#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ABCA4	24	hgsc.bcm.edu;ucsc.edu	37	1	94568673	94568673	+	Silent	SNP	G	G	T	rs148091207	byFrequency	TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr1:94568673G>T	ENST00000370225.3	-	5	554	c.468C>A	c.(466-468)atC>atA	p.I156I	ABCA4_ENST00000535735.1_Silent_p.I156I	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	156			I -> V (in STGD1; dbSNP:rs62646863). {ECO:0000269|PubMed:18977788}.		phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		CATCTTTCAAGATATCCCTTA	0.413																																																	0													251.0	240.0	244.0					1																	94568673		2203	4300	6503	SO:0001819	synonymous_variant	24			U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.468C>A	1.37:g.94568673G>T			O15112|O60438|O60915|Q0QD48|Q4LE31	Silent	SNP	ENST00000370225.3	37	CCDS747.1																																																																																				0.413	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1		NM_000350	
ABCC3	8714	hgsc.bcm.edu;ucsc.edu	37	17	48765029	48765029	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr17:48765029G>C	ENST00000285238.8	+	30	4493	c.4413G>C	c.(4411-4413)caG>caC	p.Q1471H		NM_003786.3	NP_003777.2	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 3	1471	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Doxorubicin(DB00997)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indomethacin(DB00328)|Lamivudine(DB00709)|Leucovorin(DB00650)|Methotrexate(DB00563)|Metyrapone(DB01011)|Nifedipine(DB01115)|Omeprazole(DB00338)|Phenobarbital(DB01174)|Probenecid(DB01032)|Rifampicin(DB01045)|Sulfinpyrazone(DB01138)|Verapamil(DB00661)|Vincristine(DB00541)	TCCGCACCCAGTTTGATACCT	0.577																																																	0													178.0	131.0	147.0					17																	48765029		2203	4300	6503	SO:0001583	missense	8714			Y17151	CCDS32681.1, CCDS45739.1	17q21	2012-03-14			ENSG00000108846	ENSG00000108846		"""ATP binding cassette transporters / subfamily C"""	54	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter 2"""	604323				8894702, 9827529	Standard	NM_003786		Approved	MRP3, cMOAT2, EST90757, MLP2, MOAT-D	uc002isl.3	O15438	OTTHUMG00000162245	ENST00000285238.8:c.4413G>C	17.37:g.48765029G>C	ENSP00000285238:p.Gln1471His		B2RPA9|D3DTX9|O60265|O60922|O75621|O95078|O95289|O95290|Q86X85|Q9UN52	Missense_Mutation	SNP	ENST00000285238.8	37	CCDS32681.1	.	.	.	.	.	.	.	.	.	.	G	18.82	3.704286	0.68615	.	.	ENSG00000108846	ENST00000285238	T	0.77489	-1.1	4.87	2.9	0.33743	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.069338	0.64402	D	0.000011	T	0.56171	0.1967	N	0.00864	-1.135	0.58432	D	0.999998	D	0.56035	0.974	P	0.50617	0.646	T	0.67444	-0.5669	10	0.87932	D	0	-15.8807	9.7672	0.40567	0.2225:0.0:0.7775:0.0	.	1471	O15438	MRP3_HUMAN	H	1471	ENSP00000285238:Q1471H	ENSP00000285238:Q1471H	Q	+	3	2	ABCC3	46120028	1.000000	0.71417	0.996000	0.52242	0.966000	0.64601	1.423000	0.34837	0.669000	0.31146	-0.736000	0.03550	CAG		0.577	ABCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368083.2		NM_020038	
ANKRD17	26057	hgsc.bcm.edu;ucsc.edu	37	4	74021354	74021354	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr4:74021354A>T	ENST00000358602.4	-	5	1110	c.994T>A	c.(994-996)Tca>Aca	p.S332T	ANKRD17_ENST00000509867.2_Missense_Mutation_p.S219T|ANKRD17_ENST00000330838.6_Missense_Mutation_p.S332T|ANKRD17_ENST00000514252.1_5'Flank	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17	332					blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TGACCTGTTGAAGACTGTGCA	0.353																																																	0													125.0	110.0	115.0					4																	74021354		2203	4300	6503	SO:0001583	missense	26057			AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.994T>A	4.37:g.74021354A>T	ENSP00000351416:p.Ser332Thr		E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Missense_Mutation	SNP	ENST00000358602.4	37	CCDS34004.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.393168	0.83011	.	.	ENSG00000132466	ENST00000358602;ENST00000426990;ENST00000330838;ENST00000509867;ENST00000411811	T;T;T	0.15834	2.39;2.39;2.39	5.87	5.87	0.94306	Ankyrin repeat-containing domain (4);	0.000000	0.53938	D	0.000045	T	0.15869	0.0382	N	0.12831	0.26	0.38182	D	0.939636	P;P;P;P	0.46578	0.541;0.88;0.596;0.596	B;P;B;B	0.47102	0.234;0.537;0.444;0.262	T	0.09552	-1.0669	10	0.49607	T	0.09	.	16.2806	0.82678	1.0:0.0:0.0:0.0	.	332;332;332;219	O75179-2;G5E964;O75179;E7EUV3	.;.;ANR17_HUMAN;.	T	332;332;332;219;332	ENSP00000351416:S332T;ENSP00000332265:S332T;ENSP00000427151:S219T	ENSP00000332265:S332T	S	-	1	0	ANKRD17	74240218	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.248000	0.95456	2.248000	0.74166	0.533000	0.62120	TCA		0.353	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362475.1		NM_032217	
ANK2	287	hgsc.bcm.edu	37	4	114179233	114179233	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr4:114179233T>C	ENST00000357077.4	+	12	1269	c.1216T>C	c.(1216-1218)Tgc>Cgc	p.C406R	ANK2_ENST00000264366.6_Missense_Mutation_p.C406R|ANK2_ENST00000506722.1_Missense_Mutation_p.C385R|ANK2_ENST00000394537.3_Missense_Mutation_p.C406R	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	406					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GCACATTGCCTGCAAGAAAAA	0.403																																																	0													117.0	108.0	111.0					4																	114179233		2203	4300	6503	SO:0001583	missense	287			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.1216T>C	4.37:g.114179233T>C	ENSP00000349588:p.Cys406Arg		Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.059442	0.76074	.	.	ENSG00000145362	ENST00000503271;ENST00000503423;ENST00000506722;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056	T;T;T;T;T;T;T	0.65178	-0.14;-0.12;-0.12;-0.12;-0.12;-0.12;-0.12	5.95	5.95	0.96441	Ankyrin repeat-containing domain (3);	0.000000	0.64402	D	0.000012	T	0.78355	0.4270	M	0.67569	2.06	0.80722	D	1	B;B;B;B;D	0.65815	0.045;0.285;0.016;0.044;0.995	B;B;B;B;D	0.83275	0.05;0.234;0.02;0.03;0.996	T	0.80358	-0.1416	10	0.87932	D	0	.	16.4069	0.83677	0.0:0.0:0.0:1.0	.	406;406;406;385;385	Q01484;Q01484-2;Q01484-4;Q01484-5;F8WEF9	ANK2_HUMAN;.;.;.;.	R	385;385;385;421;406;406;406;385	ENSP00000423799:C385R;ENSP00000421011:C385R;ENSP00000421067:C385R;ENSP00000424722:C421R;ENSP00000378044:C406R;ENSP00000349588:C406R;ENSP00000264366:C406R	ENSP00000264366:C406R	C	+	1	0	ANK2	114398682	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.997000	0.88414	2.272000	0.75746	0.460000	0.39030	TGC		0.403	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2		NM_001148	
ARHGAP42	143872	hgsc.bcm.edu;ucsc.edu	37	11	100641130	100641130	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr11:100641130T>G	ENST00000298815.8	+	2	214	c.211T>G	c.(211-213)Tgt>Ggt	p.C71G	ARHGAP42_ENST00000534060.1_3'UTR|ARHGAP42_ENST00000524892.2_Missense_Mutation_p.C71G	NM_152432.2	NP_689645.2	A6NI28	RHG42_HUMAN	Rho GTPase activating protein 42	71	BAR.				signal transduction (GO:0007165)	intracellular (GO:0005622)	GTPase activator activity (GO:0005096)			endometrium(3)|skin(2)	5						CCAGTTTGAATGTATTGGTGA	0.318																																																	0													111.0	102.0	105.0					11																	100641130		692	1591	2283	SO:0001583	missense	143872					11q22.1	2012-04-19			ENSG00000165895	ENSG00000165895		"""Rho GTPase activating proteins"""	26545	protein-coding gene	gene with protein product		615936				18954304	Standard	NM_152432		Approved	FLJ32810, GRAF3	uc001pge.2	A6NI28	OTTHUMG00000167530	ENST00000298815.8:c.211T>G	11.37:g.100641130T>G	ENSP00000298815:p.Cys71Gly		Q96M56	Missense_Mutation	SNP	ENST00000298815.8	37		.	.	.	.	.	.	.	.	.	.	T	22.5	4.297720	0.81025	.	.	ENSG00000165895	ENST00000524892;ENST00000298815	T;T	0.28895	1.59;1.59	5.89	5.89	0.94794	IRSp53/MIM homology domain (IMD) (1);	0.000000	0.64402	U	0.000012	T	0.34832	0.0911	M	0.66939	2.045	0.80722	D	1	B	0.20671	0.047	B	0.23419	0.046	T	0.08722	-1.0708	10	0.33141	T	0.24	.	14.2643	0.66107	0.0:0.0:0.0:1.0	.	71	A6NI28	RHG42_HUMAN	G	71	ENSP00000431776:C71G;ENSP00000298815:C71G	ENSP00000298815:C71G	C	+	1	0	ARHGAP42	100146340	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.224000	0.78042	2.254000	0.74563	0.459000	0.35465	TGT		0.318	ARHGAP42-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_152432	
CFAP61	26074	hgsc.bcm.edu	37	20	20140084	20140084	+	Missense_Mutation	SNP	C	C	G	rs201733475	byFrequency	TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr20:20140084C>G	ENST00000245957.5	+	10	1098	c.1022C>G	c.(1021-1023)cCg>cGg	p.P341R	C20orf26_ENST00000389656.3_5'UTR|C20orf26_ENST00000377309.2_5'UTR|C20orf26_ENST00000451767.2_Missense_Mutation_p.P341R|C20orf26_ENST00000377306.1_Missense_Mutation_p.P341R	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN		341										NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		GTTAGTGAACCGGAGGTAGGG	0.483																																																	0													139.0	105.0	116.0					20																	20140084		2203	4300	6503	SO:0001583	missense	26074																														ENST00000245957.5:c.1022C>G	20.37:g.20140084C>G	ENSP00000245957:p.Pro341Arg		A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Missense_Mutation	SNP	ENST00000245957.5	37	CCDS33447.1	.	.	.	.	.	.	.	.	.	.	C	4.378	0.069693	0.08436	.	.	ENSG00000089101	ENST00000340348;ENST00000343997;ENST00000389655;ENST00000245957;ENST00000377306;ENST00000451767;ENST00000442372;ENST00000377297	T;T;T	0.07688	3.17;3.17;3.17	3.82	-5.09	0.02920	.	1.875700	0.02171	N	0.059707	T	0.06508	0.0167	L	0.36672	1.1	0.80722	D	1	B;B;B;B	0.06786	0.001;0.0;0.001;0.0	B;B;B;B	0.08055	0.001;0.003;0.003;0.0	T	0.35549	-0.9784	10	0.16420	T	0.52	.	6.2679	0.20939	0.0:0.3581:0.1327:0.5092	.	341;341;296;341	Q8NHU2-3;F8W6K4;F8W6E2;Q8NHU2	.;.;.;CT026_HUMAN	R	296;341;341;341;341;341;100;133	ENSP00000245957:P341R;ENSP00000366521:P341R;ENSP00000414537:P341R	ENSP00000245957:P341R	P	+	2	0	C20orf26	20088084	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.361000	0.07612	-1.086000	0.03084	-1.615000	0.00797	CCG		0.483	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078228.3			
CCDC68	80323	hgsc.bcm.edu;ucsc.edu	37	18	52610015	52610015	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr18:52610015G>T	ENST00000591504.1	-	3	282	c.8C>A	c.(7-9)aCa>aAa	p.T3K	CCDC68_ENST00000432185.1_Missense_Mutation_p.T3K|CCDC68_ENST00000337363.4_Missense_Mutation_p.T3K	NM_025214.2	NP_079490.1	Q9H2F9	CCD68_HUMAN	coiled-coil domain containing 68	3										breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|skin(3)|stomach(1)	14				Colorectal(16;0.0256)|READ - Rectum adenocarcinoma(59;0.21)		CACTGTCACTGTTGTCATTGT	0.368																																																	0													142.0	130.0	134.0					18																	52610015		2203	4300	6503	SO:0001583	missense	80323				CCDS11959.1	18q21	2006-02-07			ENSG00000166510	ENSG00000166510			24350	protein-coding gene	gene with protein product	"""cutaneous T-cell lymphoma associated antigen"""					11149944, 15142679	Standard	NM_025214		Approved	SE57-1	uc002lft.3	Q9H2F9	OTTHUMG00000132708	ENST00000591504.1:c.8C>A	18.37:g.52610015G>T	ENSP00000466690:p.Thr3Lys		B2R9I3	Missense_Mutation	SNP	ENST00000591504.1	37	CCDS11959.1	.	.	.	.	.	.	.	.	.	.	G	16.96	3.265349	0.59431	.	.	ENSG00000166510	ENST00000337363;ENST00000432185	T;T	0.28069	1.63;1.63	5.36	5.36	0.76844	.	0.248873	0.28630	N	0.014669	T	0.43077	0.1231	M	0.65975	2.015	0.32063	N	0.595457	D	0.56746	0.977	P	0.53593	0.73	T	0.57154	-0.7860	10	0.72032	D	0.01	-2.0577	9.9154	0.41430	0.0896:0.0:0.9104:0.0	.	3	Q9H2F9	CCD68_HUMAN	K	3	ENSP00000337209:T3K;ENSP00000413406:T3K	ENSP00000337209:T3K	T	-	2	0	CCDC68	50761013	0.995000	0.38212	0.993000	0.49108	0.499000	0.33736	3.369000	0.52365	2.779000	0.95612	0.650000	0.86243	ACA		0.368	CCDC68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256006.1		NM_025214	
CDH8	1006	hgsc.bcm.edu;ucsc.edu	37	16	61687743	61687743	+	Missense_Mutation	SNP	T	T	G	rs201669981		TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr16:61687743T>G	ENST00000577390.1	-	12	3123	c.2169A>C	c.(2167-2169)gaA>gaC	p.E723D	CDH8_ENST00000299345.6_Intron|CDH8_ENST00000577730.1_Intron	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	723					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		CATTTATAAATTCATCGACAT	0.448																																																	0													94.0	98.0	97.0					16																	61687743		2203	4300	6503	SO:0001583	missense	1006			L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.2169A>C	16.37:g.61687743T>G	ENSP00000462701:p.Glu723Asp		B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	ENST00000577390.1	37	CCDS10802.1	.	.	.	.	.	.	.	.	.	.	T	0.112	-1.137197	0.01742	.	.	ENSG00000150394	ENST00000299345	.	.	.	5.7	2.3	0.28687	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	T	0.14356	0.0347	N	0.01128	-1	0.80722	D	1	B	0.11235	0.004	B	0.15870	0.014	T	0.29336	-1.0015	9	0.02654	T	1	.	8.7095	0.34376	0.0:0.2167:0.0:0.7833	.	723	P55286	CADH8_HUMAN	D	723	.	ENSP00000299345:E723D	E	-	3	2	CDH8	60245244	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.752000	0.38349	0.440000	0.26502	-0.264000	0.10439	GAA		0.448	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3		NM_001796	
CHD5	26038	hgsc.bcm.edu	37	1	6171886	6171886	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr1:6171886T>C	ENST00000262450.3	-	36	5297	c.5198A>G	c.(5197-5199)tAc>tGc	p.Y1733C	CHD5_ENST00000378021.1_Missense_Mutation_p.Y590C	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		CCAGATGTCGTAGATTTTCCC	0.627																																																	0													56.0	58.0	57.0					1																	6171886		2203	4299	6502	SO:0001583	missense	26038			AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.5198A>G	1.37:g.6171886T>C	ENSP00000262450:p.Tyr1733Cys		A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	ENST00000262450.3	37	CCDS57.1	.	.	.	.	.	.	.	.	.	.	t	27.0	4.791025	0.90367	.	.	ENSG00000116254	ENST00000262450;ENST00000378021;ENST00000377999	D;T	0.91407	-2.84;2.12	4.64	4.64	0.57946	CHD, C-terminal 2 (1);	0.174219	0.39274	N	0.001414	D	0.92590	0.7646	L	0.48642	1.525	0.48901	D	0.999721	D;D	0.67145	0.996;0.992	D;P	0.64506	0.926;0.873	D	0.92942	0.6373	10	0.54805	T	0.06	-28.4947	14.3782	0.66892	0.0:0.0:0.0:1.0	.	1733;590	Q8TDI0;Q5TG85	CHD5_HUMAN;.	C	1733;590;590	ENSP00000262450:Y1733C;ENSP00000367260:Y590C	ENSP00000262450:Y1733C	Y	-	2	0	CHD5	6094473	1.000000	0.71417	0.973000	0.42090	0.980000	0.70556	7.924000	0.87555	1.860000	0.53959	0.459000	0.35465	TAC		0.627	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002823.2		NM_015557	
DBX2	440097	hgsc.bcm.edu;ucsc.edu	37	12	45429899	45429899	+	Splice_Site	SNP	T	T	G			TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr12:45429899T>G	ENST00000332700.6	-	2	575		c.e2-2			NM_001004329.2	NP_001004329.2	Q6ZNG2	DBX2_HUMAN	developing brain homeobox 2						regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.?(1)		endometrium(3)|kidney(1)|large_intestine(3)|lung(9)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	22	Lung SC(27;0.192)	Lung NSC(34;0.142)		GBM - Glioblastoma multiforme(48;0.0515)		tggaaggtgctgcagagaaag	0.453																																																	1	Unknown(1)	lung(1)											77.0	83.0	81.0					12																	45429899		2203	4300	6503	SO:0001630	splice_region_variant	440097				CCDS31781.1	12q12	2011-06-20				ENSG00000185610		"""Homeoboxes / ANTP class : NKL subclass"""	33186	protein-coding gene	gene with protein product						11239429	Standard	NM_001004329		Approved	FLJ16139	uc001rok.1	Q6ZNG2	OTTHUMG00000169559	ENST00000332700.6:c.404-2A>C	12.37:g.45429899T>G				Splice_Site	SNP	ENST00000332700.6	37	CCDS31781.1																																																																																				0.453	DBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404810.1		NM_001004329	Intron
DNAH5	1767	hgsc.bcm.edu;ucsc.edu	37	5	13830726	13830726	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr5:13830726C>A	ENST00000265104.4	-	36	6145	c.6041G>T	c.(6040-6042)gGa>gTa	p.G2014V		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2014	AAA 1. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CCGTCCAAGTCCTCGGAAATC	0.413									Kartagener syndrome																																								0													103.0	103.0	103.0					5																	13830726		2203	4300	6503	SO:0001583	missense	1767	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.6041G>T	5.37:g.13830726C>A	ENSP00000265104:p.Gly2014Val		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.496751	0.85069	.	.	ENSG00000039139	ENST00000265104	T	0.39592	1.07	5.53	5.53	0.82687	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	T	0.62901	0.2466	L	0.56199	1.76	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.64300	-0.6440	10	0.87932	D	0	.	19.4895	0.95044	0.0:1.0:0.0:0.0	.	2014	Q8TE73	DYH5_HUMAN	V	2014	ENSP00000265104:G2014V	ENSP00000265104:G2014V	G	-	2	0	DNAH5	13883726	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.818000	0.86416	2.596000	0.87737	0.655000	0.94253	GGA		0.413	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2		NM_001369	
DPYSL4	10570	hgsc.bcm.edu	37	10	134013906	134013906	+	Silent	SNP	C	C	T	rs56326856	byFrequency	TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr10:134013906C>T	ENST00000338492.4	+	9	1022	c.858C>T	c.(856-858)gaC>gaT	p.D286D	DPYSL4_ENST00000368627.1_Silent_p.D186D|DPYSL4_ENST00000368629.1_Silent_p.D186D	NM_006426.2	NP_006417.2	O14531	DPYL4_HUMAN	dihydropyrimidinase-like 4	286					axon guidance (GO:0007411)|nervous system development (GO:0007399)|pyrimidine nucleobase catabolic process (GO:0006208)	cytosol (GO:0005829)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)	p.D286D(3)		NS(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		all_cancers(35;4.33e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;7.21e-05)|Epithelial(32;8.01e-05)|all cancers(32;9.29e-05)|BRCA - Breast invasive adenocarcinoma(275;0.206)		TGGGCACCGACGGTTCACACT	0.672													T|||	751	0.14996	0.2708	0.098	5008	,	,		15549	0.001		0.159	False		,,,				2504	0.1677																3	Substitution - Missense(3)	central_nervous_system(2)|endometrium(1)						T		1004,3402	727.6+/-409.9	119,766,1318	119.0	107.0	112.0		858	-3.2	0.1	10	dbSNP_129	112	1324,7276	756.8+/-407.5	92,1140,3068	no	coding-synonymous	DPYSL4	NM_006426.2		211,1906,4386	TT,TC,CC		15.3953,22.7871,17.8994		286/573	134013906	2328,10678	2203	4300	6503	SO:0001819	synonymous_variant	10570			AB006713	CCDS7665.1	10q25.2-q26	2008-05-14			ENSG00000151640	ENSG00000151640			3016	protein-coding gene	gene with protein product		608407				8973361, 9652388	Standard	NM_006426		Approved	ULIP4, DRP-4	uc009ybb.3	O14531	OTTHUMG00000019283	ENST00000338492.4:c.858C>T	10.37:g.134013906C>T			B2RMQ1|D3DRG5|O00240|Q5T0Q7	Silent	SNP	ENST00000338492.4	37	CCDS7665.1																																																																																				0.672	DPYSL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051050.2			
ESYT1	23344	hgsc.bcm.edu;ucsc.edu	37	12	56531335	56531335	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr12:56531335G>A	ENST00000394048.5	+	18	2255	c.1991G>A	c.(1990-1992)cGt>cAt	p.R664H	ESYT1_ENST00000267113.4_Missense_Mutation_p.R674H|ESYT1_ENST00000541590.1_Missense_Mutation_p.R674H	NM_001184796.1|NM_015292.2	NP_001171725.1|NP_056107.1	Q9BSJ8	ESYT1_HUMAN	extended synaptotagmin-like protein 1	664	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				lipid transport (GO:0006869)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(4)|lung(10)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	28						GCCAAAGACCGTTTCTTGGGG	0.542																																																	0													162.0	166.0	164.0					12																	56531335		2203	4300	6503	SO:0001583	missense	23344			AK074368	CCDS8904.1, CCDS53801.1	12q13.2	2014-07-02	2009-06-23	2009-06-23		ENSG00000139641		"""Synaptotagmins"""	29534	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member A"""	FAM62A		9872452, 10350628, 17672888	Standard	NM_015292		Approved	MBC2, KIAA0747	uc001sjr.3	Q9BSJ8		ENST00000394048.5:c.1991G>A	12.37:g.56531335G>A	ENSP00000377612:p.Arg664His		A0FGR7|A8K2S2|O94848|Q6PJN4|Q9H6J1|Q9H6W2|Q9Y416	Missense_Mutation	SNP	ENST00000394048.5	37	CCDS8904.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.706857	0.89018	.	.	ENSG00000139641	ENST00000394048;ENST00000402331;ENST00000267113;ENST00000541590	T;T;T	0.09723	2.95;2.95;2.95	5.22	4.32	0.51571	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.171239	0.50627	D	0.000111	T	0.19725	0.0474	L	0.51422	1.61	0.42390	D	0.992526	D;D	0.76494	0.998;0.999	P;D	0.64042	0.774;0.921	T	0.00385	-1.1773	10	0.42905	T	0.14	-8.1659	6.2772	0.20987	0.246:0.0:0.754:0.0	.	674;664	Q9BSJ8-2;Q9BSJ8	.;ESYT1_HUMAN	H	664;618;674;674	ENSP00000377612:R664H;ENSP00000267113:R674H;ENSP00000445952:R674H	ENSP00000267113:R674H	R	+	2	0	ESYT1	54817602	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.880000	0.56145	2.608000	0.88229	0.655000	0.94253	CGT		0.542	ESYT1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000407906.1		NM_015292	
FAM160A2	84067	hgsc.bcm.edu	37	11	6239139	6239139	+	Silent	SNP	A	A	G	rs11040809	byFrequency	TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr11:6239139A>G	ENST00000449352.2	-	9	1940	c.1677T>C	c.(1675-1677)cgT>cgC	p.R559R	FAM160A2_ENST00000529360.1_5'Flank|FAM160A2_ENST00000265978.4_Silent_p.R573R|FAM160A2_ENST00000524416.1_Silent_p.R559R			Q8N612	F16A2_HUMAN	family with sequence similarity 160, member A2	559					early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	FHF complex (GO:0070695)				NS(1)|endometrium(3)|kidney(2)|large_intestine(7)|liver(1)|lung(14)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CCACACCACGACGTGCCTCAC	0.642													A|||	547	0.109225	0.0106	0.1167	5008	,	,		11293	0.0456		0.2336	False		,,,				2504	0.1748																0								A	,	207,4195	127.0+/-164.0	7,193,2001	65.0	61.0	62.0		1677,1719	1.6	1.0	11	dbSNP_120	62	2176,6416	366.5+/-334.3	280,1616,2400	no	coding-synonymous,coding-synonymous	FAM160A2	NM_001098794.1,NM_032127.3	,	287,1809,4401	GG,GA,AA		25.3259,4.7024,18.3392	,	559/973,573/987	6239139	2383,10611	2201	4296	6497	SO:0001819	synonymous_variant	84067				CCDS7760.1, CCDS44530.1	11p15.4	2008-06-05	2008-06-05	2008-06-05	ENSG00000051009	ENSG00000051009			25378	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 56"""	C11orf56		11230166, 11214970	Standard	NM_001098794		Approved	FLJ22665, KIAA1759, DKFZP566M1046	uc001mck.4	Q8N612	OTTHUMG00000133379	ENST00000449352.2:c.1677T>C	11.37:g.6239139A>G			Q9C0A4|Q9H0N3|Q9H624	Silent	SNP	ENST00000449352.2	37	CCDS44530.1																																																																																				0.642	FAM160A2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383759.1		NM_032127	
FBXO4	26272	hgsc.bcm.edu;ucsc.edu	37	5	41929897	41929897	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr5:41929897A>G	ENST00000281623.3	+	3	580	c.524A>G	c.(523-525)aAt>aGt	p.N175S	FBXO4_ENST00000509134.1_Missense_Mutation_p.N175S|FBXO4_ENST00000296812.2_Missense_Mutation_p.N175S	NM_012176.2	NP_036308.1	Q9UKT5	FBX4_HUMAN	F-box protein 4	175					positive regulation of protein ubiquitination (GO:0031398)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|telomere maintenance (GO:0000723)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	protein homodimerization activity (GO:0042803)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(11)|prostate(1)|stomach(1)|urinary_tract(2)	27		Lung NSC(810;4.15e-05)|Breast(839;0.00093)|Ovarian(839;0.00965)|Myeloproliferative disorder(839;0.0255)|all_neural(839;0.0604)				ATCATTCAGAATGAACCACGA	0.428																																																	0													256.0	232.0	240.0					5																	41929897		2203	4300	6503	SO:0001583	missense	26272			AF129534	CCDS3938.1, CCDS3939.1, CCDS75238.1	5p12	2008-02-05	2004-06-15		ENSG00000151876	ENSG00000151876		"""F-boxes /  ""other"""""	13583	protein-coding gene	gene with protein product		609090	"""F-box only protein 4"""			10531035, 10531037	Standard	NM_033484		Approved	FBX4	uc003jmq.3	Q9UKT5	OTTHUMG00000094799	ENST00000281623.3:c.524A>G	5.37:g.41929897A>G	ENSP00000281623:p.Asn175Ser		Q68CU8|Q86VT8|Q9UK98	Missense_Mutation	SNP	ENST00000281623.3	37	CCDS3938.1	.	.	.	.	.	.	.	.	.	.	A	10.64	1.408042	0.25378	.	.	ENSG00000151876	ENST00000296812;ENST00000281623;ENST00000509134	T;T;T	0.38240	1.15;1.15;1.15	5.76	3.47	0.39725	.	0.281830	0.40640	N	0.001046	T	0.12092	0.0294	N	0.02011	-0.69	0.26804	N	0.969136	B;B;B	0.12013	0.001;0.005;0.002	B;B;B	0.09377	0.002;0.001;0.004	T	0.24190	-1.0167	10	0.14656	T	0.56	-19.8497	7.1555	0.25635	0.5352:0.3727:0.092:0.0	.	175;175;175	D6RAJ6;Q9UKT5;Q9UKT5-2	.;FBX4_HUMAN;.	S	175	ENSP00000296812:N175S;ENSP00000281623:N175S;ENSP00000421749:N175S	ENSP00000281623:N175S	N	+	2	0	FBXO4	41965654	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.183000	0.58317	1.004000	0.39156	0.533000	0.62120	AAT		0.428	FBXO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211614.1			
FHOD3	80206	hgsc.bcm.edu	37	18	34191947	34191947	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr18:34191947C>G	ENST00000359247.4	+	9	846	c.846C>G	c.(844-846)ttC>ttG	p.F282L	FHOD3_ENST00000590592.1_Missense_Mutation_p.F282L|FHOD3_ENST00000257209.4_Missense_Mutation_p.F282L|FHOD3_ENST00000445677.1_Missense_Mutation_p.F282L|FHOD3_ENST00000591635.1_5'UTR	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	282	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				AAGACACCTTCTACGACGTCG	0.527																																																	0													122.0	99.0	107.0					18																	34191947		2203	4300	6503	SO:0001583	missense	80206			AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.846C>G	18.37:g.34191947C>G	ENSP00000352186:p.Phe282Leu		A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Missense_Mutation	SNP	ENST00000359247.4	37		.	.	.	.	.	.	.	.	.	.	C	24.6	4.550513	0.86127	.	.	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	D;D;D	0.83591	-1.74;-1.74;-1.74	5.37	5.37	0.77165	GTPase-binding/formin homology 3 (1);Armadillo-type fold (1);	0.053973	0.85682	D	0.000000	D	0.88727	0.6515	M	0.66939	2.045	0.41451	D	0.98798	D;P;D;D	0.71674	0.993;0.952;0.995;0.998	D;P;P;D	0.69654	0.912;0.818;0.659;0.965	D	0.89387	0.3686	10	0.87932	D	0	.	11.5358	0.50636	0.0:0.9171:0.0:0.0829	.	282;282;282;282	Q2V2M9-2;Q2V2M9;Q2V2M9-3;E5F5Q0	.;FHOD3_HUMAN;.;.	L	282	ENSP00000257209:F282L;ENSP00000352186:F282L;ENSP00000411430:F282L	ENSP00000257209:F282L	F	+	3	2	FHOD3	32445945	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.035000	0.57297	2.676000	0.91093	0.561000	0.74099	TTC		0.527	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1		XM_371114	
HUWE1	10075	hgsc.bcm.edu	37	X	53579772	53579772	+	Silent	SNP	T	T	A			TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chrX:53579772T>A	ENST00000342160.3	-	61	9034	c.8577A>T	c.(8575-8577)acA>acT	p.T2859T	HUWE1_ENST00000262854.6_Silent_p.T2859T			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	2859					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						CCAGGCTGCTTGTATCCATAG	0.567																																																	0													47.0	42.0	44.0					X																	53579772		2203	4300	6503	SO:0001819	synonymous_variant	10075			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.8577A>T	X.37:g.53579772T>A			O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Silent	SNP	ENST00000342160.3	37	CCDS35301.1	.	.	.	.	.	.	.	.	.	.	T	10.09	1.255649	0.22965	.	.	ENSG00000086758	ENST00000427052	.	.	.	5.88	2.16	0.27623	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.8669	0.18781	0.2303:0.0:0.6307:0.139	.	.	.	.	X	1893	.	.	K	-	1	0	HUWE1	53596497	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	2.154000	0.42291	0.251000	0.21505	-0.223000	0.12442	AAG		0.567	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1		XM_497119	
IGFBP3	3486	hgsc.bcm.edu	37	7	45957039	45957039	+	Splice_Site	SNP	C	C	G			TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr7:45957039C>G	ENST00000275521.6	-	2	537		c.e2-1		IGFBP3_ENST00000381086.5_Splice_Site|IGFBP3_ENST00000465642.1_Splice_Site|IGFBP3_ENST00000381083.4_Splice_Site	NM_000598.4|NM_001013398.1	NP_000589.2|NP_001013416.1	P17936	IBP3_HUMAN	insulin-like growth factor binding protein 3						apoptotic process (GO:0006915)|cellular protein metabolic process (GO:0044267)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of signal transduction (GO:0009968)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|osteoblast differentiation (GO:0001649)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of myoblast differentiation (GO:0045663)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of glucose metabolic process (GO:0010906)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|insulin-like growth factor binding protein complex (GO:0016942)|nucleus (GO:0005634)	insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|metal ion binding (GO:0046872)|protein tyrosine phosphatase activator activity (GO:0008160)			large_intestine(6)|lung(7)|pancreas(1)|prostate(3)	17					Mecasermin(DB01277)	CTAGCATTTCCTTAAAACGCC	0.498											OREG0018049	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													33.0	35.0	34.0					7																	45957039		2203	4300	6503	SO:0001630	splice_region_variant	3486				CCDS5505.1, CCDS34632.1	7p12.3	2014-09-17			ENSG00000146674	ENSG00000146674			5472	protein-coding gene	gene with protein product	"""growth hormone-dependent binding protein"", ""acid stable subunit of the 140 K IGF complex"", ""binding protein 53"", ""binding protein 29"", ""IGF-binding protein 3"""	146732				1695633	Standard	NM_000598		Approved	IBP3, BP-53	uc003tnr.3	P17936	OTTHUMG00000023769	ENST00000275521.6:c.404-1G>C	7.37:g.45957039C>G		935	A4D2F5|D3DVM0|Q2V509|Q6P1M6|Q9UCL4	Splice_Site	SNP	ENST00000275521.6	37	CCDS5505.1	.	.	.	.	.	.	.	.	.	.	C	9.608	1.130467	0.21041	.	.	ENSG00000146674	ENST00000545032;ENST00000275521;ENST00000381086;ENST00000438491;ENST00000442142;ENST00000381083;ENST00000433047;ENST00000448817	.	.	.	5.44	5.44	0.79542	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.7691	0.69662	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	IGFBP3	45923564	1.000000	0.71417	0.989000	0.46669	0.159000	0.22180	5.629000	0.67798	2.542000	0.85734	0.655000	0.94253	.		0.498	IGFBP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251356.3		NM_001013398	Intron
KIAA1467	57613	hgsc.bcm.edu;ucsc.edu	37	12	13208556	13208556	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr12:13208556C>G	ENST00000197268.8	+	2	229	c.109C>G	c.(109-111)Ctg>Gtg	p.L37V		NM_020853.1	NP_065904.1	A2RU67	K1467_HUMAN	KIAA1467	37						integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|prostate(1)|skin(4)	36		Prostate(47;0.184)		BRCA - Breast invasive adenocarcinoma(232;0.157)		CGAAGACGATCTGGTGCTTAA	0.512																																																	0													80.0	80.0	80.0					12																	13208556		2203	4300	6503	SO:0001583	missense	57613			AB040900	CCDS31750.1	12p13.1	2006-01-23				ENSG00000084444			29288	protein-coding gene	gene with protein product						10819331	Standard	XM_005253450		Approved		uc001rbi.3	A2RU67		ENST00000197268.8:c.109C>G	12.37:g.13208556C>G	ENSP00000197268:p.Leu37Val		Q49AF2|Q5CZ81|Q6ZUV7|Q9P261	Missense_Mutation	SNP	ENST00000197268.8	37	CCDS31750.1	.	.	.	.	.	.	.	.	.	.	C	18.30	3.592974	0.66219	.	.	ENSG00000084444	ENST00000197268	T	0.26518	1.73	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.51719	0.1691	M	0.66939	2.045	0.53005	D	0.999962	D	0.89917	1.0	D	0.87578	0.998	T	0.47381	-0.9122	10	0.46703	T	0.11	-17.1588	19.2345	0.93853	0.0:1.0:0.0:0.0	.	37	A2RU67	K1467_HUMAN	V	37	ENSP00000197268:L37V	ENSP00000197268:L37V	L	+	1	2	KIAA1467	13099823	1.000000	0.71417	0.897000	0.35233	0.366000	0.29705	6.494000	0.73661	2.534000	0.85438	0.650000	0.86243	CTG		0.512	KIAA1467-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401007.1		NM_020853	
KIAA1467	57613	hgsc.bcm.edu;ucsc.edu	37	12	13224254	13224254	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr12:13224254C>G	ENST00000197268.8	+	10	1568	c.1448C>G	c.(1447-1449)aCc>aGc	p.T483S		NM_020853.1	NP_065904.1	A2RU67	K1467_HUMAN	KIAA1467	483						integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|prostate(1)|skin(4)	36		Prostate(47;0.184)		BRCA - Breast invasive adenocarcinoma(232;0.157)		ACGCCAGCCACCTCAGCAGTT	0.527																																																	0													128.0	120.0	122.0					12																	13224254		2203	4300	6503	SO:0001583	missense	57613			AB040900	CCDS31750.1	12p13.1	2006-01-23				ENSG00000084444			29288	protein-coding gene	gene with protein product						10819331	Standard	XM_005253450		Approved		uc001rbi.3	A2RU67		ENST00000197268.8:c.1448C>G	12.37:g.13224254C>G	ENSP00000197268:p.Thr483Ser		Q49AF2|Q5CZ81|Q6ZUV7|Q9P261	Missense_Mutation	SNP	ENST00000197268.8	37	CCDS31750.1	.	.	.	.	.	.	.	.	.	.	c	8.717	0.913392	0.17907	.	.	ENSG00000084444	ENST00000197268;ENST00000537625	T	0.35048	1.33	5.45	1.48	0.22813	.	0.561062	0.20863	N	0.084310	T	0.20333	0.0489	L	0.41236	1.265	0.24042	N	0.996071	B	0.18610	0.029	B	0.16289	0.015	T	0.20240	-1.0281	10	0.07990	T	0.79	-10.7065	3.8871	0.09103	0.0:0.4793:0.1897:0.331	.	483	A2RU67	K1467_HUMAN	S	483;259	ENSP00000197268:T483S	ENSP00000197268:T483S	T	+	2	0	KIAA1467	13115521	0.768000	0.28519	0.931000	0.37212	0.682000	0.39822	0.865000	0.27940	0.640000	0.30582	0.558000	0.71614	ACC		0.527	KIAA1467-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401007.1		NM_020853	
KIAA2026	158358	hgsc.bcm.edu;ucsc.edu	37	9	5968196	5968196	+	Nonsense_Mutation	SNP	T	T	A			TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr9:5968196T>A	ENST00000399933.3	-	3	2034	c.2035A>T	c.(2035-2037)Aaa>Taa	p.K679*	KIAA2026_ENST00000381461.2_Nonsense_Mutation_p.K679*	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	679	Lys-rich.									breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		GCCCTCATTTTAGTTAGTTTG	0.343																																																	0													62.0	56.0	58.0					9																	5968196		1806	4070	5876	SO:0001587	stop_gained	158358			AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.2035A>T	9.37:g.5968196T>A	ENSP00000382815:p.Lys679*		A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Nonsense_Mutation	SNP	ENST00000399933.3	37		.	.	.	.	.	.	.	.	.	.	T	37	6.104943	0.97286	.	.	ENSG00000183354	ENST00000399933;ENST00000381461;ENST00000513355	.	.	.	5.88	5.88	0.94601	.	0.113470	0.36972	U	0.002310	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.2851	0.82714	0.0:0.0:0.0:1.0	.	.	.	.	X	679;679;612	.	ENSP00000370870:K679X	K	-	1	0	KIAA2026	5958196	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.897000	0.69831	2.252000	0.74401	0.402000	0.26972	AAA		0.343	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051652.2		NM_001017969	
KLHL5	51088	hgsc.bcm.edu;ucsc.edu	37	4	39116919	39116919	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr4:39116919C>T	ENST00000504108.1	+	10	2463	c.2180C>T	c.(2179-2181)gCt>gTt	p.A727V	RP11-360F5.1_ENST00000509449.1_RNA|KLHL5_ENST00000261425.3_Missense_Mutation_p.A681V|KLHL5_ENST00000261426.5_Missense_Mutation_p.A666V|KLHL5_ENST00000359687.2_Missense_Mutation_p.A727V|KLHL5_ENST00000381930.3_Missense_Mutation_p.A727V|KLHL5_ENST00000508137.2_Missense_Mutation_p.A540V	NM_015990.4	NP_057074.3	Q96PQ7	KLHL5_HUMAN	kelch-like family member 5	727						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(3)|kidney(1)|large_intestine(11)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	29						ACTGTGGAGGCTTATGATCCC	0.408																																																	0													103.0	92.0	96.0					4																	39116919		2203	4300	6503	SO:0001583	missense	51088			AF272976	CCDS3449.1, CCDS33974.1, CCDS33975.1, CCDS54756.1	4p15.1	2013-01-30	2013-01-30		ENSG00000109790	ENSG00000109790		"""Kelch-like"", ""BTB/POZ domain containing"""	6356	protein-coding gene	gene with protein product		608064	"""kelch (Drosophila)-like 5"", ""kelch-like 5 (Drosophila)"""			11590829, 14672410	Standard	NM_001007075		Approved		uc003gtp.3	Q96PQ7	OTTHUMG00000097819	ENST00000504108.1:c.2180C>T	4.37:g.39116919C>T	ENSP00000423897:p.Ala727Val		A8K170|B7WP68|E9PCF4|F8WAE7|G3XA92|Q6Y881|Q86XW0|Q9NUK3|Q9NV27|Q9NVA9|Q9Y2X2	Missense_Mutation	SNP	ENST00000504108.1	37	CCDS33974.1	.	.	.	.	.	.	.	.	.	.	C	16.97	3.267776	0.59540	.	.	ENSG00000109790	ENST00000544221;ENST00000261425;ENST00000508137;ENST00000504108;ENST00000359687;ENST00000381930;ENST00000261426;ENST00000546147	T;T;T;T;T;T	0.75260	-0.92;-0.92;-0.92;-0.92;-0.92;-0.92	6.06	6.06	0.98353	Kelch-type beta propeller (1);	0.044840	0.85682	D	0.000000	T	0.64494	0.2603	N	0.02296	-0.605	0.80722	D	1	P;P;P	0.52463	0.523;0.582;0.953	P;P;P	0.55087	0.535;0.768;0.657	T	0.64266	-0.6448	10	0.10377	T	0.69	.	20.6208	0.99490	0.0:1.0:0.0:0.0	.	666;727;727	F8WAE7;Q96PQ7;Q96PQ7-2	.;KLHL5_HUMAN;.	V	761;681;540;727;727;727;666;321	ENSP00000261425:A681V;ENSP00000423080:A540V;ENSP00000423897:A727V;ENSP00000352716:A727V;ENSP00000371355:A727V;ENSP00000261426:A666V	ENSP00000261425:A681V	A	+	2	0	KLHL5	38793314	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.629000	0.83207	2.882000	0.98803	0.655000	0.94253	GCT		0.408	KLHL5-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000360604.1			
MASP1	5648	hgsc.bcm.edu;ucsc.edu	37	3	186937985	186937985	+	Silent	SNP	G	G	A			TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr3:186937985G>A	ENST00000337774.5	-	16	2363	c.1974C>T	c.(1972-1974)ggC>ggT	p.G658G		NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)	658	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		GGTACCACTGGCCTCTTTCTC	0.532											OREG0015972	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													91.0	85.0	87.0					3																	186937985		2203	4300	6503	SO:0001819	synonymous_variant	5648			D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.1974C>T	3.37:g.186937985G>A		2011	A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Silent	SNP	ENST00000337774.5	37	CCDS33907.1																																																																																				0.532	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344262.1		NM_001879	
MMP10	4319	hgsc.bcm.edu;ucsc.edu	37	11	102650297	102650297	+	Silent	SNP	G	G	A	rs140654514	byFrequency	TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr11:102650297G>A	ENST00000279441.4	-	2	321	c.285C>T	c.(283-285)gaC>gaT	p.D95D		NM_002425.2	NP_002416.1	P09238	MMP10_HUMAN	matrix metallopeptidase 10 (stromelysin 2)	95					collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)|regulation of cell migration (GO:0030334)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|liver(2)|lung(6)	22	all_epithelial(12;0.00961)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0303)|Lung(13;0.0828)|all cancers(10;0.116)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0145)	Marimastat(DB00786)	AGTGACCAACGTCAGGAACTC	0.483													G|||	2	0.000399361	0.0	0.0029	5008	,	,		18750	0.0		0.0	False		,,,				2504	0.0																0								G		3,4403	6.2+/-15.9	0,3,2200	109.0	89.0	96.0		285	-7.6	0.0	11	dbSNP_134	96	0,8598		0,0,4299	no	coding-synonymous	MMP10	NM_002425.2		0,3,6499	AA,AG,GG		0.0,0.0681,0.0231		95/477	102650297	3,13001	2203	4299	6502	SO:0001819	synonymous_variant	4319			X07820	CCDS8321.1	11q22.3	2008-02-05	2005-08-08		ENSG00000166670	ENSG00000166670	3.4.24.22		7156	protein-coding gene	gene with protein product		185260	"""matrix metalloproteinase 10 (stromelysin 2)"""	STMY2			Standard	NM_002425		Approved		uc001phg.2	P09238	OTTHUMG00000168083	ENST00000279441.4:c.285C>T	11.37:g.102650297G>A			B2R9X9|Q53HH9	Silent	SNP	ENST00000279441.4	37	CCDS8321.1																																																																																				0.483	MMP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398014.1			
MYH11	4629	hgsc.bcm.edu;ucsc.edu	37	16	15932004	15932004	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr16:15932004C>G	ENST00000300036.5	-	2	215	c.106G>C	c.(106-108)Gtc>Ctc	p.V36L	MYH11_ENST00000396324.3_Missense_Mutation_p.V36L|MYH11_ENST00000576790.2_Missense_Mutation_p.V36L|MYH11_ENST00000452625.2_Missense_Mutation_p.V36L	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	36					axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						GGGACCCAGACGAGTCTCTTG	0.572			T	CBFB	AML																																			Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	0													107.0	108.0	108.0					16																	15932004		2197	4300	6497	SO:0001583	missense	4629			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.106G>C	16.37:g.15932004C>G	ENSP00000300036:p.Val36Leu		D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	ENST00000300036.5	37	CCDS10565.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.041683	0.93685	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	D;D;D;D	0.88277	-2.36;-2.36;-2.36;-2.36	5.82	5.82	0.92795	Myosin, N-terminal, SH3-like (1);	0.000000	0.64402	D	0.000001	D	0.96200	0.8761	M	0.93594	3.435	0.80722	D	1	D;D;D;D;D	0.76494	0.982;0.999;0.999;0.999;0.999	P;D;D;D;D	0.91635	0.708;0.999;0.999;0.999;0.999	D	0.96621	0.9459	10	0.72032	D	0.01	.	19.0811	0.93182	0.0:1.0:0.0:0.0	.	36;36;36;36;36	Q4G140;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;MYH11_HUMAN;.;.;.	L	36	ENSP00000300036:V36L;ENSP00000345136:V36L;ENSP00000379616:V36L;ENSP00000407821:V36L	ENSP00000300036:V36L	V	-	1	0	MYH11	15839505	1.000000	0.71417	0.989000	0.46669	0.861000	0.49209	7.776000	0.85560	2.756000	0.94617	0.561000	0.74099	GTC		0.572	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2		NM_001040113	
NRBP1	29959	hgsc.bcm.edu;ucsc.edu	37	2	27663325	27663325	+	Silent	SNP	C	C	T			TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr2:27663325C>T	ENST00000233557.3	+	13	1924	c.1092C>T	c.(1090-1092)gcC>gcT	p.A364A	KRTCAP3_ENST00000288873.3_5'Flank|NRBP1_ENST00000379863.3_Silent_p.A372A|NRBP1_ENST00000379852.3_Silent_p.A364A|KRTCAP3_ENST00000407293.1_5'Flank|KRTCAP3_ENST00000543753.1_5'Flank			Q9UHY1	NRBP_HUMAN	nuclear receptor binding protein 1	364					ER to Golgi vesicle-mediated transport (GO:0006888)|gene expression (GO:0010467)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell projection (GO:0042995)|endomembrane system (GO:0012505)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19	Acute lymphoblastic leukemia(172;0.155)					ATACTAGTGCCGTACTGGCTG	0.488																																																	0													105.0	101.0	102.0					2																	27663325		2203	4300	6503	SO:0001819	synonymous_variant	29959			AF113249	CCDS1753.1	2p23	2008-02-05	2005-12-22	2005-12-22	ENSG00000115216	ENSG00000115216			7993	protein-coding gene	gene with protein product		606010	"""nuclear receptor binding protein"""	NRBP		10843813, 11956649	Standard	NM_013392		Approved	BCON3, MUDPNP, MADM	uc002rkp.3	Q9UHY1	OTTHUMG00000097789	ENST00000233557.3:c.1092C>T	2.37:g.27663325C>T			B3KV40|D6W558|Q53FZ5|Q96SU3	Silent	SNP	ENST00000233557.3	37	CCDS1753.1																																																																																				0.488	NRBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215033.1		NM_013392	
NFE2L2	4780	hgsc.bcm.edu;ucsc.edu	37	2	178098945	178098945	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	PGM			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr2:178098945G>C	ENST00000397062.3	-	2	654	c.100C>G	c.(100-102)Cga>Gga	p.R34G	NFE2L2_ENST00000423513.1_Missense_Mutation_p.R18G|NFE2L2_ENST00000446151.2_Missense_Mutation_p.R18G|NFE2L2_ENST00000464747.1_Missense_Mutation_p.R18G|NFE2L2_ENST00000397063.4_Missense_Mutation_p.R18G	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	34					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R34G(4)		central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			AATACTTCTCGACTTACTCCA	0.368			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																														Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	4	Substitution - Missense(4)	lung(2)|endometrium(2)											75.0	68.0	70.0					2																	178098945		1847	4103	5950	SO:0001583	missense	4780				CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.100C>G	2.37:g.178098945G>C	ENSP00000380252:p.Arg34Gly		B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	ENST00000397062.3	37	CCDS42782.1	.	.	.	.	.	.	.	.	.	.	G	16.68	3.190279	0.58017	.	.	ENSG00000116044	ENST00000397063;ENST00000397062;ENST00000446151;ENST00000449627;ENST00000448782;ENST00000421929;ENST00000423513	T;T;T;T;T;T;T	0.33438	1.41;1.41;1.41;1.41;1.41;1.41;1.41	5.78	2.87	0.33458	.	0.000000	0.85682	D	0.000000	T	0.60011	0.2236	M	0.86740	2.835	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.995;0.998;0.998	T	0.66862	-0.5816	10	0.72032	D	0.01	.	14.8506	0.70295	0.0:0.0:0.6243:0.3757	.	18;18;18;34	E9PGJ7;B4DNB0;C9JFL6;Q16236	.;.;.;NF2L2_HUMAN	G	18;34;18;18;18;18;18	ENSP00000380253:R18G;ENSP00000380252:R34G;ENSP00000411575:R18G;ENSP00000391590:R18G;ENSP00000400073:R18G;ENSP00000412191:R18G;ENSP00000410015:R18G	ENSP00000380252:R34G	R	-	1	2	NFE2L2	177807191	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.376000	0.73141	0.300000	0.22699	0.563000	0.77884	CGA		0.368	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257752.4		NM_006164	
OGT	8473	hgsc.bcm.edu	37	X	70775921	70775921	+	Missense_Mutation	SNP	C	C	A	rs267606503		TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chrX:70775921C>A	ENST00000373719.3	+	8	1259	c.1042C>A	c.(1042-1044)Cgc>Agc	p.R348S	OGT_ENST00000373701.3_Missense_Mutation_p.R338S	NM_181672.2|NM_181673.2	NP_858058.1|NP_858059.1	O15294	OGT1_HUMAN	O-linked N-acetylglucosamine (GlcNAc) transferase	348					apoptotic process (GO:0006915)|cellular response to retinoic acid (GO:0071300)|chromatin organization (GO:0006325)|circadian regulation of gene expression (GO:0032922)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of protein ubiquitination (GO:0031397)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of catalytic activity (GO:0043085)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of histone H3-K27 methylation (GO:0061087)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glycolytic process (GO:0006110)|regulation of insulin receptor signaling pathway (GO:0046626)|regulation of Rac protein signal transduction (GO:0035020)|response to insulin (GO:0032868)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone acetyltransferase complex (GO:0000123)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)|MLL5-L complex (GO:0070688)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	acetylglucosaminyltransferase activity (GO:0008375)|enzyme activator activity (GO:0008047)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein N-acetylglucosaminyltransferase activity (GO:0016262)|protein O-GlcNAc transferase activity (GO:0097363)			breast(6)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|liver(3)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Renal(35;0.156)					AGAGGCAGTTCGCTTGTATCG	0.438																																																	0													158.0	122.0	134.0					X																	70775921		2203	4300	6503	SO:0001583	missense	8473			U77413	CCDS14414.1, CCDS35502.1	Xq13	2013-07-24	2012-05-04		ENSG00000147162	ENSG00000147162	2.4.1.255	"""Tetratricopeptide (TTC) repeat domain containing"""	8127	protein-coding gene	gene with protein product	"""UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase"""	300255	"""O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase)"""			9083068	Standard	NM_181672		Approved	O-GLCNAC, HRNT1, MGC22921, FLJ23071	uc004eaa.2	O15294	OTTHUMG00000033316	ENST00000373719.3:c.1042C>A	X.37:g.70775921C>A	ENSP00000362824:p.Arg348Ser		Q7Z3K0|Q8WWM8|Q96CC1|Q9UG57	Missense_Mutation	SNP	ENST00000373719.3	37	CCDS14414.1	.	.	.	.	.	.	.	.	.	.	C	13.69	2.313550	0.40996	.	.	ENSG00000147162	ENST00000373719;ENST00000373701	T;T	0.59502	0.26;0.26	5.16	5.16	0.70880	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.050374	0.85682	D	0.000000	T	0.53190	0.1781	L	0.56396	1.775	0.80722	D	1	B;B;B	0.31817	0.341;0.034;0.271	B;B;B	0.36666	0.142;0.028;0.23	T	0.47341	-0.9125	10	0.08837	T	0.75	-2.2586	13.4978	0.61436	0.1563:0.8437:0.0:0.0	.	222;338;348	Q548W1;O15294-3;O15294	.;.;OGT1_HUMAN	S	348;338	ENSP00000362824:R348S;ENSP00000362805:R338S	ENSP00000362805:R338S	R	+	1	0	OGT	70692646	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.783000	0.68982	2.385000	0.81259	0.600000	0.82982	CGC		0.438	OGT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000081829.3		NM_003605, NM_181672	
PLCH2	9651	hgsc.bcm.edu	37	1	2421272	2421272	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr1:2421272A>T	ENST00000419816.2	+	10	1755	c.1481A>T	c.(1480-1482)gAg>gTg	p.E494V	RP3-395M20.2_ENST00000424657.1_RNA|PLCH2_ENST00000449969.1_Missense_Mutation_p.E467V|PLCH2_ENST00000288766.5_Intron|PLCH2_ENST00000378486.3_Missense_Mutation_p.E494V|PLCH2_ENST00000378488.3_Missense_Mutation_p.E494V			O75038	PLCH2_HUMAN	phospholipase C, eta 2	494					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(3)|skin(1)	20	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)		AGTGCTGATGAGATTGACGAT	0.612																																																	0													126.0	137.0	133.0					1																	2421272		2186	4287	6473	SO:0001583	missense	9651			AB007919	CCDS59959.1	1p36.32	2013-01-10	2006-03-16	2006-03-16	ENSG00000149527	ENSG00000149527	3.1.4.11	"""EF-hand domain containing"""	29037	protein-coding gene	gene with protein product		612836	"""phospholipase C-like 4"""	PLCL4		15899900	Standard	XM_006711054		Approved	KIAA0450, PLCeta2, RP3-395M20.1, PLC-eta2	uc001aji.1	O75038	OTTHUMG00000000719	ENST00000419816.2:c.1481A>T	1.37:g.2421272A>T	ENSP00000389803:p.Glu494Val		A2VCM3|B9DI80|Q3LUA8|Q86XJ2|Q86XU1|Q86YU7|Q8TEH5|Q8WUS6	Missense_Mutation	SNP	ENST00000419816.2	37		.	.	.	.	.	.	.	.	.	.	A	24.5	4.541373	0.85917	.	.	ENSG00000149527	ENST00000449969;ENST00000378486;ENST00000378488;ENST00000343889;ENST00000278878	T;T;T	0.50277	0.75;0.75;0.75	4.84	4.84	0.62591	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (1);	0.576765	0.17258	N	0.180864	T	0.70072	0.3182	M	0.80746	2.51	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.996	D;D;D;D	0.91635	0.979;0.979;0.999;0.937	T	0.74084	-0.3779	10	0.87932	D	0	.	13.9085	0.63850	1.0:0.0:0.0:0.0	.	341;282;467;494	B9DI81;B9DI82;O75038-2;O75038	.;.;.;PLCH2_HUMAN	V	467;494;494;341;282	ENSP00000397289:E467V;ENSP00000367747:E494V;ENSP00000367749:E494V	ENSP00000278878:E282V	E	+	2	0	PLCH2	2411132	1.000000	0.71417	0.953000	0.39169	0.703000	0.40648	7.275000	0.78548	1.940000	0.56252	0.459000	0.35465	GAG		0.612	PLCH2-009	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467514.1		NM_014638	
PNLIPRP2	5408	hgsc.bcm.edu	37	10	118383462	118383463	+	RNA	INS	-	-	A	rs56189579|rs201271480|rs200853665		TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr10:118383462_118383463insA	ENST00000298771.7	+	0	81_82				PNLIPRP2_ENST00000433618.4_RNA|PNLIPRP2_ENST00000537242.1_RNA	NR_103727.1		P54317	LIPR2_HUMAN	pancreatic lipase-related protein 2						galactolipid catabolic process (GO:0019376)|lipid digestion (GO:0044241)|phospholipid catabolic process (GO:0009395)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	acylglycerol lipase activity (GO:0047372)|calcium ion binding (GO:0005509)|galactolipase activity (GO:0047714)|phospholipase activity (GO:0004620)|triglyceride lipase activity (GO:0004806)			endometrium(1)|large_intestine(1)|lung(11)|prostate(3)	16				all cancers(201;0.015)		CCTAGGAAAAGAGTCTGCTACG	0.49																																																	0																																												5408			M93284		10q26.12	2014-03-14				ENSG00000266200	3.1.1.3		9157	protein-coding gene	gene with protein product		604423				1379598	Standard	NM_005396		Approved	PLRP2	uc001lcq.3	P54317			10.37:g.118383463_118383463dupA			A8K627|Q6IB55	Frame_Shift_Ins	INS	ENST00000298771.7	37																																																																																					0.490	PNLIPRP2-004	KNOWN	basic	processed_transcript	polymorphic_pseudogene	OTTHUMT00000050546.6		NM_005396	
POLH	5429	hgsc.bcm.edu;ucsc.edu	37	6	43550779	43550779	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr6:43550779G>T	ENST00000372236.4	+	3	468	c.173G>T	c.(172-174)gGa>gTa	p.G58V	POLH_ENST00000535400.1_5'UTR|POLH_ENST00000372226.1_Missense_Mutation_p.G58V	NM_006502.2	NP_006493.1	O75417	DPOLQ_HUMAN	polymerase (DNA directed), eta	0					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			breast(4)|endometrium(5)|kidney(1)|large_intestine(6)|lung(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	21	all_cancers(18;1.89e-05)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000753)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0826)|OV - Ovarian serous cystadenocarcinoma(102;0.167)			CGTGCATTTGGAGTCACTAGA	0.388								DNA polymerases (catalytic subunits)	Xeroderma Pigmentosum																																								0													114.0	97.0	103.0					6																	43550779		2203	4300	6503	SO:0001583	missense	5429	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	AB024313	CCDS4902.1	6p21	2014-09-17			ENSG00000170734	ENSG00000170734			9181	protein-coding gene	gene with protein product		603968				10385124, 10398605	Standard	NM_006502		Approved	RAD30A, XP-V	uc003ovq.4	Q9Y253	OTTHUMG00000014743	ENST00000372236.4:c.173G>T	6.37:g.43550779G>T	ENSP00000361310:p.Gly58Val		O95160|Q6VMB5	Missense_Mutation	SNP	ENST00000372236.4	37	CCDS4902.1	.	.	.	.	.	.	.	.	.	.	G	32	5.175943	0.94846	.	.	ENSG00000170734	ENST00000372236;ENST00000372226	D;D	0.94793	-3.52;-3.52	6.17	6.17	0.99709	DNA-repair protein, UmuC-like, N-terminal (1);DNA-repair protein, UmuC-like (1);	0.000000	0.85682	D	0.000000	D	0.98510	0.9503	H	0.97186	3.955	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98797	1.0738	10	0.87932	D	0	-8.8694	20.4745	0.99168	0.0:0.0:1.0:0.0	.	58	Q9Y253	POLH_HUMAN	V	58	ENSP00000361310:G58V;ENSP00000361300:G58V	ENSP00000361300:G58V	G	+	2	0	POLH	43658757	1.000000	0.71417	0.988000	0.46212	0.990000	0.78478	8.568000	0.90741	2.941000	0.99782	0.655000	0.94253	GGA		0.388	POLH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040666.1		NM_006502	
PRKCD	5580	hgsc.bcm.edu	37	3	53219628	53219628	+	Silent	SNP	C	C	T			TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr3:53219628C>T	ENST00000394729.2	+	10	1225	c.897C>T	c.(895-897)tcC>tcT	p.S299S	PRKCD_ENST00000330452.3_Silent_p.S299S	NM_212539.1	NP_997704.1	Q05655	KPCD_HUMAN	protein kinase C, delta	299					activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular senescence (GO:0090398)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|immunoglobulin mediated immune response (GO:0016064)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-10 production (GO:0032613)|interleukin-12 production (GO:0032615)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|mRNA metabolic process (GO:0016071)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of filopodium assembly (GO:0051490)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein binding (GO:0032091)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil activation (GO:0042119)|peptidyl-threonine phosphorylation (GO:0018107)|platelet activation (GO:0030168)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of ceramide biosynthetic process (GO:2000304)|positive regulation of glucosylceramide catabolic process (GO:2000753)|positive regulation of phospholipid scramblase activity (GO:1900163)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of sphingomyelin catabolic process (GO:2000755)|positive regulation of superoxide anion generation (GO:0032930)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of receptor activity (GO:0010469)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|termination of signal transduction (GO:0023021)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|insulin receptor substrate binding (GO:0043560)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)	p.S299S(1)		breast(1)|central_nervous_system(4)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Ovarian(412;0.0728)		OV - Ovarian serous cystadenocarcinoma(275;3.58e-08)|BRCA - Breast invasive adenocarcinoma(193;0.000142)|Kidney(197;0.00153)|KIRC - Kidney renal clear cell carcinoma(197;0.00173)	Ingenol Mebutate(DB05013)|Tamoxifen(DB00675)	AGAGAGCCTCCCGGAGATCAG	0.572																																																	1	Substitution - coding silent(1)	lung(1)											83.0	92.0	89.0					3																	53219628		2203	4300	6503	SO:0001819	synonymous_variant	5580				CCDS2870.1	3p21.31	2009-07-10			ENSG00000163932	ENSG00000163932	2.7.11.1		9399	protein-coding gene	gene with protein product		176977				8188219	Standard	NM_006254		Approved		uc003dgm.3	Q05655	OTTHUMG00000133659	ENST00000394729.2:c.897C>T	3.37:g.53219628C>T			B0KZ81|B2R834|Q15144|Q86XJ6	Silent	SNP	ENST00000394729.2	37	CCDS2870.1																																																																																				0.572	PRKCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257818.1			
PRPF8	10594	hgsc.bcm.edu	37	17	1584776	1584776	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr17:1584776G>C	ENST00000572621.1	-	5	1127	c.862C>G	c.(862-864)Cta>Gta	p.L288V	PRPF8_ENST00000304992.6_Missense_Mutation_p.L288V			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	288					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		ACTCACTGTAGGTTGATGTCT	0.398																																																	0													182.0	185.0	184.0					17																	1584776		2203	4300	6503	SO:0001583	missense	10594			AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.862C>G	17.37:g.1584776G>C	ENSP00000460348:p.Leu288Val		O14547|O75965	Missense_Mutation	SNP	ENST00000572621.1	37	CCDS11010.1	.	.	.	.	.	.	.	.	.	.	G	8.553	0.875910	0.17395	.	.	ENSG00000174231	ENST00000304992	T	0.79554	-1.28	5.84	3.83	0.44106	.	0.000000	0.85682	D	0.000000	T	0.65207	0.2669	N	0.12961	0.28	0.53005	D	0.999961	B	0.02656	0.0	B	0.04013	0.001	T	0.56583	-0.7955	10	0.30854	T	0.27	.	12.0664	0.53590	0.1865:0.0:0.8135:0.0	.	288	Q6P2Q9	PRP8_HUMAN	V	288	ENSP00000304350:L288V	ENSP00000304350:L288V	L	-	1	2	PRPF8	1531526	1.000000	0.71417	0.978000	0.43139	0.485000	0.33311	5.395000	0.66291	0.791000	0.33826	0.650000	0.86243	CTA		0.398	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438412.2			
PRX	57716	hgsc.bcm.edu	37	19	40902613	40902613	+	Missense_Mutation	SNP	G	G	A	rs150582069		TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr19:40902613G>A	ENST00000324001.7	-	7	1916	c.1646C>T	c.(1645-1647)cCg>cTg	p.P549L	PRX_ENST00000291825.7_3'UTR	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin	549	55 X 5 AA approximate tandem repeats of [LVMAG]-[PSREQC]-[EDKL]-[LIVMAP]- [AQKHRPE]; that may have a tripeptide spacer of [LV]-P-[KER].				axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.E545_P549delEVQLP(1)|p.P549Q(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			TGACACTTTCGGCAGCTGTAC	0.577													g|||	1	0.000199681	0.0	0.0	5008	,	,		16952	0.001		0.0	False		,,,				2504	0.0																2	Substitution - Missense(1)|Deletion - In frame(1)	breast(1)|kidney(1)											88.0	101.0	96.0					19																	40902613		2202	4297	6499	SO:0001583	missense	57716			AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.1646C>T	19.37:g.40902613G>A	ENSP00000326018:p.Pro549Leu		Q9BXL9|Q9HCF2	Missense_Mutation	SNP	ENST00000324001.7	37	CCDS33028.1	.	.	.	.	.	.	.	.	.	.	g	4.883	0.164188	0.09287	.	.	ENSG00000105227	ENST00000324001;ENST00000341562	T	0.03580	3.88	4.14	3.11	0.35812	.	.	.	.	.	T	0.05502	0.0145	M	0.77820	2.39	0.09310	N	0.999996	P	0.40332	0.713	B	0.30401	0.115	T	0.29640	-1.0005	9	0.66056	D	0.02	-6.8118	7.829	0.29332	0.1975:0.0:0.8025:0.0	.	549	Q9BXM0	PRAX_HUMAN	L	549	ENSP00000326018:P549L	ENSP00000326018:P549L	P	-	2	0	PRX	45594453	0.005000	0.15991	0.169000	0.22859	0.015000	0.08874	0.659000	0.24994	0.962000	0.38057	-0.185000	0.12909	CCG		0.577	PRX-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000462582.1		NM_020956	
PUF60	22827	hgsc.bcm.edu;ucsc.edu	37	8	144898831	144898831	+	Silent	SNP	G	G	C	rs367957619		TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr8:144898831G>C	ENST00000526683.1	-	12	2094	c.1539C>G	c.(1537-1539)gtC>gtG	p.V513V	PUF60_ENST00000349157.6_Silent_p.V496V|PUF60_ENST00000453551.2_Silent_p.V470V|PUF60_ENST00000527197.1_Silent_p.V467V|SCRIB_ENST00000356994.2_5'Flank|SCRIB_ENST00000377533.3_5'Flank|PUF60_ENST00000456095.2_Silent_p.V484V|PUF60_ENST00000524570.1_5'Flank|PUF60_ENST00000313352.7_Silent_p.V453V|SCRIB_ENST00000320476.3_5'Flank	NM_001271098.1|NM_078480.2	NP_001258027.1|NP_510965.1	Q9UHX1	PUF60_HUMAN	poly-U binding splicing factor 60KDa	513	Inhibits homodimerization.|Inhibits transcriptional repression, interaction with ERCC3 and apoptosis induction.|RRM 3; atypical. {ECO:0000255|PROSITE- ProRule:PRU00176}.				apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(1)|kidney(3)|lung(7)|prostate(2)	14	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;6.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			CAAAGATCTTGACAATGATTT	0.542																																																	0								G	,,	1,4159		0,1,2079	329.0	347.0	341.0		1410,1488,1539	2.2	1.0	8		341	0,8416		0,0,4208	no	coding-synonymous,coding-synonymous,coding-synonymous	PUF60	NM_001136033.1,NM_014281.3,NM_078480.1	,,	0,1,6287	CC,CG,GG		0.0,0.024,0.0080	,,	470/517,496/543,513/560	144898831	1,12575	2080	4208	6288	SO:0001819	synonymous_variant	22827			AF114818	CCDS47933.1, CCDS47934.1, CCDS47935.1, CCDS59514.1, CCDS59515.1, CCDS59516.1	8q24.3	2013-02-12	2007-07-27		ENSG00000179950	ENSG00000179950		"""RNA binding motif (RRM) containing"""	17042	protein-coding gene	gene with protein product	"""siah binding protein 1"", ""FBP interacting repressor"", ""pyrimidine tract binding splicing factor"", ""Ro ribonucleoprotein binding protein 1"""	604819				10668799, 10882074, 17579712	Standard	NM_078480		Approved	FIR, SIAHBP1, RoBPI	uc003yzs.4	Q9UHX1	OTTHUMG00000165155	ENST00000526683.1:c.1539C>G	8.37:g.144898831G>C			A8K8K8|Q969E7|Q96D94|Q96H63|Q99628|Q9NZA0|Q9UJY7	Silent	SNP	ENST00000526683.1	37	CCDS47934.1																																																																																				0.542	PUF60-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382222.1		NM_014281	
RGS12	6002	hgsc.bcm.edu;ucsc.edu	37	4	3432133	3432133	+	Splice_Site	SNP	G	G	T			TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr4:3432133G>T	ENST00000344733.5	+	17	4469		c.e17-1		RGS12_ENST00000538395.1_Splice_Site|RGS12_ENST00000306648.7_Splice_Site|RGS12_ENST00000336727.3_Splice_Site|RGS12_ENST00000382788.3_Splice_Site|RGS12_ENST00000338806.4_Splice_Site	NM_198229.2	NP_937872.1	O14924	RGS12_HUMAN	regulator of G-protein signaling 12						positive regulation of GTPase activity (GO:0043547)|regulation of catalytic activity (GO:0050790)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|GTPase regulator activity (GO:0030695)|receptor signaling protein activity (GO:0005057)			autonomic_ganglia(1)|breast(4)|endometrium(3)|kidney(2)|large_intestine(9)|lung(16)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TCTTCCAATAGAGTTTTTTGA	0.458																																																	0													106.0	106.0	106.0					4																	3432133		2203	4300	6503	SO:0001630	splice_region_variant	6002			AF035152	CCDS3366.1, CCDS3367.1, CCDS3368.1	4p16.3	2008-02-05	2007-08-14		ENSG00000159788	ENSG00000159788		"""Regulators of G-protein signaling"""	9994	protein-coding gene	gene with protein product		602512	"""regulator of G-protein signalling 12"""			9651375	Standard	NM_198229		Approved		uc003ggw.3	O14924	OTTHUMG00000090277	ENST00000344733.5:c.3566-1G>T	4.37:g.3432133G>T			B1AQ30|B1AQ31|B1AQ32|B7Z764|E7EMN9|O14922|O14923|O43510|O75338|Q147X0|Q8WX95	Splice_Site	SNP	ENST00000344733.5	37	CCDS3366.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.175503	0.78564	.	.	ENSG00000159788	ENST00000344733;ENST00000336727;ENST00000382788;ENST00000306648;ENST00000338806;ENST00000538395	.	.	.	4.76	4.76	0.60689	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.7743	0.85547	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RGS12	3401931	1.000000	0.71417	0.986000	0.45419	0.997000	0.91878	9.405000	0.97313	2.193000	0.70182	0.655000	0.94253	.		0.458	RGS12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206602.1		NM_002926	Intron
RTN3	10313	hgsc.bcm.edu;ucsc.edu	37	11	63486754	63486754	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr11:63486754A>C	ENST00000377819.5	+	3	934	c.780A>C	c.(778-780)gaA>gaC	p.E260D	RTN3_ENST00000537981.1_Intron|RTN3_ENST00000341307.2_Intron|RTN3_ENST00000354497.4_Intron|RTN3_ENST00000356000.3_Intron|RTN3_ENST00000339997.4_Missense_Mutation_p.E241D|RTN3_ENST00000540798.1_Missense_Mutation_p.E148D	NM_001265589.1	NP_001252518.1	O95197	RTN3_HUMAN	reticulon 3	260					apoptotic process (GO:0006915)|endoplasmic reticulum tubular network organization (GO:0071786)|response to stress (GO:0006950)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	20						TTGACAAAGAATTTAAAGACT	0.373																																																	0													73.0	76.0	75.0					11																	63486754		2201	4298	6499	SO:0001583	missense	10313			AF059524	CCDS8048.1, CCDS8049.1, CCDS8050.1, CCDS41664.1, CCDS58141.1, CCDS58142.1, CCDS58143.1	11q13	2011-01-14			ENSG00000133318	ENSG00000133318			10469	protein-coding gene	gene with protein product	"""neuroendocrine-specific protein-like 2"", ""NSP-like protein II"", ""isoforme III"", ""ASY interacting protein"", ""homolog of ASY protein"""	604249				10331947	Standard	NM_006054		Approved	NSPL2, NSPLII, ASYIP, HAP, RTN3-A1	uc001nxq.3	O95197		ENST00000377819.5:c.780A>C	11.37:g.63486754A>C	ENSP00000367050:p.Glu260Asp		B3KQS2|B7Z308|B7Z4M0|F5H774|Q147U9|Q496K2|Q53GN3|Q59EP0|Q5UEP2|Q6T930|Q7RTM7|Q7RTM8|Q7RTN3	Missense_Mutation	SNP	ENST00000377819.5	37	CCDS58141.1	.	.	.	.	.	.	.	.	.	.	A	19.05	3.752416	0.69533	.	.	ENSG00000133318	ENST00000377819;ENST00000339997;ENST00000540798	T;T;T	0.17370	2.28;2.28;2.28	5.98	2.71	0.32032	.	0.247523	0.28409	N	0.015456	T	0.25344	0.0616	L	0.32530	0.975	0.80722	D	1	D;D;D	0.71674	0.998;0.997;0.998	D;D;D	0.77557	0.99;0.978;0.99	T	0.01839	-1.1263	10	0.72032	D	0.01	-24.914	6.2132	0.20642	0.4486:0.0:0.5514:0.0	.	148;260;241	F5H774;O95197;O95197-2	.;RTN3_HUMAN;.	D	260;241;148	ENSP00000367050:E260D;ENSP00000344106:E241D;ENSP00000442733:E148D	ENSP00000344106:E241D	E	+	3	2	RTN3	63243330	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	0.887000	0.28254	0.192000	0.20272	0.482000	0.46254	GAA		0.373	RTN3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000397846.1		NM_006054	
SORL1	6653	hgsc.bcm.edu	37	11	121483478	121483478	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr11:121483478T>C	ENST00000260197.7	+	40	5485	c.5356T>C	c.(5356-5358)Ttt>Ctt	p.F1786L	SORL1_ENST00000527934.1_Missense_Mutation_p.F401L|SORL1_ENST00000534286.1_Missense_Mutation_p.F696L|SORL1_ENST00000525532.1_Missense_Mutation_p.F730L|SORL1_ENST00000532694.1_Missense_Mutation_p.F632L	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	1786	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		TTTCTGGGCATTTGACACCCA	0.468																																																	0													130.0	102.0	112.0					11																	121483478		2202	4299	6501	SO:0001583	missense	6653			Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.5356T>C	11.37:g.121483478T>C	ENSP00000260197:p.Phe1786Leu		B2RNX7|Q92856	Missense_Mutation	SNP	ENST00000260197.7	37	CCDS8436.1	.	.	.	.	.	.	.	.	.	.	T	18.80	3.701702	0.68501	.	.	ENSG00000137642	ENST00000260197;ENST00000525532;ENST00000532694;ENST00000534286;ENST00000527934	T;T;T;T;T	0.52526	0.66;0.66;0.66;0.66;0.66	5.76	5.76	0.90799	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.060398	0.64402	D	0.000003	T	0.52256	0.1723	N	0.14661	0.345	0.58432	D	0.999999	D;P	0.69078	0.997;0.615	D;B	0.70716	0.97;0.219	T	0.58929	-0.7549	10	0.56958	D	0.05	.	15.7457	0.77939	0.0:0.0:0.0:1.0	.	401;1786	E9PKB0;Q92673	.;SORL_HUMAN	L	1786;730;632;696;401	ENSP00000260197:F1786L;ENSP00000434634:F730L;ENSP00000432131:F632L;ENSP00000436447:F696L;ENSP00000435405:F401L	ENSP00000260197:F1786L	F	+	1	0	SORL1	120988688	1.000000	0.71417	0.860000	0.33809	0.868000	0.49771	7.000000	0.76290	2.191000	0.70037	0.533000	0.62120	TTT		0.468	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2		NM_003105	
SPEM1	374768	hgsc.bcm.edu;ucsc.edu	37	17	7324560	7324560	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr17:7324560C>T	ENST00000323675.3	+	3	591	c.566C>T	c.(565-567)cCc>cTc	p.P189L	RP11-104H15.7_ENST00000575310.1_RNA	NM_199339.2	NP_955371.2	Q8N4L4	SPEM1_HUMAN	spermatid maturation 1	189					sperm individualization (GO:0007291)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	12		Prostate(122;0.173)				GAGGAAAGGCCCCTCAAAACA	0.612																																																	0													45.0	50.0	49.0					17																	7324560		1930	4120	6050	SO:0001583	missense	374768			AK097400	CCDS42254.1	17p13.1	2011-12-12	2008-02-04	2008-02-04	ENSG00000181323	ENSG00000181323			32429	protein-coding gene	gene with protein product		615116	"""chromosome 17 open reading frame 83"""	C17orf83		17426145, 20558241, 21184802	Standard	NM_199339		Approved	FLJ40081	uc002ggv.3	Q8N4L4		ENST00000323675.3:c.566C>T	17.37:g.7324560C>T	ENSP00000315554:p.Pro189Leu			Missense_Mutation	SNP	ENST00000323675.3	37	CCDS42254.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.172433	0.78452	.	.	ENSG00000181323	ENST00000323675	.	.	.	5.77	5.77	0.91146	.	0.267510	0.26421	N	0.024475	T	0.54013	0.1832	L	0.34521	1.04	0.22305	N	0.999212	D	0.76494	0.999	D	0.72075	0.976	T	0.50701	-0.8797	9	0.87932	D	0	-11.2291	15.4838	0.75548	0.0:1.0:0.0:0.0	.	189	Q8N4L4	SPEM1_HUMAN	L	189	.	ENSP00000315554:P189L	P	+	2	0	SPEM1	7265284	0.089000	0.21612	0.957000	0.39632	0.037000	0.13140	2.323000	0.43823	2.723000	0.93209	0.655000	0.94253	CCC		0.612	SPEM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440932.1		NM_199339	
SYT17	51760	hgsc.bcm.edu	37	16	19195087	19195087	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr16:19195087T>G	ENST00000355377.2	+	5	967	c.569T>G	c.(568-570)tTc>tGc	p.F190C	SYT17_ENST00000562034.1_Missense_Mutation_p.F129C|SYT17_ENST00000568115.1_Missense_Mutation_p.F129C|SYT17_ENST00000562711.2_Missense_Mutation_p.F186C	NM_016524.2	NP_057608.2	Q9BSW7	SYT17_HUMAN	synaptotagmin XVII	190	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)	membrane (GO:0016020)|synaptic vesicle (GO:0008021)|trans-Golgi network (GO:0005802)	transporter activity (GO:0005215)			NS(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)	17						ATGCTGCACTTCAGCACTCAG	0.612																																																	0													119.0	97.0	104.0					16																	19195087		2197	4300	6497	SO:0001583	missense	51760				CCDS10575.1	16p12.3	2013-01-21			ENSG00000103528	ENSG00000103528		"""Synaptotagmins"""	24119	protein-coding gene	gene with protein product	"""B/K protein"""					10493829	Standard	NM_016524		Approved		uc002dfw.3	Q9BSW7	OTTHUMG00000131461	ENST00000355377.2:c.569T>G	16.37:g.19195087T>G	ENSP00000347538:p.Phe190Cys		O43330|Q9NZ18	Missense_Mutation	SNP	ENST00000355377.2	37	CCDS10575.1	.	.	.	.	.	.	.	.	.	.	t	32	5.187061	0.94923	.	.	ENSG00000103528	ENST00000355377	T	0.09723	2.95	5.38	5.38	0.77491	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.64402	D	0.000001	T	0.37999	0.1024	M	0.85373	2.75	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.77004	0.981;0.989	T	0.38351	-0.9665	10	0.87932	D	0	.	15.3867	0.74706	0.0:0.0:0.0:1.0	.	190;129	Q9BSW7;B4DJB2	SYT17_HUMAN;.	C	190	ENSP00000347538:F190C	ENSP00000347538:F190C	F	+	2	0	SYT17	19102588	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.994000	0.88315	2.026000	0.59711	0.375000	0.23000	TTC		0.612	SYT17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254286.2		NM_016524	
TIMELESS	8914	hgsc.bcm.edu;ucsc.edu	37	12	56814823	56814823	+	Silent	SNP	C	C	G			TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr12:56814823C>G	ENST00000553532.1	-	24	3114	c.2964G>C	c.(2962-2964)ggG>ggC	p.G988G	TIMELESS_ENST00000554616.1_Silent_p.G485G|TIMELESS_ENST00000229201.4_Silent_p.G987G					timeless circadian clock											NS(1)|breast(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(8)|lung(14)|ovary(7)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	49						CTTCTGAGCCCCCTTCTTCTT	0.488																																																	0													131.0	125.0	127.0					12																	56814823		2203	4300	6503	SO:0001819	synonymous_variant	8914			AF098162	CCDS8918.1	12q13.3	2012-12-14	2012-12-14		ENSG00000111602	ENSG00000111602			11813	protein-coding gene	gene with protein product	"""Tof1 homolog (S. cerevisiae)"", ""timeless circadian clock 1"""	603887	"""timeless (Drosophila) homolog"", ""timeless homolog (Drosophila)"""			9856465	Standard	NM_003920		Approved	hTIM, TIM, TIM1	uc001slf.2	Q9UNS1	OTTHUMG00000170600	ENST00000553532.1:c.2964G>C	12.37:g.56814823C>G				Silent	SNP	ENST00000553532.1	37	CCDS8918.1																																																																																				0.488	TIMELESS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409771.1		NM_003920	
TIMM23	100287932	hgsc.bcm.edu;ucsc.edu	37	10	51592504	51592504	+	Nonstop_Mutation	SNP	T	T	C			TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr10:51592504T>C	ENST00000260867.4	-	7	753	c.630A>G	c.(628-630)tgA>tgG	p.*210W	TIMM23_ENST00000485812.1_5'UTR|TIMM23_ENST00000374064.3_Nonstop_Mutation_p.*162W|TIMM23_ENST00000374065.3_Nonstop_Mutation_p.*173W	NM_006327.3	NP_006318.1	O14925	TIM23_HUMAN	translocase of inner mitochondrial membrane 23 homolog (yeast)	0					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial inner membrane (GO:0005743)|mitochondrial inner membrane presequence translocase complex (GO:0005744)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)	P-P-bond-hydrolysis-driven protein transmembrane transporter activity (GO:0015450)			endometrium(1)|large_intestine(1)|pancreas(1)	3						GGCAAAATCTTCAGAGTGACT	0.418																																																	0													131.0	125.0	127.0					10																	51592504		2203	4300	6503	SO:0001578	stop_lost	100287932			AF030162	CCDS73091.1	10q11.21-q11.23	2010-03-17			ENSG00000138297				17312	protein-coding gene	gene with protein product		605034				10339406	Standard	NM_006327		Approved	TIM23	uc010qha.2	O14925	OTTHUMG00000018213	ENST00000260867.4:c.630A>G	10.37:g.51592504T>C	ENSP00000260867:p.*210Cysext*40		Q53FF8|Q5T1E6|Q6P5S5	Missense_Mutation	SNP	ENST00000260867.4	37	CCDS7238.1	.	.	.	.	.	.	.	.	.	.	T	16.54	3.152810	0.57259	.	.	ENSG00000138297	ENST00000260867;ENST00000374064;ENST00000374065	.	.	.	5.55	4.4	0.53042	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.7274	0.51716	0.0:0.0777:0.0:0.9223	.	.	.	.	W	210;162;173	.	.	X	-	3	0	TIMM23	51262510	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	3.968000	0.56809	2.326000	0.78906	0.533000	0.62120	TGA		0.418	TIMM23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048040.1		NM_006327.2	
TNS4	84951	hgsc.bcm.edu	37	17	38652467	38652467	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr17:38652467G>T	ENST00000254051.6	-	2	369	c.211C>A	c.(211-213)Cag>Aag	p.Q71K		NM_032865.5	NP_116254.4	Q8IZW8	TENS4_HUMAN	tensin 4	71					apoptotic process (GO:0006915)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	30		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			GCCTCCACCTGTGGGGCTTGC	0.647																																																	0													41.0	43.0	43.0					17																	38652467		2203	4300	6503	SO:0001583	missense	84951			AF417488	CCDS11368.1	17q21.2	2013-02-14			ENSG00000131746	ENSG00000131746		"""SH2 domain containing"""	24352	protein-coding gene	gene with protein product	"""C terminal tensin like"""	608385				12154022, 12711115	Standard	NM_032865		Approved	CTEN	uc010cxb.3	Q8IZW8	OTTHUMG00000133330	ENST00000254051.6:c.211C>A	17.37:g.38652467G>T	ENSP00000254051:p.Gln71Lys		A6NMJ7|Q71RB7|Q8WV64|Q96JV4	Missense_Mutation	SNP	ENST00000254051.6	37	CCDS11368.1	.	.	.	.	.	.	.	.	.	.	G	7.940	0.742630	0.15642	.	.	ENSG00000131746	ENST00000377816;ENST00000254051	T	0.17528	2.27	5.43	3.33	0.38152	.	7.203950	0.00166	N	0.000000	T	0.15219	0.0367	L	0.29908	0.895	0.09310	N	1	B	0.19331	0.035	B	0.19946	0.027	T	0.38564	-0.9655	10	0.06099	T	0.92	-6.739	12.596	0.56470	0.0:0.3154:0.6846:0.0	.	71	Q8IZW8	TENS4_HUMAN	K	71	ENSP00000254051:Q71K	ENSP00000254051:Q71K	Q	-	1	0	TNS4	35905993	0.017000	0.18338	0.519000	0.27824	0.163000	0.22366	1.335000	0.33839	1.251000	0.43983	0.637000	0.83480	CAG		0.647	TNS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257154.3		NM_032865	
TRIM22	10346	hgsc.bcm.edu;ucsc.edu	37	11	5717667	5717667	+	Nonsense_Mutation	SNP	C	C	T	rs199731307		TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr11:5717667C>T	ENST00000379965.3	+	2	482	c.205C>T	c.(205-207)Cga>Tga	p.R69*	TRIM5_ENST00000380027.1_Intron	NM_001199573.1|NM_006074.4	NP_001186502.1|NP_006065.2	Q8IYM9	TRI22_HUMAN	tripartite motif containing 22	69					defense response to virus (GO:0051607)|immune response (GO:0006955)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein trimerization (GO:0070206)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			kidney(3)|large_intestine(8)|lung(9)|prostate(1)|stomach(2)	23		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;7.54e-09)|BRCA - Breast invasive adenocarcinoma(625;0.14)		TGGGAACCTCCGACCTAATCG	0.522													C|||	1	0.000199681	0.0	0.0	5008	,	,		20783	0.0		0.0	False		,,,				2504	0.001				GBM(104;491 2336 5222)												0								C	stop/ARG,stop/ARG	0,4392		0,0,2196	74.0	79.0	77.0		205,205	-7.9	0.0	11		77	2,8590	2.2+/-6.3	0,2,4294	yes	stop-gained,stop-gained	TRIM22	NM_001199573.1,NM_006074.4	,	0,2,6490	TT,TC,CC		0.0233,0.0,0.0154	,	69/495,69/499	5717667	2,12982	2196	4296	6492	SO:0001587	stop_gained	10346			X82200	CCDS41612.1	11p15	2013-01-09	2011-01-25		ENSG00000132274	ENSG00000132274		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16379	protein-coding gene	gene with protein product		606559	"""tripartite motif-containing 22"""			11331580, 11096452	Standard	NM_006074		Approved	STAF50, GPSTAF50, RNF94	uc001mbr.3	Q8IYM9	OTTHUMG00000066904	ENST00000379965.3:c.205C>T	11.37:g.5717667C>T	ENSP00000369299:p.Arg69*		Q05CQ0|Q15521	Nonsense_Mutation	SNP	ENST00000379965.3	37	CCDS41612.1	.	.	.	.	.	.	.	.	.	.	C	32	5.159688	0.94727	0.0	2.33E-4	ENSG00000132274	ENST00000379965;ENST00000425490;ENST00000454828;ENST00000414641;ENST00000455293	.	.	.	4.82	-7.95	0.01148	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.0002	0.14261	0.4655:0.2625:0.0:0.272	.	.	.	.	X	69	.	ENSP00000369299:R69X	R	+	1	2	TRIM22	5674243	0.000000	0.05858	0.000000	0.03702	0.301000	0.27625	-3.011000	0.00647	-1.941000	0.01042	0.467000	0.42956	CGA		0.522	TRIM22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143387.2		NM_006074	
USP17L2	377630	hgsc.bcm.edu	37	8	11995987	11995987	+	Silent	SNP	G	G	A	rs3988861	byFrequency	TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr8:11995987G>A	ENST00000333796.3	-	1	599	c.283C>T	c.(283-285)Ctg>Ttg	p.L95L	FAM66D_ENST00000434078.2_RNA	NM_001256869.1|NM_001256871.1|NM_001256872.1|NM_001256873.1|NM_001256874.1|NM_201402.2	NP_001243798.1|NP_001243800.1|NP_001243801.1|NP_001243802.1|NP_001243803.1|NP_958804.2	Q6R6M4	U17L2_HUMAN	ubiquitin specific peptidase 17-like family member 2	95	USP.				apoptotic process (GO:0006915)|CAAX-box protein processing (GO:0071586)|cell cycle checkpoint (GO:0000075)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of histone deacetylation (GO:0031064)|negative regulation of protein processing (GO:0010955)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of Ras GTPase activity (GO:0034261)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of RIG-I signaling pathway (GO:1900246)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of apoptotic process (GO:0042981)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of defense response to virus by host (GO:0050691)|regulation of ruffle assembly (GO:1900027)|ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.L95L(1)		central_nervous_system(1)|kidney(1)|large_intestine(11)|liver(1)|lung(8)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	29						AGGCACTGCAGGGAAGCGTTC	0.567																																																	1	Substitution - coding silent(1)	skin(1)											35.0	42.0	40.0					8																	11995987		1440	2909	4349	SO:0001819	synonymous_variant	377630			BC156290	CCDS43713.1	8p23.1	2012-10-09	2012-10-09		ENSG00000223443	ENSG00000223443			34434	protein-coding gene	gene with protein product	"""deubiquitinating enzyme 3"""	610186	"""ubiquitin specific peptidase 17-like 2"""				Standard	NM_201402		Approved	DUB3	uc003wvc.1	Q6R6M4	OTTHUMG00000165295	ENST00000333796.3:c.283C>T	8.37:g.11995987G>A				Silent	SNP	ENST00000333796.3	37	CCDS43713.1																																																																																				0.567	USP17L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383303.2		NM_201402	
ZNF292	23036	hgsc.bcm.edu	37	6	87966157	87966157	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr6:87966157T>A	ENST00000369577.3	+	8	2853	c.2810T>A	c.(2809-2811)gTg>gAg	p.V937E	ZNF292_ENST00000339907.4_Missense_Mutation_p.V932E	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	937						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		GAAGTAGCTGTGTCCATTAAG	0.453																																																	0													78.0	74.0	75.0					6																	87966157		1908	4122	6030	SO:0001583	missense	23036			AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.2810T>A	6.37:g.87966157T>A	ENSP00000358590:p.Val937Glu		Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Missense_Mutation	SNP	ENST00000369577.3	37	CCDS47457.1	.	.	.	.	.	.	.	.	.	.	T	6.209	0.406629	0.11754	.	.	ENSG00000188994	ENST00000369577;ENST00000339907	T;T	0.07114	3.22;3.23	5.55	4.18	0.49190	.	0.558633	0.17067	N	0.188334	T	0.02047	0.0064	N	0.19112	0.55	0.32882	D	0.510642	P	0.34462	0.454	B	0.24394	0.053	T	0.44877	-0.9299	10	0.45353	T	0.12	.	12.0058	0.53259	0.0:0.0789:0.0:0.9211	.	937	O60281	ZN292_HUMAN	E	937;932	ENSP00000358590:V937E;ENSP00000342847:V932E	ENSP00000342847:V932E	V	+	2	0	ZNF292	88022876	0.993000	0.37304	1.000000	0.80357	0.986000	0.74619	1.797000	0.38804	2.111000	0.64477	0.482000	0.46254	GTG		0.453	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376192.2		NM_015021	
SETD2	29072	ucsc.edu	37	3	47059132	47059132	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	C	C	C	G	C	C	Unknown	Valid	Somatic	.	WXS	PGM	.		SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chr3:47059132C>G	ENST00000409792.3	-	20	7571	c.7529G>C	c.(7528-7530)cGc>cCc	p.R2510P		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2510	Interaction with POLR2A.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)	p.R2510H(1)|p.R2007H(1)		breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		GAGTACCTTGCGAGCCAGATG	0.453			"""N, F, S, Mis"""		clear cell renal carcinoma																																	.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	2	Substitution - Missense(2)	kidney(2)											125.0	102.0	110.0					3																	47059132		2203	4300	6503	SO:0001583	missense	29072			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.7529G>C	3.37:g.47059132C>G	ENSP00000386759:p.Arg2510Pro		O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	37	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	C	26.2	4.716824	0.89205	.	.	ENSG00000181555	ENST00000451092;ENST00000409792	D	0.93133	-3.17	5.44	5.44	0.79542	SRI, Set2 Rpb1 interacting (1);	0.000000	0.56097	D	0.000037	D	0.96549	0.8874	M	0.76574	2.34	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.87578	0.988;0.998	D	0.96652	0.9482	10	0.87932	D	0	.	18.2031	0.89846	0.0:1.0:0.0:0.0	.	2510;2510	F2Z317;Q9BYW2	.;SETD2_HUMAN	P	2510	ENSP00000386759:R2510P	ENSP00000386759:R2510P	R	-	2	0	SETD2	47034136	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.390000	0.79816	2.837000	0.97791	0.655000	0.94253	CGC		0.453	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2		NM_014159	
KDM5C	8242	ucsc.edu	37	X	53222653	53222656	+	Frame_Shift_Del	DEL	GGCT	GGCT	-			TCGA-B0-4837-01A-01D-1373-10	TCGA-B0-4837-11A-01D-1373-10	GGCT	GGCT	GGCT	-	GGCT	GGCT	Unknown	Valid	Somatic	.	WXS	PGM	.		SOLID	078b4a67-3a8a-40f4-928c-768fa3c91450	05cbbbd4-67af-4685-b4d8-80ebe715333c	g.chrX:53222653_53222656delGGCT	ENST00000375401.3	-	25	4812_4815	c.4280_4283delAGCC	c.(4279-4284)cagcccfs	p.QP1427fs	KDM5C_ENST00000375379.3_Frame_Shift_Del_p.QP1424fs|KDM5C_ENST00000452825.3_Intron|KDM5C_ENST00000375383.3_Frame_Shift_Del_p.QP1383fs|KDM5C_ENST00000404049.3_Frame_Shift_Del_p.QP1426fs	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	1427					histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						CAGGTCTGGGGGCTGTCCAGCCTG	0.657			"""N, F, S"""		clear cell renal carcinoma																																	.		Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	0																																										SO:0001589	frameshift_variant	8242			Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.4280_4283delAGCC	X.37:g.53222653_53222656delGGCT	ENSP00000364550:p.Gln1427fs		B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Frame_Shift_Del	DEL	ENST00000375401.3	37	CCDS14351.1																																																																																				0.657	KDM5C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056737.2		NM_004187	
