP00000239451:Q135X	Q	-	1	0	SLC25A2	140663214	1.000000	0.71417	0.982000	0.44146	0.942000	0.58702	8.721000	0.91446	2.424000	0.82194	0.650000	0.86243	CAG	.	.	.	none		0.522	SLC25A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251799.2	NM_031947	
SLC22A23	63027	hgsc.bcm.edu	37	6	3410472	3410472	+	Missense_Mutation	SNP	A	A	T			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr6:3410472A>T	ENST00000406686.3	-	3	862	c.863T>A	c.(862-864)tTc>tAc	p.F288Y	SLC22A23_ENST00000436008.2_Missense_Mutation_p.F288Y|SLC22A23_ENST00000380302.4_Missense_Mutation_p.F7Y|SLC22A23_ENST00000490273.1_Missense_Mutation_p.F7Y|SLC22A23_ENST00000380298.2_Missense_Mutation_p.F288Y	NM_015482.1	NP_056297.1	A1A5C7	S22AN_HUMAN	solute carrier family 22, member 23	288					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)	14	Ovarian(93;0.0493)	all_hematologic(90;0.0905)				TCCTTCAAAGAACCTGAGTGT	0.448																																					p.F288Y		Atlas-SNP	.											.	SLC22A23	89	.	0			c.T863A						PASS	.						112.0	96.0	101.0					6																	3410472		2203	4300	6503	SO:0001583	missense	63027	exon3			TCAAAGAACCTGA	AJ420525	CCDS34331.1, CCDS47363.1, CCDS75389.1	6p25.2	2013-05-22	2008-01-11	2008-01-11	ENSG00000137266	ENSG00000137266		"""Solute carriers"""	21106	protein-coding gene	gene with protein product		611697	"""chromosome 6 open reading frame 85"""	C6orf85		17714910	Standard	NM_015482		Approved	FLJ22174	uc003mvm.3	A1A5C7	OTTHUMG00000014144	ENST00000406686.3:c.863T>A	chr6.hg19:g.3410472A>T	ENSP00000385028:p.Phe288Tyr	144.0	0.0	.		64.0	61.0	.	NM_015482	A1A5C8|Q5T8B8|Q6ZMH3|Q8IW73	Missense_Mutation	SNP	ENST00000406686.3	hg19	CCDS47363.1	.	.	.	.	.	.	.	.	.	.	A	29.1	4.980895	0.92982	.	.	ENSG00000137266	ENST00000436008;ENST00000406686;ENST00000380302;ENST00000490273;ENST00000485307;ENST00000467177;ENST00000380298	T;T;T;T;T;T;T	0.62788	0.0;0.0;0.0;0.0;0.0;0.0;0.0	5.17	5.17	0.71159	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.71239	0.3316	M	0.64997	1.995	0.52501	D	0.999957	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.997	T	0.76110	-0.3079	10	0.87932	D	0	-30.1819	15.0144	0.71573	1.0:0.0:0.0:0.0	.	288;288	C9J4Z0;A1A5C7	.;S22AN_HUMAN	Y	288;288;7;7;116;114;288	ENSP00000410245:F288Y;ENSP00000385028:F288Y;ENSP00000369657:F7Y;ENSP00000419463:F7Y;ENSP00000418134:F116Y;ENSP00000418985:F114Y;ENSP00000369653:F288Y	ENSP00000369653:F288Y	F	-	2	0	SLC22A23	3355471	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.770000	0.91746	1.960000	0.56953	0.460000	0.39030	TTC	.	.	.	none		0.448	SLC22A23-006	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353059.1	NM_021945	
PKHD1	5314	hgsc.bcm.edu	37	6	51712728	51712728	+	Missense_Mutation	SNP	A	A	G			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr6:51712728A>G	ENST00000371117.3	-	50	8227	c.7952T>C	c.(7951-7953)cTa>cCa	p.L2651P	PKHD1_ENST00000340994.4_Missense_Mutation_p.L2651P	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	2651					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					CACCAGCAGTAGGTAATTACC	0.458																																					p.L2651P		Atlas-SNP	.											.	PKHD1	927	.	0			c.T7952C						PASS	.						127.0	126.0	127.0					6																	51712728		2203	4300	6503	SO:0001583	missense	5314	exon50			AGCAGTAGGTAAT	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.7952T>C	chr6.hg19:g.51712728A>G	ENSP00000360158:p.Leu2651Pro	267.0	0.0	.		81.0	72.0	.	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	hg19	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	A	15.27	2.784987	0.49997	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.89123	-2.28;-2.47	5.47	5.47	0.80525	.	0.128004	0.36409	N	0.002604	D	0.91606	0.7348	L	0.59436	1.845	0.58432	D	0.999997	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.73708	0.98;0.965;0.981	D	0.92508	0.6014	10	0.62326	D	0.03	.	15.0183	0.71605	1.0:0.0:0.0:0.0	.	2651;2651;2651	A8MVM9;P08F94-2;P08F94	.;.;PKHD1_HUMAN	P	2651	ENSP00000360158:L2651P;ENSP00000341097:L2651P	ENSP00000341097:L2651P	L	-	2	0	PKHD1	51820687	1.000000	0.71417	0.992000	0.48379	0.153000	0.21895	6.098000	0.71458	2.196000	0.70406	0.528000	0.53228	CTA	.	.	.	none		0.458	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
AHI1	54806	hgsc.bcm.edu	37	6	135732541	135732541	+	Missense_Mutation	SNP	G	G	C			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr6:135732541G>C	ENST00000367800.4	-	19	3122	c.2906C>G	c.(2905-2907)aCt>aGt	p.T969S	AHI1_ENST00000417892.2_Missense_Mutation_p.T323S|AHI1_ENST00000327035.6_Missense_Mutation_p.T969S|AHI1_ENST00000457866.2_Missense_Mutation_p.T969S	NM_001134830.1	NP_001128302.1	Q8N157	AHI1_HUMAN	Abelson helper integration site 1	969					cellular protein localization (GO:0034613)|central nervous system development (GO:0007417)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|cloaca development (GO:0035844)|heart looping (GO:0001947)|hindbrain development (GO:0030902)|Kupffer's vesicle development (GO:0070121)|left/right axis specification (GO:0070986)|morphogenesis of a polarized epithelium (GO:0001738)|negative regulation of apoptotic process (GO:0043066)|otic vesicle development (GO:0071599)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of polarized epithelial cell differentiation (GO:0030862)|positive regulation of receptor internalization (GO:0002092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pronephric duct morphogenesis (GO:0039023)|pronephric nephron tubule morphogenesis (GO:0039008)|protein localization to organelle (GO:0033365)|regulation of behavior (GO:0050795)|retina layer formation (GO:0010842)|specification of axis polarity (GO:0065001)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vesicle targeting (GO:0006903)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|nonmotile primary cilium (GO:0031513)|photoreceptor outer segment (GO:0001750)|primary cilium (GO:0072372)|TCTN-B9D complex (GO:0036038)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)	37	Breast(56;0.239)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00904)|OV - Ovarian serous cystadenocarcinoma(155;0.00991)		AGAACTTTCAGTGTGGACAAA	0.373																																					p.T969S		Atlas-SNP	.											.	AHI1	81	.	0			c.C2906G						PASS	.						143.0	137.0	139.0					6																	135732541		1847	4102	5949	SO:0001583	missense	54806	exon20			CTTTCAGTGTGGA	AJ459824	CCDS47483.1, CCDS47484.1	6q23.2	2013-01-10	2005-11-29		ENSG00000135541	ENSG00000135541		"""WD repeat domain containing"""	21575	protein-coding gene	gene with protein product	"""Jouberin"""	608894	"""Abelson helper integration site"""			15060101, 16240161	Standard	NM_017651		Approved	FLJ20069, ORF1, JBTS3	uc003qgj.3	Q8N157	OTTHUMG00000015631	ENST00000367800.4:c.2906C>G	chr6.hg19:g.135732541G>C	ENSP00000356774:p.Thr969Ser	200.0	0.0	.		33.0	27.0	.	NM_001134832	E1P584|Q4FD35|Q504T3|Q5TCP9|Q6P098|Q6PIT6|Q8NDX0|Q9H0H2	Missense_Mutation	SNP	ENST00000367800.4	hg19	CCDS47483.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.95|12.95	2.090823|2.090823	0.36855|0.36855	.|.	.|.	ENSG00000135541|ENSG00000135541	ENST00000367799;ENST00000529865|ENST00000367800;ENST00000457866;ENST00000417892;ENST00000265602;ENST00000327035;ENST00000367801	.|T;T;T;T;T	.|0.37411	.|1.2;1.2;1.2;1.2;1.2	5.69|5.69	2.9|2.9	0.33743|0.33743	.|.	.|0.402955	.|0.30830	.|N	.|0.008787	T|T	0.13114|0.13114	0.0318|0.0318	N|N	0.22421|0.22421	0.69|0.69	0.80722|0.80722	D|D	1|1	.|P;P;B	.|0.40431	.|0.717;0.595;0.451	.|B;B;B	.|0.41271	.|0.352;0.192;0.112	T|T	0.03662|0.03662	-1.1015|-1.1015	5|10	.|0.54805	.|T	.|0.06	-12.9903|-12.9903	9.4417|9.4417	0.38673|0.38673	0.0:0.2946:0.5522:0.1532|0.0:0.2946:0.5522:0.1532	.|.	.|969;969;969	.|Q8N157-2;Q8N157;Q4FD35	.|.;AHI1_HUMAN;.	V|S	469;36|969;969;323;969;969;969	.|ENSP00000356774:T969S;ENSP00000388650:T969S;ENSP00000416867:T323S;ENSP00000265602:T969S;ENSP00000322478:T969S	.|ENSP00000265602:T969S	L|T	-|-	1|2	2|0	AHI1|AHI1	135774234|135774234	0.951000|0.951000	0.32395|0.32395	0.977000|0.977000	0.42913|0.42913	0.960000|0.960000	0.62799|0.62799	0.749000|0.749000	0.26320|0.26320	0.311000|0.311000	0.23014|0.23014	-0.127000|-0.127000	0.14921|0.14921	CTG|ACT	.	.	.	none		0.373	AHI1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391948.1	NM_017651	
RADIL	55698	hgsc.bcm.edu	37	7	4876021	4876021	+	Missense_Mutation	SNP	G	G	T			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr7:4876021G>T	ENST00000399583.3	-	3	938	c.751C>A	c.(751-753)Ctg>Atg	p.L251M	RADIL_ENST00000538469.1_Missense_Mutation_p.L11M|RADIL_ENST00000536091.1_Missense_Mutation_p.L251M	NM_018059.4	NP_060529.4	Q96JH8	RADIL_HUMAN	Ras association and DIL domains	251					multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	microtubule (GO:0005874)				NS(1)|biliary_tract(2)|breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(22)|pancreas(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		AGAAGGAGCAGATGCGGGGAC	0.701																																					p.L251M		Atlas-SNP	.											.	RADIL	110	.	0			c.C751A						PASS	.						16.0	23.0	20.0					7																	4876021		2086	4206	6292	SO:0001583	missense	55698	exon3			GGAGCAGATGCGG	AB058752	CCDS43544.1	7p22.1	2010-08-27			ENSG00000157927	ENSG00000157927			22226	protein-coding gene	gene with protein product		611491				16051602, 17704304	Standard	NM_018059		Approved	FLJ10324, KIAA1849, RASIP2	uc003snj.1	Q96JH8	OTTHUMG00000151753	ENST00000399583.3:c.751C>A	chr7.hg19:g.4876021G>T	ENSP00000382492:p.Leu251Met	12.0	0.0	.		29.0	8.0	.	NM_018059	A4D1Z5|A5YM49|B7ZL20|Q0VFZ9|Q75LH3|Q9BSP5|Q9H0M6|Q9NW43|Q9NWC4	Missense_Mutation	SNP	ENST00000399583.3	hg19	CCDS43544.1	.	.	.	.	.	.	.	.	.	.	G	12.62	1.993465	0.35131	.	.	ENSG00000157927	ENST00000399583;ENST00000316919;ENST00000536091;ENST00000538469	T;T;T	0.06849	3.25;3.25;3.25	4.85	3.96	0.45880	Forkhead-associated (FHA) domain (1);SMAD/FHA domain (1);	0.000000	0.64402	D	0.000002	T	0.29914	0.0748	M	0.82630	2.6	0.35445	D	0.795246	D	0.89917	1.0	D	0.69307	0.963	T	0.43750	-0.9372	10	0.62326	D	0.03	-21.7944	13.6214	0.62138	0.0828:0.0:0.9172:0.0	.	251	Q96JH8	RADIL_HUMAN	M	251;225;251;11	ENSP00000382492:L251M;ENSP00000442533:L251M;ENSP00000442966:L11M	ENSP00000320946:L225M	L	-	1	2	RADIL	4842547	1.000000	0.71417	0.993000	0.49108	0.126000	0.20510	3.872000	0.56085	0.473000	0.27368	-1.598000	0.00824	CTG	.	.	.	none		0.701	RADIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323769.2	NM_018059	
MET	4233	hgsc.bcm.edu	37	7	116415115	116415115	+	Missense_Mutation	SNP	T	T	A			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr7:116415115T>A	ENST00000318493.6	+	15	3450	c.3263T>A	c.(3262-3264)gTg>gAg	p.V1088E	MET_ENST00000539704.1_5'Flank|MET_ENST00000397752.3_Missense_Mutation_p.V1070E			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.V1088E(1)		NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			CAGCATGTAGTGATTGGGCCC	0.433			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																												p.V1088E		Atlas-SNP	.		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	MET,NS,carcinoma,0,1	MET	412	.	1	Substitution - Missense(1)	kidney(1)	c.T3263A						PASS	.						174.0	172.0	172.0					7																	116415115		2077	4220	6297	SO:0001583	missense	4233	exon15	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	ATGTAGTGATTGG	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.3263T>A	chr7.hg19:g.116415115T>A	ENSP00000317272:p.Val1088Glu	316.0	2.0	.		283.0	165.0	.	NM_001127500	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	hg19	CCDS47689.1	.	.	.	.	.	.	.	.	.	.	T	28.0	4.885631	0.91814	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000454623	T;T	0.73681	-0.77;-0.77	5.62	5.62	0.85841	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	D	0.84469	0.5479	M	0.62723	1.935	0.80722	D	1	D;D	0.69078	0.996;0.997	D;D	0.80764	0.994;0.989	D	0.86091	0.1550	10	0.87932	D	0	-15.0307	16.1067	0.81230	0.0:0.0:0.0:1.0	.	1088;1070	P08581-2;P08581	.;MET_HUMAN	E	1070;1088;155	ENSP00000380860:V1070E;ENSP00000317272:V1088E	ENSP00000317272:V1088E	V	+	2	0	MET	116202351	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.310000	0.78947	2.255000	0.74692	0.533000	0.62120	GTG	.	.	.	none		0.433	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3		
KLHL9	55958	hgsc.bcm.edu	37	9	21334413	21334413	+	Missense_Mutation	SNP	A	A	T			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr9:21334413A>T	ENST00000359039.4	-	1	966	c.446T>A	c.(445-447)gTc>gAc	p.V149D	KLHL9_ENST00000537938.1_Missense_Mutation_p.V81D			Q9P2J3	KLHL9_HUMAN	kelch-like family member 9	149					cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|midbody (GO:0030496)				endometrium(9)|large_intestine(7)|lung(10)|ovary(4)|skin(2)	32				Lung(24;8.52e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.118)		ATCCAAAGAGACTCCTGATAT	0.338																																					p.V149D		Atlas-SNP	.											.	KLHL9	61	.	0			c.T446A						PASS	.						39.0	43.0	42.0					9																	21334413		2203	4297	6500	SO:0001583	missense	55958	exon1			AAAGAGACTCCTG	AB037775	CCDS6503.1	9p22	2013-01-30	2013-01-30		ENSG00000198642	ENSG00000198642		"""Kelch-like"", ""BTB/POZ domain containing"""	18732	protein-coding gene	gene with protein product		611201	"""kelch-like 9 (Drosophila)"""				Standard	NM_018847		Approved	KIAA1354, FLJ13568	uc003zoy.3	Q9P2J3	OTTHUMG00000019669	ENST00000359039.4:c.446T>A	chr9.hg19:g.21334413A>T	ENSP00000351933:p.Val149Asp	145.0	0.0	.		133.0	61.0	.	NM_018847	Q8TCQ2	Missense_Mutation	SNP	ENST00000359039.4	hg19	CCDS6503.1	.	.	.	.	.	.	.	.	.	.	A	14.17	2.455753	0.43634	.	.	ENSG00000198642	ENST00000359039;ENST00000537938	T;T	0.73152	-0.7;-0.72	5.21	5.21	0.72293	BTB/POZ-like (1);BTB/POZ fold (1);	0.136382	0.48286	D	0.000181	T	0.72236	0.3435	M	0.68317	2.08	0.80722	D	1	B	0.28933	0.228	B	0.36289	0.221	T	0.74423	-0.3670	10	0.87932	D	0	.	13.3494	0.60593	1.0:0.0:0.0:0.0	.	149	Q9P2J3	KLHL9_HUMAN	D	149;81	ENSP00000351933:V149D;ENSP00000437733:V81D	ENSP00000351933:V149D	V	-	2	0	KLHL9	21324413	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.891000	0.92485	2.111000	0.64477	0.528000	0.53228	GTC	.	.	.	none		0.338	KLHL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051898.2	NM_018847	
RPL12	6136	hgsc.bcm.edu	37	9	130213582	130213582	+	Silent	SNP	G	G	A			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr9:130213582G>A	ENST00000361436.5	-	1	102	c.15C>T	c.(13-15)ttC>ttT	p.F5F	RPL12_ENST00000497322.1_5'UTR|RPL12_ENST00000536368.1_Silent_p.F5F|SNORA65_ENST00000364432.1_RNA|LRSAM1_ENST00000323301.4_5'Flank|LRSAM1_ENST00000373322.1_5'Flank|LRSAM1_ENST00000373324.4_5'Flank|LRSAM1_ENST00000300417.6_5'Flank	NM_000976.3	NP_000967.1	P30050	RL12_HUMAN	ribosomal protein L12	5					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|prostate(1)	4						CGTTGGGGTCGAACTTCGGCG	0.652																																					p.F5F		Atlas-SNP	.											.	RPL12	11	.	0			c.C15T						PASS	.						33.0	36.0	35.0					9																	130213582		2199	4296	6495	SO:0001819	synonymous_variant	6136	exon1			GGGGTCGAACTTC		CCDS6872.1	9q34	2011-04-06			ENSG00000197958	ENSG00000197958		"""L ribosomal proteins"""	10302	protein-coding gene	gene with protein product		180475				8441690	Standard	NM_000976		Approved	L12	uc004bqy.2	P30050	OTTHUMG00000020704	ENST00000361436.5:c.15C>T	chr9.hg19:g.130213582G>A		110.0	0.0	.		171.0	68.0	.	NM_000976	Q5VVV2|Q6PB27	Silent	SNP	ENST00000361436.5	hg19	CCDS6872.1																																																																																			.	.	.	none		0.652	RPL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054189.1		
AKR1E2	83592	hgsc.bcm.edu	37	10	4877871	4877871	+	Missense_Mutation	SNP	C	C	A	rs149822509	byFrequency	TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr10:4877871C>A	ENST00000298375.7	+	4	400	c.329C>A	c.(328-330)cCt>cAt	p.P110H	AKR1E2_ENST00000532248.1_Missense_Mutation_p.P110H|AKR1E2_ENST00000525281.1_3'UTR|AKR1E2_ENST00000334019.4_Missense_Mutation_p.P110H|AKR1E2_ENST00000345253.5_Missense_Mutation_p.P110H	NM_001040177.2	NP_001035267.1	Q96JD6	AKCL2_HUMAN	aldo-keto reductase family 1, member E2	110						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	1,5-anhydro-D-fructose reductase activity (GO:0050571)			NS(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)	15						TCGCAGCCTCCTCATCCAGAA	0.483																																					p.P110H	NSCLC(43;343 1097 20371 28813 45509)	Atlas-SNP	.											.	AKR1E2	30	.	0			c.C329A						PASS	.						82.0	68.0	73.0					10																	4877871		2203	4300	6503	SO:0001583	missense	83592	exon4			AGCCTCCTCATCC	AB040820	CCDS31134.1, CCDS59210.1, CCDS59209.1	10p15.2	2009-09-09	2009-09-09	2009-09-09	ENSG00000165568	ENSG00000165568		"""Aldo-keto reductases"""	23437	protein-coding gene	gene with protein product			"""aldo-keto reductase family 1, member C-like 2"""	AKRDC1, AKR1CL2			Standard	NM_001271021		Approved	MGC10612	uc001ihi.4	Q96JD6	OTTHUMG00000017577	ENST00000298375.7:c.329C>A	chr10.hg19:g.4877871C>A	ENSP00000298375:p.Pro110His	105.0	0.0	.		73.0	26.0	.	NM_001271025	Q86Z16|Q86Z17|Q86Z18|Q9BU71	Missense_Mutation	SNP	ENST00000298375.7	hg19	CCDS31134.1	.	.	.	.	.	.	.	.	.	.	C	12.44	1.940130	0.34283	.	.	ENSG00000165568	ENST00000462718;ENST00000533295;ENST00000298375;ENST00000532248;ENST00000334019;ENST00000345253	T;T;T;T;T	0.50277	0.75;2.3;2.3;2.3;1.87	3.39	2.47	0.30058	NADP-dependent oxidoreductase domain (3);	.	.	.	.	T	0.38268	0.1034	N	0.11201	0.11	0.09310	N	1	B;D;D;D;D	0.55385	0.007;0.965;0.965;0.971;0.965	B;P;P;P;P	0.54372	0.014;0.634;0.634;0.75;0.634	T	0.13764	-1.0497	9	0.72032	D	0.01	.	6.973	0.24658	0.0:0.8714:0.0:0.1286	.	71;110;110;110;110	B7Z7K2;Q96JD6-5;Q96JD6-2;Q96JD6;Q96JD6-3	.;.;.;AKCL2_HUMAN;.	H	6;114;110;110;110;110	ENSP00000435436:P114H;ENSP00000298375:P110H;ENSP00000432947:P110H;ENSP00000335034:P110H;ENSP00000335603:P110H	ENSP00000298375:P110H	P	+	2	0	AKR1E2	4867871	0.000000	0.05858	0.001000	0.08648	0.031000	0.12232	0.340000	0.19892	0.964000	0.38108	0.561000	0.74099	CCT	.	C|0.994;G|0.006	.	alt		0.483	AKR1E2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046520.4	NM_031436	
OR10G8	219869	hgsc.bcm.edu	37	11	123900948	123900948	+	Missense_Mutation	SNP	T	T	G			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr11:123900948T>G	ENST00000431524.1	+	1	652	c.619T>G	c.(619-621)Tcg>Gcg	p.S207A		NM_001004464.1	NP_001004464.1	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G, member 8	207						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|large_intestine(2)|lung(21)|ovary(1)|prostate(5)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	44		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		AATAGTGGCCTCGGGCTGCTT	0.537																																					p.S207A		Atlas-SNP	.											.	OR10G8	132	.	0			c.T619G						PASS	.						193.0	169.0	177.0					11																	123900948		2201	4299	6500	SO:0001583	missense	219869	exon1			GTGGCCTCGGGCT	AB065755	CCDS31704.1	11q24.1	2012-08-09			ENSG00000234560	ENSG00000234560		"""GPCR / Class A : Olfactory receptors"""	14845	protein-coding gene	gene with protein product							Standard	NM_001004464		Approved		uc001pzp.1	Q8NGN5	OTTHUMG00000165968	ENST00000431524.1:c.619T>G	chr11.hg19:g.123900948T>G	ENSP00000389072:p.Ser207Ala	209.0	0.0	.		173.0	71.0	.	NM_001004464	B2RNJ3|Q6IEV2	Missense_Mutation	SNP	ENST00000431524.1	hg19	CCDS31704.1	.	.	.	.	.	.	.	.	.	.	T	2.750	-0.260282	0.05791	.	.	ENSG00000234560	ENST00000431524	T	0.36157	1.27	2.91	2.91	0.33838	GPCR, rhodopsin-like superfamily (1);	0.953949	0.08599	N	0.921764	T	0.23330	0.0564	N	0.01482	-0.84	0.09310	N	1	B	0.30914	0.3	B	0.43194	0.411	T	0.46456	-0.9190	10	0.45353	T	0.12	.	11.0743	0.48021	0.0:0.0:0.0:1.0	.	207	Q8NGN5	O10G8_HUMAN	A	207	ENSP00000389072:S207A	ENSP00000389072:S207A	S	+	1	0	OR10G8	123406158	0.000000	0.05858	0.780000	0.31762	0.263000	0.26337	0.369000	0.20416	1.319000	0.45190	0.455000	0.32223	TCG	.	.	.	none		0.537	OR10G8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387270.1	NM_001004464	
ST14	6768	hgsc.bcm.edu	37	11	130066334	130066334	+	Missense_Mutation	SNP	A	A	G			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr11:130066334A>G	ENST00000278742.5	+	10	1632	c.1214A>G	c.(1213-1215)aAc>aGc	p.N405S		NM_021978.3	NP_068813.1	Q9Y5Y6	ST14_HUMAN	suppression of tumorigenicity 14 (colon carcinoma)	405	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				keratinocyte differentiation (GO:0030216)|proteolysis (GO:0006508)	basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|ovary(3)|pancreas(2)|prostate(1)|skin(3)	32	all_hematologic(175;0.0429)	Lung NSC(97;0.000602)|Breast(109;0.000962)|all_lung(97;0.00126)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0183)|Lung(977;0.228)	Urokinase(DB00013)	GTGGAGATCAACGGGGAGAAG	0.677																																					p.N405S		Atlas-SNP	.											.	ST14	82	.	0			c.A1214G						PASS	.						30.0	27.0	28.0					11																	130066334		2201	4296	6497	SO:0001583	missense	6768	exon10			AGATCAACGGGGA	AF118224	CCDS8487.1	11q24-q25	2011-08-31	2005-11-19		ENSG00000149418	ENSG00000149418		"""Serine peptidases / Transmembrane"""	11344	protein-coding gene	gene with protein product	"""epithin"", ""matriptase"""	606797		PRSS14		9925927, 10373424	Standard	NM_021978		Approved	SNC19, HAI, MT-SP1, TMPRSS14	uc001qfw.3	Q9Y5Y6	OTTHUMG00000165768	ENST00000278742.5:c.1214A>G	chr11.hg19:g.130066334A>G	ENSP00000278742:p.Asn405Ser	39.0	0.0	.		39.0	10.0	.	NM_021978	Q9BS01|Q9H3S0|Q9HB36|Q9HCA3	Missense_Mutation	SNP	ENST00000278742.5	hg19	CCDS8487.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.146950	0.77888	.	.	ENSG00000149418	ENST00000278742;ENST00000525779	T	0.18960	2.18	4.62	4.62	0.57501	CUB (5);	0.000000	0.41097	D	0.000956	T	0.32102	0.0818	L	0.41710	1.295	0.58432	D	0.999999	D;D	0.67145	0.996;0.993	D;D	0.69654	0.936;0.965	T	0.03374	-1.1043	10	0.17832	T	0.49	.	12.2663	0.54681	1.0:0.0:0.0:0.0	.	215;405	B4DYI7;Q9Y5Y6	.;ST14_HUMAN	S	405;307	ENSP00000278742:N405S	ENSP00000278742:N405S	N	+	2	0	ST14	129571544	0.997000	0.39634	0.972000	0.41901	0.891000	0.51852	3.696000	0.54757	1.730000	0.51580	0.533000	0.62120	AAC	.	.	.	none		0.677	ST14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386119.1		
FGF6	2251	hgsc.bcm.edu	37	12	4554499	4554500	+	Missense_Mutation	DNP	CC	CC	AG			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr12:4554499_4554500CC>AG	ENST00000228837.2	-	1	280_281	c.237_238GG>CT	c.(235-240)ttGGtg>ttCTtg	p.79_80LV>FL		NM_020996.1	NP_066276.2	P10767	FGF6_HUMAN	fibroblast growth factor 6	79					angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|myoblast differentiation (GO:0045445)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|sarcolemma (GO:0042383)	growth factor activity (GO:0008083)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)			TTGATCCCCACCAAATAGCCAC	0.653																																					p.V80L|p.L79F		Atlas-SNP	.											.	FGF6	40	.	0			c.G238T|c.G237C						PASS	.																																			SO:0001583	missense	2251	exon1			TCCCCACCAAATA|CCCCACCAAATAG	X63454	CCDS8527.1	12p13	2014-01-30				ENSG00000111241		"""Endogenous ligands"""	3684	protein-coding gene	gene with protein product		134921				16597617	Standard	NM_020996		Approved		uc001qmr.1	P10767		ENST00000228837.2:c.237_238delinsAG	chr12.hg19:g.4554499_4554500delinsAG	ENSP00000228837:p.L79_V80delinsFL	175.0|179.0	0.0	.		244.0|241.0	116.0	.	NM_020996	Q0VAE1	Missense_Mutation	SNP	ENST00000228837.2	hg19	CCDS8527.1																																																																																			.	.	.	none		0.653	FGF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398939.1	NM_020996	
LAG3	3902	hgsc.bcm.edu	37	12	6886462	6886462	+	Missense_Mutation	SNP	C	C	A			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr12:6886462C>A	ENST00000203629.2	+	6	1423	c.1090C>A	c.(1090-1092)Ctg>Atg	p.L364M		NM_002286.5	NP_002277.4	P18627	LAG3_HUMAN	lymphocyte-activation gene 3	364	Ig-like C2-type 3.				cell surface receptor signaling pathway (GO:0007166)|negative regulation of interleukin-2 biosynthetic process (GO:0045085)|negative regulation of T cell activation (GO:0050868)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|MHC class II protein binding (GO:0042289)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						ACCTGGATCCCTGGGGAAGCT	0.512																																					p.L364M		Atlas-SNP	.											.	LAG3	35	.	0			c.C1090A						PASS	.						113.0	112.0	112.0					12																	6886462		2203	4300	6503	SO:0001583	missense	3902	exon6			GGATCCCTGGGGA		CCDS8561.1	12p13.3	2013-01-11			ENSG00000089692	ENSG00000089692		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6476	protein-coding gene	gene with protein product		153337					Standard	NM_002286		Approved	CD223	uc001qqt.4	P18627	OTTHUMG00000169197	ENST00000203629.2:c.1090C>A	chr12.hg19:g.6886462C>A	ENSP00000203629:p.Leu364Met	255.0	0.0	.		383.0	171.0	.	NM_002286	A8K7T9|Q7Z643	Missense_Mutation	SNP	ENST00000203629.2	hg19	CCDS8561.1	.	.	.	.	.	.	.	.	.	.	C	14.51	2.556120	0.45487	.	.	ENSG00000089692	ENST00000203629	T	0.11604	2.76	4.55	2.53	0.30540	.	1.747540	0.02897	N	0.134825	T	0.10937	0.0267	N	0.24115	0.695	0.09310	N	1	P	0.46277	0.875	P	0.44732	0.459	T	0.24584	-1.0156	10	0.33940	T	0.23	2.878	7.2879	0.26350	0.1917:0.6226:0.1858:0.0	.	364	P18627	LAG3_HUMAN	M	364	ENSP00000203629:L364M	ENSP00000203629:L364M	L	+	1	2	LAG3	6756723	0.025000	0.19082	0.471000	0.27229	0.889000	0.51656	-0.025000	0.12413	1.073000	0.40885	0.561000	0.74099	CTG	.	.	.	none		0.512	LAG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402846.1		
TMTC1	83857	hgsc.bcm.edu	37	12	29670368	29670368	+	Silent	SNP	A	A	G			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr12:29670368A>G	ENST00000539277.1	-	14	2219	c.2161T>C	c.(2161-2163)Ttg>Ctg	p.L721L	TMTC1_ENST00000319685.8_5'UTR|TMTC1_ENST00000256062.5_Silent_p.L613L|TMTC1_ENST00000552618.1_Silent_p.L745L|TMTC1_ENST00000551659.1_Silent_p.L783L|RP11-310I24.1_ENST00000549070.1_RNA	NM_001193451.1	NP_001180380.1	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat containing 1	721						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(1)|endometrium(4)|kidney(3)|large_intestine(17)|lung(45)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					ACCAGTGCCAAGCGGAGCTCC	0.517																																					p.L721L		Atlas-SNP	.											.	TMTC1	147	.	0			c.T2161C						PASS	.						117.0	114.0	115.0					12																	29670368		2203	4300	6503	SO:0001819	synonymous_variant	83857	exon14			GTGCCAAGCGGAG		CCDS8718.1, CCDS53772.1	12p11.22	2014-06-09	2006-01-06			ENSG00000133687		"""Tetratricopeptide (TTC) repeat domain containing"""	24099	protein-coding gene	gene with protein product		615855				24764305	Standard	NM_001193451		Approved	ARG99, OLF, FLJ31400, FLJ41625	uc021qwi.1	Q8IUR5	OTTHUMG00000169324	ENST00000539277.1:c.2161T>C	chr12.hg19:g.29670368A>G		203.0	0.0	.		80.0	34.0	.	NM_001193451	D0EP37|F5H8B5|Q6PIU4|Q6ZSM5|Q96N52|Q9BXM2	Silent	SNP	ENST00000539277.1	hg19	CCDS53772.1																																																																																			.	.	.	none		0.517	TMTC1-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403509.1	NM_031920	
RBM19	9904	hgsc.bcm.edu	37	12	114397941	114397941	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr12:114397941C>T	ENST00000545145.2	-	3	340	c.262G>A	c.(262-264)Gcc>Acc	p.A88T	RBM19_ENST00000261741.5_Missense_Mutation_p.A88T|RBM19_ENST00000392561.3_Missense_Mutation_p.A88T	NM_001146699.1	NP_001140171.1	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	88					multicellular organismal development (GO:0007275)|positive regulation of embryonic development (GO:0040019)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(4)	55	Medulloblastoma(191;0.163)|all_neural(191;0.178)					TTGCTCCAGGCTCTGGGTTTG	0.532																																					p.A88T		Atlas-SNP	.											.	RBM19	117	.	0			c.G262A						PASS	.						100.0	99.0	99.0					12																	114397941		2203	4300	6503	SO:0001583	missense	9904	exon3			TCCAGGCTCTGGG	AL117547	CCDS9172.1	12q24.21	2013-02-12				ENSG00000122965		"""RNA binding motif (RRM) containing"""	29098	protein-coding gene	gene with protein product						9734811, 11230166	Standard	NM_016196		Approved	DKFZp586F1023, KIAA0682	uc009zwi.2	Q9Y4C8	OTTHUMG00000169646	ENST00000545145.2:c.262G>A	chr12.hg19:g.114397941C>T	ENSP00000442053:p.Ala88Thr	103.0	0.0	.		144.0	54.0	.	NM_001146699	A8K5X9|Q9BPY6|Q9UFN5	Missense_Mutation	SNP	ENST00000545145.2	hg19	CCDS9172.1	.	.	.	.	.	.	.	.	.	.	C	16.36	3.102307	0.56183	.	.	ENSG00000122965	ENST00000545145;ENST00000392561;ENST00000261741	T;T;T	0.74315	-0.83;-0.83;-0.83	4.86	4.86	0.63082	Nucleotide-binding, alpha-beta plait (1);	0.116689	0.56097	D	0.000023	T	0.76716	0.4026	M	0.79258	2.445	0.48288	D	0.999627	P	0.44478	0.836	B	0.41374	0.355	T	0.79381	-0.1827	10	0.40728	T	0.16	-26.8541	18.1761	0.89761	0.0:1.0:0.0:0.0	.	88	Q9Y4C8	RBM19_HUMAN	T	88	ENSP00000442053:A88T;ENSP00000376344:A88T;ENSP00000261741:A88T	ENSP00000261741:A88T	A	-	1	0	RBM19	112882324	1.000000	0.71417	1.000000	0.80357	0.770000	0.43624	3.397000	0.52572	2.513000	0.84729	0.557000	0.71058	GCC	.	.	.	none		0.532	RBM19-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405251.1	NM_016196	
ULK1	8408	hgsc.bcm.edu	37	12	132393457	132393457	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr12:132393457G>A	ENST00000321867.4	+	7	856	c.505G>A	c.(505-507)Gcg>Acg	p.A169T		NM_003565.2	NP_003556	O75385	ULK1_HUMAN	unc-51 like autophagy activating kinase 1	169	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|cellular response to nutrient levels (GO:0031669)|cerebellar granule cell differentiation (GO:0021707)|negative regulation of collateral sprouting (GO:0048671)|neuron projection development (GO:0031175)|neuron projection regeneration (GO:0031102)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|protein autophosphorylation (GO:0046777)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|radial glia guided migration of cerebellar granule cell (GO:0021933)|Ras protein signal transduction (GO:0007265)|receptor internalization (GO:0031623)|regulation of autophagy (GO:0010506)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|response to starvation (GO:0042594)	ATG1/UKL1 signaling complex (GO:0034273)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extrinsic component of autophagic vacuole membrane (GO:0097635)|extrinsic component of omegasome membrane (GO:0097629)|extrinsic component of pre-autophagosomal structure membrane (GO:0097632)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)	ATP binding (GO:0005524)|protein complex binding (GO:0032403)|protein serine/threonine kinase activity (GO:0004674)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	29	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		CTTCGGCTTCGCGCGGTACCT	0.711																																					p.A169T		Atlas-SNP	.											.	ULK1	92	.	0			c.G505A						PASS	.						60.0	59.0	59.0					12																	132393457		2203	4300	6503	SO:0001583	missense	8408	exon7			GGCTTCGCGCGGT	AF045458	CCDS9274.1	12q24.3	2014-02-12	2013-07-02		ENSG00000177169	ENSG00000177169			12558	protein-coding gene	gene with protein product	"""ATG1 autophagy related 1 homolog (S. cerevisiae)"""	603168	"""unc-51 (C. elegans)-like kinase 1"", ""unc-51-like kinase 1 (C. elegans)"""			9693035	Standard	NM_003565		Approved	ATG1, ATG1A	uc001uje.3	O75385	OTTHUMG00000168052	ENST00000321867.4:c.505G>A	chr12.hg19:g.132393457G>A	ENSP00000324560:p.Ala169Thr	105.0	0.0	.		139.0	60.0	.	NM_003565	Q9UQ28	Missense_Mutation	SNP	ENST00000321867.4	hg19	CCDS9274.1	.	.	.	.	.	.	.	.	.	.	G	36	5.828944	0.96996	.	.	ENSG00000177169	ENST00000321867;ENST00000537421;ENST00000542313	T;T;D	0.90133	0.97;0.97;-2.62	5.32	5.32	0.75619	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.95959	0.8684	M	0.86178	2.8	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96254	0.9185	10	0.87932	D	0	-34.7466	19.3607	0.94436	0.0:0.0:1.0:0.0	.	169	O75385	ULK1_HUMAN	T	169;86;63	ENSP00000324560:A169T;ENSP00000438953:A86T;ENSP00000444983:A63T	ENSP00000324560:A169T	A	+	1	0	ULK1	130959410	1.000000	0.71417	0.295000	0.24960	0.974000	0.67602	7.537000	0.82033	2.651000	0.90000	0.455000	0.32223	GCG	.	.	.	none		0.711	ULK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397769.3		
ACYP1	97	hgsc.bcm.edu	37	14	75528414	75528414	+	Intron	SNP	G	G	C			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr14:75528414G>C	ENST00000238618.3	-	2	188				ACYP1_ENST00000555135.1_Missense_Mutation_p.P46A|ACYP1_ENST00000555463.1_Intron|ACYP1_ENST00000357971.3_Missense_Mutation_p.P46A|ACYP1_ENST00000555694.1_Intron	NM_001107.3	NP_001098.1	P07311	ACYP1_HUMAN	acylphosphatase 1, erythrocyte (common) type						phosphate-containing compound metabolic process (GO:0006796)	extracellular vesicular exosome (GO:0070062)	acylphosphatase activity (GO:0003998)			large_intestine(2)	2				BRCA - Breast invasive adenocarcinoma(234;0.00646)		AAGCTAACTGGAACACAGCTC	0.358																																					p.P46A		Atlas-SNP	.											.	ACYP1	6	.	0			c.C136G						PASS	.						69.0	67.0	68.0					14																	75528414		1872	4101	5973	SO:0001627	intron_variant	97	exon3			TAACTGGAACACA	X84194	CCDS9838.1, CCDS45137.1	14q24.3	2014-08-08			ENSG00000119640	ENSG00000119640	3.6.1.7		179	protein-coding gene	gene with protein product		600875				7796909, 9730610	Standard	NM_001107		Approved		uc001xrg.3	P07311	OTTHUMG00000171767	ENST00000238618.3:c.84+1758C>G	chr14.hg19:g.75528414G>C		65.0	0.0	.		53.0	18.0	.	NM_203488	A6NDV8|B2R590	Missense_Mutation	SNP	ENST00000238618.3	hg19	CCDS9838.1	.	.	.	.	.	.	.	.	.	.	G	9.868	1.198229	0.22037	.	.	ENSG00000119640	ENST00000357971;ENST00000555135	.	.	.	3.01	0.887	0.19200	.	.	.	.	.	T	0.36908	0.0984	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.35450	-0.9788	7	0.87932	D	0	.	9.8551	0.41082	0.0:0.5438:0.4562:0.0	.	46	A6NDV8	.	A	46	.	ENSP00000350655:P46A	P	-	1	0	ACYP1	74598167	0.003000	0.15002	0.054000	0.19295	0.203000	0.24098	0.172000	0.16704	0.176000	0.19873	0.543000	0.68304	CCA	.	.	.	none		0.358	ACYP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415013.1		
LRRK1	79705	hgsc.bcm.edu	37	15	101592098	101592098	+	Missense_Mutation	SNP	C	C	A			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr15:101592098C>A	ENST00000388948.3	+	24	3981	c.3622C>A	c.(3622-3624)Cac>Aac	p.H1208N	RP11-505E24.3_ENST00000558979.1_RNA|RP11-505E24.2_ENST00000559857.1_RNA|LRRK1_ENST00000284395.5_Missense_Mutation_p.H1205N	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CTGCCCCAGACACCCGGACCT	0.617																																					p.H1208N		Atlas-SNP	.											.	LRRK1	310	.	0			c.C3622A						PASS	.						53.0	62.0	59.0					15																	101592098		2037	4192	6229	SO:0001583	missense	79705	exon24			CCCAGACACCCGG	AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.3622C>A	chr15.hg19:g.101592098C>A	ENSP00000373600:p.His1208Asn	90.0	0.0	.		125.0	55.0	.	NM_024652		Missense_Mutation	SNP	ENST00000388948.3	hg19	CCDS42086.1	.	.	.	.	.	.	.	.	.	.	C	33	5.194800	0.94960	.	.	ENSG00000154237	ENST00000388948;ENST00000284395	T;T	0.73789	-0.76;-0.78	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.81356	0.4805	L	0.32530	0.975	0.80722	D	1	D	0.69078	0.997	D	0.77004	0.989	T	0.83156	-0.0101	10	0.72032	D	0.01	.	19.2014	0.93713	0.0:1.0:0.0:0.0	.	1208	Q38SD2	LRRK1_HUMAN	N	1208;1205	ENSP00000373600:H1208N;ENSP00000284395:H1205N	ENSP00000284395:H1205N	H	+	1	0	LRRK1	99409621	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.669000	0.83911	2.541000	0.85698	0.655000	0.94253	CAC	.	.	.	none		0.617	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2	NM_024652	
CLEC16A	23274	hgsc.bcm.edu	37	16	11066855	11066855	+	Missense_Mutation	SNP	A	A	C			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr16:11066855A>C	ENST00000409790.1	+	7	895	c.665A>C	c.(664-666)aAt>aCt	p.N222T	CLEC16A_ENST00000409552.3_Missense_Mutation_p.N220T	NM_015226.2	NP_056041.1			C-type lectin domain family 16, member A											breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						TACTTCTCCAATTTGGTCTGG	0.463																																					p.N222T		Atlas-SNP	.											.	CLEC16A	101	.	0			c.A665C						PASS	.						86.0	83.0	84.0					16																	11066855		1967	4159	6126	SO:0001583	missense	23274	exon6			TCTCCAATTTGGT	AB002348	CCDS45409.1, CCDS58423.1	16p13.13	2010-04-27	2007-07-17	2007-07-17	ENSG00000038532	ENSG00000038532		"""C-type lectin domain containing"""	29013	protein-coding gene	gene with protein product		611303	"""KIAA0350"""	KIAA0350		9205841, 17632545	Standard	NM_015226		Approved	Gop-1	uc002dao.3	Q2KHT3	OTTHUMG00000152915	ENST00000409790.1:c.665A>C	chr16.hg19:g.11066855A>C	ENSP00000387122:p.Asn222Thr	54.0	0.0	.		39.0	17.0	.	NM_015226		Missense_Mutation	SNP	ENST00000409790.1	hg19	CCDS45409.1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.575730	0.86645	.	.	ENSG00000038532	ENST00000409790;ENST00000542102;ENST00000409552	T	0.50813	0.73	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.67813	0.2933	M	0.70595	2.14	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.78314	0.987;0.991	T	0.69161	-0.5218	10	0.51188	T	0.08	-24.4217	15.5133	0.75802	1.0:0.0:0.0:0.0	.	222;220	Q2KHT3;Q2KHT3-2	CL16A_HUMAN;.	T	222;222;220	ENSP00000387122:N222T	ENSP00000386495:N220T	N	+	2	0	CLEC16A	10974356	1.000000	0.71417	0.937000	0.37676	0.978000	0.69477	9.228000	0.95250	2.251000	0.74343	0.528000	0.53228	AAT	.	.	.	none		0.463	CLEC16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328540.2	NM_015226	
ZNF423	23090	hgsc.bcm.edu	37	16	49670867	49670867	+	Missense_Mutation	SNP	C	C	G	rs373085653		TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr16:49670867C>G	ENST00000561648.1	-	4	2249	c.2196G>C	c.(2194-2196)aaG>aaC	p.K732N	ZNF423_ENST00000567169.1_Missense_Mutation_p.K615N|ZNF423_ENST00000562871.1_Missense_Mutation_p.K672N|ZNF423_ENST00000535559.1_Missense_Mutation_p.K615N|ZNF423_ENST00000562520.1_Missense_Mutation_p.K672N|ZNF423_ENST00000563137.2_Missense_Mutation_p.K672N|ZNF423_ENST00000262383.2_Missense_Mutation_p.K732N	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	732					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				GGATGGACACCTTGGAGTCGA	0.567																																					p.K732N		Atlas-SNP	.											.	ZNF423	463	.	0			c.G2196C						PASS	.						100.0	93.0	95.0					16																	49670867		2198	4300	6498	SO:0001583	missense	23090	exon4			GGACACCTTGGAG	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.2196G>C	chr16.hg19:g.49670867C>G	ENSP00000455426:p.Lys732Asn	76.0	0.0	.		136.0	71.0	.	NM_015069	O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	ENST00000561648.1	hg19	CCDS32445.1	.	.	.	.	.	.	.	.	.	.	C	15.57	2.872977	0.51695	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.30448	1.53;1.53	5.05	5.05	0.67936	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	T	0.46946	0.1419	L	0.38531	1.155	0.53005	D	0.999969	D	0.89917	1.0	D	0.91635	0.999	T	0.31364	-0.9946	9	.	.	.	.	18.4141	0.90562	0.0:1.0:0.0:0.0	.	732	Q2M1K9	ZN423_HUMAN	N	732;615	ENSP00000262383:K732N;ENSP00000442321:K615N	.	K	-	3	2	ZNF423	48228368	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.361000	0.52306	2.352000	0.79861	0.561000	0.74099	AAG	.	.	.	alt		0.567	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069	
KIAA0513	9764	hgsc.bcm.edu	37	16	85100829	85100829	+	Missense_Mutation	SNP	C	C	T	rs148950418		TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr16:85100829C>T	ENST00000566428.1	+	2	783	c.152C>T	c.(151-153)gCg>gTg	p.A51V	KIAA0513_ENST00000258180.3_Missense_Mutation_p.A51V|KIAA0513_ENST00000567328.1_Missense_Mutation_p.A51V|KIAA0513_ENST00000538274.1_Missense_Mutation_p.A51V			O60268	K0513_HUMAN	KIAA0513	51						cytoplasm (GO:0005737)				breast(2)|endometrium(1)|kidney(2)|large_intestine(1)|liver(2)|lung(9)|pancreas(1)	18				BRCA - Breast invasive adenocarcinoma(80;0.234)		ACTGAGTCTGCGGACAGTGAG	0.647																																					p.A51V		Atlas-SNP	.											.	KIAA0513	43	.	0			c.C152T						PASS	.	C	VAL/ALA	1,4397	2.1+/-5.4	0,1,2198	72.0	58.0	63.0		152	4.5	0.2	16	dbSNP_134	63	0,8600		0,0,4300	no	missense	KIAA0513	NM_014732.2	64	0,1,6498	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	51/412	85100829	1,12997	2199	4300	6499	SO:0001583	missense	9764	exon2			AGTCTGCGGACAG	AB011085	CCDS32499.1, CCDS67091.1, CCDS73919.1	16q24.1	2012-11-29			ENSG00000135709	ENSG00000135709			29058	protein-coding gene	gene with protein product		611675				9628581	Standard	XM_005256265		Approved		uc002fiu.3	O60268	OTTHUMG00000176597	ENST00000566428.1:c.152C>T	chr16.hg19:g.85100829C>T	ENSP00000457408:p.Ala51Val	66.0	0.0	.		113.0	34.0	.	NM_014732	B4DSS5|D3DUM2|Q8N6G0	Missense_Mutation	SNP	ENST00000566428.1	hg19	CCDS32499.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.700612	0.88924	2.27E-4	0.0	ENSG00000135709	ENST00000538274;ENST00000258180	T;T	0.38240	1.15;1.15	4.54	4.54	0.55810	.	0.000000	0.85682	D	0.000000	T	0.57755	0.2075	M	0.67953	2.075	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.986	T	0.58239	-0.7671	10	0.41790	T	0.15	-15.5029	16.2567	0.82522	0.0:1.0:0.0:0.0	.	51;51	B4DSS5;O60268	.;K0513_HUMAN	V	51	ENSP00000446439:A51V;ENSP00000258180:A51V	ENSP00000258180:A51V	A	+	2	0	KIAA0513	83658330	1.000000	0.71417	0.218000	0.23776	0.820000	0.46376	6.939000	0.75911	2.234000	0.73211	0.561000	0.74099	GCG	.	C|1.000;T|0.000	0.000	weak		0.647	KIAA0513-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432736.1	NM_014732	
MYH13	8735	hgsc.bcm.edu	37	17	10258306	10258306	+	Silent	SNP	C	C	G			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr17:10258306C>G	ENST00000418404.3	-	9	970	c.807G>C	c.(805-807)ctG>ctC	p.L269L	MYH13_ENST00000252172.4_Silent_p.L269L			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	269	Myosin motor.				cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						ATTTTTCTAACAGATCTAAGG	0.368																																					p.L269L		Atlas-SNP	.											.	MYH13	533	.	0			c.G807C						PASS	.						71.0	70.0	71.0					17																	10258306		1848	4092	5940	SO:0001819	synonymous_variant	8735	exon10			TTCTAACAGATCT	AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.807G>C	chr17.hg19:g.10258306C>G		80.0	0.0	.		91.0	16.0	.	NM_003802	O95252|Q9P0U8	Silent	SNP	ENST00000418404.3	hg19	CCDS45613.1																																																																																			.	.	.	none		0.368	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1	NM_003802	
MPRIP	23164	hgsc.bcm.edu	37	17	17080727	17080727	+	Splice_Site	SNP	G	G	A			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr17:17080727G>A	ENST00000341712.4	+	21	2959		c.e21+1		MPRIP_ENST00000395804.3_Splice_Site|RP11-45M22.3_ENST00000584203.1_RNA|MPRIP_ENST00000395811.5_Splice_Site|RN7SL775P_ENST00000498361.2_RNA|MPRIP_ENST00000444976.1_Splice_Site			Q6WCQ1	MPRIP_HUMAN	myosin phosphatase Rho interacting protein							actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	31						TCCGGATATGGTGCGTCCTCG	0.582																																					.		Atlas-SNP	.											.	MPRIP	87	.	0			c.2959+1G>A						PASS	.						64.0	57.0	59.0					17																	17080727		2203	4300	6503	SO:0001630	splice_region_variant	23164	exon21			GATATGGTGCGTC	BC014102	CCDS32578.1, CCDS42268.1	17p11.2	2013-01-10			ENSG00000133030	ENSG00000133030		"""Pleckstrin homology (PH) domain containing"""	30321	protein-coding gene	gene with protein product	"""Rho interacting protein 3"""	612935				10048485	Standard	NM_201274		Approved	RHOIP3, M-RIP, p116Rip	uc002gqy.2	Q6WCQ1	OTTHUMG00000059276	ENST00000341712.4:c.2959+1G>A	chr17.hg19:g.17080727G>A		91.0	0.0	.		250.0	73.0	.	NM_015134	Q3KQZ5|Q5FB94|Q6DHW2|Q7Z5Y2|Q8N390|Q96G40	Splice_Site	SNP	ENST00000341712.4	hg19	CCDS32578.1	.	.	.	.	.	.	.	.	.	.	G	13.42	2.232815	0.39498	.	.	ENSG00000133030	ENST00000444976;ENST00000395811;ENST00000395804;ENST00000341712;ENST00000313485;ENST00000414263;ENST00000429184	.	.	.	5.13	5.13	0.70059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9433	0.92612	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MPRIP	17021452	1.000000	0.71417	0.960000	0.40013	0.094000	0.18550	9.358000	0.97109	2.539000	0.85634	0.563000	0.77884	.	.	.	.	none		0.582	MPRIP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131587.1	NM_015134	Intron
NDUFS7	374291	hgsc.bcm.edu	37	19	1391140	1391140	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr19:1391140C>T	ENST00000233627.9	+	6	727	c.431C>T	c.(430-432)cCg>cTg	p.P144L	NDUFS7_ENST00000414651.2_Missense_Mutation_p.P174L|NDUFS7_ENST00000546283.1_Missense_Mutation_p.P144L|NDUFS7_ENST00000540530.1_3'UTR|NDUFS7_ENST00000313408.7_Missense_Mutation_p.P144L|AC005329.7_ENST00000501448.1_RNA|NDUFS7_ENST00000539480.1_Missense_Mutation_p.P144L|AC005329.7_ENST00000589734.1_RNA|AC005329.7_ENST00000585596.1_RNA	NM_024407.4	NP_077718.3	O75251	NDUS7_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase)	144					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|mitochondrial respiratory chain complex I assembly (GO:0032981)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|synaptic membrane (GO:0097060)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|quinone binding (GO:0048038)			ovary(1)	1		Acute lymphoblastic leukemia(61;5.61e-13)|all_hematologic(61;2.65e-08)|Breast(49;0.00186)|Lung NSC(49;0.00292)|all_lung(49;0.00419)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Doxorubicin(DB00997)	ATGCCGGAGCCGCGCTACGTG	0.687																																					p.P144L		Atlas-SNP	.											.	NDUFS7	4	.	0			c.C431T						PASS	.						22.0	24.0	23.0					19																	1391140		2201	4298	6499	SO:0001583	missense	374291	exon6			CGGAGCCGCGCTA	AF115969	CCDS12063.1	19p13	2011-07-04	2002-08-29		ENSG00000115286	ENSG00000115286		"""Mitochondrial respiratory chain complex / Complex I"""	7714	protein-coding gene	gene with protein product	"""complex I 20kDa subunit"", ""NADH dehydrogenase [ubiquinone] iron-sulfur protein 7, mitochondrial"""	601825	"""NADH dehydrogenase (ubiquinone) Fe-S protein 7 (20kD) (NADH-coenzyme Q reductase)"""			8938450	Standard	NM_024407		Approved	PSST, FLJ46880, FLJ45860, CI-20	uc002lse.4	O75251	OTTHUMG00000168077	ENST00000233627.9:c.431C>T	chr19.hg19:g.1391140C>T	ENSP00000233627:p.Pro144Leu	44.0	0.0	.		58.0	24.0	.	NM_024407	B3KRI2|Q2T9H7|Q9BV17	Missense_Mutation	SNP	ENST00000233627.9	hg19	CCDS12063.1	.	.	.	.	.	.	.	.	.	.	C	13.64	2.298050	0.40694	.	.	ENSG00000115286	ENST00000546283;ENST00000233627;ENST00000539480;ENST00000313408;ENST00000414651;ENST00000538929;ENST00000538523;ENST00000540530;ENST00000535382	D;D;D;D;D	0.88354	-2.37;-2.37;-2.37;-2.37;-2.37	4.44	4.44	0.53790	NADH:ubiquinone oxidoreductase-like, 20kDa subunit (2);	.	.	.	.	D	0.96358	0.8812	H	0.97051	3.93	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.995;1.0;0.998;0.993	D	0.97936	1.0323	9	0.87932	D	0	.	15.6509	0.77091	0.0:1.0:0.0:0.0	.	144;151;144;144	F5H5N1;Q8NAS7;B3KRI2;O75251	.;.;.;NDUS7_HUMAN	L	144;144;144;144;174;63;63;63;63	ENSP00000440348:P144L;ENSP00000233627:P144L;ENSP00000443273:P144L;ENSP00000364262:P144L;ENSP00000406630:P174L	ENSP00000233627:P144L	P	+	2	0	NDUFS7	1342140	1.000000	0.71417	0.807000	0.32361	0.032000	0.12392	7.076000	0.76806	2.016000	0.59253	0.511000	0.50034	CCG	.	.	.	none		0.687	NDUFS7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397984.1	NM_024407	
MUC16	94025	hgsc.bcm.edu	37	19	9063328	9063328	+	Missense_Mutation	SNP	T	T	C			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr19:9063328T>C	ENST00000397910.4	-	3	24321	c.24118A>G	c.(24118-24120)Acc>Gcc	p.T8040A		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	8042	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ACTTCAGAGGTGGCCAGTATT	0.458																																					p.T8040A		Atlas-SNP	.											.	MUC16	4315	.	0			c.A24118G						PASS	.						130.0	120.0	124.0					19																	9063328		1946	4144	6090	SO:0001583	missense	94025	exon3			CAGAGGTGGCCAG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.24118A>G	chr19.hg19:g.9063328T>C	ENSP00000381008:p.Thr8040Ala	188.0	0.0	.		79.0	40.0	.	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	t	8.827	0.938900	0.18281	.	.	ENSG00000181143	ENST00000397910	T	0.24908	1.83	2.66	-2.24	0.06909	.	.	.	.	.	T	0.28067	0.0692	L	0.35854	1.095	.	.	.	P	0.49961	0.93	P	0.54664	0.758	T	0.39313	-0.9620	8	0.87932	D	0	.	7.4725	0.27357	0.7363:0.0:0.0:0.2637	.	8040	B5ME49	.	A	8040	ENSP00000381008:T8040A	ENSP00000381008:T8040A	T	-	1	0	MUC16	8924328	0.000000	0.05858	0.000000	0.03702	0.445000	0.32107	-1.059000	0.03479	-0.657000	0.05373	0.332000	0.21555	ACC	.	.	.	none		0.458	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
GGN	199720	hgsc.bcm.edu	37	19	38876904	38876904	+	Missense_Mutation	SNP	G	G	T			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr19:38876904G>T	ENST00000334928.6	-	3	1130	c.998C>A	c.(997-999)gCc>gAc	p.A333D	SPRED3_ENST00000587013.1_5'Flank|AC005789.9_ENST00000585411.1_RNA|GGN_ENST00000591809.1_Intron	NM_152657.3	NP_689870.3	Q86UU5	GGN_HUMAN	gametogenetin	333	Interaction with GGNBP1. {ECO:0000250}.|Pro-rich.				cell differentiation (GO:0030154)|gamete generation (GO:0007276)|multicellular organismal development (GO:0007275)|protein localization (GO:0008104)|spermatogenesis (GO:0007283)	nucleolus (GO:0005730)|perinuclear region of cytoplasm (GO:0048471)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TAGGGCCCGGGCTTGGGACGC	0.677																																					p.A333D		Atlas-SNP	.											.	GGN	50	.	0			c.C998A						PASS	.						28.0	32.0	30.0					19																	38876904		2201	4299	6500	SO:0001583	missense	199720	exon3			GCCCGGGCTTGGG	AF538035	CCDS12516.1	19q13.2	2008-09-04				ENSG00000179168			18869	protein-coding gene	gene with protein product		609966				12574169	Standard	NM_152657		Approved	FLJ35713, MGC33369	uc002oij.1	Q86UU5		ENST00000334928.6:c.998C>A	chr19.hg19:g.38876904G>T	ENSP00000334940:p.Ala333Asp	23.0	0.0	.		62.0	27.0	.	NM_152657	Q7RTU6|Q86UU4|Q8NAA1	Missense_Mutation	SNP	ENST00000334928.6	hg19	CCDS12516.1	.	.	.	.	.	.	.	.	.	.	G	6.337	0.430216	0.12045	.	.	ENSG00000179168	ENST00000334928	.	.	.	3.33	0.957	0.19613	.	1.070480	0.07455	N	0.899668	T	0.21227	0.0511	N	0.24115	0.695	0.09310	N	1	B;B	0.32829	0.386;0.386	B;B	0.25405	0.06;0.06	T	0.18650	-1.0330	9	0.45353	T	0.12	0.4297	5.4042	0.16312	0.0:0.2275:0.5387:0.2338	.	250;333	Q86UU5-2;Q86UU5	.;GGN_HUMAN	D	333	.	ENSP00000334940:A333D	A	-	2	0	GGN	43568744	0.000000	0.05858	0.000000	0.03702	0.073000	0.16967	-0.059000	0.11731	0.082000	0.17018	0.462000	0.41574	GCC	.	.	.	none		0.677	GGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459205.1	NM_152657	
PRR12	57479	hgsc.bcm.edu	37	19	50102854	50102854	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr19:50102854C>T	ENST00000418929.2	+	5	4016	c.4004C>T	c.(4003-4005)cCc>cTc	p.P1335L		NM_020719.1	NP_065770.1	Q9ULL5	PRR12_HUMAN	proline rich 12	0							DNA binding (GO:0003677)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)|prostate(2)	11		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		GTGCCACATCCCCCACCTTCC	0.697																																					p.P1335L		Atlas-SNP	.											.	PRR12	157	.	0			c.C4004T						PASS	.						12.0	15.0	14.0					19																	50102854		1955	4119	6074	SO:0001583	missense	57479	exon5			CACATCCCCCACC	AB033031	CCDS46143.1	19q13.33	2008-07-02	2006-02-06	2006-02-06		ENSG00000126464			29217	protein-coding gene	gene with protein product			"""KIAA1205"""	KIAA1205		10574462	Standard	NM_020719		Approved		uc002poo.4	Q9ULL5		ENST00000418929.2:c.4004C>T	chr19.hg19:g.50102854C>T	ENSP00000394510:p.Pro1335Leu	24.0	0.0	.		29.0	11.0	.	NM_020719	E9PB06|Q8N4J6	Missense_Mutation	SNP	ENST00000418929.2	hg19	CCDS46143.1	.	.	.	.	.	.	.	.	.	.	C	4.945	0.175637	0.09391	.	.	ENSG00000126464	ENST00000418929;ENST00000246798;ENST00000314734	.	.	.	4.34	4.34	0.51931	.	0.157267	0.30338	N	0.009842	T	0.56949	0.2020	L	0.42245	1.32	0.48762	D	0.999702	B	0.20164	0.042	B	0.28709	0.093	T	0.58907	-0.7553	9	0.56958	D	0.05	-10.4584	14.2367	0.65932	0.0:1.0:0.0:0.0	.	1335	Q9ULL5-3	.	L	1335;515;515	.	ENSP00000246798:P515L	P	+	2	0	PRR12	54794666	0.029000	0.19370	0.156000	0.22583	0.027000	0.11550	3.359000	0.52292	2.424000	0.82194	0.563000	0.77884	CCC	.	.	.	none		0.697	PRR12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465915.1	NM_020719	
NLRP8	126205	hgsc.bcm.edu	37	19	56459468	56459468	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr19:56459468G>A	ENST00000291971.3	+	1	271	c.200G>A	c.(199-201)gGc>gAc	p.G67D	NLRP8_ENST00000590542.1_Missense_Mutation_p.G67D	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	67	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		CTCAGTACTGGCACCATGCCC	0.557																																					p.G67D		Atlas-SNP	.											.	NLRP8	225	.	0			c.G200A						PASS	.						105.0	84.0	91.0					19																	56459468		2203	4300	6503	SO:0001583	missense	126205	exon1			GTACTGGCACCAT	AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.200G>A	chr19.hg19:g.56459468G>A	ENSP00000291971:p.Gly67Asp	59.0	0.0	.		50.0	24.0	.	NM_176811	Q7RTR4	Missense_Mutation	SNP	ENST00000291971.3	hg19	CCDS12937.1	.	.	.	.	.	.	.	.	.	.	G	5.435	0.265352	0.10294	.	.	ENSG00000179709	ENST00000291971	T	0.59083	0.29	1.98	-0.375	0.12509	Pyrin (2);DEATH-like (2);	.	.	.	.	T	0.45094	0.1325	L	0.47716	1.5	0.09310	N	1	B;B	0.24576	0.1;0.106	B;B	0.33295	0.056;0.161	T	0.38478	-0.9659	9	0.20046	T	0.44	.	2.9915	0.05984	0.1879:0.2955:0.5166:0.0	.	67;67	Q86W28-2;Q86W28	.;NALP8_HUMAN	D	67	ENSP00000291971:G67D	ENSP00000291971:G67D	G	+	2	0	NLRP8	61151280	0.003000	0.15002	0.000000	0.03702	0.002000	0.02628	0.665000	0.25083	-0.014000	0.14175	0.514000	0.50259	GGC	.	.	.	none		0.557	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457462.1	NM_176811	
ZNF583	147949	hgsc.bcm.edu	37	19	56934490	56934490	+	Missense_Mutation	SNP	A	A	T			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr19:56934490A>T	ENST00000333201.9	+	5	673	c.463A>T	c.(463-465)Aat>Tat	p.N155Y	ZNF583_ENST00000291598.7_Missense_Mutation_p.N155Y	NM_001159861.1|NM_152478.2	NP_001153333.1|NP_689691.2	Q96ND8	ZN583_HUMAN	zinc finger protein 583	155					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(2)|prostate(1)|skin(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0564)		AGAAGTTCAAAATAAAGAATA	0.363																																					p.N155Y		Atlas-SNP	.											.	ZNF583	83	.	0			c.A463T						PASS	.						71.0	78.0	76.0					19																	56934490		2202	4300	6502	SO:0001583	missense	147949	exon5			GTTCAAAATAAAG	AK055592	CCDS12943.1	19q13.43	2013-09-20			ENSG00000198440	ENSG00000198440		"""Zinc fingers, C2H2-type"", ""-"""	26427	protein-coding gene	gene with protein product							Standard	NM_152478		Approved	FLJ31030	uc010ygl.1	Q96ND8	OTTHUMG00000168874	ENST00000333201.9:c.463A>T	chr19.hg19:g.56934490A>T	ENSP00000388502:p.Asn155Tyr	246.0	0.0	.		52.0	23.0	.	NM_001159861	O14850|Q2NKK3	Missense_Mutation	SNP	ENST00000333201.9	hg19	CCDS12943.1	.	.	.	.	.	.	.	.	.	.	A	13.43	2.236222	0.39498	.	.	ENSG00000198440	ENST00000291598;ENST00000333201	T;T	0.01034	5.42;5.42	4.19	3.17	0.36434	.	0.536023	0.17228	N	0.182048	T	0.00468	0.0015	N	0.01464	-0.85	0.24096	N	0.995892	B	0.11235	0.004	B	0.06405	0.002	T	0.45731	-0.9241	9	.	.	.	.	7.714	0.28694	0.8962:0.0:0.1038:0.0	.	155	Q96ND8	ZN583_HUMAN	Y	155	ENSP00000291598:N155Y;ENSP00000388502:N155Y	.	N	+	1	0	ZNF583	61626302	0.000000	0.05858	0.416000	0.26546	0.379000	0.30106	0.567000	0.23608	0.776000	0.33473	0.379000	0.24179	AAT	.	.	.	none		0.363	ZNF583-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401453.1	NM_152478	
PLTP	5360	hgsc.bcm.edu	37	20	44534919	44534919	+	Silent	SNP	G	G	A			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr20:44534919G>A	ENST00000477313.1	-	7	1287	c.693C>T	c.(691-693)gaC>gaT	p.D231D	PLTP_ENST00000372420.1_Silent_p.D143D|PLTP_ENST00000420868.2_Silent_p.D136D|PLTP_ENST00000354050.4_Silent_p.D179D|PLTP_ENST00000372431.3_Silent_p.D231D|PLTP_ENST00000542937.1_Silent_p.D251D			P55058	PLTP_HUMAN	phospholipid transfer protein	231					lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|sperm motility (GO:0030317)|vitamin E biosynthetic process (GO:0010189)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	lipid binding (GO:0008289)			endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)	21		Myeloproliferative disorder(115;0.0122)				GGAAGTCCATGTCCAGGTTGC	0.507																																					p.D231D		Atlas-SNP	.											.	PLTP	49	.	0			c.C693T						PASS	.						102.0	82.0	89.0					20																	44534919		2203	4300	6503	SO:0001819	synonymous_variant	5360	exon8			GTCCATGTCCAGG	L26232	CCDS13386.1, CCDS13387.1, CCDS56196.1, CCDS56197.1	20q13.12	2011-08-16			ENSG00000100979	ENSG00000100979		"""BPI fold containing"""	9093	protein-coding gene	gene with protein product	"""BPI fold containing family E"""	172425					Standard	NM_006227		Approved	BPIFE	uc002xqn.2	P55058	OTTHUMG00000033047	ENST00000477313.1:c.693C>T	chr20.hg19:g.44534919G>A		64.0	0.0	.		82.0	34.0	.	NM_006227	A8K006|B4DDD5|B4DRB4|E1P5N8|E7EV16|Q8WTT1|Q9BR07|Q9BSH8	Silent	SNP	ENST00000477313.1	hg19	CCDS13386.1																																																																																			.	.	.	none		0.507	PLTP-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354633.1	NM_006227	
SLC12A5	57468	hgsc.bcm.edu	37	20	44670175	44670175	+	Silent	SNP	C	C	T			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr20:44670175C>T	ENST00000454036.2	+	8	1180	c.1131C>T	c.(1129-1131)atC>atT	p.I377I	SLC12A5_ENST00000243964.3_Silent_p.I354I	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	377					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	GTGGCCTCATCAAAGGTCTGC	0.557																																					p.I377I		Atlas-SNP	.											.	SLC12A5	181	.	0			c.C1131T						PASS	.						53.0	50.0	51.0					20																	44670175		2203	4300	6503	SO:0001819	synonymous_variant	57468	exon8			CCTCATCAAAGGT	AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.1131C>T	chr20.hg19:g.44670175C>T		93.0	0.0	.		93.0	37.0	.	NM_001134771	A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Silent	SNP	ENST00000454036.2	hg19	CCDS46610.1																																																																																			.	.	.	none		0.557	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000471538.1		
PFKL	5211	hgsc.bcm.edu	37	21	45743723	45743723	+	Silent	SNP	C	C	T			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr21:45743723C>T	ENST00000349048.4	+	16	1627	c.1572C>T	c.(1570-1572)atC>atT	p.I524I	PFKL_ENST00000403390.1_Silent_p.I571I	NM_002626.4	NP_002617.3	P17858	PFKAL_HUMAN	phosphofructokinase, liver	524	C-terminal regulatory PFK domain 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose 6-phosphate metabolic process (GO:0006002)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|negative regulation of insulin secretion (GO:0046676)|protein homotetramerization (GO:0051289)|protein oligomerization (GO:0051259)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	6-phosphofructokinase complex (GO:0005945)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|fructose binding (GO:0070061)|fructose-6-phosphate binding (GO:0070095)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	23				Colorectal(79;0.0811)		TGTGTGTCATCCCAGCCACCA	0.642																																					p.I524I		Atlas-SNP	.											.	PFKL	65	.	0			c.C1572T						PASS	.						114.0	78.0	91.0					21																	45743723		2201	4300	6501	SO:0001819	synonymous_variant	5211	exon16			TGTCATCCCAGCC		CCDS33582.1	21q22.3	1992-12-17			ENSG00000141959	ENSG00000141959	2.7.1.11		8876	protein-coding gene	gene with protein product		171860					Standard	NR_024108		Approved		uc002zel.3	P17858	OTTHUMG00000086910	ENST00000349048.4:c.1572C>T	chr21.hg19:g.45743723C>T		54.0	0.0	.		89.0	38.0	.	NM_002626	Q96A64|Q96IH4|Q9BR91	Silent	SNP	ENST00000349048.4	hg19	CCDS33582.1																																																																																			.	.	.	none		0.642	PFKL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195805.1		
INPP5J	27124	hgsc.bcm.edu	37	22	31523948	31523948	+	Missense_Mutation	SNP	G	G	C			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr22:31523948G>C	ENST00000331075.5	+	7	1848	c.1799G>C	c.(1798-1800)tGg>tCg	p.W600S	INPP5J_ENST00000400294.2_Missense_Mutation_p.W233S|INPP5J_ENST00000412277.2_Missense_Mutation_p.W533S|INPP5J_ENST00000401755.1_5'UTR|INPP5J_ENST00000404390.3_Missense_Mutation_p.W232S|INPP5J_ENST00000402238.1_5'UTR|INPP5J_ENST00000404453.1_5'UTR|INPP5J_ENST00000405300.1_Missense_Mutation_p.W233S	NM_001284285.1	NP_001271214.1	Q15735	PI5PA_HUMAN	inositol polyphosphate-5-phosphatase J	600	Catalytic. {ECO:0000255}.				inositol phosphate metabolic process (GO:0043647)|negative regulation of microtubule polymerization (GO:0031115)|negative regulation of neuron projection development (GO:0010977)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	inositol-1,3,4,5-tetrakisphosphate 5-phosphatase activity (GO:0052659)|inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|inositol-polyphosphate 5-phosphatase activity (GO:0004445)|phosphatidylinositol-3,4,5-trisphosphate 5-phosphatase activity (GO:0034485)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|skin(1)	12						CTCGTGTTCTGGTTCGGGGAC	0.577																																					p.W232S		Atlas-SNP	.											.	INPP5J	94	.	0			c.G695C						PASS	.						47.0	45.0	45.0					22																	31523948		1913	4119	6032	SO:0001583	missense	27124	exon7			TGTTCTGGTTCGG	U45975	CCDS46687.1, CCDS63453.1, CCDS63454.1, CCDS63455.1, CCDS74847.1	22q12.2	2008-09-09	2008-09-09	2008-09-09	ENSG00000185133	ENSG00000185133			8956	protein-coding gene	gene with protein product		606481	"""phosphatidylinositol (4,5) bisphosphate 5-phosphatase, A"""	PIB5PA		10591208	Standard	NM_001284287		Approved	INPP5	uc003aju.4	Q15735	OTTHUMG00000151206	ENST00000331075.5:c.1799G>C	chr22.hg19:g.31523948G>C	ENSP00000333262:p.Trp600Ser	73.0	0.0	.		110.0	46.0	.	NM_001002837	B3KS54|Q32M61|Q6ZTH6|Q8N902|Q9UDT9	Missense_Mutation	SNP	ENST00000331075.5	hg19		.	.	.	.	.	.	.	.	.	.	G	19.90	3.913228	0.72983	.	.	ENSG00000185133	ENST00000331075;ENST00000412277;ENST00000400294;ENST00000405300;ENST00000404390	D;D;D;D;D	0.81499	-1.5;-1.5;-1.5;-1.5;-1.5	4.76	4.76	0.60689	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);	0.000000	0.85682	D	0.000000	D	0.93792	0.8015	H	0.98068	4.14	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.997	D	0.96283	0.9208	10	0.87932	D	0	.	17.7408	0.88406	0.0:0.0:1.0:0.0	.	533;600;232	B4DF95;Q15735;Q15735-3	.;PI5PA_HUMAN;.	S	600;533;233;233;232	ENSP00000333262:W600S;ENSP00000392924:W533S;ENSP00000383150:W233S;ENSP00000384596:W233S;ENSP00000384534:W232S	ENSP00000333262:W600S	W	+	2	0	INPP5J	29853948	1.000000	0.71417	1.000000	0.80357	0.748000	0.42578	9.343000	0.97047	2.329000	0.79093	0.655000	0.94253	TGG	.	.	.	none		0.577	INPP5J-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000321784.1	NM_001002837	
MEI1	150365	hgsc.bcm.edu	37	22	42191444	42191444	+	Silent	SNP	C	C	A			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr22:42191444C>A	ENST00000401548.3	+	29	3604	c.3564C>A	c.(3562-3564)ctC>ctA	p.L1188L	MEI1_ENST00000400107.1_Silent_p.L521L|MEI1_ENST00000476893.1_3'UTR|MEI1_ENST00000300398.4_Intron	NM_152513.3	NP_689726.3			meiosis inhibitor 1											breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						GCAGTGTCCTCTCTCATGAAG	0.542																																					p.L1188L		Atlas-SNP	.											.	MEI1	87	.	0			c.C3564A						PASS	.						154.0	156.0	155.0					22																	42191444		2039	4204	6243	SO:0001819	synonymous_variant	150365	exon29			TGTCCTCTCTCAT	AK092934	CCDS46718.1	22q13.2	2013-10-11			ENSG00000167077	ENSG00000167077			28613	protein-coding gene	gene with protein product	"""spermatogenesis associated 38"""	608797				16683055	Standard	XM_006724154		Approved	MGC40042, SPATA38	uc003baz.1	Q5TIA1	OTTHUMG00000030083	ENST00000401548.3:c.3564C>A	chr22.hg19:g.42191444C>A		150.0	0.0	.		207.0	78.0	.	NM_152513		Silent	SNP	ENST00000401548.3	hg19	CCDS46718.1	.	.	.	.	.	.	.	.	.	.	c	0.075	-1.194186	0.01594	.	.	ENSG00000167077	ENST00000423900	.	.	.	5.01	1.65	0.23941	.	0.552403	0.16357	N	0.217956	T	0.56108	0.1963	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54906	-0.8223	6	0.87932	D	0	-15.0087	2.2726	0.04095	0.1575:0.5189:0.1526:0.171	.	.	.	.	I	7	.	ENSP00000410973:L7I	L	+	1	0	MEI1	40521390	0.219000	0.23619	0.509000	0.27700	0.069000	0.16628	-0.099000	0.11007	0.139000	0.18822	-0.521000	0.04368	CTC	.	.	.	none		0.542	MEI1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000074937.3	NM_152513	
EEF2	1938	hgsc.bcm.edu	37	19	3983291	3983293	+	Splice_Site	DEL	TGA	TGA	-	rs111408370		TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	TGA	TGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr19:3983291_3983293delTGA	ENST00000309311.6	-	3	307		c.e3-2		EEF2_ENST00000600720.1_Splice_Site|SNORD37_ENST00000384048.1_RNA	NM_001961.3	NP_001952.1	P13639	EF2_HUMAN	eukaryotic translation elongation factor 2						cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|hematopoietic progenitor cell differentiation (GO:0002244)|positive regulation of gene expression (GO:0010628)|positive regulation of translation (GO:0045727)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation activator activity (GO:0008494)|translation elongation factor activity (GO:0003746)			endometrium(4)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|GBM - Glioblastoma multiforme(1328;0.0223)|STAD - Stomach adenocarcinoma(1328;0.18)		GAGATGGCACTGATGGAGGGAGG	0.586																																					.	Colon(165;1804 1908 4071 6587 18799)	Atlas-INDEL	.											.	EEF2	57	.	0			.						PASS	.																																			SO:0001630	splice_region_variant	1938	.			.	Z11692	CCDS12117.1	19p13.3	2012-09-20			ENSG00000167658	ENSG00000167658			3214	protein-coding gene	gene with protein product	"""polypeptidyl-tRNA translocase"""	130610		EF2		2610926, 6427766	Standard	NM_001961		Approved	EEF-2	uc002lze.3	P13639		ENST00000309311.6:c.219-2TCA>-	chr19.hg19:g.3983291_3983293delTGA		28.0	0.0	0		64.0	19.0	0.296875	.	B2RMP5|D6W618|Q58J86	Splice_Site	DEL	ENST00000309311.6	hg19	CCDS12117.1																																																																																			.	.	.	none		0.586	EEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457615.2	NM_001961	Intron
KIDINS220	57498	hgsc.bcm.edu	37	2	8871568	8871568	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr2:8871568delT	ENST00000256707.3	-	30	4779	c.4598delA	c.(4597-4599)aacfs	p.N1533fs	KIDINS220_ENST00000418530.1_Frame_Shift_Del_p.N1434fs|KIDINS220_ENST00000427284.1_Frame_Shift_Del_p.N1514fs|KIDINS220_ENST00000473731.1_Frame_Shift_Del_p.N1514fs	NM_020738.2	NP_065789.1	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate, 220kDa	1533					activation of MAPKK activity (GO:0000186)|cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|dendrite morphogenesis (GO:0048813)|in utero embryonic development (GO:0001701)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of neuron projection development (GO:0010976)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|protein complex (GO:0043234)	PDZ domain binding (GO:0030165)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(25)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	60	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					CAGTGGAGTGTTATCTGATTC	0.478																																					p.N1533fs		Atlas-INDEL	.											.	KIDINS220	136	.	0			c.4599delC						PASS	.						82.0	83.0	82.0					2																	8871568		1930	4146	6076	SO:0001589	frameshift_variant	57498	exon30			.	AK025528	CCDS42650.1	2p24	2013-01-10			ENSG00000134313	ENSG00000134313		"""Ankyrin repeat domain containing"""	29508	protein-coding gene	gene with protein product	"""ankyrin repeat-rich membrane-spanning protein"""	615759				10998417, 10574462	Standard	NM_020738		Approved	ARMS	uc002qzc.2	Q9ULH0	OTTHUMG00000151658	ENST00000256707.3:c.4598delA	chr2.hg19:g.8871568delT	ENSP00000256707:p.Asn1533fs	233.0	0.0	0		145.0	57.0	0.393103	NM_020738	A1L4N4|Q4VC08|Q6MZU2|Q9H889|Q9H9E4|Q9NT37|Q9UF42	Frame_Shift_Del	DEL	ENST00000256707.3	hg19	CCDS42650.1																																																																																			.	.	.	none		0.478	KIDINS220-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323408.2	NM_020738	
PER2	8864	hgsc.bcm.edu	37	2	239176835	239176850	+	Splice_Site	DEL	GGACACTGCGGAGAAG	GGACACTGCGGAGAAG	-	rs373179670|rs377264399|rs202102579|rs374332427		TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	GGACACTGCGGAGAAG	GGACACTGCGGAGAAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr2:239176835_239176850delGGACACTGCGGAGAAG	ENST00000254657.3	-	8	1104_1108	c.825_829delCTTCTCCGCAGTGTCC	c.(823-831)agcttctcc>agcc	p.SFS275fs	PER2_ENST00000355768.2_Splice_Site_p.SFS275fs|PER2_ENST00000440245.1_Splice_Site_p.SFS275fs|PER2_ENST00000254658.3_Splice_Site_p.SFS275fs	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	275					circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		TGGCTTTTCCGGACACTGCGGAGAAGAGCCACGCTC	0.574																																					p.275_277del		Atlas-INDEL	.											.	PER2	85	.	0			c.825_830del						PASS	.																																			SO:0001630	splice_region_variant	8864	exon8			.	AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.825-1CTTCTCCGCAGTGTCC>-	chr2.hg19:g.239176835_239176850delGGACACTGCGGAGAAG		76.0	0.0	0		129.0	35.0	0.271318	NM_022817	A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	In_Frame_Del	DEL	ENST00000254657.3	hg19	CCDS2528.1																																																																																			.	.	.	none		0.574	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257167.1	NM_022817	Frame_Shift_Del
TRIM15	89870	hgsc.bcm.edu	37	6	30140094	30140094	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr6:30140094delA	ENST00000376694.4	+	7	1835	c.1366delA	c.(1366-1368)aaafs	p.K457fs	TRIM15_ENST00000376688.1_Intron	NM_033229.2	NP_150232.2	Q9C019	TRI15_HUMAN	tripartite motif containing 15	457	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				innate immune response (GO:0045087)|mesodermal cell fate determination (GO:0007500)|negative regulation of intracellular transport of viral material (GO:1901253)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of RIG-I signaling pathway (GO:1900246)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of type I interferon production (GO:0032481)	intracellular (GO:0005622)	zinc ion binding (GO:0008270)			large_intestine(2)|lung(8)|prostate(2)|skin(1)|urinary_tract(1)	14						TGCCGTCTGGAAAAAAGGTTC	0.637																																					p.W455X		Atlas-INDEL	.											.	TRIM15	34	.	0			c.1365delG						PASS	.						36.0	45.0	42.0					6																	30140094		1506	2707	4213	SO:0001589	frameshift_variant	89870	exon7			.	AF220132, U34249	CCDS4677.1	6p21.33	2013-01-09	2011-01-25		ENSG00000204610	ENSG00000204610		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16284	protein-coding gene	gene with protein product			"""zinc finger protein 178"", ""tripartite motif-containing 15"""	ZNF178		11331580, 8304341, 8812418	Standard	NM_033229		Approved	ZNFB7, RNF93	uc010jrx.3	Q9C019	OTTHUMG00000031031	ENST00000376694.4:c.1366delA	chr6.hg19:g.30140094delA	ENSP00000365884:p.Lys457fs	135.0	0.0	0		184.0	81.0	0.440217	NM_033229	A2BEC9|O95604|Q8IUX9|Q9C018	Frame_Shift_Del	DEL	ENST00000376694.4	hg19	CCDS4677.1																																																																																			.	.	.	none		0.637	TRIM15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076026.2	NM_033229	
SRRM2	23524	hgsc.bcm.edu	37	16	2814808	2814809	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr16:2814808_2814809insT	ENST00000301740.8	+	11	4828_4829	c.4279_4280insT	c.(4279-4281)atgfs	p.M1427fs		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1427	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						TTCTCCTGAAATGAAAGATGGT	0.505																																					p.M1427fs		Atlas-INDEL	.											.	SRRM2	263	.	0			c.4279_4280insT						PASS	.																																			SO:0001589	frameshift_variant	23524	exon11			.	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.4280dupT	chr16.hg19:g.2814809_2814809dupT	ENSP00000301740:p.Met1427fs	336.0	0.0	0		367.0	150.0	0.408719	NM_016333	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Frame_Shift_Ins	INS	ENST00000301740.8	hg19	CCDS32373.1																																																																																			.	.	.	none		0.505	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
PCK1	5105	hgsc.bcm.edu	37	20	56140816	56140817	+	Frame_Shift_Del	DEL	GA	GA	-	rs17847705		TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	GA	GA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr20:56140816_56140817delGA	ENST00000319441.4	+	10	1989_1990	c.1825_1826delGA	c.(1825-1827)gagfs	p.E609fs	PCK1_ENST00000543666.1_Frame_Shift_Del_p.E292fs	NM_002591.3	NP_002582.3	P35558	PCKGC_HUMAN	phosphoenolpyruvate carboxykinase 1 (soluble)	609					carbohydrate metabolic process (GO:0005975)|drug metabolic process (GO:0017144)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycerol biosynthetic process from pyruvate (GO:0046327)|internal protein amino acid acetylation (GO:0006475)|oxaloacetate metabolic process (GO:0006107)|response to activity (GO:0014823)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxylic acid binding (GO:0031406)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)			endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(19)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	34	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			CTGTGAAATCGAGAGAGAGATC	0.47																																					p.608_609del		Atlas-INDEL	.											.	PCK1	95	.	0			c.1824_1825del						PASS	.																																			SO:0001589	frameshift_variant	5105	exon10			.		CCDS13460.1	20q13.31	2007-11-06			ENSG00000124253	ENSG00000124253	4.1.1.32		8724	protein-coding gene	gene with protein product		614168				1492743	Standard	NM_002591		Approved	PEPCK-C	uc002xyn.4	P35558	OTTHUMG00000032825	ENST00000319441.4:c.1825_1826delGA	chr20.hg19:g.56140824_56140825delGA	ENSP00000319814:p.Glu609fs	115.0	0.0	0		102.0	32.0	0.313726	NM_002591	A8K437|B4DT64|Q8TCA3|Q9UJD2	Frame_Shift_Del	DEL	ENST00000319441.4	hg19	CCDS13460.1																																																																																			.	.	.	none		0.470	PCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079851.2		
PSAT1	29968	hgsc.bcm.edu	37	9	80942983	80942984	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AL-3472-01A-01D-1252-08	TCGA-AL-3472-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f246dd1b-eedd-4105-b80e-77c3cb63a450	a80cc8a1-24ad-41f0-bdad-9c05f2ad4901	g.chr9:80942983_80942984insA	ENST00000376588.3	+	8	954_955	c.886_887insA	c.(886-888)caafs	p.Q296fs	PSAT1_ENST00000347159.2_Intron	NM_058179.2	NP_478059.1	Q9Y617	SERC_HUMAN	phosphoserine aminotransferase 1	296					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-serine biosynthetic process (GO:0006564)|pyridoxine biosynthetic process (GO:0008615)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	O-phospho-L-serine:2-oxoglutarate aminotransferase activity (GO:0004648)|pyridoxal phosphate binding (GO:0030170)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|urinary_tract(1)	20						AGTGGAGCCCCAAAATAGAAGC	0.337																																					p.Q296fs	Colon(34;187 791 10662 18313 37609)	Atlas-INDEL	.											.	PSAT1	33	.	0			c.886_887insA						PASS	.																																			SO:0001589	frameshift_variant	29968	exon8			.	BC004863	CCDS6659.1, CCDS6660.1	9q21.2	2008-08-11			ENSG00000135069	ENSG00000135069			19129	protein-coding gene	gene with protein product		610936				12633500, 3651428	Standard	NM_058179		Approved	PSA	uc004ala.3	Q9Y617	OTTHUMG00000020066	ENST00000376588.3:c.890dupA	chr9.hg19:g.80942987_80942987dupA	ENSP00000365773:p.Gln296fs	111.0	0.0	0		44.0	21.0	0.477273	NM_058179	Q5T7G5|Q5T7G6|Q96AW2|Q9BQ12	Frame_Shift_Ins	INS	ENST00000376588.3	hg19	CCDS6660.1																																																																																			.	.	.	none		0.337	PSAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052777.1	NM_021154	
