#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MEGF6	1953	hgsc.bcm.edu	37	1	3425692	3425692	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chr1:3425692G>A	ENST00000356575.4	-	12	1701	c.1475C>T	c.(1474-1476)gCc>gTc	p.A492V	MEGF6_ENST00000294599.4_Missense_Mutation_p.A387V	NM_001409.3	NP_001400.3	O75095	MEGF6_HUMAN	multiple EGF-like-domains 6	492						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			cervix(2)|endometrium(3)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		TTCCTCATCGGCCCCGACGTC	0.682																																					p.A492V	Ovarian(73;978 3658)	Atlas-SNP	.											.	MEGF6	91	.	0			c.C1475T						PASS	.						16.0	20.0	18.0					1																	3425692		1999	4145	6144	SO:0001583	missense	1953	exon12			TCATCGGCCCCGA	AB011539	CCDS41237.1	1p36.3	2008-02-05	2006-03-31	2006-03-31	ENSG00000162591	ENSG00000162591			3232	protein-coding gene	gene with protein product		604266	"""EGF-like-domain, multiple 3"""	EGFL3		9693030	Standard	NM_001409		Approved		uc001akl.3	O75095	OTTHUMG00000000611	ENST00000356575.4:c.1475C>T	chr1.hg19:g.3425692G>A	ENSP00000348982:p.Ala492Val	65.0	0.0	.		56.0	13.0	.	NM_001409	Q4AC86|Q5VV39	Missense_Mutation	SNP	ENST00000356575.4	hg19	CCDS41237.1	.	.	.	.	.	.	.	.	.	.	G	0.860	-0.735532	0.03111	.	.	ENSG00000162591	ENST00000294599;ENST00000356575	D;D	0.86627	-2.15;-1.89	3.74	2.76	0.32466	.	0.812464	0.10434	N	0.675134	T	0.81297	0.4793	L	0.47716	1.5	0.09310	N	1	B;B	0.16396	0.007;0.017	B;B	0.12156	0.007;0.006	T	0.67444	-0.5669	10	0.30854	T	0.27	-0.505	7.6695	0.28451	0.0:0.1513:0.6354:0.2133	.	492;387	O75095;O75095-2	MEGF6_HUMAN;.	V	387;492	ENSP00000294599:A387V;ENSP00000348982:A492V	ENSP00000294599:A387V	A	-	2	0	MEGF6	3415552	0.011000	0.17503	0.017000	0.16124	0.027000	0.11550	1.272000	0.33109	1.906000	0.55180	0.462000	0.41574	GCC	.	.	.	none		0.682	MEGF6-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354866.1	NM_001409	
MYCN	4613	hgsc.bcm.edu	37	2	16085781	16085781	+	Silent	SNP	C	C	T			TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chr2:16085781C>T	ENST00000281043.3	+	3	1254	c.957C>T	c.(955-957)atC>atT	p.I319I		NM_005378.4	NP_005369.2	P04198	MYCN_HUMAN	v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog	319					branching morphogenesis of an epithelial tube (GO:0048754)|cartilage condensation (GO:0001502)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|lung development (GO:0030324)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|positive regulation of cell death (GO:0010942)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromatin (GO:0000785)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	31	all_cancers(1;1.35e-08)|all_neural(1;2.92e-24)|Lung SC(1;3.26e-07)|Medulloblastoma(1;6.9e-06)|all_lung(1;1.26e-05)|Glioma(3;0.135)|Acute lymphoblastic leukemia(172;0.155)|all_epithelial(1;0.169)|all_hematologic(175;0.197)		GBM - Glioblastoma multiforme(3;0.000332)			GCGAGCTGATCCTCAAACGAT	0.592			A		neuroblastoma																																p.I319I		Atlas-SNP	.		Dom	yes		2	2p24.1	4613	"""v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)"""		O	.	MYCN	63	.	0			c.C957T						PASS	.						87.0	72.0	77.0					2																	16085781		2203	4300	6503	SO:0001819	synonymous_variant	4613	exon3			GCTGATCCTCAAA	BC002712	CCDS1687.1	2p24.3	2013-08-14	2013-07-09		ENSG00000134323	ENSG00000134323		"""Basic helix-loop-helix proteins"""	7559	protein-coding gene	gene with protein product		164840		NMYC			Standard	XM_006711886		Approved	bHLHe37, N-myc, MYCNOT	uc002rci.3	P04198	OTTHUMG00000039579	ENST00000281043.3:c.957C>T	chr2.hg19:g.16085781C>T		336.0	0.0	.		463.0	105.0	.	NM_005378	Q53XS5|Q6LDT9	Silent	SNP	ENST00000281043.3	hg19	CCDS1687.1																																																																																			.	.	.	none		0.592	MYCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095469.2	NM_005378	
EIF2AK3	9451	hgsc.bcm.edu	37	2	88913362	88913362	+	Silent	SNP	T	T	C			TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chr2:88913362T>C	ENST00000303236.3	-	2	619	c.318A>G	c.(316-318)gtA>gtG	p.V106V	EIF2AK3_ENST00000419748.1_5'UTR	NM_004836.5	NP_004827.4	Q9NZJ5	E2AK3_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 3	106					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|bone mineralization (GO:0030282)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|chondrocyte development (GO:0002063)|endocrine pancreas development (GO:0031018)|endoplasmic reticulum organization (GO:0007029)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|fat cell differentiation (GO:0045444)|insulin secretion (GO:0030073)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|lactation (GO:0007595)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|negative regulation of myelination (GO:0031642)|negative regulation of translation (GO:0017148)|negative regulation of translational initiation in response to stress (GO:0032057)|ossification (GO:0001503)|positive regulation of protein binding (GO:0032092)|positive regulation of signal transduction (GO:0009967)|protein autophosphorylation (GO:0046777)|protein homooligomerization (GO:0051260)|protein phosphorylation (GO:0006468)|regulation of fatty acid metabolic process (GO:0019217)|response to endoplasmic reticulum stress (GO:0034976)|skeletal system development (GO:0001501)|SREBP signaling pathway (GO:0032933)|translation (GO:0006412)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activity (GO:0004674)			ovary(3)	3						TGCTGATAATTACTAATGACC	0.373																																					p.V106V	GBM(138;671 1851 16235 39058 45249)	Atlas-SNP	.											.	EIF2AK3	160	.	0			c.A318G						PASS	.						73.0	67.0	69.0					2																	88913362		2203	4300	6503	SO:0001819	synonymous_variant	9451	exon2			GATAATTACTAAT	AF110146	CCDS33241.1	2p12	2008-05-21			ENSG00000172071	ENSG00000172071			3255	protein-coding gene	gene with protein product		604032				10026192, 10575235	Standard	NM_004836		Approved	PEK, PERK	uc002stc.4	Q9NZJ5	OTTHUMG00000155046	ENST00000303236.3:c.318A>G	chr2.hg19:g.88913362T>C		33.0	0.0	.		29.0	13.0	.	NM_004836	A0AVH1|A0AVH2|B2RCU9|O95846|Q53QY0|Q53SB1	Silent	SNP	ENST00000303236.3	hg19	CCDS33241.1																																																																																			.	.	.	none		0.373	EIF2AK3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000338233.2	NM_004836	
RANBP2	5903	hgsc.bcm.edu	37	2	109399079	109399079	+	Missense_Mutation	SNP	T	T	G			TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chr2:109399079T>G	ENST00000283195.6	+	28	9256	c.9130T>G	c.(9130-9132)Tta>Gta	p.L3044V		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	3044	RanBD1 4. {ECO:0000255|PROSITE- ProRule:PRU00164}.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						TCAGCAGAATTTAATGAAACT	0.393																																					p.L3044V		Atlas-SNP	.											.	RANBP2	488	.	0			c.T9130G						PASS	.						89.0	90.0	90.0					2																	109399079		2203	4300	6503	SO:0001583	missense	5903	exon28			CAGAATTTAATGA	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.9130T>G	chr2.hg19:g.109399079T>G	ENSP00000283195:p.Leu3044Val	93.0	0.0	.		86.0	20.0	.	NM_006267	Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	ENST00000283195.6	hg19	CCDS2079.1	.	.	.	.	.	.	.	.	.	.	T	11.15	1.552949	0.27739	.	.	ENSG00000153201	ENST00000409491;ENST00000283195	T	0.48522	0.81	5.57	3.14	0.36123	Ran binding protein 1 (1);	.	.	.	.	T	0.32971	0.0847	L	0.31526	0.94	0.22096	N	0.999367	B	0.10296	0.003	B	0.13407	0.009	T	0.24440	-1.0160	9	0.46703	T	0.11	-10.6162	5.3388	0.15973	0.135:0.144:0.0:0.721	.	3044	P49792	RBP2_HUMAN	V	2068;3044	ENSP00000283195:L3044V	ENSP00000283195:L3044V	L	+	1	2	RANBP2	108765511	0.955000	0.32602	1.000000	0.80357	0.922000	0.55478	0.403000	0.20982	0.385000	0.24970	0.456000	0.33151	TTA	.	.	.	none		0.393	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
ZC3H6	376940	hgsc.bcm.edu	37	2	113079400	113079400	+	Silent	SNP	C	C	G			TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chr2:113079400C>G	ENST00000409871.1	+	8	1445	c.1044C>G	c.(1042-1044)tcC>tcG	p.S348S	ZC3H6_ENST00000343936.4_Silent_p.S348S	NM_198581.2	NP_940983.2	P61129	ZC3H6_HUMAN	zinc finger CCCH-type containing 6	348							metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(4)|prostate(2)	35						GTAAATTTTCCCATGATGATC	0.308																																					p.S348S		Atlas-SNP	.											.	ZC3H6	93	.	0			c.C1044G						PASS	.						46.0	41.0	43.0					2																	113079400		1800	4066	5866	SO:0001819	synonymous_variant	376940	exon8			ATTTTCCCATGAT	AK123404	CCDS46393.1	2q13	2012-07-05	2005-06-02	2005-06-02	ENSG00000188177	ENSG00000188177		"""Zinc fingers, CCCH-type domain containing"""	24762	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 6"""	ZC3HDC6			Standard	NM_198581		Approved	FLJ41410, FLJ45877, KIAA2035	uc002thq.1	P61129	OTTHUMG00000153286	ENST00000409871.1:c.1044C>G	chr2.hg19:g.113079400C>G		136.0	0.0	.		162.0	49.0	.	NM_198581	A9JR71|Q6ZW96	Silent	SNP	ENST00000409871.1	hg19	CCDS46393.1																																																																																			.	.	.	none		0.308	ZC3H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330551.1	NM_198581	
CRYGD	1421	hgsc.bcm.edu	37	2	208988981	208988981	+	Missense_Mutation	SNP	G	G	A	rs200234608		TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chr2:208988981G>A	ENST00000264376.4	-	2	134	c.107C>T	c.(106-108)gCg>gTg	p.A36V		NM_006891.3	NP_008822.2	P07320	CRGD_HUMAN	crystallin, gamma D	36	Beta/gamma crystallin 'Greek key' 1. {ECO:0000255|PROSITE-ProRule:PRU00028}.				cellular response to reactive oxygen species (GO:0034614)|lens development in camera-type eye (GO:0002088)|lens fiber cell differentiation (GO:0070306)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	structural constituent of eye lens (GO:0005212)			breast(1)|endometrium(1)|lung(3)	5				LUSC - Lung squamous cell carcinoma(261;0.0703)|Epithelial(149;0.0858)|Lung(261;0.133)		GTCCACGCGCGCCGAGTTGCA	0.652																																					p.A36V		Atlas-SNP	.											CRYGD,NS,neuroblastoma,0,1	CRYGD	18	.	0			c.C107T						PASS	.						11.0	13.0	12.0					2																	208988981		2179	4274	6453	SO:0001583	missense	1421	exon2			ACGCGCGCCGAGT		CCDS2378.1	2q33.3	2013-02-14			ENSG00000118231	ENSG00000118231			2411	protein-coding gene	gene with protein product		123690		CRYG4			Standard	NM_006891		Approved		uc002vcn.4	P07320	OTTHUMG00000132944	ENST00000264376.4:c.107C>T	chr2.hg19:g.208988981G>A	ENSP00000264376:p.Ala36Val	72.0	0.0	.		55.0	6.0	.	NM_006891	Q17RF7|Q53R51|Q99681	Missense_Mutation	SNP	ENST00000264376.4	hg19	CCDS2378.1	.	.	.	.	.	.	.	.	.	.	G	11.40	1.627591	0.28978	.	.	ENSG00000118231	ENST00000264376	T	0.72051	-0.62	4.35	3.19	0.36642	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.184420	0.36703	N	0.002444	T	0.29389	0.0732	N	0.00166	-1.94	0.09310	N	0.999995	B	0.02656	0.0	B	0.01281	0.0	T	0.34875	-0.9811	10	0.32370	T	0.25	.	8.1681	0.31239	0.9021:0.0:0.0979:0.0	.	36	P07320	CRGD_HUMAN	V	36	ENSP00000264376:A36V	ENSP00000264376:A36V	A	-	2	0	CRYGD	208697226	0.280000	0.24249	0.067000	0.19924	0.966000	0.64601	2.073000	0.41519	0.695000	0.31675	-0.573000	0.04149	GCG	.	G|0.998;A|0.002	0.002	weak		0.652	CRYGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256476.2	NM_006891	
ZNF502	91392	hgsc.bcm.edu	37	3	44762365	44762365	+	Splice_Site	SNP	G	G	T			TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chr3:44762365G>T	ENST00000296091.4	+	4	312	c.56G>T	c.(55-57)gGc>gTc	p.G19V	ZNF502_ENST00000449836.1_Splice_Site_p.G19V|ZNF502_ENST00000436624.2_Splice_Site_p.G19V	NM_001134440.1|NM_001282880.1|NM_033210.4	NP_001127912.1|NP_001269809.1|NP_149987.2	Q8TBZ5	ZN502_HUMAN	zinc finger protein 502	19					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(4)|large_intestine(8)|lung(4)|prostate(1)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.00855)|KIRC - Kidney renal clear cell carcinoma(197;0.0471)|Kidney(197;0.0589)		TTTCTTTCAGGCTGGGTAAAC	0.443																																					p.G19V		Atlas-SNP	.											.	ZNF502	58	.	0			c.G56T						PASS	.						52.0	56.0	55.0					3																	44762365		2202	4300	6502	SO:0001630	splice_region_variant	91392	exon4			TTTCAGGCTGGGT	AK022577	CCDS2719.1	3p21.32	2013-01-08			ENSG00000196653	ENSG00000196653		"""Zinc fingers, C2H2-type"""	23718	protein-coding gene	gene with protein product							Standard	NM_033210		Approved	FLJ14855, FLJ12515	uc003cnt.3	Q8TBZ5	OTTHUMG00000133086	ENST00000296091.4:c.56-1G>T	chr3.hg19:g.44762365G>T		58.0	0.0	.		62.0	29.0	.	NM_001134440		Missense_Mutation	SNP	ENST00000296091.4	hg19	CCDS2719.1	.	.	.	.	.	.	.	.	.	.	G	10.89	1.479567	0.26511	.	.	ENSG00000196653	ENST00000449836;ENST00000296091;ENST00000436624;ENST00000427783;ENST00000411443	T;T;T;T	0.52983	3.17;3.17;3.17;0.64	4.77	-1.71	0.08133	.	.	.	.	.	T	0.18964	0.0455	N	0.08118	0	0.28556	N	0.9114	B	0.13145	0.007	B	0.11329	0.006	T	0.20840	-1.0263	8	.	.	.	.	0.412	0.00443	0.3647:0.1308:0.2221:0.2825	.	19	Q8TBZ5	ZN502_HUMAN	V	19	ENSP00000397390:G19V;ENSP00000296091:G19V;ENSP00000406469:G19V;ENSP00000401717:G19V	.	G	+	2	0	ZNF502	44737369	0.011000	0.17503	0.016000	0.15963	0.013000	0.08279	-0.325000	0.07976	-0.210000	0.10140	-0.140000	0.14226	GGC	.	.	.	none		0.443	ZNF502-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256744.4	NM_033210	Missense_Mutation
QARS	5859	hgsc.bcm.edu	37	3	49135888	49135888	+	Missense_Mutation	SNP	A	A	T			TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chr3:49135888A>T	ENST00000306125.6	-	21	2319	c.1982T>A	c.(1981-1983)cTg>cAg	p.L661Q	QARS_ENST00000470225.1_5'Flank|QARS_ENST00000414533.1_Missense_Mutation_p.L650Q			P47897	SYQ_HUMAN	glutaminyl-tRNA synthetase	661					brain development (GO:0007420)|gene expression (GO:0010467)|glutaminyl-tRNA aminoacylation (GO:0006425)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|glutamine-tRNA ligase activity (GO:0004819)			breast(1)|endometrium(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	L-Glutamine(DB00130)	GGTCACCTCCAGACTCTCTAC	0.562																																					p.L661Q		Atlas-SNP	.											.	QARS	55	.	0			c.T1982A						PASS	.						54.0	57.0	56.0					3																	49135888		2203	4300	6503	SO:0001583	missense	5859	exon21			ACCTCCAGACTCT	X76013	CCDS2788.1, CCDS63633.1	3p21.31	2011-07-01			ENSG00000172053	ENSG00000172053	6.1.1.18	"""Aminoacyl tRNA synthetases / Class I"""	9751	protein-coding gene	gene with protein product	"""glutamine tRNA ligase"""	603727				8078941, 10393422	Standard	NM_005051		Approved		uc003cvx.4	P47897	OTTHUMG00000156774	ENST00000306125.6:c.1982T>A	chr3.hg19:g.49135888A>T	ENSP00000307567:p.Leu661Gln	84.0	0.0	.		123.0	38.0	.	NM_005051	B4DWJ2	Missense_Mutation	SNP	ENST00000306125.6	hg19	CCDS2788.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.130027	0.77549	.	.	ENSG00000172053	ENST00000453392;ENST00000306125;ENST00000414533	T;T	0.27402	1.67;1.67	5.8	5.8	0.92144	Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding domain (1);Ribosomal protein L25/Gln-tRNA synthetase, beta-barrel domain (1);Glutamyl/glutaminyl-tRNA synthetase, class Ib, anti-codon binding domain (1);	0.068752	0.64402	D	0.000013	T	0.67420	0.2891	H	0.94886	3.595	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.77699	-0.2490	10	0.87932	D	0	-12.8433	15.8218	0.78654	1.0:0.0:0.0:0.0	.	650;661	B4DWJ2;P47897	.;SYQ_HUMAN	Q	181;661;650	ENSP00000307567:L661Q;ENSP00000390015:L650Q	ENSP00000307567:L661Q	L	-	2	0	QARS	49110892	1.000000	0.71417	0.870000	0.34147	0.599000	0.36880	8.794000	0.91867	2.226000	0.72624	0.459000	0.35465	CTG	.	.	.	none		0.562	QARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345689.2	NM_005051	
PCBP4	57060	hgsc.bcm.edu	37	3	51994252	51994252	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chr3:51994252C>T	ENST00000461554.1	-	7	671	c.340G>A	c.(340-342)Ggc>Agc	p.G114S	RP11-155D18.12_ENST00000488257.1_RNA|PCBP4_ENST00000395014.2_Missense_Mutation_p.G80S|PCBP4_ENST00000484633.1_Missense_Mutation_p.G114S|PCBP4_ENST00000471622.1_Missense_Mutation_p.G114S|PCBP4_ENST00000322099.7_Missense_Mutation_p.G114S|PCBP4_ENST00000395013.3_Missense_Mutation_p.G37S|PCBP4_ENST00000355852.2_Missense_Mutation_p.G114S|PCBP4_ENST00000428823.2_Missense_Mutation_p.G114S	NM_001174100.1	NP_001167571.1	P57723	PCBP4_HUMAN	poly(rC) binding protein 4	114	KH 2. {ECO:0000255|PROSITE- ProRule:PRU00117}.					cytoplasm (GO:0005737)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(2)|large_intestine(2)|lung(2)|prostate(1)|stomach(1)	8				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		ATCAGTGAGCCACACTGACTG	0.587																																					p.G114S		Atlas-SNP	.											.	PCBP4	35	.	0			c.G340A						PASS	.						60.0	56.0	57.0					3																	51994252		2203	4300	6503	SO:0001583	missense	57060	exon6			GTGAGCCACACTG	AF176330	CCDS2839.1, CCDS2840.1, CCDS2840.2	3p21	2013-07-16	2001-11-28		ENSG00000090097	ENSG00000090097			8652	protein-coding gene	gene with protein product	"""RNA binding protein MCG10"", ""LYST-interacting protein"", ""alphaCP-4 protein"""	608503	"""poly(rC)-binding protein 4"""			10936052	Standard	NM_033008		Approved	MCG10, LIP4	uc003dch.2	P57723	OTTHUMG00000157366	ENST00000461554.1:c.340G>A	chr3.hg19:g.51994252C>T	ENSP00000417196:p.Gly114Ser	228.0	0.0	.		283.0	55.0	.	NM_033008	Q96AH7	Missense_Mutation	SNP	ENST00000461554.1	hg19	CCDS2839.1	.	.	.	.	.	.	.	.	.	.	C	35	5.589850	0.96590	.	.	ENSG00000090097	ENST00000355852;ENST00000322099;ENST00000461554;ENST00000484633;ENST00000395013;ENST00000428823;ENST00000395014;ENST00000471622;ENST00000294192;ENST00000468324;ENST00000466412	T;T;T;T;T;T;T;T;T;T	0.49432	0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.78	4.96	4.96	0.65561	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.000000	0.85682	D	0.000000	T	0.72977	0.3528	M	0.84773	2.715	0.36967	D	0.89361	D;D;B;P;P;D;D	0.76494	0.966;0.971;0.0;0.954;0.954;0.999;0.998	D;D;B;P;D;D;D	0.87578	0.961;0.929;0.0;0.899;0.924;0.984;0.998	T	0.81929	-0.0708	10	0.87932	D	0	-5.5523	17.8155	0.88632	0.0:1.0:0.0:0.0	.	114;114;37;114;114;80;80	C9J0A4;P57723-2;B3KM64;E7EST1;P57723;Q9GZT1;Q9HCU2	.;.;.;.;PCBP4_HUMAN;.;.	S	114;114;114;114;37;114;80;114;114;114;114	ENSP00000348111:G114S;ENSP00000322341:G114S;ENSP00000417196:G114S;ENSP00000417100:G114S;ENSP00000378460:G37S;ENSP00000395030:G114S;ENSP00000378461:G80S;ENSP00000418925:G114S;ENSP00000419694:G114S;ENSP00000419557:G114S	ENSP00000294192:G114S	G	-	1	0	PCBP4	51969292	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.751000	0.85126	2.281000	0.76405	0.563000	0.77884	GGC	.	.	.	none		0.587	PCBP4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348597.1	NM_020418	
XRN1	54464	hgsc.bcm.edu	37	3	142031582	142031582	+	Missense_Mutation	SNP	G	G	A	rs552700387		TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chr3:142031582G>A	ENST00000264951.4	-	41	4793	c.4676C>T	c.(4675-4677)tCg>tTg	p.S1559L	XRN1_ENST00000392981.2_Missense_Mutation_p.S1547L	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	1559					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						GAGATGAGACGACGAAGGCAT	0.443													G|||	1	0.000199681	0.0	0.0	5008	,	,		14945	0.0		0.0	False		,,,				2504	0.001				p.S1559L		Atlas-SNP	.											.	XRN1	138	.	0			c.C4676T						PASS	.						115.0	120.0	118.0					3																	142031582		2203	4300	6503	SO:0001583	missense	54464	exon41			TGAGACGACGAAG	AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.4676C>T	chr3.hg19:g.142031582G>A	ENSP00000264951:p.Ser1559Leu	111.0	0.0	.		127.0	27.0	.	NM_019001	Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Missense_Mutation	SNP	ENST00000264951.4	hg19	CCDS3123.1	.	.	.	.	.	.	.	.	.	.	G	17.78	3.472860	0.63737	.	.	ENSG00000114127	ENST00000264951;ENST00000392981	T;T	0.34072	1.39;1.38	5.18	5.18	0.71444	.	0.358063	0.27052	N	0.021166	T	0.30386	0.0763	L	0.29908	0.895	0.80722	D	1	B;B	0.31680	0.335;0.226	B;B	0.27170	0.077;0.035	T	0.09751	-1.0660	10	0.51188	T	0.08	-1.1955	19.0575	0.93072	0.0:0.0:1.0:0.0	.	1547;1559	Q8IZH2-2;Q8IZH2	.;XRN1_HUMAN	L	1559;1547	ENSP00000264951:S1559L;ENSP00000376707:S1547L	ENSP00000264951:S1559L	S	-	2	0	XRN1	143514272	0.997000	0.39634	0.956000	0.39512	0.965000	0.64279	6.412000	0.73303	2.554000	0.86153	0.655000	0.94253	TCG	.	.	.	none		0.443	XRN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354087.2	NM_019001	
HS3ST1	9957	hgsc.bcm.edu	37	4	11401255	11401255	+	Silent	SNP	C	C	T			TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chr4:11401255C>T	ENST00000002596.5	-	2	1549	c.375G>A	c.(373-375)acG>acA	p.T125T		NM_005114.2	NP_005105.1	O14792	HS3S1_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 1	125					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)|sulfotransferase activity (GO:0008146)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(6)|skin(3)	15						CTTTGGGCGACGTGAAATACG	0.617																																					p.T125T		Atlas-SNP	.											.	HS3ST1	41	.	0			c.G375A						PASS	.						67.0	66.0	66.0					4																	11401255		2203	4300	6503	SO:0001819	synonymous_variant	9957	exon2			GGGCGACGTGAAA	AF019386	CCDS3408.1	4p16	2008-02-05			ENSG00000002587	ENSG00000002587	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5194	protein-coding gene	gene with protein product		603244				9988767	Standard	NM_005114		Approved	3OST1	uc003gmq.3	O14792	OTTHUMG00000090547	ENST00000002596.5:c.375G>A	chr4.hg19:g.11401255C>T		178.0	0.0	.		162.0	7.0	.	NM_005114	B3KUA6|Q6PEY8	Silent	SNP	ENST00000002596.5	hg19	CCDS3408.1																																																																																			.	.	.	none		0.617	HS3ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207073.3	NM_005114	
CLCN3	1182	hgsc.bcm.edu	37	4	170625204	170625204	+	Missense_Mutation	SNP	T	T	C			TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chr4:170625204T>C	ENST00000513761.1	+	10	2178	c.1619T>C	c.(1618-1620)aTt>aCt	p.I540T	CLCN3_ENST00000504131.2_Missense_Mutation_p.I523T|CLCN3_ENST00000347613.4_Missense_Mutation_p.I540T|CLCN3_ENST00000360642.3_Missense_Mutation_p.I513T	NM_001829.3	NP_001820.2	P51790	CLCN3_HUMAN	chloride channel, voltage-sensitive 3	540					chloride transmembrane transport (GO:1902476)|endosomal lumen acidification (GO:0048388)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|vesicle membrane (GO:0012506)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|voltage-gated chloride channel activity (GO:0005247)			breast(5)|endometrium(3)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	29		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0233)|LUSC - Lung squamous cell carcinoma(193;0.131)		GCAGGAAGGATTGTGGGGATT	0.507																																					p.I540T		Atlas-SNP	.											.	CLCN3	85	.	0			c.T1619C						PASS	.						232.0	194.0	207.0					4																	170625204		2203	4300	6503	SO:0001583	missense	1182	exon10			GAAGGATTGTGGG	X78520	CCDS34100.1, CCDS34101.1, CCDS58932.1, CCDS75208.1	4q	2012-09-26	2012-02-23		ENSG00000109572	ENSG00000109572		"""Ion channels / Chloride channels : Voltage-sensitive"""	2021	protein-coding gene	gene with protein product		600580	"""chloride channel 3"""				Standard	NM_001243374		Approved	CLC3, ClC-3	uc003ish.3	P51790	OTTHUMG00000160973	ENST00000513761.1:c.1619T>C	chr4.hg19:g.170625204T>C	ENSP00000424603:p.Ile540Thr	254.0	0.0	.		208.0	61.0	.	NM_001829	B7Z932|B9EGJ9|D3DP34|E9PB97|O14918|Q86Z21	Missense_Mutation	SNP	ENST00000513761.1	hg19	CCDS34101.1	.	.	.	.	.	.	.	.	.	.	T	17.41	3.381367	0.61845	.	.	ENSG00000109572	ENST00000513761;ENST00000347613;ENST00000360642;ENST00000504131;ENST00000507875	D;D;D;D;D	0.94613	-3.47;-3.47;-3.47;-3.47;-3.47	5.22	4.03	0.46877	Chloride channel, core (2);	0.087869	0.85682	D	0.000000	D	0.93897	0.8047	L	0.49350	1.555	0.80722	D	1	B;P;B;B;B	0.34462	0.318;0.454;0.27;0.318;0.05	P;P;B;P;B	0.45794	0.493;0.493;0.41;0.493;0.135	D	0.92858	0.6303	10	0.72032	D	0.01	-2.771	11.2757	0.49165	0.0:0.0726:0.0:0.9274	.	513;523;513;540;540	B7Z932;B9EGJ9;E9PE15;P51790;P51790-2	.;.;.;CLCN3_HUMAN;.	T	540;540;513;523;513	ENSP00000424603:I540T;ENSP00000261514:I540T;ENSP00000353857:I513T;ENSP00000424540:I523T;ENSP00000425323:I513T	ENSP00000261514:I540T	I	+	2	0	CLCN3	170861779	1.000000	0.71417	0.746000	0.31095	0.658000	0.38924	7.994000	0.88315	0.936000	0.37367	0.449000	0.29647	ATT	.	.	.	none		0.507	CLCN3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363210.2		
GFM2	84340	hgsc.bcm.edu	37	5	74018240	74018240	+	Missense_Mutation	SNP	T	T	G			TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chr5:74018240T>G	ENST00000296805.3	-	20	2632	c.2175A>C	c.(2173-2175)aaA>aaC	p.K725N	RNU6-658P_ENST00000384606.1_RNA|GFM2_ENST00000515125.1_5'UTR|GFM2_ENST00000345239.2_Missense_Mutation_p.K678N|GFM2_ENST00000509430.1_Missense_Mutation_p.K725N	NM_032380.3	NP_115756.2			G elongation factor, mitochondrial 2											breast(2)|endometrium(2)|large_intestine(4)|lung(5)|prostate(1)	14		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Breast(144;0.231)		OV - Ovarian serous cystadenocarcinoma(47;1.86e-56)		CAATAACAACTTTGTTGTCCT	0.388																																					p.K725N		Atlas-SNP	.											.	GFM2	38	.	0			c.A2175C						PASS	.						146.0	144.0	144.0					5																	74018240		2203	4300	6503	SO:0001583	missense	84340	exon20			AACAACTTTGTTG	AF111808	CCDS4023.1, CCDS4024.1, CCDS47232.1	5q13	2008-02-05			ENSG00000164347	ENSG00000164347			29682	protein-coding gene	gene with protein product		606544				11735030	Standard	NM_001281302		Approved	EFG2, FLJ21661	uc003kdh.1	Q969S9	OTTHUMG00000102058	ENST00000296805.3:c.2175A>C	chr5.hg19:g.74018240T>G	ENSP00000296805:p.Lys725Asn	56.0	0.0	.		100.0	6.0	.	NM_032380		Missense_Mutation	SNP	ENST00000296805.3	hg19	CCDS4023.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.391627	0.83011	.	.	ENSG00000164347	ENST00000296805;ENST00000345239;ENST00000546082;ENST00000509430	T;T;T	0.63913	-0.07;-0.07;-0.07	5.96	4.8	0.61643	Elongation factor G/III/V (1);Translation elongation factor EFG/EF2, C-terminal (3);	0.352841	0.38663	N	0.001604	T	0.69646	0.3134	M	0.68952	2.095	0.80722	D	1	B;P;B	0.50369	0.202;0.934;0.123	B;P;B	0.52646	0.185;0.705;0.282	T	0.72503	-0.4273	10	0.87932	D	0	-1.7306	11.9157	0.52763	0.0:0.0678:0.0:0.9322	.	723;678;725	Q969S9-3;Q969S9-2;Q969S9	.;.;RRF2M_HUMAN	N	725;678;547;725	ENSP00000296805:K725N;ENSP00000296804:K678N;ENSP00000427004:K725N	ENSP00000296805:K725N	K	-	3	2	GFM2	74053996	0.999000	0.42202	0.792000	0.32020	0.989000	0.77384	1.529000	0.35996	1.079000	0.41038	0.528000	0.53228	AAA	.	.	.	none		0.388	GFM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219860.2	NM_032380	
HIST1H2AE	3012	hgsc.bcm.edu	37	6	26217562	26217562	+	Silent	SNP	G	G	A			TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chr6:26217562G>A	ENST00000303910.2	+	1	398	c.360G>A	c.(358-360)aaG>aaA	p.K120K	HIST1H2BG_ENST00000244601.3_5'Flank	NM_021052.2	NP_066390.1	P04908	H2A1B_HUMAN	histone cluster 1, H2ae	120						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.K120N(1)		central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(2)	10		all_hematologic(11;0.196)				TGCCTAAGAAGACGGAGAGCC	0.542																																					p.K120K		Atlas-SNP	.											HIST1H2AE,NS,carcinoma,0,1	HIST1H2AE	25	.	1	Substitution - Missense(1)	lung(1)	c.G360A						PASS	.						55.0	56.0	55.0					6																	26217562		2203	4300	6503	SO:0001819	synonymous_variant	3012	exon1			TAAGAAGACGGAG	M60752	CCDS4595.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000168274	ENSG00000277075		"""Histones / Replication-dependent"""	4724	protein-coding gene	gene with protein product		602786	"""H2A histone family, member A"", ""histone 1, H2ae"""	H2AFA		9119399, 1916825, 12408966	Standard	NM_021052		Approved	H2A/a, H2A.1	uc003nha.1	P04908	OTTHUMG00000014440	ENST00000303910.2:c.360G>A	chr6.hg19:g.26217562G>A		145.0	0.0	.		144.0	92.0	.	NM_021052	P28001|Q76P63	Silent	SNP	ENST00000303910.2	hg19	CCDS4595.1																																																																																			.	.	.	none		0.542	HIST1H2AE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040103.1	NM_021052	
PNPLA1	285848	hgsc.bcm.edu	37	6	36238386	36238386	+	Silent	SNP	G	G	A			TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chr6:36238386G>A	ENST00000394571.2	+	1	150	c.150G>A	c.(148-150)gcG>gcA	p.A50A	PNPLA1_ENST00000312917.5_Intron|PNPLA1_ENST00000388715.3_Intron	NM_001145717.1	NP_001139189.2	Q8N8W4	PLPL1_HUMAN	patatin-like phospholipase domain containing 1	50	Patatin.				lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)			breast(1)|kidney(1)|large_intestine(4)|lung(9)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	22						ACCGCTTTGCGGGGACATCGG	0.652																																					p.A50A		Atlas-SNP	.											.	PNPLA1	92	.	0			c.G150A						PASS	.						16.0	21.0	19.0					6																	36238386		692	1591	2283	SO:0001819	synonymous_variant	285848	exon1			CTTTGCGGGGACA		CCDS34438.1, CCDS47416.1, CCDS54997.1	6p21.31	2009-01-12			ENSG00000180316	ENSG00000180316		"""Patatin-like phospholipase domain containing"""	21246	protein-coding gene	gene with protein product		612121				16799181, 19029121	Standard	NM_001145717		Approved	FLJ38755, dJ50J22.1	uc010jwf.2	Q8N8W4	OTTHUMG00000014590	ENST00000394571.2:c.150G>A	chr6.hg19:g.36238386G>A		74.0	0.0	.		101.0	85.0	.	NM_001145717	A3RMU3|J3JS20|Q2A6N1|Q3SY95|Q3SY96|Q5R3L2	Silent	SNP	ENST00000394571.2	hg19	CCDS54997.1																																																																																			.	.	.	none		0.652	PNPLA1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_173676	
TBP	6908	hgsc.bcm.edu	37	6	170871004	170871004	+	Silent	SNP	G	G	A			TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chr6:170871004G>A	ENST00000392092.2	+	3	459	c.180G>A	c.(178-180)caG>caA	p.Q60Q	TBP_ENST00000230354.6_Silent_p.Q60Q|TBP_ENST00000540980.1_Silent_p.Q40Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	60	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		Ggcagcagcagcaacaacaac	0.542																																					p.Q60Q		Atlas-SNP	.											.	TBP	58	.	0			c.G180A						PASS	.						43.0	45.0	44.0					6																	170871004		2203	4300	6503	SO:0001819	synonymous_variant	6908	exon3			GCAGCAGCAACAA	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.180G>A	chr6.hg19:g.170871004G>A		79.0	0.0	.		108.0	13.0	.	NM_003194	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	hg19	CCDS5315.1																																																																																			.	.	.	none		0.542	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
ZNF679	168417	hgsc.bcm.edu	37	7	63720609	63720609	+	Missense_Mutation	SNP	C	C	A			TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chr7:63720609C>A	ENST00000421025.1	+	3	319	c.50C>A	c.(49-51)aCa>aAa	p.T17K	ZNF679_ENST00000255746.4_Missense_Mutation_p.T17K	NM_001159524.1|NM_153363.2	NP_001152996.1|NP_699194.2	Q8IYX0	ZN679_HUMAN	zinc finger protein 679	17	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|lung(11)|skin(1)|stomach(1)	18						GGACTGTTGACATTCAGAGAT	0.388																																					p.T17K		Atlas-SNP	.											.	ZNF679	80	.	0			c.C50A						PASS	.						55.0	48.0	50.0					7																	63720609		692	1591	2283	SO:0001583	missense	168417	exon3			TGTTGACATTCAG	BC033523	CCDS47592.1	7q11.21	2013-01-08			ENSG00000197123	ENSG00000197123		"""Zinc fingers, C2H2-type"", ""-"""	28650	protein-coding gene	gene with protein product	"""hypothetical protein MGC42415"""					12477932	Standard	NM_153363		Approved	MGC42415	uc003tsx.3	Q8IYX0	OTTHUMG00000156486	ENST00000421025.1:c.50C>A	chr7.hg19:g.63720609C>A	ENSP00000416809:p.Thr17Lys	135.0	0.0	.		159.0	9.0	.	NM_153363		Missense_Mutation	SNP	ENST00000421025.1	hg19	CCDS47592.1	.	.	.	.	.	.	.	.	.	.	c	11.22	1.573678	0.28092	.	.	ENSG00000197123	ENST00000421025;ENST00000255746	T;T	0.02974	4.09;4.09	0.195	0.195	0.15151	Krueppel-associated box (4);	.	.	.	.	T	0.09291	0.0229	M	0.82923	2.615	0.23126	N	0.998254	D	0.58268	0.982	P	0.57620	0.824	T	0.16808	-1.0390	9	0.62326	D	0.03	.	3.1108	0.06357	0.4763:0.5235:1.0E-4:1.0E-4	.	17	Q8IYX0	ZN679_HUMAN	K	17	ENSP00000416809:T17K;ENSP00000255746:T17K	ENSP00000255746:T17K	T	+	2	0	ZNF679	63358044	0.064000	0.20934	0.196000	0.23383	0.196000	0.23810	0.148000	0.16224	0.300000	0.22699	0.306000	0.20318	ACA	.	.	.	none		0.388	ZNF679-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344317.2	NM_153363	
NUP205	23165	hgsc.bcm.edu	37	7	135282924	135282924	+	Missense_Mutation	SNP	G	G	A	rs375295025		TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chr7:135282924G>A	ENST00000285968.6	+	15	2269	c.2243G>A	c.(2242-2244)cGt>cAt	p.R748H	NUP205_ENST00000440390.2_3'UTR	NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	748					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						CTACGATTCCGTACAAGAGCT	0.428																																					p.R748H		Atlas-SNP	.											.	NUP205	198	.	0			c.G2243A						PASS	.	G	HIS/ARG	0,4406		0,0,2203	159.0	164.0	162.0		2243	5.7	1.0	7		162	1,8599	1.2+/-3.3	0,1,4299	no	missense	NUP205	NM_015135.2	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	748/2013	135282924	1,13005	2203	4300	6503	SO:0001583	missense	23165	exon15			GATTCCGTACAAG	D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.2243G>A	chr7.hg19:g.135282924G>A	ENSP00000285968:p.Arg748His	82.0	0.0	.		100.0	31.0	.	NM_015135	A6H8X3|Q86YC1	Missense_Mutation	SNP	ENST00000285968.6	hg19	CCDS34759.1	.	.	.	.	.	.	.	.	.	.	G	14.29	2.490520	0.44249	0.0	1.16E-4	ENSG00000155561	ENST00000285968	T	0.32753	1.44	5.73	5.73	0.89815	.	0.098316	0.64402	D	0.000001	T	0.21387	0.0515	N	0.13098	0.295	0.80722	D	1	B	0.31655	0.334	B	0.24394	0.053	T	0.03473	-1.1033	10	0.40728	T	0.16	-22.9195	19.8824	0.96903	0.0:0.0:1.0:0.0	.	748	Q92621	NU205_HUMAN	H	748	ENSP00000285968:R748H	ENSP00000285968:R748H	R	+	2	0	NUP205	134933464	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.954000	0.76001	2.696000	0.92011	0.591000	0.81541	CGT	.	.	.	weak		0.428	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340358.1		
KMT2C	58508	hgsc.bcm.edu	37	7	151859226	151859226	+	Missense_Mutation	SNP	C	C	A			TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chr7:151859226C>A	ENST00000262189.6	-	43	11654	c.11436G>T	c.(11434-11436)gaG>gaT	p.E3812D	KMT2C_ENST00000355193.2_Missense_Mutation_p.E3812D	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	3812					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										GGTTCTGCTTCTCAACTAGTT	0.328																																					p.E3812D		Atlas-SNP	.											.	MLL3	1564	.	0			c.G11436T						PASS	.						44.0	48.0	47.0					7																	151859226		2201	4298	6499	SO:0001583	missense	58508	exon43			CTGCTTCTCAACT	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.11436G>T	chr7.hg19:g.151859226C>A	ENSP00000262189:p.Glu3812Asp	26.0	0.0	.		40.0	7.0	.	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	hg19	CCDS5931.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.21|11.21	1.570903|1.570903	0.28003|0.28003	.|.	.|.	ENSG00000055609|ENSG00000055609	ENST00000262189;ENST00000355193;ENST00000424877;ENST00000418061|ENST00000360104	D;D;D|.	0.89050|.	-1.81;-1.8;-2.46|.	5.51|5.51	2.72|2.72	0.32119|0.32119	.|.	0.311841|0.311841	0.22245|0.22245	U|U	0.062629|0.062629	T|.	0.40719|.	0.1128|.	L|L	0.35723|0.35723	1.085|1.085	0.80722|0.80722	D|D	1|1	B;B;B|.	0.15141|.	0.012;0.01;0.01|.	B;B;B|.	0.13407|.	0.006;0.009;0.009|.	T|.	0.08027|.	-1.0742|.	10|.	0.18276|0.12103	T|T	0.48|0.63	.|.	6.7615|6.7615	0.23542|0.23542	0.0:0.5573:0.2457:0.197|0.0:0.5573:0.2457:0.197	.|.	3812;2873;3812|.	Q8NEZ4;Q8NEZ4-2;Q8NEZ4-3|.	MLL3_HUMAN;.;.|.	D|X	3812;3812;398;8|1318	ENSP00000262189:E3812D;ENSP00000347325:E3812D;ENSP00000410411:E398D|.	ENSP00000262189:E3812D|ENSP00000353218:E1318X	E|E	-|-	3|1	2|0	MLL3|MLL3	151490159|151490159	0.998000|0.998000	0.40836|0.40836	0.728000|0.728000	0.30774|0.30774	0.974000|0.974000	0.67602|0.67602	0.397000|0.397000	0.20883|0.20883	0.689000|0.689000	0.31550|0.31550	0.650000|0.650000	0.86243|0.86243	GAG|GAA	.	.	.	none		0.328	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
KCNK9	51305	hgsc.bcm.edu	37	8	140630623	140630623	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chr8:140630623C>T	ENST00000520439.1	-	2	1066	c.1003G>A	c.(1003-1005)Gag>Aag	p.E335K	KCNK9_ENST00000523477.1_5'Flank|KCNK9_ENST00000303015.1_Missense_Mutation_p.E335K	NM_001282534.1	NP_001269463.1	Q9NPC2	KCNK9_HUMAN	potassium channel, subfamily K, member 9	335					cochlea development (GO:0090102)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			NS(1)|endometrium(9)|kidney(1)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)	43	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)		Doxapram(DB00561)|Halothane(DB01159)	GAGATCTCCTCGATCTTGTAA	0.552																																					p.E335K		Atlas-SNP	.											.	KCNK9	100	.	0			c.G1003A						PASS	.						115.0	113.0	113.0					8																	140630623		2203	4300	6503	SO:0001583	missense	51305	exon2			TCTCCTCGATCTT	AF212829	CCDS6377.1	8q24.3	2012-03-07			ENSG00000169427	ENSG00000169427		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6283	protein-coding gene	gene with protein product		605874				10734076, 16382106	Standard	NM_001282534		Approved	K2p9.1, TASK3, TASK-3	uc003yvf.1	Q9NPC2	OTTHUMG00000164186	ENST00000520439.1:c.1003G>A	chr8.hg19:g.140630623C>T	ENSP00000430676:p.Glu335Lys	193.0	0.0	.		213.0	89.0	.	NM_016601	Q2M290|Q540F2	Missense_Mutation	SNP	ENST00000520439.1	hg19	CCDS6377.1	.	.	.	.	.	.	.	.	.	.	C	16.05	3.013189	0.54468	.	.	ENSG00000169427	ENST00000522317;ENST00000303015;ENST00000520439	T;T;T	0.16324	2.35;2.35;2.35	5.85	5.85	0.93711	.	0.062019	0.64402	D	0.000005	T	0.19446	0.0467	M	0.70595	2.14	0.58432	D	0.999999	P	0.40083	0.702	B	0.34038	0.174	T	0.11494	-1.0585	10	0.07325	T	0.83	.	19.1531	0.93496	0.0:1.0:0.0:0.0	.	335	Q9NPC2	KCNK9_HUMAN	K	335	ENSP00000429847:E335K;ENSP00000302166:E335K;ENSP00000430676:E335K	ENSP00000302166:E335K	E	-	1	0	KCNK9	140699805	1.000000	0.71417	0.969000	0.41365	0.752000	0.42762	5.595000	0.67563	2.753000	0.94483	0.655000	0.94253	GAG	.	.	.	none		0.552	KCNK9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378473.1	NM_016601	
ST6GALNAC4	27090	hgsc.bcm.edu	37	9	130674884	130674884	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chr9:130674884C>T	ENST00000335791.5	-	4	549	c.274G>A	c.(274-276)Gct>Act	p.A92T	ST6GALNAC4_ENST00000495983.1_5'UTR|ST6GALNAC4_ENST00000343609.2_Missense_Mutation_p.A8T	NM_175039.3	NP_778204.1	Q9H4F1	SIA7D_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4	92					cellular protein metabolic process (GO:0044267)|glycolipid metabolic process (GO:0006664)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	(alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl-galactosaminide 6-alpha-sialyltransferase activity (GO:0047290)|sialyltransferase activity (GO:0008373)			endometrium(1)|large_intestine(2)|lung(2)|prostate(2)	7						TCGATCTCAGCACCCAGGCCT	0.682																																					p.A92T		Atlas-SNP	.											.	ST6GALNAC4	29	.	0			c.G274A						PASS	.						31.0	26.0	27.0					9																	130674884		2203	4299	6502	SO:0001583	missense	27090	exon4			TCTCAGCACCCAG	AB035172	CCDS6883.1	9q34	2013-03-01	2005-02-07	2005-02-07	ENSG00000136840	ENSG00000136840	2.4.99.7	"""Sialyltransferases"""	17846	protein-coding gene	gene with protein product		606378	"""sialyltransferase 7D ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase)"""	SIAT7D		10207017, 11062056	Standard	XM_005251922		Approved	ST6GALNACIV, SIAT3C	uc004bss.3	Q9H4F1	OTTHUMG00000020724	ENST00000335791.5:c.274G>A	chr9.hg19:g.130674884C>T	ENSP00000336733:p.Ala92Thr	4.0	0.0	.		18.0	6.0	.	NM_175039	Q5T9D0|Q9NWU6|Q9UKU1|Q9ULB9|Q9Y3G3|Q9Y3G4	Missense_Mutation	SNP	ENST00000335791.5	hg19	CCDS6883.1	.	.	.	.	.	.	.	.	.	.	C	12.47	1.947277	0.34377	.	.	ENSG00000136840	ENST00000541933;ENST00000335791;ENST00000343609;ENST00000361444	T;T;T	0.30714	1.52;1.52;1.52	5.58	-4.4	0.03600	.	0.720248	0.13564	N	0.378592	T	0.14874	0.0359	N	0.26092	0.79	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.13926	-1.0491	10	0.35671	T	0.21	-23.1112	4.2604	0.10739	0.0897:0.1894:0.4714:0.2496	.	92	Q9H4F1	SIA7D_HUMAN	T	8;92;8;8	ENSP00000336733:A92T;ENSP00000340382:A8T;ENSP00000355130:A8T	ENSP00000336733:A92T	A	-	1	0	ST6GALNAC4	129714705	0.000000	0.05858	0.001000	0.08648	0.554000	0.35429	-0.081000	0.11321	-0.632000	0.05553	-0.379000	0.06801	GCT	.	.	.	none		0.682	ST6GALNAC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054317.2	NM_175040	
OR51S1	119692	hgsc.bcm.edu	37	11	4869479	4869479	+	Silent	SNP	A	A	T			TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chr11:4869479A>T	ENST00000322101.2	-	1	1035	c.960T>A	c.(958-960)ggT>ggA	p.G320G	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001004758.1	NP_001004758.1	Q8NGJ8	O51S1_HUMAN	olfactory receptor, family 51, subfamily S, member 1	320						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(15)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		ACTGAGCACCACCCACCTTCC	0.448																																					p.G320G		Atlas-SNP	.											.	OR51S1	83	.	0			c.T960A						PASS	.						142.0	135.0	138.0					11																	4869479		2201	4298	6499	SO:0001819	synonymous_variant	119692	exon1			AGCACCACCCACC	AB065796	CCDS31362.1	11p15.4	2012-08-09			ENSG00000176922	ENSG00000176922		"""GPCR / Class A : Olfactory receptors"""	15204	protein-coding gene	gene with protein product							Standard	NM_001004758		Approved		uc010qyo.2	Q8NGJ8	OTTHUMG00000066506	ENST00000322101.2:c.960T>A	chr11.hg19:g.4869479A>T		92.0	0.0	.		110.0	22.0	.	NM_001004758	B9EGZ1|Q6IFI2	Silent	SNP	ENST00000322101.2	hg19	CCDS31362.1																																																																																			.	.	.	none		0.448	OR51S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142179.1	NM_001004758	
C11orf45	219833	hgsc.bcm.edu	37	11	128772504	128772504	+	Missense_Mutation	SNP	C	C	T	rs545751134		TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chr11:128772504C>T	ENST00000524878.1	-	4	556	c.386G>A	c.(385-387)cGc>cAc	p.R129H	C11orf45_ENST00000530168.1_5'UTR|KCNJ5_ENST00000338350.4_Intron|C11orf45_ENST00000310799.3_Missense_Mutation_p.R129H|KCNJ5_ENST00000529694.1_Intron			Q8TAV5	CK045_HUMAN	chromosome 11 open reading frame 45	129						extracellular region (GO:0005576)				endometrium(1)|kidney(1)|lung(2)|pancreas(1)|prostate(2)	7	all_hematologic(175;0.0641)	Lung NSC(97;0.00521)|Breast(109;0.00715)|all_lung(97;0.0111)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.00531)|LUSC - Lung squamous cell carcinoma(976;0.0193)|Lung(977;0.0195)		GTAGCCCAGGCGGCCCTCTCT	0.607																																					p.R129H		Atlas-SNP	.											.	C11orf45	14	.	0			c.G386A						PASS	.						67.0	59.0	61.0					11																	128772504		2201	4297	6498	SO:0001583	missense	219833	exon4			CCCAGGCGGCCCT	AK125634	CCDS8478.1	11q24.3	2012-05-30			ENSG00000174370	ENSG00000174370			28584	protein-coding gene	gene with protein product							Standard	NM_001256088		Approved	MGC35558, FLJ43646	uc001qeu.3	Q8TAV5	OTTHUMG00000165796	ENST00000524878.1:c.386G>A	chr11.hg19:g.128772504C>T	ENSP00000431922:p.Arg129His	74.0	0.0	.		67.0	30.0	.	NM_145013	B2RAD0	Missense_Mutation	SNP	ENST00000524878.1	hg19	CCDS8478.1	.	.	.	.	.	.	.	.	.	.	C	8.914	0.959417	0.18507	.	.	ENSG00000174370	ENST00000310799;ENST00000524878	.	.	.	2.51	-4.9	0.03094	.	.	.	.	.	T	0.13713	0.0332	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.18808	-1.0325	8	0.87932	D	0	.	0.223	0.00170	0.2826:0.2756:0.207:0.2348	.	129	Q8TAV5	CK045_HUMAN	H	129	.	ENSP00000307879:R129H	R	-	2	0	C11orf45	128277714	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.211000	0.02997	-1.303000	0.02332	-2.745000	0.00126	CGC	.	.	.	none		0.607	C11orf45-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386243.1	NM_145013	
CD163	9332	hgsc.bcm.edu	37	12	7651490	7651490	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chr12:7651490G>A	ENST00000359156.4	-	4	954	c.752C>T	c.(751-753)gCt>gTt	p.A251V	CD163_ENST00000541972.1_Missense_Mutation_p.A239V|CD163_ENST00000396620.3_Missense_Mutation_p.A251V|CD163_ENST00000432237.2_Missense_Mutation_p.A251V	NM_004244.5	NP_004235.4	Q86VB7	C163A_HUMAN	CD163 molecule	251	SRCR 2. {ECO:0000255|PROSITE- ProRule:PRU00196}.				acute-phase response (GO:0006953)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(6)|pancreas(2)|prostate(1)|skin(5)|urinary_tract(4)	76					WF10(DB05389)	AGCATCCTCAGCATGATCACA	0.433																																					p.A251V		Atlas-SNP	.											.	CD163	221	.	0			c.C752T						PASS	.						180.0	168.0	172.0					12																	7651490		2203	4300	6503	SO:0001583	missense	9332	exon4			TCCTCAGCATGAT	Z22968	CCDS8578.1, CCDS53742.1	12p13	2006-03-28	2006-03-28		ENSG00000177575	ENSG00000177575		"""CD molecules"""	1631	protein-coding gene	gene with protein product		605545	"""CD163 antigen"""			10403791, 8370408	Standard	NM_004244		Approved	M130, MM130	uc001qsz.3	Q86VB7	OTTHUMG00000168353	ENST00000359156.4:c.752C>T	chr12.hg19:g.7651490G>A	ENSP00000352071:p.Ala251Val	101.0	0.0	.		119.0	24.0	.	NM_203416	C9JIG2|Q07898|Q07899|Q07900|Q07901|Q2VLH7	Missense_Mutation	SNP	ENST00000359156.4	hg19	CCDS8578.1	.	.	.	.	.	.	.	.	.	.	G	12.85	2.061841	0.36373	.	.	ENSG00000177575	ENST00000359156;ENST00000541972;ENST00000396620;ENST00000432237	T;T;T;T	0.35605	1.3;1.3;1.3;1.3	5.16	3.02	0.34903	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	1.445290	0.04133	N	0.318256	T	0.30355	0.0762	L	0.27975	0.815	0.09310	N	0.999992	P;B;P	0.45428	0.772;0.225;0.858	B;B;B	0.43701	0.428;0.047;0.428	T	0.19614	-1.0300	10	0.41790	T	0.15	.	5.6612	0.17670	0.0941:0.0:0.4895:0.4164	.	251;251;251	C9JHR8;Q86VB7-3;Q86VB7	.;.;C163A_HUMAN	V	251;239;251;251	ENSP00000352071:A251V;ENSP00000444071:A239V;ENSP00000379863:A251V;ENSP00000403885:A251V	ENSP00000352071:A251V	A	-	2	0	CD163	7542757	0.000000	0.05858	0.278000	0.24718	0.945000	0.59286	-0.236000	0.09003	1.300000	0.44818	0.650000	0.86243	GCT	.	.	.	none		0.433	CD163-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399396.2	NM_004244, NM_203416	
PIK3C2G	5288	hgsc.bcm.edu	37	12	18478009	18478009	+	Silent	SNP	C	C	T			TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chr12:18478009C>T	ENST00000266497.5	+	7	1287	c.1249C>T	c.(1249-1251)Ctg>Ttg	p.L417L	PIK3C2G_ENST00000538779.1_Silent_p.L417L|PIK3C2G_ENST00000433979.1_Silent_p.L417L|PIK3C2G_ENST00000535651.1_Silent_p.L417L			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	417					chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)			breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				TGACTTCCACCTGAAATACCT	0.299																																					p.L417L		Atlas-SNP	.											.	PIK3C2G	315	.	0			c.C1249T						PASS	.						83.0	81.0	82.0					12																	18478009		1800	4061	5861	SO:0001819	synonymous_variant	5288	exon8			TTCCACCTGAAAT	AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.1249C>T	chr12.hg19:g.18478009C>T		33.0	0.0	.		36.0	15.0	.	NM_004570	A1L3U0	Silent	SNP	ENST00000266497.5	hg19	CCDS44839.1																																																																																			.	.	.	none		0.299	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401316.1	NM_004570	
DNAAF2	55172	hgsc.bcm.edu	37	14	50092296	50092296	+	Missense_Mutation	SNP	G	G	T			TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chr14:50092296G>T	ENST00000298292.8	-	3	2558	c.2478C>A	c.(2476-2478)ttC>ttA	p.F826L	RP11-649E7.5_ENST00000555043.1_RNA|DNAAF2_ENST00000406043.3_Missense_Mutation_p.F778L	NM_018139.2	NP_060609.2	Q9NVR5	KTU_HUMAN	dynein, axonemal, assembly factor 2	826					axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)				kidney(1)|lung(4)	5						TCTGAAAACTGAATGCACAAT	0.308																																					p.F826L		Atlas-SNP	.											.	DNAAF2	47	.	0			c.C2478A						PASS	.						99.0	91.0	94.0					14																	50092296		2202	4300	6502	SO:0001583	missense	55172	exon3			AAAACTGAATGCA	AK001425	CCDS9691.2, CCDS45100.1	14q21.3	2012-05-03	2011-06-09	2011-06-09	ENSG00000165506	ENSG00000165506			20188	protein-coding gene	gene with protein product	"""kintoun"""	612517	"""chromosome 14 open reading frame 104"""	C14orf104			Standard	NM_001083908		Approved	FLJ10563, KTU, PF13, CILD10	uc001wws.4	Q9NVR5	OTTHUMG00000152331	ENST00000298292.8:c.2478C>A	chr14.hg19:g.50092296G>T	ENSP00000298292:p.Phe826Leu	104.0	0.0	.		80.0	21.0	.	NM_018139	B9WS54|C0JAP7|Q86TR1|Q86TY8|Q969Z5	Missense_Mutation	SNP	ENST00000298292.8	hg19	CCDS9691.2	.	.	.	.	.	.	.	.	.	.	G	22.8	4.339347	0.81911	.	.	ENSG00000165506	ENST00000298292;ENST00000406043	T;T	0.08282	3.11;3.11	5.9	5.0	0.66597	.	0.163612	0.40302	N	0.001129	T	0.21145	0.0509	M	0.66939	2.045	0.33550	D	0.596045	D;D	0.65815	0.995;0.991	P;P	0.59424	0.857;0.795	T	0.09143	-1.0688	10	0.72032	D	0.01	.	10.6878	0.45854	0.1484:0.0:0.8516:0.0	.	778;826	Q9NVR5-2;Q9NVR5	.;KTU_HUMAN	L	826;778	ENSP00000298292:F826L;ENSP00000384862:F778L	ENSP00000298292:F826L	F	-	3	2	DNAAF2	49162046	0.911000	0.30947	1.000000	0.80357	0.850000	0.48378	0.932000	0.28884	2.808000	0.96608	0.551000	0.68910	TTC	.	.	.	none		0.308	DNAAF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276813.1		
DYX1C1	161582	hgsc.bcm.edu	37	15	55731768	55731768	+	Silent	SNP	T	T	C			TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chr15:55731768T>C	ENST00000321149.3	-	7	1162	c.795A>G	c.(793-795)aaA>aaG	p.K265K	DYX1C1_ENST00000448430.2_Silent_p.K265K|DYX1C1_ENST00000380679.1_Silent_p.K265K|DYX1C1_ENST00000348518.3_Silent_p.K265K|DYX1C1-CCPG1_ENST00000565113.1_RNA|DYX1C1_ENST00000457155.2_Silent_p.K265K	NM_130810.3	NP_570722.2	Q8WXU2	DYXC1_HUMAN	dyslexia susceptibility 1 candidate 1	265					cilium movement (GO:0003341)|determination of left/right symmetry (GO:0007368)|inner dynein arm assembly (GO:0036159)|neuron migration (GO:0001764)|outer dynein arm assembly (GO:0036158)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of proteasomal protein catabolic process (GO:0061136)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	estrogen receptor binding (GO:0030331)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18				all cancers(107;0.0118)|GBM - Glioblastoma multiforme(80;0.171)		CCTCAGCTTGTTTGTGTAGCC	0.348																																					p.K265K		Atlas-SNP	.											.	DYX1C1	54	.	0			c.A795G						PASS	.						66.0	67.0	66.0					15																	55731768		2193	4292	6485	SO:0001819	synonymous_variant	161582	exon7			AGCTTGTTTGTGT		CCDS10154.1, CCDS32243.1, CCDS32244.1	15q21.3	2014-09-11			ENSG00000256061	ENSG00000256061		"""Tetratricopeptide (TTC) repeat domain containing"""	21493	protein-coding gene	gene with protein product		608706				12954984	Standard	NM_130810		Approved	EKN1, FLJ37882, CILD25	uc002adc.3	Q8WXU2	OTTHUMG00000132008	ENST00000321149.3:c.795A>G	chr15.hg19:g.55731768T>C		42.0	0.0	.		85.0	23.0	.	NM_001033560	Q6P5Y9|Q8N1S6	Silent	SNP	ENST00000321149.3	hg19	CCDS10154.1																																																																																			.	.	.	none		0.348	DYX1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254976.1	NM_130810	
ADCY9	115	hgsc.bcm.edu	37	16	4163953	4163953	+	Silent	SNP	G	G	A			TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chr16:4163953G>A	ENST00000294016.3	-	2	2029	c.1491C>T	c.(1489-1491)tgC>tgT	p.C497C		NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	497	Guanylate cyclase 1. {ECO:0000255|PROSITE-ProRule:PRU00099}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						CCAGGATGCCGCAAAGGACGG	0.562																																					p.C497C		Atlas-SNP	.											.	ADCY9	151	.	0			c.C1491T						PASS	.						122.0	126.0	125.0					16																	4163953		2197	4300	6497	SO:0001819	synonymous_variant	115	exon2			GATGCCGCAAAGG	AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.1491C>T	chr16.hg19:g.4163953G>A		152.0	0.0	.		194.0	138.0	.	NM_001116	A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Silent	SNP	ENST00000294016.3	hg19	CCDS32382.1																																																																																			.	.	.	none		0.562	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438076.1		
ADCY9	115	hgsc.bcm.edu	37	16	4164162	4164162	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chr16:4164162G>A	ENST00000294016.3	-	2	1820	c.1282C>T	c.(1282-1284)Cgc>Tgc	p.R428C		NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	428	Guanylate cyclase 1. {ECO:0000255|PROSITE-ProRule:PRU00099}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						TCACACAGGCGGTCGAAGCGA	0.572																																					p.R428C		Atlas-SNP	.											ADCY9,NS,carcinoma,0,1	ADCY9	151	.	0			c.C1282T						PASS	.						67.0	70.0	69.0					16																	4164162		2197	4300	6497	SO:0001583	missense	115	exon2			ACAGGCGGTCGAA	AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.1282C>T	chr16.hg19:g.4164162G>A	ENSP00000294016:p.Arg428Cys	106.0	0.0	.		126.0	23.0	.	NM_001116	A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Missense_Mutation	SNP	ENST00000294016.3	hg19	CCDS32382.1	.	.	.	.	.	.	.	.	.	.	G	16.75	3.210746	0.58343	.	.	ENSG00000162104	ENST00000294016	D	0.81996	-1.56	5.28	5.28	0.74379	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.061240	0.64402	D	0.000003	D	0.90518	0.7029	M	0.81614	2.55	0.58432	D	0.999996	D	0.76494	0.999	P	0.59761	0.863	D	0.91803	0.5453	10	0.87932	D	0	.	18.9505	0.92640	0.0:0.0:1.0:0.0	.	428	O60503	ADCY9_HUMAN	C	428	ENSP00000294016:R428C	ENSP00000294016:R428C	R	-	1	0	ADCY9	4104163	1.000000	0.71417	0.993000	0.49108	0.907000	0.53573	3.072000	0.50049	2.481000	0.83766	0.555000	0.69702	CGC	.	.	.	none		0.572	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438076.1		
NDRG4	65009	hgsc.bcm.edu	37	16	58541744	58541744	+	Missense_Mutation	SNP	C	C	T	rs200391051		TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chr16:58541744C>T	ENST00000570248.1	+	9	759	c.653C>T	c.(652-654)aCg>aTg	p.T218M	NDRG4_ENST00000566192.1_Missense_Mutation_p.T218M|NDRG4_ENST00000394279.2_Missense_Mutation_p.T250M|NDRG4_ENST00000258187.5_Missense_Mutation_p.T250M|NDRG4_ENST00000569923.1_Missense_Mutation_p.T163M|NDRG4_ENST00000562999.1_Missense_Mutation_p.T218M|NDRG4_ENST00000568640.1_Missense_Mutation_p.T236M|NDRG4_ENST00000394282.4_Missense_Mutation_p.T270M|NDRG4_ENST00000356752.4_Missense_Mutation_p.T248M|NDRG4_ENST00000563799.1_Missense_Mutation_p.T236M	NM_001242835.1	NP_001229764.1	Q9ULP0	NDRG4_HUMAN	NDRG family member 4	218					cell differentiation (GO:0030154)|cell growth (GO:0016049)|response to stress (GO:0006950)	cytoplasm (GO:0005737)				breast(1)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	11						CGGCCTGGAACGGTGCCCAAT	0.667																																					p.T270M		Atlas-SNP	.											NDRG4,NS,malignant_melanoma,0,1	NDRG4	29	.	0			c.C809T						PASS	.	C	MET/THR,MET/THR,MET/THR,MET/THR,MET/THR,MET/THR,MET/THR	0,4396		0,0,2198	68.0	66.0	67.0		809,743,707,653,653,749,749	4.6	1.0	16		67	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense	NDRG4	NM_001130487.1,NM_001242833.1,NM_001242834.1,NM_001242835.1,NM_001242836.1,NM_020465.3,NM_022910.3	81,81,81,81,81,81,81	0,1,6497	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	270/392,248/370,236/358,218/353,218/340,250/372,250/372	58541744	1,12995	2198	4300	6498	SO:0001583	missense	65009	exon11			CTGGAACGGTGCC	AB044947	CCDS10797.1, CCDS45500.1, CCDS55999.1, CCDS58465.1, CCDS58466.1, CCDS58467.1	16q21-q22.3	2008-07-04			ENSG00000103034	ENSG00000103034			14466	protein-coding gene	gene with protein product		614463				11352569, 16408304	Standard	NM_020465		Approved	KIAA1180, SMAP-8	uc002enk.3	Q9ULP0	OTTHUMG00000133485	ENST00000570248.1:c.653C>T	chr16.hg19:g.58541744C>T	ENSP00000457659:p.Thr218Met	104.0	0.0	.		109.0	16.0	.	NM_001130487	B3KNU2|B4DK66|B4DSW5|H7C600|Q6ZNE7|Q6ZTI7|Q96PL9|Q9GZM1|Q9GZN3|Q9GZX0	Missense_Mutation	SNP	ENST00000570248.1	hg19	CCDS58466.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.947408	0.73672	0.0	1.16E-4	ENSG00000103034	ENST00000258187;ENST00000421602;ENST00000394282;ENST00000394279;ENST00000356752	T;T;T;T	0.18338	2.22;2.22;2.22;2.22	5.59	4.63	0.57726	.	0.097461	0.64402	D	0.000001	T	0.30135	0.0755	L	0.34521	1.04	0.58432	D	0.999998	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;0.979;0.999;1.0;0.999	D;D;D;P;P;P;P	0.68192	0.956;0.956;0.927;0.636;0.861;0.897;0.855	T	0.02917	-1.1094	10	0.52906	T	0.07	-0.368	15.0366	0.71751	0.143:0.857:0.0:0.0	.	236;248;236;218;218;270;250	B4DK66;B4DSW5;Q9ULP0-5;Q9ULP0-2;Q9ULP0;Q9ULP0-6;Q9ULP0-3	.;.;.;.;NDRG4_HUMAN;.;.	M	250;163;270;250;248	ENSP00000258187:T250M;ENSP00000377823:T270M;ENSP00000377820:T250M;ENSP00000349193:T248M	ENSP00000258187:T250M	T	+	2	0	NDRG4	57099245	1.000000	0.71417	0.980000	0.43619	0.680000	0.39746	4.398000	0.59697	1.340000	0.45581	0.655000	0.94253	ACG	.	C|0.999;T|0.001	0.001	weak		0.667	NDRG4-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000422671.2		
SMARCA4	6597	hgsc.bcm.edu	37	19	11129655	11129655	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chr19:11129655G>A	ENST00000429416.3	+	18	2742	c.2461G>A	c.(2461-2463)Gag>Aag	p.E821K	SMARCA4_ENST00000590574.1_Missense_Mutation_p.E821K|SMARCA4_ENST00000541122.2_Missense_Mutation_p.E821K|SMARCA4_ENST00000450717.3_Missense_Mutation_p.E821K|SMARCA4_ENST00000589677.1_Missense_Mutation_p.E821K|SMARCA4_ENST00000344626.4_Missense_Mutation_p.E821K|CTC-215O4.4_ENST00000587831.1_RNA|SMARCA4_ENST00000444061.3_Missense_Mutation_p.E821K|SMARCA4_ENST00000413806.3_Missense_Mutation_p.E821K|SMARCA4_ENST00000358026.2_Missense_Mutation_p.E821K	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	821	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.E821K(3)|p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				CTGGGCGTACGAGTTTGACAA	0.557			"""F, N, Mis"""		NSCLC																																p.E821K		Atlas-SNP	.		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	SMARCA4,NS,lymphoid_neoplasm,0,3	SMARCA4	502	.	4	Substitution - Missense(3)|Unknown(1)	central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)	c.G2461A						PASS	.						173.0	148.0	157.0					19																	11129655		2203	4300	6503	SO:0001583	missense	6597	exon17			GCGTACGAGTTTG	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.2461G>A	chr19.hg19:g.11129655G>A	ENSP00000395654:p.Glu821Lys	170.0	1.0	.		264.0	194.0	.	NM_003072	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	hg19	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.317520	0.81469	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	D;D;D;D;D;D;D	0.95690	-3.78;-3.78;-3.78;-3.78;-3.78;-3.78;-3.78	4.95	4.95	0.65309	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.98629	0.9541	H	0.97291	3.975	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;0.999;1.0;1.0	D	0.99624	1.0984	10	0.87932	D	0	-27.2359	17.1078	0.86668	0.0:0.0:1.0:0.0	.	821;821;821;821;821;821;821	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;A7E2E1;P51532	.;.;.;.;.;.;SMCA4_HUMAN	K	821;821;885;821;821;821;821;821	ENSP00000395654:E821K;ENSP00000350720:E821K;ENSP00000343896:E821K;ENSP00000445036:E821K;ENSP00000392837:E821K;ENSP00000397783:E821K;ENSP00000414727:E821K	ENSP00000343896:E821K	E	+	1	0	SMARCA4	10990655	1.000000	0.71417	0.924000	0.36721	0.213000	0.24496	9.625000	0.98406	2.571000	0.86741	0.591000	0.81541	GAG	.	.	.	none		0.557	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072	
GCDH	2639	hgsc.bcm.edu	37	19	13002761	13002761	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chr19:13002761C>T	ENST00000222214.5	+	4	455	c.244C>T	c.(244-246)Cgc>Tgc	p.R82C	GCDH_ENST00000591470.1_Missense_Mutation_p.R82C|GCDH_ENST00000457854.1_Missense_Mutation_p.R82C|GCDH_ENST00000422947.2_Silent_p.L19L			Q92947	GCDH_HUMAN	glutaryl-CoA dehydrogenase	82					cellular nitrogen compound metabolic process (GO:0034641)|fatty acid oxidation (GO:0019395)|fatty-acyl-CoA biosynthetic process (GO:0046949)|lysine catabolic process (GO:0006554)|small molecule metabolic process (GO:0044281)|tryptophan metabolic process (GO:0006568)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	fatty-acyl-CoA binding (GO:0000062)|flavin adenine dinucleotide binding (GO:0050660)|glutaryl-CoA dehydrogenase activity (GO:0004361)			autonomic_ganglia(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)	19					Flavin adenine dinucleotide(DB03147)	ACTCATGCCTCGCATCCTGTT	0.637																																					p.F82F	GBM(123;875 1636 7726 16444 26754)	Atlas-SNP	.											.	GCDH	76	.	0			c.T244T						PASS	.						79.0	63.0	68.0					19																	13002761		2203	4300	6503	SO:0001583	missense	2639	exon4			ATGCCTCGCATCC	AF012342	CCDS12286.1	19p13.2	2010-04-30	2010-04-30			ENSG00000105607	1.3.99.7		4189	protein-coding gene	gene with protein product		608801	"""glutaryl-Coenzyme A dehydrogenase"""			1438360, 8088809	Standard	NM_000159		Approved	ACAD5	uc002mvq.4	Q92947		ENST00000222214.5:c.244C>T	chr19.hg19:g.13002761C>T	ENSP00000222214:p.Arg82Cys	131.0	0.0	.		144.0	22.0	.	NM_013976	A8K2Z2|O14719	Silent	SNP	ENST00000222214.5	hg19	CCDS12286.1	.	.	.	.	.	.	.	.	.	.	C	35	5.478034	0.96291	.	.	ENSG00000105607	ENST00000457854;ENST00000222214;ENST00000421816	D;D	0.99722	-6.53;-6.53	5.31	5.31	0.75309	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA dehydrogenase, N-terminal (1);Acyl-CoA dehydrogenase/oxidase, N-terminal (1);	0.054691	0.85682	D	0.000000	D	0.99859	0.9934	H	0.98866	4.355	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.75020	0.931;0.985;0.985	D	0.96498	0.9369	10	0.87932	D	0	.	16.4613	0.84055	0.0:1.0:0.0:0.0	.	70;82;82	B4DQF2;Q92947;Q92947-2	.;GCDH_HUMAN;.	C	82;82;70	ENSP00000394872:R82C;ENSP00000222214:R82C	ENSP00000222214:R82C	R	+	1	0	GCDH	12863761	0.996000	0.38824	0.997000	0.53966	0.993000	0.82548	3.457000	0.53007	2.488000	0.83962	0.563000	0.77884	CGC	.	.	.	none		0.637	GCDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451897.1		
HAO1	54363	hgsc.bcm.edu	37	20	7894923	7894923	+	Missense_Mutation	SNP	G	G	A	rs200785017		TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chr20:7894923G>A	ENST00000378789.3	-	3	484	c.433C>T	c.(433-435)Cgg>Tgg	p.R145W		NM_017545.2	NP_060015.1	Q9UJM8	HAOX1_HUMAN	hydroxyacid oxidase (glycolate oxidase) 1	145	FMN hydroxy acid dehydrogenase. {ECO:0000255|PROSITE-ProRule:PRU00683}.				cellular nitrogen compound metabolic process (GO:0034641)|fatty acid alpha-oxidation (GO:0001561)|glycolate catabolic process (GO:0046296)|glyoxylate metabolic process (GO:0046487)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	(S)-2-hydroxy-acid oxidase activity (GO:0003973)|FMN binding (GO:0010181)|glycolate oxidase activity (GO:0008891)|glyoxylate oxidase activity (GO:0047969)|long-chain-(S)-2-hydroxy-long-chain-acid oxidase activity (GO:0052853)|medium-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052854)|receptor binding (GO:0005102)|very-long-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052852)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						TCTGCCTGCCGCACTAGCTTC	0.517																																					p.R145W		Atlas-SNP	.											HAO1,NS,carcinoma,0,3	HAO1	71	.	0			c.C433T						PASS	.						198.0	121.0	147.0					20																	7894923		2203	4300	6503	SO:0001583	missense	54363	exon3			CCTGCCGCACTAG	AL021879	CCDS13100.1	20p12	2005-01-10			ENSG00000101323	ENSG00000101323	1.1.3.15		4809	protein-coding gene	gene with protein product		605023		GOX1		9891009	Standard	NM_017545		Approved	GOX	uc002wmw.1	Q9UJM8	OTTHUMG00000031841	ENST00000378789.3:c.433C>T	chr20.hg19:g.7894923G>A	ENSP00000368066:p.Arg145Trp	212.0	0.0	.		304.0	74.0	.	NM_017545	Q14CQ0|Q9UPZ0|Q9Y3I7	Missense_Mutation	SNP	ENST00000378789.3	hg19	CCDS13100.1	.	.	.	.	.	.	.	.	.	.	G	13.38	2.218570	0.39201	.	.	ENSG00000101323	ENST00000378789	T	0.34072	1.38	6.17	0.404	0.16355	Aldolase-type TIM barrel (1);FMN-dependent dehydrogenase (1);	0.915368	0.09558	N	0.786011	T	0.61438	0.2347	M	0.92923	3.36	0.09310	N	1	D;D	0.56287	0.975;0.975	P;P	0.61592	0.891;0.891	T	0.48570	-0.9024	10	0.87932	D	0	0.281	6.8057	0.23777	0.0708:0.0792:0.4783:0.3717	.	145;145	A8K058;Q9UJM8	.;HAOX1_HUMAN	W	145	ENSP00000368066:R145W	ENSP00000368066:R145W	R	-	1	2	HAO1	7842923	0.057000	0.20700	0.316000	0.25252	0.058000	0.15608	0.662000	0.25038	0.398000	0.25338	0.655000	0.94253	CGG	.	G|0.999;A|0.001	0.001	weak		0.517	HAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077926.2		
BIK	638	hgsc.bcm.edu	37	22	43523734	43523734	+	Missense_Mutation	SNP	G	G	T			TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chr22:43523734G>T	ENST00000216115.2	+	3	256	c.193G>T	c.(193-195)Ggg>Tgg	p.G65W		NM_001197.4	NP_001188.1	Q13323	BIK_HUMAN	BCL2-interacting killer (apoptosis-inducing)	65					apoptotic mitochondrial changes (GO:0008637)|apoptotic process (GO:0006915)|male gonad development (GO:0008584)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|mitochondrial envelope (GO:0005740)				breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|urinary_tract(1)	5		Ovarian(80;0.0694)				GGCCTGCATCGGGGACGAGAT	0.677																																					p.G65W		Atlas-SNP	.											.	BIK	11	.	0			c.G193T						PASS	.						24.0	20.0	21.0					22																	43523734		2147	4197	6344	SO:0001583	missense	638	exon3			TGCATCGGGGACG	U34584	CCDS14044.1	22q13.31	2014-03-07			ENSG00000100290	ENSG00000100290			1051	protein-coding gene	gene with protein product		603392				7478623, 10591208	Standard	NM_001197		Approved	NBK	uc003bdk.3	Q13323	OTTHUMG00000150703	ENST00000216115.2:c.193G>T	chr22.hg19:g.43523734G>T	ENSP00000216115:p.Gly65Trp	18.0	0.0	.		44.0	10.0	.	NM_001197	Q16582|Q6FH93	Missense_Mutation	SNP	ENST00000216115.2	hg19	CCDS14044.1	.	.	.	.	.	.	.	.	.	.	G	14.25	2.480785	0.44044	.	.	ENSG00000100290	ENST00000216115	T	0.40476	1.03	3.8	3.8	0.43715	Apoptosis regulator, Bcl-2, BH3 motif, conserved site (1);	0.441185	0.16893	N	0.195260	T	0.50514	0.1620	L	0.29908	0.895	0.37261	D	0.907003	D	0.89917	1.0	D	0.91635	0.999	T	0.57312	-0.7833	10	0.87932	D	0	-25.3198	11.4735	0.50284	0.0:0.0:1.0:0.0	.	65	Q13323	BIK_HUMAN	W	65	ENSP00000216115:G65W	ENSP00000216115:G65W	G	+	1	0	BIK	41853678	0.100000	0.21855	0.806000	0.32338	0.168000	0.22595	2.576000	0.46033	2.410000	0.81850	0.561000	0.74099	GGG	.	.	.	none		0.677	BIK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319676.1	NM_001197	
MAGEC1	9947	hgsc.bcm.edu	37	X	140996146	140996146	+	Missense_Mutation	SNP	G	G	T			TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chrX:140996146G>T	ENST00000285879.4	+	4	3242	c.2956G>T	c.(2956-2958)Ggg>Tgg	p.G986W	MAGEC1_ENST00000406005.2_Missense_Mutation_p.G53W	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	986	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					CACCTCTGAGGGGTGTCTGAG	0.478										HNSCC(15;0.026)																											p.G986W		Atlas-SNP	.											.	MAGEC1	317	.	0			c.G2956T						PASS	.						112.0	105.0	107.0					X																	140996146		2203	4300	6503	SO:0001583	missense	9947	exon4			TCTGAGGGGTGTC	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.2956G>T	chrX.hg19:g.140996146G>T	ENSP00000285879:p.Gly986Trp	101.0	0.0	.		146.0	42.0	.	NM_005462	A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	ENST00000285879.4	hg19	CCDS35417.1	.	.	.	.	.	.	.	.	.	.	g	5.313	0.243052	0.10077	.	.	ENSG00000155495	ENST00000285879;ENST00000406005	T;T	0.05513	3.43;3.43	0.626	0.626	0.17670	.	.	.	.	.	T	0.27489	0.0675	M	0.91972	3.26	0.09310	N	1	D	0.76494	0.999	D	0.78314	0.991	T	0.02950	-1.1090	8	0.87932	D	0	.	.	.	.	.	986	O60732	MAGC1_HUMAN	W	986;53	ENSP00000285879:G986W;ENSP00000385500:G53W	ENSP00000285879:G986W	G	+	1	0	MAGEC1	140823812	0.000000	0.05858	0.005000	0.12908	0.012000	0.07955	0.510000	0.22723	0.564000	0.29238	0.279000	0.19357	GGG	.	.	.	none		0.478	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462	
GABRA3	2556	hgsc.bcm.edu	37	X	151532942	151532942	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chrX:151532942C>T	ENST00000370314.4	-	2	339	c.101G>A	c.(100-102)cGa>cAa	p.R34Q	GABRA3_ENST00000535043.1_Missense_Mutation_p.R34Q	NM_000808.3	NP_000799.1	P34903	GBRA3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 3	34					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(6)	37	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	GGGTTCTTGTCGTCTTGATTC	0.443																																					p.R34Q	NSCLC(142;2578 2613 10251 16743)	Atlas-SNP	.											.	GABRA3	97	.	0			c.G101A						PASS	.						177.0	168.0	171.0					X																	151532942		2203	4300	6503	SO:0001583	missense	2556	exon2			TCTTGTCGTCTTG		CCDS14706.1	Xq28	2012-06-22			ENSG00000011677	ENSG00000011677		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4077	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 3"""	305660					Standard	NM_000808		Approved		uc010ntk.1	P34903	OTTHUMG00000024183	ENST00000370314.4:c.101G>A	chrX.hg19:g.151532942C>T	ENSP00000359337:p.Arg34Gln	91.0	0.0	.		119.0	56.0	.	NM_000808	Q8TAF9	Missense_Mutation	SNP	ENST00000370314.4	hg19	CCDS14706.1	.	.	.	.	.	.	.	.	.	.	C	15.22	2.770224	0.49680	.	.	ENSG00000011677	ENST00000370314;ENST00000370311;ENST00000535043	T;T;T	0.71103	-0.54;-0.54;-0.54	5.01	5.01	0.66863	.	2.366800	0.01730	N	0.028823	T	0.75664	0.3880	N	0.19112	0.55	0.27649	N	0.947442	D	0.58620	0.983	P	0.61201	0.885	T	0.65651	-0.6116	10	0.37606	T	0.19	.	12.6556	0.56786	0.0:1.0:0.0:0.0	.	34	P34903	GBRA3_HUMAN	Q	34	ENSP00000359337:R34Q;ENSP00000359334:R34Q;ENSP00000443527:R34Q	ENSP00000359334:R34Q	R	-	2	0	GABRA3	151283598	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.443000	0.52907	2.039000	0.60335	0.600000	0.82982	CGA	.	.	.	none		0.443	GABRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060921.1	NM_000808	
MT-CO1	4512	hgsc.bcm.edu	37	M	6233	6233	+	Silent	SNP	A	A	G			TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chrM:6233A>G	ENST00000361624.2	+	1	330	c.330A>G	c.(328-330)ctA>ctG	p.L110L	MT-TY_ENST00000387409.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-ATP8_ENST00000361851.1_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TK_ENST00000387421.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TW_ENST00000387382.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TC_ENST00000387405.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	110					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						CCCTCTCTCCTACTCCTGCTC	0.542																																					p.L110L		Atlas-SNP	.											.	.	.	.	0			c.A330G						PASS	.																																			SO:0001819	synonymous_variant	5742	exon1			TCTCCTACTCCTG			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.330A>G	chrM.hg19:g.6233A>G		2.0	0.0	.		21.0	8.0	.	ENST00000361624	Q34770	Silent	SNP	ENST00000361624.2	hg19																																																																																				.	.	.	none		0.542	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024028	
MT-CO2	4513	hgsc.bcm.edu	37	M	8201	8201	+	Missense_Mutation	SNP	T	T	C			TCGA-AL-A5DJ-01A-11D-A26P-10	TCGA-AL-A5DJ-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b4f515ce-5bee-4e40-a66a-01f41e92181e	7c64233c-871d-4df4-8c4d-d60713a4ac1e	g.chrM:8201T>C	ENST00000361739.1	+	1	616	c.616T>C	c.(616-618)Ttc>Ctc	p.F206L	MT-TY_ENST00000387409.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-ATP8_ENST00000361851.1_5'Flank|MT-CO3_ENST00000362079.2_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-ATP6_ENST00000361899.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TA_ENST00000387392.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TC_ENST00000387405.1_RNA			P00403	COX2_HUMAN	mitochondrially encoded cytochrome c oxidase II	206					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|respiratory chain complex IV (GO:0045277)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)			endometrium(5)|kidney(8)|lung(2)|pancreas(3)|prostate(1)	19						CAAACCACAGTTTCATGCCCA	0.488																																					p.F206L		Atlas-SNP	.											.	.	.	.	0			c.T616C						PASS	.																																			SO:0001583	missense	5743	exon1			CACAGTTTCATGC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198712	ENSG00000198712		"""Mitochondrial respiratory chain complex / Complex IV"""	7421	protein-coding gene	gene with protein product		516040	"""cytochrome c oxidase II"""	MTCO2		1712754, 1989603	Standard			Approved	COX2, CO2		P00403		ENST00000361739.1:c.616T>C	chrM.hg19:g.8201T>C	ENSP00000354876:p.Phe206Leu	2.0	0.0	.		12.0	4.0	.	ENST00000361739	Q37526	Missense_Mutation	SNP	ENST00000361739.1	hg19																																																																																				.	.	.	none		0.488	MT-CO2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024029	
