#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SCMH1	22955	hgsc.bcm.edu	37	1	41503104	41503104	+	Silent	SNP	G	G	A			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr1:41503104G>A	ENST00000326197.7	-	12	1877	c.1578C>T	c.(1576-1578)caC>caT	p.H526H	SCMH1_ENST00000372597.1_Silent_p.H479H|SCMH1_ENST00000361705.3_Silent_p.H479H|SCMH1_ENST00000402904.2_Silent_p.H526H|SCMH1_ENST00000372596.1_Silent_p.H465H|SCMH1_ENST00000456518.2_Silent_p.H368H|SCMH1_ENST00000472037.1_5'UTR|SCMH1_ENST00000397171.2_Silent_p.H465H|SCMH1_ENST00000337495.5_Silent_p.H536H|SCMH1_ENST00000361191.5_Silent_p.H465H|SCMH1_ENST00000397174.2_Silent_p.H506H|SCMH1_ENST00000372595.1_Silent_p.H465H					sex comb on midleg homolog 1 (Drosophila)											breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(2)|pancreas(2)|upper_aerodigestive_tract(1)	15	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)|Breast(333;0.162)	Myeloproliferative disorder(586;0.0393)				GCAAGGGCCGGTGCCTTTGGG	0.587																																					p.H536H		Atlas-SNP	.											.	SCMH1	120	.	0			c.C1608T						PASS	.						200.0	179.0	186.0					1																	41503104		2203	4300	6503	SO:0001819	synonymous_variant	22955	exon13			GGGCCGGTGCCTT	AF149045	CCDS461.1, CCDS30688.1, CCDS53301.1, CCDS53302.1, CCDS53303.1, CCDS53304.1	1p34	2013-01-10			ENSG00000010803	ENSG00000010803		"""Sterile alpha motif (SAM) domain containing"""	19003	protein-coding gene	gene with protein product						10524249	Standard	NM_012236		Approved	Scml3	uc001cgs.3	Q96GD3	OTTHUMG00000005720	ENST00000326197.7:c.1578C>T	chr1.hg19:g.41503104G>A		225.0	0.0	.		181.0	24.0	.	NM_001172219		Silent	SNP	ENST00000326197.7	hg19	CCDS30688.1																																																																																			.	.	.	none		0.587	SCMH1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015656.1		
PTGFR	5737	hgsc.bcm.edu	37	1	78959187	78959187	+	Silent	SNP	G	G	A			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr1:78959187G>A	ENST00000370757.3	+	2	996	c.759G>A	c.(757-759)gcG>gcA	p.A253A	PTGFR_ENST00000370756.3_Silent_p.A253A|PTGFR_ENST00000370758.1_Silent_p.A253A	NM_000959.3	NP_000950.1	P43088	PF2R_HUMAN	prostaglandin F receptor (FP)	253					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|parturition (GO:0007567)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	prostaglandin F receptor activity (GO:0004958)	p.A253A(2)		breast(6)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	33				Colorectal(170;0.248)	Bimatoprost(DB00905)|Dinoprost Tromethamine(DB01160)|Latanoprost(DB00654)|Tafluprost(DB08819)|Travoprost(DB00287)	AGCTCCTGGCGATAATGTGTG	0.393																																					p.A253A		Atlas-SNP	.											PTGFR_ENST00000370758,rectum,carcinoma,0,4	PTGFR	121	.	2	Substitution - coding silent(2)	skin(2)	c.G759A						PASS	.						52.0	49.0	50.0					1																	78959187		2203	4300	6503	SO:0001819	synonymous_variant	5737	exon2			CCTGGCGATAATG	AF004021	CCDS686.1, CCDS30759.1	1p31.1	2012-08-08			ENSG00000122420	ENSG00000122420		"""GPCR / Class A : Prostanoid receptors"""	9600	protein-coding gene	gene with protein product		600563				8300593, 7759114	Standard	XM_006710781		Approved	FP	uc001din.3	P43088	OTTHUMG00000009644	ENST00000370757.3:c.759G>A	chr1.hg19:g.78959187G>A		153.0	0.0	.		127.0	17.0	.	NM_000959	A8K9Y0|Q2KHP3|Q6RYQ6|Q9P1X4	Silent	SNP	ENST00000370757.3	hg19	CCDS686.1																																																																																			.	.	.	none		0.393	PTGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026582.1	NM_000959	
PEX19	5824	hgsc.bcm.edu	37	1	160253370	160253370	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr1:160253370C>T	ENST00000368072.5	-	2	151	c.130G>A	c.(130-132)Gcc>Acc	p.A44T	DCAF8_ENST00000556710.1_Intron|PEX19_ENST00000532508.1_5'UTR|PEX19_ENST00000440949.3_5'UTR|DCAF8_ENST00000608310.1_Intron	NM_001193644.1|NM_002857.3	NP_001180573.1|NP_002848.1	P40855	PEX19_HUMAN	peroxisomal biogenesis factor 19	44	Docking to the peroxisome membrane and binding to PEX3.|Necessary for PEX19 function on peroxisome biogenesis.				chaperone-mediated protein folding (GO:0061077)|chaperone-mediated protein transport (GO:0072321)|establishment of protein localization to peroxisome (GO:0072663)|negative regulation of lipid binding (GO:1900131)|peroxisome fission (GO:0016559)|peroxisome membrane biogenesis (GO:0016557)|peroxisome organization (GO:0007031)|protein import into peroxisome membrane (GO:0045046)|protein stabilization (GO:0050821)|protein targeting to peroxisome (GO:0006625)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)	ATPase binding (GO:0051117)|peroxisome membrane class-1 targeting sequence binding (GO:0036105)|protein N-terminus binding (GO:0047485)			cervix(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(2)	11	all_cancers(52;1.27e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GCATCAGGGGCCGTGGTGGTA	0.562																																					p.A44T		Atlas-SNP	.											.	PEX19	34	.	0			c.G130A						PASS	.						65.0	67.0	66.0					1																	160253370		2203	4300	6503	SO:0001583	missense	5824	exon2			CAGGGGCCGTGGT	Y09048	CCDS1201.1	1q22	2008-07-18	2004-03-17	2004-03-19	ENSG00000162735	ENSG00000162735			9713	protein-coding gene	gene with protein product	"""housekeeping gene, 33kD"""	600279	"""peroxisomal farnesylated protein"""	PXF		9339377, 10051604	Standard	NM_002857		Approved	HK33, D1S2223E, PMP1, PMPI, PXMP1		P40855	OTTHUMG00000033112	ENST00000368072.5:c.130G>A	chr1.hg19:g.160253370C>T	ENSP00000357051:p.Ala44Thr	186.0	0.0	.		200.0	27.0	.	NM_002857	D3DVE7|Q5QNY4|Q8NI97	Missense_Mutation	SNP	ENST00000368072.5	hg19	CCDS1201.1	.	.	.	.	.	.	.	.	.	.	C	17.55	3.417114	0.62511	.	.	ENSG00000162735	ENST00000368072;ENST00000429425;ENST00000392220	.	.	.	4.61	0.66	0.17868	.	0.463549	0.23343	N	0.049217	T	0.12263	0.0298	N	0.19112	0.55	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.11792	-1.0573	9	0.13853	T	0.58	-0.5735	5.3692	0.16131	0.0:0.5415:0.1411:0.3175	.	44	P40855	PEX19_HUMAN	T	44;24;24	.	ENSP00000357051:A44T	A	-	1	0	PEX19	158519994	0.994000	0.37717	0.887000	0.34795	0.892000	0.51952	3.040000	0.49799	-0.022000	0.13986	-0.217000	0.12591	GCC	.	.	.	none		0.562	PEX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080642.2	NM_002857	
SPHKAP	80309	hgsc.bcm.edu	37	2	228882137	228882137	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr2:228882137C>T	ENST00000392056.3	-	7	3479	c.3433G>A	c.(3433-3435)Gag>Aag	p.E1145K	SPHKAP_ENST00000344657.5_Missense_Mutation_p.E1145K	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1145						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		AGCAGTAACTCAAATCCTCTC	0.527																																					p.E1145K		Atlas-SNP	.											.	SPHKAP	750	.	0			c.G3433A						PASS	.						65.0	54.0	58.0					2																	228882137		2203	4300	6503	SO:0001583	missense	80309	exon7			GTAACTCAAATCC		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.3433G>A	chr2.hg19:g.228882137C>T	ENSP00000375909:p.Glu1145Lys	121.0	0.0	.		157.0	25.0	.	NM_030623	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	hg19	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	C	30	5.054264	0.93793	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.62498	0.02;0.02	5.57	5.57	0.84162	.	0.089852	0.85682	D	0.000000	T	0.65842	0.2730	N	0.19112	0.55	0.58432	D	0.999995	P;D;D	0.65815	0.952;0.995;0.99	P;P;P	0.59487	0.601;0.82;0.858	T	0.69793	-0.5049	10	0.72032	D	0.01	.	18.8971	0.92427	0.0:1.0:0.0:0.0	.	176;1145;1145	B3KR30;Q2M3C7;Q2M3C7-2	.;SPKAP_HUMAN;.	K	1145	ENSP00000375909:E1145K;ENSP00000339886:E1145K	ENSP00000339886:E1145K	E	-	1	0	SPHKAP	228590381	1.000000	0.71417	0.983000	0.44433	0.989000	0.77384	7.152000	0.77419	2.785000	0.95823	0.655000	0.94253	GAG	.	.	.	none		0.527	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623	
OXSM	54995	hgsc.bcm.edu	37	3	25832524	25832524	+	Missense_Mutation	SNP	C	C	A			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr3:25832524C>A	ENST00000280701.3	+	2	112	c.13C>A	c.(13-15)Ctg>Atg	p.L5M	OXSM_ENST00000449808.1_3'UTR|NGLY1_ENST00000417874.2_5'Flank|OXSM_ENST00000420173.2_Missense_Mutation_p.L5M	NM_017897.2	NP_060367.1	Q9NWU1	OXSM_HUMAN	3-oxoacyl-ACP synthase, mitochondrial	5					acyl-CoA metabolic process (GO:0006637)|medium-chain fatty acid biosynthetic process (GO:0051792)|short-chain fatty acid biosynthetic process (GO:0051790)	mitochondrion (GO:0005739)	3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	25						GTCCAACTGCCTGCAAAATTT	0.368																																					p.L5M		Atlas-SNP	.											.	OXSM	54	.	0			c.C13A						PASS	.						83.0	88.0	86.0					3																	25832524		2203	4300	6503	SO:0001583	missense	54995	exon2			AACTGCCTGCAAA	BC008202	CCDS2643.1, CCDS46780.1	3p24.2	2010-03-19			ENSG00000151093	ENSG00000151093	2.3.1.41		26063	protein-coding gene	gene with protein product	"""beta-ketoacyl synthase"""	610324				12477932	Standard	NM_017897		Approved	KS, FLJ20604, FASN2D	uc003cdn.3	Q9NWU1	OTTHUMG00000130477	ENST00000280701.3:c.13C>A	chr3.hg19:g.25832524C>A	ENSP00000280701:p.Leu5Met	278.0	0.0	.		196.0	36.0	.	NM_017897		Missense_Mutation	SNP	ENST00000280701.3	hg19	CCDS2643.1	.	.	.	.	.	.	.	.	.	.	C	7.760	0.705106	0.15172	.	.	ENSG00000151093	ENST00000452098;ENST00000280701;ENST00000420173;ENST00000428266	.	.	.	4.84	3.7	0.42460	.	1.003210	0.08029	N	0.993289	T	0.24774	0.0601	N	0.08118	0	0.24531	N	0.994111	P;P	0.47677	0.899;0.838	P;B	0.51355	0.667;0.372	T	0.14117	-1.0484	9	0.52906	T	0.07	-10.4228	5.7793	0.18297	0.0:0.0885:0.1686:0.7429	.	5;5	Q9NWU1-2;Q9NWU1	.;OXSM_HUMAN	M	5	.	ENSP00000280701:L5M	L	+	1	2	OXSM	25807528	0.036000	0.19791	0.572000	0.28498	0.418000	0.31294	0.834000	0.27518	0.992000	0.38840	-0.367000	0.07326	CTG	.	.	.	none		0.368	OXSM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252876.2	NM_017897	
PROS1	5627	hgsc.bcm.edu	37	3	93624723	93624723	+	Missense_Mutation	SNP	C	C	G			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr3:93624723C>G	ENST00000394236.3	-	6	822	c.506G>C	c.(505-507)gGa>gCa	p.G169A	PROS1_ENST00000407433.1_Missense_Mutation_p.G38A	NM_000313.3	NP_000304.2	P07225	PROS_HUMAN	protein S (alpha)	169	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|negative regulation of endopeptidase activity (GO:0010951)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|endopeptidase inhibitor activity (GO:0004866)			endometrium(3)|kidney(5)|large_intestine(8)|lung(26)|ovary(1)|skin(2)|urinary_tract(1)	46					Drotrecogin alfa(DB00055)|Menadione(DB00170)|Sodium Tetradecyl Sulfate(DB00464)	ACTGCAACCTCCATTTATATT	0.299																																					p.G169A		Atlas-SNP	.											.	PROS1	126	.	0			c.G506C						PASS	.						77.0	79.0	78.0					3																	93624723		2199	4296	6495	SO:0001583	missense	5627	exon6			CAACCTCCATTTA		CCDS2923.1	3q11.1	2013-06-03			ENSG00000184500	ENSG00000184500			9456	protein-coding gene	gene with protein product		176880		PROS		214811, 1833851	Standard	NM_000313		Approved		uc003drb.4	P07225	OTTHUMG00000150354	ENST00000394236.3:c.506G>C	chr3.hg19:g.93624723C>G	ENSP00000377783:p.Gly169Ala	268.0	0.0	.		287.0	47.0	.	NM_000313	A8KAC9|D3DN28|Q15518|Q7Z715|Q9UCZ8	Missense_Mutation	SNP	ENST00000394236.3	hg19	CCDS2923.1	.	.	.	.	.	.	.	.	.	.	C	17.74	3.464378	0.63513	.	.	ENSG00000184500	ENST00000394236;ENST00000407433;ENST00000348974;ENST00000472684	D;D;D;D	0.98329	-4.87;-4.87;-4.87;-1.67	4.44	4.44	0.53790	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.125904	0.53938	D	0.000053	D	0.96334	0.8804	M	0.67397	2.05	0.40346	D	0.979083	P	0.46064	0.872	B	0.35655	0.207	D	0.96712	0.9526	10	0.62326	D	0.03	.	13.0646	0.59025	0.0:0.8385:0.1615:0.0	.	169	P07225	PROS_HUMAN	A	169;38;201;38	ENSP00000377783:G169A;ENSP00000385794:G38A;ENSP00000330021:G201A;ENSP00000419616:G38A	ENSP00000330021:G201A	G	-	2	0	PROS1	95107413	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	2.172000	0.42463	2.314000	0.78098	0.484000	0.47621	GGA	.	.	.	none		0.299	PROS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317762.1	NM_000313	
GPBP1	65056	hgsc.bcm.edu	37	5	56542173	56542173	+	Silent	SNP	T	T	A	rs371740495		TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr5:56542173T>A	ENST00000506184.2	+	7	1630	c.525T>A	c.(523-525)atT>atA	p.I175I	GPBP1_ENST00000454432.2_Silent_p.I195I|GPBP1_ENST00000424459.3_Silent_p.I195I|GPBP1_ENST00000264779.6_Silent_p.I182I|GPBP1_ENST00000538707.1_Silent_p.I182I|GPBP1_ENST00000511209.1_Silent_p.I182I|GPBP1_ENST00000514387.2_Silent_p.I4I			Q86WP2	GPBP1_HUMAN	GC-rich promoter binding protein 1	175					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	19		Lung NSC(810;0.000861)|Prostate(74;0.0305)|Breast(144;0.222)		OV - Ovarian serous cystadenocarcinoma(10;7.64e-39)		TGCTGGTCATTAAGAAAGGTA	0.383																																					p.I182I		Atlas-SNP	.											.	GPBP1	51	.	0			c.T546A						PASS	.						84.0	86.0	85.0					5																	56542173		2203	4300	6503	SO:0001819	synonymous_variant	65056	exon6			GGTCATTAAGAAA		CCDS34162.1, CCDS47211.1, CCDS47212.1, CCDS47212.2, CCDS56368.1	5q11.2	2008-02-05				ENSG00000062194			29520	protein-coding gene	gene with protein product		608412				12842993	Standard	NM_022913		Approved	DKFZp761C169, vasculin	uc003jrk.4	Q86WP2		ENST00000506184.2:c.525T>A	chr5.hg19:g.56542173T>A		124.0	0.0	.		68.0	10.0	.	NM_001127236	A6NKW3|Q6NSH6|Q9H0D4|Q9H785|Q9NSN4	Silent	SNP	ENST00000506184.2	hg19	CCDS34162.1																																																																																			.	.	.	alt		0.383	GPBP1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000374496.1	NM_022913	
PCDHA4	56144	hgsc.bcm.edu	37	5	140188710	140188710	+	Silent	SNP	C	C	T			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr5:140188710C>T	ENST00000530339.1	+	1	1938	c.1938C>T	c.(1936-1938)cgC>cgT	p.R646R	PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Silent_p.R646R|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000356878.4_Silent_p.R646R|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	646	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCGCCACCGCCTACTGGTAC	0.682																																					p.R646R		Atlas-SNP	.											.	PCDHA4	419	.	0			c.C1938T						PASS	.						74.0	76.0	75.0					5																	140188710		2203	4300	6503	SO:0001819	synonymous_variant	56144	exon1			CCACCGCCTACTG	AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.1938C>T	chr5.hg19:g.140188710C>T		156.0	0.0	.		345.0	50.0	.	NM_031500	O75285|Q2M253	Silent	SNP	ENST00000530339.1	hg19	CCDS54916.1																																																																																			.	.	.	none		0.682	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372864.2	NM_018907	
ARSI	340075	hgsc.bcm.edu	37	5	149677875	149677875	+	Missense_Mutation	SNP	G	G	T			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr5:149677875G>T	ENST00000328668.7	-	2	1191	c.612C>A	c.(610-612)agC>agA	p.S204R		NM_001012301.2	NP_001012301.1	Q5FYB1	ARSI_HUMAN	arylsulfatase family, member I	204					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	23			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AGTACTGGCCGCTGAGCCCCC	0.607																																					p.S204R		Atlas-SNP	.											.	ARSI	65	.	0			c.C612A						PASS	.						59.0	56.0	57.0					5																	149677875		2203	4300	6503	SO:0001583	missense	340075	exon2			CTGGCCGCTGAGC	AY875937	CCDS34275.1	5q32	2014-03-03	2006-03-07			ENSG00000183876		"""Arylsulfatase family"""	32521	protein-coding gene	gene with protein product		610009	"""arylsulfatase I"""			16174644, 24482476	Standard	NM_001012301		Approved	FLJ16069, SPG66	uc003lrv.2	Q5FYB1		ENST00000328668.7:c.612C>A	chr5.hg19:g.149677875G>T	ENSP00000333395:p.Ser204Arg	47.0	0.0	.		92.0	4.0	.	NM_001012301	A1L3B0|B3KV22|B7XD03	Missense_Mutation	SNP	ENST00000328668.7	hg19	CCDS34275.1	.	.	.	.	.	.	.	.	.	.	G	9.783	1.175888	0.21704	.	.	ENSG00000183876	ENST00000328668;ENST00000515301;ENST00000509146	D;D;D	0.98633	-5.04;-5.04;-5.04	4.31	-3.25	0.05079	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.346719	0.35772	N	0.002983	D	0.91236	0.7238	N	0.01257	-0.925	0.32291	N	0.566281	B	0.06786	0.001	B	0.12156	0.007	T	0.82244	-0.0553	10	0.20046	T	0.44	.	13.7168	0.62702	0.7322:0.0:0.2678:0.0	.	204	Q5FYB1	ARSI_HUMAN	R	204;61;61	ENSP00000333395:S204R;ENSP00000426879:S61R;ENSP00000420955:S61R	ENSP00000333395:S204R	S	-	3	2	ARSI	149658068	0.000000	0.05858	0.974000	0.42286	0.992000	0.81027	-1.644000	0.02002	-0.629000	0.05575	0.555000	0.69702	AGC	.	.	.	none		0.607	ARSI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373681.1	NM_001012301	
NOD1	10392	hgsc.bcm.edu	37	7	30472766	30472766	+	Missense_Mutation	SNP	A	A	G			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr7:30472766A>G	ENST00000222823.4	-	12	3176	c.2651T>C	c.(2650-2652)gTg>gCg	p.V884A		NM_006092.2	NP_006083.1	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain containing 1	884					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPK activity (GO:0000187)|apoptotic process (GO:0006915)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-8 biosynthetic process (GO:0042228)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of tumor necrosis factor production (GO:0032760)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|identical protein binding (GO:0042802)|peptidoglycan binding (GO:0042834)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|skin(2)	39						ACTCTCTGCCACTTCATCGTT	0.393																																					p.V884A		Atlas-SNP	.											.	NOD1	79	.	0			c.T2651C						PASS	.						133.0	117.0	123.0					7																	30472766		2203	4300	6503	SO:0001583	missense	10392	exon12			TCTGCCACTTCAT	AF126484	CCDS5427.1	7p15-p14	2006-12-08	2006-12-08	2006-12-08	ENSG00000106100	ENSG00000106100		"""Nucleotide-binding domain and leucine rich repeat containing"""	16390	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 1"", ""NLR family, CARD domain containing 1"""	605980	"""caspase recruitment domain family, member 4"""	CARD4		10224040, 10329646	Standard	NM_006092		Approved	NLRC1, CLR7.1	uc003tav.3	Q9Y239	OTTHUMG00000023923	ENST00000222823.4:c.2651T>C	chr7.hg19:g.30472766A>G	ENSP00000222823:p.Val884Ala	125.0	0.0	.		44.0	8.0	.	NM_006092	B4DTU3|Q549U4|Q8IWF5	Missense_Mutation	SNP	ENST00000222823.4	hg19	CCDS5427.1	.	.	.	.	.	.	.	.	.	.	A	3.545	-0.092917	0.07053	.	.	ENSG00000106100	ENST00000222823	T	0.51574	0.7	5.74	0.404	0.16355	.	0.399974	0.28544	N	0.014963	T	0.14013	0.0339	N	0.00815	-1.16	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.09885	-1.0654	10	0.12103	T	0.63	.	8.3537	0.32318	0.5662:0.0:0.4338:0.0	.	884	Q9Y239	NOD1_HUMAN	A	884	ENSP00000222823:V884A	ENSP00000222823:V884A	V	-	2	0	NOD1	30439291	0.488000	0.25996	0.983000	0.44433	0.937000	0.57800	0.908000	0.28545	0.117000	0.18138	0.460000	0.39030	GTG	.	.	.	none		0.393	NOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250443.2		
CUEDC2	79004	hgsc.bcm.edu	37	10	104184514	104184514	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr10:104184514C>T	ENST00000369937.4	-	3	255	c.110G>A	c.(109-111)gGg>gAg	p.G37E	CUEDC2_ENST00000465409.1_5'Flank	NM_024040.2	NP_076945.2	Q9H467	CUED2_HUMAN	CUE domain containing 2	37						cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)				autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(1)|stomach(1)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.122)		Epithelial(162;9.17e-09)|all cancers(201;2.16e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		CTCCAGGACCCCAAGCACATA	0.592																																					p.G37E		Atlas-SNP	.											.	CUEDC2	22	.	0			c.G110A						PASS	.						45.0	49.0	48.0					10																	104184514		1955	4136	6091	SO:0001583	missense	79004	exon3			AGGACCCCAAGCA	BC000262	CCDS41566.1	10q24.32	2008-10-23	2004-03-04	2004-03-05	ENSG00000107874	ENSG00000107874			28352	protein-coding gene	gene with protein product		614142	"""chromosome 10 open reading frame 66"""	C10orf66		12477932	Standard	NM_024040		Approved	MGC2491	uc001kvn.2	Q9H467	OTTHUMG00000018958	ENST00000369937.4:c.110G>A	chr10.hg19:g.104184514C>T	ENSP00000358953:p.Gly37Glu	106.0	0.0	.		216.0	30.0	.	NM_024040	D3DR88|Q9BWG8	Missense_Mutation	SNP	ENST00000369937.4	hg19	CCDS41566.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.419316	0.83559	.	.	ENSG00000107874	ENST00000369937	D	0.85088	-1.94	5.36	5.36	0.76844	.	0.051192	0.85682	D	0.000000	D	0.89061	0.6608	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90111	0.4192	10	0.87932	D	0	-28.8879	18.4607	0.90737	0.0:1.0:0.0:0.0	.	37	Q9H467	CUED2_HUMAN	E	37	ENSP00000358953:G37E	ENSP00000358953:G37E	G	-	2	0	CUEDC2	104174504	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.245000	0.78237	2.688000	0.91661	0.561000	0.74099	GGG	.	.	.	none		0.592	CUEDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050060.1	NM_024040	
SORCS3	22986	hgsc.bcm.edu	37	10	107022222	107022222	+	Missense_Mutation	SNP	G	G	C			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr10:107022222G>C	ENST00000369701.3	+	26	3804	c.3577G>C	c.(3577-3579)Gac>Cac	p.D1193H		NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	1193					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		GGAGCTGCTGGACAAAGAGCT	0.542																																					p.D1193H	NSCLC(116;1497 1690 7108 13108 14106)	Atlas-SNP	.											SORCS3,NS,carcinoma,0,1	SORCS3	282	.	0			c.G3577C						PASS	.						69.0	55.0	60.0					10																	107022222		2203	4300	6503	SO:0001583	missense	22986	exon26			CTGCTGGACAAAG	AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.3577G>C	chr10.hg19:g.107022222G>C	ENSP00000358715:p.Asp1193His	122.0	0.0	.		27.0	2.0	.	NM_014978	Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	ENST00000369701.3	hg19	CCDS7558.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.902493	0.92035	.	.	ENSG00000156395	ENST00000369701	T	0.19394	2.15	5.84	5.84	0.93424	.	0.105330	0.64402	D	0.000004	T	0.34106	0.0886	N	0.24115	0.695	0.58432	D	0.999998	D	0.76494	0.999	D	0.70935	0.971	T	0.02512	-1.1148	9	.	.	.	.	20.1579	0.98126	0.0:0.0:1.0:0.0	.	1193	Q9UPU3	SORC3_HUMAN	H	1193	ENSP00000358715:D1193H	.	D	+	1	0	SORCS3	107012212	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.476000	0.97823	2.767000	0.95098	0.555000	0.69702	GAC	.	.	.	none		0.542	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978	
MUC2	4583	hgsc.bcm.edu	37	11	1104253	1104253	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr11:1104253G>A	ENST00000441003.2	+	49	8471	c.8444G>A	c.(8443-8445)gGg>gAg	p.G2815E		NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	5177					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	AGGCATCTGGGGAGCGGGTGA	0.692																																					p.G2811E		Atlas-SNP	.											.	MUC2	614	.	0			c.G8432A						PASS	.						27.0	31.0	30.0					11																	1104253		1848	4082	5930	SO:0001583	missense	4583	exon50			ATCTGGGGAGCGG	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.8444G>A	chr11.hg19:g.1104253G>A	ENSP00000415183:p.Gly2815Glu	36.0	0.0	.		111.0	17.0	.	NM_002457	Q14878	Missense_Mutation	SNP	ENST00000441003.2	hg19		.	.	.	.	.	.	.	.	.	.	G	6.142	0.394436	0.11638	.	.	ENSG00000198788	ENST00000441003	T	0.14516	2.5	2.52	0.508	0.16972	.	.	.	.	.	T	0.10594	0.0259	L	0.44542	1.39	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.33471	-0.9867	9	0.87932	D	0	.	3.1167	0.06377	0.153:0.0:0.5868:0.2602	.	2815	E7EUV1	.	E	2815	ENSP00000415183:G2815E	ENSP00000415183:G2815E	G	+	2	0	MUC2	1094253	0.029000	0.19370	0.000000	0.03702	0.009000	0.06853	2.405000	0.44548	0.131000	0.18576	0.491000	0.48974	GGG	.	.	.	none		0.692	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
KRTAP5-5	439915	hgsc.bcm.edu	37	11	1651483	1651483	+	Missense_Mutation	SNP	G	G	C			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr11:1651483G>C	ENST00000399676.2	+	1	451	c.413G>C	c.(412-414)gGc>gCc	p.G138A		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	138	8 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)		p.G138A(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		TCCAAGGGGGGCTGTGGCTCC	0.692																																					p.G138A		Atlas-SNP	.											KRTAP5-5,NS,carcinoma,0,2	KRTAP5-5	86	.	1	Substitution - Missense(1)	lung(1)	c.G413C						PASS	.						13.0	19.0	17.0					11																	1651483		2129	4198	6327	SO:0001583	missense	439915	exon1			AGGGGGGCTGTGG	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.413G>C	chr11.hg19:g.1651483G>C	ENSP00000382584:p.Gly138Ala	105.0	1.0	.		221.0	11.0	.	NM_001001480	A8MWN2	Missense_Mutation	SNP	ENST00000399676.2	hg19	CCDS41592.1	.	.	.	.	.	.	.	.	.	.	g	0	-2.606108	0.00121	.	.	ENSG00000185940	ENST00000399676;ENST00000422553	T	0.01203	5.18	3.03	2.11	0.27256	.	.	.	.	.	T	0.01695	0.0054	M	0.82823	2.61	0.22601	N	0.998945	B	0.25667	0.131	B	0.19666	0.026	T	0.52366	-0.8585	9	0.02654	T	1	.	6.1318	0.20209	0.1478:0.0:0.8522:0.0	.	138	Q701N2	KRA55_HUMAN	A	138;109	ENSP00000382584:G138A	ENSP00000382584:G138A	G	+	2	0	KRTAP5-5	1608059	1.000000	0.71417	0.411000	0.26484	0.028000	0.11728	2.598000	0.46223	0.497000	0.27926	-0.360000	0.07572	GGC	.	.	.	none		0.692	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1		
MRGPRX3	117195	hgsc.bcm.edu	37	11	18159638	18159638	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr11:18159638G>A	ENST00000396275.2	+	3	1250	c.889G>A	c.(889-891)Gac>Aac	p.D297N		NM_054031.3	NP_473372.3	Q96LB0	MRGX3_HUMAN	MAS-related GPR, member X3	297						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27						GGCTCTGCAGGACACGCCTGA	0.557																																					p.D297N		Atlas-SNP	.											.	MRGPRX3	59	.	0			c.G889A						PASS	.						45.0	48.0	47.0					11																	18159638		2200	4292	6492	SO:0001583	missense	117195	exon3			CTGCAGGACACGC		CCDS7830.1	11p15.1	2013-10-10			ENSG00000179826	ENSG00000179826		"""GPCR / Class A : Orphans"""	17980	protein-coding gene	gene with protein product		607229				11551509	Standard	NM_054031		Approved	MRGX3	uc001mnu.3	Q96LB0	OTTHUMG00000166435	ENST00000396275.2:c.889G>A	chr11.hg19:g.18159638G>A	ENSP00000379571:p.Asp297Asn	132.0	0.0	.		168.0	10.0	.	NM_054031	B0M0L1|Q8TDE0|Q8TDE1	Missense_Mutation	SNP	ENST00000396275.2	hg19	CCDS7830.1	.	.	.	.	.	.	.	.	.	.	G	17.59	3.428032	0.62844	.	.	ENSG00000179826	ENST00000396275	T	0.25912	1.77	1.3	1.3	0.21679	.	0.429218	0.22048	N	0.065351	T	0.47469	0.1447	M	0.84433	2.695	0.24902	N	0.9921	D	0.89917	1.0	D	0.76575	0.988	T	0.18461	-1.0336	10	0.87932	D	0	.	5.9358	0.19165	0.0:0.0:1.0:0.0	.	297	Q96LB0	MRGX3_HUMAN	N	297	ENSP00000379571:D297N	ENSP00000379571:D297N	D	+	1	0	MRGPRX3	18116214	0.485000	0.25972	0.781000	0.31783	0.068000	0.16541	1.158000	0.31737	1.011000	0.39340	0.195000	0.17529	GAC	.	.	.	none		0.557	MRGPRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389767.1	NM_054031	
SNX15	29907	hgsc.bcm.edu	37	11	64802325	64802325	+	Missense_Mutation	SNP	T	T	G			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr11:64802325T>G	ENST00000377244.3	+	4	393	c.263T>G	c.(262-264)tTt>tGt	p.F88C	RP11-399J13.3_ENST00000301886.3_3'UTR|SNX15_ENST00000352068.5_Missense_Mutation_p.F88C	NM_013306.4|NM_147777.3	NP_037438.2|NP_680086.2	Q9NRS6	SNX15_HUMAN	sorting nexin 15	88	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				intracellular protein transport (GO:0006886)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	14						GTAGGCCGGTTTGAAGCCTCA	0.622																																					p.F88C	Esophageal Squamous(56;269 1304 3324 8253)	Atlas-SNP	.											.	SNX15	35	.	0			c.T263G						PASS	.						55.0	54.0	54.0					11																	64802325		2201	4297	6498	SO:0001583	missense	29907	exon4			GCCGGTTTGAAGC	AF175267	CCDS8089.1, CCDS8090.1	11q12	2008-05-22			ENSG00000110025	ENSG00000110025		"""Sorting nexins"""	14978	protein-coding gene	gene with protein product		605964				11208079	Standard	NM_013306		Approved			Q9NRS6	OTTHUMG00000037387	ENST00000377244.3:c.263T>G	chr11.hg19:g.64802325T>G	ENSP00000366452:p.Phe88Cys	123.0	0.0	.		237.0	27.0	.	NM_147777	E5KQS6|Q9NRS5	Missense_Mutation	SNP	ENST00000377244.3	hg19	CCDS8089.1	.	.	.	.	.	.	.	.	.	.	T	9.953	1.220623	0.22457	.	.	ENSG00000110025	ENST00000377244;ENST00000534637;ENST00000524831;ENST00000352068	T;T;T;T	0.38722	1.12;1.12;1.12;1.12	5.24	5.24	0.73138	Phox homologous domain (5);	0.000000	0.85682	D	0.000000	T	0.72922	0.3521	M	0.94142	3.5	0.80722	D	1	B;B;D	0.89917	0.002;0.032;1.0	B;B;D	0.91635	0.004;0.031;0.999	T	0.81028	-0.1118	10	0.87932	D	0	-11.7965	13.084	0.59129	0.0:0.0:0.0:1.0	.	88;88;88	E5KQS5;E5KQS6;Q9NRS6	.;.;SNX15_HUMAN	C	88;84;76;88	ENSP00000366452:F88C;ENSP00000437277:F84C;ENSP00000431690:F76C;ENSP00000316410:F88C	ENSP00000316410:F88C	F	+	2	0	SNX15	64558901	1.000000	0.71417	0.793000	0.32043	0.045000	0.14185	7.364000	0.79526	1.991000	0.58162	0.374000	0.22700	TTT	.	.	.	none		0.622	SNX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091004.3		
BIRC3	330	hgsc.bcm.edu	37	11	102206814	102206814	+	Missense_Mutation	SNP	T	T	G			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr11:102206814T>G	ENST00000263464.3	+	7	4192	c.1442T>G	c.(1441-1443)gTt>gGt	p.V481G	BIRC3_ENST00000532808.1_Missense_Mutation_p.V481G	NM_001165.4	NP_001156.1	Q13489	BIRC3_HUMAN	baculoviral IAP repeat containing 3	481	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				apoptotic process (GO:0006915)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of necroptotic process (GO:0060546)|negative regulation of phosphorylation (GO:0042326)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein ubiquitination (GO:0031398)|protein heterooligomerization (GO:0051291)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cysteine-type endopeptidase activity (GO:2000116)|regulation of inflammatory response (GO:0050727)|regulation of innate immune response (GO:0045088)|regulation of necroptotic process (GO:0060544)|regulation of nucleotide-binding oligomerization domain containing signaling pathway (GO:0070424)|regulation of RIG-I signaling pathway (GO:0039535)|regulation of toll-like receptor signaling pathway (GO:0034121)|spermatogenesis (GO:0007283)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane raft (GO:0045121)|nucleus (GO:0005634)|protein complex (GO:0043234)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(7)|lung(5)|ovary(3)|skin(1)	21	all_cancers(8;0.00044)|all_epithelial(12;0.00348)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0093)	Lung(13;0.109)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0146)		GAACATGATGTTATTAAACAG	0.353			T	MALT1	MALT																																p.V481G		Atlas-SNP	.		Dom	yes		11	11q22-q23	330	baculoviral IAP repeat-containing 3		L	.	BIRC3	56	.	0			c.T1442G						PASS	.						104.0	107.0	106.0					11																	102206814		2203	4298	6501	SO:0001583	missense	330	exon7			ATGATGTTATTAA	L49432	CCDS8315.1	11q22	2011-01-25	2011-01-25			ENSG00000023445		"""Baculoviral IAP repeat containing"", ""RING-type (C3HC4) zinc fingers"""	591	protein-coding gene	gene with protein product	"""apoptosis inhibitor 2"", ""TNFR2-TRAF signaling complex protein"", ""mammalian IAP homolog C"", ""inhibitor of apoptosis protein 1"""	601721	"""baculoviral IAP repeat-containing 3"""	API2		8552191, 8548810	Standard	NM_001165		Approved	cIAP2, hiap-1, MIHC, RNF49, MALT2, c-IAP2	uc001pgx.3	Q13489		ENST00000263464.3:c.1442T>G	chr11.hg19:g.102206814T>G	ENSP00000263464:p.Val481Gly	243.0	0.0	.		63.0	12.0	.	NM_001165	Q16628|Q9HC27|Q9UP46	Missense_Mutation	SNP	ENST00000263464.3	hg19	CCDS8315.1	.	.	.	.	.	.	.	.	.	.	T	9.986	1.229473	0.22542	.	.	ENSG00000023445	ENST00000263464;ENST00000532808;ENST00000532609	T;T	0.19532	2.14;2.14	4.98	1.35	0.21983	DEATH-like (2);Caspase Recruitment (3);	0.559991	0.21816	N	0.068695	T	0.16981	0.0408	L	0.58669	1.825	0.31062	N	0.71399	B	0.10296	0.003	B	0.15484	0.013	T	0.12915	-1.0529	10	0.27785	T	0.31	.	4.8847	0.13697	0.0:0.231:0.1477:0.6212	.	481	Q13489	BIRC3_HUMAN	G	481;481;249	ENSP00000263464:V481G;ENSP00000432907:V481G	ENSP00000263464:V481G	V	+	2	0	BIRC3	101712024	0.052000	0.20516	0.281000	0.24762	0.902000	0.53008	0.187000	0.16998	0.130000	0.18549	-0.316000	0.08728	GTT	.	.	.	none		0.353	BIRC3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394159.1	NM_001165	
OR8G5	219865	hgsc.bcm.edu	37	11	124135727	124135727	+	Silent	SNP	C	C	T			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr11:124135727C>T	ENST00000524943.2	+	1	1005	c.1005C>T	c.(1003-1005)gcC>gcT	p.A335A	OR8G1_ENST00000341493.2_RNA	NM_001005198.1	NP_001005198.1	Q8NG78	OR8G5_HUMAN	olfactory receptor, family 8, subfamily G, member 5	335						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)						Breast(109;0.0157)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0523)		TCCACGTTGCCCTGAAGAAAA	0.403																																					p.A335A	Ovarian(169;523 1969 8640 31295 51256)	Atlas-SNP	.											.	.	.	.	0			c.C1005T						PASS	.						54.0	52.0	53.0					11																	124135727		2018	4203	6221	SO:0001819	synonymous_variant	219865	exon1			CGTTGCCCTGAAG	BK004516	CCDS66256.1	11q24.1	2014-04-17		2004-03-10	ENSG00000255298	ENSG00000255298		"""GPCR / Class A : Olfactory receptors"""	19622	protein-coding gene	gene with protein product				OR8G5P, OR8G6			Standard	NM_001005198		Approved			Q8NG78	OTTHUMG00000186059	ENST00000524943.2:c.1005C>T	chr11.hg19:g.124135727C>T		87.0	0.0	.		46.0	11.0	.	NM_001005198	B2RND3|Q6IEU6	Silent	SNP	ENST00000524943.2	hg19																																																																																				.	.	.	none		0.403	OR8G5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000387283.2	NM_001005198	
PKNOX2	63876	hgsc.bcm.edu	37	11	125280693	125280693	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr11:125280693C>T	ENST00000298282.9	+	9	1008	c.737C>T	c.(736-738)cCg>cTg	p.P246L	PKNOX2_ENST00000530517.1_3'UTR|PKNOX2_ENST00000542175.1_Missense_Mutation_p.P182L	NM_022062.2	NP_071345.2	Q96KN3	PKNX2_HUMAN	PBX/knotted 1 homeobox 2	246					regulation of transcription from RNA polymerase II promoter (GO:0006357)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(14)|ovary(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	29		Breast(109;0.00234)|all_lung(97;0.0191)|Lung NSC(97;0.0196)|Medulloblastoma(222;0.0447)|all_neural(223;0.116)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.117)		TTATACCAACCGGTTACCATG	0.577																																					p.P246L		Atlas-SNP	.											.	PKNOX2	60	.	0			c.C737T						PASS	.						94.0	91.0	92.0					11																	125280693		1947	4142	6089	SO:0001583	missense	63876	exon9			ACCAACCGGTTAC	AK023136	CCDS41730.1	11q24.2	2014-09-04			ENSG00000165495	ENSG00000165495		"""Homeoboxes / TALE class"""	16714	protein-coding gene	gene with protein product		613066				11549286	Standard	NM_022062		Approved		uc001qbu.3	Q96KN3	OTTHUMG00000165884	ENST00000298282.9:c.737C>T	chr11.hg19:g.125280693C>T	ENSP00000298282:p.Pro246Leu	110.0	0.0	.		137.0	27.0	.	NM_022062	B7Z5I5|F5GZ15|Q63HL6|Q86XD1	Missense_Mutation	SNP	ENST00000298282.9	hg19	CCDS41730.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.066060	0.76187	.	.	ENSG00000165495	ENST00000530517;ENST00000531116;ENST00000298282;ENST00000542175;ENST00000535518	D;D;D;D	0.88277	-2.36;-2.36;-2.36;-2.25	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.93324	0.7872	L	0.54323	1.7	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.995	D	0.93357	0.6723	10	0.59425	D	0.04	-12.9127	19.0405	0.92997	0.0:1.0:0.0:0.0	.	182;246	F5GZ15;Q96KN3	.;PKNX2_HUMAN	L	217;217;246;182;234	ENSP00000434732:P217L;ENSP00000433971:P217L;ENSP00000298282:P246L;ENSP00000441470:P182L	ENSP00000298282:P246L	P	+	2	0	PKNOX2	124785903	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.191000	0.77763	2.586000	0.87340	0.655000	0.94253	CCG	.	.	.	none		0.577	PKNOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386866.3		
WNK1	65125	hgsc.bcm.edu	37	12	978188	978188	+	Intron	SNP	T	T	A			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr12:978188T>A	ENST00000315939.6	+	9	2782				WNK1_ENST00000535572.1_Intron|WNK1_ENST00000530271.2_Missense_Mutation_p.F1184Y|WNK1_ENST00000340908.4_Intron|WNK1_ENST00000537687.1_Missense_Mutation_p.F1099Y|WNK1_ENST00000574564.1_Missense_Mutation_p.F398Y	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1						intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			TCCCCACTTTTCTTCTGTTTC	0.493																																					p.F1184Y	Colon(19;451 567 6672 12618 28860)	Atlas-SNP	.											.	WNK1	403	.	0			c.T3551A						PASS	.						323.0	310.0	314.0					12																	978188		1914	4143	6057	SO:0001627	intron_variant	65125	exon10			CACTTTTCTTCTG	AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.2140-2243T>A	chr12.hg19:g.978188T>A		735.0	1.0	.		315.0	51.0	.	NM_213655	A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Missense_Mutation	SNP	ENST00000315939.6	hg19	CCDS8506.1	.	.	.	.	.	.	.	.	.	.	T	14.12	2.440816	0.43326	.	.	ENSG00000060237	ENST00000537687;ENST00000530271	T;T	0.16743	2.32;2.32	5.85	5.85	0.93711	.	.	.	.	.	T	0.23133	0.0559	.	.	.	0.80722	D	1	P	0.46656	0.882	B	0.44278	0.445	T	0.00842	-1.1544	8	0.52906	T	0.07	.	14.8154	0.70031	0.0:0.0:0.0:1.0	.	1184	F5H2M7	.	Y	1099;1184	ENSP00000444465:F1099Y;ENSP00000433548:F1184Y	ENSP00000433548:F1184Y	F	+	2	0	WNK1	848449	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.421000	0.52742	2.233000	0.73108	0.455000	0.32223	TTC	.	.	.	none		0.493	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206683.1	NM_018979	
CD27	939	hgsc.bcm.edu	37	12	6554287	6554287	+	Missense_Mutation	SNP	T	T	A			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr12:6554287T>A	ENST00000266557.3	+	1	255	c.26T>A	c.(25-27)cTg>cAg	p.L9Q	CD27-AS1_ENST00000399492.2_RNA|CD27-AS1_ENST00000545339.1_RNA	NM_001242.4	NP_001233	P26842	CD27_HUMAN	CD27 molecule	9					cell surface receptor signaling pathway (GO:0007166)|extrinsic apoptotic signaling pathway (GO:0097191)|immunoglobulin mediated immune response (GO:0016064)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of T cell apoptotic process (GO:0070233)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of JNK cascade (GO:0046330)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|response to ethanol (GO:0045471)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|transmembrane signaling receptor activity (GO:0004888)			kidney(1)|large_intestine(5)|lung(1)|urinary_tract(3)	10						CCCTGGTGGCTGTGCGTTCTG	0.642																																					p.L9Q		Atlas-SNP	.											.	CD27	17	.	0			c.T26A						PASS	.						18.0	24.0	22.0					12																	6554287		2202	4299	6501	SO:0001583	missense	939	exon1			GGTGGCTGTGCGT	M63928	CCDS8545.1	12p13	2014-09-17	2006-10-27	2006-10-27	ENSG00000139193	ENSG00000139193		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11922	protein-coding gene	gene with protein product		186711	"""tumor necrosis factor receptor superfamily, member 7"""	TNFRSF7		2442250, 8530100	Standard	NM_001242		Approved	S152, Tp55	uc001qod.3	P26842	OTTHUMG00000168316	ENST00000266557.3:c.26T>A	chr12.hg19:g.6554287T>A	ENSP00000266557:p.Leu9Gln	25.0	0.0	.		41.0	6.0	.	NM_001242	B2RDZ0	Missense_Mutation	SNP	ENST00000266557.3	hg19	CCDS8545.1	.	.	.	.	.	.	.	.	.	.	T	17.78	3.473069	0.63737	.	.	ENSG00000139193	ENST00000266557	D	0.95788	-3.81	4.91	4.91	0.64330	.	0.254840	0.25922	N	0.027424	D	0.95726	0.8610	L	0.36672	1.1	0.41219	D	0.986497	D	0.89917	1.0	D	0.85130	0.997	D	0.95798	0.8830	10	0.72032	D	0.01	-12.3828	10.8657	0.46853	0.0:0.0:0.0:1.0	.	9	P26842	CD27_HUMAN	Q	9	ENSP00000266557:L9Q	ENSP00000266557:L9Q	L	+	2	0	CD27	6424548	1.000000	0.71417	1.000000	0.80357	0.604000	0.37047	3.432000	0.52824	2.064000	0.61679	0.455000	0.32223	CTG	.	.	.	none		0.642	CD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399258.1		
SOX5	6660	hgsc.bcm.edu	37	12	24102509	24102509	+	Missense_Mutation	SNP	C	C	G			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr12:24102509C>G	ENST00000451604.2	-	1	128	c.27G>C	c.(25-27)caG>caC	p.Q9H	SOX5_ENST00000541847.1_Intron|SOX5_ENST00000545921.1_Intron|SOX5_ENST00000309359.1_5'UTR|SOX5_ENST00000381381.2_5'UTR|SOX5_ENST00000441133.2_Missense_Mutation_p.Q9H|SOX5_ENST00000536850.1_5'UTR|SOX5_ENST00000537393.1_Missense_Mutation_p.Q9H			P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5	9					cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system neuron differentiation (GO:0021953)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte differentiation (GO:0048709)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear transcription factor complex (GO:0044798)	sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(25)|ovary(5)|skin(2)|upper_aerodigestive_tract(3)	57						TTTCAAACTCCTGAGGTAAAT	0.433																																					p.Q9H		Atlas-SNP	.											.	SOX5	134	.	0			c.G27C						PASS	.						112.0	102.0	106.0					12																	24102509		2203	4300	6503	SO:0001583	missense	6660	exon1			AAACTCCTGAGGT	AB081589	CCDS8699.1, CCDS41761.1, CCDS44844.1, CCDS58216.1, CCDS58217.1	12p12.1	2010-04-20			ENSG00000134532	ENSG00000134532		"""SRY (sex determining region Y)-boxes"""	11201	protein-coding gene	gene with protein product		604975				8812465	Standard	NM_006940		Approved	L-SOX5, MGC35153	uc001rfw.3	P35711	OTTHUMG00000169026	ENST00000451604.2:c.27G>C	chr12.hg19:g.24102509C>G	ENSP00000398273:p.Gln9His	140.0	0.0	.		98.0	17.0	.	NM_006940	B7Z8V0|F5H5B0|Q86UK8|Q8J017|Q8J018|Q8J019|Q8J020|Q8N1D9|Q8N7E0|Q8TEA4	Missense_Mutation	SNP	ENST00000451604.2	hg19	CCDS8699.1	.	.	.	.	.	.	.	.	.	.	c	15.91	2.971147	0.53614	.	.	ENSG00000134532	ENST00000451604;ENST00000537393;ENST00000441133	D;D	0.97378	-4.34;-4.36	5.28	5.28	0.74379	.	0.154071	0.45126	D	0.000386	D	0.96222	0.8768	L	0.54323	1.7	0.80722	D	1	P;P	0.44309	0.832;0.826	P;B	0.44990	0.466;0.276	D	0.96291	0.9214	10	0.52906	T	0.07	.	17.0691	0.86568	0.0:1.0:0.0:0.0	.	9;9	G3V0H1;P35711	.;SOX5_HUMAN	H	9	ENSP00000398273:Q9H;ENSP00000439832:Q9H	ENSP00000393240:Q9H	Q	-	3	2	SOX5	23993776	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.509000	0.73725	2.631000	0.89168	0.645000	0.84053	CAG	.	.	.	none		0.433	SOX5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402006.2	NM_006940	
SRGAP1	57522	hgsc.bcm.edu	37	12	64377805	64377805	+	Missense_Mutation	SNP	T	T	A			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr12:64377805T>A	ENST00000355086.3	+	2	670	c.146T>A	c.(145-147)cTg>cAg	p.L49Q	SRGAP1_ENST00000357825.3_Missense_Mutation_p.L49Q|SRGAP1_ENST00000543397.1_Missense_Mutation_p.L9Q	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	49	F-BAR domain.|FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.				axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		CTCCAGGATCTGCAAGATTTC	0.428																																					p.L49Q		Atlas-SNP	.											.	SRGAP1	146	.	0			c.T146A						PASS	.						110.0	114.0	113.0					12																	64377805		2203	4300	6503	SO:0001583	missense	57522	exon2			AGGATCTGCAAGA	AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.146T>A	chr12.hg19:g.64377805T>A	ENSP00000347198:p.Leu49Gln	207.0	0.0	.		86.0	12.0	.	NM_020762	Q9H8A3|Q9P2P2	Missense_Mutation	SNP	ENST00000355086.3	hg19	CCDS8967.1	.	.	.	.	.	.	.	.	.	.	T	26.0	4.690212	0.88735	.	.	ENSG00000196935	ENST00000355086;ENST00000357825;ENST00000543397	T;T;T	0.56611	0.45;0.45;1.94	5.1	5.1	0.69264	Fps/Fes/Fer/CIP4 homology (3);	0.000000	0.28600	U	0.014776	T	0.74261	0.3693	M	0.83603	2.65	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.87578	0.998;0.987;0.987	T	0.77648	-0.2509	9	.	.	.	.	15.199	0.73120	0.0:0.0:0.0:1.0	.	49;9;49	Q7Z6B7;G5EA48;Q7Z6B7-2	SRGP1_HUMAN;.;.	Q	49;49;9	ENSP00000347198:L49Q;ENSP00000350480:L49Q;ENSP00000437948:L9Q	.	L	+	2	0	SRGAP1	62664072	1.000000	0.71417	0.997000	0.53966	0.933000	0.57130	7.975000	0.88055	2.060000	0.61445	0.477000	0.44152	CTG	.	.	.	none		0.428	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400896.1		
METTL17	64745	hgsc.bcm.edu	37	14	21464719	21464719	+	Missense_Mutation	SNP	G	G	T			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr14:21464719G>T	ENST00000339374.6	+	13	1347	c.1114G>T	c.(1114-1116)Gtg>Ttg	p.V372L	RP11-84C10.4_ENST00000557335.1_RNA|METTL17_ENST00000556670.2_Missense_Mutation_p.V372L|SLC39A2_ENST00000298681.4_5'Flank|METTL17_ENST00000382985.4_Missense_Mutation_p.V372L|SLC39A2_ENST00000554422.1_5'Flank	NM_001029991.1|NM_022734.2	NP_001025162.1|NP_073571.1	Q9H7H0	MET17_HUMAN	methyltransferase like 17	372					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	copper ion binding (GO:0005507)|methyltransferase activity (GO:0008168)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|skin(2)	20						GTTCTCTATGGTGATCCTTGC	0.463																																					p.V372L		Atlas-SNP	.											.	METTL17	46	.	0			c.G1114T						PASS	.						53.0	50.0	51.0					14																	21464719		2203	4300	6503	SO:0001583	missense	64745	exon13			TCTATGGTGATCC	AK024512	CCDS9562.1, CCDS41913.1	14q11.2	2011-03-03	2011-03-02	2011-03-02	ENSG00000165792	ENSG00000165792			19280	protein-coding gene	gene with protein product			"""methyltransferase 11 domain containing 1"""	METT11D1		11278769	Standard	XM_006720235		Approved	FLJ20859	uc001vyn.3	Q9H7H0	OTTHUMG00000029610	ENST00000339374.6:c.1114G>T	chr14.hg19:g.21464719G>T	ENSP00000343041:p.Val372Leu	171.0	0.0	.		164.0	25.0	.	NM_022734	Q9BSH1|Q9BZH2|Q9BZH3	Missense_Mutation	SNP	ENST00000339374.6	hg19	CCDS9562.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.25|13.25	2.180366|2.180366	0.38511|0.38511	.|.	.|.	ENSG00000165792|ENSG00000165792	ENST00000556733|ENST00000339374;ENST00000382985	.|T;T	.|0.35789	.|1.33;1.29	5.12|5.12	5.12|5.12	0.69794|0.69794	.|.	.|0.222302	.|0.37577	.|N	.|0.002038	T|T	0.20941|0.20941	0.0504|0.0504	N|N	0.17838|0.17838	0.53|0.53	0.34359|0.34359	D|D	0.690735|0.690735	.|B;B;B	.|0.12630	.|0.006;0.003;0.002	.|B;B;B	.|0.10450	.|0.005;0.005;0.003	T|T	0.24154|0.24154	-1.0168|-1.0168	5|10	.|0.12766	.|T	.|0.61	.|.	9.6516|9.6516	0.39902|0.39902	0.0949:0.0:0.9051:0.0|0.0949:0.0:0.9051:0.0	.|.	.|372;372;372	.|Q9H7H0-3;Q9H7H0;Q9H7H0-2	.|.;MET17_HUMAN;.	V|L	47|372	.|ENSP00000343041:V372L;ENSP00000372445:V372L	.|ENSP00000343041:V372L	G|V	+|+	2|1	0|0	METTL17|METTL17	20534559|20534559	0.995000|0.995000	0.38212|0.38212	0.998000|0.998000	0.56505|0.56505	0.906000|0.906000	0.53458|0.53458	1.316000|1.316000	0.33620|0.33620	2.392000|2.392000	0.81423|0.81423	0.655000|0.655000	0.94253|0.94253	GGT|GTG	.	.	.	none		0.463	METTL17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073804.4	NM_022734	
NID2	22795	hgsc.bcm.edu	37	14	52485956	52485956	+	Missense_Mutation	SNP	A	A	C			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr14:52485956A>C	ENST00000216286.5	-	14	2850	c.2851T>G	c.(2851-2853)Tat>Gat	p.Y951D	NID2_ENST00000541773.1_Missense_Mutation_p.Y850D	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)	951	Thyroglobulin type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00500}.				basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)			NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					GGGTAGGCATACTGGGCCTGG	0.577																																					p.Y951D		Atlas-SNP	.											.	NID2	201	.	0			c.T2851G						PASS	.						52.0	46.0	48.0					14																	52485956		2203	4300	6503	SO:0001583	missense	22795	exon14			AGGCATACTGGGC	AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.2851T>G	chr14.hg19:g.52485956A>C	ENSP00000216286:p.Tyr951Asp	74.0	0.0	.		103.0	27.0	.	NM_007361	A8K6I7|B4DU19|O43710	Missense_Mutation	SNP	ENST00000216286.5	hg19	CCDS9706.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.654|9.654	1.142329|1.142329	0.21205|0.21205	.|.	.|.	ENSG00000087303|ENSG00000087303	ENST00000556572|ENST00000216286;ENST00000316204;ENST00000541773;ENST00000395707	.|T;T	.|0.61742	.|0.08;0.08	5.32|5.32	0.0082|0.0082	0.14073|0.14073	.|Thyroglobulin type-1 (4);	.|1.030560	.|0.07634	.|N	.|0.929216	T|T	0.40473|0.40473	0.1118|0.1118	N|N	0.24115|0.24115	0.695|0.695	0.09310|0.09310	N|N	1|1	.|B;B;B;B	.|0.27997	.|0.0;0.021;0.197;0.117	.|B;B;B;B	.|0.29862	.|0.002;0.023;0.108;0.009	T|T	0.30387|0.30387	-0.9980|-0.9980	5|10	.|0.33940	.|T	.|0.23	.|.	5.3979|5.3979	0.16278|0.16278	0.0652:0.2279:0.4723:0.2346|0.0652:0.2279:0.4723:0.2346	.|.	.|545;850;953;951	.|E7EPP3;Q14112-2;Q5CZI2;Q14112	.|.;.;.;NID2_HUMAN	G|D	219|951;545;850;953	.|ENSP00000216286:Y951D;ENSP00000443730:Y850D	.|ENSP00000216286:Y951D	V|Y	-|-	2|1	0|0	NID2|NID2	51555706|51555706	0.419000|0.419000	0.25449|0.25449	0.019000|0.019000	0.16419|0.16419	0.026000|0.026000	0.11368|0.11368	1.277000|1.277000	0.33167|0.33167	-0.092000|-0.092000	0.12417|0.12417	-0.242000|-0.242000	0.12053|0.12053	GTA|TAT	.	.	.	none		0.577	NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276888.1		
KNSTRN	90417	hgsc.bcm.edu	37	15	40685795	40685795	+	Missense_Mutation	SNP	G	G	T			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr15:40685795G>T	ENST00000249776.8	+	9	1063	c.948G>T	c.(946-948)atG>atT	p.M316I	KNSTRN_ENST00000416151.2_3'UTR|KNSTRN_ENST00000448395.2_3'UTR|KNSTRN_ENST00000608100.1_Missense_Mutation_p.M238I	NM_033286.3	NP_150628.3			kinetochore-localized astrin/SPAG5 binding protein																		TATTAGAAATGTAAGAAGaag	0.423																																					p.M316I		Atlas-SNP	.											.	.	.	.	0			c.G948T						PASS	.						83.0	76.0	78.0					15																	40685795		1885	4111	5996	SO:0001583	missense	90417	exon9			AGAAATGTAAGAA	AK027408	CCDS42021.1, CCDS45226.1, CCDS45227.1	15q15.1	2013-01-17	2012-12-04	2012-12-04	ENSG00000128944	ENSG00000128944			30767	protein-coding gene	gene with protein product	"""small kinetochore-associated protein"", ""kinetochore-localized astrin-binding protein"", ""TRAF4 associated factor 1"""	614718	"""chromosome 15 open reading frame 23"""	C15orf23		12477932	Standard	NM_033286		Approved	FLJ14502, SKAP, kinastrin, TRAF4AF1	uc001zll.3	Q9Y448	OTTHUMG00000172454	ENST00000249776.8:c.948G>T	chr15.hg19:g.40685795G>T	ENSP00000249776:p.Met316Ile	97.0	0.0	.		90.0	18.0	.	NM_033286		Missense_Mutation	SNP	ENST00000249776.8	hg19	CCDS42021.1	.	.	.	.	.	.	.	.	.	.	G	12.89	2.074155	0.36566	.	.	ENSG00000128944	ENST00000249776	T	0.27720	1.65	5.02	3.02	0.34903	.	0.171826	0.41938	D	0.000798	T	0.16128	0.0388	N	0.14661	0.345	0.80722	D	1	B	0.11235	0.004	B	0.11329	0.006	T	0.06267	-1.0836	10	0.62326	D	0.03	-5.1946	5.8118	0.18469	0.0965:0.0:0.7133:0.1903	.	316	Q9Y448	T4AF1_HUMAN	I	316	ENSP00000249776:M316I	ENSP00000249776:M316I	M	+	3	0	C15orf23	38473087	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	1.826000	0.39092	1.491000	0.48482	0.650000	0.86243	ATG	.	.	.	none		0.423	KNSTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418636.1	NM_001142761	
RAB27A	5873	hgsc.bcm.edu	37	15	55516128	55516128	+	Silent	SNP	T	T	A			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr15:55516128T>A	ENST00000396307.2	-	5	677	c.426A>T	c.(424-426)gtA>gtT	p.V142V	RAB27A_ENST00000569493.1_Silent_p.V142V|RAB27A_ENST00000336787.1_Silent_p.V142V|RAB27A_ENST00000564609.1_Silent_p.V142V	NM_004580.4	NP_004571.2	P51159	RB27A_HUMAN	RAB27A, member RAS oncogene family	142					antigen processing and presentation (GO:0019882)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cytotoxic T cell degranulation (GO:0043316)|exocytosis (GO:0006887)|exosomal secretion (GO:1990182)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|multivesicular body organization (GO:0036257)|multivesicular body sorting pathway (GO:0071985)|natural killer cell degranulation (GO:0043320)|positive regulation of exocytosis (GO:0045921)|positive regulation of gene expression (GO:0010628)|protein targeting (GO:0006605)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle transport (GO:0048489)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|exocytic vesicle (GO:0070382)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|lysosome (GO:0005764)|melanosome (GO:0042470)|multivesicular body membrane (GO:0032585)|photoreceptor outer segment (GO:0001750)|secretory granule membrane (GO:0030667)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(2)|liver(1)|lung(3)|ovary(1)|skin(1)	9				all cancers(107;0.0273)|GBM - Glioblastoma multiforme(80;0.0993)		CCTCTTTCACTACTCTCTGGT	0.398																																					p.V142V		Atlas-SNP	.											.	RAB27A	18	.	0			c.A426T						PASS	.						167.0	168.0	167.0					15																	55516128		2193	4292	6485	SO:0001819	synonymous_variant	5873	exon6			TTTCACTACTCTC	U38654	CCDS10153.1	15q15-q21.1	2014-09-17			ENSG00000069974	ENSG00000069974		"""RAB, member RAS oncogene"""	9766	protein-coding gene	gene with protein product		603868				7592656	Standard	NM_183235		Approved	RAB27, RAM, GS2, HsT18676	uc002acq.3	P51159	OTTHUMG00000131959	ENST00000396307.2:c.426A>T	chr15.hg19:g.55516128T>A		447.0	0.0	.		91.0	12.0	.	NM_183235	O00195|Q6FI40|Q9UIR9|Q9Y5U3	Silent	SNP	ENST00000396307.2	hg19	CCDS10153.1																																																																																			.	.	.	none		0.398	RAB27A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254918.1	NM_004580, NM_183236	
TMC7	79905	hgsc.bcm.edu	37	16	19073098	19073098	+	Splice_Site	SNP	A	A	T			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr16:19073098A>T	ENST00000304381.5	+	16	2236		c.e16-1		RP11-626G11.5_ENST00000568971.1_RNA|RP11-626G11.5_ENST00000571934.1_RNA|TMC7_ENST00000421369.3_Splice_Site|RP11-626G11.5_ENST00000567047.1_RNA|RP11-626G11.5_ENST00000576433.1_RNA	NM_024847.3	NP_079123.3	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7						ion transport (GO:0006811)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	28						ATTATTTTTTAGGAAAGTCGT	0.403																																					.		Atlas-SNP	.											.	TMC7	75	.	0			c.2107-2A>T						PASS	.						87.0	80.0	82.0					16																	19073098		2197	4300	6497	SO:0001630	splice_region_variant	79905	exon16			TTTTTTAGGAAAG	AY263165	CCDS10573.1, CCDS53992.1, CCDS73837.1	16p13.11	2008-02-05			ENSG00000170537	ENSG00000170537			23000	protein-coding gene	gene with protein product						12812529, 12906855	Standard	XM_005255597		Approved	FLJ21240	uc002dfq.3	Q7Z402	OTTHUMG00000131456	ENST00000304381.5:c.2107-1A>T	chr16.hg19:g.19073098A>T		83.0	0.0	.		90.0	13.0	.	NM_024847	E7ERB6|Q5H9Q8|Q7Z5M4|Q86WX0|Q9H766	Splice_Site	SNP	ENST00000304381.5	hg19	CCDS10573.1	.	.	.	.	.	.	.	.	.	.	A	14.61	2.586609	0.46110	.	.	ENSG00000170537	ENST00000304381;ENST00000421369	.	.	.	5.03	5.03	0.67393	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.2868	0.60247	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TMC7	18980599	1.000000	0.71417	0.916000	0.36221	0.545000	0.35147	6.318000	0.72866	2.012000	0.59069	0.533000	0.62120	.	.	.	.	none		0.403	TMC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254276.3	NM_024847	Intron
DNAH3	55567	hgsc.bcm.edu	37	16	21080893	21080893	+	Missense_Mutation	SNP	C	C	T	rs577456196		TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr16:21080893C>T	ENST00000261383.3	-	23	3223	c.3224G>A	c.(3223-3225)cGc>cAc	p.R1075H	DNAH3_ENST00000415178.1_Missense_Mutation_p.R1075H	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1075	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.R1075P(2)		NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		GTCTTGTATGCGAATTAGCTT	0.453													C|||	1	0.000199681	0.0	0.0	5008	,	,		19175	0.001		0.0	False		,,,				2504	0.0				p.R1075H		Atlas-SNP	.											DNAH3_ENST00000261383,NS,carcinoma,-1,2	DNAH3	1142	.	2	Substitution - Missense(2)	lung(2)	c.G3224A						PASS	.						173.0	130.0	144.0					16																	21080893		2201	4300	6501	SO:0001583	missense	55567	exon23			TGTATGCGAATTA	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.3224G>A	chr16.hg19:g.21080893C>T	ENSP00000261383:p.Arg1075His	176.0	0.0	.		96.0	14.0	.	NM_017539	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	hg19	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	C	10.65	1.410395	0.25465	.	.	ENSG00000158486	ENST00000261383;ENST00000415178	T;T	0.61859	0.07;0.07	5.4	4.22	0.49857	Dynein heavy chain, domain-2 (1);	0.726956	0.12981	N	0.423277	T	0.44519	0.1297	L	0.28192	0.835	0.09310	N	1	D	0.65815	0.995	P	0.49332	0.607	T	0.36625	-0.9740	10	0.26408	T	0.33	.	2.0715	0.03614	0.3159:0.4174:0.1475:0.1193	.	1075	Q8TD57	DYH3_HUMAN	H	1075	ENSP00000261383:R1075H;ENSP00000394245:R1075H	ENSP00000261383:R1075H	R	-	2	0	DNAH3	20988394	0.001000	0.12720	0.952000	0.39060	0.634000	0.38068	0.318000	0.19504	2.696000	0.92011	0.655000	0.94253	CGC	.	.	.	none		0.453	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539	
TMEM107	84314	hgsc.bcm.edu	37	17	8079579	8079579	+	Missense_Mutation	SNP	G	G	T			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr17:8079579G>T	ENST00000437139.2	-	1	113	c.26C>A	c.(25-27)cCc>cAc	p.P9H	TMEM107_ENST00000449985.2_Missense_Mutation_p.P9H|RP11-599B13.7_ENST00000581248.1_lincRNA|TMEM107_ENST00000431792.2_Missense_Mutation_p.P9H|TMEM107_ENST00000532998.1_Missense_Mutation_p.P9H|SNORD118_ENST00000363593.1_RNA|TMEM107_ENST00000316425.5_Missense_Mutation_p.P9H|TMEM107_ENST00000533070.1_Missense_Mutation_p.P9H	NM_183065.2	NP_898888.1	Q6UX40	TM107_HUMAN	transmembrane protein 107	9					cilium assembly (GO:0042384)|embryonic digit morphogenesis (GO:0042733)|neural tube patterning (GO:0021532)	integral component of membrane (GO:0016021)				large_intestine(1)|lung(4)|ovary(1)	6						GAAGCGAGAGGGCACAAGCCC	0.632																																					p.P9H		Atlas-SNP	.											.	TMEM107	16	.	0			c.C26A						PASS	.						58.0	48.0	51.0					17																	8079579		2203	4300	6503	SO:0001583	missense	84314	exon1			CGAGAGGGCACAA	AF311338	CCDS11132.1, CCDS45607.1	17p13.1	2005-12-19				ENSG00000179029			28128	protein-coding gene	gene with protein product						12477932	Standard	NM_032354		Approved	MGC10744	uc002gkh.4	Q6UX40		ENST00000437139.2:c.26C>A	chr17.hg19:g.8079579G>T	ENSP00000402732:p.Pro9His	84.0	0.0	.		159.0	21.0	.	NM_183065	A0PJV7|Q6NSE3|Q6ZRX9|Q96T82	Missense_Mutation	SNP	ENST00000437139.2	hg19	CCDS45607.1	.	.	.	.	.	.	.	.	.	.	G	17.61	3.431906	0.62844	.	.	ENSG00000179029	ENST00000449985;ENST00000532998;ENST00000437139;ENST00000533070;ENST00000316425;ENST00000431792;ENST00000415860	.	.	.	5.6	4.63	0.57726	.	0.000000	0.85682	D	0.000000	T	0.77465	0.4134	M	0.79475	2.455	0.49915	D	0.999835	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.982	T	0.79948	-0.1588	9	0.87932	D	0	-37.9001	10.8172	0.46583	0.0877:0.0:0.9123:0.0	.	9;9;9;9	B3KNL7;Q6UX40-3;Q6UX40-4;Q6UX40	.;.;.;TM107_HUMAN	H	9	.	ENSP00000314116:P9H	P	-	2	0	TMEM107	8020304	1.000000	0.71417	1.000000	0.80357	0.028000	0.11728	8.301000	0.89951	1.511000	0.48818	-0.158000	0.13435	CCC	.	.	.	none		0.632	TMEM107-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388844.1	NM_032354	
TMEM106A	113277	hgsc.bcm.edu	37	17	41365849	41365849	+	Silent	SNP	C	C	T			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr17:41365849C>T	ENST00000331615.3	+	4	451	c.214C>T	c.(214-216)Ctg>Ttg	p.L72L	TMEM106A_ENST00000541594.1_Silent_p.L24L|TMEM106A_ENST00000588659.1_Silent_p.L72L|TMEM106A_ENST00000592564.1_3'UTR|TMEM106A_ENST00000536052.1_Silent_p.L72L	NM_145041.1	NP_659478.1	Q96A25	T106A_HUMAN	transmembrane protein 106A	72						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|large_intestine(1)|lung(6)|prostate(1)	11		Breast(137;0.0164)		BRCA - Breast invasive adenocarcinoma(366;0.0917)		CTCTCTAGAGCTGGAGAAGCA	0.552																																					p.L72L		Atlas-SNP	.											.	TMEM106A	20	.	0			c.C214T						PASS	.						97.0	74.0	82.0					17																	41365849		2203	4296	6499	SO:0001819	synonymous_variant	113277	exon4			CTAGAGCTGGAGA	AK056132	CCDS11462.1, CCDS74073.1	17q21.31	2012-01-23			ENSG00000184988	ENSG00000184988			28288	protein-coding gene	gene with protein product							Standard	XM_006721658		Approved	MGC20235	uc002idn.1	Q96A25		ENST00000331615.3:c.214C>T	chr17.hg19:g.41365849C>T		108.0	0.0	.		165.0	17.0	.	NM_145041	A8K2X2|B7Z698	Silent	SNP	ENST00000331615.3	hg19	CCDS11462.1																																																																																			.	.	.	none		0.552	TMEM106A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453470.2	NM_145041	
ME2	4200	hgsc.bcm.edu	37	18	48442562	48442562	+	Missense_Mutation	SNP	C	C	G			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr18:48442562C>G	ENST00000321341.5	+	5	689	c.417C>G	c.(415-417)gaC>gaG	p.D139E	ME2_ENST00000382927.3_Missense_Mutation_p.D139E	NM_002396.4	NP_002387.1	P23368	MAOM_HUMAN	malic enzyme 2, NAD(+)-dependent, mitochondrial	139					malate metabolic process (GO:0006108)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|oxaloacetate decarboxylase activity (GO:0008948)			breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(11)|upper_aerodigestive_tract(3)	23		Colorectal(6;0.0273)|all_epithelial(6;0.118)		Colorectal(21;0.0313)|READ - Rectum adenocarcinoma(32;0.105)|STAD - Stomach adenocarcinoma(97;0.184)		CGATCTCAGACAGAGGTCATG	0.333																																					p.D139E		Atlas-SNP	.											.	ME2	49	.	0			c.C417G						PASS	.						186.0	177.0	180.0					18																	48442562		2203	4300	6503	SO:0001583	missense	4200	exon5			CTCAGACAGAGGT	M55905	CCDS11948.1, CCDS54187.1	18q21	2012-10-02			ENSG00000082212	ENSG00000082212	1.1.1.40		6984	protein-coding gene	gene with protein product		154270				1993674	Standard	NM_002396		Approved		uc002ley.3	P23368	OTTHUMG00000132694	ENST00000321341.5:c.417C>G	chr18.hg19:g.48442562C>G	ENSP00000321070:p.Asp139Glu	234.0	0.0	.		38.0	4.0	.	NM_001168335	B2R8J2|Q9BWL6|Q9BYG1|Q9H4B2	Missense_Mutation	SNP	ENST00000321341.5	hg19	CCDS11948.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.129308	0.77549	.	.	ENSG00000082212	ENST00000321341;ENST00000382927	T;T	0.45668	0.89;0.89	5.8	5.8	0.92144	Malic enzyme, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.63698	0.2533	M	0.77712	2.385	0.58432	D	0.999994	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.61950	-0.6957	10	0.36615	T	0.2	-22.0057	12.879	0.58006	0.0:0.9218:0.0:0.0782	.	139;139	Q9BWL6;P23368	.;MAOM_HUMAN	E	139	ENSP00000321070:D139E;ENSP00000372384:D139E	ENSP00000321070:D139E	D	+	3	2	ME2	46696560	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.392000	0.52537	2.741000	0.93983	0.650000	0.86243	GAC	.	.	.	none		0.333	ME2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255991.1	NM_002396	
ACSBG2	81616	hgsc.bcm.edu	37	19	6177251	6177251	+	Missense_Mutation	SNP	T	T	G			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr19:6177251T>G	ENST00000586696.1	+	8	1026	c.750T>G	c.(748-750)atT>atG	p.I250M	ACSBG2_ENST00000588304.1_Missense_Mutation_p.I200M|ACSBG2_ENST00000591403.1_Missense_Mutation_p.I250M|ACSBG2_ENST00000252669.5_Missense_Mutation_p.I250M|ACSBG2_ENST00000588485.1_Missense_Mutation_p.I63M|ACSBG2_ENST00000591741.1_3'UTR			Q5FVE4	ACBG2_HUMAN	acyl-CoA synthetase bubblegum family member 2	250					cell differentiation (GO:0030154)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid metabolic process (GO:0001676)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acyl-CoA hydrolase activity (GO:0047617)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)	p.I250M(3)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(3)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TCACGTGGATTGCAGGAGCAG	0.433																																					p.I250M		Atlas-SNP	.											ACSBG2,NS,carcinoma,0,4	ACSBG2	83	.	3	Substitution - Missense(3)	endometrium(2)|kidney(1)	c.T750G						PASS	.						97.0	69.0	78.0					19																	6177251		2203	4300	6503	SO:0001583	missense	81616	exon8			GTGGATTGCAGGA		CCDS12159.1, CCDS74269.1	19p13.3	2012-10-02			ENSG00000130377	ENSG00000130377		"""Acyl-CoA synthetase family"""	24174	protein-coding gene	gene with protein product	"""bubblegum related protein"""	614363				11230166	Standard	XM_005259653		Approved	BGR, PRTD-NY3, DKFZp434K1635	uc002meh.1	Q5FVE4	OTTHUMG00000180754	ENST00000586696.1:c.750T>G	chr19.hg19:g.6177251T>G	ENSP00000465589:p.Ile250Met	82.0	0.0	.		36.0	6.0	.	NM_030924	B3KSF2|Q6UWJ3|Q7Z5A0|Q8WW03|Q96M36|Q9BYZ3|Q9H0C4	Missense_Mutation	SNP	ENST00000586696.1	hg19	CCDS12159.1	.	.	.	.	.	.	.	.	.	.	T	8.593	0.885063	0.17540	.	.	ENSG00000130377	ENST00000252669	T	0.10477	2.87	4.48	-8.78	0.00824	AMP-dependent synthetase/ligase (1);	1.500690	0.04439	N	0.370611	T	0.03564	0.0102	N	0.03154	-0.405	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.16722	0.016;0.007	T	0.41124	-0.9526	10	0.49607	T	0.09	-6.8573	2.6506	0.04998	0.499:0.0951:0.1226:0.2833	.	250;250	B4DYU1;Q5FVE4	.;ACBG2_HUMAN	M	250	ENSP00000252669:I250M	ENSP00000252669:I250M	I	+	3	3	ACSBG2	6128251	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-3.884000	0.00342	-1.157000	0.02815	-0.778000	0.03378	ATT	.	.	.	none		0.433	ACSBG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452898.1	NM_030924	
APLP1	333	hgsc.bcm.edu	37	19	36362560	36362560	+	Nonsense_Mutation	SNP	T	T	A			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr19:36362560T>A	ENST00000221891.4	+	5	776	c.584T>A	c.(583-585)tTa>tAa	p.L195*	APLP1_ENST00000537454.2_Nonsense_Mutation_p.L156*|APLP1_ENST00000586861.1_Nonsense_Mutation_p.L189*|NPHS1_ENST00000591817.1_5'Flank	NM_001024807.1|NM_005166.3	NP_001019978.1|NP_005157.1	P51693	APLP1_HUMAN	amyloid beta (A4) precursor-like protein 1	195					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular response to norepinephrine stimulus (GO:0071874)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|mRNA polyadenylation (GO:0006378)|negative regulation of cAMP biosynthetic process (GO:0030818)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|regulation of translation (GO:0006417)	basement membrane (GO:0005604)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|alpha-2B adrenergic receptor binding (GO:0031695)|alpha-2C adrenergic receptor binding (GO:0031696)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|transition metal ion binding (GO:0046914)			breast(4)|endometrium(2)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	33	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GGCATGCTCTTACCCTGTGGC	0.642																																					p.L195X		Atlas-SNP	.											.	APLP1	77	.	0			c.T584A						PASS	.						111.0	105.0	107.0					19																	36362560		2203	4300	6503	SO:0001587	stop_gained	333	exon5			TGCTCTTACCCTG	U48437	CCDS32997.1	19q	2008-07-15							597	protein-coding gene	gene with protein product	"""amyloid-like protein 1"", ""amyloid precursor-like protein 1"""	104775				8432545	Standard	NM_001024807		Approved	APLP	uc002ocf.3	P51693		ENST00000221891.4:c.584T>A	chr19.hg19:g.36362560T>A	ENSP00000221891:p.Leu195*	155.0	0.0	.		345.0	57.0	.	NM_005166	O00113|Q96A92	Nonsense_Mutation	SNP	ENST00000221891.4	hg19	CCDS32997.1	.	.	.	.	.	.	.	.	.	.	T	36	5.888940	0.97068	.	.	ENSG00000105290	ENST00000537454;ENST00000221891	.	.	.	4.41	4.41	0.53225	.	0.000000	0.33515	N	0.004832	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.3771	11.5688	0.50822	0.0:0.0:0.0:1.0	.	.	.	.	X	156;195	.	ENSP00000221891:L195X	L	+	2	0	APLP1	41054400	1.000000	0.71417	1.000000	0.80357	0.713000	0.41058	7.189000	0.77747	1.630000	0.50440	0.379000	0.24179	TTA	.	.	.	none		0.642	APLP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452564.1	NM_001024807	
ZNF585B	92285	hgsc.bcm.edu	37	19	37678072	37678072	+	Missense_Mutation	SNP	T	T	A			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr19:37678072T>A	ENST00000532828.2	-	5	618	c.367A>T	c.(367-369)Att>Ttt	p.I123F	CTC-454I21.3_ENST00000585860.2_Intron|ZNF585B_ENST00000312908.5_5'Flank|ZNF585B_ENST00000531805.1_Missense_Mutation_p.I68F|ZNF585B_ENST00000527838.1_Missense_Mutation_p.I123F	NM_152279.3	NP_689492.3	Q52M93	Z585B_HUMAN	zinc finger protein 585B	123					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|endometrium(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CCAGAATAAATTTTTTGATCT	0.373																																					p.I123F	Melanoma(93;882 1454 18863 28917 48427)	Atlas-SNP	.											.	ZNF585B	91	.	0			c.A367T						PASS	.						59.0	64.0	62.0					19																	37678072		2202	4299	6501	SO:0001583	missense	92285	exon5			AATAAATTTTTTG	AK027834	CCDS12500.1	19q13.13	2013-01-08				ENSG00000245680		"""Zinc fingers, C2H2-type"", ""-"""	30948	protein-coding gene	gene with protein product						12477932	Standard	NM_152279		Approved	FLJ14928, SZFP41	uc002ofq.3	Q52M93		ENST00000532828.2:c.367A>T	chr19.hg19:g.37678072T>A	ENSP00000433773:p.Ile123Phe	174.0	0.0	.		88.0	9.0	.	NM_152279	Q8IZD3|Q96JW6	Missense_Mutation	SNP	ENST00000532828.2	hg19	CCDS12500.1	.	.	.	.	.	.	.	.	.	.	T	4.132	0.022795	0.08006	.	.	ENSG00000245680	ENST00000531805;ENST00000532828;ENST00000527838	T;T;T	0.08634	3.07;3.15;6.5	2.32	2.32	0.28847	.	0.230506	0.22120	U	0.064354	T	0.10551	0.0258	M	0.65498	2.005	0.80722	D	1	B	0.22909	0.077	B	0.20184	0.028	T	0.06427	-1.0827	10	0.72032	D	0.01	.	9.2461	0.37527	0.0:0.0:0.0:1.0	.	123	Q52M93	Z585B_HUMAN	F	68;123;123	ENSP00000436774:I68F;ENSP00000433773:I123F;ENSP00000435268:I123F	ENSP00000435268:I123F	I	-	1	0	ZNF585B	42369912	0.614000	0.27017	0.755000	0.31263	0.021000	0.10359	0.914000	0.28624	1.052000	0.40392	0.374000	0.22700	ATT	.	.	.	none		0.373	ZNF585B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388272.2	NM_152279	
CSE1L	1434	hgsc.bcm.edu	37	20	47675025	47675025	+	Missense_Mutation	SNP	C	C	A			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr20:47675025C>A	ENST00000262982.2	+	2	148	c.25C>A	c.(25-27)Caa>Aaa	p.Q9K	CSE1L_ENST00000542325.1_5'UTR|CSE1L_ENST00000396192.3_Missense_Mutation_p.Q9K	NM_001256135.1|NM_001316.3	NP_001243064.1|NP_001307.2	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like (yeast)	9					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	importin-alpha export receptor activity (GO:0008262)			breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	35			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			TGCAAATCTGCAAACACTAAC	0.333																																					p.Q9K		Atlas-SNP	.											.	CSE1L	83	.	0			c.C25A						PASS	.						100.0	109.0	106.0					20																	47675025		2203	4300	6503	SO:0001583	missense	1434	exon2			AATCTGCAAACAC	U33286	CCDS13412.1, CCDS58773.1	20q13	2013-05-01	2001-11-28		ENSG00000124207	ENSG00000124207		"""Exportins"""	2431	protein-coding gene	gene with protein product	"""cellular apoptosis susceptibility"""	601342	"""chromosome segregation 1 (yeast homolog)-like"""			8963895, 7479798	Standard	NM_001316		Approved	CAS, XPO2, CSE1	uc002xty.4	P55060	OTTHUMG00000033046	ENST00000262982.2:c.25C>A	chr20.hg19:g.47675025C>A	ENSP00000262982:p.Gln9Lys	173.0	0.0	.		234.0	24.0	.	NM_001256135	A3RLL6|B2R5T4|E1P5Y0|F8W904|O75432|Q32M40|Q9H5B7|Q9NTS0|Q9UP98|Q9UP99|Q9UPA0	Missense_Mutation	SNP	ENST00000262982.2	hg19	CCDS13412.1	.	.	.	.	.	.	.	.	.	.	C	14.53	2.561981	0.45590	.	.	ENSG00000124207	ENST00000262982;ENST00000396192	T;T	0.68624	-0.34;-0.34	5.3	4.36	0.52297	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.58004	0.2092	L	0.59436	1.845	0.80722	D	1	B;P	0.36990	0.24;0.577	B;B	0.33042	0.157;0.13	T	0.55431	-0.8142	10	0.10902	T	0.67	-1.2095	14.1142	0.65142	0.0:0.927:0.0:0.073	.	9;9	F8W904;P55060	.;XPO2_HUMAN	K	9	ENSP00000262982:Q9K;ENSP00000379495:Q9K	ENSP00000262982:Q9K	Q	+	1	0	CSE1L	47108432	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	7.272000	0.78516	1.222000	0.43521	0.591000	0.81541	CAA	.	.	.	none		0.333	CSE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080345.2	NM_001316	
ZNF512B	57473	hgsc.bcm.edu	37	20	62598870	62598870	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr20:62598870G>A	ENST00000450537.1	-	3	188	c.128C>T	c.(127-129)cCg>cTg	p.P43L	ZNF512B_ENST00000217130.3_Missense_Mutation_p.P43L|ZNF512B_ENST00000369888.1_Missense_Mutation_p.P43L			Q96KM6	Z512B_HUMAN	zinc finger protein 512B	43					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					ACGGACCACCGGCATCCCTGC	0.637																																					p.P43L		Atlas-SNP	.											.	ZNF512B	72	.	0			c.C128T						PASS	.						79.0	84.0	82.0					20																	62598870		2203	4300	6503	SO:0001583	missense	57473	exon3			ACCACCGGCATCC	AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.128C>T	chr20.hg19:g.62598870G>A	ENSP00000393795:p.Pro43Leu	198.0	0.0	.		417.0	69.0	.	NM_020713	Q08AK9|Q9ULM4	Missense_Mutation	SNP	ENST00000450537.1	hg19	CCDS13548.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.158963	0.78226	.	.	ENSG00000196700	ENST00000369888;ENST00000450537;ENST00000217130	T;T;T	0.25414	1.8;1.8;1.8	3.86	3.86	0.44501	.	0.253119	0.27917	N	0.017321	T	0.35508	0.0934	N	0.24115	0.695	0.46586	D	0.999114	D	0.89917	1.0	D	0.81914	0.995	T	0.23583	-1.0184	10	0.87932	D	0	-13.686	13.7319	0.62792	0.0:0.0:1.0:0.0	.	43	Q96KM6	Z512B_HUMAN	L	43	ENSP00000358904:P43L;ENSP00000393795:P43L;ENSP00000217130:P43L	ENSP00000217130:P43L	P	-	2	0	ZNF512B	62069314	0.845000	0.29573	0.989000	0.46669	0.848000	0.48234	1.891000	0.39738	2.444000	0.82710	0.462000	0.41574	CCG	.	.	.	none		0.637	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080246.1	NM_020713	
COL4A6	1288	hgsc.bcm.edu	37	X	107433650	107433650	+	Missense_Mutation	SNP	T	T	G			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chrX:107433650T>G	ENST00000372216.4	-	20	1501	c.1401A>C	c.(1399-1401)aaA>aaC	p.K467N	COL4A6_ENST00000545689.1_Missense_Mutation_p.K466N|COL4A6_ENST00000394872.2_Missense_Mutation_p.K467N|COL4A6_ENST00000334504.7_Missense_Mutation_p.K466N|COL4A6_ENST00000538570.1_Missense_Mutation_p.K466N	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	467	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						CTAGGTTTCCTTTTGGACCTT	0.443									Alport syndrome with Diffuse Leiomyomatosis																												p.K467N	Melanoma(87;1895 1945 2589 7165)	Atlas-SNP	.											.	COL4A6	270	.	0			c.A1401C						PASS	.						130.0	118.0	122.0					X																	107433650		2203	4300	6503	SO:0001583	missense	1288	exon20	Familial Cancer Database		GTTTCCTTTTGGA	U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.1401A>C	chrX.hg19:g.107433650T>G	ENSP00000361290:p.Lys467Asn	179.0	0.0	.		99.0	38.0	.	NM_001847	Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Missense_Mutation	SNP	ENST00000372216.4	hg19	CCDS14541.1	.	.	.	.	.	.	.	.	.	.	T	12.36	1.915515	0.33815	.	.	ENSG00000197565	ENST00000372216;ENST00000334504;ENST00000394872;ENST00000541389;ENST00000545689;ENST00000538570	D;D;D;D;D	0.94232	-3.38;-3.38;-3.38;-3.25;-3.38	5.3	2.74	0.32292	.	0.000000	0.45361	D	0.000370	D	0.92506	0.7620	L	0.52206	1.635	0.33503	D	0.590155	D;D;D;D	0.61697	0.982;0.982;0.983;0.99	P;P;P;P	0.59487	0.764;0.764;0.725;0.858	D	0.91531	0.5242	10	0.59425	D	0.04	.	2.7178	0.05192	0.1932:0.2036:0.0:0.6032	.	466;466;467;466	F5H851;F5H3Q5;Q14031;Q14031-2	.;.;CO4A6_HUMAN;.	N	467;466;467;466;466;466	ENSP00000361290:K467N;ENSP00000334733:K466N;ENSP00000378340:K467N;ENSP00000443707:K466N;ENSP00000445236:K466N	ENSP00000334733:K466N	K	-	3	2	COL4A6	107320306	0.993000	0.37304	0.998000	0.56505	0.987000	0.75469	0.944000	0.29043	0.886000	0.36113	0.486000	0.48141	AAA	.	.	.	none		0.443	COL4A6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057875.2		
LAMB2	3913	hgsc.bcm.edu	37	3	49167097	49167098	+	Frame_Shift_Del	DEL	GG	GG	-			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	GG	GG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr3:49167097_49167098delGG	ENST00000418109.1	-	12	1621_1622	c.1457_1458delCC	c.(1456-1458)cccfs	p.P486fs	LAMB2_ENST00000305544.4_Frame_Shift_Del_p.P486fs	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	486	Laminin EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00460}.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		ATCCACTGTTGGGGTCACAAGG	0.559																																					p.486_487del		Atlas-INDEL	.											.	LAMB2	156	.	0			c.1458_1459del						PASS	.																																			SO:0001589	frameshift_variant	3913	exon11			.		CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.1457_1458delCC	chr3.hg19:g.49167099_49167100delGG	ENSP00000388325:p.Pro486fs	92.0	0.0	0		127.0	12.0	0.0944882	NM_002292	Q16321	Frame_Shift_Del	DEL	ENST00000418109.1	hg19	CCDS2789.1																																																																																			.	.	.	none		0.559	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345939.1	NM_002292	
CCAR2	57805	hgsc.bcm.edu	37	8	22474942	22474942	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr8:22474942delG	ENST00000308511.4	+	15	2104	c.1855delG	c.(1855-1857)gggfs	p.G619fs	CCAR2_ENST00000389279.3_Frame_Shift_Del_p.G619fs|CCAR2_ENST00000520861.1_Frame_Shift_Del_p.G294fs|RP11-582J16.5_ENST00000521025.1_RNA			Q8N163	CCAR2_HUMAN	cell cycle and apoptosis regulator 2	619					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mRNA processing (GO:0006397)|negative regulation of catalytic activity (GO:0043086)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage checkpoint (GO:2000003)|regulation of circadian rhythm (GO:0042752)|regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of protein stability (GO:0031647)|response to UV (GO:0009411)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|DBIRD complex (GO:0044609)|mitochondrial matrix (GO:0005759)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)										GAAGGAGGATGGGCTTTTGCC	0.502																																					p.D618fs		Atlas-INDEL	.											.	KIAA1967	72	.	0			c.1854delT						PASS	.						101.0	113.0	109.0					8																	22474942		2203	4300	6503	SO:0001589	frameshift_variant	57805	exon15			.	AL834351	CCDS34863.1	8p22	2013-08-22	2013-08-22	2013-08-22		ENSG00000158941			23360	protein-coding gene	gene with protein product	"""deleted in breast cancer"""	607359	"""KIAA1967"""	KIAA1967		12370419	Standard	NM_021174		Approved	DBC-1, DBC1, NET35	uc003xci.3	Q8N163		ENST00000308511.4:c.1855delG	chr8.hg19:g.22474942delG	ENSP00000310670:p.Gly619fs	332.0	0.0	0		678.0	97.0	0.143068	NM_021174	A6NL03|B2RB79|D3DSR6|Q6P0Q9|Q8N3G7|Q8N8M1|Q8TF34|Q9H9Q9|Q9HD12|Q9NT55	Frame_Shift_Del	DEL	ENST00000308511.4	hg19	CCDS34863.1																																																																																			.	.	.	none		0.502	CCAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375865.1	NM_021174	
BAP1	8314	hgsc.bcm.edu	37	3	52437889	52437889	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr3:52437889delC	ENST00000460680.1	-	13	1743	c.1272delG	c.(1270-1272)gggfs	p.G424fs	BAP1_ENST00000296288.5_Frame_Shift_Del_p.G406fs	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.K425fs*4(1)		NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		CCCCTGGCTTCCCTGTTCCCT	0.557			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.K425fs	GBM(101;493 1458 7992 21037 25532)	Atlas-INDEL	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	.	BAP1	371	.	1	Deletion - Frameshift(1)	kidney(1)	c.1273delA						PASS	.						85.0	89.0	88.0					3																	52437889		2203	4300	6503	SO:0001589	frameshift_variant	8314	exon13			.	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.1272delG	chr3.hg19:g.52437889delC	ENSP00000417132:p.Gly424fs	158.0	0.0	0		333.0	62.0	0.186186	NM_004656	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Frame_Shift_Del	DEL	ENST00000460680.1	hg19	CCDS2853.1																																																																																			.	.	.	none		0.557	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		
VHL	7428	hgsc.bcm.edu	37	3	10188203	10188204	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr3:10188203_10188204insT	ENST00000256474.2	+	2	1186_1187	c.346_347insT	c.(346-348)cttfs	p.L116fs	VHL_ENST00000477538.1_3'UTR|VHL_ENST00000345392.2_Intron	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	116	Involved in binding to CCT complex.		L -> V (in VHLD). {ECO:0000269|PubMed:8730290}.		cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.?(3)|p.L116fs*43(3)|p.W117fs*14(2)|p.L116V(1)|p.H115fs*15(1)|p.L116fs*16(1)|p.W117fs*42(1)|p.H115fs*41(1)|p.H115fs*42(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GATAGGTCACCTTTGGCTCTTC	0.53		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																												p.L116fs		Atlas-INDEL	.	yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	VHL,colon,carcinoma,-1,3	VHL	2192	.	14	Deletion - Frameshift(9)|Unknown(3)|Substitution - Missense(1)|Insertion - Frameshift(1)	kidney(14)	c.346_347insT	GRCh37	CM961424	VHL	M		PASS	.																																			SO:0001589	frameshift_variant	7428	exon2	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	.	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.349dupT	chr3.hg19:g.10188206_10188206dupT	ENSP00000256474:p.Leu116fs	308.0	0.0	0		443.0	81.0	0.182844	NM_000551	B2RE45|Q13599|Q6PDA9	Frame_Shift_Ins	INS	ENST00000256474.2	hg19	CCDS2597.1																																																																																			.	.	.	none		0.530	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1	NM_000551	
SLC25A42	284439	hgsc.bcm.edu	37	19	19221630	19221630	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr19:19221630delT	ENST00000318596.7	+	8	1053	c.902delT	c.(901-903)atcfs	p.I301fs		NM_178526.4	NP_848621.2	Q86VD7	S2542_HUMAN	solute carrier family 25, member 42	301					ADP transport (GO:0015866)|AMP transport (GO:0080121)|ATP transport (GO:0015867)|coenzyme A transmembrane transport (GO:0035349)|metabolic process (GO:0008152)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	adenosine-diphosphatase activity (GO:0043262)|ADP transmembrane transporter activity (GO:0015217)|AMP transmembrane transporter activity (GO:0080122)|ATP transmembrane transporter activity (GO:0005347)|coenzyme A transmembrane transporter activity (GO:0015228)			cervix(1)|large_intestine(2)|lung(3)	6			OV - Ovarian serous cystadenocarcinoma(5;5.4e-06)|Epithelial(12;0.000497)			GCCGTGGGCATCAGCTTCACC	0.657																																					p.I301fs		Atlas-INDEL	.											.	SLC25A42	18	.	0			c.901delA						PASS	.						68.0	52.0	57.0					19																	19221630		2203	4300	6503	SO:0001589	frameshift_variant	284439	exon8			.		CCDS32966.1	19p13.11	2013-05-22			ENSG00000181035	ENSG00000181035		"""Solute carriers"""	28380	protein-coding gene	gene with protein product		610823				16949250, 19429682	Standard	NM_178526		Approved	MGC26694	uc002nlf.3	Q86VD7		ENST00000318596.7:c.902delT	chr19.hg19:g.19221630delT	ENSP00000326693:p.Ile301fs	106.0	0.0	0		198.0	24.0	0.121212	NM_178526	D2T2J5|O14553|O43378	Frame_Shift_Del	DEL	ENST00000318596.7	hg19	CCDS32966.1																																																																																			.	.	.	none		0.657	SLC25A42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465931.1	NM_178526	
PHB	5245	hgsc.bcm.edu	37	17	47486482	47486483	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	CT	CT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr17:47486482_47486483delCT	ENST00000300408.3	-	5	503_504	c.431_432delAG	c.(430-432)gagfs	p.E144fs	PHB_ENST00000511832.1_Intron|RP11-81K2.1_ENST00000576461.1_Intron|PHB_ENST00000508009.1_5'UTR	NM_001281496.1|NM_001281715.1|NM_002634.2	NP_001268425.1|NP_001268644.1|NP_002625.1	P35232	PHB_HUMAN	prohibitin	144					cellular response to interleukin-6 (GO:0071354)|DNA replication (GO:0006260)|histone deacetylation (GO:0016575)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast differentiation (GO:0001649)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone receptor signaling pathway (GO:0050847)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|transcription regulatory region DNA binding (GO:0044212)			endometrium(4)|large_intestine(2)|lung(4)	10	all_cancers(4;2.62e-14)|Breast(4;4.21e-29)|all_epithelial(4;6.9e-18)		Epithelial(5;8.1e-06)|all cancers(6;7.71e-05)			TGGAGACCAGCTCTCTCTGGGT	0.554																																					p.144_145del		Atlas-INDEL	.											.	PHB	25	.	0			c.432_433del						PASS	.																																			SO:0001589	frameshift_variant	5245	exon5			.		CCDS11548.1, CCDS62244.1	17q21	2010-11-25			ENSG00000167085	ENSG00000167085			8912	protein-coding gene	gene with protein product		176705				10376528, 8244394	Standard	NM_001281496		Approved	PHB1	uc002iox.1	P35232	OTTHUMG00000134271	ENST00000300408.3:c.431_432delAG	chr17.hg19:g.47486488_47486489delCT	ENSP00000300408:p.Glu144fs	77.0	0.0	0		137.0	17.0	0.124088	NM_002634	B4DY47|Q4VBQ0	Frame_Shift_Del	DEL	ENST00000300408.3	hg19	CCDS11548.1																																																																																			.	.	.	none		0.554	PHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258826.1	NM_002634	
