#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ADAMTS3	9508	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	73175164	73175164	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr4:73175164G>T	ENST00000286657.4	-	15	2165	c.2129C>A	c.(2128-2130)tCc>tAc	p.S710Y		NM_014243.2	NP_055058.2	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 3	710	Cys-rich.				collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix organization (GO:0030198)|positive regulation of vascular endothelial growth factor signaling pathway (GO:1900748)|protein processing (GO:0016485)|vascular endothelial growth factor production (GO:0010573)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.S710Y(1)		NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(33)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	76			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TCGGCAGTGGGAATTATCTCC	0.438																																					NSCLC(168;1941 2048 2918 13048 43078)												1	Substitution - Missense(1)	kidney(1)											147.0	134.0	139.0					4																	73175164		2203	4300	6503	SO:0001583	missense	9508			AB002364	CCDS3553.1	4q21	2008-07-29	2005-08-19		ENSG00000156140	ENSG00000156140	3.4.24.-	"""ADAM metallopeptidases with thrombospondin type 1 motif"""	219	protein-coding gene	gene with protein product		605011	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 3"""			10094461	Standard	NM_014243		Approved	KIAA0366, ADAMTS-4	uc003hgk.2	O15072	OTTHUMG00000129912	ENST00000286657.4:c.2129C>A	4.37:g.73175164G>T	ENSP00000286657:p.Ser710Tyr		A1L3U9|Q9BXZ8	Missense_Mutation	SNP	ENST00000286657.4	37	CCDS3553.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.786854	0.90367	.	.	ENSG00000156140	ENST00000286657	T	0.69306	-0.39	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	D	0.88562	0.6470	H	0.97186	3.955	0.54753	D	0.999988	D	0.89917	1.0	D	0.72338	0.977	D	0.91844	0.5486	10	0.87932	D	0	.	19.8115	0.96547	0.0:0.0:1.0:0.0	.	710	O15072	ATS3_HUMAN	Y	710	ENSP00000286657:S710Y	ENSP00000286657:S710Y	S	-	2	0	ADAMTS3	73394028	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.416000	0.97383	2.751000	0.94390	0.557000	0.71058	TCC		0.438	ADAMTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252164.2			
AGAP6	414189	broad.mit.edu	37	10	51769499	51769499	+	Silent	SNP	C	C	T			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr10:51769499C>T	ENST00000374056.4	+	7	1943	c.1545C>T	c.(1543-1545)gaC>gaT	p.D515D	AGAP6_ENST00000412531.3_Silent_p.D538D			Q5VW22	AGAP6_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 6	515	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.D538D(1)		NS(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(1)|lung(8)|prostate(3)|skin(1)|stomach(2)	29						TTGTCAATGACCTAGCCAACA	0.542																																																	1	Substitution - coding silent(1)	kidney(1)																																								SO:0001819	synonymous_variant	414189				CCDS44397.1	10q11.23	2013-01-10	2008-09-22	2008-09-22	ENSG00000204149	ENSG00000204149		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	23466	protein-coding gene	gene with protein product			"""centaurin, gamma-like family, member 3"""	CTGLF3			Standard	NM_001077665		Approved	bA324H6.1	uc001jix.4	Q5VW22	OTTHUMG00000018220	ENST00000374056.4:c.1545C>T	10.37:g.51769499C>T				Silent	SNP	ENST00000374056.4	37																																																																																					0.542	AGAP6-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding			NM_001077665	
ARHGAP29	9411	broad.mit.edu	37	1	94649835	94649835	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr1:94649835G>A	ENST00000260526.6	-	19	2301	c.2119C>T	c.(2119-2121)Cgt>Tgt	p.R707C	ARHGAP29_ENST00000482481.1_5'UTR	NM_004815.3	NP_004806.3	Q52LW3	RHG29_HUMAN	Rho GTPase activating protein 29	707	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|Rho GTPase activator activity (GO:0005100)	p.R707C(1)		NS(1)|breast(5)|endometrium(6)|kidney(2)|large_intestine(9)|lung(19)|ovary(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		CCACACACACGATAAATTCCC	0.284																																																	1	Substitution - Missense(1)	kidney(1)											93.0	96.0	95.0					1																	94649835		2203	4298	6501	SO:0001583	missense	9411				CCDS748.1	1p22.1	2011-06-29			ENSG00000137962	ENSG00000137962		"""Rho GTPase activating proteins"""	30207	protein-coding gene	gene with protein product		610496				9305890	Standard	NM_004815		Approved	PARG1	uc001dqj.4	Q52LW3	OTTHUMG00000010643	ENST00000260526.6:c.2119C>T	1.37:g.94649835G>A	ENSP00000260526:p.Arg707Cys		O15463|Q59H86|Q5VYZ0|Q6NVX2|Q8TBI6	Missense_Mutation	SNP	ENST00000260526.6	37	CCDS748.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.277783	0.80692	.	.	ENSG00000137962	ENST00000260526	T	0.52754	0.65	5.82	5.82	0.92795	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.37136	N	0.002235	D	0.83027	0.5165	H	0.99634	4.67	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.90382	0.4389	10	0.87932	D	0	-20.7685	20.0915	0.97822	0.0:0.0:1.0:0.0	.	707;707	F8VWZ8;Q52LW3	.;RHG29_HUMAN	C	707	ENSP00000260526:R707C	ENSP00000260526:R707C	R	-	1	0	ARHGAP29	94422423	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.830000	0.69324	2.736000	0.93811	0.650000	0.86243	CGT		0.284	ARHGAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029376.2		NM_004815	
ARHGAP32	9743	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	129062035	129062035	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr11:129062035G>A	ENST00000310343.9	-	1	58	c.59C>T	c.(58-60)tCt>tTt	p.S20F		NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	20					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)	p.S20F(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						TATAACTTCAGACTCCAACCA	0.423																																																	1	Substitution - Missense(1)	kidney(1)											291.0	269.0	275.0					11																	129062035		1566	3579	5145	SO:0001583	missense	9743			AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.59C>T	11.37:g.129062035G>A	ENSP00000310561:p.Ser20Phe		I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Missense_Mutation	SNP	ENST00000310343.9	37	CCDS44769.1	.	.	.	.	.	.	.	.	.	.	G	5.388	0.256808	0.10185	.	.	ENSG00000134909	ENST00000310343	T	0.09350	2.99	4.98	3.1	0.35709	.	.	.	.	.	T	0.06005	0.0156	N	0.08118	0	0.18873	N	0.999983	B	0.25719	0.132	B	0.24701	0.055	T	0.34527	-0.9825	9	0.87932	D	0	.	7.1798	0.25765	0.092:0.171:0.7369:0.0	.	20	A7KAX9	RHG32_HUMAN	F	20	ENSP00000310561:S20F	ENSP00000310561:S20F	S	-	2	0	ARHGAP32	128567245	0.013000	0.17824	0.028000	0.17463	0.060000	0.15804	0.938000	0.28965	0.784000	0.33661	-0.136000	0.14681	TCT		0.423	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386151.3		NM_014715	
C14orf2	9556	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	104381489	104381489	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr14:104381489A>G	ENST00000554880.1	-	2	191	c.38T>C	c.(37-39)aTg>aCg	p.M13T	C14orf2_ENST00000553430.1_Missense_Mutation_p.M13T|C14orf2_ENST00000553449.1_Intron|C14orf2_ENST00000557040.1_Missense_Mutation_p.M13T|C14orf2_ENST00000554713.1_Missense_Mutation_p.M13T|C14orf2_ENST00000555030.1_Missense_Mutation_p.M13T|C14orf2_ENST00000414262.2_Missense_Mutation_p.M30T|C14orf2_ENST00000286953.3_Missense_Mutation_p.M13T			P56378	68MP_HUMAN	chromosome 14 open reading frame 2	13						integral component of membrane (GO:0016021)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)		p.M30T(1)|p.M13T(1)		kidney(1)	1				Epithelial(152;0.223)		GTAGGGCTTCATGGGGATCCA	0.373																																																	2	Substitution - Missense(2)	kidney(2)											89.0	88.0	88.0					14																	104381489		2203	4300	6503	SO:0001583	missense	9556			AF054175	CCDS9986.1, CCDS45169.1	14q32.33	2013-02-18			ENSG00000156411	ENSG00000156411			1188	protein-coding gene	gene with protein product	"""6.8 kDa mitochondrial proteolipid"""	604573				9653160	Standard	NM_001127393		Approved	MP68	uc001yoi.4	P56378	OTTHUMG00000171601	ENST00000554880.1:c.38T>C	14.37:g.104381489A>G	ENSP00000452133:p.Met13Thr		B2R588|G3V5Q3|Q86TT7	Missense_Mutation	SNP	ENST00000554880.1	37	CCDS9986.1	.	.	.	.	.	.	.	.	.	.	A	7.074	0.568961	0.13560	.	.	ENSG00000156411	ENST00000286953;ENST00000554880;ENST00000555030;ENST00000414262;ENST00000553430;ENST00000557040;ENST00000554713	T;T;T;T;T;T;T	0.55234	0.53;0.53;0.53;0.53;0.53;0.53;0.53	5.5	4.35	0.52113	.	0.310670	0.27151	N	0.020683	T	0.40145	0.1105	.	.	.	0.31876	N	0.61914	B;B;P	0.36354	0.026;0.017;0.549	B;B;B	0.34038	0.015;0.007;0.174	T	0.50668	-0.8801	9	0.45353	T	0.12	.	8.283	0.31910	0.9098:0.0:0.0902:0.0	.	13;13;13	G3V556;G3V5Q3;P56378	.;.;68MP_HUMAN	T	13;13;13;30;13;13;13	ENSP00000286953:M13T;ENSP00000452133:M13T;ENSP00000452186:M13T;ENSP00000401770:M30T;ENSP00000452462:M13T;ENSP00000450894:M13T;ENSP00000451500:M13T	ENSP00000286953:M13T	M	-	2	0	C14orf2	103451242	0.997000	0.39634	0.973000	0.42090	0.075000	0.17131	4.451000	0.60047	0.906000	0.36621	0.533000	0.62120	ATG		0.373	C14orf2-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414398.1		NM_001127393	
CCDC132	55610	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	92921015	92921015	+	Splice_Site	SNP	C	C	A			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr7:92921015C>A	ENST00000305866.5	+	13	1071	c.943C>A	c.(943-945)Cat>Aat	p.H315N	CCDC132_ENST00000541136.1_Splice_Site_p.H126N|CCDC132_ENST00000317751.6_Splice_Site_p.H46N|CCDC132_ENST00000544910.1_Splice_Site_p.H285N|CCDC132_ENST00000535481.1_Splice_Site_p.H35N	NM_017667.3	NP_060137.2	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132	315						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)		p.H315N(1)		endometrium(1)|large_intestine(2)|lung(5)	8	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			TTTTCTTTAGCATGTTACACC	0.303																																																	1	Substitution - Missense(1)	kidney(1)											79.0	70.0	73.0					7																	92921015		1830	4079	5909	SO:0001630	splice_region_variant	55610			AL833112, AK055965, AL832393	CCDS5630.1, CCDS43617.1, CCDS59065.1	7q21.3	2007-07-23			ENSG00000004766	ENSG00000004766			25956	protein-coding gene	gene with protein product						11347906	Standard	NM_024553		Approved	KIAA1861, FLJ20097, DKFZp313I2429	uc003umo.4	Q96JG6	OTTHUMG00000131733	ENST00000305866.5:c.943-1C>A	7.37:g.92921015C>A			B3KX22|D1MQ00|F5H5U7|Q75N07|Q8WVK3|Q9H5C6	Missense_Mutation	SNP	ENST00000305866.5	37	CCDS43617.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.18|10.18	1.279458|1.279458	0.23307|0.23307	.|.	.|.	ENSG00000004766|ENSG00000004766	ENST00000305866;ENST00000544910;ENST00000541136;ENST00000535481;ENST00000317751|ENST00000458707	T|.	0.42131|.	0.98|.	5.22|5.22	5.22|5.22	0.72569|0.72569	Vacuolar protein sorting-associated protein 54 (1);|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.55816|0.55816	0.1944|0.1944	N|N	0.25647|0.25647	0.755|0.755	0.80722|0.80722	D|D	1|1	P;P;P|.	0.47253|.	0.771;0.892;0.771|.	P;B;P|.	0.45474|.	0.482;0.422;0.482|.	T|T	0.50320|0.50320	-0.8842|-0.8842	9|6	.|.	.|.	.|.	-27.9877|-27.9877	17.9099|17.9099	0.88930|0.88930	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	35;285;315|.	B4DS55;F5H5U7;Q96JG6|.	.;.;CC132_HUMAN|.	N|Q	315;285;126;35;46|101	ENSP00000325582:H46N|.	.|.	H|H	+|+	1|3	0|2	CCDC132|CCDC132	92758951|92758951	1.000000|1.000000	0.71417|0.71417	0.982000|0.982000	0.44146|0.44146	0.290000|0.290000	0.27261|0.27261	7.462000|7.462000	0.80851|0.80851	2.604000|2.604000	0.88044|0.88044	0.591000|0.591000	0.81541|0.81541	CAT|CAC		0.303	CCDC132-019	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341687.1		NM_017667	Missense_Mutation
CDKN2AIP	55602	hgsc.bcm.edu;ucsc.edu	37	4	184368249	184368249	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr4:184368249delT	ENST00000504169.1	+	3	1619	c.1412delT	c.(1411-1413)attfs	p.I471fs	CDKN2AIP_ENST00000302350.4_3'UTR	NM_017632.2	NP_060102.1	Q9NXV6	CARF_HUMAN	CDKN2A interacting protein	471	DRBM. {ECO:0000255|PROSITE- ProRule:PRU00266}.				negative regulation of cell growth (GO:0030308)|positive regulation of signal transduction (GO:0009967)|regulation of protein stability (GO:0031647)	cytoplasm (GO:0005737)|granular component (GO:0001652)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	p53 binding (GO:0002039)|RNA binding (GO:0003723)			endometrium(1)|kidney(2)|large_intestine(2)|lung(1)	6		all_lung(41;6.9e-12)|Lung NSC(41;1.28e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;1.15e-26)|Epithelial(43;2.98e-22)|OV - Ovarian serous cystadenocarcinoma(60;7.64e-10)|GBM - Glioblastoma multiforme(59;4.22e-06)|Colorectal(24;5.87e-06)|STAD - Stomach adenocarcinoma(60;2.09e-05)|COAD - Colon adenocarcinoma(29;5.15e-05)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)		AATGCAGCTATTGAGGCTCTG	0.398																																																	0													132.0	137.0	135.0					4																	184368249		2203	4300	6503	SO:0001589	frameshift_variant	55602			AK000043	CCDS34110.1	4q35.1	2008-02-05			ENSG00000168564	ENSG00000168564			24325	protein-coding gene	gene with protein product	"""collaborates/cooperates with ARF (alternate reading frame) protein"""	615914				12154087, 16803988	Standard	NM_017632		Approved	FLJ20036, CARF	uc003ivp.1	Q9NXV6	OTTHUMG00000160626	ENST00000504169.1:c.1412delT	4.37:g.184368249delT	ENSP00000427108:p.Ile471fs		Q8TBM5|Q9NYH0	Frame_Shift_Del	DEL	ENST00000504169.1	37	CCDS34110.1																																																																																				0.398	CDKN2AIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361488.1		NM_017632	
COG5	10466	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	106924166	106924166	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr7:106924166G>A	ENST00000347053.3	-	13	1468	c.1418C>T	c.(1417-1419)gCt>gTt	p.A473V	COG5_ENST00000297135.3_Missense_Mutation_p.A473V|COG5_ENST00000393603.2_Missense_Mutation_p.A473V	NM_181733.2	NP_859422.2	Q9UP83	COG5_HUMAN	component of oligomeric golgi complex 5	473					intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)		p.A473V(1)		breast(3)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(2)|skin(4)|stomach(1)	40						GTCTTTCAAAGCCTTTTCTGG	0.368																																																	1	Substitution - Missense(1)	kidney(1)											112.0	126.0	121.0					7																	106924166		2203	4300	6503	SO:0001583	missense	10466			AF058718	CCDS5742.1, CCDS5743.1, CCDS55152.1	7q31	2010-06-24	2001-12-07	2002-05-10	ENSG00000164597	ENSG00000164597		"""Components of oligomeric golgi complex"""	14857	protein-coding gene	gene with protein product		606821	"""golgi transport complex 1 (90 kDa subunit)"""	GOLTC1		9792665, 11980916	Standard	NM_006348		Approved	GTC90	uc003vec.2	Q9UP83	OTTHUMG00000023895	ENST00000347053.3:c.1418C>T	7.37:g.106924166G>A	ENSP00000334703:p.Ala473Val		A4D0R6|A4D0R7|O14555|O95008|Q6NUL5	Missense_Mutation	SNP	ENST00000347053.3	37	CCDS5743.1	.	.	.	.	.	.	.	.	.	.	G	13.54	2.267615	0.40095	.	.	ENSG00000164597	ENST00000347053;ENST00000297135;ENST00000393603	T;T;T	0.57273	0.41;0.41;0.41	5.57	4.69	0.59074	.	0.170115	0.51477	D	0.000094	T	0.43700	0.1259	L	0.45698	1.435	0.40661	D	0.982124	B;P	0.39424	0.177;0.673	B;B	0.39706	0.033;0.307	T	0.30679	-0.9970	10	0.15066	T	0.55	-17.1457	10.2464	0.43343	0.0709:0.1369:0.7922:0.0	.	473;473	Q9UP83;Q9UP83-2	COG5_HUMAN;.	V	473	ENSP00000334703:A473V;ENSP00000297135:A473V;ENSP00000377228:A473V	ENSP00000297135:A473V	A	-	2	0	COG5	106711402	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.983000	0.63832	1.473000	0.48159	0.563000	0.77884	GCT		0.368	COG5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060216.4			
DAXX	1616	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	33288852	33288852	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr6:33288852G>A	ENST00000374542.5	-	3	904	c.700C>T	c.(700-702)Cgc>Tgc	p.R234C	DAXX_ENST00000266000.6_Missense_Mutation_p.R234C|DAXX_ENST00000477162.1_Intron|DAXX_ENST00000414083.2_Missense_Mutation_p.R159C	NM_001141969.1|NM_001141970.1|NM_001350.4	NP_001135441.1|NP_001135442.1|NP_001341.1	Q9UER7	DAXX_HUMAN	death-domain associated protein	234	Interaction with histone H3.3.				activation of JUN kinase activity (GO:0007257)|androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|chromatin remodeling (GO:0006338)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|mitotic cytokinesis (GO:0000281)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of neuron death (GO:1901216)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|PML body (GO:0016605)|SWI/SNF superfamily-type complex (GO:0070603)	androgen receptor binding (GO:0050681)|enzyme binding (GO:0019899)|heat shock protein binding (GO:0031072)|histone binding (GO:0042393)|p53 binding (GO:0002039)|protein homodimerization activity (GO:0042803)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|receptor signaling protein activity (GO:0005057)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.R234C(1)		breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(2)|lung(7)|ovary(3)|pancreas(18)|prostate(3)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	55						CCAAAGAGGCGGATCAGCTTA	0.577			"""Mis, F, N"""		Pancreatic neuroendocrine tumors. Paediatric GBM																																			Rec	yes		6	6p21.3	1616	death-domain associated protein		E	1	Substitution - Missense(1)	kidney(1)											47.0	45.0	46.0					6																	33288852		2203	4300	6503	SO:0001583	missense	1616			AF006041	CCDS4776.1, CCDS59008.1	6p21.3	2008-08-29	2008-08-29			ENSG00000204209			2681	protein-coding gene	gene with protein product		603186	"""death-associated protein 6"""			9407001, 9215629	Standard	NM_001141970		Approved	DAP6	uc011dre.2	Q9UER7		ENST00000374542.5:c.700C>T	6.37:g.33288852G>A	ENSP00000363668:p.Arg234Cys		B4E1I3|F5H082|O14747|O15141|O15208|Q5STK9|Q9BWI3	Missense_Mutation	SNP	ENST00000374542.5	37	CCDS4776.1	.	.	.	.	.	.	.	.	.	.	G	12.69	2.013874	0.35511	.	.	ENSG00000204209	ENST00000266000;ENST00000374542;ENST00000414083	.	.	.	4.94	3.04	0.35103	.	0.222293	0.41194	D	0.000923	T	0.16171	0.0389	L	0.48362	1.52	0.47949	D	0.999554	P;P;P	0.45634	0.629;0.863;0.863	B;B;B	0.32980	0.156;0.145;0.145	T	0.08764	-1.0706	9	0.51188	T	0.08	-12.0737	3.035	0.06119	0.0983:0.1915:0.5366:0.1737	.	246;234;234	B4E1C1;B2R7M0;Q9UER7	.;.;DAXX_HUMAN	C	234;234;159	.	ENSP00000266000:R234C	R	-	1	0	DAXX	33396830	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.375000	0.34295	1.281000	0.44480	0.643000	0.83706	CGC		0.577	DAXX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076403.1			
DCDC1	341019	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	30930565	30930565	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr11:30930565C>G	ENST00000597505.1	-	27	3845	c.3846G>C	c.(3844-3846)aaG>aaC	p.K1282N	DCDC1_ENST00000406071.2_Missense_Mutation_p.K17N|DCDC1_ENST00000339794.5_Missense_Mutation_p.K361N			P59894	DCDC1_HUMAN	doublecortin domain containing 1	0					intracellular signal transduction (GO:0035556)			p.K361N(2)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					ATGTAATTTCCTTATCCAAGG	0.368																																																	2	Substitution - Missense(2)	lung(1)|kidney(1)											100.0	91.0	94.0					11																	30930565		2202	4299	6501	SO:0001583	missense	100506627			AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000597505.1:c.3846G>C	11.37:g.30930565C>G	ENSP00000472625:p.Lys1282Asn		A6PVL6|B7WNX6|Q6ZU04	Missense_Mutation	SNP	ENST00000597505.1	37		.	.	.	.	.	.	.	.	.	.	C	13.86	2.364427	0.41902	.	.	ENSG00000170959	ENST00000406071;ENST00000339794	T	0.39229	1.09	5.3	3.32	0.38043	.	0.322809	0.26362	N	0.024813	T	0.35856	0.0946	M	0.66939	2.045	0.24389	N	0.99476	P	0.44877	0.845	B	0.38803	0.282	T	0.42103	-0.9471	10	0.66056	D	0.02	-6.4556	5.4937	0.16791	0.1615:0.6635:0.0:0.175	.	361	Q6ZRR9	DCDC5_HUMAN	N	17;361	ENSP00000341700:K361N	ENSP00000341700:K361N	K	-	3	2	DCDC5	30887141	0.998000	0.40836	1.000000	0.80357	0.310000	0.27922	0.364000	0.20325	1.382000	0.46385	0.655000	0.94253	AAG		0.368	DCDC1-010	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000463167.1		NM_181807	
DDX23	9416	hgsc.bcm.edu	37	12	49233688	49233689	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr12:49233688_49233689insG	ENST00000308025.3	-	5	497_498	c.418_419insC	c.(418-420)cagfs	p.Q140fs	DDX23_ENST00000553182.1_5'UTR	NM_004818.2	NP_004809.2	Q9BUQ8	DDX23_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 23	140	Glu-rich.				ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|kidney(4)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(3)	36						GGATAATGGCTGGGCCTGAAGA	0.455																																																	0																																										SO:0001589	frameshift_variant	9416			AF026402	CCDS8770.1	12q13.11	2013-07-16				ENSG00000174243		"""DEAD-boxes"""	17347	protein-coding gene	gene with protein product		612172	"""PRP28 homolog, yeast"""			9409622, 9539711	Standard	NM_004818		Approved	prp28, U5-100K, PRPF28, SNRNP100	uc001rsm.3	Q9BUQ8		ENST00000308025.3:c.419dupC	12.37:g.49233691_49233691dupG	ENSP00000310723:p.Gln140fs		B2R600|B4DH15|O43188	Frame_Shift_Ins	INS	ENST00000308025.3	37	CCDS8770.1																																																																																				0.455	DDX23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408897.2		NM_004818	
FCHSD1	89848	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	141027542	141027542	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr5:141027542A>C	ENST00000435817.2	-	8	748	c.698T>G	c.(697-699)cTg>cGg	p.L233R	FCHSD1_ENST00000522126.1_Missense_Mutation_p.L157R|FCHSD1_ENST00000522783.1_Missense_Mutation_p.L231R|FCHSD1_ENST00000519800.1_Missense_Mutation_p.L231R|FCHSD1_ENST00000523856.1_5'Flank	NM_033449.2	NP_258260.1	Q86WN1	FCSD1_HUMAN	FCH and double SH3 domains 1	233								p.L233R(1)	FCHSD1/BRAF(2)	central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCCTTGAGCAGAGCTGGCAG	0.572																																																	1	Substitution - Missense(1)	kidney(1)											72.0	76.0	75.0					5																	141027542		1967	4159	6126	SO:0001583	missense	89848			AK027281	CCDS47295.1	5q31.3	2008-02-05			ENSG00000197948	ENSG00000197948			25463	protein-coding gene	gene with protein product						11214971, 15067381	Standard	NM_033449		Approved	FLJ00007	uc003llk.3	Q86WN1	OTTHUMG00000163762	ENST00000435817.2:c.698T>G	5.37:g.141027542A>C	ENSP00000399259:p.Leu233Arg		Q6UX75|Q86Y77|Q9NXX8	Missense_Mutation	SNP	ENST00000435817.2	37	CCDS47295.1	.	.	.	.	.	.	.	.	.	.	A	19.06	3.753357	0.69648	.	.	ENSG00000197948	ENST00000435817;ENST00000522126;ENST00000522783;ENST00000519800	T;T;T;T	0.16457	2.34;2.34;2.34;2.34	5.48	5.48	0.80851	.	0.240661	0.29260	N	0.012670	T	0.31420	0.0796	L	0.43152	1.355	0.33469	D	0.585916	D	0.69078	0.997	D	0.64042	0.921	T	0.43972	-0.9358	10	0.72032	D	0.01	-10.0793	13.0934	0.59178	1.0:0.0:0.0:0.0	.	233	Q86WN1	FCSD1_HUMAN	R	233;157;231;231	ENSP00000399259:L233R;ENSP00000427796:L157R;ENSP00000428677:L231R;ENSP00000428776:L231R	ENSP00000399259:L233R	L	-	2	0	FCHSD1	141007726	1.000000	0.71417	0.966000	0.40874	0.942000	0.58702	6.432000	0.73400	2.084000	0.62774	0.379000	0.24179	CTG		0.572	FCHSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375282.2		NM_033449	
FCRL5	83416	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	157491077	157491077	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr1:157491077C>A	ENST00000361835.3	-	11	2402	c.2245G>T	c.(2245-2247)Gtg>Ttg	p.V749L	FCRL5_ENST00000356953.4_Missense_Mutation_p.V749L|FCRL5_ENST00000461387.1_5'UTR	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	749					negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)		p.V749L(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				GGGCGAGACACCGGAACTGAA	0.498																																																	1	Substitution - Missense(1)	kidney(1)											25.0	28.0	27.0					1																	157491077		2203	4298	6501	SO:0001583	missense	83416			AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.2245G>T	1.37:g.157491077C>A	ENSP00000354691:p.Val749Leu		A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Missense_Mutation	SNP	ENST00000361835.3	37	CCDS1165.1	.	.	.	.	.	.	.	.	.	.	C	10.71	1.427512	0.25726	.	.	ENSG00000143297	ENST00000361835;ENST00000356953	T;T	0.02763	4.17;4.17	5.24	5.24	0.73138	.	2.377300	0.02149	N	0.057808	T	0.03263	0.0095	M	0.83774	2.66	0.80722	D	1	P;B	0.52842	0.956;0.016	B;B	0.42163	0.378;0.006	T	0.62840	-0.6769	10	0.08381	T	0.77	.	14.2019	0.65710	0.0:1.0:0.0:0.0	.	749;749	A6NJE8;Q96RD9	.;FCRL5_HUMAN	L	749	ENSP00000354691:V749L;ENSP00000349434:V749L	ENSP00000349434:V749L	V	-	1	0	FCRL5	155757701	0.997000	0.39634	0.958000	0.39756	0.038000	0.13279	1.937000	0.40193	2.717000	0.92951	0.650000	0.86243	GTG		0.498	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046263.1		NM_031281	
GALNT5	11227	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	158167827	158167827	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr2:158167827A>T	ENST00000259056.4	+	10	3275	c.2790A>T	c.(2788-2790)caA>caT	p.Q930H		NM_014568.1	NP_055383.1	Q7Z7M9	GALT5_HUMAN	polypeptide N-acetylgalactosaminyltransferase 5	930	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|glycosaminoglycan biosynthetic process (GO:0006024)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.Q930H(1)		breast(4)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	56						AGCCATATCAAAAGTGGAAAT	0.318																																																	1	Substitution - Missense(1)	kidney(1)											52.0	59.0	57.0					2																	158167827		2203	4300	6503	SO:0001583	missense	11227			AJ245539	CCDS2203.1	2q24.1	2014-03-13	2014-03-13		ENSG00000136542	ENSG00000136542	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4127	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 5"""	615129	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)"""			10545594	Standard	NM_014568		Approved	GalNAc-T5	uc002tzg.3	Q7Z7M9	OTTHUMG00000131965	ENST00000259056.4:c.2790A>T	2.37:g.158167827A>T	ENSP00000259056:p.Gln930His		A5PKZ1|Q9UGK7|Q9UHL6	Missense_Mutation	SNP	ENST00000259056.4	37	CCDS2203.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.024843	0.75390	.	.	ENSG00000136542	ENST00000259056	T	0.65916	-0.18	5.93	3.59	0.41128	Ricin B-related lectin (1);Ricin B lectin (3);	0.445560	0.21726	N	0.070059	T	0.73048	0.3537	M	0.72894	2.215	0.42077	D	0.991237	D	0.89917	1.0	D	0.91635	0.999	T	0.73183	-0.4063	10	0.87932	D	0	.	4.9288	0.13907	0.6969:0.0:0.3031:0.0	.	930	Q7Z7M9	GALT5_HUMAN	H	930	ENSP00000259056:Q930H	ENSP00000259056:Q930H	Q	+	3	2	GALNT5	157876073	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	0.846000	0.27682	1.072000	0.40860	0.533000	0.62120	CAA		0.318	GALNT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254925.2		NM_014568	
GRM2	2912	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	51749885	51749885	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr3:51749885T>A	ENST00000395052.3	+	4	2330	c.2096T>A	c.(2095-2097)gTg>gAg	p.V699E	GRM2_ENST00000475478.1_3'UTR|GRM2_ENST00000442933.2_Intron	NM_000839.3	NP_000830.2	Q14416	GRM2_HUMAN	glutamate receptor, metabotropic 2	699					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|glutamate secretion (GO:0014047)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)	p.V699E(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(1)|lung(11)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GCCTGGCTGGTGGTGGAGGCA	0.662																																																	1	Substitution - Missense(1)	kidney(1)											49.0	40.0	43.0					3																	51749885		2203	4299	6502	SO:0001583	missense	2912			L35318	CCDS2834.1	3p21.2	2013-09-20			ENSG00000164082	ENSG00000164082		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4594	protein-coding gene	gene with protein product		604099				7620613	Standard	NM_000839		Approved	GPRC1B, mGlu2, MGLUR2	uc010hlv.3	Q14416	OTTHUMG00000156902	ENST00000395052.3:c.2096T>A	3.37:g.51749885T>A	ENSP00000378492:p.Val699Glu		B0M0K7|Q14CU5|Q52MC6|Q9H3N6	Missense_Mutation	SNP	ENST00000395052.3	37	CCDS2834.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.222482	0.79464	.	.	ENSG00000164082	ENST00000395052	D	0.89681	-2.55	5.14	5.14	0.70334	GPCR, family 3, C-terminal (2);	0.232218	0.37178	N	0.002214	D	0.88665	0.6498	L	0.55834	1.745	0.80722	D	1	P	0.38565	0.637	B	0.43701	0.428	D	0.88022	0.2769	10	0.39692	T	0.17	.	15.2689	0.73683	0.0:0.0:0.0:1.0	.	699	Q14416	GRM2_HUMAN	E	699	ENSP00000378492:V699E	ENSP00000378492:V699E	V	+	2	0	GRM2	51724925	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	6.257000	0.72480	2.075000	0.62263	0.448000	0.29417	GTG		0.662	GRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346542.1			
HINT2	84681	hgsc.bcm.edu;ucsc.edu	37	9	35813449	35813451	+	In_Frame_Del	DEL	TCT	TCT	-	rs145309300	byFrequency	TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	TCT	TCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr9:35813449_35813451delTCT	ENST00000259667.5	-	3	359_361	c.318_320delAGA	c.(316-321)gaagac>gac	p.E106del	SPAG8_ENST00000479751.1_5'Flank|SPAG8_ENST00000340291.2_5'Flank|AL133410.1_ENST00000582432.1_RNA|SPAG8_ENST00000396638.2_5'Flank|TMEM8B_ENST00000377996.1_5'Flank|HINT2_ENST00000474908.1_5'UTR|SPAG8_ENST00000484764.1_5'Flank	NM_032593.2	NP_115982.1	Q9BX68	HINT2_HUMAN	histidine triad nucleotide binding protein 2	106	HIT. {ECO:0000255|PROSITE- ProRule:PRU00464}.				apoptotic process (GO:0006915)|steroid biosynthetic process (GO:0006694)	mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)|nucleotide binding (GO:0000166)			NS(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	7	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)			CACCTGCTGGTCTTCTTCTTCAG	0.576											OREG0019179	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									GBM(185;1694 2122 5473 25431 37228)												0										2,4262		0,2,2130						0.4	1.0			62	0,8254		0,0,4127	no	coding	HINT2	NM_032593.2		0,2,6257	A1A1,A1R,RR		0.0,0.0469,0.016				2,12516				SO:0001651	inframe_deletion	84681			AY033094	CCDS6594.1	9p11.2	2005-12-20			ENSG00000137133	ENSG00000137133			18344	protein-coding gene	gene with protein product		609997					Standard	NM_032593		Approved		uc003zyh.3	Q9BX68	OTTHUMG00000019886	ENST00000259667.5:c.318_320delAGA	9.37:g.35813455_35813457delTCT	ENSP00000259667:p.Glu106del	858	Q5TCW3	In_Frame_Del	DEL	ENST00000259667.5	37	CCDS6594.1																																																																																				0.576	HINT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052390.1		NM_032593	
HSPA5	3309	broad.mit.edu;hgsc.bcm.edu	37	9	128001354	128001354	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr9:128001354G>C	ENST00000324460.6	-	5	1065	c.862C>G	c.(862-864)Ctc>Gtc	p.L288V	RP11-65N13.8_ENST00000468244.1_RNA	NM_005347.4	NP_005338.1	P11021	GRP78_HUMAN	heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)	288					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular response to antibiotic (GO:0071236)|cellular response to glucose starvation (GO:0042149)|cellular response to interleukin-4 (GO:0071353)|cerebellar Purkinje cell layer development (GO:0021680)|cerebellum structural organization (GO:0021589)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|maintenance of protein localization in endoplasmic reticulum (GO:0035437)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell migration (GO:0030335)|positive regulation of protein ubiquitination (GO:0031398)|regulation of protein folding in endoplasmic reticulum (GO:0060904)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|chaperone binding (GO:0051087)|enzyme binding (GO:0019899)|glycoprotein binding (GO:0001948)|misfolded protein binding (GO:0051787)|protein domain specific binding (GO:0019904)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)	p.L288V(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(4)|prostate(2)|skin(1)	23					Acetylsalicylic acid(DB00945)|Antihemophilic Factor(DB00025)	TCGCGCCGGAGTTTCTGCACA	0.458										Prostate(1;0.17)																																							1	Substitution - Missense(1)	kidney(1)											81.0	81.0	81.0					9																	128001354		2203	4300	6503	SO:0001583	missense	3309				CCDS6863.1	9q33.3	2011-09-02	2002-08-29		ENSG00000044574	ENSG00000044574		"""Heat shock proteins / HSP70"""	5238	protein-coding gene	gene with protein product		138120	"""heat shock 70kD protein 5 (glucose-regulated protein, 78kD)"""	GRP78			Standard	NM_005347		Approved	BiP	uc004bpn.3	P11021	OTTHUMG00000020672	ENST00000324460.6:c.862C>G	9.37:g.128001354G>C	ENSP00000324173:p.Leu288Val		B0QZ61|Q2EF78|Q9NPF1|Q9UK02	Missense_Mutation	SNP	ENST00000324460.6	37	CCDS6863.1	.	.	.	.	.	.	.	.	.	.	G	18.01	3.527132	0.64860	.	.	ENSG00000044574	ENST00000324460	T	0.01787	4.64	4.16	3.25	0.37280	.	0.000000	0.85682	D	0.000000	T	0.10981	0.0268	M	0.88105	2.93	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.00364	-1.1787	10	0.87932	D	0	-25.0776	10.3362	0.43852	0.0975:0.0:0.9025:0.0	.	288	P11021	GRP78_HUMAN	V	288	ENSP00000324173:L288V	ENSP00000324173:L288V	L	-	1	0	HSPA5	127041175	1.000000	0.71417	1.000000	0.80357	0.695000	0.40330	4.875000	0.63072	1.864000	0.54056	0.462000	0.41574	CTC		0.458	HSPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054062.1			
INSRR	3645	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	156821582	156821582	+	Splice_Site	SNP	T	T	C			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr1:156821582T>C	ENST00000368195.3	-	4	1338		c.e4-2		NTRK1_ENST00000392302.2_Intron	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor						actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.?(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CAGAATATGCTAGCAGGAGCA	0.607																																																	1	Unknown(1)	kidney(1)											79.0	65.0	70.0					1																	156821582		2203	4300	6503	SO:0001630	splice_region_variant	3645			J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.942-2A>G	1.37:g.156821582T>C			O60724|Q5VZS3	Splice_Site	SNP	ENST00000368195.3	37	CCDS1160.1	.	.	.	.	.	.	.	.	.	.	T	18.78	3.697190	0.68386	.	.	ENSG00000027644	ENST00000368195	.	.	.	4.72	4.72	0.59763	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.1419	0.59440	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	INSRR	155088206	1.000000	0.71417	0.914000	0.36105	0.927000	0.56198	7.710000	0.84655	1.970000	0.57323	0.379000	0.24179	.		0.607	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098929.1		NM_014215	Intron
ITPKB	3707	broad.mit.edu	37	1	226836374	226836374	+	Splice_Site	SNP	T	T	C			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr1:226836374T>C	ENST00000272117.3	-	2	2030	c.2031A>G	c.(2029-2031)gcA>gcG	p.A677A	ITPKB_ENST00000429204.1_Splice_Site_p.A677A			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	677					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)	p.A677A(1)|p.A203A(1)		central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				TGTGTCTACCTGCGTGTCCTG	0.542																																					Colon(84;110 1851 5306 33547)												2	Substitution - coding silent(2)	kidney(2)											151.0	147.0	148.0					1																	226836374		2203	4300	6503	SO:0001630	splice_region_variant	3707			AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.2032+1A>G	1.37:g.226836374T>C			Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	Silent	SNP	ENST00000272117.3	37	CCDS1555.1																																																																																				0.542	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091632.1		NM_002221	Silent
LAP3	51056	broad.mit.edu	37	4	17579162	17579162	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr4:17579162G>T	ENST00000226299.4	+	1	348	c.74G>T	c.(73-75)cGg>cTg	p.R25L	LAP3_ENST00000606142.1_5'UTR	NM_015907.2	NP_056991.2	P28838	AMPL_HUMAN	leucine aminopeptidase 3	25					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	aminopeptidase activity (GO:0004177)|manganese ion binding (GO:0030145)|metalloexopeptidase activity (GO:0008235)	p.R25L(1)		endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|urinary_tract(1)	20						TTCGGGAGCCGGAGTCTCTCC	0.701																																																	1	Substitution - Missense(1)	kidney(1)											21.0	21.0	21.0					4																	17579162		2198	4287	6485	SO:0001583	missense	51056			AF061738	CCDS3422.1	4p15.33	2012-07-25	2003-09-12		ENSG00000002549	ENSG00000002549	3.4.11.1		18449	protein-coding gene	gene with protein product		170250	"""peptidase S"""	PEPS		6350155, 689684	Standard	NM_015907		Approved	LAPEP, LAP	uc003gph.1	P28838	OTTHUMG00000048214	ENST00000226299.4:c.74G>T	4.37:g.17579162G>T	ENSP00000226299:p.Arg25Leu		B3KMQ3|Q6IAM6|Q6P0L6|Q9UQE3	Missense_Mutation	SNP	ENST00000226299.4	37	CCDS3422.1	.	.	.	.	.	.	.	.	.	.	G	9.043	0.990127	0.18966	.	.	ENSG00000002549	ENST00000226299	T	0.42900	0.96	5.39	0.483	0.16820	.	0.476791	0.23979	N	0.042698	T	0.16896	0.0406	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.09509	-1.0671	10	0.34782	T	0.22	-1.7785	2.442	0.04497	0.1613:0.2889:0.4115:0.1383	.	25	P28838	AMPL_HUMAN	L	25	ENSP00000226299:R25L	ENSP00000226299:R25L	R	+	2	0	LAP3	17188260	0.075000	0.21258	0.000000	0.03702	0.001000	0.01503	0.049000	0.14099	-0.164000	0.10927	-1.078000	0.02229	CGG		0.701	LAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250365.1			
LIMK2	3985	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	31664140	31664140	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr22:31664140C>T	ENST00000331728.4	+	11	1385	c.1271C>T	c.(1270-1272)cCc>cTc	p.P424L	LIMK2_ENST00000340552.4_Missense_Mutation_p.P403L|LIMK2_ENST00000333611.4_Missense_Mutation_p.P403L|LIMK2_ENST00000406516.1_Missense_Mutation_p.P346L|LIMK2_ENST00000444929.2_Missense_Mutation_p.P178L	NM_005569.3	NP_005560.1	P53671	LIMK2_HUMAN	LIM domain kinase 2	424	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				phosphorylation (GO:0016310)|spermatogenesis (GO:0007283)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)	p.P403L(1)|p.P424L(1)		endometrium(7)|kidney(3)|large_intestine(6)|lung(6)|ovary(2)|prostate(4)|skin(1)	29						GATCCGTTCCCCTGGCAGCAG	0.577																																																	2	Substitution - Missense(2)	kidney(2)											106.0	102.0	104.0					22																	31664140		2203	4300	6503	SO:0001583	missense	3985			D45906	CCDS13891.1, CCDS13892.1, CCDS33637.1	22q12	2005-01-21			ENSG00000182541	ENSG00000182541			6614	protein-coding gene	gene with protein product		601988				8537403, 10591208	Standard	NM_005569		Approved		uc003akh.3	P53671	OTTHUMG00000151251	ENST00000331728.4:c.1271C>T	22.37:g.31664140C>T	ENSP00000332687:p.Pro424Leu		A8K6H5|Q7KZ80|Q7L3H5|Q96E10|Q99464|Q9UFU0	Missense_Mutation	SNP	ENST00000331728.4	37	CCDS13891.1	.	.	.	.	.	.	.	.	.	.	.	33	5.251345	0.95305	.	.	ENSG00000182541	ENST00000406516;ENST00000444929;ENST00000331728;ENST00000436394;ENST00000333611;ENST00000340552	D;D;D;D;D	0.90004	-2.6;-2.6;-2.6;-2.6;-2.6	5.92	5.92	0.95590	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.049715	0.85682	D	0.000000	D	0.93848	0.8032	M	0.64170	1.965	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.982	D;D;D;D;P	0.79784	0.988;0.993;0.982;0.987;0.864	D	0.93812	0.7111	10	0.87932	D	0	-32.843	19.3095	0.94179	0.0:1.0:0.0:0.0	.	456;403;178;424;346	F5GY29;Q7L3H5;E7EUC1;P53671;B5MC51	.;.;.;LIMK2_HUMAN;.	L	346;178;424;456;403;403	ENSP00000384602:P346L;ENSP00000409522:P178L;ENSP00000332687:P424L;ENSP00000330470:P403L;ENSP00000339916:P403L	ENSP00000332687:P424L	P	+	2	0	LIMK2	29994140	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.487000	0.81328	2.804000	0.96469	0.655000	0.94253	CCC		0.577	LIMK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321911.1		NM_016733	
KMT2C	58508	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	151878457	151878457	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina HiSeq	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr7:151878457G>T	ENST00000262189.6	-	36	6706	c.6488C>A	c.(6487-6489)cCt>cAt	p.P2163H	KMT2C_ENST00000355193.2_Missense_Mutation_p.P2163H	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	2163	Pro-rich.				histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.P2163H(2)									GGGAGTTCCAGGAGGTTGAGA	0.483																																																	2	Substitution - Missense(2)	kidney(2)											124.0	130.0	128.0					7																	151878457		2203	4300	6503	SO:0001583	missense	58508			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.6488C>A	7.37:g.151878457G>T	ENSP00000262189:p.Pro2163His		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	G	17.08	3.296866	0.60086	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.89552	-2.5;-2.53	5.51	5.51	0.81932	.	0.000000	0.46145	D	0.000303	D	0.94558	0.8247	M	0.78456	2.415	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.994	D	0.94909	0.8063	10	0.87932	D	0	.	18.203	0.89844	0.0:0.0:1.0:0.0	.	2163;1224	Q8NEZ4;Q8NEZ4-2	MLL3_HUMAN;.	H	2163	ENSP00000262189:P2163H;ENSP00000347325:P2163H	ENSP00000262189:P2163H	P	-	2	0	MLL3	151509390	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	6.722000	0.74735	2.600000	0.87896	0.655000	0.94253	CCT		0.483	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			
MPP3	4356	broad.mit.edu	37	17	41898423	41898423	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr17:41898423A>T	ENST00000398389.4	-	11	853	c.688T>A	c.(688-690)Ttc>Atc	p.F230I	MPP3_ENST00000398393.1_Missense_Mutation_p.F255I	NM_001932.4	NP_001923.2	Q13368	MPP3_HUMAN	membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)	230	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	guanylate kinase activity (GO:0004385)	p.F230I(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	26		Breast(137;0.00394)		BRCA - Breast invasive adenocarcinoma(366;0.119)		GCGCGCATGAACACCTGCACA	0.627																																																	1	Substitution - Missense(1)	kidney(1)											24.0	28.0	26.0					17																	41898423		2013	4164	6177	SO:0001583	missense	4356				CCDS42344.1	17q12-q21	2008-07-18			ENSG00000161647	ENSG00000161647			7221	protein-coding gene	gene with protein product	"""MAGUK p55 subfamily member 3"", ""discs, large (Drosophila) homolog 3"", ""membrane protein palmitoylated 3"""	601114		DLG3		8824795	Standard	NR_003562		Approved		uc002iei.4	Q13368	OTTHUMG00000133838	ENST00000398389.4:c.688T>A	17.37:g.41898423A>T	ENSP00000381425:p.Phe230Ile		B2R7N0|D3DX47|Q4GX05|Q6PGR3|Q86SV1	Missense_Mutation	SNP	ENST00000398389.4	37	CCDS42344.1	.	.	.	.	.	.	.	.	.	.	A	28.7	4.944466	0.92593	.	.	ENSG00000161647	ENST00000398393;ENST00000398389;ENST00000356492	T;T	0.08370	3.1;3.1	4.57	4.57	0.56435	Src homology-3 domain (3);Variant SH3 (1);	0.121027	0.64402	D	0.000016	T	0.30479	0.0766	M	0.84156	2.68	0.53688	D	0.999978	P;D;D	0.67145	0.92;0.996;0.996	P;D;D	0.70016	0.652;0.967;0.967	T	0.10520	-1.0626	10	0.66056	D	0.02	.	14.1216	0.65192	1.0:0.0:0.0:0.0	.	255;230;255	B4DS20;Q13368;D3DX46	.;MPP3_HUMAN;.	I	255;230;255	ENSP00000381430:F255I;ENSP00000381425:F230I	ENSP00000348885:F255I	F	-	1	0	MPP3	39253949	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.139000	0.94554	1.928000	0.55862	0.459000	0.35465	TTC		0.627	MPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258371.1		NM_001932	
OTOP1	133060	broad.mit.edu;hgsc.bcm.edu	37	4	4199146	4199146	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr4:4199146A>C	ENST00000296358.4	-	5	1439	c.1415T>G	c.(1414-1416)aTg>aGg	p.M472R		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	472					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)		p.M472R(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		AGCAAGGGGCATGGTGTTGCC	0.542																																																	1	Substitution - Missense(1)	kidney(1)											67.0	67.0	67.0					4																	4199146		2203	4300	6503	SO:0001583	missense	133060			BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.1415T>G	4.37:g.4199146A>C	ENSP00000296358:p.Met472Arg		A1L476	Missense_Mutation	SNP	ENST00000296358.4	37	CCDS3372.1	.	.	.	.	.	.	.	.	.	.	A	6.348	0.432361	0.12045	.	.	ENSG00000163982	ENST00000296358	T	0.07800	3.16	4.45	-0.51	0.11973	.	1.799310	0.02363	N	0.077040	T	0.06735	0.0172	N	0.14661	0.345	0.09310	N	1	B	0.26809	0.16	B	0.20184	0.028	T	0.42032	-0.9475	10	0.59425	D	0.04	-9.0862	10.403	0.44241	0.6319:0.0:0.3681:0.0	.	472	Q7RTM1	OTOP1_HUMAN	R	472	ENSP00000296358:M472R	ENSP00000296358:M472R	M	-	2	0	OTOP1	4250047	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.633000	0.24598	-0.391000	0.07763	-0.585000	0.04130	ATG		0.542	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2		NM_177998	
PABPC1L	80336	broad.mit.edu	37	20	43564119	43564119	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr20:43564119C>A	ENST00000217073.2	+	11	1532	c.1532C>A	c.(1531-1533)gCa>gAa	p.A511E	PABPC1L_ENST00000217075.2_Missense_Mutation_p.A65E|PABPC1L_ENST00000255136.3_Missense_Mutation_p.A511E|PABPC1L_ENST00000537323.1_3'UTR|PABPC1L_ENST00000372824.1_Missense_Mutation_p.A65E|PABPC1L_ENST00000490798.1_3'UTR|PABPC1L_ENST00000372819.1_Missense_Mutation_p.A65E			Q4VXU2	PAP1L_HUMAN	poly(A) binding protein, cytoplasmic 1-like	511					mRNA polyadenylation (GO:0006378)|oocyte maturation (GO:0001556)	extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.A511E(1)		breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	20						TGTTCCTCAGCAGCACATAGC	0.587																																																	1	Substitution - Missense(1)	kidney(1)											44.0	43.0	44.0					20																	43564119		1568	3582	5150	SO:0001583	missense	80336			AK026760	CCDS42878.1	20q12-q13.1	2013-02-12	2007-11-21	2007-11-21	ENSG00000101104	ENSG00000101104		"""RNA binding motif (RRM) containing"""	15797	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 119"""	C20orf119		11549316	Standard	NM_001124756		Approved	dJ1069P2.3, PABPC1L1, ePAB	uc010ggv.1	Q4VXU2	OTTHUMG00000032553	ENST00000217073.2:c.1532C>A	20.37:g.43564119C>A	ENSP00000217073:p.Ala511Glu		Q4VY17	Missense_Mutation	SNP	ENST00000217073.2	37	CCDS42878.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.352|7.352	0.623104|0.623104	0.14193|0.14193	.|.	.|.	ENSG00000101104|ENSG00000101104	ENST00000255136;ENST00000421240;ENST00000372821;ENST00000217073;ENST00000372824;ENST00000372819;ENST00000217075;ENST00000372822|ENST00000372826	T;T;T;T;T;T|.	0.43688|.	0.94;0.94;0.94;0.94;0.94;0.94|.	4.73|4.73	2.72|2.72	0.32119|0.32119	Polyadenylate-binding protein/Hyperplastic disc protein (1);|.	0.374594|.	0.32328|.	N|.	0.006244|.	T|T	0.21227|0.21227	0.0511|0.0511	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	B;B|.	0.32653|.	0.006;0.379|.	B;B|.	0.30029|.	0.005;0.11|.	T|T	0.23013|0.23013	-1.0200|-1.0200	10|5	0.15952|.	T|.	0.53|.	.|.	7.5279|7.5279	0.27666|0.27666	0.1784:0.6167:0.2048:0.0|0.1784:0.6167:0.2048:0.0	.|.	511;65|.	Q4VXU2;G5E9L3|.	PAP1L_HUMAN;.|.	E|K	511;65;65;511;65;65;65;6|47	ENSP00000255136:A511E;ENSP00000217073:A511E;ENSP00000361911:A65E;ENSP00000361906:A65E;ENSP00000217075:A65E;ENSP00000361909:A6E|.	ENSP00000217073:A511E|.	A|Q	+|+	2|1	0|0	PABPC1L|PABPC1L	42997533|42997533	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.025000|0.025000	0.11179|0.11179	0.664000|0.664000	0.25068|0.25068	0.659000|0.659000	0.30945|0.30945	0.655000|0.655000	0.94253|0.94253	GCA|CAG		0.587	PABPC1L-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127816.2			
PLA2G4D	283748	hgsc.bcm.edu	37	15	42363043	42363043	+	Missense_Mutation	SNP	T	T	G	rs74678783	byFrequency	TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr15:42363043T>G	ENST00000290472.3	-	18	2009	c.1915A>C	c.(1915-1917)Aag>Cag	p.K639Q		NM_178034.3	NP_828848.3	Q86XP0	PA24D_HUMAN	phospholipase A2, group IVD (cytosolic)	639	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phospholipase A2 activity (GO:0004623)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(7)|ovary(1)|skin(2)|stomach(1)	27		all_cancers(109;6.37e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.019)|Ovarian(310;0.143)|Colorectal(260;0.245)		OV - Ovarian serous cystadenocarcinoma(18;4.9e-17)|GBM - Glioblastoma multiforme(94;1.02e-06)		CGGGGCTCCTTGGGGGTCAGC	0.632													G|||	222	0.0443291	0.0144	0.0749	5008	,	,		17980	0.0		0.1083	False		,,,				2504	0.0429																0								G	GLN/LYS	142,4264		1,140,2062	61.0	65.0	64.0		1915	3.0	0.9	15	dbSNP_131	64	853,7745		43,767,3489	yes	missense	PLA2G4D	NM_178034.3	53	44,907,5551	GG,GT,TT		9.9209,3.2229,7.6515	benign	639/819	42363043	995,12009	2203	4299	6502	SO:0001583	missense	283748			AB090876	CCDS32203.1	15q14	2008-09-19				ENSG00000159337	3.1.1.4		30038	protein-coding gene	gene with protein product		612864				14709560	Standard	NM_178034		Approved	cPLA2delta	uc001zox.3	Q86XP0		ENST00000290472.3:c.1915A>C	15.37:g.42363043T>G	ENSP00000290472:p.Lys639Gln		Q8N176	Missense_Mutation	SNP	ENST00000290472.3	37	CCDS32203.1	128	0.05860805860805861	10	0.02032520325203252	31	0.0856353591160221	0	0.0	87	0.11477572559366754	G	0.496	-0.873328	0.02570	0.032229	0.099209	ENSG00000159337	ENST00000290472	T	0.10288	2.89	4.85	2.95	0.34219	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (2);	1.129710	0.06570	N	0.748353	T	0.00073	0.0002	N	0.01048	-1.04	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.44787	-0.9305	9	0.11485	T	0.65	-3.982	2.0561	0.03582	0.2199:0.1405:0.4948:0.1447	.	639	Q86XP0	PA24D_HUMAN	Q	639	ENSP00000290472:K639Q	ENSP00000290472:K639Q	K	-	1	0	PLA2G4D	40150335	0.000000	0.05858	0.864000	0.33941	0.260000	0.26232	0.081000	0.14823	0.253000	0.21552	-0.143000	0.13931	AAG		0.632	PLA2G4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419317.1		NM_178034	
PTGIR	5739	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	47124908	47124908	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr19:47124908C>G	ENST00000291294.2	-	3	923	c.790G>C	c.(790-792)Gtc>Ctc	p.V264L	PTGIR_ENST00000597185.1_5'UTR|PTGIR_ENST00000598865.1_Missense_Mutation_p.V52L|PTGIR_ENST00000594275.1_Missense_Mutation_p.V21L	NM_000960.3	NP_000951.1	P43119	PI2R_HUMAN	prostaglandin I2 (prostacyclin) receptor (IP)	264					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of GTPase activity (GO:0043547)|response to lipopolysaccharide (GO:0032496)	cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|guanyl-nucleotide exchange factor activity (GO:0005085)	p.V264L(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	13		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000327)|all cancers(93;0.000641)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0331)	Dinoprost Tromethamine(DB01160)|Epoprostenol(DB01240)|Iloprost(DB01088)|Treprostinil(DB00374)	TCAGGGGCGACAGCCTGGGTG	0.632																																																	1	Substitution - Missense(1)	kidney(1)											34.0	31.0	32.0					19																	47124908		2149	4213	6362	SO:0001583	missense	5739				CCDS12686.1	19q13.3	2012-08-08				ENSG00000160013		"""GPCR / Class A : Prostanoid receptors"""	9602	protein-coding gene	gene with protein product		600022				7759114	Standard	NM_000960		Approved	IP	uc002pex.3	P43119		ENST00000291294.2:c.790G>C	19.37:g.47124908C>G	ENSP00000291294:p.Val264Leu			Missense_Mutation	SNP	ENST00000291294.2	37	CCDS12686.1	.	.	.	.	.	.	.	.	.	.	C	0.223	-1.026761	0.02045	.	.	ENSG00000160013	ENST00000291294	T	0.33654	1.4	4.39	1.03	0.20045	GPCR, rhodopsin-like superfamily (1);	0.378221	0.25086	N	0.033255	T	0.08891	0.0220	N	0.00554	-1.385	0.09310	N	1	B	0.06786	0.001	B	0.11329	0.006	T	0.35649	-0.9780	10	0.15066	T	0.55	-23.7801	6.8264	0.23885	0.0:0.3524:0.0:0.6476	.	264	P43119	PI2R_HUMAN	L	264	ENSP00000291294:V264L	ENSP00000291294:V264L	V	-	1	0	PTGIR	51816748	0.000000	0.05858	0.993000	0.49108	0.399000	0.30720	-1.376000	0.02561	-0.040000	0.13580	-0.367000	0.07326	GTC		0.632	PTGIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466581.1			
RIC8B	55188	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	107237651	107237651	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr12:107237651C>G	ENST00000392839.2	+	6	1193	c.1087C>G	c.(1087-1089)Cta>Gta	p.L363V	RIC8B_ENST00000355478.2_Missense_Mutation_p.L323V|RIC8B_ENST00000392837.4_Missense_Mutation_p.L363V|RIC8B_ENST00000549643.1_Intron	NM_018157.2	NP_060627.2	Q9NVN3	RIC8B_HUMAN	RIC8 guanine nucleotide exchange factor B	363					regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	G-protein alpha-subunit binding (GO:0001965)|guanyl-nucleotide exchange factor activity (GO:0005085)	p.L363V(1)		kidney(2)|large_intestine(5)|lung(10)|ovary(1)|urinary_tract(1)	19						TAGAGAGGGTCTAACTCCAGT	0.353																																																	1	Substitution - Missense(1)	kidney(1)											102.0	97.0	99.0					12																	107237651		2203	4300	6503	SO:0001583	missense	55188			AK128102	CCDS9109.2	12q23.3	2013-08-05	2013-08-05		ENSG00000111785	ENSG00000111785			25555	protein-coding gene	gene with protein product		609147	"""resistance to inhibitors of cholinesterase 8 homolog B (C. elegans)"""				Standard	XM_005268998		Approved	FLJ10620, hSyn, RIC8	uc001tlx.3	Q9NVN3	OTTHUMG00000144188	ENST00000392839.2:c.1087C>G	12.37:g.107237651C>G	ENSP00000376583:p.Leu363Val		A2RTZ0|Q4G103|Q6ZRN4|Q86WD3	Missense_Mutation	SNP	ENST00000392839.2	37	CCDS9109.2	.	.	.	.	.	.	.	.	.	.	C	18.78	3.696162	0.68386	.	.	ENSG00000111785	ENST00000392837;ENST00000392839;ENST00000355478	T;T;T	0.50277	0.75;0.75;0.75	5.51	5.51	0.81932	Synembryn (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.62829	0.2460	L	0.52266	1.64	0.80722	D	1	D;D;D	0.76494	0.998;0.997;0.999	D;D;D	0.87578	0.996;0.997;0.998	T	0.53760	-0.8393	10	0.13853	T	0.58	-3.1333	19.415	0.94690	0.0:1.0:0.0:0.0	.	323;363;363	Q9NVN3-3;Q9NVN3;B7WPL0	.;RIC8B_HUMAN;.	V	363;363;323	ENSP00000376582:L363V;ENSP00000376583:L363V;ENSP00000347662:L323V	ENSP00000347662:L323V	L	+	1	2	RIC8B	105761781	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.689000	0.61723	2.583000	0.87209	0.557000	0.71058	CTA		0.353	RIC8B-006	KNOWN	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000291398.2		NM_018157	
RIMBP3	85376	hgsc.bcm.edu	37	22	20458121	20458122	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr22:20458121_20458122insC	ENST00000426804.1	-	1	3664_3665	c.3180_3181insG	c.(3178-3183)ctgccafs	p.P1061fs	SCARNA17_ENST00000516762.1_RNA|SCARNA18_ENST00000516215.1_RNA|RN7SKP131_ENST00000363006.1_RNA	NM_015672.1	NP_056487.1	Q9UFD9	RIM3A_HUMAN	RIMS binding protein 3	1061	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.									breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	13	Colorectal(54;0.0993)|Melanoma(16;0.165)		LUSC - Lung squamous cell carcinoma(15;0.0405)|Lung(15;0.224)			AAGTCCCGTGGCAGCCGCACCT	0.653																																																	0																																										SO:0001589	frameshift_variant	85376			AB051453	CCDS46665.1	22q11.21	2014-05-06			ENSG00000196622	ENSG00000275793			29344	protein-coding gene	gene with protein product		612699				11258795, 17855024	Standard	NM_015672		Approved	KIAA1666, RIMBP3.1, RIMBP3A	uc002zsd.4	Q9UFD9	OTTHUMG00000188355	ENST00000426804.1:c.3181dupG	22.37:g.20458122_20458122dupC	ENSP00000391564:p.Pro1061fs		Q8IYP7|Q9BY94|Q9UFQ5	Frame_Shift_Ins	INS	ENST00000426804.1	37	CCDS46665.1																																																																																				0.653	RIMBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318945.2		NM_015672	
SCFD2	152579	hgsc.bcm.edu;ucsc.edu	37	4	53752026	53752026	+	Missense_Mutation	SNP	C	C	A	rs141706393	byFrequency	TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr4:53752026C>A	ENST00000401642.3	-	8	1983	c.1850G>T	c.(1849-1851)cGg>cTg	p.R617L	SCFD2_ENST00000388940.4_Missense_Mutation_p.R572L	NM_152540.3	NP_689753.2	Q8WU76	SCFD2_HUMAN	sec1 family domain containing 2	617					protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)			p.R617L(1)		breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	30			GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)			AGGATGAGGCCGGCTCACCTG	0.498																																																	1	Substitution - Missense(1)	kidney(1)											87.0	71.0	77.0					4																	53752026		2203	4300	6503	SO:0001583	missense	152579			AY299407	CCDS33984.1	4q12	2004-01-15			ENSG00000184178	ENSG00000184178			30676	protein-coding gene	gene with protein product						12477932	Standard	NM_152540		Approved	STXBP1L1, FLJ39514	uc003gzu.3	Q8WU76	OTTHUMG00000160588	ENST00000401642.3:c.1850G>T	4.37:g.53752026C>A	ENSP00000384182:p.Arg617Leu		Q8N5F3|Q8N8H0|Q96ED3	Missense_Mutation	SNP	ENST00000401642.3	37	CCDS33984.1	.	.	.	.	.	.	.	.	.	.	C	16.25	3.068851	0.55539	.	.	ENSG00000184178	ENST00000401642;ENST00000388940	T;T	0.79141	-0.96;-1.24	5.07	5.07	0.68467	.	0.000000	0.64402	D	0.000001	D	0.86719	0.6000	M	0.61703	1.905	0.54753	D	0.999985	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.88006	0.2759	10	0.72032	D	0.01	.	17.4297	0.87536	0.0:1.0:0.0:0.0	.	572;617	Q8WU76-2;Q8WU76	.;SCFD2_HUMAN	L	617;572	ENSP00000384182:R617L;ENSP00000373592:R572L	ENSP00000373592:R572L	R	-	2	0	SCFD2	53446783	1.000000	0.71417	1.000000	0.80357	0.205000	0.24178	5.410000	0.66381	2.373000	0.80994	0.561000	0.74099	CGG		0.498	SCFD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361311.3		NM_152540	
SEC31A	22872	hgsc.bcm.edu;ucsc.edu	37	4	83800058	83800058	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr4:83800058delG	ENST00000395310.2	-	4	409	c.227delC	c.(226-228)cctfs	p.P76fs	SEC31A_ENST00000436790.2_5'UTR|SEC31A_ENST00000505984.1_Frame_Shift_Del_p.P76fs|SEC31A_ENST00000348405.4_Frame_Shift_Del_p.P76fs|SEC31A_ENST00000443462.2_Frame_Shift_Del_p.P71fs|SEC31A_ENST00000505472.1_Frame_Shift_Del_p.P76fs|SEC31A_ENST00000508479.1_Frame_Shift_Del_p.P76fs|SEC31A_ENST00000355196.2_Frame_Shift_Del_p.P76fs|SEC31A_ENST00000311785.7_Frame_Shift_Del_p.P76fs|SEC31A_ENST00000500777.2_Frame_Shift_Del_p.P76fs|SEC31A_ENST00000432794.1_Frame_Shift_Del_p.P76fs|SEC31A_ENST00000448323.1_Frame_Shift_Del_p.P76fs|SEC31A_ENST00000508502.1_Frame_Shift_Del_p.P76fs|SEC31A_ENST00000513858.1_Frame_Shift_Del_p.P76fs|SEC31A_ENST00000326950.5_Frame_Shift_Del_p.P76fs|SEC31A_ENST00000509142.1_Frame_Shift_Del_p.P76fs	NM_001077207.2|NM_001077208.2|NM_014933.3	NP_001070675.1|NP_001070676.1|NP_055748.2	O94979	SC31A_HUMAN	SEC31 homolog A (S. cerevisiae)	76					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)|response to calcium ion (GO:0051592)	COPII vesicle coat (GO:0030127)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle (GO:0030134)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|vesicle coat (GO:0030120)	calcium-dependent protein binding (GO:0048306)		SEC31A/ALK(3)|SEC31A/JAK2(4)	breast(1)	1		Hepatocellular(203;0.114)				CATTTTATAAGGCCCCCAAAT	0.318																																																	0													46.0	45.0	46.0					4																	83800058		2203	4300	6503	SO:0001589	frameshift_variant	22872			AB018358	CCDS3596.1, CCDS3597.1, CCDS43244.1, CCDS47088.1, CCDS54773.1, CCDS75155.1, CCDS75156.1	4q21.3	2013-01-10	2006-10-05	2006-09-07	ENSG00000138674	ENSG00000138674		"""WD repeat domain containing"""	17052	protein-coding gene	gene with protein product		610257	"""SEC31-like 1 (S. cerevisiae)"", ""Sec31 homolog A (S. cerevisiae)"""	SEC31L1		10048485, 10788476	Standard	NM_001077206		Approved	KIAA0905, ABP125, ABP130	uc003hnh.3	O94979	OTTHUMG00000130297	ENST00000395310.2:c.227delC	4.37:g.83800058delG	ENSP00000378721:p.Pro76fs		B4DIW6|B7ZKZ7|B7ZL00|H7C2W3|Q17RR5|Q5H9P6|Q5XG74|Q659G7|Q6ZU90|Q7LCX9|Q86TJ0|Q8IZH4|Q9P048|Q9P0A6|Q9UM05|Q9UM06	Frame_Shift_Del	DEL	ENST00000395310.2	37	CCDS3596.1																																																																																				0.318	SEC31A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252640.1		NM_016211	
SLC7A3	84889	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	70147814	70147814	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chrX:70147814A>C	ENST00000374299.3	-	6	1021	c.877T>G	c.(877-879)Tct>Gct	p.S293A	SLC7A3_ENST00000298085.4_Missense_Mutation_p.S293A			Q8WY07	CTR3_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 3	293					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	arginine transmembrane transporter activity (GO:0015181)|L-lysine transmembrane transporter activity (GO:0015189)	p.S293A(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(9)|ovary(1)|urinary_tract(1)	31	Renal(35;0.156)				L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	AAGCAGACAGACAGTGAGATC	0.517																																																	1	Substitution - Missense(1)	kidney(1)											161.0	130.0	140.0					X																	70147814		2203	4300	6503	SO:0001583	missense	84889			AF320612	CCDS14404.1	Xq12	2013-05-22			ENSG00000165349	ENSG00000165349		"""Solute carriers"""	11061	protein-coding gene	gene with protein product		300443				11591158	Standard	NM_001048164		Approved	CAT-3, ATRC3, FLJ14541	uc004dyn.3	Q8WY07	OTTHUMG00000021780	ENST00000374299.3:c.877T>G	X.37:g.70147814A>C	ENSP00000363417:p.Ser293Ala		D3DVU7|Q5JQR2|Q8N185|Q8NCA7|Q96SZ7	Missense_Mutation	SNP	ENST00000374299.3	37	CCDS14404.1	.	.	.	.	.	.	.	.	.	.	A	7.911	0.736472	0.15574	.	.	ENSG00000165349	ENST00000374299;ENST00000298085	D;D	0.88664	-2.41;-2.41	5.25	4.09	0.47781	Amino acid permease domain (1);	0.534910	0.21778	N	0.069246	T	0.77691	0.4168	N	0.13235	0.315	0.09310	N	1	B	0.02656	0.0	B	0.16722	0.016	T	0.66716	-0.5853	10	0.56958	D	0.05	.	5.4545	0.16582	0.692:0.0:0.308:0.0	.	293	Q8WY07	CTR3_HUMAN	A	293	ENSP00000363417:S293A;ENSP00000298085:S293A	ENSP00000298085:S293A	S	-	1	0	SLC7A3	70064539	1.000000	0.71417	0.001000	0.08648	0.116000	0.19942	6.160000	0.71862	0.817000	0.34445	0.430000	0.28490	TCT		0.517	SLC7A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057080.1		NM_032803	
SLC9A9	285195	broad.mit.edu	37	3	143567237	143567237	+	De_novo_Start_OutOfFrame	SNP	G	G	T			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr3:143567237G>T	ENST00000316549.6	-	0	136				SLC9A9_ENST00000498717.2_5'UTR	NM_173653.3	NP_775924.1	Q8IVB4	SL9A9_HUMAN	solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9						ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|recycling endosome (GO:0055037)	sodium:proton antiporter activity (GO:0015385)			breast(2)|endometrium(5)|kidney(2)|large_intestine(13)|lung(29)|ovary(2)|skin(3)|stomach(1)	57						GCCTAAGACAGTCTGACTGCC	0.418																																																	0																																												285195			AY254100	CCDS33872.1	3q23-q24	2014-01-28	2012-03-22		ENSG00000181804	ENSG00000181804		"""Solute carriers"""	20653	protein-coding gene	gene with protein product		608396	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 9"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 9"""			14569117	Standard	NM_173653		Approved	FLJ35613, NHE9	uc003evn.3	Q8IVB4	OTTHUMG00000159373	ENST00000316549.6:c.-73C>A	3.37:g.143567237G>T			A6NMQ9|Q3LIC2|Q5JPI6|Q5WA58|Q8NAB9	Translation_Start_Site	SNP	ENST00000316549.6	37	CCDS33872.1																																																																																				0.418	SLC9A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354994.1		NM_173653	
SMC3	9126	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	112340772	112340772	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr10:112340772A>T	ENST00000361804.4	+	8	666	c.540A>T	c.(538-540)aaA>aaT	p.K180N	SMC3_ENST00000462899.1_3'UTR	NM_005445.3	NP_005436.1	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	180					DNA repair (GO:0006281)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid cohesion (GO:0007064)|mitotic spindle organization (GO:0007052)|negative regulation of DNA endoreduplication (GO:0032876)|regulation of DNA replication (GO:0006275)|signal transduction (GO:0007165)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	basement membrane (GO:0005604)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cohesin core heterodimer (GO:0008280)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear matrix (GO:0016363)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|dynein binding (GO:0045502)|microtubule motor activity (GO:0003777)|protein heterodimerization activity (GO:0046982)	p.K180N(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		CCTTAATGAAAGAAACAGGTA	0.368																																																	1	Substitution - Missense(1)	kidney(1)											84.0	84.0	84.0					10																	112340772		2203	4300	6503	SO:0001583	missense	9126			AF020043	CCDS31285.1	10q25	2014-09-17	2006-07-06	2006-07-06	ENSG00000108055	ENSG00000108055		"""Structural maintenance of chromosomes proteins"", ""Proteoglycans / Extracellular Matrix : Other"""	2468	protein-coding gene	gene with protein product	"""bamacan proteoglycan"""	606062	"""chondroitin sulfate proteoglycan 6 (bamacan)"""	CSPG6		9506951, 10358101	Standard	NM_005445		Approved	HCAP, BAM, SMC3L1, bamacan	uc001kze.3	Q9UQE7	OTTHUMG00000019042	ENST00000361804.4:c.540A>T	10.37:g.112340772A>T	ENSP00000354720:p.Lys180Asn		A8K156|O60464|Q5T482	Missense_Mutation	SNP	ENST00000361804.4	37	CCDS31285.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.157685	0.78114	.	.	ENSG00000108055	ENST00000361804	T	0.76186	-1.0	5.33	3.01	0.34805	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	T	0.70360	0.3215	N	0.20986	0.625	0.80722	D	1	D	0.67145	0.996	P	0.61658	0.892	T	0.63603	-0.6600	10	0.22109	T	0.4	.	8.8553	0.35225	0.8435:0.0:0.1565:0.0	.	180	Q9UQE7	SMC3_HUMAN	N	180	ENSP00000354720:K180N	ENSP00000354720:K180N	K	+	3	2	SMC3	112330762	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.191000	0.42640	0.447000	0.26695	0.472000	0.43445	AAA		0.368	SMC3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050337.1		NM_005445	
SRSF7	6432	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	38975784	38975784	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr2:38975784C>A	ENST00000313117.6	-	4	635	c.398G>T	c.(397-399)aGa>aTa	p.R133I	GEMIN6_ENST00000409011.1_5'Flank|SRSF7_ENST00000446327.2_Missense_Mutation_p.R133I|SRSF7_ENST00000409276.1_Missense_Mutation_p.R133I	NM_001031684.2|NM_001195446.1	NP_001026854.1|NP_001182375.1	Q16629	SRSF7_HUMAN	serine/arginine-rich splicing factor 7	133	Arg/Ser-rich (RS domain).				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.R133I(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12						AGAATGTGATCTAGACCGTGA	0.403																																																	1	Substitution - Missense(1)	kidney(1)											92.0	93.0	93.0					2																	38975784		2203	4300	6503	SO:0001583	missense	6432			L41887	CCDS33183.1, CCDS56115.1	2p22.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000115875	ENSG00000115875		"""Zinc fingers, CCHC domain containing"", ""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10789	protein-coding gene	gene with protein product	"""SR splicing factor 7"""	600572	"""splicing factor, arginine/serine-rich 7 (35kD)"", ""splicing factor, arginine/serine-rich 7, 35kDa"""	SFRS7		8013463, 20516191	Standard	NM_001031684		Approved	9G8, ZCRB2, HSSG1, AAG3, RBM37, ZCCHC20	uc002rqz.3	Q16629	OTTHUMG00000102076	ENST00000313117.6:c.398G>T	2.37:g.38975784C>A	ENSP00000325905:p.Arg133Ile		B4DLU6|G5E9M3|Q564D3	Missense_Mutation	SNP	ENST00000313117.6	37	CCDS33183.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.36|13.36	2.213879|2.213879	0.39102|0.39102	.|.	.|.	ENSG00000115875|ENSG00000115875	ENST00000313117;ENST00000446327;ENST00000409276|ENST00000452806	T;T;T|.	0.14022|.	2.55;2.54;3.02|.	5.95|5.95	5.95|5.95	0.96441|0.96441	.|.	0.000000|.	0.64402|.	D|.	0.000004|.	D|.	0.84566|.	0.5500|.	M|M	0.87180|0.87180	2.865|2.865	0.80722|0.80722	D|D	1|1	D;D|.	0.69078|.	0.997;0.995|.	D;D|.	0.78314|.	0.991;0.979|.	D|.	0.85108|.	0.0961|.	10|.	0.33141|.	T|.	0.24|.	.|.	20.3932|20.3932	0.98965|0.98965	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	133;133|.	G5E9M3;Q16629|.	.;SRSF7_HUMAN|.	I|Y	133|16	ENSP00000325905:R133I;ENSP00000402264:R133I;ENSP00000386806:R133I|.	ENSP00000325905:R133I|.	R|X	-|-	2|3	0|2	SRSF7|SRSF7	38829288|38829288	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	6.430000|6.430000	0.73391|0.73391	2.824000|2.824000	0.97209|0.97209	0.655000|0.655000	0.94253|0.94253	AGA|TAG		0.403	SRSF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219889.2		NM_001031684	
STAG3L2	442582	broad.mit.edu	37	7	74300557	74300564	+	RNA	DEL	AGAGCTCC	AGAGCTCC	-	rs367732188		TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	AGAGCTCC	AGAGCTCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr7:74300557_74300564delAGAGCTCC	ENST00000423186.1	-	0	573_580							P0CL84	ST3L2_HUMAN	stromal antigen 3-like 2 (pseudogene)							nucleus (GO:0005634)		p.E82fs*32(2)		breast(1)|central_nervous_system(1)|large_intestine(1)|lung(1)|pancreas(1)	5						CGGCCAGTGAAGAGCTCCAGGCGTGCGG	0.572																																																	2	Deletion - Frameshift(2)	large_intestine(1)|central_nervous_system(1)								96,356		38,20,168							0.0			1	208,1036		88,32,502	no	frameshift	STAG3L2	NM_001025202.2		126,52,670	A1A1,A1R,RR		16.7203,21.2389,17.9245				304,1392						442582					7q11.23	2013-06-26	2013-06-26			ENSG00000277072			33886	pseudogene	pseudogene			"""stromal antigen 3-like 2"""				Standard	NR_040584		Approved	MGC131759, STAG3L2P	uc011kfj.2	P0CL84	OTTHUMG00000156216		7.37:g.74300557_74300564delAGAGCTCC			A6NMT8|A8K0A1|Q32NE4|Q6NXR2|Q7L5M5|Q7Z5K6	Frame_Shift_Del	DEL	ENST00000423186.1	37																																																																																					0.572	STAG3L2-002	KNOWN	basic	retained_intron	pseudogene	OTTHUMT00000343523.2		NM_001025202	
SUPT6H	6830	hgsc.bcm.edu	37	17	27027220	27027225	+	In_Frame_Del	DEL	CGGACA	CGGACA	-			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	CGGACA	CGGACA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr17:27027220_27027225delCGGACA	ENST00000314616.6	+	34	4874_4879	c.4591_4596delCGGACA	c.(4591-4596)cggacadel	p.RT1531del	SUPT6H_ENST00000347486.4_In_Frame_Del_p.RT1531del	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	1531					chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					CAGCAGGACCCGGACACCTGCCTCTA	0.524																																																	0																																										SO:0001651	inframe_deletion	6830			U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.4591_4596delCGGACA	17.37:g.27027220_27027225delCGGACA	ENSP00000319104:p.Arg1531_Thr1532del		A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	In_Frame_Del	DEL	ENST00000314616.6	37	CCDS32596.1																																																																																				0.524	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2		NM_003170	
TCF3	6929	broad.mit.edu	37	19	1623968	1623968	+	Silent	SNP	C	C	T	rs199702817		TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr19:1623968C>T	ENST00000262965.5	-	8	875	c.531G>A	c.(529-531)ccG>ccA	p.P177P	TCF3_ENST00000395423.3_Silent_p.P126P|TCF3_ENST00000588136.1_Silent_p.P177P|TCF3_ENST00000344749.5_Silent_p.P177P|TCF3_ENST00000453954.2_Silent_p.P93P	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0	Pro-rich.				anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.P177P(2)		breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAAGACCCGGCGGGACCTTCC	0.632			T	"""PBX1, HLF, TFPT"""	pre B-ALL								C|||	1	0.000199681	0.0	0.0014	5008	,	,		16329	0.0		0.0	False		,,,				2504	0.0							Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	2	Substitution - coding silent(2)	kidney(2)											55.0	58.0	57.0					19																	1623968		2202	4300	6502	SO:0001819	synonymous_variant	6929			M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.531G>A	19.37:g.1623968C>T			Q53R97|Q6PD70|Q9NP00	Silent	SNP	ENST00000262965.5	37	CCDS12074.1																																																																																				0.632	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1		NM_003200	
TMEM132D	121256	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	129559305	129559305	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr12:129559305G>T	ENST00000422113.2	-	9	2741	c.2415C>A	c.(2413-2415)aaC>aaA	p.N805K	TMEM132D_ENST00000389441.4_Missense_Mutation_p.N343K	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	805					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)		p.N805K(1)		NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		TGTCACTGGTGTTGGGGTTAG	0.483																																																	1	Substitution - Missense(1)	kidney(1)											179.0	143.0	155.0					12																	129559305		2203	4300	6503	SO:0001583	missense	121256			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.2415C>A	12.37:g.129559305G>T	ENSP00000408581:p.Asn805Lys		Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	ENST00000422113.2	37	CCDS9266.1	.	.	.	.	.	.	.	.	.	.	G	0.326	-0.958852	0.02267	.	.	ENSG00000151952	ENST00000389441;ENST00000422113	T;T	0.13089	2.62;2.62	4.2	0.102	0.14522	.	1.429480	0.04278	N	0.343274	T	0.10465	0.0256	L	0.32530	0.975	0.09310	N	1	B;P	0.39282	0.047;0.666	B;B	0.33454	0.02;0.164	T	0.34925	-0.9809	9	.	.	.	-45.0579	8.1504	0.31137	0.3358:0.0:0.6642:0.0	.	805;343	Q14C87;Q14C87-2	T132D_HUMAN;.	K	343;805	ENSP00000374092:N343K;ENSP00000408581:N805K	.	N	-	3	2	TMEM132D	128125258	0.002000	0.14202	0.069000	0.20011	0.380000	0.30137	0.017000	0.13399	-0.226000	0.09899	0.462000	0.41574	AAC		0.483	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1		NM_133448	
UBA2	10054	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	34959981	34959981	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr19:34959981A>C	ENST00000246548.4	+	17	1848	c.1778A>C	c.(1777-1779)gAt>gCt	p.D593A	UBA2_ENST00000439527.2_Missense_Mutation_p.D497A|UBA2_ENST00000592791.1_Missense_Mutation_p.D119A|UBA2_ENST00000588585.1_3'UTR	NM_005499.2	NP_005490.1	Q9UBT2	SAE2_HUMAN	ubiquitin-like modifier activating enzyme 2	593					cellular protein metabolic process (GO:0044267)|positive regulation of catalytic activity (GO:0043085)|post-translational protein modification (GO:0043687)|protein sumoylation (GO:0016925)|SMT3-dependent protein catabolic process (GO:0019950)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|SUMO activating enzyme complex (GO:0031510)	ATP binding (GO:0005524)|enzyme activator activity (GO:0008047)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|SUMO activating enzyme activity (GO:0019948)	p.D593A(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	20	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			GTTGATTCAGATGAAGAAGAT	0.413																																																	1	Substitution - Missense(1)	kidney(1)											35.0	33.0	34.0					19																	34959981		2203	4300	6503	SO:0001583	missense	10054			BC003153	CCDS12439.1	19q13.11	2008-02-05	2007-11-30	2007-11-30		ENSG00000126261		"""Ubiquitin-like modifier activating enzymes"""	30661	protein-coding gene	gene with protein product	"""UBA2, ubiquitin-activating enzyme E1 homolog (yeast)"""	613295	"""SUMO1 activating enzyme subunit 2"""	SAE2		10187858, 9920803	Standard	NM_005499		Approved	FLJ13058, HRIHFB2115, ARX	uc002nvk.3	Q9UBT2		ENST00000246548.4:c.1778A>C	19.37:g.34959981A>C	ENSP00000246548:p.Asp593Ala		B3KWB9|O95605|Q59H87|Q6IBP6|Q9NTJ1|Q9UED2	Missense_Mutation	SNP	ENST00000246548.4	37	CCDS12439.1	.	.	.	.	.	.	.	.	.	.	A	11.57	1.678312	0.29783	.	.	ENSG00000126261	ENST00000246548;ENST00000439527	T;T	0.59224	0.28;1.44	5.8	5.8	0.92144	.	0.095414	0.64402	D	0.000001	T	0.53498	0.1800	L	0.51422	1.61	0.80722	D	1	B	0.12630	0.006	B	0.11329	0.006	T	0.49163	-0.8968	10	0.41790	T	0.15	-21.3697	15.1198	0.72434	1.0:0.0:0.0:0.0	.	593	Q9UBT2	SAE2_HUMAN	A	593;497	ENSP00000246548:D593A;ENSP00000437484:D497A	ENSP00000246548:D593A	D	+	2	0	UBA2	39651821	1.000000	0.71417	0.994000	0.49952	0.370000	0.29829	5.515000	0.67049	2.207000	0.71202	0.455000	0.32223	GAT		0.413	UBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459257.3		NM_005499	
VHL	7428	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	10191513	10191513	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr3:10191513T>C	ENST00000256474.2	+	3	1346	c.506T>C	c.(505-507)cTa>cCa	p.L169P	VHL_ENST00000345392.2_Missense_Mutation_p.L128P|VHL_ENST00000477538.1_3'UTR	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	169					cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.L169P(11)|p.L169fs*33(2)|p.S168fs*3(1)|p.V170fs*31(1)|p.L169_V170del(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GTCCGGAGCCTAGTCAAGCCT	0.517		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	16	Substitution - Missense(11)|Deletion - Frameshift(4)|Deletion - In frame(1)	kidney(16)	GRCh37	CM003060	VHL	M							95.0	86.0	89.0					3																	10191513		2203	4300	6503	SO:0001583	missense	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.506T>C	3.37:g.10191513T>C	ENSP00000256474:p.Leu169Pro		B2RE45|Q13599|Q6PDA9	Missense_Mutation	SNP	ENST00000256474.2	37	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	T	19.65	3.866443	0.72065	.	.	ENSG00000134086	ENST00000256474;ENST00000345392;ENST00000450183	D;D	0.99856	-7.21;-7.21	4.86	4.86	0.63082	von Hippel-Lindau disease tumour suppressor, beta/alpha domain (2);von Hippel-Lindau disease tumor suppressor, alpha domain (1);	0.000000	0.64402	D	0.000004	D	0.99782	0.9909	M	0.70275	2.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.96607	0.9449	10	0.87932	D	0	-8.7798	12.7224	0.57149	0.0:0.0:0.0:1.0	.	128;169	P40337-2;P40337	.;VHL_HUMAN	P	169;128;87	ENSP00000256474:L169P;ENSP00000344757:L128P	ENSP00000256474:L169P	L	+	2	0	VHL	10166513	1.000000	0.71417	0.937000	0.37676	0.716000	0.41182	5.790000	0.69038	2.162000	0.67917	0.533000	0.62120	CTA		0.517	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
WDR46	9277	broad.mit.edu;ucsc.edu	37	6	33255942	33255942	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr6:33255942T>G	ENST00000374617.4	-	5	900	c.544A>C	c.(544-546)Att>Ctt	p.I182L	PFDN6_ENST00000463584.1_5'Flank|WDR46_ENST00000477718.1_5'UTR|PFDN6_ENST00000374606.5_5'Flank|PFDN6_ENST00000374607.1_5'Flank|PFDN6_ENST00000374610.2_5'Flank|PFDN6_ENST00000395131.1_5'Flank	NM_001164267.1|NM_005452.5	NP_001157739.1|NP_005443.3	O15213	WDR46_HUMAN	WD repeat domain 46	182							poly(A) RNA binding (GO:0044822)	p.I182L(1)		NS(1)|breast(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)	20						GCACTTGCAATGTCCACAGCC	0.522																																																	1	Substitution - Missense(1)	kidney(1)											348.0	331.0	337.0					6																	33255942		2203	4300	6503	SO:0001583	missense	9277			Z97184	CCDS4772.1	6p21.3	2013-01-09	2005-05-31	2005-05-31	ENSG00000227057	ENSG00000227057		"""WD repeat domain containing"""	13923	protein-coding gene	gene with protein product		611440	"""chromosome 6 open reading frame 11"""	C6orf11		9545376, 9521053	Standard	NM_005452		Approved	BING4, UTP7	uc003ods.3	O15213	OTTHUMG00000031192	ENST00000374617.4:c.544A>C	6.37:g.33255942T>G	ENSP00000363746:p.Ile182Leu		A6NDP5|Q5HYZ0|Q5STK5|Q5STR3	Missense_Mutation	SNP	ENST00000374617.4	37	CCDS4772.1	.	.	.	.	.	.	.	.	.	.	T	16.40	3.112963	0.56398	.	.	ENSG00000227057	ENST00000374617;ENST00000444176	T;T	0.24151	2.0;1.87	4.28	4.28	0.50868	.	0.000000	0.85682	D	0.000000	T	0.14270	0.0345	L	0.46157	1.445	0.80722	D	1	P;P	0.49961	0.93;0.874	P;B	0.45138	0.471;0.279	T	0.02404	-1.1164	10	0.30078	T	0.28	-11.0961	11.4139	0.49941	0.0:0.0:0.0:1.0	.	128;182	B4DP15;O15213	.;WDR46_HUMAN	L	182;117	ENSP00000363746:I182L;ENSP00000405568:I117L	ENSP00000363746:I182L	I	-	1	0	WDR46	33363920	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.471000	0.73562	1.802000	0.52723	0.368000	0.22195	ATT		0.522	WDR46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076382.2		NM_005452	
ZNF716	441234	broad.mit.edu	37	7	57529077	57529077	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr7:57529077G>A	ENST00000420713.1	+	4	1022	c.910G>A	c.(910-912)Gcc>Acc	p.A304T		NM_001159279.1	NP_001152751.1	A6NP11	ZN716_HUMAN	zinc finger protein 716	304					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A304T(3)		breast(1)|kidney(1)|lung(20)|ovary(2)	24						ATGTGGCAAAGCCTTTAGCCG	0.423																																																	3	Substitution - Missense(3)	kidney(2)|skin(1)											38.0	38.0	38.0					7																	57529077		692	1591	2283	SO:0001583	missense	441234			AK131575	CCDS55112.1	7p11.1	2013-01-08			ENSG00000182111	ENSG00000182111		"""Zinc fingers, C2H2-type"", ""-"""	32458	protein-coding gene	gene with protein product							Standard	NM_001159279		Approved	FLJ46189	uc011kdi.1	A6NP11	OTTHUMG00000156689	ENST00000420713.1:c.910G>A	7.37:g.57529077G>A	ENSP00000394248:p.Ala304Thr			Missense_Mutation	SNP	ENST00000420713.1	37	CCDS55112.1	.	.	.	.	.	.	.	.	.	.	G	11.02	1.517455	0.27123	.	.	ENSG00000182111	ENST00000420713;ENST00000418732	T	0.00848	5.62	0.109	0.109	0.14578	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.00875	0.0029	N	0.11845	0.185	0.22127	N	0.999344	P	0.48230	0.907	P	0.48873	0.593	T	0.52837	-0.8522	9	0.49607	T	0.09	.	2.9432	0.05837	2.0E-4:2.0E-4:0.51:0.4896	.	292	A6NP11	ZN716_HUMAN	T	304;292	ENSP00000394248:A304T	ENSP00000387687:A292T	A	+	1	0	ZNF716	57533019	0.000000	0.05858	0.154000	0.22540	0.154000	0.21943	-0.510000	0.06328	0.181000	0.19994	0.184000	0.17185	GCC		0.423	ZNF716-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345309.1		NM_001159279	
ZRANB1	54764	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	126671767	126671767	+	Silent	SNP	G	G	A	rs75293113	byFrequency	TCGA-B0-4945-01A-01D-1421-08	TCGA-B0-4945-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9fae377f-6c63-4f47-a769-a1396fb15f56	c3df2623-db3a-4d8f-a062-5d2a7ec550a7	g.chr10:126671767G>A	ENST00000359653.4	+	7	1943	c.1572G>A	c.(1570-1572)acG>acA	p.T524T	ZRANB1_ENST00000471421.1_3'UTR	NM_017580.2	NP_060050.2	Q9UGI0	ZRAN1_HUMAN	zinc finger, RAN-binding domain containing 1	524	OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.|TRAF-binding.				cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|positive regulation of Wnt signaling pathway (GO:0030177)|protein deubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0071947)|protein K29-linked deubiquitination (GO:0035523)|protein K33-linked deubiquitination (GO:1990168)|protein K63-linked deubiquitination (GO:0070536)|regulation of cell morphogenesis (GO:0022604)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.T524T(1)		NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	23		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.172)		Colorectal(40;0.113)|COAD - Colon adenocarcinoma(40;0.119)		TGGAGCAGACGCACATTTTTG	0.363																																																	1	Substitution - coding silent(1)	kidney(1)											96.0	102.0	100.0					10																	126671767		2203	4300	6503	SO:0001819	synonymous_variant	54764			AJ252060	CCDS7642.1	10q26.12	2014-02-24			ENSG00000019995	ENSG00000019995		"""Zinc fingers, RAN-binding domain containing"", ""OTU domain containing"""	18224	protein-coding gene	gene with protein product		611749				11463333	Standard	NM_017580		Approved	TRABID	uc001lic.3	Q9UGI0	OTTHUMG00000019223	ENST00000359653.4:c.1572G>A	10.37:g.126671767G>A			B4DZ98|D3DRF4|Q5SQP6|Q69YK3	Silent	SNP	ENST00000359653.4	37	CCDS7642.1																																																																																				0.363	ZRANB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050898.1		NM_017580	
