#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TMEM201	199953	hgsc.bcm.edu	37	1	9656944	9656944	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr1:9656944G>A	ENST00000340381.6	+	3	271	c.262G>A	c.(262-264)Gcc>Acc	p.A88T	TMEM201_ENST00000340305.5_Missense_Mutation_p.A88T|TMEM201_ENST00000377376.4_Missense_Mutation_p.A88T	NM_001130924.2	NP_001124396.2	Q5SNT2	TM201_HUMAN	transmembrane protein 201	88					fibroblast migration (GO:0010761)|nuclear migration (GO:0007097)	integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)				lung(3)|upper_aerodigestive_tract(1)	4	all_lung(157;0.222)	all_epithelial(116;2.09e-14)|Renal(390;0.000469)|all_lung(118;0.000521)|Lung NSC(185;0.000744)|Colorectal(325;0.0062)|Breast(348;0.0157)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.5e-08)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|STAD - Stomach adenocarcinoma(132;0.00345)|READ - Rectum adenocarcinoma(331;0.0419)		GCCGATCCCCGCCCAGTACTT	0.672																																					p.A88T		Atlas-SNP	.											TMEM201_ENST00000340381,NS,carcinoma,0,2	TMEM201	63	.	0			c.G262A						PASS	.						66.0	60.0	62.0					1																	9656944		2203	4300	6503	SO:0001583	missense	199953	exon3			ATCCCCGCCCAGT		CCDS30579.1, CCDS44055.1, CCDS44055.2	1p36.22	2009-11-06			ENSG00000188807	ENSG00000188807			33719	protein-coding gene	gene with protein product							Standard	NM_001130924		Approved	RP13-15M17.2, NET5	uc021ofy.1	Q5SNT2	OTTHUMG00000057457	ENST00000340381.6:c.262G>A	chr1.hg19:g.9656944G>A	ENSP00000344503:p.Ala88Thr	102.0	0.0	.		58.0	19.0	.	NM_001010866	B9EH90|Q5SNT3	Missense_Mutation	SNP	ENST00000340381.6	hg19	CCDS44055.2	.	.	.	.	.	.	.	.	.	.	G	36	5.608642	0.96626	.	.	ENSG00000188807	ENST00000377376;ENST00000340305;ENST00000340381	.	.	.	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.77572	0.4150	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.97110	1.0;0.952	T	0.79090	-0.1946	9	0.59425	D	0.04	-25.3478	16.0587	0.80822	0.0:0.0:1.0:0.0	.	88;88	E9PBR6;Q5SNT2-2	.;.	T	88	.	ENSP00000344772:A88T	A	+	1	0	TMEM201	9579531	1.000000	0.71417	0.952000	0.39060	0.975000	0.68041	9.102000	0.94226	2.447000	0.82792	0.655000	0.94253	GCC	.	.	.	none		0.672	TMEM201-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127672.1	NM_001010866	
ZBTB40	9923	hgsc.bcm.edu	37	1	22850847	22850847	+	Silent	SNP	C	C	A			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr1:22850847C>A	ENST00000375647.4	+	17	3642	c.3435C>A	c.(3433-3435)acC>acA	p.T1145T	ZBTB40_ENST00000404138.1_Silent_p.T1145T|ZBTB40_ENST00000374651.4_Silent_p.T1033T	NM_014870.3	NP_055685.3	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	1145					bone mineralization (GO:0030282)|cellular response to DNA damage stimulus (GO:0006974)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(4)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)		AACTCTTCACCTCCCAGGCCC	0.577																																					p.T1145T		Atlas-SNP	.											.	ZBTB40	87	.	0			c.C3435A						PASS	.						78.0	76.0	76.0					1																	22850847		2203	4300	6503	SO:0001819	synonymous_variant	9923	exon18			CTTCACCTCCCAG	AB007947	CCDS224.1	1p36	2013-01-08			ENSG00000184677	ENSG00000184677		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	29045	protein-coding gene	gene with protein product		612106					Standard	NM_014870		Approved	KIAA0478, ZNF923	uc001bfu.2	Q9NUA8	OTTHUMG00000002897	ENST00000375647.4:c.3435C>A	chr1.hg19:g.22850847C>A		91.0	0.0	.		35.0	8.0	.	NM_001083621	O75066|Q5TFU5|Q8N1R1	Silent	SNP	ENST00000375647.4	hg19	CCDS224.1																																																																																			.	.	.	none		0.577	ZBTB40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008094.1	NM_014870	
DLGAP3	58512	hgsc.bcm.edu	37	1	35365842	35365842	+	Silent	SNP	G	G	A	rs149715442		TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr1:35365842G>A	ENST00000373347.1	-	4	1408	c.1140C>T	c.(1138-1140)acC>acT	p.T380T	DLGAP3_ENST00000235180.4_Silent_p.T380T			O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated protein 3	380					cell-cell signaling (GO:0007267)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)	p.T380T(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|prostate(3)|skin(3)|urinary_tract(1)	46		Myeloproliferative disorder(586;0.0393)				CCTTGCCACCGGTGGGGTAAC	0.612																																					p.T380T		Atlas-SNP	.											DLGAP3,right_upper_lobe,carcinoma,0,2	DLGAP3	107	.	1	Substitution - coding silent(1)	lung(1)	c.C1140T						PASS	.	G		1,4405	2.1+/-5.4	0,1,2202	85.0	86.0	86.0		1140	-0.6	1.0	1	dbSNP_134	86	0,8600		0,0,4300	no	coding-synonymous	DLGAP3	NM_001080418.1		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		380/980	35365842	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	58512	exon2			GCCACCGGTGGGG	AF131778	CCDS30670.1	1p35.3-p34.1	2008-02-05			ENSG00000116544	ENSG00000116544			30368	protein-coding gene	gene with protein product		611413				8619474, 9110174	Standard	NM_001080418		Approved	SAPAP3, DAP3	uc001byc.3	O95886	OTTHUMG00000004049	ENST00000373347.1:c.1140C>T	chr1.hg19:g.35365842G>A		234.0	0.0	.		113.0	43.0	.	NM_001080418	Q5TDD5|Q9H3X7	Silent	SNP	ENST00000373347.1	hg19	CCDS30670.1																																																																																			.	G|1.000;A|0.000	0.000	weak		0.612	DLGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011554.1	NM_021234	
ROR1	4919	hgsc.bcm.edu	37	1	64603076	64603076	+	Missense_Mutation	SNP	C	C	A			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr1:64603076C>A	ENST00000371079.1	+	5	882	c.507C>A	c.(505-507)ttC>ttA	p.F169L	ROR1_ENST00000545203.1_5'UTR|ROR1_ENST00000371080.1_Missense_Mutation_p.F169L|RP11-24J23.2_ENST00000424995.1_RNA|ROR1_ENST00000482426.1_3'UTR	NM_005012.3	NP_005003.2	Q01973	ROR1_HUMAN	receptor tyrosine kinase-like orphan receptor 1	169	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				peptidyl-tyrosine phosphorylation (GO:0018108)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			breast(7)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(10)|ovary(6)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	51						AAGATGGATTCTGTCAGCCAT	0.443																																					p.F169L		Atlas-SNP	.											.	ROR1	113	.	0			c.C507A						PASS	.						162.0	158.0	159.0					1																	64603076		2203	4300	6503	SO:0001583	missense	4919	exon5			TGGATTCTGTCAG	M97675	CCDS626.1, CCDS41344.1	1p32-p31	2013-01-11			ENSG00000185483	ENSG00000185483		"""Immunoglobulin superfamily / I-set domain containing"""	10256	protein-coding gene	gene with protein product		602336		NTRKR1		1334494, 8875995	Standard	NM_001083592		Approved		uc001dbj.3	Q01973	OTTHUMG00000009022	ENST00000371079.1:c.507C>A	chr1.hg19:g.64603076C>A	ENSP00000360120:p.Phe169Leu	163.0	0.0	.		108.0	44.0	.	NM_001083592	Q5VVX6|Q66K77|Q92776	Missense_Mutation	SNP	ENST00000371079.1	hg19	CCDS626.1	.	.	.	.	.	.	.	.	.	.	C	18.56	3.651034	0.67472	.	.	ENSG00000185483	ENST00000371080;ENST00000371079;ENST00000544776	T;T	0.75154	0.01;-0.91	6.07	5.16	0.70880	Frizzled domain (1);	0.000000	0.44902	D	0.000404	T	0.59211	0.2177	L	0.59436	1.845	0.80722	D	1	B;B	0.33477	0.413;0.243	B;B	0.35114	0.196;0.068	T	0.67233	-0.5722	10	0.72032	D	0.01	.	9.7049	0.40209	0.0:0.8053:0.0:0.1947	.	169;169	Q01973;Q66K77	ROR1_HUMAN;.	L	169;169;172	ENSP00000360121:F169L;ENSP00000360120:F169L	ENSP00000360120:F169L	F	+	3	2	ROR1	64375664	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.658000	0.37376	1.571000	0.49722	0.655000	0.94253	TTC	.	.	.	none		0.443	ROR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025002.1	NM_005012	
ATP1B1	481	hgsc.bcm.edu	37	1	169096573	169096573	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr1:169096573A>T	ENST00000367816.1	+	5	1023	c.494A>T	c.(493-495)gAa>gTa	p.E165V	ATP1B1_ENST00000499679.3_Missense_Mutation_p.E109V|ATP1B1_ENST00000367815.4_Missense_Mutation_p.E165V|ATP1B1_ENST00000367813.3_Missense_Mutation_p.E157V			P05026	AT1B1_HUMAN	ATPase, Na+/K+ transporting, beta 1 polypeptide	165					blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular potassium ion homeostasis (GO:0030007)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|leukocyte migration (GO:0050900)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|positive regulation of ATP catabolic process (GO:1903291)|positive regulation of ATPase activity (GO:0032781)|positive regulation of calcium:sodium antiporter activity (GO:1903281)|positive regulation of potassium ion import (GO:1903288)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of sodium ion export from cell (GO:1903278)|potassium ion import (GO:0010107)|protein localization to plasma membrane (GO:0072659)|protein stabilization (GO:0050821)|protein transport into plasma membrane raft (GO:0044861)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression (GO:0010468)|relaxation of cardiac muscle (GO:0055119)|response to hypoxia (GO:0001666)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|vesicle (GO:0031982)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|MHC class II protein complex binding (GO:0023026)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	14	all_hematologic(923;0.208)					TTAAATGATGAAACTTATGGC	0.393																																					p.E165V		Atlas-SNP	.											.	ATP1B1	29	.	0			c.A494T						PASS	.						104.0	101.0	102.0					1																	169096573		2203	4300	6503	SO:0001583	missense	481	exon4			ATGATGAAACTTA	U16799	CCDS1276.1	1q24.2	2012-10-22			ENSG00000143153	ENSG00000143153		"""ATPases / P-type"""	804	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit beta-1"", ""sodium pump subunit beta-1"", ""sodium-potassium ATPase subunit beta 1 (non-catalytic)"""	182330		ATP1B			Standard	NM_001677		Approved		uc001gfr.1	P05026	OTTHUMG00000034590	ENST00000367816.1:c.494A>T	chr1.hg19:g.169096573A>T	ENSP00000356790:p.Glu165Val	110.0	0.0	.		60.0	25.0	.	NM_001677	Q5TGZ3	Missense_Mutation	SNP	ENST00000367816.1	hg19	CCDS1276.1	.	.	.	.	.	.	.	.	.	.	A	12.14	1.849985	0.32699	.	.	ENSG00000143153	ENST00000367816;ENST00000367815;ENST00000499679;ENST00000367813	T;T;T;T	0.32515	1.45;1.45;1.45;1.45	6.02	4.84	0.62591	.	0.673655	0.16466	N	0.213169	T	0.17450	0.0419	L	0.55481	1.735	0.25560	N	0.987001	B	0.11235	0.004	B	0.12156	0.007	T	0.06058	-1.0848	9	0.48119	T	0.1	-7.8189	12.903	0.58135	0.7578:0.2422:0.0:0.0	.	165	P05026	AT1B1_HUMAN	V	165;165;109;157	ENSP00000356790:E165V;ENSP00000356789:E165V;ENSP00000423450:E109V;ENSP00000356787:E157V	ENSP00000356787:E157V	E	+	2	0	ATP1B1	167363197	0.003000	0.15002	0.866000	0.34008	0.333000	0.28666	1.278000	0.33179	2.311000	0.77944	0.533000	0.62120	GAA	.	.	.	none		0.393	ATP1B1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083696.1		
NMNAT2	23057	hgsc.bcm.edu	37	1	183253891	183253891	+	Missense_Mutation	SNP	G	G	C			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr1:183253891G>C	ENST00000287713.6	-	6	817	c.483C>G	c.(481-483)agC>agG	p.S161R	NMNAT2_ENST00000473046.1_5'UTR|NMNAT2_ENST00000294868.4_Missense_Mutation_p.S156R	NM_015039.3	NP_055854.1	Q9BZQ4	NMNA2_HUMAN	nicotinamide nucleotide adenylyltransferase 2	161					NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|late endosome (GO:0005770)|synapse (GO:0045202)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|nicotinamide-nucleotide adenylyltransferase activity (GO:0000309)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)			endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(7)|skin(2)	18						AGCAGATCCGGCTGAGGCTTT	0.542																																					p.S161R		Atlas-SNP	.											.	NMNAT2	48	.	0			c.C483G						PASS	.						58.0	59.0	59.0					1																	183253891		2203	4300	6503	SO:0001583	missense	23057	exon6			GATCCGGCTGAGG	AF288395	CCDS1353.1, CCDS1354.1	1q25	2008-02-05	2003-04-30	2003-05-02	ENSG00000157064	ENSG00000157064			16789	protein-coding gene	gene with protein product		608701	"""chromosome 1 open reading frame 15"""	C1orf15		11318611, 12359228	Standard	NM_015039		Approved	KIAA0479, PNAT2	uc001gqc.2	Q9BZQ4	OTTHUMG00000035519	ENST00000287713.6:c.483C>G	chr1.hg19:g.183253891G>C	ENSP00000287713:p.Ser161Arg	145.0	0.0	.		58.0	16.0	.	NM_015039	O75067|Q5T1Q3|Q8WU99|Q96QW1	Missense_Mutation	SNP	ENST00000287713.6	hg19	CCDS1353.1	.	.	.	.	.	.	.	.	.	.	.	15.18	2.757497	0.49468	.	.	ENSG00000157064	ENST00000287713;ENST00000294868	D;D	0.97430	-4.38;-4.24	5.32	5.32	0.75619	Cytidylyltransferase (1);	0.248777	0.46758	D	0.000270	D	0.94945	0.8365	N	0.08118	0	0.44254	D	0.997101	D;P;B	0.62365	0.991;0.918;0.226	D;P;B	0.64877	0.93;0.604;0.246	D	0.92751	0.6216	10	0.16420	T	0.52	-14.3221	13.3395	0.60537	0.0777:0.0:0.9223:0.0	.	161;161;156	A8K5S5;Q9BZQ4;Q9BZQ4-2	.;NMNA2_HUMAN;.	R	161;156	ENSP00000287713:S161R;ENSP00000294868:S156R	ENSP00000287713:S161R	S	-	3	2	NMNAT2	181520514	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.939000	0.28978	2.498000	0.84270	0.561000	0.74099	AGC	.	.	.	none		0.542	NMNAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086255.1		
USH2A	7399	hgsc.bcm.edu	37	1	215953196	215953196	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr1:215953196T>C	ENST00000307340.3	-	55	11314	c.10928A>G	c.(10927-10929)cAt>cGt	p.H3643R	USH2A_ENST00000366943.2_Missense_Mutation_p.H3643R	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3643	Fibronectin type-III 21. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TGTGACCGTATGCTGTCTCCT	0.483										HNSCC(13;0.011)																											p.H3643R		Atlas-SNP	.											.	USH2A	1168	.	0			c.A10928G						PASS	.						156.0	130.0	139.0					1																	215953196		2203	4300	6503	SO:0001583	missense	7399	exon55			ACCGTATGCTGTC	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.10928A>G	chr1.hg19:g.215953196T>C	ENSP00000305941:p.His3643Arg	76.0	0.0	.		54.0	25.0	.	NM_206933	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	hg19	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	T	19.34	3.808890	0.70797	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.57273	0.41;0.41	5.9	5.9	0.94986	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.46442	D	0.000296	T	0.71273	0.3320	M	0.73598	2.24	0.40934	D	0.984414	D	0.76494	0.999	D	0.68483	0.958	T	0.71547	-0.4560	10	0.35671	T	0.21	.	16.3217	0.82953	0.0:0.0:0.0:1.0	.	3643	O75445	USH2A_HUMAN	R	3643	ENSP00000305941:H3643R;ENSP00000355910:H3643R	ENSP00000305941:H3643R	H	-	2	0	USH2A	214019819	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.390000	0.73204	2.251000	0.74343	0.528000	0.53228	CAT	.	.	.	none		0.483	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
IARS2	55699	hgsc.bcm.edu	37	1	220267643	220267643	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr1:220267643T>C	ENST00000302637.5	+	1	189	c.85T>C	c.(85-87)Tgc>Cgc	p.C29R	IARS2_ENST00000366922.1_5'UTR	NM_018060.3	NP_060530.3	Q9NSE4	SYIM_HUMAN	isoleucyl-tRNA synthetase 2, mitochondrial	29					gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)			NS(1)|breast(1)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(7)|lung(17)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51				GBM - Glioblastoma multiforme(131;0.0554)	L-Isoleucine(DB00167)	CCGCCTTCCCTGCAGCCCGGG	0.711																																					p.C29R		Atlas-SNP	.											.	IARS2	106	.	0			c.T85C						PASS	.						13.0	18.0	16.0					1																	220267643		2185	4287	6472	SO:0001583	missense	55699	exon1			CTTCCCTGCAGCC	AK022665	CCDS1523.1	1q41	2011-07-01	2007-02-26		ENSG00000067704	ENSG00000067704	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	29685	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 2, mitochondrial"""	612801					Standard	NM_018060		Approved	FLJ10326	uc001hmc.3	Q9NSE4	OTTHUMG00000037287	ENST00000302637.5:c.85T>C	chr1.hg19:g.220267643T>C	ENSP00000303279:p.Cys29Arg	37.0	0.0	.		12.0	7.0	.	NM_018060	B2RPG8|Q1M2P9|Q6PI85|Q7L439|Q86WU9|Q96D91|Q9H9Q8|Q9NW42	Missense_Mutation	SNP	ENST00000302637.5	hg19	CCDS1523.1	.	.	.	.	.	.	.	.	.	.	T	8.040	0.763710	0.15914	.	.	ENSG00000067704	ENST00000302637	T	0.16457	2.34	4.13	-6.24	0.02046	.	0.684586	0.13548	N	0.379704	T	0.11239	0.0274	L	0.36672	1.1	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.11372	-1.0590	10	0.35671	T	0.21	-6.2347	11.9767	0.53096	0.1113:0.6427:0.0:0.246	.	29	Q9NSE4	SYIM_HUMAN	R	29	ENSP00000303279:C29R	ENSP00000303279:C29R	C	+	1	0	IARS2	218334266	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-1.122000	0.03267	-1.621000	0.01562	-0.353000	0.07706	TGC	.	.	.	none		0.711	IARS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_018060	
LRP2	4036	hgsc.bcm.edu	37	2	170058174	170058174	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr2:170058174A>G	ENST00000263816.3	-	44	8701	c.8416T>C	c.(8416-8418)Tgc>Cgc	p.C2806R		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	2806	LDL-receptor class A 18. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	TTATCATGGCAGTTGTCTACA	0.428																																					p.C2806R		Atlas-SNP	.											.	LRP2	751	.	0			c.T8416C						PASS	.						145.0	134.0	138.0					2																	170058174		2203	4300	6503	SO:0001583	missense	4036	exon44			CATGGCAGTTGTC		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.8416T>C	chr2.hg19:g.170058174A>G	ENSP00000263816:p.Cys2806Arg	73.0	0.0	.		104.0	19.0	.	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	hg19	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.386704	0.82902	.	.	ENSG00000081479	ENST00000263816	D	0.99919	-8.0	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	D	0.99953	0.9980	H	0.98738	4.315	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96044	0.9026	10	0.87932	D	0	.	16.3678	0.83341	1.0:0.0:0.0:0.0	.	2806	P98164	LRP2_HUMAN	R	2806	ENSP00000263816:C2806R	ENSP00000263816:C2806R	C	-	1	0	LRP2	169766420	1.000000	0.71417	1.000000	0.80357	0.802000	0.45316	9.195000	0.94971	2.254000	0.74563	0.528000	0.53228	TGC	.	.	.	none		0.428	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
FZD7	8324	hgsc.bcm.edu	37	2	202900338	202900338	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr2:202900338G>A	ENST00000286201.1	+	1	1029	c.968G>A	c.(967-969)gGc>gAc	p.G323D	RP11-107N15.1_ENST00000608741.1_lincRNA	NM_003507.1	NP_003498.1	O75084	FZD7_HUMAN	frizzled class receptor 7	323					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|mesenchymal to epithelial transition (GO:0060231)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of ectodermal cell fate specification (GO:0042666)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of JNK cascade (GO:0046330)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of catenin import into nucleus (GO:0035412)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|somatic stem cell division (GO:0048103)|stem cell maintenance (GO:0019827)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell differentiation in thymus (GO:0033077)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|endometrium(6)|large_intestine(6)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	31						TCGGACGATGGCTACCGCACG	0.627											OREG0015146	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G323D		Atlas-SNP	.											.	FZD7	70	.	0			c.G968A						PASS	.						66.0	65.0	65.0					2																	202900338		2203	4300	6503	SO:0001583	missense	8324	exon1			ACGATGGCTACCG	AB010881	CCDS2351.1	2q33	2014-01-29	2014-01-29		ENSG00000155760	ENSG00000155760		"""GPCR / Class F : Frizzled receptors"""	4045	protein-coding gene	gene with protein product		603410	"""frizzled (Drosophila) homolog 7"", ""frizzled homolog 7 (Drosophila)"", ""frizzled 7, seven transmembrane spanning receptor"", ""frizzled family receptor 7"""			9707618, 9813155	Standard	NM_003507		Approved	FzE3	uc002uyw.1	O75084	OTTHUMG00000132841	ENST00000286201.1:c.968G>A	chr2.hg19:g.202900338G>A	ENSP00000286201:p.Gly323Asp	110.0	0.0	.	2133	120.0	23.0	.	NM_003507	O94816|Q53S59|Q96B74	Missense_Mutation	SNP	ENST00000286201.1	hg19	CCDS2351.1	.	.	.	.	.	.	.	.	.	.	G	14.56	2.572271	0.45798	.	.	ENSG00000155760	ENST00000286201	D	0.81739	-1.53	5.54	5.54	0.83059	GPCR, family 2-like (1);	0.178643	0.48286	D	0.000181	D	0.83344	0.5234	M	0.85462	2.755	0.53688	D	0.999975	B	0.12013	0.005	B	0.18561	0.022	T	0.79317	-0.1853	10	0.24483	T	0.36	.	19.4882	0.95039	0.0:0.0:1.0:0.0	.	323	O75084	FZD7_HUMAN	D	323	ENSP00000286201:G323D	ENSP00000286201:G323D	G	+	2	0	FZD7	202608583	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.698000	0.54771	2.618000	0.88619	0.563000	0.77884	GGC	.	.	.	none		0.627	FZD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256314.1	NM_003507	
COL6A3	1293	hgsc.bcm.edu	37	2	238289848	238289848	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr2:238289848A>G	ENST00000295550.4	-	5	2059	c.1607T>C	c.(1606-1608)cTa>cCa	p.L536P	COL6A3_ENST00000353578.4_Missense_Mutation_p.L330P|COL6A3_ENST00000346358.4_Missense_Mutation_p.L536P|COL6A3_ENST00000392004.3_Missense_Mutation_p.L330P|COL6A3_ENST00000392003.2_Missense_Mutation_p.L129P|COL6A3_ENST00000409809.1_Missense_Mutation_p.L330P|COL6A3_ENST00000472056.1_Missense_Mutation_p.L129P|COL6A3_ENST00000347401.3_Missense_Mutation_p.L335P	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	536	Nonhelical region.|VWFA 3. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		ACTCGTGAATAGGTTGTTACG	0.547																																					p.L536P		Atlas-SNP	.											.	COL6A3	608	.	0			c.T1607C						PASS	.						73.0	83.0	80.0					2																	238289848		2203	4300	6503	SO:0001583	missense	1293	exon5			GTGAATAGGTTGT	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.1607T>C	chr2.hg19:g.238289848A>G	ENSP00000295550:p.Leu536Pro	203.0	0.0	.		191.0	30.0	.	NM_004369	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	hg19	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	A	13.45	2.239904	0.39598	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358;ENST00000392004;ENST00000392003;ENST00000433762	D;D;D;D;D;D;D;D;D	0.87334	-2.24;-2.24;-2.24;-2.24;-2.24;-2.24;-2.24;-2.24;-2.24	5.6	5.6	0.85130	von Willebrand factor, type A (3);	0.138230	0.32161	N	0.006489	D	0.92848	0.7725	M	0.75150	2.29	0.43907	D	0.996547	D;D;P;P;D;D	0.69078	0.989;0.997;0.953;0.953;0.993;0.989	P;D;P;P;D;P	0.70227	0.883;0.968;0.905;0.898;0.935;0.883	D	0.93510	0.6852	10	0.66056	D	0.02	.	15.7932	0.78384	1.0:0.0:0.0:0.0	.	536;129;129;330;330;536	E9PCV6;E9PFQ6;A8MT30;E9PGQ9;P12111-2;P12111	.;.;.;.;.;CO6A3_HUMAN	P	536;335;330;129;330;536;330;129;536	ENSP00000295550:L536P;ENSP00000315609:L335P;ENSP00000315873:L330P;ENSP00000418285:L129P;ENSP00000386844:L330P;ENSP00000295546:L536P;ENSP00000375861:L330P;ENSP00000375860:L129P;ENSP00000389539:L536P	ENSP00000295550:L536P	L	-	2	0	COL6A3	237954587	1.000000	0.71417	0.996000	0.52242	0.015000	0.08874	5.769000	0.68865	2.124000	0.65301	0.533000	0.62120	CTA	.	.	.	none		0.547	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
DAG1	1605	hgsc.bcm.edu	37	3	49568799	49568799	+	Silent	SNP	A	A	G			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr3:49568799A>G	ENST00000539901.1	+	3	1413	c.855A>G	c.(853-855)gcA>gcG	p.A285A	DAG1_ENST00000308775.2_Silent_p.A285A|DAG1_ENST00000545947.1_Silent_p.A285A|DAG1_ENST00000538711.1_Silent_p.A285A|DAG1_ENST00000515359.2_Silent_p.A285A|DAG1_ENST00000541308.1_Silent_p.A285A	NM_001177644.2	NP_001171115	Q14118	DAG1_HUMAN	dystroglycan 1 (dystrophin-associated glycoprotein 1)	285	Required for laminin recognition.				basement membrane organization (GO:0071711)|branching involved in salivary gland morphogenesis (GO:0060445)|calcium-dependent cell-matrix adhesion (GO:0016340)|commissural neuron axon guidance (GO:0071679)|cytoskeletal anchoring at plasma membrane (GO:0007016)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|extracellular matrix organization (GO:0030198)|membrane protein ectodomain proteolysis (GO:0006509)|microtubule anchoring (GO:0034453)|modulation by virus of host morphology or physiology (GO:0019048)|morphogenesis of an epithelial sheet (GO:0002011)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell migration (GO:0030336)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase B signaling (GO:0051898)|nerve maturation (GO:0021682)|NLS-bearing protein import into nucleus (GO:0006607)|response to peptide hormone (GO:0043434)	basement membrane (GO:0005604)|basolateral plasma membrane (GO:0016323)|cell outer membrane (GO:0009279)|cell-cell adherens junction (GO:0005913)|contractile ring (GO:0070938)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystroglycan complex (GO:0016011)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|node of Ranvier (GO:0033268)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|alpha-actinin binding (GO:0051393)|calcium ion binding (GO:0005509)|laminin-1 binding (GO:0043237)|SH2 domain binding (GO:0042169)|structural constituent of muscle (GO:0008307)|tubulin binding (GO:0015631)|vinculin binding (GO:0017166)|virus receptor activity (GO:0001618)			NS(1)|autonomic_ganglia(2)|breast(2)|endometrium(1)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)|skin(1)	23				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.00241)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		GGGAGGGCGCAATGTCTGCTC	0.597																																					p.A285A		Atlas-SNP	.											.	DAG1	60	.	0			c.A855G						PASS	.						82.0	77.0	79.0					3																	49568799		2203	4300	6503	SO:0001819	synonymous_variant	1605	exon4			GGGCGCAATGTCT	L19711	CCDS2799.1	3p21	2014-09-17			ENSG00000173402	ENSG00000173402			2666	protein-coding gene	gene with protein product	"""alpha-dystroglycan"", ""dystrophin-associated glycoprotein-1"", ""beta-dystroglycan"""	128239				7774920, 1741056	Standard	NM_001177643		Approved	A3a, 156DAG, AGRNR, DAG	uc021wyd.1	Q14118	OTTHUMG00000156869	ENST00000539901.1:c.855A>G	chr3.hg19:g.49568799A>G		113.0	0.0	.		104.0	44.0	.	NM_001177642	A8K6M7|Q969J9	Silent	SNP	ENST00000539901.1	hg19	CCDS2799.1																																																																																			.	.	.	none		0.597	DAG1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346326.1		
C4orf51	646603	hgsc.bcm.edu	37	4	146653660	146653660	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr4:146653660C>T	ENST00000438731.1	+	6	557	c.557C>T	c.(556-558)gCt>gTt	p.A186V	C4orf51_ENST00000508981.1_3'UTR	NM_001080531.1	NP_001074000.1	C9J302	CD051_HUMAN	chromosome 4 open reading frame 51	186										haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)	6						GATTCAGAAGCTGATCGATAC	0.488																																					p.A186V		Atlas-SNP	.											.	C4orf51	18	.	0			c.C557T						PASS	.						66.0	67.0	67.0					4																	146653660		1941	4147	6088	SO:0001583	missense	646603	exon6			CAGAAGCTGATCG		CCDS47140.1	4q31.21	2009-09-09			ENSG00000237136	ENSG00000237136			37264	protein-coding gene	gene with protein product							Standard	NM_001080531		Approved		uc003ikk.3	C9J302	OTTHUMG00000161367	ENST00000438731.1:c.557C>T	chr4.hg19:g.146653660C>T	ENSP00000391404:p.Ala186Val	39.0	0.0	.		19.0	9.0	.	NM_001080531		Missense_Mutation	SNP	ENST00000438731.1	hg19	CCDS47140.1	.	.	.	.	.	.	.	.	.	.	C	12.12	1.842007	0.32513	.	.	ENSG00000237136	ENST00000438731	.	.	.	3.65	-2.95	0.05564	.	.	.	.	.	T	0.15565	0.0375	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.16867	-1.0388	8	0.45353	T	0.12	.	4.9044	0.13791	0.0:0.3232:0.3035:0.3734	.	186	C9J302	CD051_HUMAN	V	186	.	ENSP00000391404:A186V	A	+	2	0	C4orf51	146873110	0.000000	0.05858	0.000000	0.03702	0.180000	0.23129	-0.547000	0.06055	-0.767000	0.04633	-0.391000	0.06502	GCT	.	.	.	none		0.488	C4orf51-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080531	
POU4F2	5458	hgsc.bcm.edu	37	4	147561825	147561825	+	Silent	SNP	C	C	T			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr4:147561825C>T	ENST00000281321.3	+	2	1343	c.1095C>T	c.(1093-1095)gcC>gcT	p.A365A	AC093887.1_ENST00000584185.1_RNA	NM_004575.2	NP_004566.2	Q12837	PO4F2_HUMAN	POU class 4 homeobox 2	365					axon extension (GO:0048675)|axon guidance (GO:0007411)|intracellular estrogen receptor signaling pathway (GO:0030520)|MAPK cascade (GO:0000165)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)					CCTACTTTGCCATTCAGCCTC	0.587																																					p.A365A		Atlas-SNP	.											.	POU4F2	83	.	0			c.C1095T						PASS	.						65.0	70.0	68.0					4																	147561825		2203	4300	6503	SO:0001819	synonymous_variant	5458	exon2			CTTTGCCATTCAG	U06233	CCDS34074.1	4q31.22	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9219	protein-coding gene	gene with protein product		113725	"""POU domain, class 4, transcription factor 2"", ""POU domain class 4, transcription factor 2"""	BRN3B		8332509	Standard	NM_004575		Approved	Brn-3b	uc003ikv.3	Q12837		ENST00000281321.3:c.1095C>T	chr4.hg19:g.147561825C>T		181.0	0.0	.		89.0	30.0	.	NM_004575	B1PJR6|B2RC84|Q13883|Q14987	Silent	SNP	ENST00000281321.3	hg19	CCDS34074.1																																																																																			.	.	.	none		0.587	POU4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367020.1	NM_004575	
DROSHA	29102	hgsc.bcm.edu	37	5	31409241	31409241	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr5:31409241T>C	ENST00000511367.2	-	32	4020	c.3776A>G	c.(3775-3777)aAt>aGt	p.N1259S	DROSHA_ENST00000513349.1_Missense_Mutation_p.N1222S|DROSHA_ENST00000442743.1_Missense_Mutation_p.N1222S|DROSHA_ENST00000344624.3_Missense_Mutation_p.N1259S	NM_013235.4	NP_037367.3	Q9NRR4	RNC_HUMAN	drosha, ribonuclease type III	1259	Necessary for interaction with DGCR8 and pri-miRNA processing activity.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|gene expression (GO:0010467)|miRNA metabolic process (GO:0010586)|pre-miRNA processing (GO:0031054)|primary miRNA processing (GO:0031053)|ribosome biogenesis (GO:0042254)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA catabolic process (GO:0016075)	nucleoplasm (GO:0005654)	lipopolysaccharide binding (GO:0001530)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)			breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(19)|lung(33)|ovary(2)|skin(1)	66						TTTGGGGTCATTCCAATCCTG	0.433																																					p.N1259S		Atlas-SNP	.											.	DROSHA	130	.	0			c.A3776G						PASS	.						70.0	66.0	67.0					5																	31409241		1857	4109	5966	SO:0001583	missense	29102	exon32			GGGTCATTCCAAT	AF116910	CCDS47194.1, CCDS47195.1	5q11.2	2010-11-17	2010-10-28	2010-10-28	ENSG00000113360	ENSG00000113360	3.1.26.3		17904	protein-coding gene	gene with protein product	"""drosha, ribonuclease type III"", ""drosha, double-stranded RNA-specific endoribonuclease"""	608828	"""ribonuclease type III, nuclear"""	RNASEN		10713462, 10948199	Standard	NM_013235		Approved	RNASE3L, Etohi2, HSA242976, RN3	uc003jhg.2	Q9NRR4	OTTHUMG00000161976	ENST00000511367.2:c.3776A>G	chr5.hg19:g.31409241T>C	ENSP00000425979:p.Asn1259Ser	37.0	0.0	.		36.0	22.0	.	NM_013235	E7EMP9|Q7Z5V2|Q86YH0|Q9NW73|Q9Y2V9|Q9Y4Y0	Missense_Mutation	SNP	ENST00000511367.2	hg19	CCDS47195.1	.	.	.	.	.	.	.	.	.	.	T	24.4	4.527326	0.85706	.	.	ENSG00000113360	ENST00000511367;ENST00000344624;ENST00000442743;ENST00000513349;ENST00000265075	T;T;T;T	0.40756	1.02;1.02;1.02;1.02	5.34	5.34	0.76211	Ribonuclease III (2);	0.000000	0.85682	D	0.000000	T	0.58750	0.2144	M	0.67953	2.075	0.80722	D	1	D;P	0.62365	0.991;0.683	P;B	0.58331	0.837;0.18	T	0.63453	-0.6634	10	0.72032	D	0.01	-23.6224	15.3311	0.74212	0.0:0.0:0.0:1.0	.	1222;1259	E7EMP9;Q9NRR4	.;RNC_HUMAN	S	1259;1259;1222;1222;1184	ENSP00000425979:N1259S;ENSP00000339845:N1259S;ENSP00000409335:N1222S;ENSP00000424161:N1222S	ENSP00000265075:N1184S	N	-	2	0	DROSHA	31444998	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.586000	0.82596	2.030000	0.59900	0.533000	0.62120	AAT	.	.	.	none		0.433	DROSHA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366561.3	NM_013235	
POLR3G	10622	hgsc.bcm.edu	37	5	89797779	89797779	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr5:89797779A>G	ENST00000399107.1	+	6	612	c.412A>G	c.(412-414)Act>Gct	p.T138A	POLR3G_ENST00000504930.1_Missense_Mutation_p.T138A	NM_006467.2	NP_006458.2	O15318	RPC7_HUMAN	polymerase (RNA) III (DNA directed) polypeptide G (32kD)	138					cell proliferation (GO:0008283)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase III promoter (GO:0006384)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	DNA-directed RNA polymerase activity (GO:0003899)			cervix(1)|endometrium(1)|kidney(2)|lung(4)|prostate(1)	9		all_cancers(142;5.03e-09)|all_epithelial(76;1.23e-11)|Lung NSC(167;2.46e-05)|all_lung(232;3.25e-05)|Ovarian(174;0.00832)|Colorectal(57;0.122)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(54;2.74e-31)|Epithelial(54;8.2e-26)|all cancers(79;3.86e-22)		ACTCACTAATACTGAAGATGT	0.383																																					p.T138A		Atlas-SNP	.											.	POLR3G	19	.	0			c.A412G						PASS	.						72.0	68.0	69.0					5																	89797779		1862	4108	5970	SO:0001583	missense	10622	exon6			ACTAATACTGAAG	U93868	CCDS43337.1	5q14.3	2014-06-05			ENSG00000113356	ENSG00000113356		"""RNA polymerase subunits"""	30075	protein-coding gene	gene with protein product						9171375, 12391170	Standard	NM_006467		Approved	RPC32, RPC7	uc003kjq.3	O15318	OTTHUMG00000162809	ENST00000399107.1:c.412A>G	chr5.hg19:g.89797779A>G	ENSP00000382058:p.Thr138Ala	35.0	0.0	.		38.0	11.0	.	NM_006467	A8MTH0	Missense_Mutation	SNP	ENST00000399107.1	hg19	CCDS43337.1	.	.	.	.	.	.	.	.	.	.	A	7.354	0.623448	0.14193	.	.	ENSG00000113356	ENST00000503373;ENST00000399107;ENST00000504930	.	.	.	5.76	-3.4	0.04853	.	1.429180	0.04034	N	0.301916	T	0.23410	0.0566	L	0.36672	1.1	0.09310	N	1	P	0.40144	0.704	B	0.39217	0.294	T	0.13361	-1.0512	9	0.09084	T	0.74	-1.7336	4.8923	0.13733	0.305:0.4951:0.0729:0.127	.	138	O15318	RPC7_HUMAN	A	138	.	ENSP00000382058:T138A	T	+	1	0	POLR3G	89833535	0.039000	0.19947	0.000000	0.03702	0.135000	0.20990	0.724000	0.25954	-0.710000	0.05001	-0.316000	0.08728	ACT	.	.	.	none		0.383	POLR3G-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370462.1	NM_006467	
ADTRP	84830	hgsc.bcm.edu	37	6	11735821	11735821	+	Silent	SNP	G	G	A			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr6:11735821G>A	ENST00000414691.3	-	4	896	c.486C>T	c.(484-486)gcC>gcT	p.A162A	ADTRP_ENST00000229583.5_Silent_p.A180A|ADTRP_ENST00000514824.1_5'UTR|ADTRP_ENST00000379413.2_Silent_p.A162A	NM_032744.3	NP_116133.1	Q96IZ2	ADTRP_HUMAN	androgen-dependent TFPI-regulating protein	162						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											AAGCAATGCTGGCAGCAGCCA	0.483																																					p.A180A		Atlas-SNP	.											.	ADTRP	3	.	0			c.C540T						PASS	.						66.0	60.0	62.0					6																	11735821		2203	4300	6503	SO:0001819	synonymous_variant	84830	exon5			AATGCTGGCAGCA	AJ420520	CCDS4521.1, CCDS47374.1	6p24.1	2012-01-30	2012-01-27	2012-01-27	ENSG00000111863	ENSG00000111863			21214	protein-coding gene	gene with protein product	"""androgen-induced 1-like"""	614348	"""chromosome 6 open reading frame 105"""	C6orf105		21868574	Standard	NM_032744		Approved	dJ413H6.1, AIG1L	uc011dip.2	Q96IZ2	OTTHUMG00000014260	ENST00000414691.3:c.486C>T	chr6.hg19:g.11735821G>A		57.0	0.0	.		41.0	8.0	.	NM_001143948	B2R7T9|B4DV39|Q5THW1	Silent	SNP	ENST00000414691.3	hg19	CCDS4521.1																																																																																			.	.	.	none		0.483	ADTRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039864.3	NM_032744	
MET	4233	hgsc.bcm.edu	37	7	116422117	116422117	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr7:116422117T>A	ENST00000318493.6	+	18	3839	c.3652T>A	c.(3652-3654)Ttt>Att	p.F1218I	MET_ENST00000397752.3_Missense_Mutation_p.F1200I|MET_ENST00000539704.1_Missense_Mutation_p.F70I			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.F1218V(1)		NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			AAGCAAAAAGTTTGTCCACAG	0.393			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																												p.F1218I		Atlas-SNP	.		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	MET,NS,carcinoma,0,1	MET	412	.	1	Substitution - Missense(1)	kidney(1)	c.T3652A						PASS	.						57.0	55.0	56.0					7																	116422117		1836	4092	5928	SO:0001583	missense	4233	exon18	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	AAAAAGTTTGTCC	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.3652T>A	chr7.hg19:g.116422117T>A	ENSP00000317272:p.Phe1218Ile	44.0	0.0	.		30.0	11.0	.	NM_001127500	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	hg19	CCDS47689.1	.	.	.	.	.	.	.	.	.	.	T	26.4	4.735740	0.89482	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000539704	T;T;T	0.25414	1.8;1.8;1.8	5.87	5.87	0.94306	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.37128	0.0992	N	0.16862	0.45	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.35201	-0.9798	10	0.87932	D	0	.	16.5764	0.84681	0.0:0.0:0.0:1.0	.	1218;1200	P08581-2;P08581	.;MET_HUMAN	I	1200;1218;70	ENSP00000380860:F1200I;ENSP00000317272:F1218I;ENSP00000445020:F70I	ENSP00000317272:F1218I	F	+	1	0	MET	116209353	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.972000	0.88022	2.371000	0.80710	0.533000	0.62120	TTT	.	.	.	none		0.393	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3		
DOCK5	80005	hgsc.bcm.edu	37	8	25226181	25226181	+	Silent	SNP	C	C	A			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr8:25226181C>A	ENST00000276440.7	+	33	3422	c.3378C>A	c.(3376-3378)ccC>ccA	p.P1126P		NM_024940.6	NP_079216.4	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	1126					positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(9)|large_intestine(13)|lung(20)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		CCACAATCCCCATTTTCTTTG	0.443																																					p.P1126P	Pancreas(145;34 1887 3271 10937 30165)	Atlas-SNP	.											.	DOCK5	167	.	0			c.C3378A						PASS	.						73.0	71.0	72.0					8																	25226181		2203	4300	6503	SO:0001819	synonymous_variant	80005	exon33			AATCCCCATTTTC		CCDS6047.1	8p21.2	2009-04-17			ENSG00000147459	ENSG00000147459			23476	protein-coding gene	gene with protein product						12432077	Standard	NM_024940		Approved	FLJ21034	uc003xeg.3	Q9H7D0	OTTHUMG00000131991	ENST00000276440.7:c.3378C>A	chr8.hg19:g.25226181C>A		55.0	0.0	.		40.0	16.0	.	NM_024940	B2RNY0|Q5XKD5|Q6AI11|Q6PJS6|Q6ZTS6	Silent	SNP	ENST00000276440.7	hg19	CCDS6047.1	.	.	.	.	.	.	.	.	.	.	C	9.817	1.184776	0.21870	.	.	ENSG00000147459	ENST00000444569	.	.	.	5.8	4.93	0.64822	.	.	.	.	.	T	0.60612	0.2282	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59010	-0.7534	4	.	.	.	.	9.6931	0.40141	0.0:0.6721:0.257:0.0709	.	.	.	.	N	898	.	.	H	+	1	0	DOCK5	25282098	0.998000	0.40836	1.000000	0.80357	0.999000	0.98932	0.603000	0.24149	1.461000	0.47929	0.655000	0.94253	CAT	.	.	.	none		0.443	DOCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254955.2	NM_024940	
TRPS1	7227	hgsc.bcm.edu	37	8	116631588	116631588	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr8:116631588C>T	ENST00000220888.5	-	2	857	c.698G>A	c.(697-699)gGc>gAc	p.G233D	TRPS1_ENST00000519076.1_Missense_Mutation_p.G187D|TRPS1_ENST00000520276.1_Missense_Mutation_p.G237D|TRPS1_ENST00000395715.3_Missense_Mutation_p.G246D|TRPS1_ENST00000519674.1_Missense_Mutation_p.G233D			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	233					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			GGGGTCGTTGCCGTAGTAACC	0.483									Langer-Giedion syndrome																												p.G246D		Atlas-SNP	.											.	TRPS1	516	.	0			c.G737A						PASS	.						113.0	113.0	113.0					8																	116631588		1958	4180	6138	SO:0001583	missense	7227	exon3	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	TCGTTGCCGTAGT	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.698G>A	chr8.hg19:g.116631588C>T	ENSP00000220888:p.Gly233Asp	122.0	0.0	.		117.0	38.0	.	NM_014112	B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	ENST00000220888.5	hg19		.	.	.	.	.	.	.	.	.	.	C	22.7	4.320687	0.81469	.	.	ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000519076;ENST00000520276;ENST00000519674	T;T;T;T;T	0.06528	3.29;3.29;3.29;3.29;3.29	5.56	5.56	0.83823	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.16471	0.0396	N	0.24115	0.695	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.02797	-1.1109	10	0.87932	D	0	0.3311	19.5324	0.95234	0.0:1.0:0.0:0.0	.	237;233;246	Q9UHF7-3;Q9UHF7;Q9UHF7-2	.;TRPS1_HUMAN;.	D	246;233;187;237;233	ENSP00000379065:G246D;ENSP00000220888:G233D;ENSP00000428910:G187D;ENSP00000428680:G237D;ENSP00000429174:G233D	ENSP00000220888:G233D	G	-	2	0	TRPS1	116700763	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.818000	0.86416	2.619000	0.88677	0.460000	0.39030	GGC	.	.	.	none		0.483	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112	
EPPK1	83481	hgsc.bcm.edu	37	8	144941596	144941596	+	Silent	SNP	G	G	A	rs576788732		TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr8:144941596G>A	ENST00000525985.1	-	2	5897	c.5826C>T	c.(5824-5826)gaC>gaT	p.D1942D				P58107	EPIPL_HUMAN	epiplakin 1	1942						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GGGTGCAGGGGTCCAGGAGGA	0.637																																					p.D1942D		Atlas-SNP	.											.	EPPK1	199	.	0			c.C5826T						PASS	.						39.0	47.0	44.0					8																	144941596		1996	4166	6162	SO:0001819	synonymous_variant	83481	exon1			GCAGGGGTCCAGG	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.5826C>T	chr8.hg19:g.144941596G>A		166.0	0.0	.		63.0	27.0	.	NM_031308	Q76E58|Q9NSU9	Silent	SNP	ENST00000525985.1	hg19																																																																																				.	.	.	none		0.637	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
SMU1	55234	hgsc.bcm.edu	37	9	33048146	33048146	+	Nonsense_Mutation	SNP	G	G	C			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr9:33048146G>C	ENST00000397149.3	-	11	1451	c.1401C>G	c.(1399-1401)taC>taG	p.Y467*	SMU1_ENST00000536631.1_Nonsense_Mutation_p.Y306*	NM_018225.2	NP_060695.2	Q2TAY7	SMU1_HUMAN	smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans)	467						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(2)|lung(4)|ovary(2)|prostate(1)	9			LUSC - Lung squamous cell carcinoma(29;0.0227)	GBM - Glioblastoma multiforme(74;0.11)		TACTGAAACAGTAGAGCACAA	0.443																																					p.Y467X		Atlas-SNP	.											.	SMU1	29	.	0			c.C1401G						PASS	.						117.0	98.0	104.0					9																	33048146		2203	4300	6503	SO:0001587	stop_gained	55234	exon11			GAAACAGTAGAGC	AK001667	CCDS6534.1	9p12	2013-01-10			ENSG00000122692	ENSG00000122692		"""WD repeat domain containing"""	18247	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 57"""					11438655, 11410362	Standard	NM_018225		Approved	SMU-1, FLJ10805, BWD, fSAP57	uc003zsf.1	Q2TAY7	OTTHUMG00000019757	ENST00000397149.3:c.1401C>G	chr9.hg19:g.33048146G>C	ENSP00000380336:p.Tyr467*	89.0	0.0	.		63.0	13.0	.	NM_018225	B4E3L0|Q9BU59|Q9HA96|Q9NVD1	Nonsense_Mutation	SNP	ENST00000397149.3	hg19	CCDS6534.1	.	.	.	.	.	.	.	.	.	.	G	36	5.657265	0.96724	.	.	ENSG00000122692	ENST00000397149;ENST00000536631	.	.	.	5.25	3.35	0.38373	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.9692	9.5331	0.39207	0.182:0.0:0.818:0.0	.	.	.	.	X	467;306	.	ENSP00000380336:Y467X	Y	-	3	2	SMU1	33038146	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.318000	0.51975	0.648000	0.30732	0.591000	0.81541	TAC	.	.	.	none		0.443	SMU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052022.1	NM_018225	
SPATA31D1	389763	hgsc.bcm.edu	37	9	84607291	84607291	+	Missense_Mutation	SNP	T	T	G	rs201182137	byFrequency	TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr9:84607291T>G	ENST00000344803.2	+	4	1953	c.1906T>G	c.(1906-1908)Ttg>Gtg	p.L636V		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	636					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GCAGGAAAGTTTGTGGGGCTT	0.478													G|||	3	0.000599042	0.0008	0.0	5008	,	,		19868	0.0		0.001	False		,,,				2504	0.001				p.L636V		Atlas-SNP	.											FAM75D4,NS,carcinoma,0,2	.	.	.	0			c.T1906G						PASS	.	G	VAL/LEU	0,3730		0,0,1865	101.0	98.0	99.0		1906	-3.7	0.0	9		99	1,8223		0,1,4111	no	missense	FAM75D1	NM_001001670.2	32	0,1,5976	GG,GT,TT		0.0122,0.0,0.0084	benign	636/1577	84607291	1,11953	1865	4112	5977	SO:0001583	missense	389763	exon4			GAAAGTTTGTGGG		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.1906T>G	chr9.hg19:g.84607291T>G	ENSP00000341988:p.Leu636Val	70.0	0.0	.		102.0	5.0	.	NM_001001670		Missense_Mutation	SNP	ENST00000344803.2	hg19	CCDS47986.1	.	.	.	.	.	.	.	.	.	.	G	4.363	0.066840	0.08388	0.0	1.22E-4	ENSG00000214929	ENST00000344803	T	0.05786	3.39	3.83	-3.67	0.04476	.	1.454400	0.04584	N	0.395509	T	0.02970	0.0088	N	0.11023	0.085	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.43261	-0.9402	10	0.16420	T	0.52	0.4754	3.7406	0.08528	0.108:0.096:0.4463:0.3497	.	636	Q6ZQQ2	F75D1_HUMAN	V	636	ENSP00000341988:L636V	ENSP00000341988:L636V	L	+	1	2	FAM75D1	83797111	0.011000	0.17503	0.002000	0.10522	0.000000	0.00434	-0.756000	0.04777	-1.293000	0.02362	-0.729000	0.03580	TTG	.	.	.	weak		0.478	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670	
OR5C1	392391	hgsc.bcm.edu	37	9	125551413	125551413	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr9:125551413G>A	ENST00000373680.2	+	1	264	c.202G>A	c.(202-204)Gcc>Acc	p.A68T		NM_001001923.1	NP_001001923.1	Q8NGR4	OR5C1_HUMAN	olfactory receptor, family 5, subfamily C, member 1	68						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|large_intestine(5)|lung(6)|pancreas(1)|prostate(5)|skin(1)	20						CTTCTTCCTGGCCAACCTCTC	0.617																																					p.A68T		Atlas-SNP	.											.	OR5C1	45	.	0			c.G202A						PASS	.						149.0	139.0	142.0					9																	125551413		2203	4300	6503	SO:0001583	missense	392391	exon1			TTCCTGGCCAACC	AF399514	CCDS35131.1	9q34.2	2012-08-09			ENSG00000148215	ENSG00000148215		"""GPCR / Class A : Olfactory receptors"""	8331	protein-coding gene	gene with protein product				OR5C2P			Standard	NM_001001923		Approved	OR9-F, hRPK-465_F_21	uc011lzd.2	Q8NGR4	OTTHUMG00000020622	ENST00000373680.2:c.202G>A	chr9.hg19:g.125551413G>A	ENSP00000362784:p.Ala68Thr	237.0	0.0	.		175.0	8.0	.	NM_001001923	B2RN54|B9EGT0|Q96RC4	Missense_Mutation	SNP	ENST00000373680.2	hg19	CCDS35131.1	.	.	.	.	.	.	.	.	.	.	G	14.79	2.639367	0.47153	.	.	ENSG00000148215	ENST00000373680	T	0.01099	5.34	5.17	4.27	0.50696	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36234	U	0.002710	T	0.00875	0.0029	L	0.28608	0.87	0.28228	N	0.926248	P	0.42827	0.791	B	0.32677	0.15	T	0.51100	-0.8748	10	0.62326	D	0.03	.	4.1132	0.10068	0.0841:0.1619:0.5858:0.1681	.	68	Q8NGR4	OR5C1_HUMAN	T	68	ENSP00000362784:A68T	ENSP00000362784:A68T	A	+	1	0	OR5C1	124591234	0.000000	0.05858	1.000000	0.80357	0.998000	0.95712	0.075000	0.14686	1.391000	0.46566	0.650000	0.86243	GCC	.	.	.	none		0.617	OR5C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053953.1		
KIAA1279	26128	hgsc.bcm.edu	37	10	70749011	70749011	+	Silent	SNP	G	G	C			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr10:70749011G>C	ENST00000361983.4	+	1	525	c.423G>C	c.(421-423)gcG>gcC	p.A141A		NM_015634.3	NP_056449.1	Q96EK5	KBP_HUMAN	KIAA1279	141					cell differentiation (GO:0030154)|mitochondrial transport (GO:0006839)|nervous system development (GO:0007399)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)	kinesin binding (GO:0019894)			breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	14						GCATCCAGGCGCAGGTGAGAG	0.677																																					p.A141A		Atlas-SNP	.											.	KIAA1279	35	.	0			c.G423C						PASS	.						12.0	15.0	14.0					10																	70749011		2196	4277	6473	SO:0001819	synonymous_variant	26128	exon1			CCAGGCGCAGGTG	BC012180	CCDS7284.1	10q22.1	2008-02-05			ENSG00000198954	ENSG00000198954			23419	protein-coding gene	gene with protein product		609367					Standard	NM_015634		Approved	DKFZP586B0923, TTC20	uc001joy.3	Q96EK5	OTTHUMG00000018363	ENST00000361983.4:c.423G>C	chr10.hg19:g.70749011G>C		41.0	0.0	.		24.0	15.0	.	NM_015634	A8K5M8|Q9BR89|Q9ULE1|Q9Y428	Silent	SNP	ENST00000361983.4	hg19	CCDS7284.1																																																																																			.	.	.	none		0.677	KIAA1279-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048370.1	NM_015634	
KATNAL1	84056	hgsc.bcm.edu	37	13	30814673	30814673	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr13:30814673T>C	ENST00000380615.3	-	6	817	c.650A>G	c.(649-651)aAg>aGg	p.K217R	KATNAL1_ENST00000380617.3_Missense_Mutation_p.K217R	NM_032116.4	NP_115492.1			katanin p60 subunit A-like 1											autonomic_ganglia(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|skin(1)|urinary_tract(3)	19		Lung SC(185;0.0257)		all cancers(112;0.114)|OV - Ovarian serous cystadenocarcinoma(117;0.213)		TAGCAACTTCTTAGCTTCTTC	0.363																																					p.K217R		Atlas-SNP	.											.	KATNAL1	53	.	0			c.A650G						PASS	.						112.0	103.0	106.0					13																	30814673		2203	4300	6503	SO:0001583	missense	84056	exon6			AACTTCTTAGCTT	AK097423	CCDS31956.1	13q12.3	2010-04-21			ENSG00000102781	ENSG00000102781		"""ATPases / AAA-type"""	28361	protein-coding gene	gene with protein product		614764				12477932	Standard	NM_001014380		Approved	MGC2599	uc001uss.4	Q9BW62	OTTHUMG00000016665	ENST00000380615.3:c.650A>G	chr13.hg19:g.30814673T>C	ENSP00000369989:p.Lys217Arg	102.0	0.0	.		63.0	33.0	.	NM_001014380		Missense_Mutation	SNP	ENST00000380615.3	hg19	CCDS31956.1	.	.	.	.	.	.	.	.	.	.	T	33	5.206604	0.95033	.	.	ENSG00000102781	ENST00000380615;ENST00000380617	D;D	0.95656	-3.77;-3.77	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	D	0.97685	0.9241	M	0.93678	3.445	0.80722	D	1	D	0.54964	0.969	P	0.53401	0.725	D	0.98333	1.0534	10	0.66056	D	0.02	-18.253	16.5582	0.84512	0.0:0.0:0.0:1.0	.	217	Q9BW62	KATL1_HUMAN	R	217	ENSP00000369989:K217R;ENSP00000369991:K217R	ENSP00000369989:K217R	K	-	2	0	KATNAL1	29712673	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.040000	0.89188	2.308000	0.77769	0.533000	0.62120	AAG	.	.	.	none		0.363	KATNAL1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044346.2	NM_032116	
HEXA	3073	hgsc.bcm.edu	37	15	72637848	72637848	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr15:72637848A>T	ENST00000268097.5	-	13	1968	c.1465T>A	c.(1465-1467)Ttg>Atg	p.L489M	HEXA_ENST00000567159.1_Missense_Mutation_p.L489M|HEXA_ENST00000457859.2_3'UTR|RP11-106M3.3_ENST00000570175.1_RNA|RP11-106M3.2_ENST00000379915.4_RNA|HEXA_ENST00000566304.1_Missense_Mutation_p.L500M	NM_000520.4	NP_000511.2	P06865	HEXA_HUMAN	hexosaminidase A (alpha polypeptide)	489					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	beta-N-acetylhexosaminidase activity (GO:0004563)|protein heterodimerization activity (GO:0046982)			breast(2)|cervix(1)|endometrium(3)|kidney(3)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	24						TCAGATGTCAACTTGTTGCTC	0.567																																					p.L489M		Atlas-SNP	.											.	HEXA	48	.	0			c.T1465A						PASS	.						148.0	111.0	124.0					15																	72637848		2199	4297	6496	SO:0001583	missense	3073	exon13			ATGTCAACTTGTT	M13520	CCDS10243.1	15q24.1	2012-10-02			ENSG00000213614	ENSG00000213614	3.2.1.52		4878	protein-coding gene	gene with protein product	"""Tay Sachs disease"", ""GM2 gangliosidosis"""	606869				2952641, 3013851	Standard	NM_000520		Approved		uc002aun.4	P06865	OTTHUMG00000133445	ENST00000268097.5:c.1465T>A	chr15.hg19:g.72637848A>T	ENSP00000268097:p.Leu489Met	88.0	0.0	.		71.0	10.0	.	NM_000520	B4DKE7|E7ENH7|Q53HS8|Q6AI32	Missense_Mutation	SNP	ENST00000268097.5	hg19	CCDS10243.1	.	.	.	.	.	.	.	.	.	.	A	13.26	2.184859	0.38609	.	.	ENSG00000213614	ENST00000268097	D	0.96651	-4.08	5.71	-11.4	0.00090	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	2.683750	0.01267	N	0.009357	D	0.87533	0.6201	N	0.08118	0	0.09310	N	0.999998	B;B;B	0.15930	0.015;0.0;0.006	B;B;B	0.17098	0.017;0.005;0.014	T	0.79351	-0.1839	10	0.51188	T	0.08	4.1018	4.1333	0.10159	0.1012:0.1303:0.3717:0.3968	.	500;369;489	B4DVA7;Q9BVJ8;P06865	.;.;HEXA_HUMAN	M	489	ENSP00000268097:L489M	ENSP00000268097:L489M	L	-	1	2	HEXA	70424902	0.000000	0.05858	0.000000	0.03702	0.155000	0.21991	-0.794000	0.04584	-2.858000	0.00328	-0.290000	0.09829	TTG	.	.	.	none		0.567	HEXA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257317.2	NM_000520	
METTL9	51108	hgsc.bcm.edu	37	16	21666647	21666647	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr16:21666647G>T	ENST00000358154.3	+	5	1109	c.851G>T	c.(850-852)gGt>gTt	p.G284V	IGSF6_ENST00000268389.4_5'Flank|METTL9_ENST00000396014.4_Missense_Mutation_p.G283V	NM_001077180.1|NM_016025.3	NP_001070648.1|NP_057109.3	Q9H1A3	METL9_HUMAN	methyltransferase like 9	284										endometrium(1)|kidney(3)|large_intestine(1)|lung(1)|ovary(1)	7				GBM - Glioblastoma multiforme(48;0.0759)		AGAAAAGCTGGTTTTGTTATC	0.423																																					p.G284V		Atlas-SNP	.											.	METTL9	18	.	0			c.G851T						PASS	.						116.0	105.0	109.0					16																	21666647		2199	4300	6499	SO:0001583	missense	51108	exon5			AAGCTGGTTTTGT	NM_016025, AF151839	CCDS10598.2, CCDS45440.1	16p12.2	2008-11-06			ENSG00000197006	ENSG00000197006			24586	protein-coding gene	gene with protein product	"""DORA reverse strand protein 1"""	609388				10810093, 11132146	Standard	NM_001077180		Approved	DREV1	uc002dje.3	Q9H1A3	OTTHUMG00000131584	ENST00000358154.3:c.851G>T	chr16.hg19:g.21666647G>T	ENSP00000350874:p.Gly284Val	73.0	0.0	.		66.0	16.0	.	NM_016025	Q8NBT8|Q9BWJ7|Q9H1A2|Q9Y390	Missense_Mutation	SNP	ENST00000358154.3	hg19	CCDS10598.2	.	.	.	.	.	.	.	.	.	.	G	22.6	4.309820	0.81247	.	.	ENSG00000197006	ENST00000358154;ENST00000396014;ENST00000540294	.	.	.	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.84817	0.5556	M	0.87456	2.885	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.995	D	0.86314	0.1688	9	0.87932	D	0	-12.9082	18.1377	0.89624	0.0:0.0:1.0:0.0	.	283;284	Q9H1A3-2;Q9H1A3	.;METL9_HUMAN	V	284;283;248	.	ENSP00000350874:G284V	G	+	2	0	METTL9	21574148	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.445000	0.97587	2.890000	0.99128	0.650000	0.86243	GGT	.	.	.	none		0.423	METTL9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254465.1	NM_016025	
FAM83G	644815	hgsc.bcm.edu	37	17	18881908	18881908	+	Silent	SNP	G	G	A			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr17:18881908G>A	ENST00000388995.6	-	5	1294	c.1071C>T	c.(1069-1071)gtC>gtT	p.V357V	FAM83G_ENST00000585154.2_Silent_p.V357V|SLC5A10_ENST00000395642.1_Intron|SLC5A10_ENST00000395647.2_Intron|SLC5A10_ENST00000395643.2_Intron|SLC5A10_ENST00000395645.3_Intron|FAM83G_ENST00000345041.4_Silent_p.V357V|SLC5A10_ENST00000317977.6_Intron|SLC5A10_ENST00000417251.2_Intron			A6ND36	FA83G_HUMAN	family with sequence similarity 83, member G	357					BMP signaling pathway (GO:0030509)	cytosol (GO:0005829)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(3)|stomach(1)	22						CAATCTCGTCGACGCTCTTGG	0.627																																					p.V357V		Atlas-SNP	.											.	FAM83G	51	.	0			c.C1071T						PASS	.						67.0	74.0	72.0					17																	18881908		1996	4157	6153	SO:0001819	synonymous_variant	644815	exon5			CTCGTCGACGCTC	AK123558	CCDS42276.1	17p11.2	2014-05-01	2006-03-22		ENSG00000188522	ENSG00000188522			32554	protein-coding gene	gene with protein product	"""protein associated with SMAD1"""	615886				24554596	Standard	NM_001039999		Approved	FLJ41564, PAWS1	uc002guw.3	A6ND36	OTTHUMG00000059411	ENST00000388995.6:c.1071C>T	chr17.hg19:g.18881908G>A		153.0	0.0	.		146.0	21.0	.	NM_001039999	Q3KQZ4|Q6ZW60	Silent	SNP	ENST00000388995.6	hg19	CCDS42276.1																																																																																			.	.	.	none		0.627	FAM83G-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253108.4		
KANSL1	284058	hgsc.bcm.edu	37	17	44109553	44109553	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr17:44109553A>G	ENST00000262419.6	-	14	3420	c.2950T>C	c.(2950-2952)Tcc>Ccc	p.S984P	KANSL1_ENST00000432791.1_Missense_Mutation_p.S984P|KANSL1_ENST00000393476.3_Missense_Mutation_p.S278P|KANSL1_ENST00000574590.1_Missense_Mutation_p.S984P|KANSL1_ENST00000575318.1_Missense_Mutation_p.S920P|KANSL1_ENST00000572904.1_Missense_Mutation_p.S984P	NM_001193466.1	NP_001180395	Q7Z3B3	KANL1_HUMAN	KAT8 regulatory NSL complex subunit 1	984	Sufficient for interaction with KAT8.				chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											TGACCATGGGAGTATTCTGAC	0.632																																					p.S984P		Atlas-SNP	.											.	.	.	.	0			c.T2950C						PASS	.						54.0	59.0	58.0					17																	44109553		2203	4300	6503	SO:0001583	missense	284058	exon14			CATGGGAGTATTC	BX538006	CCDS11503.1, CCDS11503.2, CCDS74084.1	17q21.31	2012-02-20	2012-02-20	2012-02-20	ENSG00000120071	ENSG00000120071			24565	protein-coding gene	gene with protein product	"""centromere protein 36"""	612452	"""KIAA1267"""	KIAA1267		10574462	Standard	NM_015443		Approved	DKFZP727C091, MSL1v1, CENP-36, NSL1	uc002ikd.3	Q7Z3B3		ENST00000262419.6:c.2950T>C	chr17.hg19:g.44109553A>G	ENSP00000262419:p.Ser984Pro	145.0	0.0	.		103.0	38.0	.	NM_001193466	A8K5E4|Q6AW85|Q8IYH1|Q9BRH0|Q9NTE7|Q9UFT0|Q9ULF3	Missense_Mutation	SNP	ENST00000262419.6	hg19	CCDS11503.1	.	.	.	.	.	.	.	.	.	.	A	13.49	2.252579	0.39797	.	.	ENSG00000120071	ENST00000262419;ENST00000432791;ENST00000393476	T;T;T	0.26660	2.54;2.54;1.72	5.2	2.98	0.34508	.	0.285019	0.36482	N	0.002570	T	0.16171	0.0389	L	0.33485	1.01	0.33040	D	0.531312	B;B;B;B	0.12013	0.005;0.002;0.004;0.004	B;B;B;B	0.14578	0.01;0.007;0.011;0.011	T	0.20438	-1.0275	10	0.19590	T	0.45	-3.7274	7.0976	0.25319	0.7735:0.1488:0.0778:0.0	.	252;315;984;984	B3KT49;Q7Z3B3-2;C9JHY2;Q7Z3B3	.;.;.;K1267_HUMAN	P	984;984;278	ENSP00000262419:S984P;ENSP00000387393:S984P;ENSP00000377117:S278P	ENSP00000262419:S984P	S	-	1	0	KIAA1267	41465400	1.000000	0.71417	0.998000	0.56505	0.228000	0.25075	1.224000	0.32539	0.443000	0.26582	-0.429000	0.05907	TCC	.	.	.	none		0.632	KANSL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440274.1	NM_015443	
ZNF652	22834	hgsc.bcm.edu	37	17	47388762	47388762	+	Silent	SNP	A	A	G			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr17:47388762A>G	ENST00000362063.2	-	5	1539	c.1221T>C	c.(1219-1221)caT>caC	p.H407H	ZNF652_ENST00000430262.2_Silent_p.H407H	NM_014897.2	NP_055712.1	Q9Y2D9	ZN652_HUMAN	zinc finger protein 652	407					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	20	all_cancers(4;6.81e-14)|Breast(4;4.97e-29)|all_epithelial(4;1.53e-17)		BRCA - Breast invasive adenocarcinoma(1;3.1e-14)|Epithelial(5;2.92e-06)|all cancers(6;3.15e-05)			TGTGCCCAATATGAATGCTCA	0.433																																					p.H407H		Atlas-SNP	.											.	ZNF652	54	.	0			c.T1221C						PASS	.						271.0	235.0	248.0					17																	47388762		2203	4300	6503	SO:0001819	synonymous_variant	22834	exon5			CCCAATATGAATG	AB023141	CCDS32677.1	17q21.32	2013-01-08				ENSG00000198740		"""Zinc fingers, C2H2-type"""	29147	protein-coding gene	gene with protein product		613907				10231032	Standard	NM_014897		Approved	KIAA0924	uc002iow.3	Q9Y2D9		ENST00000362063.2:c.1221T>C	chr17.hg19:g.47388762A>G		245.0	0.0	.		248.0	33.0	.	NM_001145365	A4QPD9|Q5H9Q0	Silent	SNP	ENST00000362063.2	hg19	CCDS32677.1																																																																																			.	.	.	none		0.433	ZNF652-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364524.1	NM_014897	
SMCHD1	23347	hgsc.bcm.edu	37	18	2772342	2772342	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr18:2772342C>T	ENST00000320876.6	+	41	5485	c.5147C>T	c.(5146-5148)aCt>aTt	p.T1716I	RP11-703M24.5_ENST00000583546.1_RNA|SMCHD1_ENST00000261598.8_Missense_Mutation_p.T1716I|snoU13_ENST00000459147.1_RNA	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	1716					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						CCAAACTATACTAAAGGCAGT	0.348																																					p.T1716I		Atlas-SNP	.											.	SMCHD1	88	.	0			c.C5147T						PASS	.						97.0	92.0	94.0					18																	2772342		1830	4076	5906	SO:0001583	missense	23347	exon41			ACTATACTAAAGG	AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.5147C>T	chr18.hg19:g.2772342C>T	ENSP00000326603:p.Thr1716Ile	98.0	0.0	.		46.0	19.0	.	NM_015295	O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Missense_Mutation	SNP	ENST00000320876.6	hg19	CCDS45822.1	.	.	.	.	.	.	.	.	.	.	C	11.11	1.541676	0.27563	.	.	ENSG00000101596	ENST00000320876;ENST00000261598	D;D	0.85411	-1.98;-1.98	5.66	5.66	0.87406	SMCs flexible hinge (1);	0.303958	0.37053	N	0.002277	T	0.75554	0.3865	N	0.22421	0.69	0.37791	D	0.92734	P	0.39391	0.671	B	0.32289	0.143	T	0.75929	-0.3144	10	0.21014	T	0.42	-19.063	19.7468	0.96255	0.0:1.0:0.0:0.0	.	1716	A6NHR9	SMHD1_HUMAN	I	1716	ENSP00000326603:T1716I;ENSP00000261598:T1716I	ENSP00000261598:T1716I	T	+	2	0	SMCHD1	2762342	0.996000	0.38824	0.997000	0.53966	0.780000	0.44128	4.014000	0.57145	2.678000	0.91216	0.563000	0.77884	ACT	.	.	.	none		0.348	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441082.2		
WIZ	58525	hgsc.bcm.edu	37	19	15558957	15558957	+	Silent	SNP	C	C	T			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr19:15558957C>T	ENST00000389282.4	-	2	375	c.162G>A	c.(160-162)aaG>aaA	p.K54K	MIR1470_ENST00000600745.1_RNA|WIZ_ENST00000263381.7_Silent_p.K54K			O95785	WIZ_HUMAN	widely interspaced zinc finger motifs	54					positive regulation of nuclear cell cycle DNA replication (GO:0010571)|protein heterotrimerization (GO:0070208)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	24						GGGGGCCCTCCTTGGTGACAG	0.647																																					p.K54K		Atlas-SNP	.											.	WIZ	152	.	0			c.G162A						PASS	.						68.0	74.0	73.0					19																	15558957		1957	4128	6085	SO:0001819	synonymous_variant	58525	exon2			GCCCTCCTTGGTG	AK091183	CCDS42516.1	19p13.12	2012-10-05	2007-01-18		ENSG00000011451	ENSG00000011451		"""Zinc fingers, C2H2-type"""	30917	protein-coding gene	gene with protein product			"""WIZ zinc finger"""			9795207, 12226707	Standard	NM_021241		Approved	ZNF803	uc002nbb.4	O95785		ENST00000389282.4:c.162G>A	chr19.hg19:g.15558957C>T		223.0	0.0	.		76.0	30.0	.	NM_021241	B3KVH1|B7ZM82|M0QY21|Q4G0E0|Q6P6B0|Q6ZN24|Q7LDY6|Q7LDZ1|Q96IG5|Q96SQ6|Q9BUR8|Q9NPT1	Silent	SNP	ENST00000389282.4	hg19																																																																																				.	.	.	none		0.647	WIZ-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_021241	
PLVAP	83483	hgsc.bcm.edu	37	19	17476947	17476947	+	Missense_Mutation	SNP	A	A	C			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr19:17476947A>C	ENST00000252590.4	-	2	488	c.427T>G	c.(427-429)Tgc>Ggc	p.C143G		NM_031310.1	NP_112600.1	Q9BX97	PLVAP_HUMAN	plasmalemma vesicle associated protein	143					MAPK cascade (GO:0000165)|positive regulation of cellular extravasation (GO:0002693)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						TGATCTCTGCATTGCTTCTCA	0.552																																					p.C143G		Atlas-SNP	.											.	PLVAP	64	.	0			c.T427G						PASS	.						242.0	205.0	217.0					19																	17476947		2203	4300	6503	SO:0001583	missense	83483	exon2			CTCTGCATTGCTT	AF326591	CCDS32952.1	19p13.2	2008-07-17				ENSG00000130300			13635	protein-coding gene	gene with protein product	"""fenestrated-endothelial linked structure protein; PV-1 protein"""	607647				11401446	Standard	NM_031310		Approved	gp68, PV-1, PV1, FELS	uc002ngk.1	Q9BX97		ENST00000252590.4:c.427T>G	chr19.hg19:g.17476947A>C	ENSP00000252590:p.Cys143Gly	293.0	1.0	.		138.0	52.0	.	NM_031310	Q86VP0|Q8N8Y0|Q8ND68|Q8TER8|Q9BZD5	Missense_Mutation	SNP	ENST00000252590.4	hg19	CCDS32952.1	.	.	.	.	.	.	.	.	.	.	A	13.54	2.268758	0.40095	.	.	ENSG00000130300	ENST00000252590	T	0.29142	1.58	4.06	4.06	0.47325	.	0.379023	0.30455	N	0.009594	T	0.38374	0.1038	L	0.34521	1.04	0.09310	N	0.999998	D	0.89917	1.0	D	0.91635	0.999	T	0.12426	-1.0548	10	0.20519	T	0.43	-58.5488	9.6793	0.40061	1.0:0.0:0.0:0.0	.	143	Q9BX97	PLVAP_HUMAN	G	143	ENSP00000252590:C143G	ENSP00000252590:C143G	C	-	1	0	PLVAP	17337947	0.326000	0.24669	0.096000	0.21009	0.003000	0.03518	3.317000	0.51968	2.071000	0.62044	0.454000	0.30748	TGC	.	.	.	none		0.552	PLVAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463655.1	NM_031310	
PRX	57716	hgsc.bcm.edu	37	19	40903295	40903295	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr19:40903295C>T	ENST00000324001.7	-	7	1234	c.964G>A	c.(964-966)Gtg>Atg	p.V322M	PRX_ENST00000291825.7_3'UTR	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin	322					axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GTGGGCACCACTACCGACACA	0.687																																					p.V322M		Atlas-SNP	.											.	PRX	151	.	0			c.G964A						PASS	.						13.0	13.0	13.0					19																	40903295		2068	4088	6156	SO:0001583	missense	57716	exon7			GCACCACTACCGA	AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.964G>A	chr19.hg19:g.40903295C>T	ENSP00000326018:p.Val322Met	49.0	0.0	.		33.0	9.0	.	NM_181882	Q9BXL9|Q9HCF2	Missense_Mutation	SNP	ENST00000324001.7	hg19	CCDS33028.1	.	.	.	.	.	.	.	.	.	.	C	1.262	-0.615608	0.03663	.	.	ENSG00000105227	ENST00000324001;ENST00000341562	T	0.01092	5.35	4.56	1.19	0.21007	.	0.747813	0.11845	N	0.523898	T	0.00608	0.0020	N	0.02539	-0.55	0.09310	N	0.999999	B	0.18610	0.029	B	0.10450	0.005	T	0.47623	-0.9103	10	0.46703	T	0.11	-5.234	4.3329	0.11073	0.0:0.205:0.1751:0.6198	.	322	Q9BXM0	PRAX_HUMAN	M	322	ENSP00000326018:V322M	ENSP00000326018:V322M	V	-	1	0	PRX	45595135	0.003000	0.15002	0.072000	0.20136	0.072000	0.16883	0.502000	0.22594	0.794000	0.33899	-0.367000	0.07326	GTG	.	.	.	none		0.687	PRX-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000462582.1	NM_020956	
APOL5	80831	hgsc.bcm.edu	37	22	36123235	36123235	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr22:36123235C>T	ENST00000249044.2	+	3	1120	c.1120C>T	c.(1120-1122)Cca>Tca	p.P374S		NM_030642.1	NP_085145.1	Q9BWW9	APOL5_HUMAN	apolipoprotein L, 5	374					lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	high-density lipoprotein particle binding (GO:0008035)|lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|skin(2)|urinary_tract(1)	19						TGTGGTTAAACCAGAAGGTAG	0.597																																					p.P374S		Atlas-SNP	.											.	APOL5	45	.	0			c.C1120T						PASS	.						42.0	46.0	45.0					22																	36123235		2196	4290	6486	SO:0001583	missense	80831	exon3			GTTAAACCAGAAG	AY014878	CCDS13920.1	22q12.3	2013-01-24			ENSG00000128313	ENSG00000128313		"""Apolipoproteins"""	14869	protein-coding gene	gene with protein product		607255				11374903	Standard	NM_030642		Approved	APOLV	uc003aof.3	Q9BWW9	OTTHUMG00000150588	ENST00000249044.2:c.1120C>T	chr22.hg19:g.36123235C>T	ENSP00000249044:p.Pro374Ser	105.0	0.0	.		40.0	16.0	.	NM_030642	Q5TFL9|Q9UGW5	Missense_Mutation	SNP	ENST00000249044.2	hg19	CCDS13920.1	.	.	.	.	.	.	.	.	.	.	C	8.430	0.848333	0.17034	.	.	ENSG00000128313	ENST00000249044	T	0.06142	3.34	1.94	-1.84	0.07809	.	3.921800	0.02219	U	0.063822	T	0.03608	0.0103	N	0.08118	0	0.09310	N	1	B	0.28552	0.215	B	0.23018	0.043	T	0.37911	-0.9685	10	0.87932	D	0	.	4.2557	0.10715	0.0:0.3635:0.4734:0.1631	.	374	Q9BWW9	APOL5_HUMAN	S	374	ENSP00000249044:P374S	ENSP00000249044:P374S	P	+	1	0	APOL5	34453181	0.000000	0.05858	0.001000	0.08648	0.029000	0.11900	-0.970000	0.03810	-0.348000	0.08286	0.462000	0.41574	CCA	.	.	.	none		0.597	APOL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318979.1	NM_030642	
DDX3X	1654	hgsc.bcm.edu	37	X	41203029	41203029	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chrX:41203029G>T	ENST00000399959.2	+	8	1574	c.719G>T	c.(718-720)aGt>aTt	p.S240I	DDX3X_ENST00000478993.1_3'UTR|DDX3X_ENST00000542215.1_Intron|DDX3X_ENST00000441189.2_Intron|DDX3X_ENST00000457138.2_Missense_Mutation_p.S224I|RN7SL15P_ENST00000582825.1_RNA	NM_001193416.1|NM_001193417.1|NM_001356.3	NP_001180345.1|NP_001180346.1|NP_001347.3	O00571	DDX3X_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked	240	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.|Interaction with GSK3B.				ATP catabolic process (GO:0006200)|cellular response to arsenic-containing substance (GO:0071243)|cellular response to osmotic stress (GO:0071470)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|mature ribosome assembly (GO:0042256)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell growth (GO:0030307)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of translation (GO:0045727)|positive regulation of translational initiation (GO:0045948)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|stress granule assembly (GO:0034063)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 5'-UTR binding (GO:0048027)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|transcription factor binding (GO:0008134)|translation initiation factor binding (GO:0031369)			NS(3)|breast(8)|central_nervous_system(36)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84						CCCATCTTGAGTCAGATTTAT	0.398										HNSCC(61;0.18)																											p.S240I		Atlas-SNP	.											.	DDX3X	138	.	0			c.G719T						PASS	.						90.0	78.0	82.0					X																	41203029		1934	4159	6093	SO:0001583	missense	1654	exon8			TCTTGAGTCAGAT	U50553	CCDS43931.1, CCDS55404.1	Xp11.3-p11.23	2013-07-16	2013-07-16	2003-06-20	ENSG00000215301	ENSG00000215301		"""DEAD-boxes"""	2745	protein-coding gene	gene with protein product		300160	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked"""	DDX3		9381176, 9730595	Standard	NM_001193416		Approved	DBX, HLP2, DDX14	uc004dfe.3	O00571	OTTHUMG00000021369	ENST00000399959.2:c.719G>T	chrX.hg19:g.41203029G>T	ENSP00000382840:p.Ser240Ile	154.0	0.0	.		89.0	10.0	.	NM_001193416	A8K538|B4E3E8|O15536	Missense_Mutation	SNP	ENST00000399959.2	hg19	CCDS43931.1	.	.	.	.	.	.	.	.	.	.	G	33	5.205754	0.95033	.	.	ENSG00000215301	ENST00000399959;ENST00000457138	T;T	0.15718	2.4;2.4	5.42	5.42	0.78866	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.30166	0.0756	N	0.20328	0.56	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.997;0.992;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.941;0.932;0.999;0.999	T	0.14643	-1.0465	10	0.87932	D	0	-15.9903	18.5561	0.91085	0.0:0.0:1.0:0.0	.	240;224;240;252;240	B4DLU5;B4E3E8;B5BTY4;Q59GX6;O00571	.;.;.;.;DDX3X_HUMAN	I	240;224	ENSP00000382840:S240I;ENSP00000392494:S224I	ENSP00000382840:S240I	S	+	2	0	DDX3X	41087973	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.636000	0.98440	2.411000	0.81874	0.600000	0.82982	AGT	.	.	.	none		0.398	DDX3X-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056253.1	NM_024005	
ATP11C	286410	hgsc.bcm.edu	37	X	138844142	138844142	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chrX:138844142A>G	ENST00000327569.3	-	22	2725	c.2627T>C	c.(2626-2628)cTt>cCt	p.L876P	ATP11C_ENST00000370543.1_Missense_Mutation_p.L876P|ATP11C_ENST00000359686.2_Missense_Mutation_p.L876P|ATP11C_ENST00000370557.1_Missense_Mutation_p.L870P|ATP11C_ENST00000361648.2_Missense_Mutation_p.L876P|ATP11C_ENST00000460773.1_5'UTR	NM_173694.4	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C	876					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|positive regulation of B cell differentiation (GO:0045579)|pre-B cell differentiation (GO:0002329)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(31)|ovary(5)|prostate(1)|skin(3)	75	Acute lymphoblastic leukemia(192;0.000127)					GTACTGTACAAGGTGTGCTAT	0.343																																					p.L876P		Atlas-SNP	.											.	ATP11C	319	.	0			c.T2627C						PASS	.						112.0	100.0	104.0					X																	138844142		2203	4300	6503	SO:0001583	missense	286410	exon22			TGTACAAGGTGTG	AJ580094	CCDS14668.1, CCDS35410.1	Xq27.1	2011-06-09	2007-09-19		ENSG00000101974	ENSG00000101974		"""ATPases / P-type"""	13554	protein-coding gene	gene with protein product		300516	"""ATPase, Class VI, type 11C"""			11015572	Standard	NM_173694		Approved	ATPIG, ATPIQ	uc004faz.3	Q8NB49	OTTHUMG00000022538	ENST00000327569.3:c.2627T>C	chrX.hg19:g.138844142A>G	ENSP00000332756:p.Leu876Pro	75.0	0.0	.		152.0	69.0	.	NM_001010986	Q5JT69|Q5JT70|Q5JT71|Q5JT72|Q5JT73|Q6ZND5|Q6ZU50|Q6ZUP7|Q70IJ9|Q70IK0|Q8WX24	Missense_Mutation	SNP	ENST00000327569.3	hg19	CCDS14668.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.010046	0.75046	.	.	ENSG00000101974	ENST00000370557;ENST00000361648;ENST00000327569;ENST00000370543;ENST00000359686	T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.78394	0.4276	H	0.96518	3.835	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.85280	0.1061	10	0.72032	D	0.01	.	14.1997	0.65693	1.0:0.0:0.0:0.0	.	876;876;876	Q8NB49-3;Q8NB49;Q8NB49-2	.;AT11C_HUMAN;.	P	870;876;876;876;876	ENSP00000359588:L870P;ENSP00000355165:L876P;ENSP00000332756:L876P;ENSP00000359574:L876P;ENSP00000352715:L876P	ENSP00000332756:L876P	L	-	2	0	ATP11C	138671808	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.962000	0.93254	1.952000	0.56665	0.441000	0.28932	CTT	.	.	.	none		0.343	ATP11C-008	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354945.1	NM_173694	
SLC25A12	8604	hgsc.bcm.edu	37	2	172691265	172691266	+	Frame_Shift_Del	DEL	GC	GC	-			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	GC	GC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr2:172691265_172691266delGC	ENST00000422440.2	-	7	759_760	c.722_723delGC	c.(721-723)ggcfs	p.G241fs	SLC25A12_ENST00000392592.4_Frame_Shift_Del_p.G134fs	NM_003705.4	NP_003696.2	O75746	CMC1_HUMAN	solute carrier family 25 (aspartate/glutamate carrier), member 12	241					aspartate transport (GO:0015810)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|L-glutamate transport (GO:0015813)|malate-aspartate shuttle (GO:0043490)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|upper_aerodigestive_tract(1)	23			OV - Ovarian serous cystadenocarcinoma(117;0.216)		L-Aspartic Acid(DB00128)	CTTTCCTTGTGCCAGCTAGAGT	0.361																																					p.241_242del		Atlas-Indel,Pindel	.											.	SLC25A12	59	.	0			c.723_724del						PASS	.																																			SO:0001589	frameshift_variant	8604	exon7			.	Y14494	CCDS33327.1	2q24	2013-05-22	2012-03-29		ENSG00000115840	ENSG00000115840		"""Solute carriers"", ""EF-hand domain containing"""	10982	protein-coding gene	gene with protein product		603667	"""solute carrier family 25 (mitochondrial carrier, Aralar), member 12"""			9722566, 10702666, 11566871	Standard	NM_003705		Approved	Aralar	uc002uhh.3	O75746	OTTHUMG00000134290	ENST00000422440.2:c.722_723delGC	chr2.hg19:g.172691265_172691266delGC	ENSP00000388658:p.Gly241fs	87.0	0.0	0		134.0	16.0	0.119403	NM_003705	B3KR64|Q96AM8	Frame_Shift_Del	DEL	ENST00000422440.2	hg19	CCDS33327.1																																																																																			.	.	.	none		0.361	SLC25A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259010.2	NM_003705	
ZDHHC3	51304	hgsc.bcm.edu	37	3	44986685	44986687	+	In_Frame_Del	DEL	TGA	TGA	-			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	TGA	TGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr3:44986685_44986687delTGA	ENST00000424952.2	-	3	672_674	c.404_406delTCA	c.(403-408)atcaag>aag	p.I135del	ZDHHC3_ENST00000296127.3_In_Frame_Del_p.I135del|ZDHHC3_ENST00000342790.4_In_Frame_Del_p.I169del	NM_001135179.1	NP_001128651.1	Q9NYG2	ZDHC3_HUMAN	zinc finger, DHHC-type containing 3	135					protein palmitoylation (GO:0018345)|protein targeting (GO:0006605)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(4)	8				BRCA - Breast invasive adenocarcinoma(193;0.00943)|KIRC - Kidney renal clear cell carcinoma(197;0.053)|Kidney(197;0.0665)		CGGTCGGGCTTGATGCTGCAGCA	0.591																																					p.135_136del		Atlas-Indel,Pindel	.											.	ZDHHC3	25	.	0			c.405_407del						PASS	.																																			SO:0001651	inframe_deletion	51304	exon3			.	AF247703	CCDS2724.1, CCDS46811.1	3p21.31	2010-02-09			ENSG00000163812	ENSG00000163812		"""Zinc fingers, DHHC-type"""	18470	protein-coding gene	gene with protein product	"""golgi-specific DHHC Zinc Finger Protein"""					19955568	Standard	NM_016598		Approved	ZNF373, GODZ	uc003cod.3	Q9NYG2	OTTHUMG00000133093	ENST00000424952.2:c.404_406delTCA	chr3.hg19:g.44986685_44986687delTGA	ENSP00000395502:p.Ile135del	133.0	0.0	0		154.0	28.0	0.181818	NM_001135179	Q53A17|Q96BL0	In_Frame_Del	DEL	ENST00000424952.2	hg19	CCDS46811.1																																																																																			.	.	.	none		0.591	ZDHHC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347004.1	NM_016598	
UGT1A9	54600	hgsc.bcm.edu	37	2	234580593	234580593	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr2:234580593delG	ENST00000354728.4	+	1	95	c.13delG	c.(13-15)gggfs	p.G5fs	UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A1_ENST00000609637.1_Frame_Shift_Del_p.G5fs			O60656	UD19_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A9	5					cellular glucuronidation (GO:0052695)|cellular lipid metabolic process (GO:0044255)|drug metabolic process (GO:0017144)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|metabolic process (GO:0008152)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of fatty acid metabolic process (GO:0045922)|retinoic acid metabolic process (GO:0042573)|small molecule metabolic process (GO:0044281)|xenobiotic glucuronidation (GO:0052697)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)			breast(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	37		Breast(86;0.000766)|all_lung(227;0.00269)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0331)|Lung NSC(271;0.0459)|Lung SC(224;0.128)		Epithelial(121;1.26e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000436)|Lung(119;0.00347)|LUSC - Lung squamous cell carcinoma(224;0.00757)	Acetaminophen(DB00316)|Buprenorphine(DB00921)|Canagliflozin(DB08907)|Dabigatran etexilate(DB06695)|Dapagliflozin(DB06292)|Entacapone(DB00494)|Etodolac(DB00749)|Ezogabine(DB04953)|Flurbiprofen(DB00712)|Haloperidol(DB00502)|Human Serum Albumin(DB00062)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ketobemidone(DB06738)|Lumiracoxib(DB01283)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Nateglinide(DB00731)|Niflumic Acid(DB04552)|Oxazepam(DB00842)|Propofol(DB00818)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sulfamethoxazole(DB01015)|Tapentadol(DB06204)|Valproic Acid(DB00313)|Zileuton(DB00744)	GGCTTGCACAGGGTGGACCAG	0.557																																					p.T4fs		Atlas-Indel,Pindel	.											.	UGT1A9	79	.	0			c.12delA						PASS	.						66.0	61.0	63.0					2																	234580593		2203	4300	6503	SO:0001589	frameshift_variant	54600	exon1			.	AF056188	CCDS2505.1	2q37	2010-03-05	2005-07-20		ENSG00000241119	ENSG00000241119		"""UDP glucuronosyltransferases"""	12541	other	complex locus constituent		606434	"""UDP glycosyltransferase 1 family, polypeptide A9"""			9295054, 1910331	Standard	NM_021027		Approved	HLUGP4, LUGP4, UGT1AI		O60656	OTTHUMG00000059124	ENST00000354728.4:c.13delG	chr2.hg19:g.234580593delG	ENSP00000346768:p.Gly5fs	67.0	0.0	0		71.0	18.0	0.253521	NM_021027	B8K285|P36509|Q9HAX0	Frame_Shift_Del	DEL	ENST00000354728.4	hg19	CCDS2505.1																																																																																			.	.	.	none		0.557	UGT1A9-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130995.1	NM_021027	
DHX15	1665	hgsc.bcm.edu	37	4	24543620	24543620	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr4:24543620delT	ENST00000336812.4	-	8	1517	c.1361delA	c.(1360-1362)gagfs	p.E454fs	DHX15_ENST00000508032.1_5'Flank	NM_001358.2	NP_001349.2	O43143	DHX15_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 15	454	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	30		Breast(46;0.0503)				CAAAAGGGACTCAACTCTGAT	0.423																																					p.E454fs		Atlas-Indel,Pindel	.											.	DHX15	69	.	0			c.1362delG						PASS	.						91.0	90.0	91.0					4																	24543620		2203	4300	6503	SO:0001589	frameshift_variant	1665	exon8			.	AB001636	CCDS33966.1	4p15.3	2013-05-13	2013-05-13	2003-06-20	ENSG00000109606	ENSG00000109606		"""DEAH-boxes"""	2738	protein-coding gene	gene with protein product		603403	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 15"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 15"""	DDX15		9388478	Standard	NM_001358		Approved	HRH2, DBP1, PRP43, PrPp43p, PRPF43	uc003gqx.3	O43143	OTTHUMG00000160304	ENST00000336812.4:c.1361delA	chr4.hg19:g.24543620delT	ENSP00000336741:p.Glu454fs	53.0	0.0	0		56.0	17.0	0.303571	NM_001358	Q9NQT7	Frame_Shift_Del	DEL	ENST00000336812.4	hg19	CCDS33966.1																																																																																			.	.	.	none		0.423	DHX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360143.1	NM_001358	
DIEXF	27042	hgsc.bcm.edu	37	1	210006621	210006621	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr1:210006621delA	ENST00000491415.2	+	4	537	c.480delA	c.(478-480)gcafs	p.A160fs		NM_014388.6	NP_055203.4	Q68CQ4	DIEXF_HUMAN	digestive organ expansion factor homolog (zebrafish)	160	Glu-rich.				multicellular organismal development (GO:0007275)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(15)|large_intestine(7)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(2)	53						TCACAGATGCAAAACACGAGT	0.478																																					p.A160fs		Atlas-Indel,Pindel	.											.	DIEXF	97	.	0			c.479delC						PASS	.						113.0	103.0	107.0					1																	210006621		2203	4300	6503	SO:0001589	frameshift_variant	27042	exon4			.	BC022964	CCDS1493.1	1q32.2	2011-08-12	2011-02-16	2011-02-16	ENSG00000117597	ENSG00000117597			28440	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 107"""	C1orf107		16322560	Standard	NM_014388		Approved	MGC29875, DEF, UTP25	uc001hhr.2	Q68CQ4	OTTHUMG00000036654	ENST00000491415.2:c.480delA	chr1.hg19:g.210006621delA	ENSP00000419005:p.Ala160fs	104.0	0.0	0		81.0	31.0	0.382716	NM_014388	O75992|Q4VY00|Q63HL9	Frame_Shift_Del	DEL	ENST00000491415.2	hg19	CCDS1493.1																																																																																			.	.	.	none		0.478	DIEXF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089127.2	NM_014388	
ATAD2	29028	hgsc.bcm.edu	37	8	124382171	124382185	+	In_Frame_Del	DEL	TCATCATCATCATCG	TCATCATCATCATCG	-	rs139406007|rs539981908|rs370549201|rs200543112|rs117211505|rs113160199|rs148244463	byFrequency	TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	TCATCATCATCATCG	TCATCATCATCATCG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr8:124382171_124382185delTCATCATCATCATCG	ENST00000287394.5	-	7	914_928	c.807_821delCGATGATGATGATGA	c.(805-822)gacgatgatgatgatgat>gat	p.269_274DDDDDD>D	ATAD2_ENST00000521903.1_De_novo_Start_InFrame|ATAD2_ENST00000534257.1_5'Flank	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	269	Asp-rich.				ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			atcatcatcatcatcatcatcatcgtcatcatcat	0.372																																					p.270_274del		Pindel	.											.	ATAD2	160	.	0			c.808_822del						PASS	.																																			SO:0001651	inframe_deletion	29028	exon7			.	BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.807_821delCGATGATGATGATGA	chr8.hg19:g.124382171_124382185delTCATCATCATCATCG	ENSP00000287394:p.Asp269_Asp273del	48.0	0.0	.		45.0	12.0	0.267	NM_014109	Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	In_Frame_Del	DEL	ENST00000287394.5	hg19	CCDS6343.1																																																																																			.	.	.	none		0.372	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381766.2	NM_014109	
HNRNPCL1	343069	hgsc.bcm.edu	37	1	12907282	12907285	+	Frame_Shift_Del	DEL	GGTG	GGTG	-	rs139731855|rs149796618|rs148930640		TCGA-B1-7332-01A-11D-2136-08	TCGA-B1-7332-10A-01D-2136-08	GGTG	GGTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d453dcec-6bab-4b59-a593-ee38835cbe15	9d012012-57fb-4523-a066-ad674ddb3d3f	g.chr1:12907282_12907285delGGTG	ENST00000317869.6	-	2	1083_1086	c.858_861delCACC	c.(856-861)agcaccfs	p.ST286fs		NM_001013631.1|NM_001136561.2|NM_001146181.1	NP_001013653.1|NP_001130033.2|NP_001139653.1	O60812	HNRC1_HUMAN	heterogeneous nuclear ribonucleoprotein C-like 1	286						nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.S286R(1)|p.T287A(1)|p.T287T(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|stomach(2)	29						CCTGGCCATTGGTGCTGTCTCTGT	0.436																																					p.287_288del		Pindel	.											.	HNRNPCL1	68	.	3	Substitution - Missense(2)|Substitution - coding silent(1)	stomach(2)|lung(1)	c.859_862del						PASS	.																																			SO:0001589	frameshift_variant	343069	exon2			.	BC002696	CCDS30591.1	1p36.21	2013-02-12		2008-04-18	ENSG00000179172	ENSG00000179172		"""RNA binding motif (RRM) containing"""	29295	protein-coding gene	gene with protein product				HNRPCL1			Standard	NM_001013631		Approved			O60812	OTTHUMG00000001931	ENST00000317869.6:c.858_861delCACC	chr1.hg19:g.12907282_12907285delGGTG	ENSP00000365370:p.Ser286fs	380.0	0.0	.		233.0	16.0	0.069	NM_001013631	B2RP44	Frame_Shift_Del	DEL	ENST00000317869.6	hg19	CCDS30591.1																																																																																			.	.	.	none		0.436	HNRNPCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005462.1	NM_001013631	
