#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
AAAS	8086	broad.mit.edu	37	12	53708552	53708552	+	Silent	SNP	A	A	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr12:53708552A>T	ENST00000209873.4	-	6	693	c.528T>A	c.(526-528)cgT>cgA	p.R176R	AAAS_ENST00000550286.1_Silent_p.R52R|AAAS_ENST00000394384.3_Intron|AAAS_ENST00000549983.1_5'UTR	NM_015665.5	NP_056480.1	Q9NRG9	AAAS_HUMAN	achalasia, adrenocortical insufficiency, alacrimia	176					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|learning (GO:0007612)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nucleocytoplasmic transport (GO:0006913)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|regulation of nucleocytoplasmic transport (GO:0046822)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)		p.R176R(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(2)	20						CATTATACACACGGACTGAGT	0.547																																																	1	Substitution - coding silent(1)	kidney(1)											88.0	69.0	76.0					12																	53708552		2203	4300	6503	SO:0001819	synonymous_variant	8086			AJ289841	CCDS8856.1, CCDS53797.1	12q13	2013-06-27	2010-06-24		ENSG00000094914	ENSG00000094914		"""WD repeat domain containing"""	13666	protein-coding gene	gene with protein product	"""aladin"", ""Allgrove, triple-A"""	605378	"""achalasia, adrenocortical insufficiency, alacrimia (Allgrove, triple-A)"""			11062474	Standard	NM_015665		Approved		uc001scr.4	Q9NRG9	OTTHUMG00000169729	ENST00000209873.4:c.528T>A	12.37:g.53708552A>T			Q5JB47|Q9NWI6|Q9UG19	Silent	SNP	ENST00000209873.4	37	CCDS8856.1																																																																																				0.547	AAAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405632.1			
ABCA10	10349	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	67189998	67189998	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr17:67189998A>T	ENST00000269081.4	-	14	2387	c.1478T>A	c.(1477-1479)tTt>tAt	p.F493Y	ABCA10_ENST00000416101.2_Intron	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	493	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.F493Y(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					TATTTTAGCAAATACCCTGAG	0.333																																																	1	Substitution - Missense(1)	kidney(1)											132.0	135.0	134.0					17																	67189998		2203	4300	6503	SO:0001583	missense	10349			AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.1478T>A	17.37:g.67189998A>T	ENSP00000269081:p.Phe493Tyr		C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	Missense_Mutation	SNP	ENST00000269081.4	37	CCDS11684.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.059916	0.76074	.	.	ENSG00000154263	ENST00000269081	T	0.38887	1.11	3.71	2.54	0.30619	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.33235	U	0.005137	T	0.36880	0.0983	L	0.31578	0.945	0.80722	D	1	D;P	0.60575	0.988;0.872	P;P	0.52454	0.699;0.699	T	0.05632	-1.0873	10	0.27785	T	0.31	.	9.3042	0.37865	0.84:0.0:0.0:0.16	.	493;493	E5RFN6;Q8WWZ4	.;ABCAA_HUMAN	Y	493	ENSP00000269081:F493Y	ENSP00000269081:F493Y	F	-	2	0	ABCA10	64701593	1.000000	0.71417	0.422000	0.26621	0.989000	0.77384	6.316000	0.72857	1.531000	0.49152	0.455000	0.32223	TTT		0.333	ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379881.4		NM_080282	
ABCD4	5826	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	74757105	74757105	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr14:74757105C>G	ENST00000356924.4	-	12	1359	c.1216G>C	c.(1216-1218)Gat>Cat	p.D406H	ABCD4_ENST00000298816.7_Missense_Mutation_p.D302H|ABCD4_ENST00000557554.1_5'UTR|AC005519.4_ENST00000554532.2_RNA	NM_005050.3	NP_005041.1	O14678	ABCD4_HUMAN	ATP-binding cassette, sub-family D (ALD), member 4	406	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cobalamin metabolic process (GO:0009235)|transmembrane transport (GO:0055085)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.D406H(1)		cervix(2)|endometrium(3)|kidney(3)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	27				BRCA - Breast invasive adenocarcinoma(234;0.00153)		AGGCTCAGATCCTTGATTAGG	0.607											OREG0022800	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - Missense(1)	kidney(1)											134.0	137.0	136.0					14																	74757105		2203	4300	6503	SO:0001583	missense	5826			AF009746	CCDS9828.1	14q24	2012-03-14			ENSG00000119688	ENSG00000119688		"""ATP binding cassette transporters / subfamily D"""	68	protein-coding gene	gene with protein product		603214		PXMP1L		9266848, 9302272	Standard	NR_003256		Approved	PMP69, P70R, EST352188	uc001xpr.2	O14678	OTTHUMG00000171207	ENST00000356924.4:c.1216G>C	14.37:g.74757105C>G	ENSP00000349396:p.Asp406His	1155	A8K5L7|Q6IAQ0|Q96E75	Missense_Mutation	SNP	ENST00000356924.4	37	CCDS9828.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.0|28.0	4.879677|4.879677	0.91740|0.91740	.|.	.|.	ENSG00000119688|ENSG00000119688	ENST00000356924;ENST00000298816|ENST00000556517	D;D|.	0.99872|.	-2.84;-7.37|.	4.99|4.99	4.99|4.99	0.66335|0.66335	ABC transporter-like (1);|.	0.049027|.	0.85682|.	D|.	0.000000|.	T|T	0.73265|0.73265	0.3565|0.3565	M|M	0.62209|0.62209	1.925|1.925	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;0.999;0.999;0.999|.	D;D;D;D|.	0.74348|.	0.983;0.971;0.962;0.96|.	T|T	0.71649|0.71649	-0.4529|-0.4529	10|5	0.59425|.	D|.	0.04|.	.|.	18.4618|18.4618	0.90741|0.90741	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	302;302;406;406|.	F8W7M4;B7Z4V6;A8K5L7;O14678|.	.;.;.;ABCD4_HUMAN|.	H|S	406;302|17	ENSP00000349396:D406H;ENSP00000298816:D302H|.	ENSP00000298816:D302H|.	D|R	-|-	1|3	0|2	ABCD4|ABCD4	73826858|73826858	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.956000|0.956000	0.61745|0.61745	7.280000|7.280000	0.78610|0.78610	2.577000|2.577000	0.86979|0.86979	0.561000|0.561000	0.74099|0.74099	GAT|AGG		0.607	ABCD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314382.1		NM_005050	
ABLIM1	3983	hgsc.bcm.edu	37	10	116417921	116417922	+	Frame_Shift_Ins	INS	-	-	AAAA			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr10:116417921_116417922insAAAA	ENST00000277895.5	-	1	135_136	c.38_39insTTTT	c.(37-39)ttgfs	p.L13fs	ABLIM1_ENST00000369252.4_Intron|ABLIM1_ENST00000533213.2_Intron|snoU13_ENST00000458910.1_RNA	NM_002313.5	NP_002304.3	O14639	ABLM1_HUMAN	actin binding LIM protein 1	13					axon guidance (GO:0007411)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|lamellipodium assembly (GO:0030032)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|visual perception (GO:0007601)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	30		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)		CAGAGCTGCACAATTTCCCCAG	0.54																																																	0																																										SO:0001589	frameshift_variant	3983			AF005654	CCDS7590.1, CCDS31289.1	10q25	2008-07-07		2002-09-13	ENSG00000099204	ENSG00000099204			78	protein-coding gene	gene with protein product		602330		LIMAB1, ABLIM		9245787	Standard	NM_002313		Approved	abLIM, limatin	uc021pyw.1	O14639	OTTHUMG00000019088	ENST00000277895.5:c.38_39insTTTT	10.37:g.116417921_116417922insAAAA	ENSP00000277895:p.Leu13fs		A6NI16|A6NJ06|A8MXA9|B3KVH2|Q15039|Q5JVV1|Q5JVV2|Q5T6N2|Q5T6N3|Q5T6N5|Q68CQ9|Q9BUP1	Frame_Shift_Ins	INS	ENST00000277895.5	37	CCDS7590.1																																																																																				0.540	ABLIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050469.3			
ABTB2	25841	hgsc.bcm.edu	37	11	34378374	34378374	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr11:34378374C>A	ENST00000435224.2	-	1	1181	c.757G>T	c.(757-759)Gat>Tat	p.D253Y	ABTB2_ENST00000298992.2_Missense_Mutation_p.D67Y	NM_145804.2	NP_665803.2	Q8N961	ABTB2_HUMAN	ankyrin repeat and BTB (POZ) domain containing 2	253					cellular response to toxic substance (GO:0097237)	nucleus (GO:0005634)				breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(20;0.0691)				CCTCCGCCATCAGGGCTGTGG	0.662																																																	0													22.0	20.0	21.0					11																	34378374		2202	4297	6499	SO:0001583	missense	25841			AK056863	CCDS7890.1, CCDS7890.2	11p13	2013-10-02			ENSG00000166016	ENSG00000166016		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23842	protein-coding gene	gene with protein product							Standard	NM_145804		Approved	DKFZP586C1619, BTBD22, ABTB2A	uc001mvl.2	Q8N961	OTTHUMG00000044382	ENST00000435224.2:c.757G>T	11.37:g.34378374C>A	ENSP00000410157:p.Asp253Tyr		A8K6S9|E9PRW7|Q52LD6|Q6MZW4|Q8NB44	Missense_Mutation	SNP	ENST00000435224.2	37	CCDS7890.2	.	.	.	.	.	.	.	.	.	.	C	15.36	2.809138	0.50421	.	.	ENSG00000166016	ENST00000435224;ENST00000298992	T;T	0.60299	0.2;0.2	4.96	4.96	0.65561	Histone-fold (2);	0.296847	0.31347	N	0.007807	T	0.64907	0.2641	M	0.83223	2.63	0.50813	D	0.999897	P	0.51653	0.947	P	0.44561	0.453	T	0.73225	-0.4050	10	0.59425	D	0.04	-14.9652	15.4021	0.74849	0.0:1.0:0.0:0.0	.	67	Q8N961	ABTB2_HUMAN	Y	253;67	ENSP00000410157:D253Y;ENSP00000298992:D67Y	ENSP00000298992:D67Y	D	-	1	0	ABTB2	34334950	0.989000	0.36119	0.994000	0.49952	0.708000	0.40852	3.265000	0.51561	2.296000	0.77279	0.455000	0.32223	GAT		0.662	ABTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388703.3		NM_145804	
ACTR1A	10121	hgsc.bcm.edu	37	10	104248835	104248859	+	Frame_Shift_Del	DEL	AATGAAGATGTCGCCTTCAAGGGCT	AATGAAGATGTCGCCTTCAAGGGCT	-	rs34205116|rs145976767		TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	AATGAAGATGTCGCCTTCAAGGGCT	AATGAAGATGTCGCCTTCAAGGGCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr10:104248835_104248859delAATGAAGATGTCGCCTTCAAGGGCT	ENST00000369905.4	-	3	213_237	c.150_174delAGCCCTTGAAGGCGACATCTTCATT	c.(148-174)ggagcccttgaaggcgacatcttcattfs	p.GALEGDIFI50fs	ACTR1A_ENST00000446605.2_Frame_Shift_Del_p.GALEGDIFI3fs|ACTR1A_ENST00000487599.1_Frame_Shift_Del_p.GALEGDIFI50fs|ACTR1A_ENST00000545684.1_Intron	NM_005736.3	NP_005727.1	P61163	ACTZ_HUMAN	ARP1 actin-related protein 1 homolog A, centractin alpha (yeast)	50					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|vesicle-mediated transport (GO:0016192)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|extracellular vesicular exosome (GO:0070062)|microtubule associated complex (GO:0005875)	ATP binding (GO:0005524)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	13		Colorectal(252;0.122)		Epithelial(162;5.34e-09)|all cancers(201;1.43e-07)|BRCA - Breast invasive adenocarcinoma(275;0.222)		CTTTGGGGCCAATGAAGATGTCGCCTTCAAGGGCTCCTGCCATGA	0.489																																																	0																																										SO:0001589	frameshift_variant	10121			X82206	CCDS7536.1	10q24	2008-07-08	2001-11-28		ENSG00000138107	ENSG00000138107			167	protein-coding gene	gene with protein product		605143	"""ARP1 (actin-related protein 1, yeast) homolog A (centractin alpha)"""			1528266	Standard	NM_005736		Approved	ARP1	uc001kvv.3	P61163	OTTHUMG00000018956	ENST00000369905.4:c.150_174delAGCCCTTGAAGGCGACATCTTCATT	10.37:g.104248835_104248859delAATGAAGATGTCGCCTTCAAGGGCT	ENSP00000358921:p.Gly50fs		B2R6B0|P42024	Frame_Shift_Del	DEL	ENST00000369905.4	37	CCDS7536.1																																																																																				0.489	ACTR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050053.1			
AKAP2	11217	hgsc.bcm.edu	37	9	112900341	112900342	+	In_Frame_Ins	INS	-	-	GAAGCT	rs373159646|rs34665027|rs150402481	byFrequency	TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr9:112900341_112900342insGAAGCT	ENST00000259318.7	+	2	2031_2032	c.1824_1825insGAAGCT	c.(1825-1827)gaa>GAAGCTgaa	p.609_609E>EAE	PALM2-AKAP2_ENST00000302798.7_In_Frame_Ins_p.840_840E>EAE|AKAP2_ENST00000510514.5_In_Frame_Ins_p.840_840E>EAE|AKAP2_ENST00000374525.1_In_Frame_Ins_p.698_698E>EAE|AKAP2_ENST00000434623.2_In_Frame_Ins_p.698_698E>EAE|PALM2-AKAP2_ENST00000374530.3_In_Frame_Ins_p.840_840E>EAE|AKAP2_ENST00000555236.1_In_Frame_Ins_p.840_840E>EAE	NM_001136562.2	NP_001130034.1	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2	609								p.E839_E840insEA(1)|p.E697_E698insEA(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	33						CGACTGTAGAGGAAGCTGAAGC	0.505														656	0.13099	0.1309	0.0821	5008	,	,		20174	0.2133		0.1362	False		,,,				2504	0.0757																2	Insertion - In frame(2)	lung(2)							,,,,	550,3714		39,472,1621					,,,,	2.7	0.9		dbSNP_134	39	1146,7108		82,982,3063	no	coding,coding,coding,coding,coding	AKAP2,PALM2-AKAP2	NM_147150.2,NM_007203.4,NM_001198656.1,NM_001136562.2,NM_001004065.4	,,,,	121,1454,4684	A1A1,A1R,RR		13.8842,12.8987,13.5485	,,,,	,,,,		1696,10822				SO:0001652	inframe_insertion	11217			AB023137	CCDS43861.1, CCDS48003.1, CCDS56581.1	9q31.3	2009-10-16			ENSG00000241978	ENSG00000241978		"""A-kinase anchor proteins"""	372	protein-coding gene	gene with protein product	"""protein kinase A2"""	604582		PRKA2		10231032	Standard	NM_001136562		Approved	AKAP-KL, KIAA0920, DKFZp564L0716		Q9Y2D5	OTTHUMG00000156811	ENST00000259318.7:c.1831_1836dupGAAGCT	9.37:g.112900342_112900347dupGAAGCT	Exception_encountered		B1ALX9|B2RTU4|B3KQ00|B4DTZ2|B7ZW07|B9EJB5|Q9UG26	In_Frame_Ins	INS	ENST00000259318.7	37	CCDS48003.1																																																																																				0.505	AKAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346067.3		NM_001004065	
AKAP9	10142	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	91668040	91668040	+	Nonsense_Mutation	SNP	C	C	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr7:91668040C>G	ENST00000359028.2	+	18	4907	c.4682C>G	c.(4681-4683)tCa>tGa	p.S1561*	AKAP9_ENST00000358100.2_Nonsense_Mutation_p.S1561*|AKAP9_ENST00000356239.3_Nonsense_Mutation_p.S1549*			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	1561					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)	p.S1549*(1)|p.S1561*(1)		NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			CTGACTATTTCAGAAGAAATG	0.308			T	BRAF	papillary thyroid																																			Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	2	Substitution - Nonsense(2)	kidney(2)											58.0	66.0	64.0					7																	91668040		2202	4293	6495	SO:0001587	stop_gained	10142			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.4682C>G	7.37:g.91668040C>G	ENSP00000351922:p.Ser1561*		A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Nonsense_Mutation	SNP	ENST00000359028.2	37		.	.	.	.	.	.	.	.	.	.	C	44	10.896752	0.99485	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394565	.	.	.	5.24	5.24	0.73138	.	0.000000	0.32548	N	0.005951	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	17.3736	0.87385	0.0:1.0:0.0:0.0	.	.	.	.	X	1549;1561;1561;1561;1561	.	ENSP00000348573:S1549X	S	+	2	0	AKAP9	91505976	1.000000	0.71417	1.000000	0.80357	0.797000	0.45037	3.265000	0.51561	2.602000	0.87976	0.591000	0.81541	TCA		0.308	AKAP9-202	KNOWN	basic	protein_coding	protein_coding			NM_005751	
AKT2	208	broad.mit.edu	37	19	40742001	40742001	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr19:40742001T>C	ENST00000392038.2	-	11	1269	c.971A>G	c.(970-972)gAc>gGc	p.D324G	AKT2_ENST00000424901.1_Missense_Mutation_p.D324G|AKT2_ENST00000311278.6_Missense_Mutation_p.D281G|AKT2_ENST00000579047.1_Missense_Mutation_p.D262G	NM_001243027.1|NM_001243028.1|NM_001626.4	NP_001229956.1|NP_001229957.1|NP_001617.1	P31751	AKT2_HUMAN	v-akt murine thymoma viral oncogene homolog 2	324	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of Ral GTPase activity (GO:0032859)|apoptotic process (GO:0006915)|carbohydrate transport (GO:0008643)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|fat cell differentiation (GO:0045444)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|insulin receptor signaling pathway (GO:0008286)|intracellular protein transmembrane transport (GO:0065002)|mammary gland epithelial cell differentiation (GO:0060644)|membrane organization (GO:0061024)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|peripheral nervous system myelin maintenance (GO:0032287)|positive regulation of cell motility (GO:2000147)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)|protein localization to plasma membrane (GO:0072659)|regulation of cell cycle arrest (GO:0071156)|regulation of cell migration (GO:0030334)|regulation of translation (GO:0006417)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)	p.D324G(1)		breast(1)|cervix(1)|kidney(3)|large_intestine(9)|lung(10)|prostate(2)|skin(1)	27			Lung(22;0.000499)			ATAGTCATTGTCCTCCAGCAC	0.637			A		"""ovarian, pancreatic """																																			Dom	yes		19	19q13.1-q13.2	208	v-akt murine thymoma viral oncogene homolog 2		E	1	Substitution - Missense(1)	kidney(1)											72.0	58.0	62.0					19																	40742001		2203	4300	6503	SO:0001583	missense	208			M77198	CCDS12552.1	19q13.1-q13.2	2013-01-10			ENSG00000105221	ENSG00000105221	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	392	protein-coding gene	gene with protein product		164731				1409633	Standard	NM_001626		Approved		uc002onf.3	P31751	OTTHUMG00000137375	ENST00000392038.2:c.971A>G	19.37:g.40742001T>C	ENSP00000375892:p.Asp324Gly		B2RBD8|Q05BV0|Q0VAN0|Q0VAN1|Q68GC0	Missense_Mutation	SNP	ENST00000392038.2	37	CCDS12552.1	.	.	.	.	.	.	.	.	.	.	T	25.7	4.661738	0.88154	.	.	ENSG00000105221	ENST00000392038;ENST00000391844;ENST00000424901;ENST00000311278;ENST00000391845	T;T;T	0.20069	2.1;2.1;2.1	5.66	5.66	0.87406	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.042391	0.85682	D	0.000000	T	0.18173	0.0436	N	0.00778	-1.195	0.80722	D	1	B;B;D	0.76494	0.02;0.11;0.999	B;B;D	0.77004	0.116;0.196;0.989	T	0.56444	-0.7978	10	0.39692	T	0.17	.	14.8659	0.70416	0.0:0.0:0.0:1.0	.	262;281;324	B4DG79;Q0VAN0;P31751	.;.;AKT2_HUMAN	G	324;225;324;281;144	ENSP00000375892:D324G;ENSP00000399532:D324G;ENSP00000309428:D281G	ENSP00000309428:D281G	D	-	2	0	AKT2	45433841	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.994000	0.88315	2.159000	0.67721	0.459000	0.35465	GAC		0.637	AKT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268029.1		NM_001626	
ALG5	29880	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	37567752	37567752	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr13:37567752G>C	ENST00000239891.3	-	4	409	c.343C>G	c.(343-345)Cag>Gag	p.Q115E	ALG5_ENST00000443765.1_Intron|ALG5_ENST00000413537.2_Missense_Mutation_p.Q115E|ALG5_ENST00000496689.1_5'UTR	NM_013338.4	NP_037470.1	Q9Y673	ALG5_HUMAN	ALG5, dolichyl-phosphate beta-glucosyltransferase	115					cellular protein metabolic process (GO:0044267)|determination of left/right symmetry (GO:0007368)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	dolichyl-phosphate beta-glucosyltransferase activity (GO:0004581)|oligosaccharyl transferase activity (GO:0004576)	p.Q115E(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)	11		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)		all cancers(112;5.79e-07)|Epithelial(112;1.81e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00785)|BRCA - Breast invasive adenocarcinoma(63;0.0127)|GBM - Glioblastoma multiforme(144;0.0472)		TTTGAGGTCTGATCTTTACTG	0.343																																																	1	Substitution - Missense(1)	kidney(1)											130.0	125.0	126.0					13																	37567752		2203	4300	6503	SO:0001583	missense	29880			AF088028	CCDS9361.1, CCDS45033.1	13q13.1	2013-02-22	2013-02-21		ENSG00000120697	ENSG00000120697	2.4.1.117	"""Glycosyltransferase family 2 domain containing"""	20266	protein-coding gene	gene with protein product		604565	"""asparagine-linked glycosylation 5 homolog (yeast, dolichyl-phosphate beta-glucosyltransferase)"", ""asparagine-linked glycosylation 5, dolichyl-phosphate beta-glucosyltransferase homolog (S. cerevisiae)"""			10359825	Standard	NM_013338		Approved	bA421P11.2	uc001uvy.3	Q9Y673	OTTHUMG00000016741	ENST00000239891.3:c.343C>G	13.37:g.37567752G>C	ENSP00000239891:p.Gln115Glu		B4DR37|Q5TBA6	Missense_Mutation	SNP	ENST00000239891.3	37	CCDS9361.1	.	.	.	.	.	.	.	.	.	.	G	0.105	-1.146190	0.01714	.	.	ENSG00000120697	ENST00000239891;ENST00000413537	T;T	0.56776	0.44;0.44	5.51	1.51	0.23008	Glycosyl transferase, family 2 (1);	0.345278	0.33916	N	0.004438	T	0.34279	0.0892	N	0.20357	0.565	0.33107	D	0.540003	B	0.02656	0.0	B	0.09377	0.004	T	0.29366	-1.0014	10	0.30078	T	0.28	-20.5088	11.5955	0.50970	0.0:0.3077:0.4795:0.2128	.	115	Q9Y673	ALG5_HUMAN	E	115	ENSP00000239891:Q115E;ENSP00000389647:Q115E	ENSP00000239891:Q115E	Q	-	1	0	ALG5	36465752	1.000000	0.71417	0.995000	0.50966	0.176000	0.22953	1.646000	0.37249	0.016000	0.14998	-1.357000	0.01221	CAG		0.343	ALG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044528.2		NM_013338	
ASXL2	55252	broad.mit.edu;hgsc.bcm.edu	37	2	26029201	26029201	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr2:26029201G>A	ENST00000435504.4	-	4	442	c.149C>T	c.(148-150)aCt>aTt	p.T50I	ASXL2_ENST00000272341.4_5'UTR|ASXL2_ENST00000336112.4_Missense_Mutation_p.T22I|ASXL2_ENST00000497092.1_5'UTR			Q76L83	ASXL2_HUMAN	additional sex combs like transcriptional regulator 2	50					adult heart development (GO:0007512)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone H3-K27 trimethylation (GO:1902466)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)	p.T50I(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(3)	33	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AAGAGGAGAAGTCCCACTGCA	0.373																																																	1	Substitution - Missense(1)	kidney(1)											44.0	42.0	42.0					2																	26029201		1903	4124	6027	SO:0001583	missense	55252					2p24.1	2014-06-17	2014-06-17		ENSG00000143970	ENSG00000143970			23805	protein-coding gene	gene with protein product		612991	"""additional sex combs like 2 (Drosophila)"""			12888926	Standard	NM_018263		Approved	ASXH2, FLJ10898, KIAA1685	uc002rgs.2	Q76L83	OTTHUMG00000152176	ENST00000435504.4:c.149C>T	2.37:g.26029201G>A	ENSP00000391447:p.Thr50Ile		Q53TC9|Q5H9U4|Q76L81|Q86XM1|Q9C0H8|Q9NV67	Missense_Mutation	SNP	ENST00000435504.4	37		.	.	.	.	.	.	.	.	.	.	G	24.2	4.505443	0.85282	.	.	ENSG00000143970	ENST00000435504;ENST00000336112	T;T	0.28666	1.85;1.6	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.55641	0.1933	M	0.67397	2.05	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.58457	-0.7633	10	0.87932	D	0	-17.0653	17.5725	0.87939	0.0:0.0:1.0:0.0	.	50	Q76L83	ASXL2_HUMAN	I	50;22	ENSP00000391447:T50I;ENSP00000337250:T22I	ENSP00000337250:T22I	T	-	2	0	ASXL2	25882705	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.285000	0.95894	2.572000	0.86782	0.563000	0.77884	ACT		0.373	ASXL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000325593.3		NM_018263	
ATP12A	479	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	25281239	25281239	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr13:25281239G>A	ENST00000381946.3	+	16	2415	c.2248G>A	c.(2248-2250)Ggg>Agg	p.G750R	ATP12A_ENST00000218548.6_Missense_Mutation_p.G756R			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	750					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)	p.G750R(1)		breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		GATTGCCATGGGGATAGCAGG	0.552																																					Pancreas(156;1582 1935 18898 22665 26498)												1	Substitution - Missense(1)	kidney(1)											98.0	81.0	87.0					13																	25281239		2203	4300	6503	SO:0001583	missense	479			L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.2248G>A	13.37:g.25281239G>A	ENSP00000371372:p.Gly750Arg		Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Missense_Mutation	SNP	ENST00000381946.3	37	CCDS31948.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.978037	0.74360	.	.	ENSG00000075673	ENST00000218548;ENST00000381946	D;D	0.99051	-5.37;-5.37	5.81	5.81	0.92471	HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.99609	0.9858	H	0.97783	4.075	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97810	1.0250	10	0.87932	D	0	.	17.5599	0.87903	0.0:0.0:1.0:0.0	.	756;750	P54707-2;P54707	.;AT12A_HUMAN	R	756;750	ENSP00000218548:G756R;ENSP00000371372:G750R	ENSP00000218548:G756R	G	+	1	0	ATP12A	24179239	1.000000	0.71417	1.000000	0.80357	0.212000	0.24457	9.742000	0.98846	2.739000	0.93911	0.563000	0.77884	GGG		0.552	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044199.1		NM_001676	
ATP8B3	148229	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	1807166	1807166	+	Splice_Site	SNP	C	C	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr19:1807166C>T	ENST00000310127.6	-	6	854		c.e6+1		ATP8B3_ENST00000539485.1_Splice_Site|ATP8B3_ENST00000525591.1_Splice_Site|ATP8B3_ENST00000526092.2_Splice_Site	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3						binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.?(1)		central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACAGCACTCACCATGTCGTCC	0.662																																																	1	Unknown(1)	kidney(1)											110.0	122.0	118.0					19																	1807166		2135	4243	6378	SO:0001630	splice_region_variant	148229			AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.615+1G>A	19.37:g.1807166C>T			Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Splice_Site	SNP	ENST00000310127.6	37	CCDS45901.1	.	.	.	.	.	.	.	.	.	.	C	10.72	1.430001	0.25726	.	.	ENSG00000130270	ENST00000310127;ENST00000539485;ENST00000525591;ENST00000526092;ENST00000382339;ENST00000533993	.	.	.	3.9	3.9	0.45041	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8619	0.70387	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ATP8B3	1758166	1.000000	0.71417	0.519000	0.27824	0.025000	0.11179	5.308000	0.65768	1.696000	0.51158	0.561000	0.74099	.		0.662	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388279.1		NM_138813	Intron
BAP1	8314	hgsc.bcm.edu;ucsc.edu	37	3	52439864	52439864	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr3:52439864delT	ENST00000460680.1	-	10	1319	c.848delA	c.(847-849)gagfs	p.E284fs	BAP1_ENST00000296288.5_Frame_Shift_Del_p.E266fs	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	195					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E283_S285del(1)		NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		CTTGGACTCCTCAGGCAGCTG	0.562			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															GBM(101;493 1458 7992 21037 25532)			Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	1	Deletion - In frame(1)	eye(1)											67.0	67.0	67.0					3																	52439864		2203	4300	6503	SO:0001589	frameshift_variant	8314			AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.848delA	3.37:g.52439864delT	ENSP00000417132:p.Glu284fs		B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Frame_Shift_Del	DEL	ENST00000460680.1	37	CCDS2853.1																																																																																				0.562	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1			
BTAF1	9044	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	93768666	93768666	+	Silent	SNP	T	T	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr10:93768666T>G	ENST00000265990.6	+	27	4202	c.3894T>G	c.(3892-3894)acT>acG	p.T1298T	BTAF1_ENST00000544642.1_Silent_p.T126T	NM_003972.2	NP_003963.1	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa	1298	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T1298T(1)		central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(6)	59		Colorectal(252;0.0846)				TAGGAAAAACTTTACAGTCCA	0.333																																																	1	Substitution - coding silent(1)	kidney(1)											89.0	91.0	90.0					10																	93768666		2202	4300	6502	SO:0001819	synonymous_variant	9044			AJ001017	CCDS7419.1	10q22-q23	2013-05-01	2013-05-01		ENSG00000095564	ENSG00000095564			17307	protein-coding gene	gene with protein product	"""Mot1 homolog (S. cerevisiae)"""	605191	"""BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170 kD (Mot1 homolog, S. cerevisiae)"""			9342322, 9488487	Standard	NM_003972		Approved	TAFII170, TAF172, MOT1, TAF-172, TAF(II)170	uc001khr.3	O14981	OTTHUMG00000018752	ENST00000265990.6:c.3894T>G	10.37:g.93768666T>G			B4E0W6|O43578	Silent	SNP	ENST00000265990.6	37	CCDS7419.1																																																																																				0.333	BTAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049380.4		NM_003972	
KIAA1549L	25758	broad.mit.edu;hgsc.bcm.edu	37	11	33566496	33566496	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr11:33566496C>G	ENST00000321505.4	+	2	2246	c.2066C>G	c.(2065-2067)aCa>aGa	p.T689R	KIAA1549L_ENST00000389726.3_Missense_Mutation_p.T695R|KIAA1549L_ENST00000265654.5_Missense_Mutation_p.T695R			Q6ZVL6	K154L_HUMAN	KIAA1549-like	689						integral component of membrane (GO:0016021)		p.T689R(1)|p.T695R(1)									AAAAATGTCACAAACAAGGCC	0.542																																																	2	Substitution - Missense(2)	kidney(2)											66.0	75.0	72.0					11																	33566496		2024	4171	6195	SO:0001583	missense	0			U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.2066C>G	11.37:g.33566496C>G	ENSP00000315295:p.Thr689Arg		B0QYU0	Missense_Mutation	SNP	ENST00000321505.4	37	CCDS44565.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	14.35|14.35	2.509604|2.509604	0.44660|0.44660	.|.	.|.	ENSG00000110427|ENSG00000110427	ENST00000526400|ENST00000321505;ENST00000389726;ENST00000265654;ENST00000536568	.|.	.|.	.|.	4.81|4.81	4.81|4.81	0.61882|0.61882	.|.	.|0.112351	.|0.39759	.|N	.|0.001280	T|T	0.75474|0.75474	0.3854|0.3854	M|M	0.74881|0.74881	2.28|2.28	0.38549|0.38549	D|D	0.9494|0.9494	.|D;B	.|0.71674	.|0.998;0.413	.|P;B	.|0.58721	.|0.844;0.217	T|T	0.81391|0.81391	-0.0954|-0.0954	5|9	.|0.72032	.|D	.|0.01	-8.291|-8.291	16.1171|16.1171	0.81314|0.81314	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|695;695	.|E9PAT2;Q6ZVL6-2	.|.;.	E|R	87|689;695;695;529	.|.	.|ENSP00000265654:T695R	Q|T	+|+	1|2	0|0	C11orf41|C11orf41	33523072|33523072	0.995000|0.995000	0.38212|0.38212	0.795000|0.795000	0.32087|0.32087	0.198000|0.198000	0.23893|0.23893	3.442000|3.442000	0.52900|0.52900	2.248000|2.248000	0.74166|0.74166	0.537000|0.537000	0.68136|0.68136	CAA|ACA		0.542	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317998.1		NM_012194	
MISP	126353	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	757806	757806	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr19:757806C>T	ENST00000215582.6	+	2	963	c.860C>T	c.(859-861)aCc>aTc	p.T287I		NM_173481.2	NP_775752.1	Q8IVT2	MISP_HUMAN	mitotic spindle positioning	287					mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.T287I(1)									TCCCCGGGGACCCCCAAGGAG	0.657																																																	1	Substitution - Missense(1)	kidney(1)											44.0	46.0	46.0					19																	757806		2203	4300	6503	SO:0001583	missense	126353			BC052236	CCDS12042.1	19p13.3	2014-06-25	2013-05-03	2013-05-03	ENSG00000099812	ENSG00000099812			27000	protein-coding gene	gene with protein product	"""mitotic interactor and substrate of Plk1"""	615289	"""chromosome 19 open reading frame 21"""	C19orf21		23574715, 23509069, 24475924	Standard	NM_173481		Approved	DKFZp686H18209, Caprice		Q8IVT2	OTTHUMG00000181786	ENST00000215582.6:c.860C>T	19.37:g.757806C>T	ENSP00000215582:p.Thr287Ile			Missense_Mutation	SNP	ENST00000215582.6	37	CCDS12042.1	.	.	.	.	.	.	.	.	.	.	C	9.082	0.999564	0.19121	.	.	ENSG00000099812	ENST00000215582	T	0.14766	2.48	4.46	2.19	0.27852	.	1.793870	0.03008	N	0.149009	T	0.12860	0.0312	L	0.51422	1.61	0.09310	N	1	B	0.31318	0.319	B	0.25759	0.063	T	0.26573	-1.0099	10	0.33141	T	0.24	-2.5429	2.9926	0.05988	0.2978:0.461:0.1486:0.0926	.	287	Q8IVT2	CS021_HUMAN	I	287	ENSP00000215582:T287I	ENSP00000215582:T287I	T	+	2	0	C19orf21	708806	0.000000	0.05858	0.013000	0.15412	0.058000	0.15608	-0.874000	0.04210	0.870000	0.35726	0.491000	0.48974	ACC		0.657	MISP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457600.2		NM_173481	
C20orf196	149840	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	5843933	5843933	+	Missense_Mutation	SNP	G	G	T	rs372237912		TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr20:5843933G>T	ENST00000303142.6	+	3	529	c.442G>T	c.(442-444)Gcc>Tcc	p.A148S		NM_152504.2	NP_689717.2	Q8IYI0	CT196_HUMAN	chromosome 20 open reading frame 196	148								p.A148S(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|stomach(1)	9						TTTTCAAATGGCCCGGGTGAT	0.517																																																	1	Substitution - Missense(1)	kidney(1)											53.0	52.0	53.0					20																	5843933		2203	4300	6503	SO:0001583	missense	149840			AK057796	CCDS13091.1	20p12.3	2006-07-07			ENSG00000171984	ENSG00000171984			26318	protein-coding gene	gene with protein product						12477932	Standard	NM_152504		Approved	FLJ25067	uc002wmf.3	Q8IYI0	OTTHUMG00000031813	ENST00000303142.6:c.442G>T	20.37:g.5843933G>T	ENSP00000305875:p.Ala148Ser		A8K9J3|Q5TGA9|Q96LU1	Missense_Mutation	SNP	ENST00000303142.6	37	CCDS13091.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.544914	0.86022	.	.	ENSG00000171984	ENST00000303142;ENST00000442185	T;T	0.59502	0.26;0.26	5.64	5.64	0.86602	.	0.000000	0.64402	D	0.000006	T	0.73505	0.3595	M	0.61703	1.905	0.39766	D	0.972099	D	0.89917	1.0	D	0.91635	0.999	T	0.76594	-0.2902	10	0.87932	D	0	-13.9098	15.2004	0.73132	0.0:0.0:1.0:0.0	.	148	Q8IYI0	CT196_HUMAN	S	148;195	ENSP00000305875:A148S;ENSP00000410534:A195S	ENSP00000305875:A148S	A	+	1	0	C20orf196	5791933	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	4.981000	0.63819	2.657000	0.90304	0.655000	0.94253	GCC		0.517	C20orf196-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077882.2		NM_152504	
ANKRD30BP2	149992	broad.mit.edu	37	21	14414855	14414855	+	RNA	SNP	A	A	G	rs201948955		TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr21:14414855A>G	ENST00000507941.1	+	0	95									ankyrin repeat domain 30B pseudogene 2																		GCCAATGGCCATGCAGAAGTA	0.448																																																	0																																												0			AF427490		21q11.2	2010-06-14	2010-06-14	2010-06-14	ENSG00000224309	ENSG00000224309			16620	pseudogene	pseudogene	"""cancer/testis antigen 85"""		"""chromosome 21 open reading frame 99"""	C21orf99		12036297, 17114284	Standard	NR_026916		Approved	CT85, CTSP-1	uc002yja.4		OTTHUMG00000074164		21.37:g.14414855A>G				RNA	SNP	ENST00000507941.1	37																																																																																					0.448	ANKRD30BP2-004	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000372094.1		NR_026916	
CFAP69	79846	hgsc.bcm.edu;ucsc.edu	37	7	89891285	89891285	+	Frame_Shift_Del	DEL	T	T	-	rs575988791		TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr7:89891285delT	ENST00000389297.4	+	4	522	c.271delT	c.(271-273)tttfs	p.F91fs	C7orf63_ENST00000463311.1_3'UTR|C7orf63_ENST00000497910.1_Frame_Shift_Del_p.F91fs|C7orf63_ENST00000316089.8_Frame_Shift_Del_p.F91fs	NM_001039706.2|NM_001160138.1	NP_001034795.2|NP_001153610.1	A5D8W1	CG063_HUMAN		91										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|prostate(3)	37						AGCACAGATATTTAAAATTCT	0.254																																																	0													38.0	40.0	39.0					7																	89891285		1776	4035	5811	SO:0001589	frameshift_variant	79846																														ENST00000389297.4:c.271delT	7.37:g.89891285delT	ENSP00000373948:p.Phe91fs		A3KMP9|B4DYW6|B4DZP7|B9EIM7|Q6V705|Q8IY89|Q9H7C2	Frame_Shift_Del	DEL	ENST00000389297.4	37	CCDS43613.2																																																																																				0.254	C7orf63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139891.4			
CPED1	79974	broad.mit.edu;hgsc.bcm.edu	37	7	120911339	120911339	+	Splice_Site	SNP	G	G	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr7:120911339G>A	ENST00000310396.5	+	22	3190	c.2723G>A	c.(2722-2724)aGt>aAt	p.S908N		NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	908						endoplasmic reticulum (GO:0005783)		p.S908N(1)									TCCAATCAGAGTGAAGTACAG	0.323																																																	1	Substitution - Missense(1)	kidney(1)											69.0	71.0	70.0					7																	120911339		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.2722-1G>A	7.37:g.120911339G>A			A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Missense_Mutation	SNP	ENST00000310396.5	37	CCDS34739.1	.	.	.	.	.	.	.	.	.	.	G	8.302	0.820073	0.16678	.	.	ENSG00000106034	ENST00000310396	T	0.17854	2.25	5.93	3.06	0.35304	.	0.748284	0.13888	N	0.355784	T	0.07954	0.0199	N	0.17474	0.49	0.80722	D	1	B	0.10296	0.003	B	0.10450	0.005	T	0.21381	-1.0247	10	0.12430	T	0.62	-4.4235	2.4311	0.04471	0.225:0.1973:0.4689:0.1087	.	908	A4D0V7	CG058_HUMAN	N	908	ENSP00000309772:S908N	ENSP00000309772:S908N	S	+	2	0	C7orf58	120698575	0.095000	0.21747	1.000000	0.80357	0.989000	0.77384	-0.059000	0.11731	0.803000	0.34113	0.555000	0.69702	AGT		0.323	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346959.1		NM_024913	Missense_Mutation
CACNA1D	776	broad.mit.edu;hgsc.bcm.edu	37	3	53845422	53845422	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr3:53845422A>T	ENST00000350061.5	+	48	6986	c.6475A>T	c.(6475-6477)Acc>Tcc	p.T2159S	CACNA1D_ENST00000422281.2_Missense_Mutation_p.T2135S|CACNA1D_ENST00000288139.4_Missense_Mutation_p.T2179S	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	2159					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)	p.T2179S(1)		breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GATATGCATCACCACCTTGTA	0.582																																																	1	Substitution - Missense(1)	kidney(1)											37.0	35.0	35.0					3																	53845422		2203	4300	6503	SO:0001583	missense	776			AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.6475A>T	3.37:g.53845422A>T	ENSP00000288133:p.Thr2159Ser		B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Missense_Mutation	SNP	ENST00000350061.5	37	CCDS46848.1	.	.	.	.	.	.	.	.	.	.	A	12.66	2.005872	0.35415	.	.	ENSG00000157388	ENST00000350061;ENST00000288139;ENST00000422281;ENST00000481478	D;D;D;D	0.96651	-4.04;-4.08;-4.04;-4.07	5.74	5.74	0.90152	.	0.337294	0.27159	N	0.020647	D	0.96491	0.8855	L	0.46157	1.445	0.80722	D	1	B;B;D;P	0.76494	0.209;0.298;0.999;0.783	B;B;D;B	0.75484	0.068;0.114;0.986;0.314	D	0.94083	0.7346	10	0.05436	T	0.98	.	16.3545	0.83230	1.0:0.0:0.0:0.0	.	2135;1852;2159;2179	B0FYA3;Q59GD8;Q01668;Q01668-2	.;.;CAC1D_HUMAN;.	S	2159;2179;2135;1852	ENSP00000288133:T2159S;ENSP00000288139:T2179S;ENSP00000409174:T2135S;ENSP00000418014:T1852S	ENSP00000288139:T2179S	T	+	1	0	CACNA1D	53820462	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	6.122000	0.71608	2.326000	0.78906	0.533000	0.62120	ACC		0.582	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1		NM_000720	
CARD11	84433	broad.mit.edu;ucsc.edu	37	7	2946320	2946320	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr7:2946320G>C	ENST00000396946.4	-	25	3820	c.3417C>G	c.(3415-3417)atC>atG	p.I1139M		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	1139	Guanylate kinase-like.				Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)	p.I1132M(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		GCTCCTCGCCGATCTTGTCCT	0.652			Mis		DLBCL																																			Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	1	Substitution - Missense(1)	kidney(1)											93.0	77.0	82.0					7																	2946320		2203	4300	6503	SO:0001583	missense	84433			AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.3417C>G	7.37:g.2946320G>C	ENSP00000380150:p.Ile1139Met		A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	ENST00000396946.4	37	CCDS5336.2	.	.	.	.	.	.	.	.	.	.	G	14.36	2.512926	0.44660	.	.	ENSG00000198286	ENST00000396946	T	0.25414	1.8	3.68	-1.88	0.07713	.	0.000000	0.64402	D	0.000004	T	0.38506	0.1043	M	0.71036	2.16	0.30324	N	0.787324	D	0.89917	1.0	D	0.75484	0.986	T	0.32851	-0.9891	10	0.87932	D	0	-21.8247	3.2545	0.06827	0.3319:0.102:0.4529:0.1132	.	1139	Q9BXL7	CAR11_HUMAN	M	1139	ENSP00000380150:I1139M	ENSP00000380150:I1139M	I	-	3	3	CARD11	2912846	0.007000	0.16637	0.141000	0.22245	0.991000	0.79684	-0.005000	0.12855	-0.213000	0.10094	0.511000	0.50034	ATC		0.652	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4		NM_032415	
CBR3	874	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	21	37518699	37518699	+	Silent	SNP	C	C	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr21:37518699C>A	ENST00000290354.5	+	3	1004	c.723C>A	c.(721-723)atC>atA	p.I241I	CBR3-AS1_ENST00000413862.1_RNA|CBR3-AS1_ENST00000608632.1_RNA|CBR3-AS1_ENST00000608641.1_RNA|CBR3-AS1_ENST00000427491.1_RNA|CBR3-AS1_ENST00000608622.1_RNA|CBR3-AS1_ENST00000453159.1_RNA|CBR3-AS1_ENST00000608690.1_RNA	NM_001236.3	NP_001227.1	O75828	CBR3_HUMAN	carbonyl reductase 3	241					cognition (GO:0050890)|phylloquinone catabolic process (GO:0042376)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	3-keto sterol reductase activity (GO:0000253)|carbonyl reductase (NADPH) activity (GO:0004090)|NADPH binding (GO:0070402)	p.I241I(1)		kidney(1)|large_intestine(1)|lung(1)	3					Doxorubicin(DB00997)	AAGACAGCATCAGGACTGTGG	0.567																																																	1	Substitution - coding silent(1)	kidney(1)											92.0	90.0	91.0					21																	37518699		2203	4300	6503	SO:0001819	synonymous_variant	874			AB004854	CCDS13642.1	21q22.2	2011-09-14			ENSG00000159231	ENSG00000159231	1.1.1.184	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	1549	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 21C, member 2"""	603608				9740676, 19027726	Standard	NM_001236		Approved	SDR21C2	uc002yve.3	O75828	OTTHUMG00000086617	ENST00000290354.5:c.723C>A	21.37:g.37518699C>A			Q6FHP2	Silent	SNP	ENST00000290354.5	37	CCDS13642.1																																																																																				0.567	CBR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194632.1			
CCDC125	202243	hgsc.bcm.edu;ucsc.edu	37	5	68607025	68607025	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr5:68607025delC	ENST00000396496.2	-	4	480	c.373delG	c.(373-375)gaafs	p.E125fs	CCDC125_ENST00000460090.1_Intron|CCDC125_ENST00000383374.2_Frame_Shift_Del_p.E124fs|CCDC125_ENST00000511257.1_5'UTR|CCDC125_ENST00000396499.1_Frame_Shift_Del_p.E125fs			Q86Z20	CC125_HUMAN	coiled-coil domain containing 125	125						cytoplasm (GO:0005737)				breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(7)|urinary_tract(1)	19		Lung NSC(167;7.26e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.2e-56)|Epithelial(20;2.31e-52)|all cancers(19;5.85e-48)|Lung(70;0.0183)		TTTAACATTTCTACCTCCTGA	0.363																																																	0													117.0	108.0	111.0					5																	68607025		2202	4298	6500	SO:0001589	frameshift_variant	202243			AB024691	CCDS4000.1, CCDS75255.1	5q13.2	2008-02-05			ENSG00000183323	ENSG00000183323			28924	protein-coding gene	gene with protein product		613781					Standard	XM_005248461		Approved	KENAE	uc003jvv.1	Q86Z20	OTTHUMG00000131259	ENST00000396496.2:c.373delG	5.37:g.68607025delC	ENSP00000379754:p.Glu125fs		Q86Z19	Frame_Shift_Del	DEL	ENST00000396496.2	37	CCDS4000.1																																																																																				0.363	CCDC125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254027.4		NM_176816	
CCDC51	79714	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	48474087	48474088	+	Missense_Mutation	DNP	GC	GC	CT			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr3:48474087_48474088GC>CT	ENST00000395694.2	-	4	1051_1052	c.966_967GC>AG	c.(964-969)gaGCag>gaAGag	p.Q323E	CCDC51_ENST00000412398.2_Missense_Mutation_p.Q214E|PLXNB1_ENST00000296440.6_5'Flank|CCDC51_ENST00000447018.1_Missense_Mutation_p.Q214E|CCDC51_ENST00000442740.1_Missense_Mutation_p.Q214E|CCDC51_ENST00000395696.1_Missense_Mutation_p.Q323E|PLXNB1_ENST00000448774.2_5'Flank	NM_001256964.1	NP_001243893.1	Q96ER9	CCD51_HUMAN	coiled-coil domain containing 51	323						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.Q323E(2)|p.E322E(1)		endometrium(4)|kidney(4)|large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		CCATCAAGCTGCTCTCGTAAGC	0.53																																																	3	Substitution - Missense(2)|Substitution - coding silent(1)	kidney(3)																																								SO:0001583	missense	79714			AK022498	CCDS2766.2, CCDS58830.1	3p21.31	2005-12-30			ENSG00000164051	ENSG00000164051			25714	protein-coding gene	gene with protein product						12477932	Standard	NM_001256964		Approved	FLJ12436	uc003ctc.3	Q96ER9	OTTHUMG00000133534	ENST00000395694.2:c.966_967delinsCT	3.37:g.48474087_48474088delinsCT	ENSP00000379047:p.Gln323Glu		Q9HA01	Missense_Mutation|Silent	SNP	ENST00000395694.2	37	CCDS2766.2																																																																																				0.530	CCDC51-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344599.2		NM_024661	
CD63	967	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	56121064	56121064	+	Silent	SNP	G	G	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr12:56121064G>A	ENST00000549117.1	-	3	562	c.126C>T	c.(124-126)acC>acT	p.T42T	CD63_ENST00000548160.1_5'Flank|CD63_ENST00000420846.3_Silent_p.T42T|CD63_ENST00000552692.1_Silent_p.T42T|CD63_ENST00000546939.1_5'UTR|CD63_ENST00000257857.4_Silent_p.T42T|CD63_ENST00000552754.1_Intron|CD63_ENST00000550776.1_5'UTR|RP11-644F5.11_ENST00000552576.1_RNA|CD63_ENST00000548898.1_5'Flank|CD63_ENST00000552067.1_5'Flank	NM_001257389.1	NP_001244318.1	P08962	CD63_HUMAN	CD63 molecule	42					blood coagulation (GO:0007596)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular protein localization (GO:0034613)|endosome to melanosome transport (GO:0035646)|pigment granule maturation (GO:0048757)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of receptor internalization (GO:0002092)|protein transport (GO:0015031)|regulation of rubidium ion transport (GO:2000680)|regulation of vascular endothelial growth factor signaling pathway (GO:1900746)	cell surface (GO:0009986)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|multivesicular body, internal vesicle (GO:0097487)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)		p.T42T(1)		kidney(1)|large_intestine(3)|lung(2)|ovary(1)	7						CCTGGATTATGGTCTGACTCA	0.572																																					Pancreas(123;1459 1747 6717 18841 37380)												1	Substitution - coding silent(1)	kidney(1)											103.0	98.0	100.0					12																	56121064		2203	4300	6503	SO:0001819	synonymous_variant	967			M58485	CCDS8890.1, CCDS58242.1, CCDS58243.1	12q12-q13	2013-02-14	2006-03-28					"""CD molecules"", ""Tetraspanins"""	1692	protein-coding gene	gene with protein product		155740	"""CD63 antigen (melanoma 1 antigen)"""	MLA1			Standard	NM_001780		Approved	ME491, TSPAN30	uc031qhv.1	P08962		ENST00000549117.1:c.126C>T	12.37:g.56121064G>A			F8VZE2|Q5TZP3|Q8N6Z9|Q9UCG6	Silent	SNP	ENST00000549117.1	37	CCDS8890.1																																																																																				0.572	CD63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409234.1			
CLRN3	119467	hgsc.bcm.edu;ucsc.edu	37	10	129676520	129676523	+	Frame_Shift_Del	DEL	TATT	TATT	-	rs34656572	byFrequency	TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	TATT	TATT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr10:129676520_129676523delTATT	ENST00000368671.3	-	3	733_736	c.571_574delAATA	c.(571-576)aatatafs	p.NI191fs		NM_152311.3	NP_689524.1	Q8NCR9	CLRN3_HUMAN	clarin 3	191						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	6		all_epithelial(44;0.00168)|all_lung(145;0.0586)|Lung NSC(174;0.0765)|all_neural(114;0.201)|Glioma(114;0.222)|Colorectal(57;0.235)				ACAGTGACTATATTTAGAAGAATG	0.461																																																	0																																										SO:0001589	frameshift_variant	119467			BC029478	CCDS7656.1	10q26.2	2006-11-24	2006-11-23	2006-11-23	ENSG00000180745	ENSG00000180745			20795	protein-coding gene	gene with protein product			"""transmembrane protein 12"""	TMEM12		12145752, 12080385	Standard	NM_152311		Approved	MGC32871, USH3AL1	uc001lka.1	Q8NCR9	OTTHUMG00000019253	ENST00000368671.3:c.571_574delAATA	10.37:g.129676520_129676523delTATT	ENSP00000357660:p.Asn191fs		Q6MZX8	Frame_Shift_Del	DEL	ENST00000368671.3	37	CCDS7656.1																																																																																				0.461	CLRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050987.1		NM_152311	
CROCCP2	84809	broad.mit.edu	37	1	16946434	16946434	+	lincRNA	SNP	C	C	T	rs367060	byFrequency	TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr1:16946434C>T	ENST00000412962.1	-	0	1085				RP5-1182A14.5_ENST00000607700.1_lincRNA			Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											CTCAGCCTTCCGCCGGGCCAG	0.672													.|||	253	0.0505192	0.115	0.0533	5008	,	,		65734	0.0119		0.0437	False		,,,				2504	0.0082																0																																												0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16946434C>T			Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	ENST00000412962.1	37																																																																																					0.672	CROCCP2-003	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000092784.1		NR_026752.1	
CROCC	9696	hgsc.bcm.edu	37	1	17275337	17275337	+	Missense_Mutation	SNP	C	C	T	rs143866013	byFrequency	TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr1:17275337C>T	ENST00000375541.5	+	19	2821	c.2752C>T	c.(2752-2754)Cgg>Tgg	p.R918W	CROCC_ENST00000467938.1_Intron	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin									p.R918W(2)		breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		TGAGGTGCAACGGCAGCTGGC	0.677																																																	2	Substitution - Missense(2)	skin(2)											38.0	43.0	41.0					1																	17275337		2203	4298	6501	SO:0001583	missense	9696			AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.2752C>T	1.37:g.17275337C>T	ENSP00000364691:p.Arg918Trp			Missense_Mutation	SNP	ENST00000375541.5	37	CCDS30616.1	.	.	.	.	.	.	.	.	.	.	C	16.77	3.216169	0.58452	.	.	ENSG00000058453	ENST00000375541;ENST00000445545	T	0.23552	1.9	4.38	2.36	0.29203	.	.	.	.	.	T	0.39886	0.1095	L	0.50333	1.59	0.34311	D	0.68543	D;D	0.76494	0.999;0.999	D;D	0.63488	0.915;0.915	T	0.53143	-0.8480	9	0.72032	D	0.01	.	10.9364	0.47247	0.41:0.59:0.0:0.0	.	221;918	Q5TZA2-2;Q5TZA2	.;CROCC_HUMAN	W	918;799	ENSP00000364691:R918W	ENSP00000364691:R918W	R	+	1	2	CROCC	17147924	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	1.205000	0.32308	0.452000	0.26830	0.557000	0.71058	CGG		0.677	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006249.2		NM_014675	
CYP2A13	1553	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	41594410	41594410	+	Silent	SNP	C	C	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr19:41594410C>T	ENST00000330436.3	+	1	34	c.34C>T	c.(34-36)Ctg>Ttg	p.L12L		NM_000766.4	NP_000757.2	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 13	12					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.L12L(1)		breast(3)|endometrium(6)|kidney(4)|large_intestine(8)|lung(13)|ovary(3)|prostate(3)|skin(2)	42					Methoxsalen(DB00553)|Nicotine(DB00184)|Testosterone(DB00624)	GGTGACCTTGCTGGCCTGCCT	0.577																																																	1	Substitution - coding silent(1)	kidney(1)											71.0	59.0	63.0					19																	41594410		2203	4300	6503	SO:0001819	synonymous_variant	1553			U22028	CCDS12571.1	19q13.2	2013-11-11	2003-01-14		ENSG00000197838	ENSG00000197838		"""Cytochrome P450s"""	2608	protein-coding gene	gene with protein product		608055	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 13"""			7668294, 15128046	Standard	NM_000766		Approved	CPAD, CYP2A	uc002opt.4	Q16696	OTTHUMG00000182762	ENST00000330436.3:c.34C>T	19.37:g.41594410C>T			Q53YR8|Q6R569|Q6R570|Q9H2X2	Silent	SNP	ENST00000330436.3	37	CCDS12571.1																																																																																				0.577	CYP2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463505.1		NM_000766	
DCUN1D3	123879	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	20871576	20871576	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr16:20871576A>G	ENST00000324344.4	-	3	832	c.547T>C	c.(547-549)Tac>Cac	p.Y183H	ERI2_ENST00000564349.1_Intron|DCUN1D3_ENST00000563934.1_Missense_Mutation_p.Y183H	NM_173475.2	NP_775746.1	Q8IWE4	DCNL3_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 3	183	DCUN1. {ECO:0000255|PROSITE- ProRule:PRU00574}.				negative regulation of cell growth (GO:0030308)|positive regulation of apoptotic process (GO:0043065)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)	perinuclear region of cytoplasm (GO:0048471)		p.Y183H(1)		NS(2)|breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|ovary(2)	14				GBM - Glioblastoma multiforme(48;0.249)		GTAAACCGGTAGAGATCCTTG	0.478																																																	1	Substitution - Missense(1)	kidney(1)											133.0	137.0	135.0					16																	20871576		2201	4300	6501	SO:0001583	missense	123879			BC040442	CCDS10592.1	16p12.3	2013-06-10	2013-06-10		ENSG00000188215	ENSG00000188215			28734	protein-coding gene	gene with protein product			"""DCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae)"""			15988528	Standard	NM_173475		Approved	MGC48972, FLJ41725, DKFZp686O0290	uc002dhz.3	Q8IWE4	OTTHUMG00000131553	ENST00000324344.4:c.547T>C	16.37:g.20871576A>G	ENSP00000319482:p.Tyr183His		B3KVY4	Missense_Mutation	SNP	ENST00000324344.4	37	CCDS10592.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.428683	0.83667	.	.	ENSG00000188215	ENST00000324344	.	.	.	5.92	5.92	0.95590	Domain of unknown function DUF298 (2);	0.000000	0.85682	D	0.000000	D	0.88187	0.6369	H	0.96943	3.91	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92036	0.5637	9	0.87932	D	0	-4.016	16.3662	0.83325	1.0:0.0:0.0:0.0	.	183	Q8IWE4	DCNL3_HUMAN	H	183	.	ENSP00000319482:Y183H	Y	-	1	0	DCUN1D3	20779077	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.268000	0.95675	2.274000	0.75844	0.533000	0.62120	TAC		0.478	DCUN1D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254415.2		NM_173475	
EPHB6	2051	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	142568043	142568043	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr7:142568043T>G	ENST00000392957.2	+	18	3471	c.2684T>G	c.(2683-2685)tTg>tGg	p.L895W	EPHB6_ENST00000476059.1_3'UTR|EPHB6_ENST00000442129.1_Missense_Mutation_p.L895W|EPHB6_ENST00000411471.2_Missense_Mutation_p.L618W	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	895	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)	p.L880W(1)		NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					CTACTTATGTTGGACACTTGG	0.562																																																	1	Substitution - Missense(1)	kidney(1)											122.0	141.0	135.0					7																	142568043		2203	4300	6503	SO:0001583	missense	2051			D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.2684T>G	7.37:g.142568043T>G	ENSP00000376684:p.Leu895Trp		A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Missense_Mutation	SNP	ENST00000392957.2	37	CCDS5873.2	.	.	.	.	.	.	.	.	.	.	T	26.4	4.735408	0.89482	.	.	ENSG00000106123	ENST00000392957;ENST00000442129;ENST00000411471	D;D;D	0.83419	-1.72;-1.72;-1.72	5.58	5.58	0.84498	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.37809	N	0.001923	D	0.91978	0.7459	M	0.86740	2.835	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93307	0.6681	10	0.87932	D	0	.	14.9267	0.70884	0.0:0.0:0.0:1.0	.	895;618	O15197;O15197-2	EPHB6_HUMAN;.	W	895;895;618	ENSP00000376684:L895W;ENSP00000410789:L895W;ENSP00000409061:L618W	ENSP00000376684:L895W	L	+	2	0	EPHB6	142278165	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.845000	0.86875	2.107000	0.64212	0.533000	0.62120	TTG		0.562	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341329.1			
FANCD2	2177	hgsc.bcm.edu	37	3	10108913	10108913	+	Missense_Mutation	SNP	G	G	T	rs80258959		TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr3:10108913G>T	ENST00000419585.1	+	26	2567	c.2406G>T	c.(2404-2406)caG>caT	p.Q802H	FANCD2_ENST00000383806.1_Missense_Mutation_p.Q802H|FANCD2_ENST00000287647.3_Missense_Mutation_p.Q802H|FANCD2_ENST00000383807.1_Missense_Mutation_p.Q802H			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	802					DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)	p.Q802H(2)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		CCTTCTGCCAGGAAACATCAC	0.378			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																														yes	Rec		Fanconi anaemia D2	3	3p26	2177	"""Fanconi anemia, complementation group D2"""		L	2	Substitution - Missense(2)	prostate(2)											82.0	72.0	75.0					3																	10108913		2203	4300	6503	SO:0001583	missense	2177	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.2406G>T	3.37:g.10108913G>T	ENSP00000398754:p.Gln802His		Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Missense_Mutation	SNP	ENST00000419585.1	37	CCDS33696.1	.	.	.	.	.	.	.	.	.	.	G	17.37	3.373535	0.61624	.	.	ENSG00000144554	ENST00000287647;ENST00000383807;ENST00000383806;ENST00000419585	T;T;T;T	0.52983	0.64;0.64;0.64;0.64	5.44	1.83	0.25207	.	0.551240	0.20789	N	0.085651	T	0.50240	0.1604	M	0.63428	1.95	0.30837	N	0.736052	P;P	0.50710	0.938;0.938	P;P	0.53988	0.739;0.739	T	0.53229	-0.8468	10	0.54805	T	0.06	.	3.6289	0.08124	0.3156:0.0:0.4962:0.1881	.	802;802	Q9BXW9-2;Q9BXW9	.;FACD2_HUMAN	H	802	ENSP00000287647:Q802H;ENSP00000373318:Q802H;ENSP00000373317:Q802H;ENSP00000398754:Q802H	ENSP00000287647:Q802H	Q	+	3	2	FANCD2	10083913	0.804000	0.28969	0.409000	0.26459	0.904000	0.53231	1.055000	0.30467	0.519000	0.28406	0.585000	0.79938	CAG		0.378	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339873.1			
FANCG	2189	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	35078167	35078167	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr9:35078167A>T	ENST00000378643.3	-	4	972	c.481T>A	c.(481-483)Ttg>Atg	p.L161M	FANCG_ENST00000476212.1_5'Flank	NM_004629.1	NP_004620.1	O15287	FANCG_HUMAN	Fanconi anemia, complementation group G	161					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|mitochondrion organization (GO:0007005)|ovarian follicle development (GO:0001541)|response to radiation (GO:0009314)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	damaged DNA binding (GO:0003684)	p.L161M(1)		NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(7)|ovary(2)|prostate(3)|stomach(1)	28			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			TCTAGTAACAAGGCCAGGTCC	0.592			"""Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks																															yes	Rec		Fanconi anaemia G	9	9p13	2189	"""Fanconi anemia, complementation group G"""		L	1	Substitution - Missense(1)	kidney(1)											72.0	76.0	75.0					9																	35078167		2203	4300	6503	SO:0001583	missense	2189			AJ007669	CCDS6574.1	9p13	2014-09-17			ENSG00000221829	ENSG00000221829		"""Fanconi anemia, complementation groups"""	3588	protein-coding gene	gene with protein product	"""DNA repair protein XRCC9"", ""X-ray repair, complementing defective, in Chinese hamster, 9"", ""X-ray repair complementing defective repair in Chinese hamster cells 9"""	602956		XRCC9		9256465, 9382107	Standard	NM_004629		Approved	FAG	uc003zwb.1	O15287	OTTHUMG00000019850	ENST00000378643.3:c.481T>A	9.37:g.35078167A>T	ENSP00000367910:p.Leu161Met			Missense_Mutation	SNP	ENST00000378643.3	37	CCDS6574.1	.	.	.	.	.	.	.	.	.	.	A	12.91	2.079831	0.36662	.	.	ENSG00000221829	ENST00000378643;ENST00000543657;ENST00000448890	T;T	0.78003	0.58;-1.14	5.51	0.138	0.14793	.	.	.	.	.	T	0.69663	0.3136	M	0.63428	1.95	0.09310	N	1	P	0.40476	0.718	B	0.42422	0.387	T	0.58103	-0.7695	9	0.30078	T	0.28	-1.8724	0.6979	0.00902	0.371:0.164:0.109:0.3561	.	161	O15287	FANCG_HUMAN	M	161	ENSP00000367910:L161M;ENSP00000409607:L161M	ENSP00000367910:L161M	L	-	1	2	FANCG	35068167	0.004000	0.15560	0.933000	0.37362	0.442000	0.32017	0.872000	0.28037	0.357000	0.24183	0.533000	0.62120	TTG		0.592	FANCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052269.1		NM_004629	
FCHO2	115548	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	72333026	72333026	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr5:72333026A>G	ENST00000430046.2	+	10	1014	c.898A>G	c.(898-900)Aaa>Gaa	p.K300E	FCHO2_ENST00000512348.1_Missense_Mutation_p.K267E|FCHO2_ENST00000287761.6_Missense_Mutation_p.K300E|FCHO2_ENST00000341845.6_Missense_Mutation_p.K300E	NM_001146032.1|NM_138782.2	NP_001139504.1|NP_620137.2	Q0JRZ9	FCHO2_HUMAN	FCH domain only 2	300					clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)|membrane invagination (GO:0010324)|protein localization to plasma membrane (GO:0072659)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)	p.K300E(2)		cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(1)	17		Lung NSC(167;0.0465)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;4.6e-53)		TAAAAAGGAAAAAGATGCAGA	0.259																																																	2	Substitution - Missense(2)	kidney(2)											39.0	42.0	41.0					5																	72333026		1785	4046	5831	SO:0001583	missense	115548			AL831971	CCDS47230.1, CCDS54868.1	5q13.2	2005-08-15			ENSG00000157107	ENSG00000157107			25180	protein-coding gene	gene with protein product		613438				15254787	Standard	NM_138782		Approved		uc003kcl.3	Q0JRZ9	OTTHUMG00000162413	ENST00000430046.2:c.898A>G	5.37:g.72333026A>G	ENSP00000393776:p.Lys300Glu		A8K6W7|B2RNQ9|B4DHK0|E9PG79|Q0JTJ3|Q96CF5	Missense_Mutation	SNP	ENST00000430046.2	37	CCDS47230.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.199534	0.79015	.	.	ENSG00000157107	ENST00000430046;ENST00000341845;ENST00000512348;ENST00000287761	T;T;T;T	0.58506	1.14;1.1;3.46;0.33	4.86	4.86	0.63082	.	0.419476	0.27302	N	0.019987	T	0.64724	0.2624	L	0.42686	1.345	0.44073	D	0.996828	D;P;D;P	0.69078	0.997;0.64;0.984;0.633	D;B;P;B	0.73380	0.98;0.417;0.885;0.34	T	0.59284	-0.7483	10	0.08179	T	0.78	-13.1585	14.7513	0.69528	1.0:0.0:0.0:0.0	.	267;267;300;300	B4DHK0;E9PG79;Q0JRZ9-2;Q0JRZ9	.;.;.;FCHO2_HUMAN	E	300;300;267;300	ENSP00000393776:K300E;ENSP00000344034:K300E;ENSP00000427296:K267E;ENSP00000287761:K300E	ENSP00000287761:K300E	K	+	1	0	FCHO2	72368782	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	6.660000	0.74417	1.924000	0.55735	0.383000	0.25322	AAA		0.259	FCHO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000368795.3		XM_291142	
FNTB	2342	broad.mit.edu;hgsc.bcm.edu	37	14	65511120	65511120	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr14:65511120C>T	ENST00000246166.2	+	9	1148	c.914C>T	c.(913-915)gCg>gTg	p.A305V	MIR4706_ENST00000582134.1_RNA|MAX_ENST00000341653.2_Intron|CHURC1-FNTB_ENST00000549987.1_Missense_Mutation_p.A340V|FNTB_ENST00000447296.2_Missense_Mutation_p.A339V|FNTB_ENST00000542227.1_Missense_Mutation_p.A259V	NM_002028.3	NP_002019.1	P49356	FNTB_HUMAN	farnesyltransferase, CAAX box, beta	305					negative regulation of cell proliferation (GO:0008285)|phototransduction, visible light (GO:0007603)|positive regulation of cell cycle (GO:0045787)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|protein farnesylation (GO:0018343)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to cytokine (GO:0034097)|response to inorganic substance (GO:0010035)|response to organic cyclic compound (GO:0014070)|rhodopsin mediated signaling pathway (GO:0016056)|wound healing (GO:0042060)	cytosol (GO:0005829)|microtubule associated complex (GO:0005875)|protein farnesyltransferase complex (GO:0005965)	farnesyltranstransferase activity (GO:0004311)|protein farnesyltransferase activity (GO:0004660)|zinc ion binding (GO:0008270)	p.A305V(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14				all cancers(60;0.00115)|OV - Ovarian serous cystadenocarcinoma(108;0.00412)|BRCA - Breast invasive adenocarcinoma(234;0.011)		TTCTGGCAGGCGGGGCTCCTG	0.602																																																	1	Substitution - Missense(1)	kidney(1)											95.0	94.0	94.0					14																	65511120		2203	4300	6503	SO:0001583	missense	2342				CCDS9769.1	14q23.3	2011-09-28			ENSG00000257365	ENSG00000257365			3785	protein-coding gene	gene with protein product		134636				8276393	Standard	NM_002028		Approved	FPTB		P49356	OTTHUMG00000142811	ENST00000246166.2:c.914C>T	14.37:g.65511120C>T	ENSP00000246166:p.Ala305Val		B2RDX6|B4E1A0	Missense_Mutation	SNP	ENST00000246166.2	37	CCDS9769.1	.	.	.	.	.	.	.	.	.	.	C	34	5.330964	0.95733	.	.	ENSG00000125954;ENSG00000125954;ENSG00000125954;ENSG00000125954;ENSG00000257365	ENST00000542227;ENST00000549987;ENST00000447296;ENST00000448390;ENST00000246166	T;T;T;T;T	0.30981	1.51;1.51;1.51;1.51;1.51	5.47	5.47	0.80525	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);	0.052650	0.85682	D	0.000000	T	0.33206	0.0855	L	0.45051	1.395	0.80722	D	1	P;P;P;D	0.60575	0.597;0.926;0.855;0.988	B;B;B;P	0.47864	0.05;0.231;0.057;0.559	T	0.01456	-1.1350	10	0.40728	T	0.16	-19.7838	13.9225	0.63940	0.0:0.8474:0.1526:0.0	.	308;259;339;305	Q86TX8;B4E1A0;B4DL54;P49356	.;.;.;FNTB_HUMAN	V	259;340;339;61;305	ENSP00000443140:A259V;ENSP00000447121:A340V;ENSP00000406393:A339V;ENSP00000399362:A61V;ENSP00000246166:A305V	ENSP00000246166:A305V	A	+	2	0	FNTB;AL139022.1	64580873	1.000000	0.71417	0.976000	0.42696	0.982000	0.71751	5.798000	0.69095	2.849000	0.98006	0.609000	0.83330	GCG		0.602	FNTB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000286392.1		NM_002028	
GABRE	2564	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	151123279	151123279	+	Missense_Mutation	SNP	C	C	T	rs80186670	byFrequency	TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chrX:151123279C>T	ENST00000370328.3	-	9	1468	c.1415G>A	c.(1414-1416)cGc>cAc	p.R472H	GABRE_ENST00000370325.1_3'UTR|GABRE_ENST00000483564.1_5'UTR|AF274855.1_ENST00000582865.1_RNA	NM_004961.3	NP_004952.2	P78334	GBRE_HUMAN	gamma-aminobutyric acid (GABA) A receptor, epsilon	472					gamma-aminobutyric acid signaling pathway (GO:0007214)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.R359H(1)|p.R472H(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|skin(1)	27	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GATGCAGAGGCGGCCCTGCTG	0.522													C|||	2	0.000529801	0.0	0.0014	3775	,	,		13567	0.0		0.0	False		,,,				2504	0.001																2	Substitution - Missense(2)	kidney(2)						C	HIS/ARG	2,3833		0,2,0,1630,571	43.0	43.0	43.0		1415	2.8	1.0	X	dbSNP_131	43	15,6713		0,10,5,2418,1867	yes	missense	GABRE	NM_004961.3	29	0,12,5,4048,2438	TT,TC,T,CC,C		0.2229,0.0522,0.1609	probably-damaging	472/507	151123279	17,10546	2203	4300	6503	SO:0001583	missense	2564			Y09765	CCDS14703.1	Xq28	2012-06-22			ENSG00000102287	ENSG00000102287		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4085	protein-coding gene	gene with protein product	"""GABA(A) receptor, epsilon"""	300093				9039914, 9084408	Standard	NM_004961		Approved		uc004ffi.3	P78334	OTTHUMG00000024176	ENST00000370328.3:c.1415G>A	X.37:g.151123279C>T	ENSP00000359353:p.Arg472His		E7ET93|O15345|O15346|Q6PCD2|Q99520	Missense_Mutation	SNP	ENST00000370328.3	37	CCDS14703.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	13.75	2.331461	0.41297	5.22E-4	0.002229	ENSG00000102287	ENST00000370328	D	0.85629	-2.01	5.68	2.79	0.32731	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.918420	0.09130	N	0.844470	T	0.81009	0.4734	L	0.60904	1.88	0.58432	D	0.999999	B	0.32800	0.385	B	0.29353	0.101	T	0.71576	-0.4551	10	0.66056	D	0.02	.	6.8835	0.24187	0.0:0.6742:0.0:0.3258	.	472	P78334	GBRE_HUMAN	H	472	ENSP00000359353:R472H	ENSP00000359353:R472H	R	-	2	0	GABRE	150873935	1.000000	0.71417	0.967000	0.41034	0.720000	0.41350	3.321000	0.51999	0.130000	0.18549	-0.191000	0.12829	CGC		0.522	GABRE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060903.1		NM_004961, NM_021990, NM_021984	
GOLGA1	2800	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	127690521	127690521	+	Silent	SNP	G	G	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr9:127690521G>A	ENST00000373555.4	-	6	678	c.345C>T	c.(343-345)gcC>gcT	p.A115A		NM_002077.3	NP_002068	Q92805	GOGA1_HUMAN	golgin A1	115					protein targeting to Golgi (GO:0000042)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)		p.A115A(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	20						TGGCTCTGTTGGCTTGGAATG	0.428																																																	1	Substitution - coding silent(1)	kidney(1)											122.0	97.0	105.0					9																	127690521		2203	4300	6503	SO:0001819	synonymous_variant	2800			U51587	CCDS6860.1	9q34.11	2010-02-12	2010-02-12		ENSG00000136935	ENSG00000136935			4424	protein-coding gene	gene with protein product		602502	"""golgi autoantigen, golgin subfamily a, 1"""			9324025	Standard	NM_002077		Approved	golgin-97, MGC33154	uc004bpc.3	Q92805	OTTHUMG00000020665	ENST00000373555.4:c.345C>T	9.37:g.127690521G>A			Q5T164|Q8IYZ9	Silent	SNP	ENST00000373555.4	37	CCDS6860.1																																																																																				0.428	GOLGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054049.1		NM_002077	
HDX	139324	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	83724059	83724059	+	Silent	SNP	T	T	C			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chrX:83724059T>C	ENST00000297977.5	-	3	783	c.672A>G	c.(670-672)ccA>ccG	p.P224P	HDX_ENST00000506585.2_Silent_p.P166P|HDX_ENST00000373177.2_Silent_p.P224P	NM_001177479.1|NM_144657.4	NP_001170950.1|NP_653258.2	Q7Z353	HDX_HUMAN	highly divergent homeobox	224						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.P224P(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(12)|liver(1)|lung(19)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						GAATCCCAACTGGTTCAATTT	0.418																																					Pancreas(53;231 1169 36156 43751 51139)												1	Substitution - coding silent(1)	kidney(1)											136.0	119.0	124.0					X																	83724059		2203	4300	6503	SO:0001819	synonymous_variant	139324			BX538112	CCDS35342.1, CCDS55456.1	Xq21.1	2012-03-09	2007-07-13	2007-07-13	ENSG00000165259	ENSG00000165259		"""Homeoboxes / POU class"""	26411	protein-coding gene	gene with protein product			"""chromosome X open reading frame 43"""	CXorf43			Standard	NM_144657		Approved	FLJ30678	uc004eek.2	Q7Z353	OTTHUMG00000021926	ENST00000297977.5:c.672A>G	X.37:g.83724059T>C			A8K1Y5|B7ZL18|Q5JZB4|Q96NK7	Silent	SNP	ENST00000297977.5	37	CCDS35342.1																																																																																				0.418	HDX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057379.2		NM_144657	
GPR112	139378	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	135431578	135431578	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chrX:135431578A>T	ENST00000394143.1	+	6	6004	c.5713A>T	c.(5713-5715)Aat>Tat	p.N1905Y	GPR112_ENST00000412101.1_Missense_Mutation_p.N1700Y|GPR112_ENST00000287534.4_Missense_Mutation_p.N1842Y|GPR112_ENST00000394141.1_Missense_Mutation_p.N1700Y|GPR112_ENST00000370652.1_Missense_Mutation_p.N1905Y	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	1905					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.N1905Y(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					ACCTACATCCAATGAGATGGA	0.433																																																	1	Substitution - Missense(1)	kidney(1)											140.0	134.0	136.0					X																	135431578		2203	4299	6502	SO:0001583	missense	139378			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.5713A>T	X.37:g.135431578A>T	ENSP00000377699:p.Asn1905Tyr		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	a	7.635	0.679658	0.14907	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.39997	1.09;1.09;1.05;1.15;1.05	3.78	1.17	0.20885	.	.	.	.	.	T	0.26738	0.0654	N	0.24115	0.695	0.09310	N	1	P;P;P	0.48016	0.815;0.904;0.845	B;B;B	0.39935	0.178;0.314;0.166	T	0.10154	-1.0642	9	0.87932	D	0	.	7.738	0.28825	0.6141:0.3859:0.0:0.0	.	1842;1700;1905	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	Y	1905;1905;1700;1842;1700	ENSP00000377699:N1905Y;ENSP00000359686:N1905Y;ENSP00000416526:N1700Y;ENSP00000287534:N1842Y;ENSP00000377697:N1700Y	ENSP00000287534:N1842Y	N	+	1	0	GPR112	135259244	0.000000	0.05858	0.004000	0.12327	0.013000	0.08279	0.376000	0.20535	-0.048000	0.13401	0.430000	0.28490	AAT		0.433	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			
HLA-A	3105	hgsc.bcm.edu	37	6	29910699	29910699	+	Missense_Mutation	SNP	G	G	A	rs1059451		TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr6:29910699G>A	ENST00000396634.1	+	4	580	c.239G>A	c.(238-240)gGg>gAg	p.G80E	HLA-A_ENST00000376802.2_Missense_Mutation_p.G80E|HLA-A_ENST00000376809.5_Missense_Mutation_p.G80E|HLA-A_ENST00000376806.5_Missense_Mutation_p.G80E			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	80	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						GAGCAGGAGGGGCCGGAGTAT	0.657									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																																							0													60.0	64.0	63.0					6																	29910699		2203	4300	6503	SO:0001583	missense	3105	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.239G>A	6.37:g.29910699G>A	ENSP00000379873:p.Gly80Glu		O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Missense_Mutation	SNP	ENST00000396634.1	37	CCDS34373.1	.	.	.	.	.	.	.	.	.	.	.	10.31	1.314580	0.23908	.	.	ENSG00000206503	ENST00000396634;ENST00000376806;ENST00000376809;ENST00000355767;ENST00000376802	T;T;T;T	0.00856	5.61;5.61;5.61;5.61	3.72	-6.15	0.02105	MHC class I, alpha chain, alpha1/alpha2 (2);MHC classes I/II-like antigen recognition protein (2);MHC class I-like antigen recognition (2);	.	.	.	.	T	0.00552	0.0018	M	0.80183	2.485	0.09310	N	1	B;B;B;B	0.18610	0.002;0.008;0.029;0.017	B;B;B;B	0.28849	0.019;0.049;0.049;0.095	T	0.36407	-0.9749	9	0.72032	D	0.01	.	5.6199	0.17451	0.4487:0.2137:0.3376:0.0	rs1059451;rs2230986;rs3173428;rs41545313	80;80;80;80	P13746;Q5SRN7;Q5SRN5;P04439	1A11_HUMAN;.;.;1A03_HUMAN	E	80	ENSP00000379873:G80E;ENSP00000366002:G80E;ENSP00000366005:G80E;ENSP00000365998:G80E	ENSP00000348012:G80E	G	+	2	0	HLA-A	30018678	0.000000	0.05858	0.000000	0.03702	0.198000	0.23893	-0.747000	0.04823	-1.556000	0.01695	-0.346000	0.07831	GGG		0.657	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1		NM_002116	
HMCN1	83872	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	186136027	186136027	+	Missense_Mutation	SNP	G	G	A	rs150494959	byFrequency	TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr1:186136027G>A	ENST00000271588.4	+	100	15756	c.15527G>A	c.(15526-15528)cGt>cAt	p.R5176H	HMCN1_ENST00000367492.2_Missense_Mutation_p.R5176H	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	5176	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.R5176H(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TGTGTGGTCCGTTGTGGAAGT	0.463													G|||	3	0.000599042	0.0015	0.0014	5008	,	,		19991	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	kidney(1)						G	HIS/ARG	9,4397	15.5+/-35.6	0,9,2194	225.0	192.0	203.0		15527	-10.8	0.0	1	dbSNP_134	203	2,8598	2.2+/-6.3	0,2,4298	yes	missense	HMCN1	NM_031935.2	29	0,11,6492	AA,AG,GG		0.0233,0.2043,0.0846	benign	5176/5636	186136027	11,12995	2203	4300	6503	SO:0001583	missense	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.15527G>A	1.37:g.186136027G>A	ENSP00000271588:p.Arg5176His		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	G	9.045	0.990593	0.18966	0.002043	2.33E-4	ENSG00000143341	ENST00000271588;ENST00000367492	D;D	0.87412	-2.25;-2.25	5.39	-10.8	0.00216	EGF-like calcium-binding (2);	0.402712	0.27764	N	0.017956	T	0.72716	0.3495	L	0.33093	0.98	0.09310	N	0.999995	B	0.13594	0.008	B	0.10450	0.005	T	0.48091	-0.9065	10	0.19147	T	0.46	.	13.2854	0.60241	0.657:0.0807:0.2623:0.0	.	5176	Q96RW7	HMCN1_HUMAN	H	5176	ENSP00000271588:R5176H;ENSP00000356462:R5176H	ENSP00000271588:R5176H	R	+	2	0	HMCN1	184402650	0.003000	0.15002	0.000000	0.03702	0.444000	0.32077	0.271000	0.18626	-2.778000	0.00362	-1.170000	0.01741	CGT		0.463	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1		NM_031935	
HSPA1L	3305	hgsc.bcm.edu	37	6	31778972	31778989	+	In_Frame_Del	DEL	GCTTGTTCTGGCTGATGT	GCTTGTTCTGGCTGATGT	-	rs200543237		TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	GCTTGTTCTGGCTGATGT	GCTTGTTCTGGCTGATGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr6:31778972_31778989delGCTTGTTCTGGCTGATGT	ENST00000375654.4	-	2	950_967	c.761_778delACATCAGCCAGAACAAGC	c.(760-780)gacatcagccagaacaagcga>gga	p.254_260DISQNKR>G	HSPA1L_ENST00000417199.3_In_Frame_Del_p.254_260DISQNKR>G	NM_005527.3	NP_005518.3	P34931	HS71L_HUMAN	heat shock 70kDa protein 1-like	254					binding of sperm to zona pellucida (GO:0007339)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|pleura(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						CTCACGGCTCGCTTGTTCTGGCTGATGTCCTTTTTGTG	0.564																																																	0																																										SO:0001651	inframe_deletion	3305			D85730	CCDS34413.1	6p21.3	2014-01-21	2002-08-29		ENSG00000204390	ENSG00000204390		"""Heat shock proteins / HSP70"""	5234	protein-coding gene	gene with protein product		140559	"""heat shock 70kD protein-like 1"""			9685725, 9349405	Standard	NM_005527		Approved	HSP70-HOM, hum70t	uc003nxh.3	P34931	OTTHUMG00000031208	ENST00000375654.4:c.761_778delACATCAGCCAGAACAAGC	6.37:g.31778972_31778989delGCTTGTTCTGGCTGATGT	ENSP00000364805:p.Asp254_Arg260delinsGly		A6NNB0|B0UXW8|O75634|Q2HXR3|Q8NE72|Q96QC9|Q9UQM1	In_Frame_Del	DEL	ENST00000375654.4	37	CCDS34413.1																																																																																				0.564	HSPA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076416.2			
IRAK3	11213	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	66638963	66638963	+	Missense_Mutation	SNP	G	G	A	rs146885838		TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr12:66638963G>A	ENST00000261233.4	+	11	1656	c.1235G>A	c.(1234-1236)cGg>cAg	p.R412Q	IRAK3_ENST00000457197.2_Missense_Mutation_p.R351Q	NM_007199.2	NP_009130.2			interleukin-1 receptor-associated kinase 3									p.R412Q(1)		breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	36				GBM - Glioblastoma multiforme(28;0.0203)		CCCTGCCCTCGGAATTTCTCT	0.478													G|||	1	0.000199681	0.0	0.0	5008	,	,		16506	0.0		0.0	False		,,,				2504	0.001																1	Substitution - Missense(1)	kidney(1)						G	GLN/ARG,GLN/ARG	0,4406		0,0,2203	77.0	78.0	77.0		1052,1235	0.2	1.0	12	dbSNP_134	77	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense	IRAK3	NM_001142523.1,NM_007199.2	43,43	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign,benign	351/536,412/597	66638963	2,13004	2203	4300	6503	SO:0001583	missense	11213			AF113136	CCDS8975.1, CCDS44937.1	12q13.13	2008-05-02			ENSG00000090376	ENSG00000090376			17020	protein-coding gene	gene with protein product		604459				10383454	Standard	NM_001142523		Approved	IRAK-M	uc001sth.3	Q9Y616	OTTHUMG00000169002	ENST00000261233.4:c.1235G>A	12.37:g.66638963G>A	ENSP00000261233:p.Arg412Gln			Missense_Mutation	SNP	ENST00000261233.4	37	CCDS8975.1	.	.	.	.	.	.	.	.	.	.	G	13.24	2.179269	0.38511	0.0	2.33E-4	ENSG00000090376	ENST00000261233;ENST00000457197	T;T	0.34472	1.36;1.36	5.89	0.206	0.15208	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.555348	0.17856	N	0.159681	T	0.14700	0.0355	N	0.05467	-0.045	0.28564	N	0.910972	B;B	0.29115	0.196;0.233	B;B	0.20384	0.017;0.029	T	0.23404	-1.0189	9	.	.	.	-3.6624	9.0567	0.36410	0.4439:0.0:0.5561:0.0	.	351;412	Q9Y616-2;Q9Y616	.;IRAK3_HUMAN	Q	412;351	ENSP00000261233:R412Q;ENSP00000409852:R351Q	.	R	+	2	0	IRAK3	64925230	0.832000	0.29368	0.998000	0.56505	0.884000	0.51177	-0.066000	0.11598	0.097000	0.17492	0.561000	0.74099	CGG		0.478	IRAK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401908.1			
KCNB2	9312	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	73848635	73848635	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr8:73848635T>C	ENST00000523207.1	+	3	1633	c.1045T>C	c.(1045-1047)Ttt>Ctt	p.F349L		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	349					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.F349L(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	GATAATGATATTTTCCAGCCT	0.473																																																	1	Substitution - Missense(1)	kidney(1)											117.0	120.0	119.0					8																	73848635		2203	4300	6503	SO:0001583	missense	9312			U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.1045T>C	8.37:g.73848635T>C	ENSP00000430846:p.Phe349Leu		Q7Z7D0|Q9BXD3	Missense_Mutation	SNP	ENST00000523207.1	37	CCDS6209.1	.	.	.	.	.	.	.	.	.	.	T	33	5.201501	0.94997	.	.	ENSG00000182674	ENST00000523207	D	0.97870	-4.58	5.58	5.58	0.84498	Ion transport (1);	0.000000	0.46758	D	0.000266	D	0.98520	0.9506	M	0.76727	2.345	0.58432	D	0.999998	D	0.89917	1.0	D	0.87578	0.998	D	0.99827	1.1051	10	0.87932	D	0	.	15.7481	0.77962	0.0:0.0:0.0:1.0	.	349	Q92953	KCNB2_HUMAN	L	349	ENSP00000430846:F349L	ENSP00000430846:F349L	F	+	1	0	KCNB2	74011189	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.121000	0.65114	0.533000	0.62120	TTT		0.473	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1		NM_004770	
SZT2	23334	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	43905719	43905719	+	Splice_Site	SNP	G	G	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr1:43905719G>A	ENST00000562955.1	+	50	7039	c.7039G>A	c.(7039-7041)Gga>Aga	p.G2347R	SZT2_ENST00000372442.1_Splice_Site_p.G1505R	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	2404					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)		p.G1505R(2)|p.G2347R(1)		NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						CACACCCACAGGTATGCAAGT	0.577																																																	3	Substitution - Missense(3)	kidney(3)											60.0	60.0	60.0					1																	43905719		2203	4300	6503	SO:0001630	splice_region_variant	0			AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.7039+1G>A	1.37:g.43905719G>A			A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Missense_Mutation	SNP	ENST00000562955.1	37	CCDS30694.2	.	.	.	.	.	.	.	.	.	.	G	12.77	2.038661	0.35989	.	.	ENSG00000198198	ENST00000372442	.	.	.	5.05	5.05	0.67936	.	0.206888	0.40064	N	0.001187	T	0.62744	0.2453	L	0.38175	1.15	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.57780	-0.7752	9	0.27785	T	0.31	.	9.3362	0.38051	0.0942:0.0:0.9058:0.0	.	2347	Q5T011-5	.	R	1505	.	ENSP00000361519:G1505R	G	+	1	0	SZT2	43678306	1.000000	0.71417	0.976000	0.42696	0.221000	0.24807	5.796000	0.69080	2.611000	0.88343	0.655000	0.94253	GGA		0.577	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019517.3		NM_015284	Missense_Mutation
KIDINS220	57498	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	8919170	8919170	+	Silent	SNP	G	G	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr2:8919170G>T	ENST00000256707.3	-	19	2651	c.2470C>A	c.(2470-2472)Cgg>Agg	p.R824R	KIDINS220_ENST00000319688.5_Silent_p.R825R|KIDINS220_ENST00000473731.1_Silent_p.R824R|KIDINS220_ENST00000427284.1_Silent_p.R824R|KIDINS220_ENST00000418530.1_Silent_p.R782R	NM_020738.2	NP_065789.1	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate, 220kDa	824	KAP NTPase.				activation of MAPKK activity (GO:0000186)|cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|dendrite morphogenesis (GO:0048813)|in utero embryonic development (GO:0001701)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of neuron projection development (GO:0010976)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|protein complex (GO:0043234)	PDZ domain binding (GO:0030165)	p.R824R(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(25)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	60	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					TTTGAATCCCGAAGCACACTA	0.408																																																	1	Substitution - coding silent(1)	kidney(1)											234.0	211.0	218.0					2																	8919170		1881	4116	5997	SO:0001819	synonymous_variant	57498			AK025528	CCDS42650.1	2p24	2013-01-10			ENSG00000134313	ENSG00000134313		"""Ankyrin repeat domain containing"""	29508	protein-coding gene	gene with protein product	"""ankyrin repeat-rich membrane-spanning protein"""	615759				10998417, 10574462	Standard	NM_020738		Approved	ARMS	uc002qzc.2	Q9ULH0	OTTHUMG00000151658	ENST00000256707.3:c.2470C>A	2.37:g.8919170G>T			A1L4N4|Q4VC08|Q6MZU2|Q9H889|Q9H9E4|Q9NT37|Q9UF42	Silent	SNP	ENST00000256707.3	37	CCDS42650.1																																																																																				0.408	KIDINS220-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323408.2		NM_020738	
KRTAP4-11	653240	broad.mit.edu	37	17	39274415	39274415	+	Silent	SNP	C	C	T	rs425487		TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr17:39274415C>T	ENST00000391413.2	-	1	191	c.153G>A	c.(151-153)agG>agA	p.R51R		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	51	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].		Missing (in allele KAP4.14). {ECO:0000269|PubMed:15955084}.			keratin filament (GO:0045095)		p.R51R(6)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			AGCACTGGGGCCTGCAGCAGC	0.667																																																	6	Substitution - coding silent(6)	endometrium(3)|kidney(2)|lung(1)											9.0	15.0	13.0					17																	39274415		682	1579	2261	SO:0001819	synonymous_variant	653240			AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.153G>A	17.37:g.39274415C>T			A0AUY2	Silent	SNP	ENST00000391413.2	37	CCDS45675.1																																																																																				0.667	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1			
LCN1	3933	broad.mit.edu	37	9	138416709	138416709	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr9:138416709A>G	ENST00000263598.2	+	5	497	c.437A>G	c.(436-438)gAg>gGg	p.E146G	LCN1_ENST00000371781.3_Missense_Mutation_p.E146G	NM_001252617.1|NM_001252618.1|NM_001252619.1|NM_002297.3	NP_001239546.1|NP_001239547.1|NP_001239548.1|NP_002288.1	P31025	LCN1_HUMAN	lipocalin 1	146					negative regulation of endopeptidase activity (GO:0010951)|proteolysis (GO:0006508)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|sensory perception of taste (GO:0050909)|transport (GO:0006810)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)	p.E146G(2)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)	13		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.54e-08)|Epithelial(140;5.25e-08)|all cancers(34;9.27e-07)|READ - Rectum adenocarcinoma(205;0.155)		GAAGCCTTGGAGGACTTTGAG	0.652																																																	2	Substitution - Missense(2)	kidney(1)|central_nervous_system(1)											34.0	30.0	32.0					9																	138416709		2201	4300	6501	SO:0001583	missense	3933				CCDS6991.1	9q34	2011-11-14	2011-11-01		ENSG00000160349	ENSG00000160349		"""Lipocalins"""	6525	protein-coding gene	gene with protein product	"""Von Ebner gland protein"", ""tear lipocalin"", ""lipocalin 1-like 2"", ""tear prealbumin"""	151675	"""lipocalin 1 (protein migrating faster than albumin, tear prealbumin)"", ""lipocalin 1 (tear prealbumin)"""			8276406	Standard	NM_002297		Approved	VEGP, TP, PMFA, MGC71975, TLC	uc022bpk.1	P31025	OTTHUMG00000020908	ENST00000263598.2:c.437A>G	9.37:g.138416709A>G	ENSP00000263598:p.Glu146Gly		Q5T8A1	Missense_Mutation	SNP	ENST00000263598.2	37	CCDS6991.1	.	.	.	.	.	.	.	.	.	.	A	12.61	1.988307	0.35036	.	.	ENSG00000160349	ENST00000263598;ENST00000371781	T;T	0.12361	2.69;2.69	3.28	-3.09	0.05331	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.847626	0.10026	N	0.725343	T	0.19604	0.0471	M	0.87180	2.865	0.09310	N	1	B	0.30870	0.298	B	0.26310	0.068	T	0.26121	-1.0112	10	0.87932	D	0	.	11.2067	0.48773	0.2934:0.7065:0.0:0.0	.	146	P31025	LCN1_HUMAN	G	146	ENSP00000263598:E146G;ENSP00000360846:E146G	ENSP00000263598:E146G	E	+	2	0	LCN1	137556530	0.251000	0.23961	0.000000	0.03702	0.296000	0.27459	0.261000	0.18442	-0.543000	0.06240	0.519000	0.50382	GAG		0.652	LCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054992.1		NM_002297	
LPCAT2	54947	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	55565881	55565881	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr16:55565881A>T	ENST00000262134.5	+	5	882	c.698A>T	c.(697-699)aAa>aTa	p.K233I		NM_017839.4	NP_060309.2	Q7L5N7	PCAT2_HUMAN	lysophosphatidylcholine acyltransferase 2	233					glycerophospholipid biosynthetic process (GO:0046474)|membrane organization (GO:0061024)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)|1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|calcium ion binding (GO:0005509)	p.K233I(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	12						ATTACTTTTAAACCAGGTGAG	0.264																																																	1	Substitution - Missense(1)	kidney(1)											57.0	66.0	63.0					16																	55565881		2193	4281	6474	SO:0001583	missense	54947			AK000488	CCDS10753.1	16q12.2	2013-01-10	2007-12-17	2007-12-17	ENSG00000087253	ENSG00000087253		"""EF-hand domain containing"""	26032	protein-coding gene	gene with protein product		612040	"""acyltransferase like 1"""	AYTL1		16704971	Standard	NM_017839		Approved	FLJ20481	uc002eie.4	Q7L5N7	OTTHUMG00000133238	ENST00000262134.5:c.698A>T	16.37:g.55565881A>T	ENSP00000262134:p.Lys233Ile		A3KBM1|Q6MZJ6|Q9NX23	Missense_Mutation	SNP	ENST00000262134.5	37	CCDS10753.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.257252	0.80246	.	.	ENSG00000087253	ENST00000262134	D	0.95171	-3.63	5.29	5.29	0.74685	Phospholipid/glycerol acyltransferase (2);	0.000000	0.85682	D	0.000000	D	0.98080	0.9367	H	0.95645	3.7	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99470	1.0945	10	0.87932	D	0	-33.089	15.5099	0.75772	1.0:0.0:0.0:0.0	.	233	Q7L5N7	PCAT2_HUMAN	I	233	ENSP00000262134:K233I	ENSP00000262134:K233I	K	+	2	0	LPCAT2	54123382	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.882000	0.87258	2.128000	0.65567	0.459000	0.35465	AAA		0.264	LPCAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256977.2		NM_017839	
LYPLA2P1	653639	broad.mit.edu	37	6	33333333	33333333	+	IGR	SNP	G	G	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr6:33333333G>A								DAXX (42542 upstream) : KIFC1 (25979 downstream)																							AGTTAGACAGGAGGCAGCAGC	0.577																																																	0																																										SO:0001628	intergenic_variant	653639																															6.37:g.33333333G>A				Missense_Mutation	SNP		37																																																																																				0	0.577									
MAGEC1	9947	broad.mit.edu;hgsc.bcm.edu	37	X	140994211	140994211	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chrX:140994211C>T	ENST00000285879.4	+	4	1307	c.1021C>T	c.(1021-1023)Cct>Tct	p.P341S	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	341								p.P341S(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					TCTCCAGATTCCTATGACCTC	0.468										HNSCC(15;0.026)																																							1	Substitution - Missense(1)	kidney(1)											120.0	123.0	122.0					X																	140994211		2202	4295	6497	SO:0001583	missense	9947			AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.1021C>T	X.37:g.140994211C>T	ENSP00000285879:p.Pro341Ser		A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	ENST00000285879.4	37	CCDS35417.1	.	.	.	.	.	.	.	.	.	.	c	9.043	0.990060	0.18966	.	.	ENSG00000155495	ENST00000285879	T	0.06608	3.28	.	.	.	.	.	.	.	.	T	0.04998	0.0134	N	0.08118	0	0.80722	D	1	P	0.48350	0.909	P	0.50440	0.641	T	0.50849	-0.8779	8	0.66056	D	0.02	.	5.9409	0.19192	0.0:0.9994:0.0:6.0E-4	.	341	O60732	MAGC1_HUMAN	S	341	ENSP00000285879:P341S	ENSP00000285879:P341S	P	+	1	0	MAGEC1	140821877	0.133000	0.22466	0.045000	0.18777	0.045000	0.14185	1.674000	0.37544	0.148000	0.19059	0.150000	0.16122	CCT		0.468	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1		NM_005462	
MALAT1	378938	broad.mit.edu	37	11	65271716	65271716	+	lincRNA	SNP	C	C	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr11:65271716C>T	ENST00000534336.1	+	0	6484					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		TATCAGCATACTCAAAATTTT	0.408																																																	0													35.0	36.0	36.0					11																	65271716		874	1988	2862			378938			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65271716C>T				RNA	SNP	ENST00000534336.1	37																																																																																					0.408	MALAT1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000389143.1		NR_002819	
MDN1	23195	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	90388338	90388338	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr6:90388338A>C	ENST00000369393.3	-	75	12507	c.12392T>G	c.(12391-12393)tTt>tGt	p.F4131C	MDN1_ENST00000428876.1_Missense_Mutation_p.F4131C|RP1-122O8.7_ENST00000438877.1_RNA			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	4131					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)	p.F4131C(1)		NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		AAGGTGTTTAAAGAGGTCTGA	0.443																																																	1	Substitution - Missense(1)	kidney(1)											173.0	158.0	163.0					6																	90388338		2203	4300	6503	SO:0001583	missense	23195			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.12392T>G	6.37:g.90388338A>C	ENSP00000358400:p.Phe4131Cys		O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	37	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	A	9.967	1.224507	0.22457	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.04083	3.71;3.71	4.92	4.92	0.64577	.	0.000000	0.85682	D	0.000000	T	0.15825	0.0381	M	0.83012	2.62	0.58432	D	0.999999	D	0.89917	1.0	D	0.85130	0.997	T	0.01021	-1.1478	10	0.87932	D	0	.	14.5645	0.68165	1.0:0.0:0.0:0.0	.	4131	Q9NU22	MDN1_HUMAN	C	4131	ENSP00000358400:F4131C;ENSP00000413970:F4131C	ENSP00000358400:F4131C	F	-	2	0	MDN1	90445059	1.000000	0.71417	0.999000	0.59377	0.257000	0.26127	8.808000	0.91939	1.847000	0.53656	0.459000	0.35465	TTT		0.443	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2			
MSL3P1	151507	broad.mit.edu;ucsc.edu	37	2	234775439	234775439	+	RNA	SNP	T	T	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr2:234775439T>A	ENST00000438684.1	-	0	675					NR_024322.1		P0C860	MS3L2_HUMAN	male-specific lethal 3 homolog (Drosophila) pseudogene 1						chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)											CTCCTATTAGTATTTGTGGCA	0.468																																																	0													63.0	51.0	55.0					2																	234775439		692	1591	2283			0			BI831020		2q37.1	2011-03-21	2011-03-21	2011-03-21	ENSG00000224287	ENSG00000224287			17837	pseudogene	pseudogene			"""male-specific lethal 3-like 2 (Drosophila)"""	MSL3L2			Standard	NR_024322		Approved		uc010znf.2	P0C860	OTTHUMG00000059126		2.37:g.234775439T>A				Missense_Mutation	SNP	ENST00000438684.1	37																																																																																					0.468	MSL3P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000131002.2		NR_024322	
MTOR	2475	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	11188164	11188164	+	Missense_Mutation	SNP	G	G	T	rs587777893		TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr1:11188164G>T	ENST00000361445.4	-	43	6006	c.5930C>A	c.(5929-5931)aCa>aAa	p.T1977K	MTOR_ENST00000376838.1_Missense_Mutation_p.T182K	NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	1977	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.T1977R(2)|p.T1977K(1)		breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	AGAAGCCACTGTCAGTGGGTA	0.478																																																	3	Substitution - Missense(3)	kidney(2)|prostate(1)											117.0	121.0	120.0					1																	11188164		2203	4300	6503	SO:0001583	missense	2475			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.5930C>A	1.37:g.11188164G>T	ENSP00000354558:p.Thr1977Lys		Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	37	CCDS127.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.883448	0.91740	.	.	ENSG00000198793	ENST00000361445;ENST00000376838	T;T	0.81247	-1.47;-1.47	5.8	5.8	0.92144	PIK-related kinase (1);	0.000000	0.85682	D	0.000000	D	0.91389	0.7283	M	0.88704	2.975	0.80722	D	1	D	0.76494	0.999	D	0.65987	0.94	D	0.92259	0.5815	10	0.87932	D	0	-18.9382	20.063	0.97692	0.0:0.0:1.0:0.0	.	1977	P42345	MTOR_HUMAN	K	1977;182	ENSP00000354558:T1977K;ENSP00000366034:T182K	ENSP00000354558:T1977K	T	-	2	0	MTOR	11110751	1.000000	0.71417	0.968000	0.41197	0.902000	0.53008	9.188000	0.94921	2.735000	0.93741	0.655000	0.94253	ACA		0.478	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1		NM_004958	
MUC16	94025	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	9066745	9066745	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr19:9066745G>T	ENST00000397910.4	-	3	20904	c.20701C>A	c.(20701-20703)Caa>Aaa	p.Q6901K		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	6903	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.Q6901K(2)|p.Q2534K(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ACAGAGGATTGTGACCCATGT	0.488																																																	3	Substitution - Missense(3)	kidney(3)											271.0	258.0	262.0					19																	9066745		2121	4236	6357	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.20701C>A	19.37:g.9066745G>T	ENSP00000381008:p.Gln6901Lys		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	5.408	0.260390	0.10239	.	.	ENSG00000181143	ENST00000397910	T	0.23147	1.92	2.57	0.226	0.15353	.	.	.	.	.	T	0.16385	0.0394	L	0.29908	0.895	.	.	.	B	0.31968	0.349	B	0.34385	0.181	T	0.26677	-1.0096	8	0.87932	D	0	.	2.8799	0.05644	0.1613:0.0:0.5667:0.2721	.	6901	B5ME49	.	K	6901	ENSP00000381008:Q6901K	ENSP00000381008:Q6901K	Q	-	1	0	MUC16	8927745	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.046000	0.11983	0.125000	0.18397	0.407000	0.27541	CAA		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1		NM_024690	
MYH3	4621	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	10535165	10535165	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr17:10535165C>A	ENST00000583535.1	-	35	5212	c.5125G>T	c.(5125-5127)Gac>Tac	p.D1709Y	MYH3_ENST00000226209.7_Missense_Mutation_p.D1709Y	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	1709					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)	p.D1709Y(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						TCGTTGGAGTCCAGGAGCTCC	0.647																																																	1	Substitution - Missense(1)	kidney(1)											63.0	63.0	63.0					17																	10535165		2203	4300	6503	SO:0001583	missense	4621				CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.5125G>T	17.37:g.10535165C>A	ENSP00000464317:p.Asp1709Tyr		Q15492	Missense_Mutation	SNP	ENST00000583535.1	37	CCDS11157.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.745517	0.89663	.	.	ENSG00000109063	ENST00000226209	T	0.80824	-1.42	4.85	4.85	0.62838	Myosin tail (1);	.	.	.	.	D	0.92335	0.7568	M	0.93197	3.39	0.52099	D	0.999946	D	0.76494	0.999	D	0.73708	0.981	D	0.94108	0.7368	9	0.87932	D	0	.	18.5202	0.90950	0.0:1.0:0.0:0.0	.	1709	P11055	MYH3_HUMAN	Y	1709	ENSP00000226209:D1709Y	ENSP00000226209:D1709Y	D	-	1	0	MYH3	10475890	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	7.613000	0.82986	2.665000	0.90641	0.561000	0.74099	GAC		0.647	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252734.2		NM_002470	
MYO1H	283446	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	109826583	109826583	+	Silent	SNP	C	C	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr12:109826583C>T	ENST00000431443.2	+	1	60	c.60C>T	c.(58-60)gaC>gaT	p.D20D	MYO1H_ENST00000310903.5_Silent_p.D20D	NM_001101421.3	NP_001094891.3	Q8N1T3	MYO1H_HUMAN	myosin IH	20	Myosin motor.					myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.D20D(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(17)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	47						TGCTATTGGACGCGTACACCA	0.532																																																	2	Substitution - coding silent(2)	endometrium(1)|kidney(1)											216.0	223.0	220.0					12																	109826583		2103	4233	6336	SO:0001819	synonymous_variant	283446				CCDS53826.1	12q24.11	2011-09-27			ENSG00000174527	ENSG00000174527		"""Myosins / Myosin superfamily : Class I"""	13879	protein-coding gene	gene with protein product		614636					Standard	NM_001101421		Approved	FLJ37587	uc010sxn.1	Q8N1T3	OTTHUMG00000169252	ENST00000431443.2:c.60C>T	12.37:g.109826583C>T			F5H3C6	Silent	SNP	ENST00000431443.2	37																																																																																					0.532	MYO1H-201	KNOWN	basic	protein_coding	protein_coding			NM_173597	
NDST4	64579	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	115769372	115769372	+	Splice_Site	SNP	A	A	C			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr4:115769372A>C	ENST00000264363.2	-	9	2617	c.1939T>G	c.(1939-1941)Tgg>Ggg	p.W647G		NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4	647	Heparan sulfate N-sulfotransferase 4.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)	p.W647G(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		TTTTCTTACCAGTCTATTCCT	0.348																																																	1	Substitution - Missense(1)	kidney(1)											162.0	152.0	155.0					4																	115769372		2203	4299	6502	SO:0001630	splice_region_variant	64579			AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.1940+1T>G	4.37:g.115769372A>C			Q2KHM8	Missense_Mutation	SNP	ENST00000264363.2	37	CCDS3706.1	.	.	.	.	.	.	.	.	.	.	A	20.5	4.004993	0.74932	.	.	ENSG00000138653	ENST00000264363	T	0.59224	0.28	5.71	5.71	0.89125	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	D	0.82287	0.5004	M	0.93462	3.42	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.87165	0.2217	10	0.87932	D	0	.	15.9869	0.80160	1.0:0.0:0.0:0.0	.	647	Q9H3R1	NDST4_HUMAN	G	647	ENSP00000264363:W647G	ENSP00000264363:W647G	W	-	1	0	NDST4	115988821	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	8.910000	0.92685	2.171000	0.68590	0.533000	0.62120	TGG		0.348	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256427.1		NM_022569	Missense_Mutation
NFATC3	4775	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	68208354	68208354	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr16:68208354A>G	ENST00000346183.3	+	6	1876	c.1852A>G	c.(1852-1854)Atg>Gtg	p.M618V	NFATC3_ENST00000535127.2_3'UTR|NFATC3_ENST00000575270.1_Missense_Mutation_p.M618V|NFATC3_ENST00000329524.4_Missense_Mutation_p.M618V|NFATC3_ENST00000349223.5_Missense_Mutation_p.M618V	NM_173165.2	NP_775188.1	Q12968	NFAC3_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3	618					cellular respiration (GO:0045333)|cellular response to calcium ion (GO:0071277)|cellular response to lithium ion (GO:0071285)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.M618V(2)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	44		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)		AGGTCATGAAATGGTTGTGAC	0.343																																																	2	Substitution - Missense(2)	kidney(2)											178.0	185.0	182.0					16																	68208354		2198	4300	6498	SO:0001583	missense	4775			L41067	CCDS10860.1, CCDS10861.1, CCDS10862.1	16q22	2009-11-24			ENSG00000072736	ENSG00000072736		"""Nuclear factor of activated T-cells"""	7777	protein-coding gene	gene with protein product		602698				7749981	Standard	NM_004555		Approved	NFAT4, NFATX	uc002evo.2	Q12968	OTTHUMG00000137555	ENST00000346183.3:c.1852A>G	16.37:g.68208354A>G	ENSP00000300659:p.Met618Val		O75211|Q14516|Q99840|Q99841|Q99842	Missense_Mutation	SNP	ENST00000346183.3	37	CCDS10860.1	.	.	.	.	.	.	.	.	.	.	A	6.949	0.544962	0.13312	.	.	ENSG00000072736	ENST00000349223;ENST00000346183;ENST00000329524;ENST00000535127	T;T;T	0.11277	2.79;2.79;2.79	5.62	4.51	0.55191	Cell surface receptor IPT/TIG (1);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.036954	0.85682	D	0.000000	T	0.09642	0.0237	L	0.46670	1.46	0.44807	D	0.997816	B;P;B;B	0.39480	0.194;0.675;0.194;0.194	B;B;B;B	0.34779	0.026;0.189;0.026;0.026	T	0.07252	-1.0782	10	0.87932	D	0	-8.6546	7.5684	0.27894	0.5905:0.2767:0.0:0.1328	.	618;618;618;618	Q12968;Q12968-3;B5B2S0;B5B2S2	NFAC3_HUMAN;.;.;.	V	618;618;618;139	ENSP00000264008:M618V;ENSP00000300659:M618V;ENSP00000331324:M618V	ENSP00000331324:M618V	M	+	1	0	NFATC3	66765855	1.000000	0.71417	1.000000	0.80357	0.010000	0.07245	6.009000	0.70745	0.948000	0.37687	-0.435000	0.05868	ATG		0.343	NFATC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268890.2		NM_004555	
NFU1	27247	hgsc.bcm.edu;ucsc.edu	37	2	69650750	69650751	+	Frame_Shift_Ins	INS	-	-	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr2:69650750_69650751insT	ENST00000410022.2	-	3	470_471	c.265_266insA	c.(265-267)cccfs	p.P89fs	NFU1_ENST00000394305.1_Intron|NFU1_ENST00000303698.3_Frame_Shift_Ins_p.P65fs|NFU1_ENST00000471185.1_Intron	NM_001002755.2	NP_001002755.1	Q9UMS0	NFU1_HUMAN	NFU1 iron-sulfur cluster scaffold	89					iron-sulfur cluster assembly (GO:0016226)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|iron ion binding (GO:0005506)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)	7						AGCTGGGGTGGGAAAATCCATG	0.391																																																	0																																										SO:0001589	frameshift_variant	27247			AJ132584	CCDS33217.1, CCDS42694.1, CCDS46315.1	2p15-p13	2014-07-03	2014-07-03	2006-10-24	ENSG00000169599	ENSG00000169599			16287	protein-coding gene	gene with protein product		608100	"""HIRA interacting protein 5"", ""NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae)"""	HIRIP5		11342215, 12886008	Standard	NR_045631		Approved	CGI-33, NifU, NIFUC	uc002sfk.3	Q9UMS0	OTTHUMG00000152668	ENST00000410022.2:c.265_266insA	2.37:g.69650750_69650751insT	ENSP00000387219:p.Pro89fs		B4DUL9|Q53QE5|Q6VNZ8|Q7Z5B1|Q7Z5B2|Q9Y322	Frame_Shift_Ins	INS	ENST00000410022.2	37	CCDS33217.1																																																																																				0.391	NFU1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327279.3		NM_015700	
NOL11	25926	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	65735643	65735643	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr17:65735643G>C	ENST00000253247.4	+	16	1969	c.1854G>C	c.(1852-1854)aaG>aaC	p.K618N	NOL11_ENST00000535137.1_Missense_Mutation_p.K436N|SNORA38B_ENST00000363524.1_RNA	NM_015462.3	NP_056277.2	Q9H8H0	NOL11_HUMAN	nucleolar protein 11	618					maturation of SSU-rRNA (GO:0030490)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|t-UTP complex (GO:0034455)	poly(A) RNA binding (GO:0044822)	p.K618N(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	11	all_cancers(12;1.54e-10)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0518)|COAD - Colon adenocarcinoma(4;0.0977)|LUSC - Lung squamous cell carcinoma(166;0.24)			TGTTTCTTAAGTATTTGTATT	0.328																																																	1	Substitution - Missense(1)	kidney(1)											91.0	88.0	89.0					17																	65735643		2203	4300	6503	SO:0001583	missense	25926			AK023702	CCDS11671.1	17q24.2	2005-08-08							24557	protein-coding gene	gene with protein product		615366				12477932	Standard	NM_015462		Approved	DKFZP586L0724	uc002jgd.1	Q9H8H0		ENST00000253247.4:c.1854G>C	17.37:g.65735643G>C	ENSP00000253247:p.Lys618Asn		B7Z5V9|Q7L5S1|Q9UG18	Missense_Mutation	SNP	ENST00000253247.4	37	CCDS11671.1	.	.	.	.	.	.	.	.	.	.	G	10.76	1.441694	0.25900	.	.	ENSG00000130935	ENST00000253247;ENST00000535137	T	0.48201	0.82	5.0	4.01	0.46588	.	0.458821	0.25529	N	0.030052	T	0.30854	0.0778	N	0.22421	0.69	0.22601	N	0.998948	B	0.23937	0.094	B	0.19666	0.026	T	0.22977	-1.0201	10	0.66056	D	0.02	0.0049	6.651	0.22961	0.0916:0.0:0.729:0.1794	.	618	Q9H8H0	NOL11_HUMAN	N	618;436	ENSP00000253247:K618N	ENSP00000253247:K618N	K	+	3	2	NOL11	63166105	1.000000	0.71417	1.000000	0.80357	0.554000	0.35429	2.357000	0.44125	1.198000	0.43158	0.579000	0.79373	AAG		0.328	NOL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448074.1		NM_015462	
NT5DC3	51559	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	104171814	104171814	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr12:104171814G>T	ENST00000392876.3	-	14	1480	c.1440C>A	c.(1438-1440)ttC>ttA	p.F480L		NM_001031701.2	NP_001026871.1	Q86UY8	NT5D3_HUMAN	5'-nucleotidase domain containing 3	480						cytosol (GO:0005829)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)	p.F480L(1)|p.F405L(1)		NS(1)|breast(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(15)|ovary(2)|skin(1)|stomach(2)	30						GGTCTGTGCGGAACAGGCTTC	0.478																																																	2	Substitution - Missense(2)	kidney(2)											84.0	84.0	84.0					12																	104171814		2203	4300	6503	SO:0001583	missense	51559			AB032786	CCDS41824.1	12q22-q23.1	2006-02-03			ENSG00000111696	ENSG00000111696			30826	protein-coding gene	gene with protein product		611076					Standard	NM_001031701		Approved	TU12B1-TY, FLJ11266	uc010swe.1	Q86UY8	OTTHUMG00000157017	ENST00000392876.3:c.1440C>A	12.37:g.104171814G>T	ENSP00000376615:p.Phe480Leu		Q9NUM7|Q9P2T2|Q9P2T3	Missense_Mutation	SNP	ENST00000392876.3	37	CCDS41824.1	.	.	.	.	.	.	.	.	.	.	G	15.85	2.954872	0.53293	.	.	ENSG00000111696	ENST00000392876	T	0.23348	1.91	5.8	2.64	0.31445	HAD-like domain (1);	0.000000	0.85682	D	0.000000	T	0.53674	0.1811	M	0.88377	2.95	0.49687	D	0.999817	D	0.89917	1.0	D	0.97110	1.0	T	0.60556	-0.7240	10	0.87932	D	0	-34.7602	10.8689	0.46872	0.2629:0.0:0.7371:0.0	.	480	Q86UY8	NT5D3_HUMAN	L	480	ENSP00000376615:F480L	ENSP00000376615:F480L	F	-	3	2	NT5DC3	102695944	1.000000	0.71417	1.000000	0.80357	0.002000	0.02628	2.142000	0.42177	0.801000	0.34066	-0.136000	0.14681	TTC		0.478	NT5DC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347118.2		NM_016575	
NOS1	4842	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	117672492	117672492	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr12:117672492A>T	ENST00000338101.4	-	21	3219	c.3215T>A	c.(3214-3216)cTg>cAg	p.L1072Q	NOS1_ENST00000344089.3_3'UTR|NOS1_ENST00000317775.6_Missense_Mutation_p.L1038Q			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)	p.L1038Q(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		GAAGACACCCAGGTGGTCCCC	0.592																																					Esophageal Squamous(162;1748 2599 51982 52956)												1	Substitution - Missense(1)	kidney(1)											47.0	51.0	50.0					12																	117672492		2027	4184	6211	SO:0001583	missense	4842				CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.3215T>A	12.37:g.117672492A>T	ENSP00000337459:p.Leu1072Gln			Missense_Mutation	SNP	ENST00000338101.4	37	CCDS55890.1	.	.	.	.	.	.	.	.	.	.	A	29.6	5.022675	0.93462	.	.	ENSG00000089250	ENST00000397605;ENST00000317775;ENST00000541241;ENST00000338101	T;T	0.52983	0.64;0.64	5.05	5.05	0.67936	Riboflavin synthase-like beta-barrel (1);FAD-binding, type 1 (1);NADPH-cytochrome p450 reductase, FAD-binding, alpha-helical domain-3 (1);Ferredoxin reductase-type FAD-binding domain (1);Flavoprotein pyridine nucleotide cytochrome reductase (1);	0.000000	0.64402	D	0.000001	T	0.76737	0.4029	H	0.94771	3.58	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.84119	0.0405	10	0.87932	D	0	-20.3439	14.9474	0.71042	1.0:0.0:0.0:0.0	.	1038	P29475	NOS1_HUMAN	Q	933;1038;1038;1072	ENSP00000320758:L1038Q;ENSP00000337459:L1072Q	ENSP00000320758:L1038Q	L	-	2	0	NOS1	116156875	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.015000	0.93640	2.113000	0.64589	0.459000	0.35465	CTG		0.592	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1			
OR10A4	283297	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	6897950	6897950	+	Silent	SNP	T	T	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr11:6897950T>G	ENST00000379829.2	+	1	95	c.72T>G	c.(70-72)ctT>ctG	p.L24L		NM_207186.2	NP_997069.2	Q9H209	O10A4_HUMAN	olfactory receptor, family 10, subfamily A, member 4	24					axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L24L(1)		kidney(1)|large_intestine(2)|liver(2)|lung(20)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	31		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		CCACTGAGCTTCAGGCTCTAC	0.453																																																	1	Substitution - coding silent(1)	kidney(1)											190.0	177.0	181.0					11																	6897950		2201	4296	6497	SO:0001819	synonymous_variant	283297			AF209506	CCDS7774.1	11p15.4	2012-08-09	2002-11-13	2004-03-10	ENSG00000170782	ENSG00000170782		"""GPCR / Class A : Olfactory receptors"""	15130	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily A, member 4 pseudogene"""	OR10A4P			Standard	NM_207186		Approved		uc010rat.2	Q9H209	OTTHUMG00000165740	ENST00000379829.2:c.72T>G	11.37:g.6897950T>G			B2RNP5|B9EH36|Q96R20	Silent	SNP	ENST00000379829.2	37	CCDS7774.1																																																																																				0.453	OR10A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385985.1		NM_207186	
OR10H2	26538	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	15839672	15839672	+	Silent	SNP	C	C	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr19:15839672C>T	ENST00000305899.3	+	1	839	c.819C>T	c.(817-819)acC>acT	p.T273T		NM_013939.2	NP_039227.1	O60403	O10H2_HUMAN	olfactory receptor, family 10, subfamily H, member 2	273						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T273T(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(1)	27	all_hematologic(1;0.0517)|Acute lymphoblastic leukemia(2;0.074)					AGGGTGACACCCTGATGGCCA	0.552																																																	1	Substitution - coding silent(1)	kidney(1)											150.0	120.0	130.0					19																	15839672		2203	4300	6503	SO:0001819	synonymous_variant	26538			AC004597	CCDS12333.1	19p13.1	2012-08-09				ENSG00000171942		"""GPCR / Class A : Olfactory receptors"""	8173	protein-coding gene	gene with protein product							Standard	NM_013939		Approved		uc002nbm.2	O60403		ENST00000305899.3:c.819C>T	19.37:g.15839672C>T			Q6IFQ1|Q96R58	Silent	SNP	ENST00000305899.3	37	CCDS12333.1																																																																																				0.552	OR10H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460917.1			
OR51T1	401665	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	4903629	4903629	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr11:4903629C>T	ENST00000322049.1	+	1	500	c.500C>T	c.(499-501)aCt>aTt	p.T167I	MMP26_ENST00000380390.1_Intron|OR51T1_ENST00000380378.1_Missense_Mutation_p.T194I|MMP26_ENST00000477339.1_Intron			Q8NGJ9	O51T1_HUMAN	olfactory receptor, family 51, subfamily T, member 1	167						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T167I(1)|p.T194I(1)		NS(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		GCCATAAACACTGTGTCTTTT	0.453																																																	2	Substitution - Missense(2)	kidney(2)											169.0	158.0	162.0					11																	4903629		2201	4298	6499	SO:0001583	missense	401665			BK004283	CCDS31363.1	11p15.4	2012-08-09			ENSG00000176900	ENSG00000176900		"""GPCR / Class A : Olfactory receptors"""	15205	protein-coding gene	gene with protein product							Standard	NM_001004759		Approved		uc010qyp.2	Q8NGJ9	OTTHUMG00000066507	ENST00000322049.1:c.500C>T	11.37:g.4903629C>T	ENSP00000322679:p.Thr167Ile		Q6IFH9	Missense_Mutation	SNP	ENST00000322049.1	37		.	.	.	.	.	.	.	.	.	.	C	6.718	0.501246	0.12822	.	.	ENSG00000176900	ENST00000380378;ENST00000322049	T;T	0.72394	-0.65;-0.65	4.8	-9.59	0.00556	GPCR, rhodopsin-like superfamily (1);	2.089500	0.02057	N	0.050485	T	0.64360	0.2591	L	0.47016	1.485	0.09310	N	1	P	0.39157	0.662	B	0.42138	0.377	T	0.68401	-0.5418	10	0.72032	D	0.01	.	9.5857	0.39514	0.4635:0.3548:0.1817:0.0	.	167	Q8NGJ9	O51T1_HUMAN	I	194;167	ENSP00000369738:T194I;ENSP00000322679:T167I	ENSP00000322679:T167I	T	+	2	0	OR51T1	4860205	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-2.572000	0.00912	-3.054000	0.00259	0.484000	0.47621	ACT		0.453	OR51T1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000142180.1		NM_001004759	
PARP6	56965	broad.mit.edu;hgsc.bcm.edu	37	15	72542434	72542434	+	Splice_Site	SNP	C	C	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr15:72542434C>T	ENST00000569795.1	-	19	2106		c.e19-1		PARP6_ENST00000287196.9_Splice_Site|PARP6_ENST00000260376.7_Splice_Site|PARP6_ENST00000413097.2_Splice_Site			Q2NL67	PARP6_HUMAN	poly (ADP-ribose) polymerase family, member 6								NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.?(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(8)|skin(1)|urinary_tract(1)	18						GTGGGACCCACTGTAAGGCAG	0.512																																																	1	Unknown(1)	kidney(1)											118.0	119.0	119.0					15																	72542434		2016	4184	6200	SO:0001630	splice_region_variant	56965			AL390093	CCDS10241.2	15q22	2010-02-16			ENSG00000137817	ENSG00000137817		"""Poly (ADP-ribose) polymerases"""	26921	protein-coding gene	gene with protein product						15273990	Standard	XM_005254557		Approved	pART17	uc002auc.3	Q2NL67	OTTHUMG00000133443	ENST00000569795.1:c.1419-1G>A	15.37:g.72542434C>T			Q9H7C5|Q9H9X6|Q9HAF3|Q9NPS6|Q9UFG4	Splice_Site	SNP	ENST00000569795.1	37	CCDS10241.2	.	.	.	.	.	.	.	.	.	.	C	22.0	4.237319	0.79800	.	.	ENSG00000137817	ENST00000419739;ENST00000287196;ENST00000260376;ENST00000413097	.	.	.	4.97	4.97	0.65823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.9545	0.86254	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PARP6	70329488	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.483000	0.81158	2.592000	0.87571	0.555000	0.69702	.		0.512	PARP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257315.2		NM_020214	Intron
PHF14	9678	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	11078422	11078422	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr7:11078422T>G	ENST00000403050.3	+	11	2468	c.2016T>G	c.(2014-2016)aaT>aaG	p.N672K	PHF14_ENST00000445996.2_Missense_Mutation_p.N387K	NM_014660.3	NP_055475.2	O94880	PHF14_HUMAN	PHD finger protein 14	672					lung alveolus development (GO:0048286)|negative regulation of mesenchymal cell proliferation involved in lung development (GO:2000791)|negative regulation of platelet-derived growth factor receptor-alpha signaling pathway (GO:2000584)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.N672K(1)		NS(2)|breast(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	35				UCEC - Uterine corpus endometrioid carcinoma (126;0.205)		AAAACCTGAATGGAAAACTTC	0.348																																																	1	Substitution - Missense(1)	kidney(1)											76.0	72.0	73.0					7																	11078422		1836	4077	5913	SO:0001583	missense	9678			AB018326	CCDS47542.1	7p21.3	2013-01-28			ENSG00000106443	ENSG00000106443		"""Zinc fingers, PHD-type"""	22203	protein-coding gene	gene with protein product						9872452	Standard	NM_014660		Approved	KIAA0783	uc003sry.2	O94880	OTTHUMG00000150463	ENST00000403050.3:c.2016T>G	7.37:g.11078422T>G	ENSP00000385795:p.Asn672Lys		A7MCZ3|B4DI82	Missense_Mutation	SNP	ENST00000403050.3	37	CCDS47542.1	.	.	.	.	.	.	.	.	.	.	T	10.66	1.413564	0.25465	.	.	ENSG00000106443	ENST00000403050;ENST00000445996	T;T	0.70045	-0.1;-0.45	4.62	3.47	0.39725	.	0.103751	0.64402	D	0.000004	T	0.66577	0.2803	N	0.24115	0.695	0.51482	D	0.999928	D;D;D;B	0.63880	0.989;0.981;0.993;0.035	D;D;D;B	0.72982	0.969;0.932;0.979;0.011	T	0.61422	-0.7066	10	0.25106	T	0.35	.	10.3996	0.44222	0.0:0.0773:0.0:0.9227	.	387;387;672;672	O94880-2;B4DG57;A8MSQ1;O94880	.;.;.;PHF14_HUMAN	K	672;387	ENSP00000385795:N672K;ENSP00000403907:N387K	ENSP00000385795:N672K	N	+	3	2	PHF14	11044947	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.429000	0.34903	0.925000	0.37094	0.533000	0.62120	AAT		0.348	PHF14-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000318212.1		NM_014660	
PLA2G4E	123745	hgsc.bcm.edu	37	15	42302338	42302338	+	Frame_Shift_Del	DEL	A	A	-	rs28736629|rs59057790|rs547723807	byFrequency	TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr15:42302338delA	ENST00000413860.2	-	1	107	c.108delT	c.(106-108)ggtfs	p.G38fs	PLA2G4E_ENST00000399518.3_Intron|CTD-2382E5.2_ENST00000552704.1_RNA			Q3MJ16	PA24E_HUMAN	phospholipase A2, group IVE	48	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phospholipase A2 activity (GO:0004623)	p.A39fs*19(1)		NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|stomach(1)	16		all_cancers(109;8.09e-13)|all_epithelial(112;2.03e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.0273)		OV - Ovarian serous cystadenocarcinoma(18;7.61e-18)|GBM - Glioblastoma multiforme(94;3.07e-06)		TGGCCCCCCCACCCCGGGCCT	0.592																																																	1	Deletion - Frameshift(1)	ovary(1)											53.0	67.0	62.0					15																	42302338		1855	4078	5933	SO:0001589	frameshift_variant	123745				CCDS55962.1	15q15.1	2008-09-19			ENSG00000188089	ENSG00000188089	3.1.1.4		24791	protein-coding gene	gene with protein product						15866882	Standard	NM_001206670		Approved	FLJ45651	uc021sjp.1	Q3MJ16	OTTHUMG00000130371	ENST00000413860.2:c.108delT	15.37:g.42302338delA	ENSP00000413897:p.Gly38fs		Q6ZSC0	Frame_Shift_Del	DEL	ENST00000413860.2	37																																																																																					0.592	PLA2G4E-201	KNOWN	basic	protein_coding	protein_coding			NM_198442	
PLCG1	5335	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	39798840	39798840	+	Silent	SNP	C	C	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr20:39798840C>T	ENST00000373271.1	+	24	3144	c.2739C>T	c.(2737-2739)gcC>gcT	p.A913A	PLCG1_ENST00000373272.2_Silent_p.A913A|PLCG1_ENST00000244007.3_Silent_p.A913A	NM_182811.1	NP_877963.1	P19174	PLCG1_HUMAN	phospholipase C, gamma 1	913	PH 2; second part. {ECO:0000255|PROSITE- ProRule:PRU00145}.				activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|cell migration (GO:0016477)|cellular response to epidermal growth factor stimulus (GO:0071364)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phospholipid catabolic process (GO:0009395)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cell projection (GO:0042995)|cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|protein kinase binding (GO:0019901)|receptor signaling protein activity (GO:0005057)	p.A913A(1)		breast(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(16)|skin(6)|urinary_tract(2)	46		Myeloproliferative disorder(115;0.00878)				ATGTTGCTGCCGACTCACAGG	0.612																																																	1	Substitution - coding silent(1)	kidney(1)											89.0	90.0	90.0					20																	39798840		2203	4300	6503	SO:0001819	synonymous_variant	5335			M34667	CCDS13313.1, CCDS13314.1	20q12-q13.1	2013-02-14	2004-01-29		ENSG00000124181	ENSG00000124181	3.1.4.11	"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"", ""SH2 domain containing"""	9065	protein-coding gene	gene with protein product		172420	"""phospholipase C, gamma 1 (formerly subtype 148)"""	PLC1		2167438, 3254788	Standard	NM_182811		Approved	PLC148, PLC-II, PLCgamma1, NCKAP3	uc002xjo.1	P19174	OTTHUMG00000033082	ENST00000373271.1:c.2739C>T	20.37:g.39798840C>T			B7ZLY7|B9EGH4|E1P5W4|Q2V575	Silent	SNP	ENST00000373271.1	37	CCDS13314.1																																																																																				0.612	PLCG1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080514.3		NM_182811	
POLR2A	5430	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	7405412	7405412	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr17:7405412T>C	ENST00000322644.6	+	15	2942	c.2543T>C	c.(2542-2544)aTt>aCt	p.I848T		NM_000937.4	NP_000928	P24928	RPB1_HUMAN	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	848					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA-directed RNA polymerase activity (GO:0003968)|ubiquitin protein ligase binding (GO:0031625)	p.I848T(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(17)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	50		Prostate(122;0.173)				GAGGGGCTCATTGACACGGCT	0.587																																																	1	Substitution - Missense(1)	kidney(1)											41.0	36.0	37.0					17																	7405412		2203	4300	6503	SO:0001583	missense	5430					17p13.1	2013-01-21	2002-08-29		ENSG00000181222	ENSG00000181222	2.7.7.6	"""RNA polymerase subunits"""	9187	protein-coding gene	gene with protein product	"""DNA-directed RNA polymerase II largest subunit, RNA polymerase II 220 kd subunit"", ""RNA polymerase II subunit B1"""	180660	"""polymerase (RNA) II (DNA directed) polypeptide A (220kD)"""	POLR2			Standard	NM_000937		Approved	POLRA, RPB1	uc002ghf.4	P24928	OTTHUMG00000177594	ENST00000322644.6:c.2543T>C	17.37:g.7405412T>C	ENSP00000314949:p.Ile848Thr		A6NN93|B9EH88|Q6NX41	Missense_Mutation	SNP	ENST00000322644.6	37	CCDS32548.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.398059	0.83120	.	.	ENSG00000181222	ENST00000535204;ENST00000322644	T	0.71698	-0.59	5.92	5.92	0.95590	RNA polymerase Rpb1, domain 5 (1);	0.000000	0.85682	D	0.000000	D	0.87744	0.6254	M	0.92738	3.34	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90538	0.4500	10	0.87932	D	0	-10.549	15.3488	0.74368	0.0:0.0:0.0:1.0	.	848	P24928	RPB1_HUMAN	T	804;848	ENSP00000314949:I848T	ENSP00000314949:I848T	I	+	2	0	SLC35G6	7346136	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	5.106000	0.64597	2.274000	0.75844	0.533000	0.62120	ATT		0.587	POLR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437967.1		NM_000937	
POM121L9P	29774	broad.mit.edu	37	22	24659734	24659734	+	RNA	SNP	T	T	C			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr22:24659734T>C	ENST00000414583.2	+	0	3259					NR_003714.1				POM121 transmembrane nucleoporin-like 9, pseudogene																		CTCTCTCCTGTGGGAGGGGGG	0.632																																																	0																																												29774			AL040062, AL117401		22q11.22	2012-03-13	2012-03-13		ENSG00000128262	ENSG00000128262			30080	pseudogene	pseudogene			"""POM121 membrane glycoprotein-like 9, pseudogene"""				Standard	NR_003714		Approved				OTTHUMG00000150763		22.37:g.24659734T>C				RNA	SNP	ENST00000414583.2	37																																																																																					0.632	POM121L9P-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000319991.1		NM_014549	
POM121L9P	29774	broad.mit.edu	37	22	24659741	24659741	+	RNA	SNP	G	G	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr22:24659741G>A	ENST00000414583.2	+	0	3266					NR_003714.1				POM121 transmembrane nucleoporin-like 9, pseudogene																		CTGTGGGAGGGGGGAATGTTC	0.622																																																	0																																												29774			AL040062, AL117401		22q11.22	2012-03-13	2012-03-13		ENSG00000128262	ENSG00000128262			30080	pseudogene	pseudogene			"""POM121 membrane glycoprotein-like 9, pseudogene"""				Standard	NR_003714		Approved				OTTHUMG00000150763		22.37:g.24659741G>A				RNA	SNP	ENST00000414583.2	37																																																																																					0.622	POM121L9P-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000319991.1		NM_014549	
PPIP5K1	9677	broad.mit.edu	37	15	43873430	43873430	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr15:43873430A>G	ENST00000396923.3	-	8	1055	c.934T>C	c.(934-936)Ttc>Ctc	p.F312L	PPIP5K1_ENST00000360135.4_Missense_Mutation_p.F312L|PPIP5K1_ENST00000432870.3_5'UTR|PPIP5K1_ENST00000360301.4_Missense_Mutation_p.F312L|PPIP5K1_ENST00000348806.6_Missense_Mutation_p.F312L|PPIP5K1_ENST00000381885.1_Missense_Mutation_p.F312L|PPIP5K1_ENST00000381879.4_Missense_Mutation_p.F312L|PPIP5K1_ENST00000334933.4_Missense_Mutation_p.F312L|PPIP5K1_ENST00000420765.1_Missense_Mutation_p.F312L			Q6PFW1	VIP1_HUMAN	diphosphoinositol pentakisphosphate kinase 1	312					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)	p.F312L(1)		large_intestine(1)	1						TCTACCTTGAAAGCTACGCAG	0.498																																																	1	Substitution - Missense(1)	kidney(1)											65.0	88.0	80.0					15																	43873430		2196	4295	6491	SO:0001583	missense	9677			AF502586	CCDS32215.1, CCDS45252.1, CCDS53937.1	15q15.3	2010-01-27	2010-01-26	2010-01-26	ENSG00000168781	ENSG00000168781	2.7.4.24		29023	protein-coding gene	gene with protein product		610979	"""histidine acid phosphatase domain containing 2A"""	HISPPD2A		17412958, 17690096, 18981179	Standard	NM_001190214		Approved	KIAA0377, IPS1, VIP1	uc001zrw.3	Q6PFW1	OTTHUMG00000059758	ENST00000396923.3:c.934T>C	15.37:g.43873430A>G	ENSP00000380129:p.Phe312Leu		O15082|Q5HYF8|Q7Z3A7|Q86TE7|Q86UV3|Q86UV4|Q86XW8|Q8IZN0	Missense_Mutation	SNP	ENST00000396923.3	37	CCDS45252.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.560904	0.86335	.	.	ENSG00000168781	ENST00000381885;ENST00000360301;ENST00000360135;ENST00000334933;ENST00000396923;ENST00000304953;ENST00000381878;ENST00000420765;ENST00000381879;ENST00000348806;ENST00000335092	T;T;T;T;T;T;T;T	0.58060	0.36;0.44;1.06;0.44;0.36;0.36;0.41;1.06	4.74	4.74	0.60224	.	0.000000	0.85682	D	0.000000	T	0.77896	0.4199	H	0.94808	3.585	0.80722	D	1	D;D;D;D	0.71674	0.998;0.998;0.998;0.998	D;P;D;D	0.64237	0.923;0.839;0.923;0.923	D	0.84556	0.0647	10	0.62326	D	0.03	-11.7494	14.4623	0.67459	1.0:0.0:0.0:0.0	.	312;312;312;312	Q6PFW1-7;Q6PFW1;Q6PFW1-2;Q6PFW1-3	.;VIP1_HUMAN;.;.	L	312;312;312;312;312;312;312;312;312;312;313	ENSP00000371309:F312L;ENSP00000353446:F312L;ENSP00000353253:F312L;ENSP00000334779:F312L;ENSP00000380129:F312L;ENSP00000400887:F312L;ENSP00000371303:F312L;ENSP00000308773:F312L	ENSP00000304750:F312L	F	-	1	0	PPIP5K1	41660722	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.121000	0.94375	1.978000	0.57642	0.524000	0.50904	TTC		0.498	PPIP5K1-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000132907.1		NM_014659	
PRKCE	5581	hgsc.bcm.edu	37	2	46203625	46203626	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr2:46203625_46203626insG	ENST00000306156.3	+	3	797_798	c.470_471insG	c.(469-474)caggggfs	p.QG157fs		NM_005400.2	NP_005391.1	Q02156	KPCE_HUMAN	protein kinase C, epsilon	157					activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to ethanol (GO:0071361)|cellular response to hypoxia (GO:0071456)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|locomotory exploration behavior (GO:0035641)|macrophage activation involved in immune response (GO:0002281)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cellular glucuronidation (GO:2001031)|positive regulation of cytokinesis (GO:0032467)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of insulin secretion (GO:0032024)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|release of sequestered calcium ion into cytosol (GO:0051209)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|TRAM-dependent toll-like receptor 4 signaling pathway (GO:0035669)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|ethanol binding (GO:0035276)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|receptor activator activity (GO:0030546)|signal transducer activity (GO:0004871)		MBOAT2/PRKCE(2)	breast(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(13)|ovary(3)|upper_aerodigestive_tract(2)	34		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)		Tamoxifen(DB00675)	AGGAAGCGGCAGGGGGCCGTCA	0.584																																																	0										4,4176		1,2,2087						4.5	1.0		dbSNP_130	65	4,8158		0,4,4077	no	frameshift	PRKCE	NM_005400.2		1,6,6164	A1A1,A1R,RR		0.049,0.0957,0.0648				8,12334				SO:0001589	frameshift_variant	5581				CCDS1824.1	2p21	2009-07-10			ENSG00000171132	ENSG00000171132	2.7.11.1		9401	protein-coding gene	gene with protein product		176975				1382605, 7877991	Standard	NM_005400		Approved		uc002rut.3	Q02156	OTTHUMG00000128817	ENST00000306156.3:c.475dupG	2.37:g.46203630_46203630dupG	ENSP00000306124:p.Gln157fs		B0LPH7|Q32MQ3|Q53SL4|Q53SM5|Q9UE81	Frame_Shift_Ins	INS	ENST00000306156.3	37	CCDS1824.1																																																																																				0.584	PRKCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250751.2			
PRUNE	58497	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	151001376	151001376	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr1:151001376C>T	ENST00000271620.3	+	7	1045	c.889C>T	c.(889-891)Cgg>Tgg	p.R297W	PRUNE_ENST00000467771.1_3'UTR|PRUNE_ENST00000271619.8_Intron|PRUNE_ENST00000368935.1_Intron|PRUNE_ENST00000368937.1_Intron|PRUNE_ENST00000368934.1_Intron|PRUNE_ENST00000368936.1_Missense_Mutation_p.R115W	NM_021222.1	NP_067045.1	Q86TP1	PRUNE_HUMAN	prune exopolyphosphatase	297						cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	inorganic diphosphatase activity (GO:0004427)|metal ion binding (GO:0046872)	p.R297W(1)		NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	14	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			TGAGCCAGTGCGGCAGTTGGC	0.498																																																	1	Substitution - Missense(1)	kidney(1)											158.0	118.0	131.0					1																	151001376		2203	4300	6503	SO:0001583	missense	58497			U67085	CCDS977.1	1q21.2	2013-04-29	2013-04-29		ENSG00000143363	ENSG00000143363	3.6.1.11		13420	protein-coding gene	gene with protein product			"""prune homolog (Drosophila)"""			10602478, 11687967, 18700747	Standard	NM_021222		Approved	DRES-17, HTCD37	uc001ewh.1	Q86TP1	OTTHUMG00000035062	ENST00000271620.3:c.889C>T	1.37:g.151001376C>T	ENSP00000271620:p.Arg297Trp		B2RCH8|B4DFL7|Q5SZF9|Q659E5|Q6P4E0|Q8N654|Q96JU5|Q9C071|Q9C072|Q9UIV0	Missense_Mutation	SNP	ENST00000271620.3	37	CCDS977.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.222733	0.79464	.	.	ENSG00000143363	ENST00000450884;ENST00000271620;ENST00000302413;ENST00000368936	T;T	0.59638	0.25;0.41	5.12	4.17	0.49024	DHHA2 (1);	0.000000	0.64402	D	0.000003	T	0.68550	0.3013	M	0.77313	2.365	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.71721	-0.4507	10	0.87932	D	0	.	11.0437	0.47846	0.3015:0.6985:0.0:0.0	.	297	Q86TP1	PRUNE_HUMAN	W	115;297;230;115	ENSP00000271620:R297W;ENSP00000357932:R115W	ENSP00000271620:R297W	R	+	1	2	PRUNE	149268000	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.731000	0.26058	2.661000	0.90470	0.603000	0.83216	CGG		0.498	PRUNE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084885.1		NM_021222	
RANBP10	57610	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	67778202	67778202	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr16:67778202C>T	ENST00000317506.3	-	4	672	c.557G>A	c.(556-558)gGc>gAc	p.G186D	RANBP10_ENST00000536251.1_5'UTR|RANBP10_ENST00000602677.1_Missense_Mutation_p.G186D|RANBP10_ENST00000448631.2_Intron|RANBP10_ENST00000425512.2_Missense_Mutation_p.G54D|RANBP10_ENST00000602887.1_5'UTR|RANBP10_ENST00000411657.2_Missense_Mutation_p.G69D	NM_020850.1	NP_065901.1	Q6VN20	RBP10_HUMAN	RAN binding protein 10	186	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				microtubule cytoskeleton organization (GO:0000226)	cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)	Ran guanyl-nucleotide exchange factor activity (GO:0005087)	p.G186D(1)		endometrium(5)|kidney(2)|large_intestine(3)|lung(10)|ovary(2)|skin(1)	23		Acute lymphoblastic leukemia(13;4.34e-06)|all_hematologic(13;0.000643)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00522)|Epithelial(162;0.025)|all cancers(182;0.157)		AAGGCTGTGGCCATTCTTGGT	0.577																																																	1	Substitution - Missense(1)	kidney(1)											169.0	127.0	141.0					16																	67778202		2198	4300	6498	SO:0001583	missense	57610			AB040897	CCDS32469.1	16q22	2008-02-05				ENSG00000141084			29285	protein-coding gene	gene with protein product		614031				14684163	Standard	NM_020850		Approved	KIAA1464	uc002eud.3	Q6VN20		ENST00000317506.3:c.557G>A	16.37:g.67778202C>T	ENSP00000316589:p.Gly186Asp		A4FTY2|B4DID0|B4DQH9|E7EW27|Q9P264	Missense_Mutation	SNP	ENST00000317506.3	37	CCDS32469.1	.	.	.	.	.	.	.	.	.	.	C	35	5.415539	0.96092	.	.	ENSG00000141084	ENST00000317506;ENST00000411657;ENST00000425512	T;T;T	0.64438	-0.1;-0.1;-0.1	6.08	6.08	0.98989	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.85682	D	0.000000	D	0.86531	0.5955	H	0.95151	3.63	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;0.999	D	0.89249	0.3589	10	0.87932	D	0	-17.397	20.2672	0.98462	0.0:1.0:0.0:0.0	.	54;186;69;186	B4DHL9;B4E1Y2;B4DID0;Q6VN20	.;.;.;RBP10_HUMAN	D	186;69;54	ENSP00000316589:G186D;ENSP00000416460:G69D;ENSP00000410617:G54D	ENSP00000316589:G186D	G	-	2	0	RANBP10	66335703	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.818000	0.86416	2.894000	0.99253	0.591000	0.81541	GGC		0.577	RANBP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467896.1		NM_020850	
RANBP6	26953	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	6013437	6013437	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr9:6013437T>G	ENST00000259569.5	-	1	2181	c.2171A>C	c.(2170-2172)cAt>cCt	p.H724P	RANBP6_ENST00000485372.1_5'Flank	NM_001243202.1|NM_001243203.1|NM_012416.3	NP_001230131.1|NP_001230132.1|NP_036548.1	O60518	RNBP6_HUMAN	RAN binding protein 6	724					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.H724P(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(5)|large_intestine(8)|lung(9)|ovary(7)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		AACATTGTCATGGAAATAAAA	0.418																																																	1	Substitution - Missense(1)	kidney(1)											96.0	97.0	97.0					9																	6013437		2203	4300	6503	SO:0001583	missense	26953			AF039023	CCDS6467.1	9p24.1	2008-03-26			ENSG00000137040	ENSG00000137040			9851	protein-coding gene	gene with protein product							Standard	NM_001243202		Approved		uc003zjr.3	O60518	OTTHUMG00000019512	ENST00000259569.5:c.2171A>C	9.37:g.6013437T>G	ENSP00000259569:p.His724Pro		Q5T7X4|Q7Z3V2|Q96E78	Missense_Mutation	SNP	ENST00000259569.5	37	CCDS6467.1	.	.	.	.	.	.	.	.	.	.	T	15.46	2.839900	0.51057	.	.	ENSG00000137040	ENST00000259569	T	0.25749	1.78	3.79	2.64	0.31445	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	U	0.000000	T	0.54095	0.1837	M	0.92317	3.295	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.72982	0.961;0.979	T	0.58463	-0.7632	10	0.87932	D	0	-11.0545	7.6993	0.28613	0.0:0.1039:0.0:0.8961	.	312;724	B4DTX6;O60518	.;RNBP6_HUMAN	P	724	ENSP00000259569:H724P	ENSP00000259569:H724P	H	-	2	0	RANBP6	6003437	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.590000	0.46154	0.808000	0.34231	0.528000	0.53228	CAT		0.418	RANBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051650.1		NM_012416	
RETSAT	54884	hgsc.bcm.edu;ucsc.edu	37	2	85570442	85570442	+	Missense_Mutation	SNP	C	C	T	rs143283662	byFrequency	TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr2:85570442C>T	ENST00000295802.4	-	11	1868	c.1756G>A	c.(1756-1758)Gcc>Acc	p.A586T	RETSAT_ENST00000475624.2_5'Flank|RETSAT_ENST00000457495.2_Missense_Mutation_p.A525T|RETSAT_ENST00000263854.6_3'UTR	NM_017750.3	NP_060220.3	Q6NUM9	RETST_HUMAN	retinol saturase (all-trans-retinol 13,14-reductase)	586					oxidation-reduction process (GO:0055114)|retinol metabolic process (GO:0042572)	endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear outer membrane (GO:0005640)	all-trans-retinol 13,14-reductase activity (GO:0051786)|oxidoreductase activity (GO:0016491)			NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	30					Vitamin A(DB00162)	TTCAGGATGGCGCTGCTGCAC	0.557																																																	0								C	THR/ALA	19,4387	25.3+/-52.1	0,19,2184	79.0	83.0	81.0		1756	2.8	0.9	2	dbSNP_134	81	97,8503	53.1+/-113.8	0,97,4203	yes	missense	RETSAT	NM_017750.3	58	0,116,6387	TT,TC,CC		1.1279,0.4312,0.8919	benign	586/611	85570442	116,12890	2203	4300	6503	SO:0001583	missense	54884			AK075261	CCDS1972.1	2p11.2	2008-02-05			ENSG00000042445	ENSG00000042445	1.3.99.23		25991	protein-coding gene	gene with protein product						12975309, 15358783	Standard	NM_017750		Approved	FLJ20296	uc002spd.3	Q6NUM9	OTTHUMG00000154611	ENST00000295802.4:c.1756G>A	2.37:g.85570442C>T	ENSP00000295802:p.Ala586Thr		A6NIK3|Q53R95|Q53SA9|Q6UX05|Q8N2H5|Q96FA4|Q9NXE5	Missense_Mutation	SNP	ENST00000295802.4	37	CCDS1972.1	11	0.005036630036630037	3	0.006097560975609756	0	0.0	0	0.0	8	0.010554089709762533	C	10.94	1.492955	0.26774	0.004312	0.011279	ENSG00000042445	ENST00000295802;ENST00000457495	T;T	0.24538	1.85;1.87	5.02	2.79	0.32731	.	0.378221	0.27008	N	0.021399	T	0.08891	0.0220	L	0.31752	0.955	0.36813	D	0.886002	P;P;B	0.35894	0.526;0.526;0.392	B;B;B	0.31290	0.127;0.127;0.06	T	0.13388	-1.0511	10	0.13470	T	0.59	-15.1159	5.0693	0.14598	0.0:0.6331:0.0:0.3669	.	525;525;586	G5E9N3;B4DKE1;Q6NUM9	.;.;RETST_HUMAN	T	586;525	ENSP00000295802:A586T;ENSP00000405040:A525T	ENSP00000295802:A586T	A	-	1	0	RETSAT	85423953	0.135000	0.22499	0.850000	0.33497	0.599000	0.36880	0.516000	0.22817	1.239000	0.43787	0.561000	0.74099	GCC		0.557	RETSAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252489.1		NM_017750	
RGS9	8787	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	63149596	63149596	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr17:63149596C>A	ENST00000262406.9	+	2	181	c.114C>A	c.(112-114)aaC>aaA	p.N38K	RGS9_ENST00000443584.3_Missense_Mutation_p.N38K|RGS9_ENST00000449996.3_Missense_Mutation_p.N38K|RGS9_ENST00000577186.1_3'UTR	NM_003835.3	NP_003826.2	O75916	RGS9_HUMAN	regulator of G-protein signaling 9	38	DEP. {ECO:0000255|PROSITE- ProRule:PRU00066}.				dopamine receptor signaling pathway (GO:0007212)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to estrogen (GO:0043627)|rhodopsin mediated signaling pathway (GO:0016056)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)	p.N38K(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(8)|liver(2)|lung(12)|ovary(2)|prostate(3)|skin(3)	41						GAATGCAGAACCAGAGGGTCC	0.532																																																	1	Substitution - Missense(1)	kidney(1)											136.0	141.0	139.0					17																	63149596		1961	4145	6106	SO:0001583	missense	8787			AF071476	CCDS42373.1, CCDS45764.1	17q24	2008-07-18	2007-08-14			ENSG00000108370		"""Regulators of G-protein signaling"""	10004	protein-coding gene	gene with protein product	"""regulator of G protein signalling 9"", ""regulator of G protein signalling 9L"", ""regulator of G-protein signaling 9L"""	604067	"""regulator of G-protein signalling 9"""			9765512	Standard	NM_003835		Approved	PERRS, RGS9L, MGC26458, MGC111763	uc002jfe.3	O75916		ENST00000262406.9:c.114C>A	17.37:g.63149596C>A	ENSP00000262406:p.Asn38Lys		A8K3C0|O75573|Q696R2|Q8TD64|Q8TD65|Q9HC32|Q9HC33	Missense_Mutation	SNP	ENST00000262406.9	37	CCDS42373.1	.	.	.	.	.	.	.	.	.	.	C	11.97	1.799102	0.31777	.	.	ENSG00000108370	ENST00000262406;ENST00000449996;ENST00000443584	T;T;T	0.22336	1.96;1.96;1.96	5.49	0.934	0.19477	DEP domain (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.682279	0.14929	N	0.290192	T	0.14056	0.0340	L	0.46157	1.445	0.27537	N	0.950907	P;P;B	0.35328	0.495;0.473;0.417	B;B;B	0.28916	0.074;0.096;0.058	T	0.15037	-1.0451	10	0.54805	T	0.06	.	4.2086	0.10500	0.16:0.5761:0.0:0.2639	.	38;38;38	A8K1G1;O75916;O75916-5	.;RGS9_HUMAN;.	K	38	ENSP00000262406:N38K;ENSP00000396329:N38K;ENSP00000405814:N38K	ENSP00000262406:N38K	N	+	3	2	RGS9	60580058	0.382000	0.25148	0.998000	0.56505	0.977000	0.68977	0.026000	0.13599	0.693000	0.31634	0.561000	0.74099	AAC		0.532	RGS9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445885.1		NM_003835	
RINL	126432	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	39360340	39360340	+	Silent	SNP	G	G	C			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr19:39360340G>C	ENST00000591812.1	-	10	1433	c.1347C>G	c.(1345-1347)ccC>ccG	p.P449P	RINL_ENST00000340740.3_Silent_p.P335P|RINL_ENST00000602238.1_5'Flank|CTC-360G5.6_ENST00000593830.1_RNA|RINL_ENST00000598904.1_Silent_p.P335P			Q6ZS11	RINL_HUMAN	Ras and Rab interactor-like	449	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.				endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)	actin cytoskeleton (GO:0015629)|cytoplasmic vesicle (GO:0031410)|ruffle (GO:0001726)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)	p.P335P(1)		endometrium(3)|kidney(4)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)|urinary_tract(2)	17						CGGCCCCCAGGGGATCTGGGA	0.612											OREG0025454	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - coding silent(1)	kidney(1)											47.0	55.0	52.0					19																	39360340		2203	4300	6503	SO:0001819	synonymous_variant	126432			AK127808	CCDS12522.1, CCDS59386.1	19q13.2	2010-07-13			ENSG00000187994	ENSG00000187994			24795	protein-coding gene	gene with protein product							Standard	NM_001195833		Approved	FLJ45909	uc010xuo.2	Q6ZS11		ENST00000591812.1:c.1347C>G	19.37:g.39360340G>C		885	B4DPG5	Silent	SNP	ENST00000591812.1	37	CCDS59386.1																																																																																				0.612	RINL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460433.1		NM_198445	
RNF10	9921	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	121002894	121002894	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr12:121002894G>T	ENST00000325954.4	+	11	2146	c.1685G>T	c.(1684-1686)aGa>aTa	p.R562I	RNF10_ENST00000413266.2_Missense_Mutation_p.R567I	NM_014868.4	NP_055683.3	Q8N5U6	RNF10_HUMAN	ring finger protein 10	562					negative regulation of Schwann cell proliferation (GO:0010626)|positive regulation of myelination (GO:0031643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autoubiquitination (GO:0051865)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R562I(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)	27	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CAGCGTCACAGATATCTCTCT	0.473																																																	1	Substitution - Missense(1)	kidney(1)											215.0	201.0	206.0					12																	121002894		2203	4300	6503	SO:0001583	missense	9921			AB027196	CCDS9201.1	12q23-q24	2013-01-09			ENSG00000022840	ENSG00000022840		"""RING-type (C3HC4) zinc fingers"""	10055	protein-coding gene	gene with protein product							Standard	NM_014868		Approved	KIAA0262, RIE2	uc001typ.4	Q8N5U6	OTTHUMG00000168999	ENST00000325954.4:c.1685G>T	12.37:g.121002894G>T	ENSP00000322242:p.Arg562Ile		Q92550|Q9NPP8|Q9ULW4	Missense_Mutation	SNP	ENST00000325954.4	37	CCDS9201.1	.	.	.	.	.	.	.	.	.	.	G	17.35	3.366262	0.61513	.	.	ENSG00000022840	ENST00000325954;ENST00000458409;ENST00000413266;ENST00000546262;ENST00000540046	T;T;T;T	0.20881	2.04;2.04;2.04;2.04	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.52175	0.1718	M	0.81112	2.525	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.982	T	0.54761	-0.8245	10	0.87932	D	0	.	19.8677	0.96824	0.0:0.0:1.0:0.0	.	567;562	Q8N5U6-2;Q8N5U6	.;RNF10_HUMAN	I	562;562;567;10;106	ENSP00000322242:R562I;ENSP00000415682:R567I;ENSP00000439221:R10I;ENSP00000439859:R106I	ENSP00000322242:R562I	R	+	2	0	RNF10	119487277	1.000000	0.71417	0.976000	0.42696	0.039000	0.13416	7.990000	0.88215	2.709000	0.92574	0.655000	0.94253	AGA		0.473	RNF10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401898.4			
RNF38	152006	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	36376116	36376116	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr9:36376116A>T	ENST00000259605.6	-	3	278	c.171T>A	c.(169-171)gaT>gaA	p.D57E	RNF38_ENST00000353739.4_Missense_Mutation_p.D7E|RNF38_ENST00000491349.1_5'UTR|RNF38_ENST00000357058.3_5'UTR|RNF38_ENST00000350199.4_5'UTR|RNF38_ENST00000377877.4_5'UTR|RNF38_ENST00000377885.2_5'UTR	NM_022781.4	NP_073618.3	Q9H0F5	RNF38_HUMAN	ring finger protein 38	57					male gonad development (GO:0008584)|protein ubiquitination (GO:0016567)	nucleus (GO:0005634)|sperm flagellum (GO:0036126)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.D57E(1)		breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(1)|lung(3)|stomach(1)	11			STAD - Stomach adenocarcinoma(86;0.228)			GACTTGGACTATCTTCACTCT	0.423																																																	1	Substitution - Missense(1)	kidney(1)											193.0	169.0	177.0					9																	36376116		2203	4300	6503	SO:0001583	missense	152006				CCDS6603.1, CCDS6604.1	9p	2013-01-09			ENSG00000137075	ENSG00000137075		"""RING-type (C3HC4) zinc fingers"""	18052	protein-coding gene	gene with protein product		612488					Standard	XM_005251364		Approved		uc003zzh.3	Q9H0F5	OTTHUMG00000019905	ENST00000259605.6:c.171T>A	9.37:g.36376116A>T	ENSP00000259605:p.Asp57Glu		A6PVP9|B1AM81|B1AM82|B3KSG4|E7EVL3|Q7LB33|Q8N0Y0|Q9H748	Missense_Mutation	SNP	ENST00000259605.6	37	CCDS6603.1	.	.	.	.	.	.	.	.	.	.	A	11.35	1.612315	0.28712	.	.	ENSG00000137075	ENST00000259605;ENST00000353739	T;T	0.08370	3.1;3.15	5.91	4.76	0.60689	.	0.000000	0.85682	D	0.000000	T	0.14442	0.0349	L	0.41236	1.265	0.80722	D	1	D;D	0.61697	0.99;0.984	D;D	0.72625	0.978;0.952	T	0.18524	-1.0334	10	0.09590	T	0.72	-7.9479	7.8302	0.29338	0.8413:0.0:0.1587:0.0	.	7;57	Q9H0F5-2;Q9H0F5	.;RNF38_HUMAN	E	57;7	ENSP00000259605:D57E;ENSP00000335239:D7E	ENSP00000259605:D57E	D	-	3	2	RNF38	36366116	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.005000	0.40864	2.254000	0.74563	0.533000	0.62120	GAT		0.423	RNF38-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052422.3		NM_022781	
ROS1	6098	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	117677884	117677884	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr6:117677884G>T	ENST00000368508.3	-	25	4247	c.4049C>A	c.(4048-4050)cCa>cAa	p.P1350Q	GOPC_ENST00000467125.1_Intron|ROS1_ENST00000368507.3_Missense_Mutation_p.P1345Q	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	1350					cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.P1350Q(2)	TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		GTATATCAATGGTTTCTCTAG	0.408			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																			Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	2	Substitution - Missense(2)	kidney(2)											179.0	145.0	157.0					6																	117677884		2203	4300	6503	SO:0001583	missense	6098			M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.4049C>A	6.37:g.117677884G>T	ENSP00000357494:p.Pro1350Gln		Q15368|Q5TDB5	Missense_Mutation	SNP	ENST00000368508.3	37	CCDS5116.1	.	.	.	.	.	.	.	.	.	.	G	10.99	1.506277	0.26949	.	.	ENSG00000047936	ENST00000368508;ENST00000368507	T;T	0.72725	-0.67;-0.68	5.08	4.2	0.49525	.	0.000000	0.64402	D	0.000005	T	0.58481	0.2125	L	0.34521	1.04	0.80722	D	1	P	0.50443	0.935	P	0.50490	0.642	T	0.66412	-0.5930	10	0.87932	D	0	.	13.09	0.59162	0.0:0.0:0.839:0.161	.	1350	P08922	ROS1_HUMAN	Q	1350;1345	ENSP00000357494:P1350Q;ENSP00000357493:P1345Q	ENSP00000357493:P1345Q	P	-	2	0	ROS1	117784577	0.990000	0.36364	0.128000	0.21923	0.014000	0.08584	4.328000	0.59253	1.445000	0.47624	-0.182000	0.12963	CCA		0.408	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043464.1			
SAMD10	140700	broad.mit.edu	37	20	62607109	62607109	+	Silent	SNP	C	C	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr20:62607109C>T	ENST00000369886.3	-	4	696	c.522G>A	c.(520-522)gtG>gtA	p.V174V	ZNF512B_ENST00000450537.1_Intron|ZNF512B_ENST00000217130.3_Intron|SAMD10_ENST00000498830.1_5'UTR	NM_080621.4	NP_542188.1	Q9BYL1	SAM10_HUMAN	sterile alpha motif domain containing 10	174	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.							p.V174V(1)		kidney(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|prostate(1)	7	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					CCTGCTGCAGCACCTCCTGCC	0.687																																																	1	Substitution - coding silent(1)	kidney(1)											26.0	31.0	29.0					20																	62607109		2201	4297	6498	SO:0001819	synonymous_variant	140700				CCDS13549.1	20q13.33	2013-01-10	2004-07-15	2004-07-16	ENSG00000130590	ENSG00000130590		"""Sterile alpha motif (SAM) domain containing"""	16129	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 136"""	C20orf136			Standard	NM_080621		Approved		uc002yhm.2	Q9BYL1	OTTHUMG00000033011	ENST00000369886.3:c.522G>A	20.37:g.62607109C>T				Silent	SNP	ENST00000369886.3	37	CCDS13549.1																																																																																				0.687	SAMD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080255.1		NM_080621	
SCN2A	6326	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	166183424	166183424	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr2:166183424T>G	ENST00000375437.2	+	13	2369	c.2079T>G	c.(2077-2079)gaT>gaG	p.D693E	SCN2A_ENST00000283256.6_Missense_Mutation_p.D693E|SCN2A_ENST00000375427.2_Missense_Mutation_p.D693E|SCN2A_ENST00000357398.3_Missense_Mutation_p.D693E	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	693					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.D693E(2)		NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTTCCATGGATTTATTGGAAG	0.373																																																	2	Substitution - Missense(2)	kidney(2)											174.0	165.0	168.0					2																	166183424		2203	4300	6503	SO:0001583	missense	6326			AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.2079T>G	2.37:g.166183424T>G	ENSP00000364586:p.Asp693Glu		A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	ENST00000375437.2	37	CCDS33314.1	.	.	.	.	.	.	.	.	.	.	T	11.42	1.634778	0.29068	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.91464	-2.85;-2.85;-2.85;-2.85	5.8	4.65	0.58169	Domain of unknown function DUF3451 (1);	0.000000	0.64402	D	0.000002	D	0.84334	0.5449	L	0.37850	1.14	0.42940	D	0.994342	B;B	0.09022	0.002;0.0	B;B	0.19391	0.025;0.006	T	0.76735	-0.2850	10	0.24483	T	0.36	.	8.8661	0.35286	0.0:0.1647:0.0:0.8353	.	693;693	Q99250-2;Q99250	.;SCN2A_HUMAN	E	693	ENSP00000364586:D693E;ENSP00000349973:D693E;ENSP00000283256:D693E;ENSP00000364576:D693E	ENSP00000283256:D693E	D	+	3	2	SCN2A	165891670	0.998000	0.40836	0.998000	0.56505	0.958000	0.62258	0.526000	0.22971	1.032000	0.39892	0.528000	0.53228	GAT		0.373	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2		NM_021007	
SLC7A14	57709	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	170185029	170185029	+	Silent	SNP	G	G	A	rs201486833		TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr3:170185029G>A	ENST00000231706.5	-	8	2445	c.2130C>T	c.(2128-2130)taC>taT	p.Y710Y	CLDN11_ENST00000451576.1_Intron|CLDN11_ENST00000486975.1_Intron	NM_020949.2	NP_066000.2	Q8TBB6	S7A14_HUMAN	solute carrier family 7, member 14	710					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)	amino acid transmembrane transporter activity (GO:0015171)	p.Y710Y(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(23)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(4)	53	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			CCTCTGTGGCGTAGGAGAAAC	0.587													G|||	1	0.000199681	0.0	0.0	5008	,	,		13869	0.0		0.001	False		,,,				2504	0.0																1	Substitution - coding silent(1)	kidney(1)						G		0,4406		0,0,2203	68.0	69.0	68.0		2130	-4.5	0.5	3		68	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	SLC7A14	NM_020949.2		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		710/772	170185029	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	57709			BC022968	CCDS33892.1	3q26.2	2014-06-13	2013-07-19		ENSG00000013293	ENSG00000013293		"""Solute carriers"""	29326	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 142"""	615720					Standard	NM_020949		Approved	KIAA1613, PPP1R142	uc003fgz.2	Q8TBB6	OTTHUMG00000158941	ENST00000231706.5:c.2130C>T	3.37:g.170185029G>A			B3KV33|Q9HCF9	Silent	SNP	ENST00000231706.5	37	CCDS33892.1																																																																																				0.587	SLC7A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352598.2		NM_020949	
SNX25	83891	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	186188308	186188308	+	Splice_Site	SNP	A	A	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr4:186188308A>T	ENST00000504273.1	+	5	892	c.598A>T	c.(598-600)Agg>Tgg	p.R200W	SNX25_ENST00000264694.8_Splice_Site_p.R200W			Q9H3E2	SNX25_HUMAN	sorting nexin 25	200					negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein transport (GO:0015031)|receptor catabolic process (GO:0032801)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)	p.R200W(1)		NS(1)|breast(4)|endometrium(2)|kidney(4)|large_intestine(8)|lung(13)|ovary(2)|pancreas(2)|prostate(2)|urinary_tract(2)	40		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		GAAGCAACTAAGGTATTTGGT	0.413																																																	1	Substitution - Missense(1)	kidney(1)											104.0	103.0	104.0					4																	186188308		2203	4300	6503	SO:0001630	splice_region_variant	83891			AF113223	CCDS34116.1	4q35.1	2011-05-03			ENSG00000109762	ENSG00000109762		"""Sorting nexins"""	21883	protein-coding gene	gene with protein product						12461558	Standard	NM_031953		Approved	SBBI31	uc003ixh.3	Q9H3E2	OTTHUMG00000160475	ENST00000504273.1:c.599+1A>T	4.37:g.186188308A>T			Q3ZT30|Q8N6K3	Missense_Mutation	SNP	ENST00000504273.1	37	CCDS34116.1	.	.	.	.	.	.	.	.	.	.	A	27.8	4.862179	0.91511	.	.	ENSG00000109762	ENST00000504273;ENST00000264694	T;T	0.15487	2.42;2.42	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.43366	0.1244	M	0.80422	2.495	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	T	0.46275	-0.9203	10	0.87932	D	0	-16.804	13.2399	0.59992	1.0:0.0:0.0:0.0	.	200	Q9H3E2	SNX25_HUMAN	W	200	ENSP00000426255:R200W;ENSP00000264694:R200W	ENSP00000264694:R200W	R	+	1	2	SNX25	186425302	1.000000	0.71417	0.994000	0.49952	0.989000	0.77384	6.763000	0.74955	2.055000	0.61198	0.533000	0.62120	AGG		0.413	SNX25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360756.1		NM_031953	Missense_Mutation
SPEN	23013	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	16259441	16259441	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr1:16259441C>T	ENST00000375759.3	+	11	6910	c.6706C>T	c.(6706-6708)Cct>Tct	p.P2236S		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	2236	Interaction with MSX2. {ECO:0000250}.|RID.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)	p.P2236S(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		CTTCCCAGCACCTCCACCTTA	0.567																																																	1	Substitution - Missense(1)	kidney(1)											64.0	70.0	68.0					1																	16259441		2203	4300	6503	SO:0001583	missense	23013				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.6706C>T	1.37:g.16259441C>T	ENSP00000364912:p.Pro2236Ser		Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	ENST00000375759.3	37	CCDS164.1	.	.	.	.	.	.	.	.	.	.	C	5.691	0.312087	0.10789	.	.	ENSG00000065526	ENST00000375759	T	0.10668	2.85	5.05	2.01	0.26516	.	.	.	.	.	T	0.08582	0.0213	L	0.43152	1.355	0.41845	D	0.990148	B	0.18461	0.028	B	0.18263	0.021	T	0.20874	-1.0262	9	0.09084	T	0.74	-2.2375	10.1534	0.42807	0.0:0.5169:0.4104:0.0728	.	2236	Q96T58	MINT_HUMAN	S	2236	ENSP00000364912:P2236S	ENSP00000364912:P2236S	P	+	1	0	SPEN	16132028	0.144000	0.22641	0.189000	0.23252	0.597000	0.36814	0.559000	0.23485	0.119000	0.18210	0.462000	0.41574	CCT		0.567	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1		NM_015001	
SRCAP	10847	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	30734516	30734516	+	Silent	SNP	C	C	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr16:30734516C>T	ENST00000262518.4	+	24	4510	c.4125C>T	c.(4123-4125)ctC>ctT	p.L1375L	SRCAP_ENST00000344771.4_Silent_p.L1217L|SRCAP_ENST00000395059.2_Silent_p.L1313L	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	1375	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)	p.L1375L(1)		NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			GGCCTCTTCTCAAGCTGGTCC	0.602																																																	1	Substitution - coding silent(1)	kidney(1)											91.0	85.0	87.0					16																	30734516		2197	4300	6497	SO:0001819	synonymous_variant	10847			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.4125C>T	16.37:g.30734516C>T			B0JZA6|O15026|Q7Z744|Q9Y5L9	Silent	SNP	ENST00000262518.4	37	CCDS10689.2																																																																																				0.602	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1		NM_006662	
SREK1	140890	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	65458025	65458025	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr5:65458025C>G	ENST00000380918.3	+	5	812	c.152C>G	c.(151-153)cCa>cGa	p.P51R	SREK1_ENST00000334121.6_Missense_Mutation_p.P167R|SREK1_ENST00000284041.3_3'UTR	NM_139168.3	NP_631907.1	Q8WXA9	SREK1_HUMAN	splicing regulatory glutamine/lysine-rich protein 1	51					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.P51R(1)|p.P167R(1)		breast(1)|kidney(3)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)	9						CCACAGCCACCACTTATGGGA	0.413																																					GBM(10;31 347 27684 38976 41583)												2	Substitution - Missense(2)	kidney(2)											90.0	85.0	87.0					5																	65458025		2203	4300	6503	SO:0001583	missense	140890			AF459094	CCDS3991.1, CCDS43323.1, CCDS75253.1	5q11.2-q12.1	2013-02-12	2010-09-08	2010-09-08	ENSG00000153914	ENSG00000153914		"""RNA binding motif (RRM) containing"""	17882	protein-coding gene	gene with protein product	"""serine-arginine-rich splicing regulatory protein 508"""	609268	"""splicing factor, arginine/serine-rich 12"""	SFRS12		12043562	Standard	NM_001077199		Approved	DKFZp564B176, SRrp86, SRrp508	uc003jun.4	Q8WXA9	OTTHUMG00000097809	ENST00000380918.3:c.152C>G	5.37:g.65458025C>G	ENSP00000370305:p.Pro51Arg		A4FTW3|Q2M1J0|Q86X37	Missense_Mutation	SNP	ENST00000380918.3	37	CCDS3991.1	.	.	.	.	.	.	.	.	.	.	C	19.43	3.825632	0.71143	.	.	ENSG00000153914	ENST00000521691;ENST00000334121;ENST00000537482;ENST00000380918	T;T	0.74421	-0.84;-0.84	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	D	0.82939	0.5146	L	0.48642	1.525	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.996;0.996;0.998	T	0.81437	-0.0933	10	0.39692	T	0.17	.	19.245	0.93898	0.0:1.0:0.0:0.0	.	51;51;167	Q69YM5;Q8WXA9;Q8WXA9-2	.;SREK1_HUMAN;.	R	51;167;167;51	ENSP00000334538:P167R;ENSP00000370305:P51R	ENSP00000334538:P167R	P	+	2	0	SREK1	65493781	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.418000	0.80167	2.614000	0.88457	0.655000	0.94253	CCA		0.413	SREK1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000381118.1		NM_001077199	
RNF217-AS1	7955	broad.mit.edu;hgsc.bcm.edu	37	6	125233396	125233396	+	RNA	SNP	A	A	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr6:125233396A>T	ENST00000439075.1	-	0	1349					NR_026876.1																						GCTCCATGGTATATGGTATGT	0.408																																																	0													74.0	72.0	73.0					6																	125233396		876	1991	2867			7955																															6.37:g.125233396A>T				RNA	SNP	ENST00000439075.1	37																																																																																					0.408	RP11-510H23.1-001	KNOWN	basic	antisense	antisense	OTTHUMT00000042059.1			
TBC1D8B	54885	broad.mit.edu;hgsc.bcm.edu	37	X	106092530	106092530	+	Intron	SNP	G	G	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chrX:106092530G>A	ENST00000357242.5	+	12	2011				TBC1D8B_ENST00000310452.2_Silent_p.E631E|TBC1D8B_ENST00000276175.3_Intron	NM_017752.2	NP_060222.2	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)								calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)	p.E631E(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|liver(4)|lung(15)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						TTATTGGGGAGAAGTAGAAAA	0.333																																																	1	Substitution - coding silent(1)	kidney(1)											40.0	43.0	42.0					X																	106092530		2201	4298	6499	SO:0001627	intron_variant	54885			AK123957	CCDS14522.1, CCDS14523.1	Xq22.3	2013-01-10			ENSG00000133138	ENSG00000133138		"""EF-hand domain containing"""	24715	protein-coding gene	gene with protein product						8889548	Standard	NM_017752		Approved	FLJ20298, RP11-321G1.1	uc004emo.3	Q0IIM8	OTTHUMG00000022152	ENST00000357242.5:c.1838-725G>A	X.37:g.106092530G>A			B9A6K5|B9A6K6|Q5JRB7|Q6ZVX5|Q9NXE3	Silent	SNP	ENST00000357242.5	37	CCDS14522.1																																																																																				0.333	TBC1D8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057807.2		NM_017752	
TDRKH	11022	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	151751219	151751219	+	Silent	SNP	A	A	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr1:151751219A>G	ENST00000368822.1	-	6	1458	c.825T>C	c.(823-825)agT>agC	p.S275S	TDRKH_ENST00000484421.1_5'UTR|TDRKH_ENST00000368827.6_Silent_p.S275S|TDRKH_ENST00000368823.1_Silent_p.S271S|TDRKH_ENST00000368824.3_Silent_p.S275S|TDRKH_ENST00000458431.2_Silent_p.S275S|TDRKH_ENST00000368825.3_Silent_p.S230S|TDRKH_ENST00000440583.2_Silent_p.S51S			Q9Y2W6	TDRKH_HUMAN	tudor and KH domain containing	275					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	mitochondrion (GO:0005739)|pi-body (GO:0071546)|piP-body (GO:0071547)	RNA binding (GO:0003723)	p.S275S(1)		breast(5)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			AGCTGTCATCACTAGGTTTCT	0.507																																																	1	Substitution - coding silent(1)	kidney(1)											60.0	60.0	60.0					1																	151751219		2002	4192	6194	SO:0001819	synonymous_variant	11022			AF227192	CCDS41394.1, CCDS41395.1	1q21	2013-01-23	2003-11-07		ENSG00000182134	ENSG00000182134		"""Tudor domain containing"""	11713	protein-coding gene	gene with protein product		609501	"""tudor and KH domain containing"""			10767542	Standard	NM_001083964		Approved	TDRD2	uc001eza.4	Q9Y2W6	OTTHUMG00000013062	ENST00000368822.1:c.825T>C	1.37:g.151751219A>G			D3DV24|Q5SZR3|Q5SZR5|Q8N582|Q9NYV5	Silent	SNP	ENST00000368822.1	37	CCDS41394.1																																																																																				0.507	TDRKH-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000036648.2		NM_006862	
THEG	51298	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	362387	362387	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr19:362387T>A	ENST00000342640.4	-	8	995	c.953A>T	c.(952-954)gAt>gTt	p.D318V	THEG_ENST00000346878.2_Missense_Mutation_p.D294V	NM_016585.4	NP_057669.1	Q9P2T0	THEG_HUMAN	theg spermatid protein	318					cell differentiation (GO:0030154)|chaperone-mediated protein complex assembly (GO:0051131)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)		p.D318V(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|skin(2)|soft_tissue(1)	29		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCAGCGAGGATCTCGGTCAGG	0.597																																																	1	Substitution - Missense(1)	kidney(1)											104.0	96.0	99.0					19																	362387		2203	4300	6503	SO:0001583	missense	51298			AF268610	CCDS12025.1, CCDS12026.1	19p13.3	2012-02-24	2012-02-24		ENSG00000105549	ENSG00000105549			13706	protein-coding gene	gene with protein product	"""cancer/testis antigen 56"""	609503	"""Theg homolog (mouse)"""			11173852	Standard	NM_016585		Approved	CT56, THEG1	uc002lol.3	Q9P2T0	OTTHUMG00000165491	ENST00000342640.4:c.953A>T	19.37:g.362387T>A	ENSP00000340088:p.Asp318Val		A6NMJ8	Missense_Mutation	SNP	ENST00000342640.4	37	CCDS12025.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.72|14.72	2.618289|2.618289	0.46736|0.46736	.|.	.|.	ENSG00000105549|ENSG00000105549	ENST00000342640;ENST00000346878|ENST00000530711	T;T|.	0.29397|.	1.57;1.57|.	3.85|3.85	-0.119|-0.119	0.13543|0.13543	.|.	0.925155|.	0.09166|.	N|.	0.839514|.	T|T	0.39937|0.39937	0.1097|0.1097	L|L	0.55481|0.55481	1.735|1.735	0.09310|0.09310	N|N	1|1	D;P|.	0.57899|.	0.981;0.731|.	P;B|.	0.54026|.	0.74;0.186|.	T|T	0.42015|0.42015	-0.9476|-0.9476	10|6	0.59425|0.87932	D|D	0.04|0	-22.8218|-22.8218	3.7178|3.7178	0.08445|0.08445	0.0:0.173:0.4606:0.3664|0.0:0.173:0.4606:0.3664	.|.	294;318|.	Q9P2T0-2;Q9P2T0|.	.;THEG_HUMAN|.	V|F	318;294|96	ENSP00000340088:D318V;ENSP00000264820:D294V|.	ENSP00000340088:D318V|ENSP00000431699:I96F	D|I	-|-	2|1	0|0	THEG|THEG	313387|313387	0.036000|0.036000	0.19791|0.19791	0.814000|0.814000	0.32528|0.32528	0.873000|0.873000	0.50193|0.50193	-0.241000|-0.241000	0.08940|0.08940	0.108000|0.108000	0.17862|0.17862	0.413000|0.413000	0.27773|0.27773	GAT|ATC		0.597	THEG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384431.2			
TMOD1	7111	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	100286582	100286582	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr9:100286582G>A	ENST00000259365.4	+	2	325	c.112G>A	c.(112-114)Gac>Aac	p.D38N	TMOD1_ENST00000395211.2_Missense_Mutation_p.D38N	NM_003275.3	NP_003266.1	P28289	TMOD1_HUMAN	tropomodulin 1	38					adult locomotory behavior (GO:0008344)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)	cortical cytoskeleton (GO:0030863)|cytosol (GO:0005829)|membrane (GO:0016020)|myofibril (GO:0030016)		p.D38N(1)		breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(2)|urinary_tract(1)	11		Acute lymphoblastic leukemia(62;0.154)		STAD - Stomach adenocarcinoma(157;0.105)		GGATGAGCTGGACCCTGATGT	0.512																																																	1	Substitution - Missense(1)	kidney(1)											138.0	112.0	121.0					9																	100286582		2203	4300	6503	SO:0001583	missense	7111				CCDS6726.1	9q22	2008-07-21		2003-03-21	ENSG00000136842	ENSG00000136842			11871	protein-coding gene	gene with protein product		190930		D9S57E, TMOD		1370827, 8661028	Standard	NM_003275		Approved	ETMOD	uc004axl.2	P28289	OTTHUMG00000020325	ENST00000259365.4:c.112G>A	9.37:g.100286582G>A	ENSP00000259365:p.Asp38Asn		B2RB77|Q5T7W3|Q9BUF1	Missense_Mutation	SNP	ENST00000259365.4	37	CCDS6726.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.821210	0.90873	.	.	ENSG00000136842	ENST00000395211;ENST00000259365	T;T	0.54279	0.58;0.58	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.76814	0.4040	M	0.87097	2.86	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.81468	-0.0919	10	0.87932	D	0	-31.3023	17.3565	0.87337	0.0:0.0:1.0:0.0	.	38	P28289	TMOD1_HUMAN	N	38	ENSP00000378637:D38N;ENSP00000259365:D38N	ENSP00000259365:D38N	D	+	1	0	TMOD1	99326403	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.283000	0.78640	2.534000	0.85438	0.585000	0.79938	GAC		0.512	TMOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053320.2		NM_003275	
TNKS1BP1	85456	broad.mit.edu;ucsc.edu	37	11	57076184	57076184	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr11:57076184A>T	ENST00000532437.1	-	5	4312	c.4001T>A	c.(4000-4002)cTa>cAa	p.L1334Q	TNKS1BP1_ENST00000530920.1_5'Flank|TNKS1BP1_ENST00000358252.3_Missense_Mutation_p.L1334Q			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	1334	Acidic.|Gly-rich.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)	p.L1334Q(1)		breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				ACATCCCCGTAGCCCCTGAGA	0.607																																																	1	Substitution - Missense(1)	kidney(1)											133.0	144.0	141.0					11																	57076184		2201	4296	6497	SO:0001583	missense	85456			AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.4001T>A	11.37:g.57076184A>T	ENSP00000437271:p.Leu1334Gln		A7E2F8|Q6PJ35|Q6ZV74	Missense_Mutation	SNP	ENST00000532437.1	37	CCDS7951.1	.	.	.	.	.	.	.	.	.	.	A	1.846	-0.466237	0.04476	.	.	ENSG00000149115	ENST00000358252;ENST00000532437	T;T	0.30714	1.52;1.52	3.64	2.71	0.32032	.	1.094760	0.07289	N	0.872167	T	0.15998	0.0385	N	0.08118	0	0.09310	N	1	B	0.29955	0.263	B	0.23716	0.048	T	0.23226	-1.0194	10	0.54805	T	0.06	.	6.3792	0.21525	0.1496:0.0:0.8504:0.0	.	1334	Q9C0C2	TB182_HUMAN	Q	1334	ENSP00000350990:L1334Q;ENSP00000437271:L1334Q	ENSP00000350990:L1334Q	L	-	2	0	TNKS1BP1	56832760	0.000000	0.05858	0.016000	0.15963	0.181000	0.23173	-1.027000	0.03592	0.497000	0.27926	-0.464000	0.05259	CTA		0.607	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392455.1		NM_033396	
TRIM2	23321	broad.mit.edu;hgsc.bcm.edu	37	4	154216562	154216562	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr4:154216562C>A	ENST00000437508.2	+	6	1004	c.803C>A	c.(802-804)aCc>aAc	p.T268N	TRIM2_ENST00000494872.1_3'UTR|TRIM2_ENST00000338700.5_Missense_Mutation_p.T295N	NM_001130067.1	NP_001123539.1	Q9C040	TRIM2_HUMAN	tripartite motif containing 2	268					cell death (GO:0008219)|regulation of neuron apoptotic process (GO:0043523)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.T295N(1)|p.T268N(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)	19	all_hematologic(180;0.093)	Medulloblastoma(177;0.00225)		GBM - Glioblastoma multiforme(119;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0703)		GGCACGGAGACCGAGGTCCTA	0.602																																																	2	Substitution - Missense(2)	kidney(2)											58.0	50.0	53.0					4																	154216562		2203	4300	6503	SO:0001583	missense	23321			AF220018	CCDS3781.2, CCDS47147.1	4q31.3	2013-01-09	2011-01-25		ENSG00000109654	ENSG00000109654		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	15974	protein-coding gene	gene with protein product		614141	"""tripartite motif-containing 2"""			9628581, 11331580	Standard	NM_015271		Approved	KIAA0517, RNF86	uc003inh.2	Q9C040	OTTHUMG00000155991	ENST00000437508.2:c.803C>A	4.37:g.154216562C>A	ENSP00000415812:p.Thr268Asn		D3DP09|O60272|Q9BSI9|Q9UFZ1	Missense_Mutation	SNP	ENST00000437508.2	37	CCDS47147.1	.	.	.	.	.	.	.	.	.	.	C	19.00	3.741288	0.69304	.	.	ENSG00000109654	ENST00000437508;ENST00000338700	T;T	0.70749	-0.51;-0.5	5.31	5.31	0.75309	B-box, C-terminal (1);	0.091864	0.85682	D	0.000000	T	0.63616	0.2526	L	0.34521	1.04	0.53688	D	0.999977	B;B	0.34214	0.442;0.308	B;B	0.31869	0.137;0.137	T	0.66728	-0.5850	10	0.66056	D	0.02	-1.6814	19.3326	0.94297	0.0:1.0:0.0:0.0	.	295;268	D3DP09;Q9C040	.;TRIM2_HUMAN	N	268;295	ENSP00000415812:T268N;ENSP00000339659:T295N	ENSP00000339659:T295N	T	+	2	0	TRIM2	154436012	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.411000	0.80078	2.639000	0.89480	0.561000	0.74099	ACC		0.602	TRIM2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342652.1			
TSEN54	283989	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	73519837	73519837	+	Silent	SNP	C	C	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr17:73519837C>G	ENST00000333213.6	+	10	1443	c.1407C>G	c.(1405-1407)ccC>ccG	p.P469P	LLGL2_ENST00000578363.1_5'Flank|LLGL2_ENST00000392550.3_5'Flank|LLGL2_ENST00000167462.5_5'Flank|LLGL2_ENST00000375227.4_5'Flank	NM_207346.2	NP_997229.2	Q7Z6J9	SEN54_HUMAN	TSEN54 tRNA splicing endonuclease subunit	469					mRNA processing (GO:0006397)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	nucleus (GO:0005634)		p.P469P(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(5)|ovary(2)	13	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			CTGGCAAACCCTATGCCCGGA	0.552																																																	1	Substitution - coding silent(1)	kidney(1)											59.0	57.0	58.0					17																	73519837		2203	4300	6503	SO:0001819	synonymous_variant	283989			AK097583	CCDS11724.1	17q25.1	2013-08-06	2013-08-06		ENSG00000182173	ENSG00000182173		"""tRNA splicing endonuclease subunits"""	27561	protein-coding gene	gene with protein product		608755	"""tRNA splicing endonuclease 54 homolog (SEN54, S. cerevisiae)"", ""tRNA splicing endonuclease 54 homolog (S. cerevisiae)"""			15109492	Standard	NM_207346		Approved	SEN54, SEN54L	uc002jof.1	Q7Z6J9		ENST00000333213.6:c.1407C>G	17.37:g.73519837C>G			Q86WV3|Q86XE4|Q8N9H2	Silent	SNP	ENST00000333213.6	37	CCDS11724.1																																																																																				0.552	TSEN54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447618.1		NM_207346	
VHL	7428	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	10191479	10191479	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr3:10191479C>G	ENST00000256474.2	+	3	1312	c.472C>G	c.(472-474)Ctg>Gtg	p.L158V	VHL_ENST00000477538.1_3'UTR|VHL_ENST00000345392.2_Missense_Mutation_p.L117V	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	158	Interaction with Elongin BC complex.		L -> P (in VHLD; type I-II; abolishes release from chaperonin complex and the interaction with Elongin BC complex). {ECO:0000269|PubMed:10635329, ECO:0000269|PubMed:8956040, ECO:0000269|PubMed:9829912}.|L -> V (in VHLD; type I). {ECO:0000269|PubMed:8956040}.		cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.L158V(12)|p.V155fs*15(2)|p.L158_K159del(1)|p.T157fs*14(1)|p.L158fs*16(1)|p.V155_K159delVYTLK(1)|p.T157_K159del(1)|p.Y156*(1)|p.T157_K159>I(1)|p.L158fs*6(1)|p.L158fs*1(1)|p.L158fs*15(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		AGTGTATACTCTGAAAGAGCG	0.498		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	24	Substitution - Missense(12)|Deletion - Frameshift(7)|Deletion - In frame(3)|Complex - deletion inframe(1)|Insertion - Frameshift(1)	kidney(23)|soft_tissue(1)	GRCh37	CM941380	VHL	M							89.0	81.0	84.0					3																	10191479		2203	4300	6503	SO:0001583	missense	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.472C>G	3.37:g.10191479C>G	ENSP00000256474:p.Leu158Val		B2RE45|Q13599|Q6PDA9	Missense_Mutation	SNP	ENST00000256474.2	37	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	C	16.32	3.090345	0.55968	.	.	ENSG00000134086	ENST00000256474;ENST00000345392;ENST00000450183	D;D	0.99830	-7.01;-7.01	4.86	3.07	0.35406	von Hippel-Lindau disease tumour suppressor, beta/alpha domain (2);von Hippel-Lindau disease tumor suppressor, alpha domain (1);	0.000000	0.64402	D	0.000003	D	0.99680	0.9880	M	0.75777	2.31	0.39234	D	0.963723	D;D	0.76494	0.999;0.99	D;D	0.80764	0.994;0.992	D	0.98323	1.0529	10	0.87932	D	0	-5.6982	9.2424	0.37504	0.0:0.8287:0.0:0.1713	.	117;158	P40337-2;P40337	.;VHL_HUMAN	V	158;117;76	ENSP00000256474:L158V;ENSP00000344757:L117V	ENSP00000256474:L158V	L	+	1	2	VHL	10166479	0.995000	0.38212	0.989000	0.46669	0.613000	0.37349	1.729000	0.38115	0.765000	0.33221	0.655000	0.94253	CTG		0.498	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
VPS8	23355	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	184689536	184689536	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr3:184689536G>A	ENST00000437079.3	+	40	3587	c.3416G>A	c.(3415-3417)cGt>cAt	p.R1139H	VPS8_ENST00000436792.2_Missense_Mutation_p.R1137H|VPS8_ENST00000446204.2_Missense_Mutation_p.R1047H|VPS8_ENST00000287546.4_Missense_Mutation_p.R1139H	NM_001009921.2	NP_001009921.1	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog (S. cerevisiae)	1139							zinc ion binding (GO:0008270)	p.R1139H(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			CAGCAGCAACGTGAGGTAGGA	0.468																																																	1	Substitution - Missense(1)	kidney(1)											108.0	100.0	103.0					3																	184689536		1897	4128	6025	SO:0001583	missense	23355			AK056661	CCDS46972.1	3q27.2	2006-07-07	2006-07-07	2006-07-07	ENSG00000156931	ENSG00000156931			29122	protein-coding gene	gene with protein product			"""KIAA0804"""	KIAA0804		9872452	Standard	NM_001009921		Approved	FLJ32099	uc003fpb.1	Q8N3P4	OTTHUMG00000156707	ENST00000437079.3:c.3416G>A	3.37:g.184689536G>A	ENSP00000397879:p.Arg1139His		A8K8Q8|B9EIQ1|C9JB61|O94896|Q63HP2|Q9BVP9|Q9H9B0	Missense_Mutation	SNP	ENST00000437079.3	37	CCDS46971.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.716481	0.89205	.	.	ENSG00000156931	ENST00000287546;ENST00000437079;ENST00000436792;ENST00000446204	T;T;T;T	0.19938	2.12;2.12;2.12;2.11	5.75	5.75	0.90469	Quinonprotein alcohol dehydrogenase-like (1);	0.000000	0.85682	D	0.000000	T	0.49932	0.1586	M	0.81341	2.54	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.974;0.998;0.979	T	0.45086	-0.9285	10	0.45353	T	0.12	-12.5682	16.8669	0.86032	0.0:0.0:1.0:0.0	.	1139;1047;1137	Q8N3P4;Q8N3P4-2;Q8N3P4-3	VPS8_HUMAN;.;.	H	1139;1139;1137;1047	ENSP00000287546:R1139H;ENSP00000397879:R1139H;ENSP00000404704:R1137H;ENSP00000405483:R1047H	ENSP00000287546:R1139H	R	+	2	0	VPS8	186172230	1.000000	0.71417	0.959000	0.39883	0.990000	0.78478	6.133000	0.71682	2.732000	0.93576	0.655000	0.94253	CGT		0.468	VPS8-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			NM_015303	
WIPI1	55062	broad.mit.edu;hgsc.bcm.edu	37	17	66422217	66422217	+	Splice_Site	SNP	G	G	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr17:66422217G>A	ENST00000262139.5	-	12	1291	c.1292C>T	c.(1291-1293)cCt>cTt	p.P431L	RP11-120M18.2_ENST00000592030.1_RNA|MIR635_ENST00000384830.1_RNA|WIPI1_ENST00000546360.1_Splice_Site_p.P349L|WIPI1_ENST00000589459.1_5'UTR	NM_017983.5	NP_060453.3	Q5MNZ9	WIPI1_HUMAN	WD repeat domain, phosphoinositide interacting 1	431					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|autophagy (GO:0006914)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|vesicle targeting, trans-Golgi to endosome (GO:0048203)	autophagic vacuole membrane (GO:0000421)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|pre-autophagosomal structure (GO:0000407)|pre-autophagosomal structure membrane (GO:0034045)|trans-Golgi network (GO:0005802)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|receptor binding (GO:0005102)	p.P431L(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	18						AATGCTCACAGGAGGAAACTC	0.517																																																	1	Substitution - Missense(1)	kidney(1)											97.0	76.0	83.0					17																	66422217		2203	4300	6503	SO:0001630	splice_region_variant	55062				CCDS11677.1	17q24.2	2014-02-12				ENSG00000070540		"""WD repeat domain containing"""	25471	protein-coding gene	gene with protein product		609224				15020712, 15602573	Standard	NM_017983		Approved	FLJ10055, WIPI49, Atg18, ATG18A	uc010dey.3	Q5MNZ9		ENST00000262139.5:c.1293+1C>T	17.37:g.66422217G>A			Q8IXM5|Q9NWF8	Missense_Mutation	SNP	ENST00000262139.5	37	CCDS11677.1	.	.	.	.	.	.	.	.	.	.	G	32	5.160158	0.94727	.	.	ENSG00000070540	ENST00000262139;ENST00000546360	T;T	0.70399	0.02;-0.48	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	D	0.84106	0.5399	M	0.68593	2.085	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.84686	0.0720	10	0.87932	D	0	-12.7522	20.04	0.97581	0.0:0.0:1.0:0.0	.	431	Q5MNZ9	WIPI1_HUMAN	L	431;349	ENSP00000262139:P431L;ENSP00000437345:P349L	ENSP00000262139:P431L	P	-	2	0	WIPI1	63933812	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	8.955000	0.93058	2.733000	0.93635	0.655000	0.94253	CCT		0.517	WIPI1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448739.1		NM_017983	Missense_Mutation
ZDBF2	57683	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	207170060	207170060	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chr2:207170060G>T	ENST00000374423.3	+	5	1194	c.808G>T	c.(808-810)Gtt>Ttt	p.V270F		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	270							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.V270F(2)		endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						AGATAAGTTGGTTTTGTGGAA	0.363																																																	2	Substitution - Missense(2)	kidney(2)											31.0	29.0	30.0					2																	207170060		1832	4073	5905	SO:0001583	missense	57683			AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.808G>T	2.37:g.207170060G>T	ENSP00000363545:p.Val270Phe		Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	ENST00000374423.3	37	CCDS46501.1	.	.	.	.	.	.	.	.	.	.	G	10.93	1.488747	0.26686	.	.	ENSG00000204186	ENST00000374423	T	0.18960	2.18	4.92	-9.85	0.00476	.	1.045340	0.07730	N	0.945183	T	0.08582	0.0213	N	0.22421	0.69	0.09310	N	1	B	0.18310	0.027	B	0.11329	0.006	T	0.35001	-0.9806	10	0.56958	D	0.05	.	0.3635	0.00368	0.2959:0.2307:0.257:0.2164	.	270	Q9HCK1	ZDBF2_HUMAN	F	270	ENSP00000363545:V270F	ENSP00000363545:V270F	V	+	1	0	ZDBF2	206878305	0.002000	0.14202	0.002000	0.10522	0.179000	0.23085	-1.174000	0.03105	-1.375000	0.02129	0.650000	0.86243	GTT		0.363	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1		NM_020923	
ZFX	7543	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	24228654	24228654	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4827-01A-02D-1421-08	TCGA-B0-4827-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	02f83f9a-4e4d-44f3-8d67-b4fc2d35102b	bb38d638-fc05-4d25-bbb9-180592399803	g.chrX:24228654G>A	ENST00000379177.1	+	11	2006	c.1579G>A	c.(1579-1581)Gag>Aag	p.E527K	ZFX_ENST00000338565.3_Missense_Mutation_p.E477K|ZFX_ENST00000379188.3_Missense_Mutation_p.E527K|ZFX_ENST00000539115.1_Missense_Mutation_p.E298K|ZFX_ENST00000304543.5_Missense_Mutation_p.E527K|ZFX_ENST00000540034.1_Missense_Mutation_p.E566K	NM_001178085.1|NM_003410.3	NP_001171556.1|NP_003401.2	P17010	ZFX_HUMAN	zinc finger protein, X-linked	527					death (GO:0016265)|fertilization (GO:0009566)|homeostasis of number of cells (GO:0048872)|multicellular organism growth (GO:0035264)|oocyte development (GO:0048599)|ovarian follicle development (GO:0001541)|parental behavior (GO:0060746)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)	p.E527K(1)		cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(2)|lung(4)|ovary(2)|prostate(1)	24						CTGTGAATACGAGACAGCTGA	0.443																																					Esophageal Squamous(20;306 562 7346 32868 37983)												1	Substitution - Missense(1)	kidney(1)											140.0	129.0	133.0					X																	24228654		2203	4300	6503	SO:0001583	missense	7543				CCDS14211.1, CCDS55390.1	Xp22.1-p21.3	2013-01-08			ENSG00000005889	ENSG00000005889		"""Zinc fingers, C2H2-type"""	12869	protein-coding gene	gene with protein product		314980					Standard	NM_003410		Approved	ZNF926	uc022bua.1	P17010	OTTHUMG00000021264	ENST00000379177.1:c.1579G>A	X.37:g.24228654G>A	ENSP00000368475:p.Glu527Lys		B9EG97|O43668|Q8WYJ8	Missense_Mutation	SNP	ENST00000379177.1	37	CCDS14211.1	.	.	.	.	.	.	.	.	.	.	G	19.62	3.862392	0.71949	.	.	ENSG00000005889	ENST00000539115;ENST00000379188;ENST00000535562;ENST00000379177;ENST00000304543;ENST00000540034;ENST00000338565	T;T;T;T;T;T	0.27557	1.66;1.66;1.66;1.66;1.66;1.66	5.31	5.31	0.75309	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.000000	0.64402	D	0.000002	T	0.32941	0.0846	N	0.02368	-0.58	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.998	T	0.58154	-0.7686	10	0.62326	D	0.03	-8.3466	18.0859	0.89457	0.0:0.0:1.0:0.0	.	566;249;527	B9EG97;F5GYV7;P17010	.;.;ZFX_HUMAN	K	298;527;249;527;527;566;477	ENSP00000438233:E298K;ENSP00000368486:E527K;ENSP00000368475:E527K;ENSP00000304985:E527K;ENSP00000441382:E566K;ENSP00000343384:E477K	ENSP00000304985:E527K	E	+	1	0	ZFX	24138575	1.000000	0.71417	0.974000	0.42286	0.979000	0.70002	9.869000	0.99810	2.207000	0.71202	0.600000	0.82982	GAG		0.443	ZFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056084.1		NM_003410	
