#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ALS2	57679	hgsc.bcm.edu	37	2	202593234	202593234	+	Splice_Site	SNP	C	C	G			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr2:202593234C>G	ENST00000264276.6	-	15	3214		c.e15+1		ALS2_ENST00000457679.2_Splice_Site	NM_020919.3	NP_065970.2	Q96Q42	ALS2_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)						behavioral fear response (GO:0001662)|cell death (GO:0008219)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|locomotory behavior (GO:0007626)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Rab GTPase activity (GO:0032851)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of Ran GTPase activity (GO:0032853)|protein localization (GO:0008104)|receptor recycling (GO:0001881)|regulation of endosome size (GO:0051036)|response to oxidative stress (GO:0006979)|synaptic transmission, glutamatergic (GO:0035249)|vesicle organization (GO:0016050)	centrosome (GO:0005813)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome (GO:0005769)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|ruffle (GO:0001726)|vesicle (GO:0031982)	protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(22)|ovary(1)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	72						ATCCAGCCTACCTGGGCATGG	0.443																																																	0													90.0	89.0	89.0					2																	202593234		1883	4106	5989	SO:0001630	splice_region_variant	57679			AB053305	CCDS42800.1, CCDS46492.1	2q33-q35	2014-09-17	2004-06-23		ENSG00000003393	ENSG00000003393		"""Rho guanine nucleotide exchange factors"""	443	protein-coding gene	gene with protein product	"""alsin"""	606352	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 6"""	ALS2CR6		11586298	Standard	NM_020919		Approved		uc002uyo.3	Q96Q42	OTTHUMG00000154507	ENST00000264276.6:c.2841+1G>C	2.37:g.202593234C>G			Q53TT1|Q53TV2|Q8N1E0|Q96PC4|Q96Q41|Q9H973|Q9HCK9	Splice_Site	SNP	ENST00000264276.6	37	CCDS42800.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.701252	0.88924	.	.	ENSG00000003393	ENST00000264276;ENST00000457679	.	.	.	5.82	5.82	0.92795	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0966	0.97849	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ALS2	202301479	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.487000	0.81328	2.753000	0.94483	0.557000	0.71058	.		0.443	ALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335562.3		NM_020919	Intron
ANGPTL4	51129	hgsc.bcm.edu;ucsc.edu	37	19	8438683	8438683	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr19:8438683C>G	ENST00000301455.2	+	7	1305	c.1134C>G	c.(1132-1134)atC>atG	p.I378M	RAB11B-AS1_ENST00000593581.1_RNA|RAB11B-AS1_ENST00000597407.1_RNA|ANGPTL4_ENST00000393962.2_Missense_Mutation_p.I340M|ANGPTL4_ENST00000541807.1_Missense_Mutation_p.I211M|RAB11B-AS1_ENST00000597785.1_RNA	NM_139314.1	NP_647475.1	Q9BY76	ANGL4_HUMAN	angiopoietin-like 4	378	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|cellular lipid metabolic process (GO:0044255)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of lipoprotein lipase activity (GO:0051005)|positive regulation of angiogenesis (GO:0045766)|protein homooligomerization (GO:0051260)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	enzyme inhibitor activity (GO:0004857)			large_intestine(1)|lung(1)|ovary(2)|skin(2)	6						AGAAGGGAATCTTCTGGAAGA	0.627																																																	0													93.0	104.0	100.0					19																	8438683		2203	4300	6503	SO:0001583	missense	51129			AF202636	CCDS12200.1, CCDS42493.1	19p13.3	2013-10-07				ENSG00000167772		"""Fibrinogen C domain containing"""	16039	protein-coding gene	gene with protein product	"""fasting-induced adipose factor"", ""hepatic angiopoietin-related protein"", ""PPARG angiopoietin related protein"", ""hepatic fibrinogen/angiopoietin-related protein"", ""peroxisome proliferator-activated receptor (PPAR) gamma induced angiopoietin-related protein"", ""angiopoietin-related protein 4"""	605910				10698685, 10866690, 23960078	Standard	NM_139314		Approved	pp1158, PGAR, ARP4, HFARP, FIAF, NL2	uc002mjq.1	Q9BY76		ENST00000301455.2:c.1134C>G	19.37:g.8438683C>G	ENSP00000301455:p.Ile378Met		A8MY84|B4E089|D6W670|F5H0I2|Q53HQ6|Q53HU1|Q6UXN0|Q9HBV4|Q9NZU4|Q9Y5B3	Missense_Mutation	SNP	ENST00000301455.2	37	CCDS12200.1	.	.	.	.	.	.	.	.	.	.	C	17.42	3.384878	0.61956	.	.	ENSG00000167772	ENST00000301455;ENST00000393962;ENST00000541807	T;T;T	0.81078	-1.45;-1.45;-1.45	5.49	4.44	0.53790	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 2 (1);	0.055779	0.64402	D	0.000001	D	0.82838	0.5124	L	0.52126	1.63	0.47862	D	0.999531	P;P	0.51057	0.941;0.941	P;P	0.57204	0.815;0.815	T	0.83068	-0.0144	10	0.59425	D	0.04	.	10.0496	0.42208	0.1554:0.6948:0.1499:0.0	.	340;378	A8MY84;Q9BY76	.;ANGL4_HUMAN	M	378;340;211	ENSP00000301455:I378M;ENSP00000377534:I340M;ENSP00000439833:I211M	ENSP00000301455:I378M	I	+	3	3	ANGPTL4	8344683	1.000000	0.71417	0.999000	0.59377	0.867000	0.49689	1.208000	0.32345	1.273000	0.44346	0.563000	0.77884	ATC		0.627	ANGPTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460322.1		NM_139314	
ANO7	50636	hgsc.bcm.edu	37	2	242154264	242154264	+	Silent	SNP	G	G	A			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr2:242154264G>A	ENST00000274979.8	+	18	2038	c.1935G>A	c.(1933-1935)ctG>ctA	p.L645L	ANO7_ENST00000402430.3_Silent_p.L644L	NM_001001891.3	NP_001001891.2	Q6IWH7	ANO7_HUMAN	anoctamin 7	645					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(14)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	32						AGGAGCTCCTGGTCATCATGG	0.647																																																	0													131.0	95.0	107.0					2																	242154264		2203	4300	6503	SO:0001819	synonymous_variant	50636			AY617079	CCDS33423.1, CCDS46563.1	2q37.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000146205	ENSG00000146205		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	31677	protein-coding gene	gene with protein product		605096	"""transmembrane protein 16G"""	PCANAP5, TMEM16G		14981236, 15375614, 24692353	Standard	NM_001001891		Approved	NGEP, PCANAP5L, IPCA-5	uc002wax.2	Q6IWH7	OTTHUMG00000151702	ENST00000274979.8:c.1935G>A	2.37:g.242154264G>A			Q6IWH6	Silent	SNP	ENST00000274979.8	37	CCDS33423.1																																																																																				0.647	ANO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323509.1		NM_001001891	
ARHGAP31	57514	hgsc.bcm.edu	37	3	119134491	119134491	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr3:119134491A>G	ENST00000264245.4	+	12	4247	c.3715A>G	c.(3715-3717)Acc>Gcc	p.T1239A		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	1239					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						ACCCAGCTCAACCAGTGGGAC	0.552																																					Pancreas(7;176 297 5394 51128 51241)												0													45.0	53.0	50.0					3																	119134491		1927	4121	6048	SO:0001583	missense	57514				CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.3715A>G	3.37:g.119134491A>G	ENSP00000264245:p.Thr1239Ala		Q9ULL6	Missense_Mutation	SNP	ENST00000264245.4	37	CCDS43135.1	.	.	.	.	.	.	.	.	.	.	A	5.934	0.356284	0.11239	.	.	ENSG00000031081	ENST00000264245	T	0.06142	3.34	5.96	-1.18	0.09617	.	0.623213	0.15942	N	0.237126	T	0.03651	0.0104	N	0.20986	0.625	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.43032	-0.9416	10	0.23891	T	0.37	.	6.4791	0.22053	0.4918:0.1287:0.3795:0.0	.	1239	Q2M1Z3	RHG31_HUMAN	A	1239	ENSP00000264245:T1239A	ENSP00000264245:T1239A	T	+	1	0	ARHGAP31	120617181	0.000000	0.05858	0.000000	0.03702	0.270000	0.26580	0.761000	0.26489	-0.110000	0.12022	0.460000	0.39030	ACC		0.552	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354942.2			
ARSF	416	hgsc.bcm.edu	37	X	3007543	3007543	+	Silent	SNP	T	T	C			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chrX:3007543T>C	ENST00000381127.1	+	7	1058	c.837T>C	c.(835-837)agT>agC	p.S279S	ARSF_ENST00000537104.1_Silent_p.S279S|ARSF_ENST00000359361.2_Silent_p.S279S	NM_001201538.1|NM_001201539.1	NP_001188467.1|NP_001188468.1	P54793	ARSF_HUMAN	arylsulfatase F	279					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	38		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TCAGGCACAGTAAGGAAACTT	0.438																																																	0													251.0	190.0	210.0					X																	3007543		2203	4300	6503	SO:0001819	synonymous_variant	416			X97868	CCDS14123.1	Xp22.3	2013-02-14			ENSG00000062096	ENSG00000062096		"""Arylsulfatase family"""	721	protein-coding gene	gene with protein product		300003				7720070	Standard	NM_004042		Approved		uc022brz.1	P54793	OTTHUMG00000021081	ENST00000381127.1:c.837T>C	X.37:g.3007543T>C			Q8TCC5	Silent	SNP	ENST00000381127.1	37	CCDS14123.1																																																																																				0.438	ARSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055652.1			
ASXL3	80816	hgsc.bcm.edu;ucsc.edu	37	18	31311982	31311982	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr18:31311982A>T	ENST00000269197.5	+	9	930	c.930A>T	c.(928-930)gaA>gaT	p.E310D		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	310					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						TAAATAATGAATTCTTTGCAT	0.378																																																	0													137.0	127.0	130.0					18																	31311982		1883	4100	5983	SO:0001583	missense	80816			AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.930A>T	18.37:g.31311982A>T	ENSP00000269197:p.Glu310Asp		Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.220031	0.79464	.	.	ENSG00000141431	ENST00000269197	T	0.42900	0.96	6.04	2.46	0.29980	.	0.341741	0.28700	N	0.014432	T	0.61123	0.2322	M	0.79011	2.435	0.36210	D	0.851326	D	0.89917	1.0	D	0.87578	0.998	T	0.68458	-0.5403	10	0.87932	D	0	.	9.2713	0.37673	0.6637:0.0:0.3363:0.0	.	310	Q9C0F0	ASXL3_HUMAN	D	310	ENSP00000269197:E310D	ENSP00000269197:E310D	E	+	3	2	ASXL3	29565980	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.288000	0.33296	0.538000	0.28769	0.460000	0.39030	GAA		0.378	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2			
BAP1	8314	hgsc.bcm.edu;ucsc.edu	37	3	52441470	52441470	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	PGM			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr3:52441470C>A	ENST00000460680.1	-	6	853	c.382G>T	c.(382-384)Gga>Tga	p.G128*	BAP1_ENST00000296288.5_Nonsense_Mutation_p.G128*	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0	Interaction with HIP2.				anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.?(2)|p.G128R(1)		NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		ATCGCATATCCTTTGCTCTAC	0.542			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															GBM(101;493 1458 7992 21037 25532)			Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	3	Unknown(2)|Substitution - Missense(1)	eye(3)											92.0	95.0	94.0					3																	52441470		2203	4300	6503	SO:0001587	stop_gained	8314			AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.382G>T	3.37:g.52441470C>A	ENSP00000417132:p.Gly128*		B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Nonsense_Mutation	SNP	ENST00000460680.1	37	CCDS2853.1	.	.	.	.	.	.	.	.	.	.	C	40	8.173802	0.98688	.	.	ENSG00000163930	ENST00000460680;ENST00000296288;ENST00000470173	.	.	.	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-1.844	19.9064	0.97008	0.0:1.0:0.0:0.0	.	.	.	.	X	128;128;49	.	ENSP00000296288:G128X	G	-	1	0	BAP1	52416510	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.453000	0.80700	2.716000	0.92895	0.655000	0.94253	GGA		0.542	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1			
BCL10	8915	hgsc.bcm.edu	37	1	85736490	85736490	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr1:85736490C>G	ENST00000370580.1	-	2	894	c.157G>C	c.(157-159)Gaa>Caa	p.E53Q		NM_003921.4	NP_003912.1	O95999	BCL10_HUMAN	B-cell CLL/lymphoma 10	53	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				adaptive immune response (GO:0002250)|B cell apoptotic process (GO:0001783)|cell death (GO:0008219)|cellular defense response (GO:0006968)|cellular response to mechanical stimulus (GO:0071260)|Fc-epsilon receptor signaling pathway (GO:0038095)|immunoglobulin mediated immune response (GO:0016064)|innate immune response (GO:0045087)|interleukin-6 biosynthetic process (GO:0042226)|lymphotoxin A biosynthetic process (GO:0042109)|negative regulation of mature B cell apoptotic process (GO:0002906)|neural tube closure (GO:0001843)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of mast cell cytokine production (GO:0032765)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T cell activation (GO:0050870)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein oligomerization (GO:0051259)|regulation of T cell receptor signaling pathway (GO:0050856)|response to food (GO:0032094)|response to fungus (GO:0009620)|response to molecule of bacterial origin (GO:0002237)|T cell apoptotic process (GO:0070231)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor signaling pathway (GO:0002224)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|lysosome (GO:0005764)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme binding (GO:0019899)|kinase binding (GO:0019900)|NF-kappaB binding (GO:0051059)|protease binding (GO:0002020)|protein C-terminus binding (GO:0008022)|protein kinase B binding (GO:0043422)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)			haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	19				all cancers(265;0.0114)|Epithelial(280;0.0311)		GAAATTTCTTCAGTGTCTTCT	0.368			T	IGH@	MALT																																NSCLC(34;993 1034 12176 32621 50182)			Dom	yes		1	1p22	8915	B-cell CLL/lymphoma 10		L	0													95.0	100.0	99.0					1																	85736490		2202	4300	6502	SO:0001583	missense	8915			AJ006288	CCDS704.1	1p22	2008-07-18			ENSG00000142867	ENSG00000142867			989	protein-coding gene	gene with protein product	"""CARD-like apoptotic protein"", ""CARD-containing apoptotic signaling protein"", ""CARD containing molecule enhancing NF-kB"", ""caspase-recruiting domain-containing protein"", ""CARD-containing proapoptotic protein"""	603517				9989495	Standard	NM_003921		Approved	CARMEN, CIPER, mE10, c-E10, CLAP	uc021opd.1	O95999	OTTHUMG00000009965	ENST00000370580.1:c.157G>C	1.37:g.85736490C>G	ENSP00000359612:p.Glu53Gln		Q5VUF1	Missense_Mutation	SNP	ENST00000370580.1	37	CCDS704.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.020236	0.93462	.	.	ENSG00000142867	ENST00000370580;ENST00000271015;ENST00000394761	T	0.33438	1.41	5.99	5.99	0.97316	DEATH-like (2);Caspase Recruitment (2);	0.000000	0.85682	D	0.000000	T	0.50292	0.1607	M	0.63843	1.955	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.47824	-0.9087	10	0.87932	D	0	-22.6443	20.4777	0.99188	0.0:1.0:0.0:0.0	.	53	O95999	BCL10_HUMAN	Q	53	ENSP00000359612:E53Q	ENSP00000271015:E53Q	E	-	1	0	BCL10	85509078	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.187000	0.72039	2.840000	0.97914	0.655000	0.94253	GAA		0.368	BCL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027612.1		NM_003921	
BCORL1	63035	hgsc.bcm.edu	37	X	129148822	129148822	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chrX:129148822G>T	ENST00000218147.7	+	4	2271	c.2074G>T	c.(2074-2076)Gag>Tag	p.E692*	BCORL1_ENST00000540052.1_Nonsense_Mutation_p.E692*|BCORL1_ENST00000303743.5_Nonsense_Mutation_p.E692*|BCORL1_ENST00000359304.2_Nonsense_Mutation_p.E692*			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	692					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.E692K(1)		breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						CATCTTTCCCGAGATCGTGAG	0.602																																																	1	Substitution - Missense(1)	ovary(1)											70.0	58.0	62.0					X																	129148822		2203	4300	6503	SO:0001587	stop_gained	63035			AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.2074G>T	X.37:g.129148822G>T	ENSP00000218147:p.Glu692*		B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Nonsense_Mutation	SNP	ENST00000218147.7	37	CCDS14616.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.2|20.2	3.957789|3.957789	0.73902|0.73902	.|.	.|.	ENSG00000085185|ENSG00000085185	ENST00000218147;ENST00000303743;ENST00000359304;ENST00000540052;ENST00000456822|ENST00000441294	.|.	.|.	.|.	5.28|5.28	5.28|5.28	0.74379|0.74379	.|.	0.000000|.	0.37178|.	N|.	0.002211|.	.|T	.|0.74351	.|0.3705	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.73953	.|-0.3820	.|3	0.26408|.	T|.	0.33|.	-9.2769|-9.2769	18.0781|18.0781	0.89433|0.89433	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|L	692;692;692;692;292|127	.|.	ENSP00000218147:E692X|.	E|R	+|+	1|2	0|0	BCORL1|BCORL1	128976503|128976503	1.000000|1.000000	0.71417|0.71417	0.980000|0.980000	0.43619|0.43619	0.333000|0.333000	0.28666|0.28666	4.592000|4.592000	0.61027|0.61027	2.205000|2.205000	0.71048|0.71048	0.436000|0.436000	0.28706|0.28706	GAG|CGA		0.602	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058223.1		NM_021946	
C1QTNF9	338872	hgsc.bcm.edu	37	13	24895240	24895240	+	Silent	SNP	G	G	A	rs200205073	byFrequency	TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr13:24895240G>A	ENST00000382071.2	+	4	421	c.336G>A	c.(334-336)aaG>aaA	p.K112K	C1QTNF9-AS1_ENST00000449656.1_RNA|C1QTNF9_ENST00000332018.4_Silent_p.K112K			P0C862	C1T9A_HUMAN	C1q and tumor necrosis factor related protein 9	112	Collagen-like 2.					collagen trimer (GO:0005581)|extracellular region (GO:0005576)				endometrium(1)|kidney(2)|lung(6)	9		all_cancers(29;3.55e-20)|all_epithelial(30;4.25e-17)|all_lung(29;1.04e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.00565)|Epithelial(112;0.027)|OV - Ovarian serous cystadenocarcinoma(117;0.115)|Lung(94;0.159)		TGGGAGAGAAGGGCCTCCGAG	0.587													A|||	2170	0.433307	0.2186	0.536	5008	,	,		10534	0.5169		0.6054	False		,,,				2504	0.3875																0													38.0	22.0	29.0					13																	24895240		1844	2724	4568	SO:0001819	synonymous_variant	338872			BC040438	CCDS9306.1	13q12.12	2010-08-18			ENSG00000240654	ENSG00000240654			28732	protein-coding gene	gene with protein product		614285				12975309, 18787108	Standard	NM_178540		Approved	MGC48915, CTRP9, C1QTNF9A, AQL1	uc001upj.3	P0C862	OTTHUMG00000016576	ENST00000382071.2:c.336G>A	13.37:g.24895240G>A			A2A3T6|Q0VGC5|Q5VX65|Q5VX66|Q8IUU4	Silent	SNP	ENST00000382071.2	37	CCDS9306.1																																																																																				0.587	C1QTNF9-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044177.1		NM_178540	
CCDC110	256309	hgsc.bcm.edu	37	4	186380243	186380243	+	Missense_Mutation	SNP	A	A	C	rs59319722	byFrequency	TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr4:186380243A>C	ENST00000307588.3	-	6	1573	c.1498T>G	c.(1498-1500)Tac>Gac	p.Y500D	CCDC110_ENST00000507501.1_5'Flank|CCDC110_ENST00000393540.3_Missense_Mutation_p.Y463D|CCDC110_ENST00000510617.1_Missense_Mutation_p.Y500D	NM_152775.3	NP_689988.1	Q8TBZ0	CC110_HUMAN	coiled-coil domain containing 110	500			Y -> D (in dbSNP:rs59319722).			nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(9)	30		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;7.86e-05)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|Colorectal(36;0.0381)|all_hematologic(60;0.0749)		OV - Ovarian serous cystadenocarcinoma(60;1.13e-10)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.00014)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00921)|COAD - Colon adenocarcinoma(29;0.0105)|READ - Rectum adenocarcinoma(43;0.164)		TCTTTGCTGTATTCTTCTGTT	0.274													C|||	1927	0.384784	0.2784	0.3631	5008	,	,		16317	0.2857		0.5378	False		,,,				2504	0.4888																0								C	ASP/TYR,ASP/TYR	1438,2954		230,978,988	27.0	28.0	28.0		1387,1498	4.2	0.1	4	dbSNP_129	28	4818,3740		1364,2090,825	yes	missense,missense	CCDC110	NM_001145411.1,NM_152775.3	160,160	1594,3068,1813	CC,CA,AA		43.7018,32.7413,48.3089	benign,benign	463/797,500/834	186380243	6256,6694	2196	4279	6475	SO:0001583	missense	256309			AB080722	CCDS3843.1, CCDS47170.1	4q35.1	2010-12-24			ENSG00000168491	ENSG00000168491			28504	protein-coding gene	gene with protein product	"""cancer/testis antigen 52"""	609488				18160854	Standard	NM_152775		Approved	KM-HN-1, MGC33607, CT52	uc003ixu.4	Q8TBZ0	OTTHUMG00000160415	ENST00000307588.3:c.1498T>G	4.37:g.186380243A>C	ENSP00000306776:p.Tyr500Asp		Q86YI9|Q8N7W0	Missense_Mutation	SNP	ENST00000307588.3	37	CCDS3843.1	856	0.39194139194139194	148	0.3008130081300813	147	0.40607734806629836	161	0.28146853146853146	400	0.5277044854881267	C	0	-2.653368	0.00109	0.327413	0.562982	ENSG00000168491	ENST00000393540;ENST00000307588;ENST00000510617	T;T;T	0.04406	3.63;3.65;3.65	5.96	4.25	0.50352	.	0.427611	0.22036	N	0.065525	T	0.00012	0.0000	N	0.00368	-1.59	0.58432	P	1.0000000000287557E-6	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.39057	-0.9632	9	0.02654	T	1	-2.8884	7.4078	0.27001	0.1356:0.7252:0.0:0.1391	rs59319722;rs62345630	500;463;500	B4DZA2;Q8TBZ0-2;Q8TBZ0	.;.;CC110_HUMAN	D	463;500;500	ENSP00000377172:Y463D;ENSP00000306776:Y500D;ENSP00000427246:Y500D	ENSP00000306776:Y500D	Y	-	1	0	CCDC110	186617237	0.987000	0.35691	0.075000	0.20258	0.106000	0.19336	2.024000	0.41049	0.446000	0.26666	-0.121000	0.15023	TAC		0.274	CCDC110-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360519.2		NM_152775	
CDAN1	146059	hgsc.bcm.edu	37	15	43017754	43017754	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr15:43017754G>A	ENST00000356231.3	-	26	3406	c.3383C>T	c.(3382-3384)cCg>cTg	p.P1128L		NM_138477.2	NP_612486.2	Q8IWY9	CDAN1_HUMAN	codanin 1	1128					chromatin assembly (GO:0031497)|chromatin organization (GO:0006325)|negative regulation of DNA replication (GO:0008156)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	24		all_cancers(109;5.4e-16)|all_epithelial(112;2.97e-14)|Lung NSC(122;1.75e-08)|all_lung(180;5.99e-08)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;2.49e-07)		CAGCGGAACCGGCCCCTGAAA	0.597																																																	0													48.0	50.0	49.0					15																	43017754		2203	4299	6502	SO:0001583	missense	146059			AF525398	CCDS32209.1	15q15.2	2012-04-25	2012-04-25			ENSG00000140326			1713	protein-coding gene	gene with protein product		607465	"""congenital dyserythropoietic anemia, type I"""			8634422, 12434312	Standard	XM_005254177		Approved	CDA-I, CDAI	uc001zql.3	Q8IWY9		ENST00000356231.3:c.3383C>T	15.37:g.43017754G>A	ENSP00000348564:p.Pro1128Leu		Q6NYD0|Q7Z7L5|Q969N3	Missense_Mutation	SNP	ENST00000356231.3	37	CCDS32209.1	.	.	.	.	.	.	.	.	.	.	G	19.79	3.893474	0.72639	.	.	ENSG00000140326	ENST00000356231;ENST00000267892	D	0.87334	-2.24	5.72	3.85	0.44370	.	0.311094	0.40818	N	0.001002	D	0.89812	0.6823	L	0.43152	1.355	0.50632	D	0.999882	D;D	0.89917	0.996;1.0	P;D	0.91635	0.806;0.999	D	0.89286	0.3615	10	0.72032	D	0.01	-2.1211	10.9694	0.47431	0.1525:0.0:0.8475:0.0	.	1128;1126	Q8IWY9;C9K0H8	CDAN1_HUMAN;.	L	1128;1126	ENSP00000348564:P1128L	ENSP00000267892:P1126L	P	-	2	0	CDAN1	40805046	1.000000	0.71417	0.684000	0.30055	0.689000	0.40095	3.643000	0.54374	0.768000	0.33290	0.563000	0.77884	CCG		0.597	CDAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000431103.1		XM_085300	
CHD2	1106	hgsc.bcm.edu;ucsc.edu	37	15	93567834	93567834	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr15:93567834C>A	ENST00000394196.4	+	39	6454	c.5386C>A	c.(5386-5388)Cct>Act	p.P1796T		NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	1796					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			TCAGAAATCTCCTCACGATTC	0.473																																																	0													93.0	94.0	94.0					15																	93567834		1907	4118	6025	SO:0001583	missense	1106			AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.5386C>A	15.37:g.93567834C>A	ENSP00000377747:p.Pro1796Thr		C6G482|Q96IP5	Missense_Mutation	SNP	ENST00000394196.4	37	CCDS10374.2	.	.	.	.	.	.	.	.	.	.	C	19.66	3.868721	0.72065	.	.	ENSG00000173575	ENST00000394196	D	0.93019	-3.15	5.62	5.62	0.85841	.	.	.	.	.	D	0.94496	0.8228	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.94024	0.7295	9	0.42905	T	0.14	-9.2437	20.0326	0.97545	0.0:1.0:0.0:0.0	.	1796	O14647	CHD2_HUMAN	T	1796	ENSP00000377747:P1796T	ENSP00000377747:P1796T	P	+	1	0	CHD2	91368838	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	7.017000	0.76399	2.805000	0.96524	0.609000	0.83330	CCT		0.473	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313528.3		NM_001271	
CHDH	55349	hgsc.bcm.edu;ucsc.edu	37	3	53853013	53853013	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr3:53853013C>T	ENST00000315251.6	-	8	1755	c.1318G>A	c.(1318-1320)Gcc>Acc	p.A440T		NM_018397.4	NP_060867.2	Q8NE62	CHDH_HUMAN	choline dehydrogenase	440					glycine betaine biosynthetic process from choline (GO:0019285)	mitochondrial inner membrane (GO:0005743)	choline dehydrogenase activity (GO:0008812)|flavin adenine dinucleotide binding (GO:0050660)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)	17		Hepatocellular(537;0.152)		BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)	Choline(DB00122)	TGGGGATTGGCACTTCTCAGT	0.547																																																	0													209.0	174.0	186.0					3																	53853013		2203	4300	6503	SO:0001583	missense	55349			AJ272267	CCDS2873.1	3p21	2004-11-24			ENSG00000016391	ENSG00000016391	1.1.99.1		24288	protein-coding gene	gene with protein product							Standard	NM_018397		Approved		uc003dgz.3	Q8NE62	OTTHUMG00000158281	ENST00000315251.6:c.1318G>A	3.37:g.53853013C>T	ENSP00000319851:p.Ala440Thr		Q9NY17	Missense_Mutation	SNP	ENST00000315251.6	37	CCDS2873.1	.	.	.	.	.	.	.	.	.	.	C	14.81	2.646725	0.47258	.	.	ENSG00000016391	ENST00000315251	T	0.46451	0.87	5.78	-1.56	0.08532	Glucose-methanol-choline oxidoreductase, C-terminal (1);	0.883796	0.09984	N	0.730676	T	0.31544	0.0800	L	0.42744	1.35	0.25210	N	0.989984	B	0.10296	0.003	B	0.19666	0.026	T	0.30446	-0.9978	10	0.31617	T	0.26	-8.7483	7.5823	0.27972	0.102:0.4238:0.0:0.4742	.	440	Q8NE62	CHDH_HUMAN	T	440	ENSP00000319851:A440T	ENSP00000319851:A440T	A	-	1	0	CHDH	53828053	0.000000	0.05858	0.556000	0.28293	0.974000	0.67602	-0.379000	0.07437	-0.352000	0.08237	0.563000	0.77884	GCC		0.547	CHDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350567.2		NM_018397	
CLSTN2	64084	hgsc.bcm.edu	37	3	140281788	140281788	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr3:140281788T>C	ENST00000458420.3	+	14	2538	c.2348T>C	c.(2347-2349)tTc>tCc	p.F783S		NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	783					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						AGCAATGAGTTCAACTTGGAG	0.552										HNSCC(16;0.037)																											GBM(45;858 913 3709 36904 37282)												0													59.0	57.0	57.0					3																	140281788		2203	4300	6503	SO:0001583	missense	64084			AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.2348T>C	3.37:g.140281788T>C	ENSP00000402460:p.Phe783Ser		B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	ENST00000458420.3	37	CCDS3112.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.396433	0.83011	.	.	ENSG00000158258	ENST00000458420	T	0.31247	1.5	4.95	4.95	0.65309	.	0.093191	0.85682	D	0.000000	T	0.46756	0.1409	M	0.79926	2.475	0.51482	D	0.999922	D	0.60575	0.988	P	0.51657	0.676	T	0.52335	-0.8589	9	.	.	.	-27.8624	12.8671	0.57946	0.0:0.0:0.0:1.0	.	783	Q9H4D0	CSTN2_HUMAN	S	783	ENSP00000402460:F783S	.	F	+	2	0	CLSTN2	141764478	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.997000	0.88414	1.981000	0.57761	0.533000	0.62120	TTC		0.552	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359393.3		NM_022131	
COL4A2	1284	hgsc.bcm.edu	37	13	111156500	111156500	+	Missense_Mutation	SNP	C	C	T	rs139124960		TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr13:111156500C>T	ENST00000360467.5	+	45	4597	c.4291C>T	c.(4291-4293)Cgt>Tgt	p.R1431C	COL4A2-AS1_ENST00000417970.2_RNA	NM_001846.2	NP_001837.2	P08572	CO4A2_HUMAN	collagen, type IV, alpha 2	1431	Triple-helical region.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of angiogenesis (GO:0016525)|transcription, DNA-templated (GO:0006351)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	extracellular matrix structural constituent (GO:0005201)	p.R1431C(1)		NS(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|liver(2)|lung(48)|ovary(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	80	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			TGCAGGTTTCCGTGGGGCTCC	0.612																																																	1	Substitution - Missense(1)	skin(1)											53.0	59.0	57.0					13																	111156500		1936	4130	6066	SO:0001583	missense	1284			AK025912	CCDS41907.1	13q34	2013-09-05			ENSG00000134871	ENSG00000134871		"""Collagens"""	2203	protein-coding gene	gene with protein product	"""canstatin"", ""collagen type IV alpha 2"""	120090				2439508, 3025878	Standard	NM_001846		Approved	FLJ22259, DKFZp686I14213	uc001vqx.3	P08572	OTTHUMG00000017344	ENST00000360467.5:c.4291C>T	13.37:g.111156500C>T	ENSP00000353654:p.Arg1431Cys		Q14052|Q548C3|Q5VZA9|Q66K23	Missense_Mutation	SNP	ENST00000360467.5	37	CCDS41907.1	.	.	.	.	.	.	.	.	.	.	C	14.86	2.661176	0.47572	.	.	ENSG00000134871	ENST00000360467;ENST00000257309	D	0.93906	-3.31	5.2	5.2	0.72013	.	0.000000	0.52532	D	0.000072	D	0.91529	0.7325	M	0.69185	2.1	0.44789	D	0.997794	P	0.44044	0.825	B	0.38842	0.283	D	0.92063	0.5658	10	0.56958	D	0.05	.	13.3852	0.60791	0.1987:0.8013:0.0:0.0	.	1431	P08572	CO4A2_HUMAN	C	1431	ENSP00000353654:R1431C	ENSP00000257309:R1431C	R	+	1	0	COL4A2	109954501	0.877000	0.30153	0.909000	0.35828	0.887000	0.51463	2.389000	0.44407	2.423000	0.82170	0.561000	0.74099	CGT		0.612	COL4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045761.2		NM_001846	
COPB1	1315	hgsc.bcm.edu;ucsc.edu	37	11	14510041	14510041	+	Nonsense_Mutation	SNP	A	A	C			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr11:14510041A>C	ENST00000249923.3	-	6	996	c.696T>G	c.(694-696)taT>taG	p.Y232*	COPB1_ENST00000439561.2_Nonsense_Mutation_p.Y232*	NM_016451.4	NP_057535.1	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1	232					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|viral process (GO:0016032)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle (GO:0005798)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	36						TTCTTACCTTATAAATCAGTT	0.303																																																	0													54.0	53.0	53.0					11																	14510041		2198	4286	6484	SO:0001587	stop_gained	1315			BC037280	CCDS7815.1	11p15.2	2011-05-20	2006-06-30	2006-06-30	ENSG00000129083	ENSG00000129083			2231	protein-coding gene	gene with protein product		600959	"""coatomer protein complex, subunit beta"""	COPB		7982906	Standard	NM_016451		Approved		uc001mlg.2	P53618	OTTHUMG00000165824	ENST00000249923.3:c.696T>G	11.37:g.14510041A>C	ENSP00000249923:p.Tyr232*		D3DQX0|Q6GTT7|Q9NTK2|Q9UNW7	Nonsense_Mutation	SNP	ENST00000249923.3	37	CCDS7815.1	.	.	.	.	.	.	.	.	.	.	A	37	6.580450	0.97680	.	.	ENSG00000129083	ENST00000249923;ENST00000439561;ENST00000534234	.	.	.	5.0	3.86	0.44501	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	.	7.9415	0.29961	0.7091:0.0:0.2909:0.0	.	.	.	.	X	232	.	ENSP00000249923:Y232X	Y	-	3	2	COPB1	14466617	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.297000	0.43593	0.843000	0.35070	0.533000	0.62120	TAT		0.303	COPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386410.1		NM_016451	
CSMD1	64478	hgsc.bcm.edu	37	8	3265502	3265502	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr8:3265502C>A	ENST00000520002.1	-	15	2548	c.1993G>T	c.(1993-1995)Gcc>Tcc	p.A665S	CSMD1_ENST00000539096.1_Missense_Mutation_p.A664S|CSMD1_ENST00000537824.1_Missense_Mutation_p.A664S|CSMD1_ENST00000602723.1_Missense_Mutation_p.A665S|CSMD1_ENST00000400186.3_Missense_Mutation_p.A665S|CSMD1_ENST00000542608.1_Missense_Mutation_p.A664S|CSMD1_ENST00000602557.1_Missense_Mutation_p.A665S			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	665	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CCACTGCTGGCCAGCTGGGAA	0.488																																																	0													76.0	71.0	73.0					8																	3265502		1950	4149	6099	SO:0001583	missense	64478					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.1993G>T	8.37:g.3265502C>A	ENSP00000430733:p.Ala665Ser		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.85|17.85	3.490778|3.490778	0.64074|0.64074	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096|ENST00000335551	T;T;T;T;T|.	0.34072|.	1.38;1.38;1.38;1.38;1.38|.	5.23|5.23	4.35|4.35	0.52113|0.52113	CUB (5);|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.39911|0.39911	0.1096|0.1096	N|N	0.11870|0.11870	0.19|0.19	0.44061|0.44061	D|D	0.996807|0.996807	D;P|.	0.67145|.	0.996;0.645|.	D;P|.	0.83275|.	0.996;0.542|.	T|T	0.20306|0.20306	-1.0279|-1.0279	10|5	0.23302|.	T|.	0.38|.	.|.	13.9368|13.9368	0.64029|0.64029	0.0:0.9262:0.0:0.0738|0.0:0.9262:0.0:0.0738	.|.	665;665|.	E5RIG2;Q96PZ7|.	.;CSMD1_HUMAN|.	S|V	665;665;527;664;664;664|144	ENSP00000383047:A665S;ENSP00000430733:A665S;ENSP00000441462:A664S;ENSP00000446243:A664S;ENSP00000441675:A664S|.	ENSP00000320445:A527S|.	A|G	-|-	1|2	0|0	CSMD1|CSMD1	3252909|3252909	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.919000|0.919000	0.55068|0.55068	3.795000|3.795000	0.55499|0.55499	1.197000|1.197000	0.43143|0.43143	0.467000|0.467000	0.42956|0.42956	GCC|GGC		0.488	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2		NM_033225	
CTTNBP2	83992	hgsc.bcm.edu	37	7	117431331	117431331	+	Missense_Mutation	SNP	G	G	T	rs201032165		TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr7:117431331G>T	ENST00000160373.3	-	4	2010	c.1919C>A	c.(1918-1920)cCt>cAt	p.P640H	CTTNBP2_ENST00000487820.1_5'Flank	NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	640					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		GGTTGCAGCAGGCCAGGCACC	0.562																																																	0													92.0	84.0	87.0					7																	117431331		2203	4300	6503	SO:0001583	missense	83992				CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.1919C>A	7.37:g.117431331G>T	ENSP00000160373:p.Pro640His		O43389|Q7LG11|Q9C0A5	Missense_Mutation	SNP	ENST00000160373.3	37	CCDS5774.1	.	.	.	.	.	.	.	.	.	.	G	16.12	3.034481	0.54896	.	.	ENSG00000077063	ENST00000160373	T	0.67865	-0.29	5.74	3.92	0.45320	.	0.250831	0.48286	D	0.000194	T	0.74122	0.3675	M	0.72118	2.19	0.37353	D	0.910873	D	0.58970	0.984	P	0.56514	0.8	T	0.78481	-0.2187	10	0.45353	T	0.12	-4.398	10.9732	0.47450	0.0714:0.1451:0.7835:0.0	.	640	Q8WZ74	CTTB2_HUMAN	H	640	ENSP00000160373:P640H	ENSP00000160373:P640H	P	-	2	0	CTTNBP2	117218567	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.477000	0.60223	1.559000	0.49555	0.563000	0.77884	CCT		0.562	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4		NM_033427	
DHRS4L1	728635	hgsc.bcm.edu	37	14	24513063	24513063	+	RNA	SNP	A	A	C			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr14:24513063A>C	ENST00000558293.1	+	0	437					NR_102693.1																						actgcagaagaagcatggtgc	0.463																																																	0													106.0	120.0	115.0					14																	24513063		1006	2119	3125			728635																															14.37:g.24513063A>C				Missense_Mutation	SNP	ENST00000558293.1	37		.	.	.	.	.	.	.	.	.	.	A	5.391	0.257325	0.10239	.	.	ENSG00000225766	ENST00000397065	.	.	.	0.109	0.109	0.14578	NAD(P)-binding domain (1);	.	.	.	.	T	0.34308	0.0893	L	0.37630	1.12	.	.	.	B	0.06786	0.001	B	0.21546	0.035	T	0.34502	-0.9826	6	0.36615	T	0.2	.	.	.	.	.	135	P0CG22	DR4L1_HUMAN	A	135	.	ENSP00000380255:E135A	E	+	2	0	AL136295.1	23582903	0.426000	0.25506	0.224000	0.23877	0.227000	0.25037	0.335000	0.19806	0.156000	0.19299	0.155000	0.16302	GAA		0.463	RP11-468E2.9-005	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417272.1			
DIAPH2	1730	hgsc.bcm.edu	37	X	96212938	96212938	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chrX:96212938C>T	ENST00000324765.8	+	16	2073	c.1726C>T	c.(1726-1728)Cct>Tct	p.P576S	DIAPH2_ENST00000373061.3_Missense_Mutation_p.P576S|DIAPH2_ENST00000373054.4_Missense_Mutation_p.P572S|DIAPH2_ENST00000355827.4_Missense_Mutation_p.P576S|DIAPH2_ENST00000373049.4_Missense_Mutation_p.P576S			O60879	DIAP2_HUMAN	diaphanous-related formin 2	576	FH1.|Poly-Pro.				actin filament polymerization (GO:0030041)|cytokinesis (GO:0000910)|female gamete generation (GO:0007292)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	endosome (GO:0005768)	receptor binding (GO:0005102)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51						CGGAGGAGCTCCTCTTCCTCC	0.607																																																	0													55.0	48.0	50.0					X																	96212938		2203	4300	6503	SO:0001583	missense	1730			Y15909	CCDS14467.1, CCDS14468.1	Xq22	2013-05-24	2013-05-24		ENSG00000147202	ENSG00000147202			2877	protein-coding gene	gene with protein product		300108	"""diaphanous (Drosophila, homolog) 2"", ""diaphanous homolog 2 (Drosophila)"""			9360932	Standard	NM_006729		Approved	POF, DIA, POF2, DIA2	uc004efu.4	O60879	OTTHUMG00000022689	ENST00000324765.8:c.1726C>T	X.37:g.96212938C>T	ENSP00000321348:p.Pro576Ser		A6NG19|O60878|Q8WX06|Q8WX48|Q9UJL2	Missense_Mutation	SNP	ENST00000324765.8	37	CCDS14467.1	.	.	.	.	.	.	.	.	.	.	C	5.808	0.333407	0.11013	.	.	ENSG00000147202	ENST00000373061;ENST00000373054;ENST00000355827;ENST00000373049;ENST00000324765;ENST00000537885	T;T;T;T;T	0.76709	-1.04;-1.04;-1.04;-1.04;-1.04	5.41	-2.15	0.07102	.	26.510500	0.00465	N	0.000107	T	0.73171	0.3553	M	0.71296	2.17	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.06405	0.001;0.002	T	0.37337	-0.9710	10	0.33940	T	0.23	.	2.9231	0.05776	0.0888:0.3561:0.2571:0.298	.	576;576	O60879;O60879-2	DIAP2_HUMAN;.	S	576;572;576;576;576;583	ENSP00000362152:P576S;ENSP00000362145:P572S;ENSP00000348082:P576S;ENSP00000362140:P576S;ENSP00000321348:P576S	ENSP00000321348:P576S	P	+	1	0	DIAPH2	96099594	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.237000	0.08990	-1.134000	0.02899	-2.423000	0.00217	CCT		0.607	DIAPH2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058871.2		NM_006729, NM_007309	
DOCK6	57572	hgsc.bcm.edu;ucsc.edu	37	19	11314960	11314960	+	Silent	SNP	G	G	A			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr19:11314960G>A	ENST00000294618.7	-	40	5147	c.5136C>T	c.(5134-5136)ccC>ccT	p.P1712P	DOCK6_ENST00000319867.7_Silent_p.P1051P|DOCK6_ENST00000586702.1_5'Flank|CTC-510F12.2_ENST00000588634.1_RNA	NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	1712	DHR-2.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						CTTCCAGGATGGGGATGAGGT	0.607											OREG0025251	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													47.0	49.0	48.0					19																	11314960		2005	4155	6160	SO:0001819	synonymous_variant	57572				CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.5136C>T	19.37:g.11314960G>A		671	A6H8X5|Q7Z7P4|Q9P2F2	Silent	SNP	ENST00000294618.7	37	CCDS45975.1																																																																																				0.607	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453155.1		NM_020812	
DNAJB1	3337	hgsc.bcm.edu	37	19	14627478	14627478	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr19:14627478G>C	ENST00000254322.2	-	2	662	c.592C>G	c.(592-594)Cga>Gga	p.R198G	DNAJB1_ENST00000396969.4_Missense_Mutation_p.R98G	NM_006145.1	NP_006136.1	P25685	DNJB1_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 1	198					chaperone cofactor-dependent protein refolding (GO:0070389)|chaperone mediated protein folding requiring cofactor (GO:0051085)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of ATPase activity (GO:0032781)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|unfolded protein binding (GO:0051082)			NS(1)|breast(1)|cervix(3)|endometrium(1)|kidney(1)|lung(7)|prostate(1)|urinary_tract(1)	16				GBM - Glioblastoma multiforme(1328;0.0476)		TCTTCGTTTCGAATGCTCTTT	0.483																																																	0													177.0	168.0	171.0					19																	14627478		2203	4300	6503	SO:0001583	missense	3337			D49547	CCDS12312.1, CCDS74295.1	19p13.12	2014-08-12			ENSG00000132002	ENSG00000132002		"""Heat shock proteins / DNAJ (HSP40)"""	5270	protein-coding gene	gene with protein product	"""radial spoke 16 homolog B (Chlamydomonas)"""	604572		HSPF1		8975727, 8250930	Standard	XM_006722733		Approved	Hsp40, Sis1, RSPH16B	uc002myz.1	P25685	OTTHUMG00000183289	ENST00000254322.2:c.592C>G	19.37:g.14627478G>C	ENSP00000254322:p.Arg198Gly		B4DX52	Missense_Mutation	SNP	ENST00000254322.2	37	CCDS12312.1	.	.	.	.	.	.	.	.	.	.	g	19.25	3.791174	0.70452	.	.	ENSG00000132002	ENST00000254322;ENST00000396969	D;D	0.82167	-1.58;-1.58	5.01	5.01	0.66863	HSP40/DnaJ peptide-binding (1);	0.000000	0.85682	D	0.000000	D	0.84506	0.5487	M	0.83692	2.655	0.80722	D	1	B	0.10296	0.003	B	0.09377	0.004	T	0.83273	-0.0042	10	0.66056	D	0.02	.	15.793	0.78380	0.0:0.0:1.0:0.0	.	198	P25685	DNJB1_HUMAN	G	198;98	ENSP00000254322:R198G;ENSP00000444212:R98G	ENSP00000254322:R198G	R	-	1	2	DNAJB1	14488478	1.000000	0.71417	0.534000	0.28014	0.988000	0.76386	7.706000	0.84615	2.320000	0.78422	0.561000	0.74099	CGA		0.483	DNAJB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465987.1		NM_006145	
DUSP11	8446	hgsc.bcm.edu	37	2	74001019	74001019	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr2:74001019A>G	ENST00000272444.3	-	4	523	c.482T>C	c.(481-483)aTt>aCt	p.I161T	DUSP11_ENST00000377706.4_Missense_Mutation_p.I114T|DUSP11_ENST00000480948.1_5'UTR|DUSP11_ENST00000443070.1_Missense_Mutation_p.I161T	NM_003584.2	NP_003575.2	O75319	DUS11_HUMAN	dual specificity phosphatase 11 (RNA/RNP complex 1-interacting)	114	Tyrosine-protein phosphatase.				peptidyl-tyrosine dephosphorylation (GO:0035335)|polynucleotide 5' dephosphorylation (GO:0098507)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)	nucleus (GO:0005634)	nucleotide phosphatase activity, acting on free nucleotides (GO:0098519)|phosphatase activity (GO:0016791)|poly(A) RNA binding (GO:0044822)|polynucleotide 5'-phosphatase activity (GO:0004651)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|RNA binding (GO:0003723)	p.I114N(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(4)|skin(1)	12						AACTGTAAAAATTTTTAAGTA	0.294																																																	1	Substitution - Missense(1)	large_intestine(1)											69.0	78.0	75.0					2																	74001019		2203	4298	6501	SO:0001583	missense	8446			AF023917	CCDS1928.2	2p13.1	2011-06-09			ENSG00000144048	ENSG00000144048		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	3066	protein-coding gene	gene with protein product		603092				9685386	Standard	NM_003584		Approved	PIR1	uc002sjp.3	O75319	OTTHUMG00000129816	ENST00000272444.3:c.482T>C	2.37:g.74001019A>G	ENSP00000272444:p.Ile161Thr		B2RCT8|Q6AI47|Q9BWE3	Missense_Mutation	SNP	ENST00000272444.3	37	CCDS1928.2	.	.	.	.	.	.	.	.	.	.	A	21.1	4.095738	0.76870	.	.	ENSG00000144048	ENST00000272444;ENST00000443070;ENST00000377706;ENST00000452812	T;D	0.87887	1.17;-2.31	4.95	4.95	0.65309	Dual specificity phosphatase, catalytic domain (1);	0.159438	0.56097	D	0.000034	D	0.93307	0.7867	M	0.86178	2.8	0.52501	D	0.999954	D;P	0.76494	0.999;0.946	D;P	0.74023	0.982;0.892	D	0.93987	0.7263	10	0.66056	D	0.02	-7.0312	12.9075	0.58160	1.0:0.0:0.0:0.0	.	161;114	C9JYA6;O75319	.;DUS11_HUMAN	T	161;161;114;112	ENSP00000413444:I161T;ENSP00000366935:I114T	ENSP00000272444:I161T	I	-	2	0	DUSP11	73854527	1.000000	0.71417	0.999000	0.59377	0.974000	0.67602	6.773000	0.75006	2.216000	0.71823	0.533000	0.62120	ATT		0.294	DUSP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252047.3			
DYNC2H1	79659	hgsc.bcm.edu	37	11	103025274	103025274	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr11:103025274T>G	ENST00000375735.2	+	23	3541	c.3397T>G	c.(3397-3399)Ttt>Gtt	p.F1133V	DYNC2H1_ENST00000398093.3_Missense_Mutation_p.F1133V|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	1133	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		AATTTGGGCCTTTTATGAAGA	0.368																																																	0													26.0	25.0	26.0					11																	103025274		1816	4071	5887	SO:0001583	missense	79659			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.3397T>G	11.37:g.103025274T>G	ENSP00000364887:p.Phe1133Val		O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	37	CCDS53701.1	.	.	.	.	.	.	.	.	.	.	T	7.739	0.700852	0.15172	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.59364	0.27;0.27	5.16	4.24	0.50183	Dynein heavy chain, domain-2 (1);	0.545067	0.14457	U	0.318409	T	0.26846	0.0657	N	0.02315	-0.6	0.24802	N	0.992696	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.15150	-1.0447	10	0.19590	T	0.45	.	4.9066	0.13802	0.1517:0.609:0.0:0.2392	.	1133;1133	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	V	1133	ENSP00000364887:F1133V;ENSP00000381167:F1133V	ENSP00000364887:F1133V	F	+	1	0	DYNC2H1	102530484	0.922000	0.31269	0.952000	0.39060	0.982000	0.71751	1.752000	0.38349	1.165000	0.42670	-0.479000	0.04858	TTT		0.368	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1		XM_370652	
EPHX1	2052	hgsc.bcm.edu	37	1	226027044	226027044	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr1:226027044C>A	ENST00000366837.4	+	5	915	c.719C>A	c.(718-720)cCc>cAc	p.P240H	EPHX1_ENST00000272167.5_Missense_Mutation_p.P240H|RP11-285F7.2_ENST00000424332.1_RNA	NM_000120.3	NP_000111.1	P07099	HYEP_HUMAN	epoxide hydrolase 1, microsomal (xenobiotic)	240					aromatic compound catabolic process (GO:0019439)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cis-stilbene-oxide hydrolase activity (GO:0033961)|epoxide hydrolase activity (GO:0004301)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	28	Breast(184;0.197)					CAGCTGGTGCCCAGGTGAGGT	0.557																																																	0													61.0	69.0	66.0					1																	226027044		2203	4300	6503	SO:0001583	missense	2052			J03518	CCDS1547.1	1q42.1	2009-07-10			ENSG00000143819	ENSG00000143819	3.3.2.9		3401	protein-coding gene	gene with protein product		132810		EPHX		9925921	Standard	NM_000120		Approved		uc001hpk.3	P07099	OTTHUMG00000037743	ENST00000366837.4:c.719C>A	1.37:g.226027044C>A	ENSP00000355802:p.Pro240His		B2R8N0|Q5VTJ6|Q9NP75|Q9NPE7|Q9NQU6|Q9NQU7|Q9NQU8|Q9NQU9|Q9NQV0|Q9NQV1|Q9NQV2	Missense_Mutation	SNP	ENST00000366837.4	37	CCDS1547.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.645761	0.87958	.	.	ENSG00000143819	ENST00000272167;ENST00000366837	T;T	0.11821	2.74;2.74	4.69	4.69	0.59074	Alpha/beta hydrolase fold-1 (1);	0.000000	0.85682	D	0.000000	T	0.49762	0.1576	M	0.93808	3.46	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.65861	-0.6065	10	0.87932	D	0	-26.8861	17.9678	0.89105	0.0:1.0:0.0:0.0	.	240	P07099	HYEP_HUMAN	H	240	ENSP00000272167:P240H;ENSP00000355802:P240H	ENSP00000272167:P240H	P	+	2	0	EPHX1	224093667	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.501000	0.81600	2.311000	0.77944	0.591000	0.81541	CCC		0.557	EPHX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092064.1		NM_000120	
EXOC1	55763	hgsc.bcm.edu	37	4	56738088	56738088	+	Silent	SNP	A	A	G			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr4:56738088A>G	ENST00000381295.2	+	8	1386	c.1038A>G	c.(1036-1038)agA>agG	p.R346R	EXOC1_ENST00000346134.7_Silent_p.R346R|EXOC1_ENST00000349598.6_Silent_p.R346R	NM_001024924.1	NP_001020095.1	Q9NV70	EXOC1_HUMAN	exocyst complex component 1	346					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	35	Glioma(25;0.08)|all_neural(26;0.101)					TTGCCCGGAGACTGGCCAGTC	0.398																																																	0													92.0	90.0	91.0					4																	56738088		2203	4300	6503	SO:0001819	synonymous_variant	55763			AK027047	CCDS3502.1, CCDS3503.1	4q12	2013-01-22	2005-11-01	2005-11-01	ENSG00000090989	ENSG00000090989			30380	protein-coding gene	gene with protein product		607879	"""SEC3-like 1 (S. cerevisiae)"""	SEC3L1		11042152, 11406615	Standard	XM_005265747		Approved	SEC3, FLJ10893, BM-102, Sec3p	uc003hbf.1	Q9NV70	OTTHUMG00000102165	ENST00000381295.2:c.1038A>G	4.37:g.56738088A>G			Q504V4|Q8WUE7|Q96T15|Q9NZE4	Silent	SNP	ENST00000381295.2	37	CCDS3502.1																																																																																				0.398	EXOC1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361799.1		NM_018261	
EZH2	2146	hgsc.bcm.edu	37	7	148512045	148512045	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr7:148512045G>A	ENST00000460911.1	-	14	1706	c.1618C>T	c.(1618-1620)Caa>Taa	p.Q540*	EZH2_ENST00000476773.1_Intron|EZH2_ENST00000320356.2_Nonsense_Mutation_p.Q545*|EZH2_ENST00000541220.1_Intron|EZH2_ENST00000350995.2_Nonsense_Mutation_p.Q501*|EZH2_ENST00000478654.1_Intron|EZH2_ENST00000483967.1_Nonsense_Mutation_p.Q531*			Q15910	EZH2_HUMAN	enhancer of zeste 2 polycomb repressive complex 2 subunit	540	CXC. {ECO:0000255|PROSITE- ProRule:PRU00970}.|Cys-rich.				cellular response to hydrogen peroxide (GO:0070301)|cerebellar cortex development (GO:0021695)|chromatin organization (GO:0006325)|DNA methylation (GO:0006306)|G1 to G0 transition (GO:0070314)|histone H3-K27 methylation (GO:0070734)|negative regulation of epidermal cell differentiation (GO:0045605)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|protein localization to chromatin (GO:0071168)|regulation of cell proliferation (GO:0042127)|regulation of circadian rhythm (GO:0042752)|regulation of gliogenesis (GO:0014013)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(313)|kidney(3)|large_intestine(8)|liver(1)|lung(23)|parathyroid(2)|skin(3)|upper_aerodigestive_tract(3)	359	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00239)			CAAAAATTTTGTGCTATCACA	0.388			Mis		DLBCL																																			Rec?	yes		7	7q35-q36	2146	enhancer of zeste homolog 2		L	0													87.0	82.0	84.0					7																	148512045		2203	4300	6503	SO:0001587	stop_gained	2146				CCDS5891.1, CCDS5892.1, CCDS56516.1, CCDS56517.1, CCDS56518.1	7q35-q36	2014-09-17	2014-05-28		ENSG00000106462	ENSG00000106462		"""Chromatin-modifying enzymes / K-methyltransferases"""	3527	protein-coding gene	gene with protein product		601573	"""enhancer of zeste (Drosophila) homolog 2"", ""enhancer of zeste homolog 2 (Drosophila)"""			8954776, 17172412	Standard	NM_152998		Approved	EZH1, ENX-1, KMT6, KMT6A	uc003wfb.2	Q15910	OTTHUMG00000158973	ENST00000460911.1:c.1618C>T	7.37:g.148512045G>A	ENSP00000419711:p.Gln540*		B2RAQ1|B3KS30|B7Z1D6|B7Z7L6|Q15755|Q75MG3|Q92857|Q96FI6	Nonsense_Mutation	SNP	ENST00000460911.1	37	CCDS56516.1	.	.	.	.	.	.	.	.	.	.	g	39	7.316878	0.98207	.	.	ENSG00000106462	ENST00000320356;ENST00000460911;ENST00000350995;ENST00000483967	.	.	.	5.32	5.32	0.75619	.	0.060720	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	.	19.0233	0.92923	0.0:0.0:1.0:0.0	.	.	.	.	X	545;540;501;531	.	ENSP00000320147:Q545X	Q	-	1	0	EZH2	148142978	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.460000	0.97641	2.481000	0.83766	0.563000	0.77884	CAA		0.388	EZH2-008	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352744.1		NM_004456	
PCED1B	91523	hgsc.bcm.edu	37	12	47630058	47630058	+	Silent	SNP	T	T	A			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr12:47630058T>A	ENST00000546455.1	+	4	1943	c.1212T>A	c.(1210-1212)cgT>cgA	p.R404R	RP11-493L12.3_ENST00000547748.1_RNA|PCED1B_ENST00000432328.1_Silent_p.R404R			Q96HM7	PED1B_HUMAN	PC-esterase domain containing 1B	404	Pro-rich.						hydrolase activity (GO:0016787)										GCAGGTATCGTCCCCGTGGCC	0.597																																																	0													70.0	66.0	67.0					12																	47630058		2203	4300	6503	SO:0001819	synonymous_variant	0			BC016154	CCDS8752.1	12q13.11	2012-06-11	2012-06-11	2012-06-11	ENSG00000179715	ENSG00000179715			28255	protein-coding gene	gene with protein product			"""family with sequence similarity 113, member B"""	FAM113B		20056006	Standard	NM_138371		Approved	MGC16044	uc001rpq.3	Q96HM7	OTTHUMG00000169617	ENST00000546455.1:c.1212T>A	12.37:g.47630058T>A			Q96B20	Silent	SNP	ENST00000546455.1	37	CCDS8752.1	.	.	.	.	.	.	.	.	.	.	T	6.744	0.506005	0.12883	.	.	ENSG00000179715	ENST00000330951	.	.	.	4.04	-8.08	0.01094	.	.	.	.	.	T	0.34658	0.0905	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.49934	-0.8886	5	0.87932	D	0	11.4603	6.6992	0.23215	0.4518:0.0:0.3587:0.1895	.	.	.	.	D	248	.	ENSP00000328560:V248D	V	+	2	0	FAM113B	45916325	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-1.880000	0.01627	-2.435000	0.00554	0.533000	0.62120	GTC		0.597	PCED1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405079.1		NM_138371	
FLNB	2317	hgsc.bcm.edu	37	3	58088038	58088038	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr3:58088038G>T	ENST00000295956.4	+	9	1619	c.1454G>T	c.(1453-1455)gGg>gTg	p.G485V	FLNB_ENST00000493452.1_Missense_Mutation_p.G316V|FLNB_ENST00000490882.1_Missense_Mutation_p.G485V|FLNB_ENST00000357272.4_Missense_Mutation_p.G485V|FLNB_ENST00000348383.5_Missense_Mutation_p.G485V|FLNB_ENST00000358537.3_Missense_Mutation_p.G485V|FLNB_ENST00000419752.2_Missense_Mutation_p.G316V|FLNB_ENST00000429972.2_Missense_Mutation_p.G485V	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	485					actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		GCAGGAAGTGGGGAGCTCGGT	0.527																																																	0													150.0	148.0	148.0					3																	58088038		2203	4300	6503	SO:0001583	missense	2317			AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.1454G>T	3.37:g.58088038G>T	ENSP00000295956:p.Gly485Val		B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Missense_Mutation	SNP	ENST00000295956.4	37	CCDS2885.1	.	.	.	.	.	.	.	.	.	.	G	32	5.180606	0.94846	.	.	ENSG00000136068	ENST00000295956;ENST00000490882;ENST00000358537;ENST00000429972;ENST00000348383;ENST00000357272;ENST00000493452;ENST00000419752	D;D;D;D;D;D;D;D	0.93953	-3.32;-3.32;-3.32;-3.32;-3.32;-3.32;-3.32;-3.32	5.43	5.43	0.79202	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.97873	0.9301	H	0.96142	3.775	0.80722	D	1	P;D;D;P;P;P	0.55800	0.847;0.972;0.973;0.932;0.951;0.951	P;D;D;P;P;D	0.65874	0.786;0.939;0.933;0.856;0.864;0.933	D	0.98693	1.0697	10	0.87932	D	0	.	19.5914	0.95514	0.0:0.0:1.0:0.0	.	485;485;316;316;485;485	O75369-2;B2ZZ83;E7EN95;O75369-7;Q60FE7;O75369	.;.;.;.;.;FLNB_HUMAN	V	485;485;485;485;485;485;316;316	ENSP00000295956:G485V;ENSP00000420213:G485V;ENSP00000351339:G485V;ENSP00000415599:G485V;ENSP00000232447:G485V;ENSP00000349819:G485V;ENSP00000418510:G316V;ENSP00000414532:G316V	ENSP00000295956:G485V	G	+	2	0	FLNB	58063078	1.000000	0.71417	0.998000	0.56505	0.942000	0.58702	9.813000	0.99286	2.720000	0.93068	0.591000	0.81541	GGG		0.527	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353569.1		NM_001457	
FLT4	2324	hgsc.bcm.edu;ucsc.edu	37	5	180057623	180057623	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr5:180057623C>T	ENST00000261937.6	-	3	410	c.332G>A	c.(331-333)tGc>tAc	p.C111Y	FLT4_ENST00000393347.3_Missense_Mutation_p.C111Y|FLT4_ENST00000424276.2_5'UTR|FLT4_ENST00000502649.1_Missense_Mutation_p.C111Y	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	111	Ig-like C2-type 1.				blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CTTGTAGTAGCAGACGTAGCT	0.627																																					Colon(97;1075 1466 27033 27547 35871)												0													195.0	149.0	165.0					5																	180057623		2203	4298	6501	SO:0001583	missense	2324			X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.332G>A	5.37:g.180057623C>T	ENSP00000261937:p.Cys111Tyr		A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Missense_Mutation	SNP	ENST00000261937.6	37	CCDS4457.1	.	.	.	.	.	.	.	.	.	.	C	18.20	3.572229	0.65765	.	.	ENSG00000037280	ENST00000261937;ENST00000393347;ENST00000502649	T;T;T	0.55413	0.52;0.52;0.52	4.9	4.9	0.64082	Immunoglobulin subtype (1);Tyrosine-protein kinase, vascular endothelial growth factor receptor (VEGFR), N-terminal (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.76543	0.4002	M	0.85462	2.755	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;0.999	D;D;D;D;D	0.87578	0.998;0.995;0.982;0.996;0.996	T	0.81221	-0.1031	9	0.87932	D	0	.	18.5214	0.90954	0.0:1.0:0.0:0.0	.	111;111;111;111;111	B5A928;B5A927;P35916-3;E9PD35;P35916	.;.;.;.;VGFR3_HUMAN	Y	111	ENSP00000261937:C111Y;ENSP00000377016:C111Y;ENSP00000426057:C111Y	ENSP00000261937:C111Y	C	-	2	0	FLT4	179990229	1.000000	0.71417	0.994000	0.49952	0.537000	0.34900	7.067000	0.76741	2.465000	0.83290	0.456000	0.33151	TGC		0.627	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253527.4			
FRY	10129	hgsc.bcm.edu	37	13	32836597	32836597	+	Silent	SNP	T	T	C			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr13:32836597T>C	ENST00000380250.3	+	53	8260	c.7764T>C	c.(7762-7764)atT>atC	p.I2588I	FRY_ENST00000542859.1_5'Flank	NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	2588						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.I2588I(1)		NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		ATCTGCAGATTTCTGAGGGTT	0.393																																																	1	Substitution - coding silent(1)	lung(1)											85.0	82.0	83.0					13																	32836597		1865	4113	5978	SO:0001819	synonymous_variant	10129			AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.7764T>C	13.37:g.32836597T>C			Q9Y3N6	Silent	SNP	ENST00000380250.3	37	CCDS41875.1																																																																																				0.393	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044405.1		NM_023037	
GNL2	29889	hgsc.bcm.edu	37	1	38056444	38056444	+	Missense_Mutation	SNP	T	T	G	rs112315084		TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr1:38056444T>G	ENST00000373062.3	-	4	345	c.247A>C	c.(247-249)Aac>Cac	p.N83H		NM_013285.2	NP_037417.1	Q13823	NOG2_HUMAN	guanine nucleotide binding protein-like 2 (nucleolar)	83					GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	30		Myeloproliferative disorder(586;0.0393)				ACACGTGTGTTTCCTGTTTTA	0.353																																																	0													133.0	123.0	126.0					1																	38056444		2203	4300	6503	SO:0001583	missense	29889			L05425	CCDS421.1	1p34	2008-02-05			ENSG00000134697	ENSG00000134697			29925	protein-coding gene	gene with protein product		609365				8822211	Standard	NM_013285		Approved	Ngp-1, HUMAUANTIG	uc001cbk.3	Q13823	OTTHUMG00000004322	ENST00000373062.3:c.247A>C	1.37:g.38056444T>G	ENSP00000362153:p.Asn83His		Q9BWN7	Missense_Mutation	SNP	ENST00000373062.3	37	CCDS421.1	.	.	.	.	.	.	.	.	.	.	T	28.0	4.885112	0.91814	.	.	ENSG00000134697	ENST00000373062	T	0.50813	0.73	5.76	5.76	0.90799	Nucleolar GTPase, NGP1-type (1);	0.000000	0.85682	D	0.000000	T	0.79106	0.4390	H	0.96208	3.785	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	D	0.86083	0.1545	10	0.87932	D	0	-31.2344	16.0659	0.80870	0.0:0.0:0.0:1.0	.	83;83	Q5T0F3;Q13823	.;NOG2_HUMAN	H	83	ENSP00000362153:N83H	ENSP00000362153:N83H	N	-	1	0	GNL2	37829031	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.952000	0.87827	2.209000	0.71365	0.533000	0.62120	AAC		0.353	GNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012478.1		NM_013285	
GPR113	165082	hgsc.bcm.edu	37	2	26540932	26540932	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr2:26540932C>T	ENST00000311519.1	-	2	237	c.238G>A	c.(238-240)Ggc>Agc	p.G80S	GPR113_ENST00000421160.2_Intron|GPR113_ENST00000541401.1_Intron|GPR113_ENST00000459892.1_Intron|GPR113_ENST00000333478.6_Intron	NM_001145168.1	NP_001138640.1	Q8IZF5	GP113_HUMAN	G protein-coupled receptor 113	80					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATTGTCTGGCCCTTGGGCCAT	0.587																																																	0													55.0	57.0	57.0					2																	26540932		692	1591	2283	SO:0001583	missense	165082			AB083619	CCDS33159.2, CCDS46238.1, CCDS46239.1	2p24.1	2014-08-08			ENSG00000173567	ENSG00000173567		"""-"", ""GPCR / Class B : Orphans"""	18989	protein-coding gene	gene with protein product						12435584	Standard	NM_153835		Approved	hGPCR37, PGR23	uc002rhe.4	Q8IZF5	OTTHUMG00000150225	ENST00000311519.1:c.238G>A	2.37:g.26540932C>T	ENSP00000307831:p.Gly80Ser		B4DF15|E9PEV1|Q53TA5|Q6UXT7|Q6UXX3|Q86SL7|Q8IXD8|Q8TDT3	Missense_Mutation	SNP	ENST00000311519.1	37	CCDS46239.1	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.763429	0.00651	.	.	ENSG00000173567	ENST00000311519	T	0.34667	1.35	0.645	-0.32	0.12721	.	.	.	.	.	T	0.15176	0.0366	N	0.08118	0	0.09310	N	1	B	0.13145	0.007	B	0.06405	0.002	T	0.26467	-1.0102	8	0.22109	T	0.4	.	.	.	.	.	80	Q8IZF5	GP113_HUMAN	S	80	ENSP00000307831:G80S	ENSP00000307831:G80S	G	-	1	0	GPR113	26394436	0.000000	0.05858	0.001000	0.08648	0.050000	0.14768	-2.166000	0.01273	-0.199000	0.10317	-0.657000	0.03884	GGC		0.587	GPR113-004	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000316892.1		NM_153835	
GPR98	84059	hgsc.bcm.edu;ucsc.edu	37	5	90144583	90144583	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr5:90144583G>A	ENST00000405460.2	+	79	17245	c.17149G>A	c.(17149-17151)Gag>Aag	p.E5717K	GPR98_ENST00000425867.2_Missense_Mutation_p.E1378K	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	5717					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TGAAGTGACTGAGAATTTTGC	0.388																																																	0													105.0	98.0	100.0					5																	90144583		1834	4088	5922	SO:0001583	missense	84059			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.17149G>A	5.37:g.90144583G>A	ENSP00000384582:p.Glu5717Lys		O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	G	36	5.958734	0.97145	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000425867	T;T	0.36157	1.27;1.33	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.58380	0.2118	L	0.54323	1.7	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.996;0.996;0.998	T	0.49437	-0.8940	9	.	.	.	.	20.3931	0.98965	0.0:0.0:1.0:0.0	.	1378;5717;1378	E7EML1;Q8WXG9;Q8WXG9-2	.;GPR98_HUMAN;.	K	5717;5717;1378	ENSP00000384582:E5717K;ENSP00000392618:E1378K	.	E	+	1	0	GPR98	90180339	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.085000	0.94083	2.824000	0.97209	0.655000	0.94253	GAG		0.388	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2		NM_032119	
GTF2H1	2965	hgsc.bcm.edu	37	11	18359819	18359819	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr11:18359819C>A	ENST00000265963.4	+	4	671	c.511C>A	c.(511-513)Ctg>Atg	p.L171M	GTF2H1_ENST00000534641.1_Missense_Mutation_p.L55M|GTF2H1_ENST00000453096.2_Missense_Mutation_p.L171M|GTF2H1_ENST00000524753.4_5'UTR	NM_005316.3	NP_005307.1	P32780	TF2H1_HUMAN	general transcription factor IIH, polypeptide 1, 62kDa	171					7-methylguanosine mRNA capping (GO:0006370)|ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|gene expression (GO:0010467)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	core TFIIH complex (GO:0000439)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	20						TGCTGCATTTCTGGTATGTGA	0.368								Nucleotide excision repair (NER)																																									0													125.0	115.0	119.0					11																	18359819		2199	4293	6492	SO:0001583	missense	2965				CCDS7838.1	11p15.1-p14	2012-11-05	2002-08-29		ENSG00000110768	ENSG00000110768		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	4655	protein-coding gene	gene with protein product		189972	"""general transcription factor IIH, polypeptide 1 (62kD subunit)"""			1529339, 8162052	Standard	NM_005316		Approved	BTF2, P62, TFIIH	uc001moh.2	P32780	OTTHUMG00000167690	ENST00000265963.4:c.511C>A	11.37:g.18359819C>A	ENSP00000265963:p.Leu171Met		B3KXE0|D3DQY2|Q6I9Y7|Q9H5K5|Q9NQD9	Missense_Mutation	SNP	ENST00000265963.4	37	CCDS7838.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.085879	0.76642	.	.	ENSG00000110768	ENST00000453096;ENST00000534641;ENST00000265963	T;T;T	0.38887	1.11;1.18;1.11	5.66	3.8	0.43715	.	0.000000	0.85682	D	0.000000	T	0.67021	0.2849	M	0.87617	2.895	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.71434	-0.4594	10	0.72032	D	0.01	-7.8362	12.0073	0.53268	0.0:0.8607:0.0:0.1393	.	171	P32780	TF2H1_HUMAN	M	171;55;171	ENSP00000393638:L171M;ENSP00000435375:L55M;ENSP00000265963:L171M	ENSP00000265963:L171M	L	+	1	2	GTF2H1	18316395	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.612000	0.61169	0.768000	0.33290	0.650000	0.86243	CTG		0.368	GTF2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395627.2		NM_005316	
GRAMD1B	57476	hgsc.bcm.edu	37	11	123477468	123477468	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr11:123477468C>A	ENST00000529750.1	+	10	1373	c.1046C>A	c.(1045-1047)cCc>cAc	p.P349H	GRAMD1B_ENST00000456860.2_Missense_Mutation_p.P356H|GRAMD1B_ENST00000450171.2_5'Flank|GRAMD1B_ENST00000322282.7_Missense_Mutation_p.P349H	NM_020716.1	NP_065767.1	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B	349						integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		GAGGACATCCCCACTGAGCTC	0.498																																																	0													67.0	68.0	68.0					11																	123477468		2007	4170	6177	SO:0001583	missense	57476			AB033027	CCDS53720.1, CCDS66253.1, CCDS66254.1	11q24.1	2005-11-02				ENSG00000023171			29214	protein-coding gene	gene with protein product						10574462	Standard	NM_001286564		Approved	KIAA1201	uc001pyx.2	Q3KR37		ENST00000529750.1:c.1046C>A	11.37:g.123477468C>A	ENSP00000436500:p.Pro349His		Q6UW85|Q9ULL9	Missense_Mutation	SNP	ENST00000529750.1	37	CCDS53720.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.333067	0.81801	.	.	ENSG00000023171	ENST00000539133;ENST00000456860;ENST00000322282;ENST00000529750;ENST00000529432;ENST00000534764	T;T;T;T;T	0.35605	1.71;1.71;1.71;1.72;1.3	5.25	4.33	0.51752	.	0.000000	0.85682	D	0.000000	T	0.55625	0.1932	L	0.56769	1.78	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.984;0.999;0.998;0.99	T	0.58634	-0.7602	10	0.66056	D	0.02	.	13.9513	0.64118	0.0:0.9264:0.0:0.0736	.	309;356;349;356	B7Z4N9;F5H572;Q3KR37;E7EPH8	.;.;GRM1B_HUMAN;.	H	356;356;349;349;309;345	ENSP00000402457:P356H;ENSP00000325628:P349H;ENSP00000436500:P349H;ENSP00000432987:P309H;ENSP00000434214:P345H	ENSP00000325628:P349H	P	+	2	0	GRAMD1B	122982678	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	7.755000	0.85180	1.200000	0.43188	0.462000	0.41574	CCC		0.498	GRAMD1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387404.2		XM_370660	
HDAC11	79885	hgsc.bcm.edu;ucsc.edu	37	3	13522780	13522780	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr3:13522780G>C	ENST00000295757.3	+	2	220	c.37G>C	c.(37-39)Gag>Cag	p.E13Q	HDAC11_ENST00000437379.2_5'UTR|HDAC11_ENST00000446613.2_5'UTR|HDAC11_ENST00000404548.1_Missense_Mutation_p.E13Q|HDAC11-AS1_ENST00000424112.2_RNA|HDAC11_ENST00000522202.1_5'UTR|HDAC11_ENST00000433119.1_5'UTR|HDAC11_ENST00000402271.1_Missense_Mutation_p.E13Q|HDAC11_ENST00000405025.1_5'UTR|HDAC11_ENST00000404040.1_Missense_Mutation_p.E13Q|HDAC11_ENST00000402259.1_Missense_Mutation_p.E13Q	NM_024827.3	NP_079103.2	Q96DB2	HDA11_HUMAN	histone deacetylase 11	13					chromatin modification (GO:0016568)|histone deacetylation (GO:0016575)|oligodendrocyte development (GO:0014003)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone deacetylase activity (GO:0004407)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|transcription factor binding (GO:0008134)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(4)|prostate(3)	13						GCATGTGCCAGAGACACGCTG	0.577																																																	0													113.0	92.0	99.0					3																	13522780		2203	4300	6503	SO:0001583	missense	79885			AK025426	CCDS2615.1, CCDS46760.1	3p25.1	2008-07-18			ENSG00000163517	ENSG00000163517	3.5.1.98		19086	protein-coding gene	gene with protein product		607226				11948178	Standard	NM_001136041		Approved		uc003bxy.3	Q96DB2	OTTHUMG00000129800	ENST00000295757.3:c.37G>C	3.37:g.13522780G>C	ENSP00000295757:p.Glu13Gln		B4DDK1|Q9H6I7|Q9H6X3|Q9NTC9	Missense_Mutation	SNP	ENST00000295757.3	37	CCDS2615.1	.	.	.	.	.	.	.	.	.	.	G	10.82	1.457736	0.26161	.	.	ENSG00000163517	ENST00000295757;ENST00000402259;ENST00000402271;ENST00000404548;ENST00000404040;ENST00000458642;ENST00000418189;ENST00000434848	T;T;T;T	0.72505	-0.64;0.9;-0.66;-0.08	5.28	3.33	0.38152	Histone deacetylase domain (1);	0.614285	0.16205	N	0.224730	T	0.47525	0.1450	N	0.12182	0.205	0.09310	N	0.999997	B	0.06786	0.001	B	0.06405	0.002	T	0.30031	-0.9992	10	0.87932	D	0	-5.8697	3.9433	0.09338	0.0898:0.1586:0.5878:0.1638	.	13	Q96DB2	HDA11_HUMAN	Q	13;13;13;13;13;13;32;32	ENSP00000295757:E13Q;ENSP00000384706:E13Q;ENSP00000384123:E13Q;ENSP00000385475:E13Q	ENSP00000295757:E13Q	E	+	1	0	HDAC11	13497780	0.000000	0.05858	0.893000	0.35052	0.994000	0.84299	0.028000	0.13644	2.479000	0.83701	0.655000	0.94253	GAG		0.577	HDAC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252028.5		NM_024827	
HERC1	8925	hgsc.bcm.edu	37	15	63932415	63932415	+	Missense_Mutation	SNP	A	A	G	rs555948391		TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr15:63932415A>G	ENST00000443617.2	-	61	11924	c.11837T>C	c.(11836-11838)tTt>tCt	p.F3946S		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	3946					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						AGATTCTGGAAACTGGGCTCC	0.448																																																	0													124.0	125.0	125.0					15																	63932415		1886	4102	5988	SO:0001583	missense	8925			U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.11837T>C	15.37:g.63932415A>G	ENSP00000390158:p.Phe3946Ser		Q8IW65	Missense_Mutation	SNP	ENST00000443617.2	37	CCDS45277.1	.	.	.	.	.	.	.	.	.	.	A	27.0	4.788426	0.90367	.	.	ENSG00000103657	ENST00000443617	T	0.27256	1.68	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.48352	0.1495	L	0.59436	1.845	0.80722	D	1	D	0.65815	0.995	D	0.72982	0.979	T	0.47861	-0.9084	10	0.87932	D	0	.	15.9998	0.80285	1.0:0.0:0.0:0.0	.	3946	Q15751	HERC1_HUMAN	S	3946	ENSP00000390158:F3946S	ENSP00000390158:F3946S	F	-	2	0	HERC1	61719468	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.189000	0.69895	0.533000	0.62120	TTT		0.448	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1		NM_003922	
HEXDC	284004	hgsc.bcm.edu	37	17	80391635	80391635	+	Silent	SNP	C	C	A			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr17:80391635C>A	ENST00000327949.9	+	4	395	c.384C>A	c.(382-384)gcC>gcA	p.A128A	HEXDC_ENST00000337014.6_Silent_p.A128A|HEXDC_ENST00000577944.1_Silent_p.A128A			Q8WVB3	HEXDC_HUMAN	hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing	128					carbohydrate metabolic process (GO:0005975)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	beta-N-acetylhexosaminidase activity (GO:0004563)			breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	16	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			TGGTGGGCGCCATGATTGACC	0.657																																																	0													37.0	41.0	40.0					17																	80391635		1940	4134	6074	SO:0001819	synonymous_variant	284004			AK074405	CCDS42402.1	17q25.3	2011-12-19			ENSG00000169660	ENSG00000169660			26307	protein-coding gene	gene with protein product						12477932	Standard	NM_173620		Approved	FLJ23825	uc002kev.4	Q8WVB3		ENST00000327949.9:c.384C>A	17.37:g.80391635C>A			B7UUP6|Q8IYN4|Q8TE81	Silent	SNP	ENST00000327949.9	37																																																																																					0.657	HEXDC-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000443513.1		NM_173620	
HSPA14	51182	hgsc.bcm.edu;ucsc.edu	37	10	14893312	14893312	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr10:14893312A>T	ENST00000378372.3	+	7	801	c.562A>T	c.(562-564)Act>Tct	p.T188S		NM_016299.2	NP_057383.2	Q0VDF9	HSP7E_HUMAN	heat shock 70kDa protein 14	188					'de novo' cotranslational protein folding (GO:0051083)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)			breast(4)|endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)	17						AGACTCCCCTACTGGAAAAAG	0.353																																																	0													117.0	116.0	117.0					10																	14893312		2203	4300	6503	SO:0001583	missense	51182			AF112210	CCDS7103.1, CCDS60487.1	10p13	2011-09-02			ENSG00000187522	ENSG00000187522		"""Heat shock proteins / HSP70"""	29526	protein-coding gene	gene with protein product		610369				12477932	Standard	NM_016299		Approved	HSP70-4, HSP70L1	uc001ind.4	Q0VDF9	OTTHUMG00000017712	ENST00000378372.3:c.562A>T	10.37:g.14893312A>T	ENSP00000367623:p.Thr188Ser		A8K8F8|B0YIY9|Q9P0X2|Q9UI07	Missense_Mutation	SNP	ENST00000378372.3	37	CCDS7103.1	.	.	.	.	.	.	.	.	.	.	A	9.342	1.063220	0.19987	.	.	ENSG00000187522	ENST00000378372	T	0.01209	5.17	5.62	4.49	0.54785	.	0.200560	0.48286	D	0.000194	T	0.00815	0.0027	N	0.05306	-0.075	0.80722	D	1	B	0.06786	0.001	B	0.12837	0.008	T	0.63611	-0.6598	10	0.21014	T	0.42	-10.0098	11.3641	0.49662	0.9291:0.0:0.0709:0.0	.	188	Q0VDF9	HSP7E_HUMAN	S	188	ENSP00000367623:T188S	ENSP00000367623:T188S	T	+	1	0	HSPA14	14933318	0.672000	0.27530	1.000000	0.80357	0.934000	0.57294	1.067000	0.30616	0.951000	0.37770	0.528000	0.53228	ACT		0.353	HSPA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046910.1		NM_016299	
HSPA1L	3305	hgsc.bcm.edu	37	6	31778695	31778695	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr6:31778695A>G	ENST00000375654.4	-	2	1244	c.1055T>C	c.(1054-1056)cTt>cCt	p.L352P	HSPA1L_ENST00000417199.3_Missense_Mutation_p.L352P	NM_005527.3	NP_005518.3	P34931	HS71L_HUMAN	heat shock 70kDa protein 1-like	352					binding of sperm to zona pellucida (GO:0007339)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|pleura(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						GTAGTCCTGAAGCAGCCGCTG	0.532																																																	0													56.0	55.0	55.0					6																	31778695		2203	4300	6503	SO:0001583	missense	3305			D85730	CCDS34413.1	6p21.3	2014-01-21	2002-08-29		ENSG00000204390	ENSG00000204390		"""Heat shock proteins / HSP70"""	5234	protein-coding gene	gene with protein product		140559	"""heat shock 70kD protein-like 1"""			9685725, 9349405	Standard	NM_005527		Approved	HSP70-HOM, hum70t	uc003nxh.3	P34931	OTTHUMG00000031208	ENST00000375654.4:c.1055T>C	6.37:g.31778695A>G	ENSP00000364805:p.Leu352Pro		A6NNB0|B0UXW8|O75634|Q2HXR3|Q8NE72|Q96QC9|Q9UQM1	Missense_Mutation	SNP	ENST00000375654.4	37	CCDS34413.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.00|14.00	2.404082|2.404082	0.42613|0.42613	.|.	.|.	ENSG00000204390|ENSG00000204390	ENST00000424494|ENST00000375654;ENST00000417199;ENST00000375653	.|T;T	.|0.01185	.|5.21;5.21	5.4|5.4	4.22|4.22	0.49857|0.49857	.|.	.|0.000000	.|0.29376	.|N	.|0.012334	T|T	0.07999|0.07999	0.0200|0.0200	H|H	0.98849|0.98849	4.35|4.35	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	T|T	0.01476|0.01476	-1.1345|-1.1345	6|10	0.15952|0.87932	T|D	0.53|0	-10.0156|-10.0156	10.7426|10.7426	0.46162|0.46162	0.84:0.1599:0.0:0.0|0.84:0.1599:0.0:0.0	.|.	.|352	.|P34931	.|HS71L_HUMAN	L|P	224|352;352;297	.|ENSP00000364805:L352P;ENSP00000387691:L352P	ENSP00000405825:F224L|ENSP00000364804:L297P	F|L	-|-	1|2	0|0	HSPA1L|HSPA1L	31886674|31886674	1.000000|1.000000	0.71417|0.71417	0.972000|0.972000	0.41901|0.41901	0.633000|0.633000	0.38033|0.38033	9.139000|9.139000	0.94554|0.94554	1.047000|1.047000	0.40274|0.40274	-0.449000|-0.449000	0.05564|0.05564	TTC|CTT		0.532	HSPA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076416.2			
ITGA10	8515	hgsc.bcm.edu	37	1	145532550	145532550	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr1:145532550T>C	ENST00000369304.3	+	9	1178	c.1003T>C	c.(1003-1005)Ttc>Ctc	p.F335L	ITGA10_ENST00000539363.1_Missense_Mutation_p.F192L|ITGA10_ENST00000538811.1_Missense_Mutation_p.F204L|ITGA10_ENST00000481236.1_3'UTR	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	335	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GCGATTCTTTTTCAATGTCAC	0.483																																																	0													147.0	141.0	143.0					1																	145532550		2203	4300	6503	SO:0001583	missense	8515			AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.1003T>C	1.37:g.145532550T>C	ENSP00000358310:p.Phe335Leu		B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Missense_Mutation	SNP	ENST00000369304.3	37	CCDS918.1	.	.	.	.	.	.	.	.	.	.	T	27.7	4.855926	0.91355	.	.	ENSG00000143127	ENST00000369304;ENST00000543043;ENST00000539363;ENST00000538811	D;D;D	0.86297	-2.1;-2.1;-2.1	5.27	5.27	0.74061	von Willebrand factor, type A (3);	0.125587	0.52532	D	0.000066	D	0.90796	0.7110	M	0.69185	2.1	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;0.997;0.999;1.0	D;D;D;D	0.97110	0.999;0.966;0.991;1.0	D	0.92141	0.5720	10	0.87932	D	0	.	13.4487	0.61158	0.0:0.0:0.0:1.0	.	301;204;192;335	F5H3T9;F5GY13;B2RTV5;O75578	.;.;.;ITA10_HUMAN	L	335;301;192;204	ENSP00000358310:F335L;ENSP00000439894:F192L;ENSP00000440011:F204L	ENSP00000358310:F335L	F	+	1	0	ITGA10	144243907	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.541000	0.82084	2.143000	0.66587	0.459000	0.35465	TTC		0.483	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038537.2		NM_003637	
IL24	11009	hgsc.bcm.edu;ucsc.edu	37	1	207072689	207072689	+	Silent	SNP	G	G	A			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr1:207072689G>A	ENST00000294984.2	+	3	343	c.69G>A	c.(67-69)gcG>gcA	p.A23A	IL24_ENST00000367093.3_Silent_p.A24A|IL24_ENST00000391929.3_Silent_p.A24A|IL24_ENST00000491169.1_Intron	NM_001185156.1|NM_006850.3	NP_001172085.1|NP_006841.1	Q13007	IL24_HUMAN	interleukin 24	23					apoptotic process (GO:0006915)|cellular response to interleukin-4 (GO:0071353)|cellular response to lipopolysaccharide (GO:0071222)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|serine phosphorylation of STAT3 protein (GO:0033136)|wound healing (GO:0042060)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)				endometrium(4)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	12	Breast(84;0.201)					CTTTGCTGGCGACAGCCTCTC	0.577																																																	0													52.0	52.0	52.0					1																	207072689		2203	4300	6503	SO:0001819	synonymous_variant	11009			U16261	CCDS1471.1, CCDS53465.1, CCDS53466.1, CCDS73021.1	1q32	2011-07-15		2001-06-29	ENSG00000162892	ENSG00000162892		"""Interleukins and interleukin receptors"""	11346	protein-coding gene	gene with protein product	"""melanoma differentiation association protein 7"", ""suppression of tumorigenicity 16 (melanoma differentiation)"", ""IL-4-induced secreted protein"""	604136		ST16		8545104, 8799171	Standard	NM_001185156		Approved	mda-7, IL10B, Mob-5, C49A, FISP, IL-24	uc001heu.2	Q13007	OTTHUMG00000036459	ENST00000294984.2:c.69G>A	1.37:g.207072689G>A			Q2YHE5|Q53XZ7|Q5YLN8|Q96DB0|Q96KG4	Silent	SNP	ENST00000294984.2	37	CCDS1471.1																																																																																				0.577	IL24-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000088680.2		NM_006850	
ITGB7	3695	hgsc.bcm.edu	37	12	53586257	53586257	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr12:53586257G>C	ENST00000267082.5	-	14	2243	c.2012C>G	c.(2011-2013)gCc>gGc	p.A671G	ITGB7_ENST00000550743.2_Missense_Mutation_p.A523G|ITGB7_ENST00000422257.3_Missense_Mutation_p.A671G|ITGB7_ENST00000338737.4_Missense_Mutation_p.A523G	NM_000889.1	NP_000880.1	P26010	ITB7_HUMAN	integrin, beta 7	671					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte tethering or rolling (GO:0050901)|multicellular organismal development (GO:0007275)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alpha4-beta7 complex (GO:0034669)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			NS(2)|breast(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						ATTGGTATGGGCACAAGCTGT	0.567																																																	0													117.0	104.0	108.0					12																	53586257		2203	4300	6503	SO:0001583	missense	3695				CCDS8849.1	12q13.1	2010-03-23				ENSG00000139626		"""Integrins"""	6162	protein-coding gene	gene with protein product		147559				2040616	Standard	XM_005268851		Approved		uc001scc.3	P26010		ENST00000267082.5:c.2012C>G	12.37:g.53586257G>C	ENSP00000267082:p.Ala671Gly		Q9UCP7|Q9UCS7	Missense_Mutation	SNP	ENST00000267082.5	37	CCDS8849.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.42|10.42	1.344727|1.344727	0.24426|0.24426	.|.	.|.	ENSG00000139626|ENSG00000139626	ENST00000422257;ENST00000267082;ENST00000338737|ENST00000542497	D;D;D|D	0.90444|0.94793	-1.62;-1.62;-2.67|-3.52	4.3|4.3	4.3|4.3	0.51218|0.51218	Integrin beta subunit, tail (1);|.	0.000000|.	0.42420|.	D|.	0.000707|.	D|D	0.93070|0.93070	0.7794|0.7794	L|L	0.42245|0.42245	1.32|1.32	0.21527|0.21527	N|N	0.999659|0.999659	P|.	0.38504|.	0.634|.	B|.	0.36378|.	0.223|.	D|D	0.87850|0.87850	0.2657|0.2657	10|7	0.22109|0.87932	T|D	0.4|0	.|.	9.9348|9.9348	0.41545|0.41545	0.0:0.0:0.6824:0.3176|0.0:0.0:0.6824:0.3176	.|.	671|.	P26010|.	ITB7_HUMAN|.	G|W	671;671;523|458	ENSP00000408741:A671G;ENSP00000267082:A671G;ENSP00000345501:A523G|ENSP00000437375:C458W	ENSP00000267082:A671G|ENSP00000437375:C458W	A|C	-|-	2|3	0|2	ITGB7|ITGB7	51872524|51872524	0.001000|0.001000	0.12720|0.12720	0.985000|0.985000	0.45067|0.45067	0.976000|0.976000	0.68499|0.68499	0.346000|0.346000	0.19997|0.19997	2.420000|2.420000	0.82092|0.82092	0.561000|0.561000	0.74099|0.74099	GCC|TGC		0.567	ITGB7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405821.2			
KANK4	163782	hgsc.bcm.edu	37	1	62740019	62740019	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr1:62740019A>G	ENST00000371153.4	-	3	1135	c.757T>C	c.(757-759)Tca>Cca	p.S253P	KANK4_ENST00000354381.3_Intron|KANK4_ENST00000371150.1_5'Flank	NM_181712.4	NP_859063.3	Q5T7N3	KANK4_HUMAN	KN motif and ankyrin repeat domains 4	253	Pro-rich.					cytoplasm (GO:0005737)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(49)|ovary(3)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	81						TTCTGGAATGAGAAAGGAGGG	0.552																																																	0													42.0	38.0	39.0					1																	62740019		2203	4300	6503	SO:0001583	missense	163782			AK096259	CCDS620.1	1p31.3	2013-10-11	2008-01-29	2008-01-29	ENSG00000132854	ENSG00000132854		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	27263	protein-coding gene	gene with protein product		614612	"""ankyrin repeat domain 38"""	ANKRD38		17996375, 19554261	Standard	NM_181712		Approved	KIAA0172	uc001dah.4	Q5T7N3	OTTHUMG00000008971	ENST00000371153.4:c.757T>C	1.37:g.62740019A>G	ENSP00000360195:p.Ser253Pro		B1ALP7|Q6P9A0|Q86T71|Q86VE6|Q8NAX3	Missense_Mutation	SNP	ENST00000371153.4	37	CCDS620.1	.	.	.	.	.	.	.	.	.	.	A	11.33	1.606388	0.28623	.	.	ENSG00000132854	ENST00000371153	T	0.47528	0.84	5.27	-1.33	0.09172	.	1.611770	0.04220	N	0.333438	T	0.37156	0.0993	L	0.50333	1.59	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.14090	-1.0485	10	0.34782	T	0.22	-0.4801	1.3882	0.02245	0.2893:0.2788:0.2964:0.1355	.	253	Q5T7N3	KANK4_HUMAN	P	253	ENSP00000360195:S253P	ENSP00000360195:S253P	S	-	1	0	KANK4	62512607	.	.	0.000000	0.03702	0.042000	0.13812	.	.	-0.251000	0.09542	0.379000	0.24179	TCA		0.552	KANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024877.1		NM_181712	
VWA8	23078	hgsc.bcm.edu	37	13	42460952	42460952	+	Silent	SNP	C	C	T	rs138269345		TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr13:42460952C>T	ENST00000379310.3	-	7	899	c.831G>A	c.(829-831)ttG>ttA	p.L277L	VWA8_ENST00000281496.6_Silent_p.L277L	NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	277						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)										TTGAATATAACAACTTAAGTT	0.279																																																	0								C	,	0,4400		0,0,2200	51.0	57.0	55.0		831,831	-1.5	0.0	13	dbSNP_134	55	1,8555	1.2+/-3.3	0,1,4277	no	coding-synonymous,coding-synonymous	KIAA0564	NM_001009814.1,NM_015058.1	,	0,1,6477	TT,TC,CC		0.0117,0.0,0.0077	,	277/1040,277/1906	42460952	1,12955	2200	4278	6478	SO:0001819	synonymous_variant	0			AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.831G>A	13.37:g.42460952C>T			O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	Silent	SNP	ENST00000379310.3	37	CCDS41881.1																																																																																				0.279	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354828.2		NM_015058	
LILRA1	11024	hgsc.bcm.edu	37	19	55106622	55106622	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr19:55106622G>T	ENST00000251372.3	+	5	598	c.416G>T	c.(415-417)gGg>gTg	p.G139V	LILRB1_ENST00000418536.2_Intron|LILRA1_ENST00000473156.1_3'UTR|LILRB1_ENST00000448689.1_Intron|LILRB1_ENST00000396321.2_Intron|LILRA1_ENST00000453777.1_Missense_Mutation_p.G139V	NM_006863.2	NP_006854.1	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1	139	Ig-like C2-type 2.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	47				GBM - Glioblastoma multiforme(193;0.0348)		ACCTCAGGAGGGAACGTGACC	0.542																																																	0													145.0	131.0	136.0					19																	55106622		2203	4300	6503	SO:0001583	missense	11024			AF025530	CCDS12901.1, CCDS62802.1	19q13.4	2013-01-11			ENSG00000104974	ENSG00000104974		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6602	protein-coding gene	gene with protein product		604810				9548455	Standard	NM_006863		Approved	LIR-6, CD85i, LIR6	uc002qgh.2	O75019	OTTHUMG00000065701	ENST00000251372.3:c.416G>T	19.37:g.55106622G>T	ENSP00000251372:p.Gly139Val		O75018|Q3MJA6	Missense_Mutation	SNP	ENST00000251372.3	37	CCDS12901.1	.	.	.	.	.	.	.	.	.	.	G	9.413	1.080981	0.20309	.	.	ENSG00000104974	ENST00000251372;ENST00000453777	T;T	0.00808	5.67;5.67	2.24	-0.287	0.12858	Immunoglobulin-like fold (1);	0.539850	0.16757	N	0.200777	T	0.01558	0.0050	M	0.70108	2.13	0.18873	N	0.999983	D;P	0.61697	0.99;0.558	P;B	0.46275	0.51;0.173	T	0.46498	-0.9187	10	0.54805	T	0.06	.	4.855	0.13555	0.3884:0.0:0.6116:0.0	.	139;139	O75019-2;O75019	.;LIRA1_HUMAN	V	139	ENSP00000251372:G139V;ENSP00000413715:G139V	ENSP00000251372:G139V	G	+	2	0	LILRA1	59798434	0.000000	0.05858	0.006000	0.13384	0.009000	0.06853	-0.109000	0.10840	-0.159000	0.11021	0.194000	0.17425	GGG		0.542	LILRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140807.2		NM_006863	
LPHN3	23284	hgsc.bcm.edu;ucsc.edu	37	4	62935947	62935947	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr4:62935947T>A	ENST00000514591.1	+	25	4060	c.3731T>A	c.(3730-3732)aTa>aAa	p.I1244K	LPHN3_ENST00000507625.1_Missense_Mutation_p.I1303K|RP11-84A1.3_ENST00000506704.1_RNA|LPHN3_ENST00000509896.1_3'UTR|LPHN3_ENST00000508946.1_Missense_Mutation_p.I1287K|LPHN3_ENST00000512091.2_3'UTR|RP11-84A1.3_ENST00000504135.1_RNA|LPHN3_ENST00000506746.1_Missense_Mutation_p.I1346K|LPHN3_ENST00000504896.1_3'UTR|LPHN3_ENST00000511324.1_3'UTR|LPHN3_ENST00000514157.1_3'UTR|LPHN3_ENST00000507164.1_3'UTR|LPHN3_ENST00000508693.1_3'UTR|LPHN3_ENST00000545650.1_Missense_Mutation_p.I1244K|RP11-84A1.3_ENST00000509461.1_RNA|LPHN3_ENST00000514996.1_Missense_Mutation_p.I1278K|LPHN3_ENST00000506700.1_3'UTR|LPHN3_ENST00000506720.1_Missense_Mutation_p.I1355K			Q9HAR2	LPHN3_HUMAN	latrophilin 3	1222					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						GTGCAAATCATAGACCGTGGC	0.458																																																	0													88.0	73.0	78.0					4																	62935947		692	1591	2283	SO:0001583	missense	23284			AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.3731T>A	4.37:g.62935947T>A	ENSP00000422533:p.Ile1244Lys		E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	ENST00000514591.1	37	CCDS54768.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.32|12.32	1.901322|1.901322	0.33535|0.33535	.|.	.|.	ENSG00000150471|ENSG00000150471	ENST00000502815|ENST00000514591;ENST00000545650;ENST00000295349;ENST00000507625;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996	.|T;T;T;T;T;T;T	.|0.71103	.|-0.52;-0.52;-0.54;-0.51;-0.52;-0.52;-0.51	5.12|5.12	5.12|5.12	0.69794|0.69794	.|GPCR, family 2, latrophilin, C-terminal (1);	.|0.128379	.|0.51477	.|D	.|0.000085	T|T	0.61286|0.61286	0.2335|0.2335	L|L	0.44542|0.44542	1.39|1.39	0.80722|0.80722	D|D	1|1	.|P;P	.|0.42203	.|0.773;0.773	.|B;B	.|0.41332	.|0.354;0.354	T|T	0.60994|0.60994	-0.7152|-0.7152	5|10	.|0.06099	.|T	.|0.92	.|.	14.9211|14.9211	0.70838|0.70838	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|1244;1222	.|E9PE04;Q9HAR2	.|.;LPHN3_HUMAN	Q|K	692|1244;1244;1222;1303;1287;1355;1346;1278	.|ENSP00000422533:I1244K;ENSP00000439831:I1244K;ENSP00000421372:I1303K;ENSP00000421627:I1287K;ENSP00000420931:I1355K;ENSP00000425884:I1346K;ENSP00000424258:I1278K	.|ENSP00000295349:I1222K	H|I	+|+	3|2	2|0	LPHN3|LPHN3	62618542|62618542	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	5.881000|5.881000	0.69706|0.69706	1.928000|1.928000	0.55862|0.55862	0.377000|0.377000	0.23210|0.23210	CAT|ATA		0.458	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1			
LRRC1	55227	hgsc.bcm.edu	37	6	53787551	53787551	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr6:53787551A>G	ENST00000370888.1	+	14	1812	c.1535A>G	c.(1534-1536)gAg>gGg	p.E512G	RP3-523E19.2_ENST00000474641.2_RNA	NM_018214.4	NP_060684.4	Q9BTT6	LRRC1_HUMAN	leucine rich repeat containing 1	512						cytoplasm (GO:0005737)|membrane (GO:0016020)				cervix(1)|endometrium(3)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20	Lung NSC(77;0.0147)			BRCA - Breast invasive adenocarcinoma(397;0.0745)		AACAAAAACGAGGTCAATCAT	0.473																																																	0													240.0	245.0	243.0					6																	53787551		1977	4166	6143	SO:0001583	missense	55227			AF332199	CCDS4953.2	6p12.2	2014-07-30	2003-11-19		ENSG00000137269	ENSG00000137269			14307	protein-coding gene	gene with protein product		608195	"""leucine-rich repeat-containing 1"""				Standard	NM_018214		Approved	dJ523E19.1, LANO, FLJ10775, FLJ11834	uc003pcd.1	Q9BTT6	OTTHUMG00000014885	ENST00000370888.1:c.1535A>G	6.37:g.53787551A>G	ENSP00000359925:p.Glu512Gly		Q5TGN3|Q9HAC0|Q9NVF1	Missense_Mutation	SNP	ENST00000370888.1	37	CCDS4953.2	.	.	.	.	.	.	.	.	.	.	A	19.08	3.757841	0.69648	.	.	ENSG00000137269	ENST00000370888	T	0.56444	0.46	5.91	5.91	0.95273	.	0.120820	0.53938	D	0.000042	T	0.31263	0.0791	L	0.40543	1.245	0.80722	D	1	P	0.36282	0.546	B	0.31812	0.136	T	0.31052	-0.9957	10	0.52906	T	0.07	.	15.5324	0.75974	1.0:0.0:0.0:0.0	.	512	Q9BTT6	LRRC1_HUMAN	G	512	ENSP00000359925:E512G	ENSP00000359925:E512G	E	+	2	0	LRRC1	53895510	1.000000	0.71417	1.000000	0.80357	0.752000	0.42762	8.747000	0.91610	2.266000	0.75297	0.533000	0.62120	GAG		0.473	LRRC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040970.2		NM_025168	
LRRIQ1	84125	hgsc.bcm.edu;ucsc.edu	37	12	85439805	85439805	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr12:85439805C>G	ENST00000393217.2	+	5	405	c.344C>G	c.(343-345)tCt>tGt	p.S115C		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	115										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		TAGATATTATCTGAAATAGAA	0.299																																																	0													61.0	61.0	61.0					12																	85439805		2203	4300	6503	SO:0001583	missense	84125			AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.344C>G	12.37:g.85439805C>G	ENSP00000376910:p.Ser115Cys		Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	ENST00000393217.2	37	CCDS41816.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.58|12.58	1.981011|1.981011	0.34942|0.34942	.|.	.|.	ENSG00000133640|ENSG00000133640	ENST00000533414|ENST00000256007;ENST00000378580;ENST00000393212;ENST00000393217	.|T;T	.|0.54479	.|1.37;0.57	4.17|4.17	3.18|3.18	0.36537|0.36537	.|.	.|0.423774	.|0.18070	.|N	.|0.152659	T|T	0.62612|0.62612	0.2442|0.2442	L|L	0.58101|0.58101	1.795|1.795	0.28095|0.28095	N|N	0.931659|0.931659	.|D;D;D	.|0.76494	.|0.999;0.999;0.999	.|D;D;D	.|0.80764	.|0.976;0.994;0.987	T|T	0.52631|0.52631	-0.8550|-0.8550	5|10	.|0.51188	.|T	.|0.08	.|.	6.0741|6.0741	0.19905|0.19905	0.0:0.8573:0.0:0.1427|0.0:0.8573:0.0:0.1427	.|.	.|115;115;115	.|Q96JM4-2;Q96JM4;C9JI57	.|.;LRIQ1_HUMAN;.	V|C	13|115	.|ENSP00000376906:S115C;ENSP00000376910:S115C	.|ENSP00000256007:S115C	L|S	+|+	1|2	2|0	LRRIQ1|LRRIQ1	83963936|83963936	0.997000|0.997000	0.39634|0.39634	1.000000|1.000000	0.80357|0.80357	0.801000|0.801000	0.45260|0.45260	0.651000|0.651000	0.24873|0.24873	2.138000|2.138000	0.66242|0.66242	0.585000|0.585000	0.79938|0.79938	CTG|TCT		0.299	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2		NM_032165	
LRRK1	79705	hgsc.bcm.edu	37	15	101595284	101595284	+	Silent	SNP	C	C	A			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr15:101595284C>A	ENST00000388948.3	+	27	4547	c.4188C>A	c.(4186-4188)tcC>tcA	p.S1396S	LRRK1_ENST00000284395.5_Silent_p.S1393S|RP11-505E24.2_ENST00000559857.1_RNA	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TGGTGTGGTCCCTTGACGTCA	0.537																																																	0													138.0	136.0	137.0					15																	101595284		2053	4190	6243	SO:0001819	synonymous_variant	79705			AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.4188C>A	15.37:g.101595284C>A				Silent	SNP	ENST00000388948.3	37	CCDS42086.1																																																																																				0.537	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2		NM_024652	
MARS2	92935	hgsc.bcm.edu	37	2	198571043	198571043	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr2:198571043C>A	ENST00000282276.6	+	1	957	c.914C>A	c.(913-915)tCt>tAt	p.S305Y	AC011997.1_ENST00000409845.1_Intron	NM_138395.3	NP_612404.1	Q96GW9	SYMM_HUMAN	methionyl-tRNA synthetase 2, mitochondrial	305					cell death (GO:0008219)|gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	22					L-Methionine(DB00134)	CCGGCCACCTCTCATATCATA	0.517																																																	0													80.0	84.0	82.0					2																	198571043		2203	4300	6503	SO:0001583	missense	92935			BC009115	CCDS33358.1	2q33.1	2014-01-30	2007-02-26		ENSG00000247626	ENSG00000247626	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	25133	protein-coding gene	gene with protein product	"""methionine tRNA ligase 2, mitochondrial"""	609728				15274629	Standard	NM_138395		Approved	mtMetRS, SPAX3	uc002uuq.3	Q96GW9	OTTHUMG00000154487	ENST00000282276.6:c.914C>A	2.37:g.198571043C>A	ENSP00000282276:p.Ser305Tyr		A0AVC3|Q76E79|Q8IW62|Q8N7N4	Missense_Mutation	SNP	ENST00000282276.6	37	CCDS33358.1	.	.	.	.	.	.	.	.	.	.	C	0.129	-1.115889	0.01799	.	.	ENSG00000247626	ENST00000282276;ENST00000499940	T	0.44881	0.91	5.26	1.05	0.20165	Aminoacyl-tRNA synthetase, class I (M) (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.379769	0.28821	N	0.014035	T	0.10078	0.0247	N	0.00317	-1.655	0.25526	N	0.987327	B	0.06786	0.001	B	0.04013	0.001	T	0.25502	-1.0130	10	0.45353	T	0.12	-1.4985	4.3351	0.11081	0.1477:0.5028:0.2608:0.0886	.	305	Q96GW9	SYMM_HUMAN	Y	305;232	ENSP00000282276:S305Y	ENSP00000282276:S305Y	S	+	2	0	MARS2	198279288	0.994000	0.37717	0.856000	0.33681	0.997000	0.91878	1.868000	0.39509	0.598000	0.29829	0.655000	0.94253	TCT		0.517	MARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335477.1		NM_138395	
MED13	9969	hgsc.bcm.edu	37	17	60023848	60023848	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr17:60023848A>T	ENST00000397786.2	-	30	6582	c.6506T>A	c.(6505-6507)tTt>tAt	p.F2169Y		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	2169					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						ATTCATAATAAAGTTATATAA	0.398																																																	0													68.0	64.0	66.0					17																	60023848		1861	4098	5959	SO:0001583	missense	9969			AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.6506T>A	17.37:g.60023848A>T	ENSP00000380888:p.Phe2169Tyr		B2RU05|O60334	Missense_Mutation	SNP	ENST00000397786.2	37	CCDS42366.1	.	.	.	.	.	.	.	.	.	.	A	13.69	2.312622	0.40895	.	.	ENSG00000108510	ENST00000397786;ENST00000262436	T	0.74315	-0.83	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.76572	0.4006	N	0.22421	0.69	0.80722	D	1	D	0.57899	0.981	D	0.65010	0.931	T	0.79424	-0.1809	10	0.56958	D	0.05	-17.4997	14.6897	0.69076	1.0:0.0:0.0:0.0	.	2169	Q9UHV7	MED13_HUMAN	Y	2169;2168	ENSP00000380888:F2169Y	ENSP00000262436:F2168Y	F	-	2	0	MED13	57378630	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.859000	0.92264	1.876000	0.54355	0.482000	0.46254	TTT		0.398	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445461.1		NM_005121	
MMS19	64210	hgsc.bcm.edu	37	10	99220744	99220744	+	Silent	SNP	G	G	A	rs559287087		TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr10:99220744G>A	ENST00000438925.2	-	24	2667	c.2332C>T	c.(2332-2334)Cta>Tta	p.L778L	MMS19_ENST00000355839.6_Silent_p.L735L|MMS19_ENST00000370782.2_Silent_p.L778L|MMS19_ENST00000327277.7_Silent_p.S373S|MMS19_ENST00000327238.10_Silent_p.L680L	NM_022362.4	NP_071757.4	Q96T76	MMS19_HUMAN	MMS19 nucleotide excision repair homolog (S. cerevisiae)	778					cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|iron-sulfur cluster assembly (GO:0016226)|nucleotide-excision repair (GO:0006289)|phosphorelay signal transduction system (GO:0000160)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	CIA complex (GO:0097361)|cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|membrane (GO:0016020)|MMXD complex (GO:0071817)|nucleus (GO:0005634)|spindle (GO:0005819)	estrogen receptor binding (GO:0030331)|protein binding, bridging (GO:0030674)|receptor signaling complex scaffold activity (GO:0030159)|transcription coactivator activity (GO:0003713)			endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|stomach(1)	16		Colorectal(252;0.0846)		Epithelial(162;3.33e-10)|all cancers(201;2.74e-08)		GCTAGCTGTAGGAATTCATCC	0.488								Direct reversal of damage					G|||	1	0.000199681	0.0	0.0	5008	,	,		20869	0.0		0.001	False		,,,				2504	0.0																0													28.0	28.0	28.0					10																	99220744		2199	4296	6495	SO:0001819	synonymous_variant	64210			AF007151	CCDS7464.1, CCDS73177.1	10q24-q25	2007-08-15	2007-08-15	2007-08-15	ENSG00000155229	ENSG00000155229			13824	protein-coding gene	gene with protein product	"""MET18 homolog (S. cerevisiae)"""	614777		MMS19L		11071939	Standard	NM_022362		Approved	MET18, hMMS19	uc001kns.4	Q96T76	OTTHUMG00000018857	ENST00000438925.2:c.2332C>T	10.37:g.99220744G>A			B0QZ75|B3KPE5|B4DQX2|B4E2I3|D3DR55|F8W9Y2|Q17RZ8|Q5T455|Q66K82|Q7L4W8|Q969Z1|Q96DF1|Q96MR1|Q96RK5|Q96SK1|Q9BUE2|Q9BYS9	Silent	SNP	ENST00000438925.2	37	CCDS7464.1																																																																																				0.488	MMS19-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049706.2			
MKI67	4288	hgsc.bcm.edu	37	10	129903530	129903530	+	Missense_Mutation	SNP	C	C	T	rs139058203		TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr10:129903530C>T	ENST00000368654.3	-	13	6949	c.6574G>A	c.(6574-6576)Gaa>Aaa	p.E2192K	MKI67_ENST00000368653.3_Missense_Mutation_p.E1832K	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	2192	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				GCCAAGTCTTCTAGGGGTTGG	0.493																																																	0													169.0	165.0	167.0					10																	129903530		2203	4300	6503	SO:0001583	missense	4288			X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.6574G>A	10.37:g.129903530C>T	ENSP00000357643:p.Glu2192Lys		Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	37	CCDS7659.1	.	.	.	.	.	.	.	.	.	.	C	17.09	3.300234	0.60195	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	T;T	0.04406	3.63;3.63	4.79	3.89	0.44902	.	0.624595	0.13866	N	0.357331	T	0.18882	0.0453	M	0.77486	2.375	0.44635	D	0.997619	D;D;D	0.89917	0.987;0.999;1.0	P;D;D	0.87578	0.728;0.987;0.998	T	0.04255	-1.0965	10	0.18710	T	0.47	.	11.4488	0.50140	0.0:0.9154:0.0:0.0846	.	2191;1832;2192	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	K	2192;1832;2191	ENSP00000357643:E2192K;ENSP00000357642:E1832K	ENSP00000357642:E1832K	E	-	1	0	MKI67	129793520	0.051000	0.20477	0.352000	0.25734	0.104000	0.19210	3.043000	0.49823	1.155000	0.42497	0.561000	0.74099	GAA		0.493	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1		NM_002417	
MYCBP2	23077	hgsc.bcm.edu;ucsc.edu	37	13	77669615	77669615	+	Silent	SNP	T	T	C			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr13:77669615T>C	ENST00000544440.2	-	58	9980	c.9963A>G	c.(9961-9963)gaA>gaG	p.E3321E	MYCBP2-AS1_ENST00000593933.1_RNA|MYCBP2_ENST00000407578.2_Silent_p.E3359E|MYCBP2_ENST00000482517.1_5'Flank|MYCBP2_ENST00000357337.6_Silent_p.E3321E					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		GAATGCTCGGTTCTGCTGCAC	0.502																																																	0													133.0	122.0	125.0					13																	77669615		2203	4300	6503	SO:0001819	synonymous_variant	23077			AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.9963A>G	13.37:g.77669615T>C				Silent	SNP	ENST00000544440.2	37																																																																																					0.502	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1		NM_015057	
MYOM1	8736	hgsc.bcm.edu;ucsc.edu	37	18	3154964	3154964	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr18:3154964G>T	ENST00000356443.4	-	11	1957	c.1624C>A	c.(1624-1626)Ctc>Atc	p.L542I	MYOM1_ENST00000400569.3_Missense_Mutation_p.L542I|MYOM1_ENST00000261606.7_Missense_Mutation_p.L542I	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	542	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)			NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						AAATATCCGAGAATAGGACTC	0.433																																																	0													63.0	62.0	62.0					18																	3154964		1889	4113	6002	SO:0001583	missense	8736			AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.1624C>A	18.37:g.3154964G>T	ENSP00000348821:p.Leu542Ile		Q14BD6|Q6H969|Q6ZUU0	Missense_Mutation	SNP	ENST00000356443.4	37	CCDS45824.1	.	.	.	.	.	.	.	.	.	.	G	14.04	2.415718	0.42817	.	.	ENSG00000101605	ENST00000356443;ENST00000400569;ENST00000261606	T;T;T	0.58060	0.36;0.36;0.36	5.01	3.22	0.36961	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.347218	0.27735	N	0.018074	T	0.40932	0.1137	N	0.25286	0.73	0.30192	N	0.799388	P;P	0.46142	0.846;0.873	B;P	0.47941	0.426;0.562	T	0.31861	-0.9928	10	0.27785	T	0.31	.	7.6091	0.28120	0.1503:0.1364:0.7133:0.0	.	542;542	P52179-2;P52179	.;MYOM1_HUMAN	I	542	ENSP00000348821:L542I;ENSP00000383413:L542I;ENSP00000261606:L542I	ENSP00000261606:L542I	L	-	1	0	MYOM1	3144964	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	0.819000	0.27308	0.695000	0.31675	0.655000	0.94253	CTC		0.433	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441037.2		NM_003803	
MYO5B	4645	hgsc.bcm.edu;ucsc.edu	37	18	47518664	47518664	+	Silent	SNP	G	G	C			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr18:47518664G>C	ENST00000285039.7	-	6	1049	c.750C>G	c.(748-750)gtC>gtG	p.V250V		NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	250	Myosin motor.				endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)	p.V250V(1)		NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		TCACCTGGAAGACCACTCTGG	0.502																																																	1	Substitution - coding silent(1)	large_intestine(1)											206.0	196.0	199.0					18																	47518664		1952	4147	6099	SO:0001819	synonymous_variant	4645			AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.750C>G	18.37:g.47518664G>C			B0I1R3|Q0P656|Q9H6Y6	Silent	SNP	ENST00000285039.7	37	CCDS42436.1																																																																																				0.502	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448515.2			
NAB1	4664	hgsc.bcm.edu	37	2	191524675	191524675	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr2:191524675G>T	ENST00000337386.5	+	4	1234	c.773G>T	c.(772-774)aGa>aTa	p.R258I	NAB1_ENST00000484774.1_3'UTR|NAB1_ENST00000357215.5_Missense_Mutation_p.R258I|NAB1_ENST00000409641.1_Missense_Mutation_p.R258I|NAB1_ENST00000545490.1_Missense_Mutation_p.R28I|NAB1_ENST00000409581.1_Missense_Mutation_p.R258I	NM_005966.3	NP_005957.2	Q13506	NAB1_HUMAN	NGFI-A binding protein 1 (EGR1 binding protein 1)	258	NCD2.				endochondral ossification (GO:0001958)|myelination (GO:0042552)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of epidermis development (GO:0045682)|regulation of transcription, DNA-templated (GO:0006355)|Schwann cell differentiation (GO:0014037)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				kidney(2)|large_intestine(2)|lung(1)|prostate(1)|skin(1)	7			OV - Ovarian serous cystadenocarcinoma(117;0.00318)|Epithelial(96;0.0405)|all cancers(119;0.109)			ATATATGGCAGATTTGACTCA	0.428																																																	0													79.0	73.0	75.0					2																	191524675		2203	4300	6503	SO:0001583	missense	4664				CCDS2307.1	2q32.3-q33	2008-05-23			ENSG00000138386	ENSG00000138386			7626	protein-coding gene	gene with protein product	"""EGR1 binding protein 1"""	600800				7624335, 8668170, 9418898	Standard	XM_005246579		Approved		uc002usb.3	Q13506	OTTHUMG00000132689	ENST00000337386.5:c.773G>T	2.37:g.191524675G>T	ENSP00000336894:p.Arg258Ile		O75383|O75384|Q6GTU1|Q9UEV1	Missense_Mutation	SNP	ENST00000337386.5	37	CCDS2307.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.5|29.5	5.008759|5.008759	0.93346|0.93346	.|.	.|.	ENSG00000138386|ENSG00000138386	ENST00000434473|ENST00000409581;ENST00000337386;ENST00000357215;ENST00000409641;ENST00000545490	.|.	.|.	.|.	5.51|5.51	5.51|5.51	0.81932|0.81932	.|NAB co-repressor, domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.80592|0.80592	0.4652|0.4652	M|M	0.78049|0.78049	2.395|2.395	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.71674	.|0.98;0.998;0.998	.|D;D;D	.|0.91635	.|0.988;0.999;0.999	T|T	0.81942|0.81942	-0.0702|-0.0702	5|9	.|0.87932	.|D	.|0	-20.8905|-20.8905	18.5908|18.5908	0.91212|0.91212	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|258;258;258	.|F8W8J7;B8ZZS2;Q13506	.|.;.;NAB1_HUMAN	H|I	40|258;258;258;258;28	.|.	.|ENSP00000336894:R258I	Q|R	+|+	3|2	2|0	NAB1|NAB1	191232920|191232920	1.000000|1.000000	0.71417|0.71417	0.969000|0.969000	0.41365|0.41365	0.994000|0.994000	0.84299|0.84299	9.477000|9.477000	0.97925|0.97925	2.873000|2.873000	0.98535|0.98535	0.561000|0.561000	0.74099|0.74099	CAG|AGA		0.428	NAB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255986.1		NM_005966	
NOL4	8715	hgsc.bcm.edu;ucsc.edu	37	18	31538245	31538245	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr18:31538245A>T	ENST00000261592.5	-	7	1491	c.1194T>A	c.(1192-1194)aaT>aaA	p.N398K	NOL4_ENST00000535475.1_Missense_Mutation_p.N243K|NOL4_ENST00000589544.1_Missense_Mutation_p.N398K|NOL4_ENST00000535384.1_Missense_Mutation_p.N113K|NOL4_ENST00000538587.1_Missense_Mutation_p.N324K|NOL4_ENST00000269185.4_Missense_Mutation_p.N284K	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	O94818	NOL4_HUMAN	nucleolar protein 4	398						nucleolus (GO:0005730)	RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	51						CGTCTGTCTCATTAACTTTCT	0.473																																																	0													221.0	189.0	200.0					18																	31538245		2203	4300	6503	SO:0001583	missense	8715			AB017800	CCDS11907.2, CCDS56058.1, CCDS56059.1, CCDS59308.1	18q12	2010-05-04			ENSG00000101746	ENSG00000101746			7870	protein-coding gene	gene with protein product	"""cancer/testis antigen 125"""	603577				9813152	Standard	NM_003787		Approved	NOLP, HRIHFB2255, CT125	uc010dmi.3	O94818	OTTHUMG00000132291	ENST00000261592.5:c.1194T>A	18.37:g.31538245A>T	ENSP00000261592:p.Asn398Lys		B4DSQ0|B7Z3Z7|F5H1E3|Q6IBS2|Q9BWF1	Missense_Mutation	SNP	ENST00000261592.5	37	CCDS11907.2	.	.	.	.	.	.	.	.	.	.	A	15.23	2.772298	0.49680	.	.	ENSG00000101746	ENST00000261592;ENST00000269185;ENST00000399171;ENST00000535384;ENST00000535475;ENST00000538587	T;T	0.79454	-1.27;-1.27	5.5	-2.03	0.07365	.	0.307374	0.31834	N	0.006987	T	0.80270	0.4592	L	0.43152	1.355	0.37806	D	0.927877	D;P;P;B;P;P;B;D	0.71674	0.99;0.763;0.592;0.277;0.634;0.592;0.241;0.998	P;B;B;B;B;B;B;D	0.80764	0.894;0.21;0.322;0.154;0.234;0.322;0.133;0.994	T	0.79235	-0.1887	10	0.56958	D	0.05	-9.8986	11.8411	0.52355	0.8071:0.0:0.1929:0.0	.	284;147;113;324;398;113;398;243	B4DLW2;F8W825;B7Z3Z7;B4DSQ0;O94818;F5H1E3;O94818-2;B3KRF4	.;.;.;.;NOL4_HUMAN;.;.;.	K	398;284;147;113;243;324	ENSP00000445733:N113K;ENSP00000443472:N324K	ENSP00000261592:N398K	N	-	3	2	NOL4	29792243	0.984000	0.35163	0.392000	0.26245	0.899000	0.52679	0.306000	0.19279	-0.296000	0.08947	-0.385000	0.06624	AAT		0.473	NOL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255386.1		NM_003787	
NTNG1	22854	hgsc.bcm.edu	37	1	107867021	107867021	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr1:107867021A>T	ENST00000370068.1	+	3	1210	c.364A>T	c.(364-366)Act>Tct	p.T122S	NTNG1_ENST00000370074.4_Missense_Mutation_p.T122S|NTNG1_ENST00000370061.3_Missense_Mutation_p.T122S|NTNG1_ENST00000370070.2_Missense_Mutation_p.T122S|NTNG1_ENST00000542803.1_Missense_Mutation_p.T122S|NTNG1_ENST00000370073.2_Missense_Mutation_p.T122S|NTNG1_ENST00000370066.1_Missense_Mutation_p.T122S|NTNG1_ENST00000477948.1_3'UTR|NTNG1_ENST00000370071.2_Missense_Mutation_p.T122S|NTNG1_ENST00000370065.1_Missense_Mutation_p.T122S|NTNG1_ENST00000370072.3_Missense_Mutation_p.T122S|NTNG1_ENST00000370067.1_Missense_Mutation_p.T122S			Q9Y2I2	NTNG1_HUMAN	netrin G1	122	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|soft_tissue(1)|urinary_tract(1)	37		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		GCAGTCTGCCACTTGGAAGGA	0.468																																																	0													119.0	122.0	121.0					1																	107867021		2203	4300	6503	SO:0001583	missense	22854			AB023193	CCDS30785.1, CCDS44179.1, CCDS44180.1	1p13.2-p13.1	2013-03-01			ENSG00000162631	ENSG00000162631		"""Netrins"""	23319	protein-coding gene	gene with protein product	"""netrin G1f"", ""Netrin-G1"""	608818				10964959	Standard	NM_001113226		Approved	KIAA0976, Lmnt1	uc001dvh.4	Q9Y2I2	OTTHUMG00000010965	ENST00000370068.1:c.364A>T	1.37:g.107867021A>T	ENSP00000359085:p.Thr122Ser		Q5VU86|Q5VU87|Q5VU89|Q5VU90|Q5VU91|Q7Z2Y3|Q8N633	Missense_Mutation	SNP	ENST00000370068.1	37	CCDS44180.1	.	.	.	.	.	.	.	.	.	.	A	12.06	1.825878	0.32237	.	.	ENSG00000162631	ENST00000370076;ENST00000370073;ENST00000370071;ENST00000542803;ENST00000370061;ENST00000370072;ENST00000370070;ENST00000535584;ENST00000370074;ENST00000370068;ENST00000294649;ENST00000370067;ENST00000370066;ENST00000370065	T;T;T;T;T;T;T;T;T;T;T	0.74947	-0.89;-0.89;-0.89;-0.89;-0.89;-0.89;-0.89;-0.89;-0.89;-0.89;-0.89	5.83	5.83	0.93111	Laminin, N-terminal (3);	0.000000	0.64402	D	0.000006	T	0.47021	0.1423	N	0.13043	0.29	0.50313	D	0.999862	B;B;B;B;B	0.27932	0.025;0.043;0.027;0.006;0.194	B;B;B;B;B	0.35770	0.049;0.027;0.047;0.007;0.21	T	0.51608	-0.8684	10	0.12430	T	0.62	.	16.2015	0.82084	1.0:0.0:0.0:0.0	.	122;122;122;122;122	B4DKF0;Q9Y2I2;Q9Y2I2-4;Q9Y2I2-2;Q9Y2I2-1	.;NTNG1_HUMAN;.;.;.	S	122	ENSP00000359090:T122S;ENSP00000359088:T122S;ENSP00000440561:T122S;ENSP00000359078:T122S;ENSP00000359089:T122S;ENSP00000359087:T122S;ENSP00000359091:T122S;ENSP00000359085:T122S;ENSP00000359084:T122S;ENSP00000359083:T122S;ENSP00000359082:T122S	ENSP00000294649:T122S	T	+	1	0	NTNG1	107668544	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.519000	0.67074	2.230000	0.72887	0.533000	0.62120	ACT		0.468	NTNG1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000030340.1		NM_014917	
NOTCH2	4853	hgsc.bcm.edu;ucsc.edu	37	1	120539837	120539837	+	Silent	SNP	T	T	C	rs1616532	byFrequency	TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr1:120539837T>C	ENST00000256646.2	-	4	753	c.534A>G	c.(532-534)aaA>aaG	p.K178K	NOTCH2_ENST00000602566.1_Silent_p.K139K	NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	178	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		CAGTCTCACATTTCTGCCCTG	0.557			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																															Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	0													118.0	92.0	101.0					1																	120539837		2202	4300	6502	SO:0001819	synonymous_variant	4853	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.534A>G	1.37:g.120539837T>C			Q5T3X7|Q99734|Q9H240	Silent	SNP	ENST00000256646.2	37	CCDS908.1																																																																																				0.557	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1		NM_024408	
ONECUT1	3175	hgsc.bcm.edu	37	15	53049880	53049880	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr15:53049880A>T	ENST00000305901.5	-	2	1397	c.1270T>A	c.(1270-1272)Ttg>Atg	p.L424M	ONECUT1_ENST00000561401.2_5'UTR|ONECUT1_ENST00000560699.2_Silent_p.G64G	NM_004498.2	NP_004489.1	Q9UBC0	HNF6_HUMAN	one cut homeobox 1	424					B cell differentiation (GO:0030183)|cell fate commitment (GO:0045165)|cilium assembly (GO:0042384)|endocrine pancreas development (GO:0031018)|endoderm development (GO:0007492)|epithelial cell development (GO:0002064)|glucose metabolic process (GO:0006006)|liver development (GO:0001889)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)|regulation of transcription, DNA-templated (GO:0006355)|spleen development (GO:0048536)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)|skin(1)	17				all cancers(107;0.0708)		CTCAGCTCCAACCCCAGCTGC	0.493																																																	0													162.0	151.0	155.0					15																	53049880		2194	4293	6487	SO:0001583	missense	3175			U77975	CCDS10150.1	15q21.3	2012-03-09	2007-07-16		ENSG00000169856	ENSG00000169856		"""Homeoboxes / CUT class"""	8138	protein-coding gene	gene with protein product		604164	"""one cut domain, family member 1"""	HNF6, HNF6A		8887657, 8790352	Standard	NM_004498		Approved	HNF-6	uc002aci.2	Q9UBC0	OTTHUMG00000131899	ENST00000305901.5:c.1270T>A	15.37:g.53049880A>T	ENSP00000302630:p.Leu424Met		B2RTV4|Q99744|Q9UMR6	Missense_Mutation	SNP	ENST00000305901.5	37	CCDS10150.1	.	.	.	.	.	.	.	.	.	.	A	15.93	2.979276	0.53827	.	.	ENSG00000169856	ENST00000305901	D	0.98296	-4.85	6.16	1.4	0.22301	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.98648	0.9547	M	0.86178	2.8	0.80722	D	1	P	0.51537	0.946	D	0.77557	0.99	D	0.98237	1.0486	10	0.87932	D	0	-9.1088	8.9906	0.36022	0.6465:0.0:0.3535:0.0	.	424	Q9UBC0	HNF6_HUMAN	M	424	ENSP00000302630:L424M	ENSP00000302630:L424M	L	-	1	2	ONECUT1	50837172	1.000000	0.71417	0.974000	0.42286	0.981000	0.71138	2.779000	0.47734	-0.005000	0.14395	-0.263000	0.10527	TTG		0.493	ONECUT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254849.2			
OR10G7	390265	hgsc.bcm.edu	37	11	123909172	123909172	+	Silent	SNP	G	G	A	rs28414940	byFrequency	TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr11:123909172G>A	ENST00000330487.5	-	1	545	c.537C>T	c.(535-537)gaC>gaT	p.D179D		NM_001004463.1	NP_001004463.1	Q8NGN6	O10G7_HUMAN	olfactory receptor, family 10, subfamily G, member 7	179						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(6)|lung(20)|ovary(2)|prostate(2)|stomach(3)|urinary_tract(1)	47		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		TGGGCGGTGCGTCACAGAAGT	0.542													G|||	1129	0.225439	0.0356	0.2867	5008	,	,		22868	0.3135		0.2823	False		,,,				2504	0.2894																0								G		377,4025	190.9+/-216.7	20,337,1844	210.0	202.0	205.0		537	-3.0	0.6	11	dbSNP_125	205	2604,5990	418.8+/-352.9	359,1886,2052	no	coding-synonymous	OR10G7	NM_001004463.1		379,2223,3896	AA,AG,GG		30.3002,8.5643,22.9378		179/312	123909172	2981,10015	2201	4297	6498	SO:0001819	synonymous_variant	390265			AB065754	CCDS31705.1	11q24.1	2012-08-09			ENSG00000182634	ENSG00000182634		"""GPCR / Class A : Olfactory receptors"""	14842	protein-coding gene	gene with protein product							Standard	NM_001004463		Approved		uc001pzq.1	Q8NGN6	OTTHUMG00000165969	ENST00000330487.5:c.537C>T	11.37:g.123909172G>A			Q6IFE8	Silent	SNP	ENST00000330487.5	37	CCDS31705.1																																																																																				0.542	OR10G7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387271.1		NM_001004463	
P2RX2	22953	hgsc.bcm.edu	37	12	133198303	133198303	+	Silent	SNP	C	C	A			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr12:133198303C>A	ENST00000389110.3	+	11	1198	c.1161C>A	c.(1159-1161)ccC>ccA	p.P387P	P2RX2_ENST00000350048.5_Silent_p.P363P|P2RX2_ENST00000449132.2_Intron|P2RX2_ENST00000351222.4_Silent_p.P295P|P2RX2_ENST00000348800.5_Intron|P2RX2_ENST00000343948.4_Silent_p.P413P|P2RX2_ENST00000352418.4_Silent_p.P315P	NM_170682.2|NM_170683.2|NM_174873.1	NP_733782.1|NP_733783.1|NP_777362.1	Q9UBL9	P2RX2_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 2	387					behavioral response to pain (GO:0048266)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of hypoxic conditions in blood by carotid body chemoreceptor signaling (GO:0003029)|ion transmembrane transport (GO:0034220)|neuromuscular junction development (GO:0007528)|neuromuscular synaptic transmission (GO:0007274)|neuronal action potential (GO:0019228)|peristalsis (GO:0030432)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|response to ATP (GO:0033198)|response to carbohydrate (GO:0009743)|response to hypoxia (GO:0001666)|sensory perception of sound (GO:0007605)|sensory perception of taste (GO:0050909)|skeletal muscle fiber development (GO:0048741)|urinary bladder smooth muscle contraction (GO:0014832)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|dendritic spine (GO:0043197)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|cadmium ion binding (GO:0046870)|cobalt ion binding (GO:0050897)|copper ion binding (GO:0005507)|drug binding (GO:0008144)|extracellular ATP-gated cation channel activity (GO:0004931)|identical protein binding (GO:0042802)|ligand-gated ion channel activity (GO:0015276)|mercury ion binding (GO:0045340)|nickel cation binding (GO:0016151)|phosphatidylinositol binding (GO:0035091)|purinergic nucleotide receptor activity (GO:0001614)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|kidney(2)|large_intestine(2)|liver(2)|lung(8)|ovary(1)|prostate(3)	20	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0767)		OV - Ovarian serous cystadenocarcinoma(86;2.32e-08)|Epithelial(86;8.62e-08)|all cancers(50;4.5e-06)		CGAGCCACCCCTCAGGTAGCT	0.592																																																	0													65.0	64.0	64.0					12																	133198303		2203	4300	6503	SO:0001819	synonymous_variant	22953			AF109387	CCDS31930.1, CCDS31931.1, CCDS31932.1, CCDS31933.1, CCDS31934.1, CCDS31935.1, CCDS61286.1, CCDS73548.1	12q24.33	2013-03-22			ENSG00000187848	ENSG00000187848		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	15459	protein-coding gene	gene with protein product		600844	"""deafness, autosomal dominant 41"""	DFNA41		10570044, 7523952, 23345450	Standard	XM_005266154		Approved	P2X2	uc001ukk.1	Q9UBL9	OTTHUMG00000168018	ENST00000389110.3:c.1161C>A	12.37:g.133198303C>A			A6NGB4|A6NH93|A6NHC2|A6NHU3|A6NIG9|Q6V9R6|Q9NR37|Q9NR38|Q9UHD5|Q9UHD6|Q9UHD7|Q9Y637|Q9Y638	Silent	SNP	ENST00000389110.3	37	CCDS31931.1																																																																																				0.592	P2RX2-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397542.1			
P4HA1	5033	hgsc.bcm.edu;ucsc.edu	37	10	74806681	74806681	+	Splice_Site	SNP	A	A	C			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr10:74806681A>C	ENST00000307116.2	-	8	1194		c.e8+1		P4HA1_ENST00000263556.3_Splice_Site|P4HA1_ENST00000394890.2_Splice_Site|P4HA1_ENST00000412021.2_Splice_Site|P4HA1_ENST00000440381.1_Splice_Site|P4HA1_ENST00000373008.2_Splice_Site			P13674	P4HA1_HUMAN	prolyl 4-hydroxylase, alpha polypeptide I						collagen fibril organization (GO:0030199)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)	endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|procollagen-proline 4-dioxygenase complex (GO:0016222)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|procollagen-proline 4-dioxygenase activity (GO:0004656)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)	15	Prostate(51;0.0198)				Hydralazine(DB01275)|L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	AACATTATTTACCCTTGGTTT	0.323																																					Colon(147;367 2405 2662 52127)												0													87.0	88.0	88.0					10																	74806681		2203	4300	6503	SO:0001630	splice_region_variant	5033				CCDS7320.1, CCDS41537.1, CCDS44432.1	10q21.3-q23.1	2008-12-09	2008-12-09		ENSG00000122884	ENSG00000122884	1.14.11.2		8546	protein-coding gene	gene with protein product	"""collagen prolyl 4-hydroxylase alpha(I)"""	176710	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide I"""	P4HA		2556027	Standard	NM_001017962		Approved	C-P4Halpha(I)	uc001jtg.3	P13674	OTTHUMG00000018449	ENST00000307116.2:c.1077+1T>G	10.37:g.74806681A>C			C9JL12|Q15082|Q15083|Q5VSQ5	Splice_Site	SNP	ENST00000307116.2	37		.	.	.	.	.	.	.	.	.	.	A	24.3	4.516215	0.85495	.	.	ENSG00000122884	ENST00000307116;ENST00000373008;ENST00000412021;ENST00000394890;ENST00000263556;ENST00000440381	.	.	.	5.8	5.8	0.92144	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1382	0.81506	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	P4HA1	74476687	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.938000	0.92943	2.211000	0.71520	0.528000	0.53228	.		0.323	P4HA1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000048601.1		NM_000917	Intron
PHKB	5257	hgsc.bcm.edu;ucsc.edu	37	16	47622841	47622841	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr16:47622841G>A	ENST00000323584.5	+	10	920	c.896G>A	c.(895-897)tGc>tAc	p.C299Y	PHKB_ENST00000299167.8_Missense_Mutation_p.C299Y|PHKB_ENST00000566044.1_Missense_Mutation_p.C292Y|PHKB_ENST00000567402.1_3'UTR|PHKB_ENST00000455779.1_Missense_Mutation_p.C292Y	NM_000293.2	NP_000284.1	Q93100	KPBB_HUMAN	phosphorylase kinase, beta	299					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|liver(1)|lung(18)|ovary(1)|skin(1)	41		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				CTGCTCCCCTGCATCAGTTAT	0.428																																																	0													90.0	85.0	86.0					16																	47622841		2201	4300	6501	SO:0001583	missense	5257				CCDS10729.1, CCDS42161.1	16q12-q13	2009-07-10			ENSG00000102893	ENSG00000102893	2.7.11.19		8927	protein-coding gene	gene with protein product		172490					Standard	NM_000293		Approved		uc002eev.4	Q93100	OTTHUMG00000133102	ENST00000323584.5:c.896G>A	16.37:g.47622841G>A	ENSP00000313504:p.Cys299Tyr		Q8N4T5	Missense_Mutation	SNP	ENST00000323584.5	37	CCDS10729.1	.	.	.	.	.	.	.	.	.	.	G	18.33	3.601315	0.66445	.	.	ENSG00000102893	ENST00000299167;ENST00000455779;ENST00000323584	D;D	0.92752	-3.1;-3.1	5.58	5.58	0.84498	Six-hairpin glycosidase-like (1);Glycoside hydrolase 15-related (1);	0.102879	0.64402	D	0.000001	D	0.92681	0.7674	L	0.51422	1.61	0.80722	D	1	P;P	0.52692	0.951;0.955	P;P	0.49477	0.612;0.566	D	0.93299	0.6675	10	0.87932	D	0	-7.2568	19.5889	0.95499	0.0:0.0:1.0:0.0	.	299;292	Q93100;Q93100-4	KPBB_HUMAN;.	Y	292;292;299	ENSP00000414345:C292Y;ENSP00000313504:C299Y	ENSP00000299167:C292Y	C	+	2	0	PHKB	46180342	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	7.322000	0.79097	2.628000	0.89032	0.585000	0.79938	TGC		0.428	PHKB-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000430413.1			
PIP	5304	hgsc.bcm.edu	37	7	142832380	142832380	+	Silent	SNP	A	A	G			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr7:142832380A>G	ENST00000291009.3	+	2	229	c.189A>G	c.(187-189)aaA>aaG	p.K63K		NM_002652.2	NP_002643.1	P12273	PIP_HUMAN	prolactin-induced protein	63					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|negative regulation of T cell apoptotic process (GO:0070233)|positive regulation of gene expression (GO:0010628)|proteolysis (GO:0006508)|regulation of immune system process (GO:0002682)|retina homeostasis (GO:0001895)	apical plasma membrane (GO:0016324)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	actin binding (GO:0003779)|aspartic-type endopeptidase activity (GO:0004190)|glycoprotein binding (GO:0001948)|IgG binding (GO:0019864)|protein dimerization activity (GO:0046983)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(1)|skin(1)	18	Melanoma(164;0.059)	Ovarian(593;2.82e-05)|Breast(660;0.012)		BRCA - Breast invasive adenocarcinoma(188;0.0026)|LUSC - Lung squamous cell carcinoma(290;0.0733)|Lung(243;0.08)		CAGAATTGAAAGAATGCATGG	0.368																																																	0													56.0	51.0	52.0					7																	142832380		2203	4299	6502	SO:0001819	synonymous_variant	5304				CCDS34768.1	7q34	2013-09-19			ENSG00000159763	ENSG00000159763			8993	protein-coding gene	gene with protein product	"""prolactin-inducible protein"""	176720				2727805, 1955075	Standard	NM_002652		Approved	GCDFP-15, GCDFP15, GPIP4	uc003wcf.1	P12273	OTTHUMG00000152635	ENST00000291009.3:c.189A>G	7.37:g.142832380A>G			A0A963|A0A9C3|A0A9F3|A4D2I1	Silent	SNP	ENST00000291009.3	37	CCDS34768.1																																																																																				0.368	PIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327089.1		NM_002652	
PITRM1	10531	hgsc.bcm.edu;ucsc.edu	37	10	3200259	3200259	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr10:3200259A>G	ENST00000224949.4	-	11	1257	c.1223T>C	c.(1222-1224)aTa>aCa	p.I408T	PITRM1-AS1_ENST00000598280.1_RNA|PITRM1-AS1_ENST00000601046.1_RNA|PITRM1_ENST00000380994.1_5'UTR|PITRM1_ENST00000451104.2_Missense_Mutation_p.I376T|PITRM1_ENST00000380989.2_Missense_Mutation_p.I408T			Q5JRX3	PREP_HUMAN	pitrilysin metallopeptidase 1	408					positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|urinary_tract(3)	33						CGTTCTGTCTATGAGGCTTCT	0.458																																																	0													124.0	117.0	120.0					10																	3200259		1969	4159	6128	SO:0001583	missense	10531			AB029027	CCDS55699.1, CCDS55700.1, CCDS59208.1	10p15.2	2008-07-30	2005-08-17		ENSG00000107959	ENSG00000107959			17663	protein-coding gene	gene with protein product	"""PreP peptidasome"""		"""pitrilysin metalloproteinase 1"""			1036083, 10470851, 16849325	Standard	NM_014889		Approved	MP1, KIAA1104, hMP1, PreP	uc009xhv.2	Q5JRX3	OTTHUMG00000017557	ENST00000224949.4:c.1223T>C	10.37:g.3200259A>G	ENSP00000224949:p.Ile408Thr		B3KMJ6|B4E0J8|C9JSL2|E7ES23|O95204|Q2M2G6|Q4VBR1|Q5JRW7|Q7L5Z7|Q9BSI6|Q9BVJ5|Q9UPP8	Missense_Mutation	SNP	ENST00000224949.4	37	CCDS59208.1	.	.	.	.	.	.	.	.	.	.	a	15.55	2.865330	0.51588	.	.	ENSG00000107959	ENST00000224949;ENST00000380980;ENST00000380989;ENST00000451104	T;T;T	0.10005	2.92;2.92;2.92	5.58	5.58	0.84498	Peptidase M16, C-terminal (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.214718	0.47852	D	0.000216	T	0.44623	0.1302	M	0.93720	3.45	0.22552	N	0.998995	B;B;B;B;B;B	0.33883	0.39;0.403;0.376;0.43;0.43;0.43	B;P;P;P;P;P	0.55455	0.367;0.641;0.667;0.776;0.776;0.776	T	0.45264	-0.9273	10	0.87932	D	0	-10.843	15.7366	0.77849	1.0:0.0:0.0:0.0	.	401;376;408;408;408;401	E9PDX6;E7ES23;Q5JRX3-2;C9JSL2;Q5JRX3;B4DH07	.;.;.;.;PREP_HUMAN;.	T	408;401;408;376	ENSP00000224949:I408T;ENSP00000370377:I408T;ENSP00000401201:I376T	ENSP00000224949:I408T	I	-	2	0	PITRM1	3190259	1.000000	0.71417	0.003000	0.11579	0.012000	0.07955	6.268000	0.72552	2.126000	0.65437	0.460000	0.39030	ATA		0.458	PITRM1-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046469.2			
PLAUR	5329	hgsc.bcm.edu	37	19	44153251	44153251	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr19:44153251A>T	ENST00000340093.3	-	7	1028	c.799T>A	c.(799-801)Tca>Aca	p.S267T	PLAUR_ENST00000601723.1_Missense_Mutation_p.S218T|PLAUR_ENST00000221264.4_Missense_Mutation_p.S222T|PLAUR_ENST00000339082.3_Intron	NM_002659.3	NP_002650.1	Q03405	UPAR_HUMAN	plasminogen activator, urokinase receptor	267	UPAR/Ly6 3.				attachment of GPI anchor to protein (GO:0016255)|blood coagulation (GO:0007596)|C-terminal protein lipidation (GO:0006501)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|chemotaxis (GO:0006935)|fibrinolysis (GO:0042730)|post-translational protein modification (GO:0043687)|regulation of proteolysis (GO:0030162)|signal transduction (GO:0007165)|urokinase plasminogen activator signaling pathway (GO:0038195)	anchored component of membrane (GO:0031225)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|receptor activity (GO:0004872)|urokinase plasminogen activator receptor activity (GO:0030377)			endometrium(1)|kidney(4)|large_intestine(5)|lung(5)|ovary(1)|stomach(1)|urinary_tract(3)	20		Prostate(69;0.0153)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)|Urokinase(DB00013)	TGGCACATTGAGGCGGTTGCA	0.517																																																	0													124.0	112.0	116.0					19																	44153251		2203	4300	6503	SO:0001583	missense	5329				CCDS12628.1, CCDS33041.1, CCDS33042.1, CCDS74386.1	19q13	2012-03-15			ENSG00000011422	ENSG00000011422		"""CD molecules"""	9053	protein-coding gene	gene with protein product	"""urokinase-type plasminogen activator (uPA) receptor"", ""urokinase plasminogen activator surface receptor"""	173391					Standard	NM_002659		Approved	URKR, UPAR, CD87	uc002oxf.2	Q03405		ENST00000340093.3:c.799T>A	19.37:g.44153251A>T	ENSP00000339328:p.Ser267Thr		A8K409|Q12876|Q15845|Q16887|Q6IB52|Q9BWT0|Q9NYC8|Q9UD69|Q9UEA6|Q9UM92|Q9UMV0	Missense_Mutation	SNP	ENST00000340093.3	37	CCDS12628.1	.	.	.	.	.	.	.	.	.	.	A	18.54	3.646855	0.67358	.	.	ENSG00000011422	ENST00000340093;ENST00000221264	T;T	0.71579	-0.58;-0.58	4.09	4.09	0.47781	Ly-6 antigen / uPA receptor -like (1);CD59 antigen, conserved site (1);CD59 antigen (1);	0.470684	0.16080	N	0.230577	D	0.82825	0.5121	M	0.79805	2.47	0.33912	D	0.639816	D;D	0.76494	0.999;0.985	D;D	0.83275	0.996;0.97	D	0.86863	0.2031	10	0.72032	D	0.01	-17.2972	9.7306	0.40359	1.0:0.0:0.0:0.0	.	222;267	Q03405-3;Q03405	.;UPAR_HUMAN	T	267;222	ENSP00000339328:S267T;ENSP00000221264:S222T	ENSP00000221264:S222T	S	-	1	0	PLAUR	48845091	0.846000	0.29590	0.895000	0.35142	0.026000	0.11368	3.484000	0.53201	2.078000	0.62432	0.260000	0.18958	TCA		0.517	PLAUR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463571.1		NM_002659	
PLEKHA5	54477	hgsc.bcm.edu	37	12	19440437	19440437	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr12:19440437C>A	ENST00000299275.6	+	12	1798	c.1792C>A	c.(1792-1794)Cca>Aca	p.P598T	PLEKHA5_ENST00000317589.4_Missense_Mutation_p.P598T|PLEKHA5_ENST00000429027.2_Missense_Mutation_p.P604T|PLEKHA5_ENST00000309364.4_Missense_Mutation_p.P598T|PLEKHA5_ENST00000355397.3_Missense_Mutation_p.P598T|PLEKHA5_ENST00000510738.2_3'UTR|PLEKHA5_ENST00000538714.1_Missense_Mutation_p.P598T|PLEKHA5_ENST00000539256.1_Missense_Mutation_p.P356T|PLEKHA5_ENST00000543806.1_Missense_Mutation_p.P490T|PLEKHA5_ENST00000424268.1_Missense_Mutation_p.P490T|PLEKHA5_ENST00000359180.3_Missense_Mutation_p.P598T	NM_019012.5	NP_061885.2	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A member 5	598					reproductive system development (GO:0061458)	cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					AAGGTCAGTGCCAGCTGGCCT	0.408																																					Pancreas(196;329 2193 11246 14234 19524)												0													114.0	113.0	113.0					12																	19440437		2203	4300	6503	SO:0001583	missense	54477			AF302150	CCDS8682.1, CCDS44840.1, CCDS44840.2, CCDS55809.1, CCDS58213.1, CCDS58214.1	12p12	2013-01-10			ENSG00000052126	ENSG00000052126		"""Pleckstrin homology (PH) domain containing"""	30036	protein-coding gene	gene with protein product		607770				11214970, 11001876	Standard	NM_001143821		Approved	PEPP2, KIAA1686, FLJ10667	uc031qgo.1	Q9HAU0	OTTHUMG00000167921	ENST00000299275.6:c.1792C>A	12.37:g.19440437C>A	ENSP00000299275:p.Pro598Thr		A0JP03|B4DGS1|E9PHQ3|F5H0I0|Q6NSF8|Q86ST7|Q8N3K6|Q96DY9|Q9BVR4|Q9C0H7|Q9H924|Q9NVK8	Missense_Mutation	SNP	ENST00000299275.6	37	CCDS8682.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.790589	0.90367	.	.	ENSG00000052126	ENST00000317589;ENST00000355397;ENST00000359180;ENST00000542828;ENST00000309364;ENST00000429027;ENST00000299275;ENST00000539256;ENST00000538714;ENST00000424268;ENST00000543806;ENST00000536974	T;T;T;T;T;T;T;T;T;T;T	0.61274	2.45;0.12;2.45;2.45;0.12;2.45;2.45;0.12;0.52;0.52;2.45	5.86	5.86	0.93980	.	0.164899	0.56097	D	0.000040	T	0.79287	0.4420	M	0.79926	2.475	0.53688	D	0.999975	D;P;P;D;D;D;P	0.89917	0.996;0.532;0.853;1.0;1.0;0.973;0.849	D;B;P;D;D;P;P	0.91635	0.985;0.376;0.505;0.999;0.998;0.658;0.555	T	0.80372	-0.1410	10	0.72032	D	0.01	-14.9146	20.1859	0.98214	0.0:1.0:0.0:0.0	.	598;490;490;604;604;598;598	Q9HAU0-4;F5H0I0;E7EME8;B4DHK5;E9PHQ3;Q9HAU0;Q9HAU0-2	.;.;.;.;.;PKHA5_HUMAN;.	T	598;598;598;605;598;604;598;356;598;490;490;490	ENSP00000325155:P598T;ENSP00000347560:P598T;ENSP00000352104:P598T;ENSP00000311239:P598T;ENSP00000404296:P604T;ENSP00000299275:P598T;ENSP00000440611:P356T;ENSP00000439673:P598T;ENSP00000400411:P490T;ENSP00000439837:P490T;ENSP00000440371:P490T	ENSP00000299275:P598T	P	+	1	0	PLEKHA5	19331704	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.811000	0.62606	2.777000	0.95525	0.591000	0.81541	CCA		0.408	PLEKHA5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397013.1		NM_019012	
PNMT	5409	hgsc.bcm.edu	37	17	37826360	37826360	+	Silent	SNP	A	A	G			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr17:37826360A>G	ENST00000269582.2	+	3	885	c.567A>G	c.(565-567)ccA>ccG	p.P189P	PNMT_ENST00000394246.1_Silent_p.P91P	NM_002686.3	NP_002677.1	P11086	PNMT_HUMAN	phenylethanolamine N-methyltransferase	189					catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|epinephrine biosynthetic process (GO:0042418)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phenylethanolamine N-methyltransferase activity (GO:0004603)	p.P189P(1)		NS(1)|breast(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	8	all_cancers(6;6.59e-85)|all_epithelial(6;2.89e-103)|Breast(7;1.05e-86)|Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|BRCA - Breast invasive adenocarcinoma(8;3.87e-45)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			CTGTGAGCCCAGATCTTGCCA	0.682																																																	1	Substitution - coding silent(1)	ovary(1)											37.0	37.0	37.0					17																	37826360		2203	4300	6503	SO:0001819	synonymous_variant	5409				CCDS11343.1	17q	2010-04-16			ENSG00000141744	ENSG00000141744	2.1.1.28		9160	protein-coding gene	gene with protein product		171190		PENT		3372503	Standard	NM_002686		Approved		uc002hsi.2	P11086	OTTHUMG00000133209	ENST00000269582.2:c.567A>G	17.37:g.37826360A>G				Silent	SNP	ENST00000269582.2	37	CCDS11343.1																																																																																				0.682	PNMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256923.2		NM_002686	
PNN	5411	hgsc.bcm.edu	37	14	39650383	39650383	+	Silent	SNP	C	C	T			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr14:39650383C>T	ENST00000216832.4	+	9	1537	c.1470C>T	c.(1468-1470)tcC>tcT	p.S490S	PNN_ENST00000557680.1_Intron	NM_002687.3	NP_002678	Q9H307	PININ_HUMAN	pinin, desmosome associated protein	490	Gln-rich.				cell adhesion (GO:0007155)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			breast(2)|endometrium(5)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(2)|stomach(1)	27	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0119)		aatcccagtcccaaccAGTAC	0.517																																																	0													56.0	57.0	57.0					14																	39650383		2203	4300	6503	SO:0001819	synonymous_variant	5411			U77718	CCDS9671.1	14q21.1	2010-07-02			ENSG00000100941	ENSG00000100941			9162	protein-coding gene	gene with protein product		603154				8922384	Standard	NM_002687		Approved	memA	uc001wuw.4	Q9H307	OTTHUMG00000028821	ENST00000216832.4:c.1470C>T	14.37:g.39650383C>T			B4DZX8|O60899|Q53EM7|Q6P5X4|Q7KYL1|Q99738|Q9UHZ9|Q9UQR9	Silent	SNP	ENST00000216832.4	37	CCDS9671.1																																																																																				0.517	PNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276776.2		NM_002687	
PRKAG2	51422	hgsc.bcm.edu;ucsc.edu	37	7	151483611	151483611	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr7:151483611G>A	ENST00000287878.4	-	2	635	c.131C>T	c.(130-132)gCc>gTc	p.A44V	PRKAG2_ENST00000461529.1_5'UTR|PRKAG2_ENST00000392801.2_5'UTR	NM_016203.3	NP_057287.2	Q9UGJ0	AAKG2_HUMAN	protein kinase, AMP-activated, gamma 2 non-catalytic subunit	44					ATP biosynthetic process (GO:0006754)|carnitine shuttle (GO:0006853)|cell cycle arrest (GO:0007050)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|glycogen metabolic process (GO:0005977)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase activity (GO:0045860)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of fatty acid metabolic process (GO:0019217)|regulation of fatty acid oxidation (GO:0046320)|regulation of glucose import (GO:0046324)|regulation of glycolytic process (GO:0006110)|small molecule metabolic process (GO:0044281)|sterol biosynthetic process (GO:0016126)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|ATP binding (GO:0005524)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|phosphorylase kinase regulator activity (GO:0008607)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|upper_aerodigestive_tract(1)	26	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)	Acetylsalicylic acid(DB00945)	GAGCGGCATGGCGAAGGAGCT	0.597																																																	0													79.0	62.0	68.0					7																	151483611		2203	4300	6503	SO:0001583	missense	51422			AF087875	CCDS5928.1, CCDS43683.1, CCDS47752.1	7q35-q36	2014-09-17			ENSG00000106617	ENSG00000106617			9386	protein-coding gene	gene with protein product	"""AMPK gamma2"""	602743				8557660, 8621499	Standard	NM_024429		Approved	AAKG, AAKG2, H91620p, WPWS, CMH6	uc003wkk.3	Q9UGJ0	OTTHUMG00000157324	ENST00000287878.4:c.131C>T	7.37:g.151483611G>A	ENSP00000287878:p.Ala44Val		Q53Y07|Q6NUI0|Q75MP4|Q9NUZ9|Q9UDN8|Q9ULX8	Missense_Mutation	SNP	ENST00000287878.4	37	CCDS5928.1	.	.	.	.	.	.	.	.	.	.	G	19.61	3.859386	0.71834	.	.	ENSG00000106617	ENST00000287878	D	0.87103	-2.21	5.34	5.34	0.76211	.	0.152287	0.43110	D	0.000612	D	0.89234	0.6657	L	0.27053	0.805	0.80722	D	1	D;P	0.71674	0.998;0.689	D;B	0.80764	0.994;0.223	D	0.90536	0.4499	10	0.72032	D	0.01	.	15.8511	0.78930	0.0:0.0:1.0:0.0	.	44;44	Q8NCK6;Q9UGJ0	.;AAKG2_HUMAN	V	44	ENSP00000287878:A44V	ENSP00000287878:A44V	A	-	2	0	PRKAG2	151114544	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	5.746000	0.68681	2.516000	0.84829	0.644000	0.83932	GCC		0.597	PRKAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348440.2		NM_016203	
PSD4	23550	hgsc.bcm.edu	37	2	113942954	113942954	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr2:113942954C>T	ENST00000245796.6	+	4	1381	c.1186C>T	c.(1186-1188)Cct>Tct	p.P396S	PSD4_ENST00000441564.3_Missense_Mutation_p.P396S	NM_012455.2	NP_036587.2	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4	396					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			cervix(1)|endometrium(2)|large_intestine(4)|lung(13)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CTCTCTCAGCCCTGAGGGCTG	0.582																																																	0													93.0	99.0	97.0					2																	113942954		2203	4300	6503	SO:0001583	missense	23550			U63127	CCDS33276.1	2q13	2013-01-10			ENSG00000125637	ENSG00000125637		"""Pleckstrin homology (PH) domain containing"""	19096	protein-coding gene	gene with protein product		614442				12082148	Standard	XM_005263634		Approved	TIC, EFA6B	uc002tjc.3	Q8NDX1	OTTHUMG00000153339	ENST00000245796.6:c.1186C>T	2.37:g.113942954C>T	ENSP00000245796:p.Pro396Ser		A6NEG7|A8K1Y0|O95621|Q4ZG34|Q6GPH8|Q8IYP4	Missense_Mutation	SNP	ENST00000245796.6	37	CCDS33276.1	.	.	.	.	.	.	.	.	.	.	C	9.786	1.176739	0.21704	.	.	ENSG00000125637	ENST00000245796;ENST00000441564	T;T	0.10668	2.94;2.85	3.63	0.584	0.17422	.	1.688070	0.03125	N	0.164288	T	0.07143	0.0181	N	0.19112	0.55	0.09310	N	1	B;B	0.32829	0.386;0.267	B;B	0.31191	0.125;0.059	T	0.33033	-0.9884	10	0.16896	T	0.51	.	5.9837	0.19421	0.3894:0.421:0.1896:0.0	.	396;396	Q8NDX1-2;Q8NDX1	.;PSD4_HUMAN	S	396	ENSP00000245796:P396S;ENSP00000413997:P396S	ENSP00000245796:P396S	P	+	1	0	PSD4	113659425	0.000000	0.05858	0.001000	0.08648	0.140000	0.21249	-0.222000	0.09190	0.099000	0.17552	0.563000	0.77884	CCT		0.582	PSD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330789.1		NM_012455	
PSME3	10197	hgsc.bcm.edu	37	17	40990734	40990734	+	Intron	SNP	G	G	A			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr17:40990734G>A	ENST00000590720.1	+	7	638				PSME3_ENST00000592169.1_Intron|PSME3_ENST00000441946.2_Intron|PSME3_ENST00000541124.1_Intron|PSME3_ENST00000293362.3_Missense_Mutation_p.C144Y|PSME3_ENST00000545225.1_Intron			P61289	PSME3_HUMAN	proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki)						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of endopeptidase activity (GO:0010950)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome activator complex (GO:0008537)|proteasome complex (GO:0000502)	endopeptidase activator activity (GO:0061133)|MDM2/MDM4 family protein binding (GO:0097371)|p53 binding (GO:0002039)			NS(1)|cervix(1)|large_intestine(3)|lung(1)	6		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)		CCTCATATATGTTTTGACCTC	0.453																																																	0													78.0	80.0	79.0					17																	40990734		2203	4300	6503	SO:0001627	intron_variant	10197			U11292	CCDS11442.1, CCDS45689.1, CCDS59290.1	17q12-q21	2004-02-17				ENSG00000131467		"""Proteasome (prosome, macropain) subunits"""	9570	protein-coding gene	gene with protein product		605129				7951316	Standard	NM_005789		Approved	Ki, PA28-gamma, REG-GAMMA, PA28G	uc002ibq.4	P61289		ENST00000590720.1:c.406-14G>A	17.37:g.40990734G>A			A8K9A3|O35563|P97373|Q12920|Q13172|Q9BQD9	Missense_Mutation	SNP	ENST00000590720.1	37	CCDS45689.1	.	.	.	.	.	.	.	.	.	.	G	1.679	-0.506972	0.04231	.	.	ENSG00000131467	ENST00000293362	T	0.21543	2.0	3.61	-5.33	0.02713	.	2.817570	0.01234	N	0.008457	T	0.07188	0.0182	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33979	-0.9847	9	0.02654	T	1	-14.5112	6.311	0.21164	0.6499:0.0:0.205:0.1451	.	144	P61289-2	.	Y	144	ENSP00000293362:C144Y	ENSP00000293362:C144Y	C	+	2	0	PSME3	38244260	.	.	0.000000	0.03702	0.308000	0.27856	.	.	-1.209000	0.02631	-0.140000	0.14226	TGT		0.453	PSME3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452430.1		NM_176863	
RAD50	10111	hgsc.bcm.edu;ucsc.edu	37	5	131973813	131973813	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr5:131973813T>G	ENST00000265335.6	+	23	3903	c.3516T>G	c.(3514-3516)aaT>aaG	p.N1172K	AC004041.2_ENST00000457489.1_RNA|AC004041.2_ENST00000417516.1_RNA|AC004041.2_ENST00000458509.1_RNA|RAD50_ENST00000378823.3_Missense_Mutation_p.N1033K|AC004041.2_ENST00000435042.1_RNA			Q92878	RAD50_HUMAN	RAD50 homolog (S. cerevisiae)	1172					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|reciprocal meiotic recombination (GO:0007131)|regulation of mitotic recombination (GO:0000019)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	membrane (GO:0016020)|Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|nuclease activity (GO:0004518)|protein binding, bridging (GO:0030674)|zinc ion binding (GO:0008270)			breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CCGATGAAAATGTATCAGCTT	0.418								Homologous recombination																																									0													115.0	109.0	111.0					5																	131973813		2203	4300	6503	SO:0001583	missense	10111			Z75311	CCDS34233.1	5q23-q31	2008-05-30	2001-11-28		ENSG00000113522	ENSG00000113522			9816	protein-coding gene	gene with protein product		604040	"""RAD50 (S. cerevisiae) homolog"""			8756642, 9705271	Standard	NM_005732		Approved	hRad50, RAD50-2	uc003kxi.3	Q92878	OTTHUMG00000059613	ENST00000265335.6:c.3516T>G	5.37:g.131973813T>G	ENSP00000265335:p.Asn1172Lys		B9EGF5|O43254|Q6GMT7|Q6P5X3|Q9UP86	Missense_Mutation	SNP	ENST00000265335.6	37	CCDS34233.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.34|16.34	3.095768|3.095768	0.56075|0.56075	.|.	.|.	ENSG00000113522|ENSG00000113522	ENST00000455677|ENST00000378823;ENST00000265335	.|T;T	.|0.03358	.|3.96;3.96	5.95|5.95	-2.42|-2.42	0.06542|0.06542	.|.	.|0.048252	.|0.85682	.|D	.|0.000000	T|T	0.01800|0.01800	0.0057|0.0057	N|N	0.08118|0.08118	0|0	0.39608|0.39608	D|D	0.96984|0.96984	.|B	.|0.16166	.|0.016	.|B	.|0.17098	.|0.017	T|T	0.49753|0.49753	-0.8906|-0.8906	5|10	.|0.05525	.|T	.|0.97	-26.1253|-26.1253	15.4981|15.4981	0.75673|0.75673	0.0:0.6379:0.0:0.3621|0.0:0.6379:0.0:0.3621	.|.	.|1172	.|Q92878	.|RAD50_HUMAN	G|K	51|1033;1172	.|ENSP00000368100:N1033K;ENSP00000265335:N1172K	.|ENSP00000265335:N1172K	C|N	+|+	1|3	0|2	RAD50|RAD50	132001712|132001712	0.326000|0.326000	0.24669|0.24669	0.986000|0.986000	0.45419|0.45419	0.991000|0.991000	0.79684|0.79684	-0.391000|-0.391000	0.07323|0.07323	-0.335000|-0.335000	0.08451|0.08451	-0.256000|-0.256000	0.11100|0.11100	TGT|AAT		0.418	RAD50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132566.5		NM_005732	
RALGDS	5900	hgsc.bcm.edu	37	9	135985694	135985694	+	Silent	SNP	C	C	A			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr9:135985694C>A	ENST00000372050.3	-	3	498	c.477G>T	c.(475-477)ctG>ctT	p.L159L	RALGDS_ENST00000393160.3_Silent_p.L104L|RALGDS_ENST00000393157.3_Silent_p.L158L|RALGDS_ENST00000372062.3_Silent_p.L142L|RALGDS_ENST00000372047.3_Silent_p.L159L|RALGDS_ENST00000542690.1_Silent_p.L230L|RALGDS_ENST00000469972.1_5'Flank	NM_006266.2	NP_006257.1	Q12967	GNDS_HUMAN	ral guanine nucleotide dissociation stimulator	159	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				neurotrophin TRK receptor signaling pathway (GO:0048011)|Ras protein signal transduction (GO:0007265)|regulation of catalytic activity (GO:0050790)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|small GTPase regulator activity (GO:0005083)			endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)	10				OV - Ovarian serous cystadenocarcinoma(145;3.66e-06)|Epithelial(140;2.77e-05)		TTTTGAACAGCAGGTCCAGGA	0.617			T	CIITA	"""PMBL, Hodgkin Lymphona, """																																Melanoma(189;762 2088 15384 21931 52515)			Dom	yes		9	9q34.3	5900	ral guanine nucleotide dissociation stimulator		L	0													107.0	91.0	96.0					9																	135985694		2202	4300	6502	SO:0001819	synonymous_variant	5900			AB037729	CCDS6959.1, CCDS43897.1, CCDS65172.1, CCDS65173.1, CCDS65174.1	9q34.3	2009-04-08			ENSG00000160271	ENSG00000160271			9842	protein-coding gene	gene with protein product		601619				7972015	Standard	NM_006266		Approved	RGF, RalGEF, RGDS	uc004ccr.3	Q12967	OTTHUMG00000020858	ENST00000372050.3:c.477G>T	9.37:g.135985694C>A			B7Z753|E7ER93|E7ERZ0|Q5T7V4|Q6KH11|Q6PCE1|Q6ZSD5|Q9HAX7|Q9HAY1|Q9HCT1|Q9P2N8	Silent	SNP	ENST00000372050.3	37	CCDS6959.1																																																																																				0.617	RALGDS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054837.1		NM_006266	
TRMT10C	54931	hgsc.bcm.edu	37	3	101284157	101284157	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr3:101284157C>A	ENST00000309922.6	+	2	686	c.532C>A	c.(532-534)Cta>Ata	p.L178I		NM_017819.2	NP_060289.2	Q7L0Y3	MRRP1_HUMAN	tRNA methyltransferase 10 homolog C (S. cerevisiae)	178					mitochondrial RNA 5'-end processing (GO:0000964)|tRNA processing (GO:0008033)	mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)										GAAAAACTTTCTATTTTTACG	0.408																																																	0													82.0	78.0	79.0					3																	101284157		1829	4082	5911	SO:0001583	missense	0			AK000439	CCDS43122.1	3q12.3	2012-06-28	2012-06-28	2012-06-28	ENSG00000174173	ENSG00000174173			26022	protein-coding gene	gene with protein product	"""mitochondrial RNase P subunit 1"""	615423	"""RNA (guanine-9-) methyltransferase domain containing 1"""	RG9MTD1		18984158	Standard	NM_017819		Approved	FLJ20432, MRPP1	uc003duz.4	Q7L0Y3	OTTHUMG00000159114	ENST00000309922.6:c.532C>A	3.37:g.101284157C>A	ENSP00000312356:p.Leu178Ile		Q9NRG5|Q9NX54|Q9Y596	Missense_Mutation	SNP	ENST00000309922.6	37	CCDS43122.1	.	.	.	.	.	.	.	.	.	.	C	5.561	0.288436	0.10513	.	.	ENSG00000174173	ENST00000309922;ENST00000495642	T;T	0.23348	2.5;1.91	5.72	1.13	0.20643	.	0.645826	0.14968	N	0.287972	T	0.11153	0.0272	N	0.14661	0.345	0.09310	N	1	B	0.23442	0.085	B	0.17979	0.02	T	0.29336	-1.0015	10	0.19590	T	0.45	-24.9	4.2544	0.10710	0.4104:0.3593:0.0:0.2302	.	178	Q7L0Y3	MRRP1_HUMAN	I	178	ENSP00000312356:L178I;ENSP00000419389:L178I	ENSP00000312356:L178I	L	+	1	2	RG9MTD1	102766847	0.749000	0.28305	0.332000	0.25469	0.456000	0.32438	0.515000	0.22801	0.293000	0.22520	0.655000	0.94253	CTA		0.408	TRMT10C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353400.2		NM_017819	
RLN1	6013	hgsc.bcm.edu	37	9	5339628	5339629	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	AC	AC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr9:5339628_5339629delAC	ENST00000223862.1	-	1	244_245	c.118_119delGT	c.(118-120)gttfs	p.V40fs	RLN1_ENST00000487557.2_5'Flank|RLN1_ENST00000223858.4_Frame_Shift_Del_p.V40fs	NM_006911.2	NP_008842.1	P04808	REL1_HUMAN	relaxin 1	40					female pregnancy (GO:0007565)|signal transduction (GO:0007165)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			large_intestine(1)|lung(4)	5	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.02)|Lung(218;0.0984)		CTGCGCGCGAACTAATTCGCGG	0.51																																																	0																																										SO:0001589	frameshift_variant	6013				CCDS6462.1	9p24.1	2013-02-26	2004-11-15		ENSG00000107018	ENSG00000107018		"""Endogenous ligands"""	10026	protein-coding gene	gene with protein product	"""prorelaxin H1"""	179730	"""relaxin 1 (H1)"""				Standard	NM_006911		Approved	H1	uc003zjb.2	P04808	OTTHUMG00000019495	ENST00000223862.1:c.118_119delGT	9.37:g.5339628_5339629delAC	ENSP00000223862:p.Val40fs		Q99936|Q9UQJ1	Frame_Shift_Del	DEL	ENST00000223862.1	37	CCDS6462.1																																																																																				0.510	RLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051617.1			
RNF123	63891	hgsc.bcm.edu	37	3	49737755	49737755	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr3:49737755G>T	ENST00000327697.6	+	13	1224	c.1080G>T	c.(1078-1080)caG>caT	p.Q360H	RNF123_ENST00000432042.1_Missense_Mutation_p.Q214H	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123	360					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		TGGTGCACCAGGTCCTGGACC	0.607																																																	0													105.0	80.0	88.0					3																	49737755		2203	4300	6503	SO:0001583	missense	63891			AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891	ENST00000327697.6:c.1080G>T	3.37:g.49737755G>T	ENSP00000328287:p.Gln360His		A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Missense_Mutation	SNP	ENST00000327697.6	37	CCDS33758.1	.	.	.	.	.	.	.	.	.	.	G	12.76	2.034803	0.35893	.	.	ENSG00000164068	ENST00000327697;ENST00000389066;ENST00000432042	T;T	0.76448	-0.72;-1.02	5.58	0.684	0.18003	.	0.428062	0.26304	N	0.025155	T	0.52008	0.1708	N	0.08118	0	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.24693	-1.0153	10	0.34782	T	0.22	-16.1031	5.3663	0.16115	0.2799:0.2538:0.4663:0.0	.	214;360	C9J266;Q5XPI4	.;RN123_HUMAN	H	360;360;214	ENSP00000328287:Q360H;ENSP00000392443:Q214H	ENSP00000328287:Q360H	Q	+	3	2	RNF123	49712759	1.000000	0.71417	0.986000	0.45419	0.954000	0.61252	1.417000	0.34770	0.319000	0.23209	-0.136000	0.14681	CAG		0.607	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346475.2		NM_022064	
SCARF1	8578	hgsc.bcm.edu	37	17	1538815	1538815	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr17:1538815G>A	ENST00000263071.4	-	11	1779	c.1730C>T	c.(1729-1731)cCg>cTg	p.P577L	SCARF1_ENST00000348987.3_Missense_Mutation_p.P491L|SCARF1_ENST00000571272.1_Missense_Mutation_p.R565C	NM_003693.2|NM_145350.1	NP_003684.2|NP_663325.1	Q14162	SREC_HUMAN	scavenger receptor class F, member 1	577	Pro/Ser-rich.				cell adhesion (GO:0007155)|cholesterol catabolic process (GO:0006707)|dendrite development (GO:0016358)|neuron remodeling (GO:0016322)|positive regulation of axon regeneration (GO:0048680)|positive regulation of neuron projection development (GO:0010976)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	endocytic vesicle membrane (GO:0030666)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	low-density lipoprotein particle binding (GO:0030169)|scavenger receptor activity (GO:0005044)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(3)|kidney(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		GGAGGTGCGCGGGATGGCGAA	0.677																																																	0													53.0	55.0	54.0					17																	1538815		2203	4300	6503	SO:0001583	missense	8578			D63483	CCDS11007.1, CCDS45564.1	17p13.3	2008-07-18			ENSG00000074660	ENSG00000074660			16820	protein-coding gene	gene with protein product	"""scavenger receptor expressed by endothelial cells"", ""acetyl LDL receptor"""	607873				9395444, 8590280	Standard	NM_003693		Approved	SREC, KIAA0149	uc002fsz.2	Q14162	OTTHUMG00000090555	ENST00000263071.4:c.1730C>T	17.37:g.1538815G>A	ENSP00000263071:p.Pro577Leu		A8MQ05|O43701|Q8NHD2|Q8NHD3|Q8NHD4|Q8NHD5	Missense_Mutation	SNP	ENST00000263071.4	37	CCDS11007.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.2|27.2	4.807736|4.807736	0.90623|0.90623	.|.	.|.	ENSG00000074660|ENSG00000074660	ENST00000263071;ENST00000348987|ENST00000434376	T;T|.	0.30448|.	1.53;1.53|.	5.21|5.21	5.21|5.21	0.72293|0.72293	.|.	0.000000|.	0.42964|.	D|.	0.000633|.	T|T	0.52565|0.52565	0.1742|0.1742	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	D;D|D	0.89917|0.61080	1.0;1.0|0.989	D;D|B	0.97110|0.38921	1.0;0.999|0.285	T|T	0.60566|0.60566	-0.7238|-0.7238	9|7	0.33940|0.51188	T|T	0.23|0.08	-8.7985|-8.7985	18.7945|18.7945	0.91988|0.91988	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	491;577|565	Q14162-2;Q14162|Q14162-3	.;SREC_HUMAN|.	L|C	577;491|565	ENSP00000263071:P577L;ENSP00000323964:P491L|.	ENSP00000263071:P577L|ENSP00000411167:R565C	P|R	-|-	2|1	0|0	SCARF1|SCARF1	1485565|1485565	1.000000|1.000000	0.71417|0.71417	0.952000|0.952000	0.39060|0.39060	0.853000|0.853000	0.48598|0.48598	9.128000|9.128000	0.94424|0.94424	2.428000|2.428000	0.82296|0.82296	0.555000|0.555000	0.69702|0.69702	CCG|CGC		0.677	SCARF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207081.4		NM_003693	
SETD4	54093	hgsc.bcm.edu;ucsc.edu	37	21	37416207	37416207	+	Silent	SNP	C	C	T	rs372995455		TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr21:37416207C>T	ENST00000399215.1	-	6	2146	c.774G>A	c.(772-774)acG>acA	p.T258T	SETD4_ENST00000399207.1_Silent_p.T258T|SETD4_ENST00000399212.1_Silent_p.T234T|SETD4_ENST00000399208.2_Silent_p.T258T|SETD4_ENST00000481477.1_5'UTR|SETD4_ENST00000332131.4_Silent_p.T258T|SETD4_ENST00000399201.1_Silent_p.T234T|AP000688.1_ENST00000600312.1_Intron|SETD4_ENST00000399205.1_Silent_p.T234T			Q9NVD3	SETD4_HUMAN	SET domain containing 4	258	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.						methyltransferase activity (GO:0008168)			autonomic_ganglia(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)	15						AACGTGAAGTCGTTCTAATTT	0.368																																																	0								C	,	0,4406		0,0,2203	118.0	99.0	106.0		774,774	-11.2	0.0	21		106	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	SETD4	NM_001007259.1,NM_017438.3	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	258/308,258/441	37416207	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	54093			AK001660	CCDS13640.1, CCDS42923.1, CCDS74791.1, CCDS74792.1	21q22.13	2006-02-15	2006-02-15	2006-02-15	ENSG00000185917	ENSG00000185917			1258	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 27"", ""chromosome 21 open reading frame 18"""	C21orf27, C21orf18			Standard	XM_005261000		Approved		uc021wiy.1	Q9NVD3	OTTHUMG00000086483	ENST00000399215.1:c.774G>A	21.37:g.37416207C>T			B4DT14|D3DSG2|D3DSG4|Q8NE19|Q9BU46	Silent	SNP	ENST00000399215.1	37	CCDS13640.1																																																																																				0.368	SETD4-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194456.1		NM_017438	
SIGLEC12	89858	hgsc.bcm.edu;ucsc.edu	37	19	52001300	52001300	+	Silent	SNP	C	C	A			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr19:52001300C>A	ENST00000291707.3	-	5	1432	c.1377G>T	c.(1375-1377)ctG>ctT	p.L459L	SIGLEC12_ENST00000598614.1_Silent_p.L341L	NM_053003.2	NP_443729.1	Q96PQ1	SIG12_HUMAN	sialic acid binding Ig-like lectin 12 (gene/pseudogene)	459	Ig-like C2-type 2.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(2)|biliary_tract(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(1)|lung(23)|ovary(4)|prostate(2)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)	61		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)		GGGAGAGGCTCAGGGAAATGT	0.592																																																	0													56.0	52.0	53.0					19																	52001300		2203	4300	6503	SO:0001819	synonymous_variant	89858			AF282256	CCDS12833.1, CCDS59416.1	19q13.41	2013-01-29	2011-06-29	2004-10-20	ENSG00000254521	ENSG00000254521		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15482	protein-coding gene	gene with protein product		606094	"""SIGLEC-like 1"", ""sialic acid binding Ig-like lectin 12"""	SIGLECL1		11409877, 11328818, 21555517	Standard	NM_053003		Approved	SLG, S2V, Siglec-XII, Siglec-12, Siglec-L1	uc002pwx.1	Q96PQ1	OTTHUMG00000165524	ENST00000291707.3:c.1377G>T	19.37:g.52001300C>A			Q8IYH7	Silent	SNP	ENST00000291707.3	37	CCDS12833.1																																																																																				0.592	SIGLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384641.2		NM_053003	
SLC28A1	9154	hgsc.bcm.edu	37	15	85451987	85451987	+	Silent	SNP	G	G	T			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr15:85451987G>T	ENST00000286749.3	+	8	846	c.756G>T	c.(754-756)gtG>gtT	p.V252V	SLC28A1_ENST00000537216.1_Silent_p.V252V|SLC28A1_ENST00000538177.1_Silent_p.V252V|SLC28A1_ENST00000537624.1_Silent_p.V252V|SLC28A1_ENST00000394573.1_Silent_p.V252V|SLC28A1_ENST00000537703.1_Silent_p.V174V			O00337	S28A1_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 1	252					nucleobase-containing compound metabolic process (GO:0006139)|nucleoside transmembrane transport (GO:1901642)|nucleoside transport (GO:0015858)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|nucleoside transmembrane transporter activity (GO:0005337)|nucleoside:sodium symporter activity (GO:0005415)			breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	41			BRCA - Breast invasive adenocarcinoma(143;0.0587)		Gemcitabine(DB00441)|Stavudine(DB00649)|Zidovudine(DB00495)	CCAGCTTCGTGTTTGGGGAGG	0.547																																																	0													80.0	78.0	79.0					15																	85451987		2203	4299	6502	SO:0001819	synonymous_variant	9154			U62967	CCDS10334.1, CCDS10335.1, CCDS73777.1	15q25.3	2013-07-17	2013-07-17		ENSG00000156222	ENSG00000156222		"""Solute carriers"""	11001	protein-coding gene	gene with protein product		606207	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 1"""			9124315	Standard	NM_004213		Approved	CNT1	uc002blg.3	O00337	OTTHUMG00000148668	ENST00000286749.3:c.756G>T	15.37:g.85451987G>T			A0AV42|A8K7I2|O00335|O00336|Q5U5S6|Q5U648|Q9UEZ9	Silent	SNP	ENST00000286749.3	37	CCDS10334.1																																																																																				0.547	SLC28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308998.2			
SORL1	6653	hgsc.bcm.edu;ucsc.edu	37	11	121498365	121498365	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr11:121498365G>C	ENST00000260197.7	+	47	6595	c.6466G>C	c.(6466-6468)Gcc>Ccc	p.A2156P	SORL1_ENST00000525532.1_Missense_Mutation_p.A1100P|SORL1_ENST00000534286.1_Missense_Mutation_p.A1066P|SORL1_ENST00000527934.1_Missense_Mutation_p.A771P|SORL1_ENST00000532694.1_Missense_Mutation_p.A1002P	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	2156					cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		GGTGGGGTTTGCCATCCTGTA	0.592																																																	0													101.0	87.0	92.0					11																	121498365		2202	4299	6501	SO:0001583	missense	6653			Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.6466G>C	11.37:g.121498365G>C	ENSP00000260197:p.Ala2156Pro		B2RNX7|Q92856	Missense_Mutation	SNP	ENST00000260197.7	37	CCDS8436.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.896397	0.91962	.	.	ENSG00000137642	ENST00000260197;ENST00000525532;ENST00000532694;ENST00000534286;ENST00000527934	D;D;D;D;D	0.92495	-3.05;-2.8;-2.45;-2.48;-2.36	5.74	4.82	0.62117	.	0.148154	0.42821	D	0.000644	D	0.87346	0.6154	N	0.14661	0.345	0.40161	D	0.977066	D;P	0.57257	0.979;0.924	P;B	0.47299	0.543;0.255	D	0.89415	0.3706	10	0.59425	D	0.04	.	15.032	0.71713	0.0692:0.0:0.9308:0.0	.	771;2156	E9PKB0;Q92673	.;SORL_HUMAN	P	2156;1100;1002;1066;771	ENSP00000260197:A2156P;ENSP00000434634:A1100P;ENSP00000432131:A1002P;ENSP00000436447:A1066P;ENSP00000435405:A771P	ENSP00000260197:A2156P	A	+	1	0	SORL1	121003575	1.000000	0.71417	0.996000	0.52242	0.906000	0.53458	3.868000	0.56055	2.709000	0.92574	0.655000	0.94253	GCC		0.592	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2		NM_003105	
SP3	6670	hgsc.bcm.edu	37	2	174819867	174819867	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr2:174819867G>A	ENST00000310015.6	-	4	1903	c.1373C>T	c.(1372-1374)tCt>tTt	p.S458F	SP3_ENST00000483084.1_5'Flank|SP3_ENST00000418194.2_Missense_Mutation_p.S390F|SP3_ENST00000455789.2_Missense_Mutation_p.S405F	NM_001172712.1|NM_003111.4	NP_001166183.1|NP_003102.1	Q02447	SP3_HUMAN	Sp3 transcription factor	458	Transactivation domain (Gln-rich).				B cell differentiation (GO:0030183)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|embryonic skeletal system development (GO:0048706)|enucleate erythrocyte differentiation (GO:0043353)|granulocyte differentiation (GO:0030851)|liver development (GO:0001889)|lung development (GO:0030324)|megakaryocyte differentiation (GO:0030219)|monocyte differentiation (GO:0030224)|natural killer cell differentiation (GO:0001779)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|T cell differentiation (GO:0030217)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|double-stranded DNA binding (GO:0003690)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)		EWSR1/SP3(3)	NS(2)|large_intestine(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.185)			TACCTGTCCAGAAGGGGTCAC	0.433																																																	0													75.0	72.0	73.0					2																	174819867		2203	4300	6503	SO:0001583	missense	6670			M97191	CCDS2254.1, CCDS46452.1	2q31	2013-01-08			ENSG00000172845	ENSG00000172845		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11208	protein-coding gene	gene with protein product		601804				1341900, 1454515	Standard	NM_003111		Approved	SPR-2	uc002uig.3	Q02447	OTTHUMG00000132333	ENST00000310015.6:c.1373C>T	2.37:g.174819867G>A	ENSP00000310301:p.Ser458Phe		A0AVL9|B4E2B7|Q69B26|Q69B27|Q8TD56|Q8WWU4|Q9BQR1	Missense_Mutation	SNP	ENST00000310015.6	37	CCDS2254.1	.	.	.	.	.	.	.	.	.	.	G	18.45	3.626020	0.66901	.	.	ENSG00000172845	ENST00000310015;ENST00000455789;ENST00000418194	T;T;T	0.07688	3.17;3.17;3.17	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.29914	0.0748	L	0.61218	1.895	0.80722	D	1	D;D;D	0.89917	1.0;0.997;1.0	D;D;D	0.91635	0.98;0.98;0.999	T	0.00247	-1.1881	10	0.87932	D	0	.	20.0915	0.97822	0.0:0.0:1.0:0.0	.	455;458;405	B7ZLN9;Q02447;Q02447-6	.;SP3_HUMAN;.	F	458;405;390	ENSP00000310301:S458F;ENSP00000388903:S405F;ENSP00000406140:S390F	ENSP00000310301:S458F	S	-	2	0	SP3	174528113	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.194000	0.94962	2.736000	0.93811	0.650000	0.86243	TCT		0.433	SP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255452.1		NM_003111	
SPIRE1	56907	hgsc.bcm.edu;ucsc.edu	37	18	12463349	12463349	+	Splice_Site	SNP	C	C	G			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr18:12463349C>G	ENST00000409402.4	-	12	1906		c.e12+1		SPIRE1_ENST00000383356.2_Splice_Site|SPIRE1_ENST00000410092.3_Splice_Site|SPIRE1_ENST00000453447.2_Splice_Site|SPIRE1_ENST00000464481.1_Splice_Site|SPIRE1_ENST00000309836.5_Splice_Site	NM_001128626.1	NP_001122098.1			spire-type actin nucleation factor 1											breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)	28						CCTGTACTTACAAGAGAGCGG	0.453																																																	0													92.0	86.0	88.0					18																	12463349		2203	4300	6503	SO:0001630	splice_region_variant	56907			AL833817	CCDS32790.2, CCDS45829.1, CCDS45830.1	18p11.21	2013-08-27	2013-08-27		ENSG00000134278	ENSG00000134278			30622	protein-coding gene	gene with protein product		609216	"""spire homolog 1 (Drosophila)"", ""spire family actin nucleation factor 1"""			10574461, 11747823	Standard	NM_001128626		Approved	spir-1, KIAA1135	uc002kre.3	Q08AE8	OTTHUMG00000153940	ENST00000409402.4:c.1638+1G>C	18.37:g.12463349C>G				Splice_Site	SNP	ENST00000409402.4	37	CCDS45829.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.507304	0.85282	.	.	ENSG00000134278	ENST00000453447;ENST00000409402;ENST00000410092;ENST00000309836;ENST00000383356	.	.	.	5.37	5.37	0.77165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.533	0.95237	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SPIRE1	12453349	1.000000	0.71417	0.996000	0.52242	0.938000	0.57974	7.181000	0.77682	2.700000	0.92200	0.579000	0.79373	.		0.453	SPIRE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333109.2		XM_290818	Intron
SYCE2	256126	hgsc.bcm.edu	37	19	13011345	13011345	+	Silent	SNP	A	A	G			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr19:13011345A>G	ENST00000293695.7	-	4	442	c.424T>C	c.(424-426)Ttg>Ctg	p.L142L	GCDH_ENST00000588242.2_3'UTR	NM_001105578.1	NP_001099048.1	Q6PIF2	SYCE2_HUMAN	synaptonemal complex central element protein 2	142					synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)				endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(1)	8						TCTGTCTCCAAATGGCTGATC	0.473																																																	0													110.0	97.0	101.0					19																	13011345		1886	4119	6005	SO:0001819	synonymous_variant	256126			AK097443	CCDS42509.1	19p13.13	2008-02-05				ENSG00000161860			27411	protein-coding gene	gene with protein product	"""central element synaptonemal complex 1"""	611487				15944401	Standard	NM_001105578		Approved	CESC1	uc002mvr.2	Q6PIF2		ENST00000293695.7:c.424T>C	19.37:g.13011345A>G			B4DYD3	Silent	SNP	ENST00000293695.7	37	CCDS42509.1																																																																																				0.473	SYCE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451913.1		XM_497609	
TBC1D1	23216	hgsc.bcm.edu	37	4	38016542	38016542	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr4:38016542A>G	ENST00000261439.4	+	3	1185	c.830A>G	c.(829-831)cAc>cGc	p.H277R	TBC1D1_ENST00000508802.1_Missense_Mutation_p.H277R	NM_001253914.1|NM_001253915.1|NM_015173.3	NP_001240843.1|NP_001240844.1|NP_055988.2	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1	277	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				membrane organization (GO:0061024)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(3)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	36						ATTAGCGGACACAATATTGTG	0.532																																																	0													47.0	50.0	49.0					4																	38016542		2203	4300	6503	SO:0001583	missense	23216			AB029031	CCDS33972.1, CCDS58897.1	4p14	2013-07-09			ENSG00000065882	ENSG00000065882			11578	protein-coding gene	gene with protein product		609850				10965142, 18258599	Standard	NM_015173		Approved	TBC, TBC1, KIAA1108	uc003gtb.3	Q86TI0	OTTHUMG00000150302	ENST00000261439.4:c.830A>G	4.37:g.38016542A>G	ENSP00000261439:p.His277Arg		B7Z3D9|E9PGH8|Q96K82|Q9UPP4	Missense_Mutation	SNP	ENST00000261439.4	37	CCDS33972.1	.	.	.	.	.	.	.	.	.	.	A	1.621	-0.521517	0.04171	.	.	ENSG00000065882	ENST00000508802;ENST00000261439;ENST00000446803	T;T;T	0.18174	3.6;3.99;2.23	5.65	3.11	0.35812	Phosphotyrosine interaction domain (1);	0.101745	0.43416	N	0.000575	T	0.07143	0.0181	N	0.08118	0	0.80722	D	1	B;B;B	0.26809	0.001;0.16;0.001	B;B;B	0.23150	0.005;0.044;0.005	T	0.30736	-0.9968	10	0.12103	T	0.63	-22.4534	8.897	0.35470	0.8062:0.1274:0.0664:0.0	.	277;277;277	B9A6J6;E9PGH8;Q86TI0	.;.;TBCD1_HUMAN	R	277;277;148	ENSP00000423651:H277R;ENSP00000261439:H277R;ENSP00000396877:H148R	ENSP00000261439:H277R	H	+	2	0	TBC1D1	37692937	0.214000	0.23563	0.151000	0.22473	0.019000	0.09904	0.921000	0.28718	0.461000	0.27071	-0.461000	0.05368	CAC		0.532	TBC1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317443.2		NM_015173	
SYNPO2	171024	hgsc.bcm.edu;ucsc.edu	37	4	119978853	119978853	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr4:119978853C>T	ENST00000307142.4	+	5	3746	c.3550C>T	c.(3550-3552)Cct>Tct	p.P1184S	SYNPO2_ENST00000448416.2_3'UTR	NM_133477.2	NP_597734.2	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	0						actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						GTCCTATATTCCTCAAACCCA	0.463																																																	0													88.0	86.0	87.0					4																	119978853		2203	4300	6503	SO:0001583	missense	171024			AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000307142.4:c.3550C>T	4.37:g.119978853C>T	ENSP00000306015:p.Pro1184Ser		B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Missense_Mutation	SNP	ENST00000307142.4	37	CCDS34054.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.10|12.10	1.835840|1.835840	0.32421|0.32421	.|.	.|.	ENSG00000172403|ENSG00000172403	ENST00000307142|ENST00000504178	T|.	0.09723|.	2.95|.	5.76|5.76	4.03|4.03	0.46877|0.46877	.|.	0.168798|.	0.28665|.	N|.	0.014544|.	T|T	0.46425|0.46425	0.1392|0.1392	L|L	0.29908|0.29908	0.895|0.895	0.34391|0.34391	D|D	0.694223|0.694223	B;B|.	0.23377|.	0.051;0.084|.	B;B|.	0.23419|.	0.02;0.046|.	T|T	0.54754|0.54754	-0.8246|-0.8246	9|5	.|.	.|.	.|.	-7.2272|-7.2272	12.0203|12.0203	0.53340|0.53340	0.0:0.8609:0.0:0.1391|0.0:0.8609:0.0:0.1391	.|.	1184;1184|.	B9EG60;Q9UMS6-2|.	.;.|.	S|F	1184|1077	ENSP00000306015:P1184S|.	.|.	P|S	+|+	1|2	0|0	SYNPO2|SYNPO2	120198301|120198301	0.587000|0.587000	0.26791|0.26791	0.104000|0.104000	0.21259|0.21259	0.038000|0.038000	0.13279|0.13279	1.943000|1.943000	0.40253|0.40253	0.793000|0.793000	0.33875|0.33875	0.655000|0.655000	0.94253|0.94253	CCT|TCC		0.463	SYNPO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364018.1			
TDRD10	126668	hgsc.bcm.edu;ucsc.edu	37	1	154517301	154517301	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr1:154517301G>T	ENST00000368480.3	+	11	913	c.828G>T	c.(826-828)tgG>tgT	p.W276C	TDRD10_ENST00000479937.1_3'UTR|TDRD10_ENST00000368482.4_Missense_Mutation_p.W276C			Q5VZ19	TDR10_HUMAN	tudor domain containing 10	276	Tudor.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			TGGACACCTGGGCTGTGGTCA	0.552																																																	0													208.0	180.0	189.0					1																	154517301		2203	4300	6503	SO:0001583	missense	126668			AL713777	CCDS30878.2, CCDS41406.1	1q21.3	2013-02-12			ENSG00000163239	ENSG00000163239		"""Tudor domain containing"", ""RNA binding motif (RRM) containing"""	25316	protein-coding gene	gene with protein product						12975309	Standard	NM_182499		Approved	DKFZp434M202	uc009wow.3	Q5VZ19	OTTHUMG00000037264	ENST00000368480.3:c.828G>T	1.37:g.154517301G>T	ENSP00000357465:p.Trp276Cys		A4FU09|B0QZ53|B4DXV4|Q3ZCP1|Q3ZCS7|Q5SXY7|Q6UXV2|Q8TCN3	Missense_Mutation	SNP	ENST00000368480.3	37	CCDS41406.1	.	.	.	.	.	.	.	.	.	.	G	16.63	3.176920	0.57692	.	.	ENSG00000163239	ENST00000368482;ENST00000368480	T;T	0.11063	2.81;2.81	4.54	4.54	0.55810	Maternal tudor protein (1);	0.529762	0.15335	N	0.267838	T	0.12305	0.0299	L	0.29908	0.895	0.26657	N	0.971991	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.994	T	0.05852	-1.0860	10	0.72032	D	0.01	-7.721	12.6499	0.56755	0.0:0.0:1.0:0.0	.	276;276	Q5VZ19;Q5VZ19-2	TDR10_HUMAN;.	C	276	ENSP00000357467:W276C;ENSP00000357465:W276C	ENSP00000357465:W276C	W	+	3	0	TDRD10	152783925	0.996000	0.38824	0.062000	0.19696	0.986000	0.74619	1.870000	0.39529	2.351000	0.79841	0.650000	0.86243	TGG		0.552	TDRD10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090700.2		NM_182499	
EMC3	55831	hgsc.bcm.edu	37	3	10011439	10011439	+	Silent	SNP	G	G	A			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr3:10011439G>A	ENST00000245046.2	-	7	1079	c.621C>T	c.(619-621)gcC>gcT	p.A207A	EMC3_ENST00000497557.1_5'UTR	NM_018447.2	NP_060917.1	Q9P0I2	EMC3_HUMAN	ER membrane protein complex subunit 3	207						ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)											GCATGGCCATGGCTGCTCCCG	0.498																																																	0													124.0	109.0	114.0					3																	10011439		2203	4300	6503	SO:0001819	synonymous_variant	0			AF157321	CCDS2594.1	3p25.3	2012-05-23	2012-05-23	2012-05-23	ENSG00000125037	ENSG00000125037			23999	protein-coding gene	gene with protein product			"""transmembrane protein 111"""	TMEM111		19797678, 22119785	Standard	NM_018447		Approved		uc003bun.3	Q9P0I2	OTTHUMG00000128652	ENST00000245046.2:c.621C>T	3.37:g.10011439G>A			B2R4Z9|Q53GH8|Q6ZMC2	Silent	SNP	ENST00000245046.2	37	CCDS2594.1																																																																																				0.498	EMC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250532.1		NM_018447	
TMEM164	84187	hgsc.bcm.edu	37	X	109247114	109247114	+	Silent	SNP	C	C	A			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chrX:109247114C>A	ENST00000372073.1	+	2	448	c.112C>A	c.(112-114)Cgg>Agg	p.R38R	TMEM164_ENST00000372068.2_Silent_p.R38R|TMEM164_ENST00000288381.4_Silent_p.R38R|TMEM164_ENST00000372072.3_Intron			Q5U3C3	TM164_HUMAN	transmembrane protein 164	38						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|large_intestine(5)|lung(6)|skin(1)	14						TTGGCAGCAGCGGCTGCTGGA	0.627																																																	0													87.0	91.0	90.0					X																	109247114		2203	4300	6503	SO:0001819	synonymous_variant	84187			AK094127	CCDS14550.2, CCDS55475.1	Xq22.3	2008-02-05			ENSG00000157600	ENSG00000157600			26217	protein-coding gene	gene with protein product						12477932	Standard	NM_032227		Approved	FLJ22679, RP13-360B22.2	uc004eom.3	Q5U3C3	OTTHUMG00000022192	ENST00000372073.1:c.112C>A	X.37:g.109247114C>A			B3KSQ8|F5H2P2	Silent	SNP	ENST00000372073.1	37	CCDS14550.2																																																																																				0.627	TMEM164-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057898.1		NM_032227	
TMEM38A	79041	hgsc.bcm.edu	37	19	16793274	16793274	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr19:16793274G>C	ENST00000187762.2	+	4	600	c.509G>C	c.(508-510)cGa>cCa	p.R170P		NM_024074.1	NP_076979.1	Q9H6F2	TM38A_HUMAN	transmembrane protein 38A	170						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|sarcoplasmic reticulum membrane (GO:0033017)	potassium channel activity (GO:0005267)			central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)	15						CAGCTGCTCCGAGGGGTCTGG	0.572																																																	0													141.0	117.0	125.0					19																	16793274		2203	4300	6503	SO:0001583	missense	79041			AK025981	CCDS12349.1	19p13.11	2013-05-23				ENSG00000072954			28462	protein-coding gene	gene with protein product		611235				17611541	Standard	NM_024074		Approved	MGC3169, TRIC-A	uc002nes.3	Q9H6F2		ENST00000187762.2:c.509G>C	19.37:g.16793274G>C	ENSP00000187762:p.Arg170Pro		A8K9P9	Missense_Mutation	SNP	ENST00000187762.2	37	CCDS12349.1	.	.	.	.	.	.	.	.	.	.	g	31	5.098558	0.94197	.	.	ENSG00000072954	ENST00000187762	.	.	.	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	D	0.83501	0.5268	M	0.82823	2.61	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85005	0.0902	9	0.54805	T	0.06	-8.3019	18.1208	0.89571	0.0:0.0:1.0:0.0	.	170	Q9H6F2	TM38A_HUMAN	P	170	.	ENSP00000187762:R170P	R	+	2	0	TMEM38A	16654274	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	9.513000	0.98010	2.499000	0.84300	0.655000	0.94253	CGA		0.572	TMEM38A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462841.1		NM_024074	
TNS4	84951	hgsc.bcm.edu;ucsc.edu	37	17	38643651	38643651	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr17:38643651T>A	ENST00000254051.6	-	4	1083	c.925A>T	c.(925-927)Agt>Tgt	p.S309C		NM_032865.5	NP_116254.4	Q8IZW8	TENS4_HUMAN	tensin 4	309	Ser-rich.				apoptotic process (GO:0006915)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	30		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			TTGGCTGGACTTTCCAAGGAT	0.572																																																	0													85.0	84.0	84.0					17																	38643651		2203	4300	6503	SO:0001583	missense	84951			AF417488	CCDS11368.1	17q21.2	2013-02-14			ENSG00000131746	ENSG00000131746		"""SH2 domain containing"""	24352	protein-coding gene	gene with protein product	"""C terminal tensin like"""	608385				12154022, 12711115	Standard	NM_032865		Approved	CTEN	uc010cxb.3	Q8IZW8	OTTHUMG00000133330	ENST00000254051.6:c.925A>T	17.37:g.38643651T>A	ENSP00000254051:p.Ser309Cys		A6NMJ7|Q71RB7|Q8WV64|Q96JV4	Missense_Mutation	SNP	ENST00000254051.6	37	CCDS11368.1	.	.	.	.	.	.	.	.	.	.	T	12.49	1.953992	0.34471	.	.	ENSG00000131746	ENST00000377816;ENST00000254051	T	0.47177	0.85	4.81	3.67	0.42095	.	1.477250	0.04002	N	0.296693	T	0.36580	0.0972	N	0.19112	0.55	0.27618	N	0.948427	B	0.22851	0.076	B	0.19148	0.024	T	0.20273	-1.0280	10	0.52906	T	0.07	-18.4874	8.932	0.35677	0.1776:0.0:0.0:0.8224	.	309	Q8IZW8	TENS4_HUMAN	C	309	ENSP00000254051:S309C	ENSP00000254051:S309C	S	-	1	0	TNS4	35897177	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	2.458000	0.45014	2.011000	0.59026	0.459000	0.35465	AGT		0.572	TNS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257154.3		NM_032865	
TMUB2	79089	hgsc.bcm.edu	37	17	42265113	42265113	+	Splice_Site	SNP	T	T	C			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr17:42265113T>C	ENST00000587989.1	+	2	188		c.e2+2		TMUB2_ENST00000592825.1_Splice_Site|TMUB2_ENST00000587172.1_5'Flank|TMUB2_ENST00000590235.1_Intron|ASB16-AS1_ENST00000588785.1_RNA|ASB16-AS1_ENST00000591166.1_RNA|TMUB2_ENST00000357984.3_Intron|TMUB2_ENST00000589184.1_Splice_Site|TMUB2_ENST00000446571.3_Splice_Site|TMUB2_ENST00000538716.2_Splice_Site|ASB16-AS1_ENST00000592897.1_RNA|TMUB2_ENST00000319511.6_Splice_Site|TMUB2_ENST00000589785.1_Intron|ASB16-AS1_ENST00000585457.1_RNA|TMUB2_ENST00000589856.1_Splice_Site			Q71RG4	TMUB2_HUMAN	transmembrane and ubiquitin-like domain containing 2							integral component of membrane (GO:0016021)				endometrium(2)|kidney(2)|large_intestine(1)|lung(3)	8		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.113)		cctcatgaggtaggtactgtt	0.413																																																	0													173.0	169.0	170.0					17																	42265113		1015	2126	3141	SO:0001630	splice_region_variant	79089				CCDS11479.1, CCDS54134.1	17q21	2006-06-27				ENSG00000168591			28459	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_177441		Approved	MGC3123	uc002ifo.3	Q71RG4		ENST00000587989.1:c.35+2T>C	17.37:g.42265113T>C			B3KU81|Q8NDI2|Q9BPZ5|Q9HAG3	Splice_Site	SNP	ENST00000587989.1	37	CCDS54134.1																																																																																				0.413	TMUB2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457711.1		NM_177441	Intron
TRPV6	55503	hgsc.bcm.edu	37	7	142571254	142571254	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr7:142571254C>A	ENST00000359396.3	-	13	1980	c.1735G>T	c.(1735-1737)Ggc>Tgc	p.G579C	RP11-114L10.2_ENST00000438839.1_RNA	NM_018646.3	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel, subfamily V, member 6	579					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|regulation of calcium ion-dependent exocytosis (GO:0017158)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)			breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	42	Melanoma(164;0.059)					TGAGTGTCGCCCATCATGGCA	0.597																																																	0													156.0	129.0	138.0					7																	142571254		2203	4300	6503	SO:0001583	missense	55503			AJ277909	CCDS5874.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000165125	ENSG00000165125		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	14006	protein-coding gene	gene with protein product		606680	"""epithelial calcium channel 2"""	ECAC2		11097838, 11549322, 16382100, 16717058	Standard	NM_018646		Approved	CaT1	uc003wbx.2	Q9H1D0	OTTHUMG00000157158	ENST00000359396.3:c.1735G>T	7.37:g.142571254C>A	ENSP00000352358:p.Gly579Cys		A4D2I8|Q8TDL3|Q8WXR8|Q96LC5|Q9H1D1|Q9H296	Missense_Mutation	SNP	ENST00000359396.3	37	CCDS5874.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.447464	0.84101	.	.	ENSG00000165125	ENST00000359396;ENST00000311470	D	0.86164	-2.08	5.57	5.57	0.84162	.	0.049164	0.85682	D	0.000000	D	0.93749	0.8002	M	0.81341	2.54	0.58432	D	0.999999	D	0.89917	1.0	D	0.74674	0.984	D	0.94222	0.7468	10	0.87932	D	0	-17.0116	18.5442	0.91040	0.0:1.0:0.0:0.0	.	579	Q9H1D0	TRPV6_HUMAN	C	579;411	ENSP00000352358:G579C	ENSP00000310825:G411C	G	-	1	0	TRPV6	142281376	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.595000	0.67563	2.613000	0.88420	0.655000	0.94253	GGC		0.597	TRPV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347662.1		NM_014274	
USP45	85015	hgsc.bcm.edu	37	6	99924089	99924089	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr6:99924089T>C	ENST00000327681.6	-	9	1395	c.863A>G	c.(862-864)gAt>gGt	p.D288G	USP45_ENST00000369233.2_Missense_Mutation_p.D288G|USP45_ENST00000500704.2_Missense_Mutation_p.D288G|USP45_ENST00000392738.2_Missense_Mutation_p.D26G	NM_001080481.1	NP_001073950.1	Q70EL2	UBP45_HUMAN	ubiquitin specific peptidase 45	288	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(6)|lung(2)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	22		all_cancers(76;0.000208)|Acute lymphoblastic leukemia(125;8.41e-11)|all_hematologic(75;2.56e-07)|all_epithelial(107;0.122)|Colorectal(196;0.133)		BRCA - Breast invasive adenocarcinoma(108;0.0718)		TTGCTGGAAATCTTTAAATCG	0.363																																																	0													79.0	77.0	78.0					6																	99924089		2203	4300	6503	SO:0001583	missense	85015			AL832030	CCDS34501.1	6q16.2	2008-02-05	2005-08-08		ENSG00000123552	ENSG00000123552		"""Ubiquitin-specific peptidases"""	20080	protein-coding gene	gene with protein product			"""ubiquitin specific protease 45"""			12838346	Standard	NM_001080481		Approved	MGC14793	uc003ppx.2	Q70EL2	OTTHUMG00000015267	ENST00000327681.6:c.863A>G	6.37:g.99924089T>C	ENSP00000333376:p.Asp288Gly		B2RXG0|Q5T062|Q86T44|Q86TC0|Q9BRU1	Missense_Mutation	SNP	ENST00000327681.6	37	CCDS34501.1	.	.	.	.	.	.	.	.	.	.	T	3.026	-0.200696	0.06219	.	.	ENSG00000123552	ENST00000392738;ENST00000500704;ENST00000327681;ENST00000369233;ENST00000511403	T;T;T;T;T	0.27402	1.67;1.67;1.67;1.67;1.67	5.69	1.52	0.23074	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.224286	0.45867	N	0.000323	T	0.01523	0.0049	N	0.00355	-1.605	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.48399	-0.9039	10	0.02654	T	1	.	6.9379	0.24476	0.0:0.6849:0.121:0.1941	.	288;26	Q70EL2;Q70EL2-3	UBP45_HUMAN;.	G	26;288;288;288;44	ENSP00000376495:D26G;ENSP00000424372:D288G;ENSP00000333376:D288G;ENSP00000358236:D288G;ENSP00000423374:D44G	ENSP00000333376:D288G	D	-	2	0	USP45	100030810	1.000000	0.71417	0.993000	0.49108	0.997000	0.91878	1.683000	0.37638	-0.031000	0.13781	0.477000	0.44152	GAT		0.363	USP45-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041609.2		NM_032929	
WDR43	23160	hgsc.bcm.edu	37	2	29164351	29164351	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr2:29164351G>T	ENST00000407426.3	+	15	1701	c.1645G>T	c.(1645-1647)Ggg>Tgg	p.G549W		NM_015131.1	NP_055946.1	Q15061	WDR43_HUMAN	WD repeat domain 43	549						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	20	Acute lymphoblastic leukemia(172;0.155)					ACCCCAGCTGGGGACACTCTA	0.403																																																	0													75.0	72.0	73.0					2																	29164351		1883	4102	5985	SO:0001583	missense	23160			D87716	CCDS46251.1	2p23.3	2013-01-09			ENSG00000163811	ENSG00000163811		"""WD repeat domain containing"""	28945	protein-coding gene	gene with protein product	"""UTP5, small subunit (SSU) processome component, homolog (yeast)"""					7584026, 7584028, 17699751	Standard	NM_015131		Approved	KIAA0007, NET12, UTP5	uc002rmo.2	Q15061	OTTHUMG00000152015	ENST00000407426.3:c.1645G>T	2.37:g.29164351G>T	ENSP00000384302:p.Gly549Trp		Q15395|Q92577	Missense_Mutation	SNP	ENST00000407426.3	37	CCDS46251.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.4|20.4	3.986489|3.986489	0.74589|0.74589	.|.	.|.	ENSG00000163811|ENSG00000163811	ENST00000407426|ENST00000446643	T|.	0.66815|.	-0.23|.	5.51|5.51	4.6|4.6	0.57074|0.57074	.|.	0.049965|.	0.85682|.	D|.	0.000000|.	T|T	0.75874|0.75874	0.3909|0.3909	M|M	0.83603|0.83603	2.65|2.65	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	D|.	0.81914|.	0.995|.	T|T	0.77970|0.77970	-0.2387|-0.2387	10|5	0.87932|.	D|.	0|.	-10.5131|-10.5131	12.6872|12.6872	0.56954|0.56954	0.0845:0.0:0.9155:0.0|0.0845:0.0:0.9155:0.0	.|.	549|.	Q15061|.	WDR43_HUMAN|.	W|C	549|100	ENSP00000384302:G549W|.	ENSP00000384302:G549W|.	G|W	+|+	1|3	0|0	WDR43|WDR43	29017855|29017855	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	5.729000|5.729000	0.68538|0.68538	1.368000|1.368000	0.46115|0.46115	0.555000|0.555000	0.69702|0.69702	GGG|TGG		0.403	WDR43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324865.1		XM_087089	
XPO1	7514	hgsc.bcm.edu	37	2	61717806	61717806	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr2:61717806A>G	ENST00000401558.2	-	17	2720	c.1993T>C	c.(1993-1995)Tgg>Cgg	p.W665R	XPO1_ENST00000404992.2_Missense_Mutation_p.W665R|XPO1_ENST00000406957.1_Missense_Mutation_p.W665R	NM_003400.3	NP_003391.1	O14980	XPO1_HUMAN	exportin 1	665	Necessary for HTLV-1 Rex-mediated mRNA export.				gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein export from nucleus (GO:0006611)|protein localization to nucleus (GO:0034504)|regulation of centrosome duplication (GO:0010824)|regulation of protein catabolic process (GO:0042176)|regulation of protein export from nucleus (GO:0046825)|response to drug (GO:0042493)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|RNA metabolic process (GO:0016070)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)	annulate lamellae (GO:0005642)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleocytoplasmic transporter activity (GO:0005487)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			ATACTATCCCACACTTGATTA	0.353			Mis		CLL																																		-'	Dom	yes		2	2p15	7514	"""exportin 1 (CRM1 homolog, yeast)"""		L	0													209.0	176.0	187.0					2																	61717806		2202	4300	6502	SO:0001583	missense	7514			Y08614	CCDS33205.1	2p15	2014-02-19	2014-02-19		ENSG00000082898	ENSG00000082898		"""Exportins"""	12825	protein-coding gene	gene with protein product	"""chromosome region maintenance 1 homolog (yeast)"""	602559	"""exportin 1 (CRM1, yeast, homolog)"", ""exportin 1 (CRM1 homolog, yeast)"""			9205132, 9368044	Standard	XM_005264544		Approved	CRM1, emb	uc002sbj.3	O14980	OTTHUMG00000152316	ENST00000401558.2:c.1993T>C	2.37:g.61717806A>G	ENSP00000384863:p.Trp665Arg		A6NL14|A8K1K5|D6W5E2|Q63HP8|Q68CP3|Q99433	Missense_Mutation	SNP	ENST00000401558.2	37	CCDS33205.1	.	.	.	.	.	.	.	.	.	.	A	26.4	4.730792	0.89390	.	.	ENSG00000082898	ENST00000401558;ENST00000404992;ENST00000406957	T;T;T	0.68181	-0.31;-0.31;-0.31	6.16	6.16	0.99307	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.86772	0.6013	M	0.93898	3.47	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.89953	0.4081	10	0.87932	D	0	-5.6081	16.8061	0.85666	1.0:0.0:0.0:0.0	.	312;665	B3KWD0;O14980	.;XPO1_HUMAN	R	665	ENSP00000384863:W665R;ENSP00000385942:W665R;ENSP00000385559:W665R	ENSP00000384863:W665R	W	-	1	0	XPO1	61571310	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.312000	0.96287	2.367000	0.80283	0.528000	0.53228	TGG		0.353	XPO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325872.3		NM_003400	
ZC3H6	376940	hgsc.bcm.edu	37	2	113089834	113089834	+	Silent	SNP	A	A	G			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr2:113089834A>G	ENST00000409871.1	+	12	3740	c.3339A>G	c.(3337-3339)ccA>ccG	p.P1113P	ZC3H6_ENST00000343936.4_Silent_p.P1113P|AC115115.2_ENST00000607612.1_RNA	NM_198581.2	NP_940983.2	P61129	ZC3H6_HUMAN	zinc finger CCCH-type containing 6	1113							metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(4)|prostate(2)	35						CAGCTGACCCACAGGCGGACG	0.517																																																	0													41.0	44.0	43.0					2																	113089834		1950	4144	6094	SO:0001819	synonymous_variant	376940			AK123404	CCDS46393.1	2q13	2012-07-05	2005-06-02	2005-06-02	ENSG00000188177	ENSG00000188177		"""Zinc fingers, CCCH-type domain containing"""	24762	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 6"""	ZC3HDC6			Standard	NM_198581		Approved	FLJ41410, FLJ45877, KIAA2035	uc002thq.1	P61129	OTTHUMG00000153286	ENST00000409871.1:c.3339A>G	2.37:g.113089834A>G			A9JR71|Q6ZW96	Silent	SNP	ENST00000409871.1	37	CCDS46393.1																																																																																				0.517	ZC3H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330551.1		NM_198581	
ZDBF2	57683	hgsc.bcm.edu	37	2	207170632	207170632	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr2:207170632G>T	ENST00000374423.3	+	5	1766	c.1380G>T	c.(1378-1380)ttG>ttT	p.L460F		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	460							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						TTCTTCACTTGGTTACCAACC	0.328																																																	0													39.0	37.0	37.0					2																	207170632		1839	4084	5923	SO:0001583	missense	57683			AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.1380G>T	2.37:g.207170632G>T	ENSP00000363545:p.Leu460Phe		Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	ENST00000374423.3	37	CCDS46501.1	.	.	.	.	.	.	.	.	.	.	G	7.606	0.673779	0.14841	.	.	ENSG00000204186	ENST00000374423	T	0.56776	0.44	4.24	0.277	0.15668	.	1.713730	0.04188	N	0.327781	T	0.42223	0.1193	L	0.40543	1.245	0.09310	N	1	B	0.15930	0.015	B	0.12837	0.008	T	0.26360	-1.0105	10	0.45353	T	0.12	.	3.718	0.08445	0.3201:0.1865:0.4934:0.0	.	460	Q9HCK1	ZDBF2_HUMAN	F	460	ENSP00000363545:L460F	ENSP00000363545:L460F	L	+	3	2	ZDBF2	206878877	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.812000	0.27211	0.138000	0.18790	-0.157000	0.13467	TTG		0.328	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1		NM_020923	
ZNF292	23036	hgsc.bcm.edu	37	6	87970404	87970404	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr6:87970404G>T	ENST00000369577.3	+	8	7100	c.7057G>T	c.(7057-7059)Gaa>Taa	p.E2353*	ZNF292_ENST00000339907.4_Nonsense_Mutation_p.E2348*	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	2353						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		GCAGATTGAAGAAAATAAGCC	0.363																																																	0													53.0	54.0	54.0					6																	87970404		1838	4081	5919	SO:0001587	stop_gained	23036			AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.7057G>T	6.37:g.87970404G>T	ENSP00000358590:p.Glu2353*		Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Nonsense_Mutation	SNP	ENST00000369577.3	37	CCDS47457.1	.	.	.	.	.	.	.	.	.	.	G	44	11.033928	0.99506	.	.	ENSG00000188994	ENST00000369577;ENST00000339907	.	.	.	5.62	5.62	0.85841	.	0.241555	0.42548	D	0.000700	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	.	15.1666	0.72833	0.0:0.1406:0.8594:0.0	.	.	.	.	X	2353;2348	.	ENSP00000342847:E2348X	E	+	1	0	ZNF292	88027123	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.192000	0.50989	2.659000	0.90383	0.585000	0.79938	GAA		0.363	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376192.2		NM_015021	
ZNF544	27300	hgsc.bcm.edu	37	19	58772926	58772926	+	Missense_Mutation	SNP	A	A	C	rs199688490		TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr19:58772926A>C	ENST00000596652.1	+	6	1188	c.954A>C	c.(952-954)agA>agC	p.R318S	CTD-3138B18.4_ENST00000600029.1_Intron|ZNF544_ENST00000599953.1_Missense_Mutation_p.R176S|ZNF544_ENST00000600220.1_Missense_Mutation_p.R290S|CTD-3138B18.5_ENST00000597230.1_RNA|ZNF544_ENST00000600044.1_Missense_Mutation_p.R290S|ZNF544_ENST00000269829.4_Missense_Mutation_p.R318S|ZNF544_ENST00000596929.1_Intron|ZNF544_ENST00000596825.1_3'UTR|ZNF544_ENST00000595981.1_Intron|ZNF544_ENST00000415203.2_Missense_Mutation_p.R290S|ZNF544_ENST00000599227.1_3'UTR			Q6NX49	ZN544_HUMAN	zinc finger protein 544	318					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|skin(1)|urinary_tract(1)	18		all_cancers(17;4.17e-12)|all_epithelial(17;1.25e-08)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.17)|GBM - Glioblastoma multiforme(193;0.018)		AAACAGAAAGAAGTGGCCCTG	0.478													A|||	1	0.000199681	0.0	0.0014	5008	,	,		20015	0.0		0.0	False		,,,				2504	0.0																0													64.0	60.0	61.0					19																	58772926		2203	4300	6503	SO:0001583	missense	27300			AF020591	CCDS12973.1	19q13.43	2013-01-08				ENSG00000198131		"""Zinc fingers, C2H2-type"", ""-"""	16759	protein-coding gene	gene with protein product	"""zinc finger protein AF020591"""						Standard	NM_014480		Approved	AF020591	uc010euo.3	Q6NX49		ENST00000596652.1:c.954A>C	19.37:g.58772926A>C	ENSP00000469635:p.Arg318Ser		A8K6J1|Q9UEX4	Missense_Mutation	SNP	ENST00000596652.1	37	CCDS12973.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	A	11.71	1.718922	0.30503	.	.	ENSG00000198131	ENST00000269829;ENST00000415203	T;T	0.18657	2.2;2.2	3.52	1.34	0.21922	.	.	.	.	.	T	0.20901	0.0503	M	0.63169	1.94	0.09310	N	0.999998	B;P;P	0.41784	0.035;0.642;0.762	B;B;B	0.40329	0.019;0.205;0.326	T	0.15378	-1.0439	9	0.72032	D	0.01	.	4.6825	0.12741	0.696:0.1938:0.1102:0.0	.	290;290;318	B7ZAY1;B4DL50;Q6NX49	.;.;ZN544_HUMAN	S	318;290	ENSP00000269829:R318S;ENSP00000394341:R290S	ENSP00000269829:R318S	R	+	3	2	ZNF544	63464738	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	0.423000	0.21313	0.095000	0.17434	0.533000	0.62120	AGA		0.478	ZNF544-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466754.1		NM_014480	
ZFP69	339559	hgsc.bcm.edu	37	1	40945114	40945114	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr1:40945114G>T	ENST00000372706.1	+	2	1087	c.81G>T	c.(79-81)gaG>gaT	p.E27D	ZFP69_ENST00000372705.3_Missense_Mutation_p.E27D			Q49AA0	ZFP69_HUMAN	ZFP69 zinc finger protein	27	SCAN box.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										AGGCCGTGGAGGGGGCGCCCC	0.552																																																	0													46.0	48.0	47.0					1																	40945114		2203	4300	6503	SO:0001583	missense	0			AK122618	CCDS30686.1	1p34.2	2013-01-09	2012-11-27	2012-11-27	ENSG00000187815	ENSG00000187815		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	24708	protein-coding gene	gene with protein product	"""ZFP69 zinc finger protein A"""		"""zinc finger protein 642"""	ZNF642			Standard	XM_005270808		Approved	ZKSCAN23A, FLJ16030, ZFP69A, ZSCAN54A	uc001cfo.3	Q49AA0	OTTHUMG00000007303	ENST00000372706.1:c.81G>T	1.37:g.40945114G>T	ENSP00000361791:p.Glu27Asp		Q5SWM5|Q6ZWK8	Missense_Mutation	SNP	ENST00000372706.1	37	CCDS30686.1	.	.	.	.	.	.	.	.	.	.	.	12.24	1.877280	0.33162	.	.	ENSG00000187815	ENST00000372706;ENST00000372705	T;T	0.08546	3.08;3.08	4.44	0.385	0.16249	.	0.234704	0.21947	N	0.066796	T	0.11153	0.0272	M	0.86573	2.825	0.21290	N	0.999732	P	0.34522	0.455	B	0.26416	0.069	T	0.12192	-1.0557	10	0.66056	D	0.02	.	7.1207	0.25442	0.3992:0.0:0.6008:0.0	.	27	Q49AA0	ZN642_HUMAN	D	27	ENSP00000361791:E27D;ENSP00000361790:E27D	ENSP00000361790:E27D	E	+	3	2	ZNF642	40717701	0.996000	0.38824	0.301000	0.25044	0.021000	0.10359	1.378000	0.34328	-0.023000	0.13963	-0.150000	0.13652	GAG		0.552	ZFP69-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019082.1		NM_198494	
ZNF777	27153	hgsc.bcm.edu;ucsc.edu	37	7	149133877	149133877	+	Missense_Mutation	SNP	G	G	T	rs368317468		TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr7:149133877G>T	ENST00000247930.4	-	5	1451	c.1128C>A	c.(1126-1128)aaC>aaA	p.N376K		NM_015694.2	NP_056509.2	Q9ULD5	ZN777_HUMAN	zinc finger protein 777	376	Glu-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(5)|lung(17)|ovary(1)|skin(2)|urinary_tract(1)	26	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			AGCCCTCGTCGTTGGTCTGTA	0.572																																																	0													84.0	86.0	85.0					7																	149133877		1960	4136	6096	SO:0001583	missense	27153			AB033111	CCDS43675.1	7q36.1	2013-01-08			ENSG00000196453	ENSG00000196453		"""Zinc fingers, C2H2-type"", ""-"""	22213	protein-coding gene	gene with protein product							Standard	NM_015694		Approved	KIAA1285	uc003wfv.3	Q9ULD5	OTTHUMG00000158967	ENST00000247930.4:c.1128C>A	7.37:g.149133877G>T	ENSP00000247930:p.Asn376Lys		Q8N2R2|Q8N659	Missense_Mutation	SNP	ENST00000247930.4	37	CCDS43675.1	.	.	.	.	.	.	.	.	.	.	G	16.88	3.245104	0.59103	.	.	ENSG00000196453	ENST00000247930;ENST00000314683	T	0.04706	3.57	5.66	-2.26	0.06867	.	0.000000	0.64402	D	0.000014	T	0.07818	0.0196	N	0.24115	0.695	0.28815	N	0.898025	D	0.71674	0.998	D	0.81914	0.995	T	0.12142	-1.0559	10	0.25751	T	0.34	-34.4006	10.8812	0.46939	0.5718:0.0:0.4282:0.0	.	376	Q9ULD5-2	.	K	376;119	ENSP00000247930:N376K	ENSP00000247930:N376K	N	-	3	2	ZNF777	148764810	0.150000	0.22732	0.983000	0.44433	0.992000	0.81027	-0.730000	0.04915	-0.365000	0.08076	0.555000	0.69702	AAC		0.572	ZNF777-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352708.1		NM_015694	
ZNFX1	57169	hgsc.bcm.edu;ucsc.edu	37	20	47874148	47874148	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4691-01A-01D-1361-10	TCGA-B0-4691-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	349d9df2-d3d8-46ba-b3d6-f34692b1f9fd	dd70d55f-aea5-4de6-89bf-e4e6cd32f2f3	g.chr20:47874148C>G	ENST00000396105.1	-	8	2716	c.2470G>C	c.(2470-2472)Gag>Cag	p.E824Q	ZNFX1_ENST00000371752.1_Missense_Mutation_p.E824Q|ZNFX1_ENST00000371754.4_Missense_Mutation_p.E824Q	NM_021035.2	NP_066363.1	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	824							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(8)|kidney(7)|large_intestine(15)|liver(1)|lung(17)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	60			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			TCTGCGATCTCTATCAGCGAA	0.532																																																	0													123.0	103.0	110.0					20																	47874148		2203	4300	6503	SO:0001583	missense	57169			AK022641	CCDS13417.1	20q13.13	2014-02-12			ENSG00000124201	ENSG00000124201			29271	protein-coding gene	gene with protein product						10718198	Standard	NM_021035		Approved	KIAA1404, FLJ11277	uc002xui.3	Q9P2E3	OTTHUMG00000032696	ENST00000396105.1:c.2470G>C	20.37:g.47874148C>G	ENSP00000379412:p.Glu824Gln		Q9BQM7|Q9BQM8|Q9H8C1|Q9H9S2|Q9NUM1|Q9NWW1	Missense_Mutation	SNP	ENST00000396105.1	37	CCDS13417.1	.	.	.	.	.	.	.	.	.	.	C	17.23	3.336972	0.60963	.	.	ENSG00000124201	ENST00000396106;ENST00000371754;ENST00000371752;ENST00000396105;ENST00000371744;ENST00000455070	D;D;D;T;D	0.87029	-1.96;-2.2;-2.2;-0.86;-1.57	5.87	4.9	0.64082	.	0.241583	0.44483	D	0.000459	D	0.85017	0.5601	L	0.50333	1.59	0.42796	D	0.993918	B	0.31459	0.324	B	0.38985	0.287	T	0.81422	-0.0940	10	0.27785	T	0.31	-11.1755	11.8114	0.52185	0.0:0.9099:0.0:0.0901	.	824	Q9P2E3	ZNFX1_HUMAN	Q	824;824;824;824;824;628	ENSP00000360819:E824Q;ENSP00000360817:E824Q;ENSP00000379412:E824Q;ENSP00000360809:E824Q;ENSP00000413800:E628Q	ENSP00000360809:E824Q	E	-	1	0	ZNFX1	47307555	0.995000	0.38212	0.985000	0.45067	0.537000	0.34900	3.402000	0.52608	1.394000	0.46624	0.655000	0.94253	GAG		0.532	ZNFX1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079647.2		NM_021035	
