#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
DOCK7	85440	hgsc.bcm.edu	37	1	63119731	63119731	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr1:63119731A>G	ENST00000340370.5	-	3	261	c.244T>C	c.(244-246)Ttt>Ctt	p.F82L	DOCK7_ENST00000251157.5_Missense_Mutation_p.F82L|DOCK7_ENST00000404627.2_Missense_Mutation_p.F82L	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	82					activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						TCTGGAGGAAATTCAATCAAA	0.428																																					p.F82L		Atlas-SNP	.											.	DOCK7	184	.	0			c.T244C						PASS	.						67.0	66.0	66.0					1																	63119731		2203	4300	6503	SO:0001583	missense	85440	exon3			GAGGAAATTCAAT		CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.244T>C	chr1.hg19:g.63119731A>G	ENSP00000340742:p.Phe82Leu	83.0	0.0	.		85.0	27.0	.	NM_001271999	Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Missense_Mutation	SNP	ENST00000340370.5	hg19	CCDS30734.1	.	.	.	.	.	.	.	.	.	.	A	34	5.346120	0.95807	.	.	ENSG00000116641	ENST00000371140;ENST00000251157;ENST00000340370;ENST00000404627	T;T;T	0.63580	-0.05;-0.05;-0.05	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.73799	0.3633	M	0.84156	2.68	0.80722	D	1	P;D;P	0.56521	0.911;0.976;0.861	P;P;P	0.62382	0.895;0.901;0.73	T	0.78314	-0.2252	10	0.59425	D	0.04	.	15.1374	0.72579	1.0:0.0:0.0:0.0	.	82;82;82	Q96NI0;Q96N67-2;Q96N67-5	.;.;.	L	82	ENSP00000251157:F82L;ENSP00000340742:F82L;ENSP00000384446:F82L	ENSP00000251157:F82L	F	-	1	0	DOCK7	62892319	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.683000	0.91236	2.162000	0.67917	0.533000	0.62120	TTT	.	.	.	none		0.428	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036806.1	NM_033407	
PLEKHO1	51177	hgsc.bcm.edu	37	1	150131515	150131515	+	Missense_Mutation	SNP	C	C	A			TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr1:150131515C>A	ENST00000369124.4	+	6	1305	c.1027C>A	c.(1027-1029)Ccg>Acg	p.P343T	PLEKHO1_ENST00000025469.6_Missense_Mutation_p.P309T|PLEKHO1_ENST00000369126.1_Missense_Mutation_p.P160T	NM_016274.4	NP_057358.2	Q53GL0	PKHO1_HUMAN	pleckstrin homology domain containing, family O member 1	343	Negative regulator of AP-1 activity.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|skin(2)	22	Lung NSC(24;7.78e-28)|Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			CCCTCGGTCTCCGCCGGATTC	0.607																																					p.P343T		Atlas-SNP	.											.	PLEKHO1	37	.	0			c.C1027A						PASS	.						50.0	54.0	53.0					1																	150131515		2203	4300	6503	SO:0001583	missense	51177	exon6			CGGTCTCCGCCGG	AF073836	CCDS945.1	1q21.2	2013-01-10			ENSG00000023902	ENSG00000023902		"""Pleckstrin homology (PH) domain containing"""	24310	protein-coding gene	gene with protein product		608335				10799509	Standard	NM_016274		Approved	CKIP-1, OC120	uc001ett.3	Q53GL0	OTTHUMG00000012510	ENST00000369124.4:c.1027C>A	chr1.hg19:g.150131515C>A	ENSP00000358120:p.Pro343Thr	132.0	0.0	.		127.0	19.0	.	NM_016274	Q336K5|Q8IZ51|Q9NRV3|Q9UL48	Missense_Mutation	SNP	ENST00000369124.4	hg19	CCDS945.1	.	.	.	.	.	.	.	.	.	.	C	15.60	2.880995	0.51801	.	.	ENSG00000023902	ENST00000369126;ENST00000025469;ENST00000369124;ENST00000441340	T;T	0.41758	0.99;0.99	5.24	5.24	0.73138	.	0.515831	0.21943	N	0.066842	T	0.13329	0.0323	N	0.14661	0.345	0.35920	D	0.831769	B	0.34103	0.437	B	0.32090	0.14	T	0.07309	-1.0779	10	0.52906	T	0.07	-17.5791	8.9859	0.35994	0.0:0.899:0.0:0.101	.	343	Q53GL0	PKHO1_HUMAN	T	160;309;343;223	ENSP00000025469:P309T;ENSP00000358120:P343T	ENSP00000025469:P309T	P	+	1	0	PLEKHO1	148398139	0.278000	0.24230	1.000000	0.80357	0.732000	0.41865	1.272000	0.33109	2.726000	0.93360	0.655000	0.94253	CCG	.	.	.	none		0.607	PLEKHO1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034962.1	NM_016274	
C2orf61	285051	hgsc.bcm.edu	37	2	47382353	47382353	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr2:47382353A>G	ENST00000445927.2	-	1	164	c.38T>C	c.(37-39)aTa>aCa	p.I13T	RP11-761B3.1_ENST00000422269.1_Intron|C2orf61_ENST00000294947.2_Missense_Mutation_p.I13T	NM_001163561.1	NP_001157033.1	Q8N801	CB061_HUMAN	chromosome 2 open reading frame 61	13								p.0?(2)		endometrium(1)|kidney(1)|lung(2)	4		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)			GTCTTCCCTTATTGAGGTGGA	0.632																																					p.I13T		Atlas-SNP	.											.	C2orf61	31	.	2	Whole gene deletion(2)	haematopoietic_and_lymphoid_tissue(2)	c.T38C						PASS	.						103.0	86.0	91.0					2																	47382353		2203	4300	6503	SO:0001583	missense	285051	exon1			TCCCTTATTGAGG	AK097491	CCDS1831.1, CCDS54356.1	2p21	2008-02-05			ENSG00000239605	ENSG00000239605			26850	protein-coding gene	gene with protein product							Standard	NM_173649		Approved	FLJ40172	uc010yog.2	Q8N801	OTTHUMG00000128851	ENST00000445927.2:c.38T>C	chr2.hg19:g.47382353A>G	ENSP00000408527:p.Ile13Thr	118.0	0.0	.		100.0	31.0	.	NM_173649	H7C2Z2	Missense_Mutation	SNP	ENST00000445927.2	hg19	CCDS54356.1	.	.	.	.	.	.	.	.	.	.	A	7.690	0.690952	0.15039	.	.	ENSG00000239605	ENST00000445927;ENST00000294947	T;T	0.32988	1.43;1.44	3.27	-2.91	0.05631	.	.	.	.	.	T	0.15219	0.0367	N	0.22421	0.69	0.09310	N	1	B	0.16396	0.017	B	0.14023	0.01	T	0.27806	-1.0063	9	0.59425	D	0.04	-0.0687	0.6125	0.00764	0.3325:0.172:0.1132:0.3822	.	13	Q8N801	CB061_HUMAN	T	13	ENSP00000408527:I13T;ENSP00000294947:I13T	ENSP00000294947:I13T	I	-	2	0	C2orf61	47235857	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.157000	0.16402	-0.545000	0.06224	-0.527000	0.04329	ATA	.	.	.	none		0.632	C2orf61-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_173649	
ZNF2	7549	hgsc.bcm.edu	37	2	95847510	95847510	+	Missense_Mutation	SNP	C	C	G			TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr2:95847510C>G	ENST00000340539.5	+	5	1399	c.937C>G	c.(937-939)Cct>Gct	p.P313A	ZNF2_ENST00000425369.1_Missense_Mutation_p.P233A|ZNF2_ENST00000398107.2_Missense_Mutation_p.P271A|ZNF2_ENST00000453539.2_Missense_Mutation_p.P326A|ZNF2_ENST00000295210.6_Missense_Mutation_p.P275A	NM_021088.2	NP_066574	Q9BSG1	ZNF2_HUMAN	zinc finger protein 2	313					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(4)|lung(3)|upper_aerodigestive_tract(1)	12		Ovarian(717;0.00768)		READ - Rectum adenocarcinoma(193;0.0222)		TGGCAGGAAGCCTTATGAGTG	0.468																																					p.P313A		Atlas-SNP	.											.	ZNF2	21	.	0			c.C937G						PASS	.						72.0	78.0	76.0					2																	95847510		2117	4248	6365	SO:0001583	missense	7549	exon5			AGGAAGCCTTATG	X60152	CCDS42712.1, CCDS42713.1, CCDS62957.1	2q11.1	2013-09-24	2005-02-07		ENSG00000163067	ENSG00000275111		"""Zinc fingers, C2H2-type"", ""-"""	12991	protein-coding gene	gene with protein product		194500	"""zinc finger protein 2 (A1-5)"""			8183940, 1945843	Standard	NM_021088		Approved	A1-5, ZNF661, Zfp661	uc002suf.3	Q9BSG1	OTTHUMG00000155150	ENST00000340539.5:c.937C>G	chr2.hg19:g.95847510C>G	ENSP00000345392:p.Pro313Ala	168.0	0.0	.		153.0	53.0	.	NM_021088	A8MWV7|B4DIR4|Q4ZFY6|Q96G44|Q9UMC5	Missense_Mutation	SNP	ENST00000340539.5	hg19	CCDS42712.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.197452	0.79015	.	.	ENSG00000163067	ENST00000398107;ENST00000340539;ENST00000425369;ENST00000295210;ENST00000453539	T;T;T;T;T	0.16457	2.34;2.34;2.34;2.34;2.34	5.31	5.31	0.75309	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.49305	D	0.000154	T	0.43233	0.1238	M	0.77406	2.37	0.53688	D	0.999974	D;D;D	0.76494	0.986;0.999;0.962	P;D;P	0.66847	0.766;0.947;0.514	T	0.35051	-0.9804	10	0.87932	D	0	-19.4509	16.5178	0.84305	0.0:1.0:0.0:0.0	.	275;271;312	B4DIR4;A8MWV7;Q9BSG1	.;.;ZNF2_HUMAN	A	271;313;233;275;326	ENSP00000381178:P271A;ENSP00000345392:P313A;ENSP00000406017:P233A;ENSP00000295210:P275A;ENSP00000411051:P326A	ENSP00000295210:P275A	P	+	1	0	ZNF2	95211237	1.000000	0.71417	0.998000	0.56505	0.591000	0.36615	7.297000	0.78799	2.765000	0.95021	0.655000	0.94253	CCT	.	.	.	none		0.468	ZNF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338595.2	NM_021088	
PGAP1	80055	hgsc.bcm.edu	37	2	197750195	197750195	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr2:197750195G>T	ENST00000354764.4	-	12	1339	c.1225C>A	c.(1225-1227)Caa>Aaa	p.Q409K	PGAP1_ENST00000409188.1_3'UTR|PGAP1_ENST00000409475.1_Missense_Mutation_p.Q409K	NM_024989.3	NP_079265.2	Q75T13	PGAP1_HUMAN	post-GPI attachment to proteins 1	409					anterior/posterior axis specification (GO:0009948)|attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|embryonic pattern specification (GO:0009880)|forebrain regionalization (GO:0021871)|head development (GO:0060322)|intracellular protein transport (GO:0006886)|myo-inositol transport (GO:0015798)|post-translational protein modification (GO:0043687)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	nuclease activity (GO:0004518)|phosphoric ester hydrolase activity (GO:0042578)			breast(4)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|ovary(6)|stomach(1)|urinary_tract(1)	40						TCAACCCCTTGCAGGCTTTGA	0.284																																					p.Q409K		Atlas-SNP	.											.	PGAP1	84	.	0			c.C1225A						PASS	.						52.0	59.0	57.0					2																	197750195		2191	4286	6477	SO:0001583	missense	80055	exon12			CCCCTTGCAGGCT		CCDS2318.1	2q33.1	2014-03-03			ENSG00000197121	ENSG00000197121			25712	protein-coding gene	gene with protein product	"""GPI inositol-deacylase"""	611655				14734546, 17711852, 24482476	Standard	XM_005246866		Approved	FLJ12377, Bst1, SPG67	uc002utw.3	Q75T13	OTTHUMG00000132743	ENST00000354764.4:c.1225C>A	chr2.hg19:g.197750195G>T	ENSP00000346809:p.Gln409Lys	105.0	0.0	.		71.0	5.0	.	NM_024989	Q4G0R8|Q4ZG47|Q53SM0|Q6AW92|Q6UWV4|Q9HA24	Missense_Mutation	SNP	ENST00000354764.4	hg19	CCDS2318.1	.	.	.	.	.	.	.	.	.	.	G	14.07	2.425404	0.43020	.	.	ENSG00000197121	ENST00000422382;ENST00000354764;ENST00000409475	.	.	.	5.26	5.26	0.73747	.	0.261976	0.38778	N	0.001561	T	0.56630	0.1998	N	0.24115	0.695	0.80722	D	1	B;P	0.49447	0.228;0.924	B;P	0.62298	0.083;0.9	T	0.46373	-0.9196	9	0.06891	T	0.86	-10.914	14.225	0.65853	0.0:0.0:1.0:0.0	.	409;409	Q75T13-3;Q75T13	.;PGAP1_HUMAN	K	189;409;409	.	ENSP00000346809:Q409K	Q	-	1	0	PGAP1	197458440	0.997000	0.39634	0.967000	0.41034	0.825000	0.46686	3.380000	0.52448	2.732000	0.93576	0.591000	0.81541	CAA	.	.	.	none		0.284	PGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256103.5	NM_024989	
TPRG1	285386	hgsc.bcm.edu	37	3	188925189	188925189	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr3:188925189A>G	ENST00000345063.3	+	2	183	c.16A>G	c.(16-18)Agt>Ggt	p.S6G	TPRG1_ENST00000433971.1_Missense_Mutation_p.S6G	NM_198485.3	NP_940887.1	Q6ZUI0	TPRG1_HUMAN	tumor protein p63 regulated 1	6						cytoplasm (GO:0005737)				endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|skin(2)|urinary_tract(1)	16	all_cancers(143;6.12e-12)|all_hematologic(3;0.0359)|Ovarian(172;0.0925)	all_lung(153;8.23e-09)|Lung NSC(153;3.55e-06)|all_neural(597;0.0019)|Myeloproliferative disorder(1037;0.0255)	Lung(62;6.93e-06)	GBM - Glioblastoma multiforme(93;4.77e-14)		AACAATTGGGAGTTTTGAAGG	0.458																																					p.S6G		Atlas-SNP	.											.	TPRG1	32	.	0			c.A16G						PASS	.						97.0	95.0	96.0					3																	188925189		2203	4300	6503	SO:0001583	missense	285386	exon2			ATTGGGAGTTTTG	AK125682	CCDS3292.1	3q28	2008-02-04	2008-01-16	2008-01-16	ENSG00000188001	ENSG00000188001			24759	protein-coding gene	gene with protein product			"""family with sequence similarity 79, member B"""	FAM79B			Standard	NM_198485		Approved	FLJ41238, FLJ43694	uc003frw.2	Q6ZUI0	OTTHUMG00000156321	ENST00000345063.3:c.16A>G	chr3.hg19:g.188925189A>G	ENSP00000341031:p.Ser6Gly	132.0	0.0	.		149.0	23.0	.	NM_198485		Missense_Mutation	SNP	ENST00000345063.3	hg19	CCDS3292.1	.	.	.	.	.	.	.	.	.	.	A	14.92	2.678779	0.47886	.	.	ENSG00000188001	ENST00000433971;ENST00000412373;ENST00000345063;ENST00000456832	.	.	.	5.83	5.83	0.93111	.	0.488214	0.25631	N	0.029360	T	0.39410	0.1077	L	0.34521	1.04	0.31374	N	0.679799	B	0.26363	0.147	B	0.29077	0.098	T	0.48681	-0.9014	9	0.45353	T	0.12	-5.1687	12.5927	0.56451	1.0:0.0:0.0:0.0	.	6	Q6ZUI0	TPRG1_HUMAN	G	6	.	ENSP00000341031:S6G	S	+	1	0	TPRG1	190407883	1.000000	0.71417	0.982000	0.44146	0.737000	0.42083	2.764000	0.47613	2.235000	0.73313	0.533000	0.62120	AGT	.	.	.	none		0.458	TPRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343931.1	NM_198485	
MUC4	4585	hgsc.bcm.edu	37	3	195490958	195490958	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr3:195490958G>A	ENST00000346145.4	-	10	1333	c.1294C>T	c.(1294-1296)Cgg>Tgg	p.R432W	MUC4_ENST00000349607.4_Missense_Mutation_p.R381W|MUC4_ENST00000475231.1_Missense_Mutation_p.R4616W|MUC4_ENST00000463781.3_Missense_Mutation_p.R4668W	NM_004532.5	NP_004523.3	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	1425					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACGTGGGGCCGCCTCTGCTGG	0.662																																					p.R4668W		Atlas-SNP	.											.	MUC4	1505	.	0			c.C14002T						PASS	.						18.0	16.0	16.0					3																	195490958		2200	4299	6499	SO:0001583	missense	4585	exon11			GGGGCCGCCTCTG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000346145.4:c.1294C>T	chr3.hg19:g.195490958G>A	ENSP00000304207:p.Arg432Trp	330.0	0.0	.		210.0	10.0	.	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000346145.4	hg19	CCDS3310.1	.	.	.	.	.	.	.	.	.	.	.	9.013	0.982982	0.18889	.	.	ENSG00000145113	ENST00000349607;ENST00000346145;ENST00000463781;ENST00000475231	T;T;T;T	0.78126	-1.15;-0.44;-0.46;-0.33	5.25	-4.79	0.03200	AMOP (2);	0.750787	0.11391	N	0.568766	T	0.73814	0.3635	M	0.76002	2.32	0.25565	N	0.986958	P;P;P;P;B;B;D	0.53619	0.469;0.922;0.779;0.91;0.027;0.027;0.961	B;P;B;B;B;B;P	0.49451	0.107;0.611;0.199;0.303;0.019;0.019;0.466	T	0.65553	-0.6140	10	0.87932	D	0	-4.1234	1.1024	0.01687	0.3996:0.1018:0.1745:0.324	.	4540;1425;381;432;4668;4616;1373	E7ESK3;Q99102;Q99102-12;Q99102-13;E9PDY6;E7ENC5;Q99102-10	.;MUC4_HUMAN;.;.;.;.;.	W	381;432;4668;4616	ENSP00000338109:R381W;ENSP00000304207:R432W;ENSP00000417498:R4668W;ENSP00000420243:R4616W	ENSP00000304207:R432W	R	-	1	2	MUC4	196976629	0.021000	0.18746	0.104000	0.21259	0.021000	0.10359	-0.327000	0.07955	-0.553000	0.06158	-0.187000	0.12897	CGG	.	.	.	none		0.662	MUC4-015	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341862.1	NM_018406	
UBA6	55236	hgsc.bcm.edu	37	4	68534339	68534339	+	Silent	SNP	T	T	C			TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr4:68534339T>C	ENST00000322244.5	-	9	782	c.723A>G	c.(721-723)acA>acG	p.T241T	UBA6_ENST00000420827.2_Silent_p.T241T	NM_018227.5	NP_060697.4	A0AVT1	UBA6_HUMAN	ubiquitin-like modifier activating enzyme 6	241					protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|FAT10 activating enzyme activity (GO:0019780)|ligase activity (GO:0016874)			central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(6)|liver(1)|lung(23)|skin(2)|upper_aerodigestive_tract(2)	44						GGAATTGTCCTGTCTCCAGTT	0.303																																					p.T241T		Atlas-SNP	.											.	UBA6	98	.	0			c.A723G						PASS	.						123.0	120.0	121.0					4																	68534339		2203	4300	6503	SO:0001819	synonymous_variant	55236	exon9			TTGTCCTGTCTCC	AK094164	CCDS3516.1	4q13.2	2008-02-05	2007-11-30	2007-11-30	ENSG00000033178	ENSG00000033178		"""Ubiquitin-like modifier activating enzymes"""	25581	protein-coding gene	gene with protein product	"""UBA6, ubiquitin-activating enzyme E1"""	611361	"""ubiquitin-activating enzyme E1-like 2"""	UBE1L2		17580310	Standard	NM_018227		Approved	FLJ10808	uc003hdg.4	A0AVT1	OTTHUMG00000129299	ENST00000322244.5:c.723A>G	chr4.hg19:g.68534339T>C		76.0	0.0	.		94.0	5.0	.	NM_018227	A6N8M7|B2RAV3|Q4W5K0|Q6UV21|Q86T78|Q86TC7|Q8N5T3|Q8N9E4|Q9H3T7|Q9NVC9	Silent	SNP	ENST00000322244.5	hg19	CCDS3516.1																																																																																			.	.	.	none		0.303	UBA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251429.2	NM_018227	
ASIC5	51802	hgsc.bcm.edu	37	4	156784757	156784757	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr4:156784757G>A	ENST00000537611.2	-	2	236	c.190C>T	c.(190-192)Ctc>Ttc	p.L64F	TDO2_ENST00000506181.1_Intron	NM_017419.2	NP_059115.1	Q9NY37	ASIC5_HUMAN	acid-sensing (proton-gated) ion channel family member 5	64					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrogen ion channel activity (GO:0015252)|ligand-gated sodium channel activity (GO:0015280)										ACCAACCAGAGCACCCTGCGA	0.483																																					p.L64F		Atlas-SNP	.											.	.	.	.	0			c.C190T						PASS	.						131.0	116.0	121.0					4																	156784757		2203	4300	6503	SO:0001583	missense	51802	exon2			ACCAGAGCACCCT	AJ252011	CCDS3793.1	4q32.1	2012-10-03	2012-03-02	2012-03-02	ENSG00000256394	ENSG00000256394			17537	protein-coding gene	gene with protein product			"""amiloride-sensitive cation channel 5, intestinal"""	ACCN5		10767424	Standard	NM_017419		Approved	INAC, HINAC	uc003ipe.1	Q9NY37	OTTHUMG00000161941	ENST00000537611.2:c.190C>T	chr4.hg19:g.156784757G>A	ENSP00000442477:p.Leu64Phe	144.0	0.0	.		149.0	56.0	.	NM_017419		Missense_Mutation	SNP	ENST00000537611.2	hg19	CCDS3793.1	.	.	.	.	.	.	.	.	.	.	G	6.118	0.390031	0.11581	.	.	ENSG00000256394	ENST00000537611	T	0.65732	-0.17	4.24	1.65	0.23941	.	0.825563	0.10479	N	0.669867	T	0.38878	0.1057	N	0.11651	0.15	0.58432	D	0.999998	B	0.10296	0.003	B	0.17979	0.02	T	0.26744	-1.0094	10	0.02654	T	1	-0.483	12.6071	0.56529	0.0:0.0:0.5103:0.4896	.	64	Q9NY37	ACCN5_HUMAN	F	64	ENSP00000442477:L64F	ENSP00000264432:L64F	L	-	1	0	ACCN5	157004207	0.075000	0.21258	0.386000	0.26170	0.148000	0.21650	0.106000	0.15354	0.224000	0.20940	-0.271000	0.10264	CTC	.	.	.	none		0.483	ASIC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366464.1		
BTN2A2	10385	hgsc.bcm.edu	37	6	26384118	26384118	+	Silent	SNP	T	T	C			TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr6:26384118T>C	ENST00000356709.4	+	2	180	c.69T>C	c.(67-69)ctT>ctC	p.L23L	BTN2A2_ENST00000482536.1_Silent_p.L23L|BTN2A2_ENST00000469230.1_Silent_p.L23L|BTN2A2_ENST00000416795.2_Silent_p.L23L|BTN2A2_ENST00000432533.2_Silent_p.L23L|BTN2A2_ENST00000352867.2_Silent_p.L23L	NM_001197240.1|NM_006995.4	NP_001184169.1|NP_008926.2	Q8WVV5	BT2A2_HUMAN	butyrophilin, subfamily 2, member A2	23					negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cellular metabolic process (GO:0031324)|negative regulation of cytokine secretion (GO:0050710)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|large_intestine(5)|lung(13)	23						tcctcctccttctcAGCCTGT	0.577																																					p.L23L		Atlas-SNP	.											.	BTN2A2	87	.	0			c.T69C						PASS	.						151.0	111.0	124.0					6																	26384118		2203	4300	6503	SO:0001819	synonymous_variant	10385	exon2			CCTCCTTCTCAGC	U90550	CCDS4606.1, CCDS4607.1, CCDS56401.1, CCDS56402.1, CCDS56403.1	6p22.1	2014-01-14			ENSG00000124508	ENSG00000124508		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1137	protein-coding gene	gene with protein product		613591				10354554, 9149941	Standard	NM_006995		Approved	BTF2, BT2.2, BTN2.2	uc003nhq.3	Q8WVV5	OTTHUMG00000014452	ENST00000356709.4:c.69T>C	chr6.hg19:g.26384118T>C		148.0	0.0	.		143.0	10.0	.	NM_181531	A6NM84|B4DE97|B4DQ01|E9PH07|O00480	Silent	SNP	ENST00000356709.4	hg19	CCDS4606.1																																																																																			.	.	.	none		0.577	BTN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040117.1		
SYNGAP1	8831	hgsc.bcm.edu	37	6	33400480	33400480	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr6:33400480C>T	ENST00000418600.2	+	5	507	c.406C>T	c.(406-408)Cgg>Tgg	p.R136W	SYNGAP1_ENST00000428982.2_Missense_Mutation_p.R77W|SYNGAP1_ENST00000496374.1_3'UTR|SYNGAP1_ENST00000293748.5_Missense_Mutation_p.R136W	NM_006772.2	NP_006763.2	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	136					dendrite development (GO:0016358)|negative regulation of axonogenesis (GO:0050771)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|pattern specification process (GO:0007389)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|receptor clustering (GO:0043113)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of MAPK cascade (GO:0043408)|regulation of synapse structure and activity (GO:0050803)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Rab GTPase activator activity (GO:0005097)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(15)|ovary(7)|pancreas(1)|stomach(1)|urinary_tract(1)	43						CCTGAGCCGACGGCTAAAAAG	0.577																																					p.R136W		Atlas-SNP	.											.	SYNGAP1	202	.	0			c.C406T						PASS	.						56.0	49.0	51.0					6																	33400480		2203	4300	6503	SO:0001583	missense	8831	exon5			AGCCGACGGCTAA	AB067525	CCDS34434.2	6p21.3	2010-06-25	2010-06-25		ENSG00000197283	ENSG00000197283			11497	protein-coding gene	gene with protein product		603384	"""synaptic Ras GTPase activating protein 1 homolog (rat)"""			9581761, 18323856	Standard	NM_006772		Approved	SYNGAP, RASA5, KIAA1938	uc011dri.2	Q96PV0	OTTHUMG00000031096	ENST00000418600.2:c.406C>T	chr6.hg19:g.33400480C>T	ENSP00000403636:p.Arg136Trp	59.0	0.0	.		54.0	16.0	.	NM_006772	A2AB17|A2BEL6|A2BEL7|A8MQC4|Q8TCS2|Q9UGE2	Missense_Mutation	SNP	ENST00000418600.2	hg19	CCDS34434.2	.	.	.	.	.	.	.	.	.	.	C	15.30	2.792591	0.50102	.	.	ENSG00000197283	ENST00000293748;ENST00000418600;ENST00000449372;ENST00000428982	T;T;T	0.28666	1.6;1.71;1.77	4.06	-1.15	0.09709	Pleckstrin homology domain (1);	0.000000	0.85682	D	0.000000	T	0.34048	0.0884	M	0.69358	2.11	0.58432	D	0.999996	D;D;D	0.71674	0.965;0.98;0.998	B;P;P	0.62382	0.416;0.621;0.901	T	0.43065	-0.9414	10	0.87932	D	0	.	11.9927	0.53184	0.6778:0.3221:0.0:0.0	.	136;136;136	Q96PV0;Q96PV0-4;B7ZCA0	SYGP1_HUMAN;.;.	W	136;136;136;77	ENSP00000293748:R136W;ENSP00000403636:R136W;ENSP00000412475:R77W	ENSP00000293748:R136W	R	+	1	2	SYNGAP1	33508458	0.994000	0.37717	0.996000	0.52242	0.938000	0.57974	1.265000	0.33027	0.002000	0.14630	0.467000	0.42956	CGG	.	.	.	none		0.577	SYNGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076151.4	XM_166407	
LPA	4018	hgsc.bcm.edu	37	6	161026202	161026202	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr6:161026202A>G	ENST00000316300.5	-	18	2865	c.2821T>C	c.(2821-2823)Tac>Cac	p.Y941H	LPA_ENST00000447678.1_Missense_Mutation_p.Y941H			P08519	APOA_HUMAN	lipoprotein, Lp(a)	3449	Kringle 9. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	TTTCCGTGGTAGCACTCCTGC	0.458																																					p.Y941H		Atlas-SNP	.											.	LPA	237	.	0			c.T2821C						PASS	.						269.0	278.0	275.0					6																	161026202		2200	4298	6498	SO:0001583	missense	4018	exon19			CGTGGTAGCACTC	X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.2821T>C	chr6.hg19:g.161026202A>G	ENSP00000321334:p.Tyr941His	66.0	0.0	.		55.0	32.0	.	NM_005577	Q5VTD7|Q9UD88	Missense_Mutation	SNP	ENST00000316300.5	hg19	CCDS43523.1	.	.	.	.	.	.	.	.	.	.	a	10.16	1.275243	0.23307	.	.	ENSG00000198670	ENST00000316300;ENST00000447678	T;T	0.65364	-0.15;-0.15	2.16	2.16	0.27623	Kringle (4);Kringle-like fold (1);	.	.	.	.	T	0.72087	0.3417	H	0.95816	3.725	0.21782	N	0.999546	D	0.60160	0.987	D	0.70227	0.968	T	0.61004	-0.7150	9	0.26408	T	0.33	.	6.2159	0.20656	1.0:0.0:0.0:0.0	.	3449	P08519	APOA_HUMAN	H	941	ENSP00000321334:Y941H;ENSP00000395608:Y941H	ENSP00000321334:Y941H	Y	-	1	0	LPA	160946192	0.988000	0.35896	0.913000	0.36048	0.097000	0.18754	2.967000	0.49216	0.999000	0.39023	0.155000	0.16302	TAC	.	.	.	none		0.458	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042957.1	NM_005577	
TAX1BP1	8887	hgsc.bcm.edu	37	7	27856559	27856559	+	Nonsense_Mutation	SNP	A	A	T			TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr7:27856559A>T	ENST00000396319.2	+	15	2075	c.1987A>T	c.(1987-1989)Aga>Tga	p.R663*	TAX1BP1_ENST00000265393.6_Nonsense_Mutation_p.R621*|TAX1BP1_ENST00000543117.1_Nonsense_Mutation_p.R621*|TAX1BP1_ENST00000433216.2_Nonsense_Mutation_p.R464*|TAX1BP1_ENST00000409980.1_Nonsense_Mutation_p.R687*	NM_006024.6	NP_006015.4	Q86VP1	TAXB1_HUMAN	Tax1 (human T-cell leukemia virus type I) binding protein 1	663					apoptotic process (GO:0006915)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)	cytosol (GO:0005829)	kinase binding (GO:0019900)			breast(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(8)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31			GBM - Glioblastoma multiforme(3;0.0823)			GCCACCTGTCAGAGTCCCCTC	0.453																																					p.R663X		Atlas-SNP	.											.	TAX1BP1	71	.	0			c.A1987T						PASS	.						63.0	65.0	65.0					7																	27856559		2203	4300	6503	SO:0001587	stop_gained	8887	exon15			CCTGTCAGAGTCC	U33821	CCDS5415.1, CCDS43561.1, CCDS56471.1	7p15	2010-08-05			ENSG00000106052	ENSG00000106052			11575	protein-coding gene	gene with protein product		605326				10435631	Standard	NM_006024		Approved	TXBP151, CALCOCO3	uc003szl.3	Q86VP1	OTTHUMG00000023377	ENST00000396319.2:c.1987A>T	chr7.hg19:g.27856559A>T	ENSP00000379612:p.Arg663*	31.0	0.0	.		74.0	44.0	.	NM_006024	B4DKU7|E7ENV2|O60398|O95770|Q13311|Q9BQG5|Q9UI88	Nonsense_Mutation	SNP	ENST00000396319.2	hg19	CCDS5415.1	.	.	.	.	.	.	.	.	.	.	A	28.1	4.886755	0.91814	.	.	ENSG00000106052	ENST00000543117;ENST00000265393;ENST00000409980;ENST00000433216;ENST00000396319;ENST00000457186	.	.	.	5.67	4.5	0.54988	.	0.000000	0.56097	D	0.000023	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05620	T	0.96	-17.6197	12.6545	0.56780	0.857:0.143:0.0:0.0	.	.	.	.	X	621;621;687;464;663;200	.	ENSP00000265393:R621X	R	+	1	2	TAX1BP1	27823084	1.000000	0.71417	0.999000	0.59377	0.808000	0.45660	2.947000	0.49058	0.975000	0.38392	0.533000	0.62120	AGA	.	.	.	none		0.453	TAX1BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214142.1	NM_006024	
ZNF727	442319	hgsc.bcm.edu	37	7	63538777	63538777	+	Silent	SNP	G	G	A			TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr7:63538777G>A	ENST00000550760.3	+	4	1529	c.1350G>A	c.(1348-1350)aaG>aaA	p.K450K	RP11-3N2.13_ENST00000445978.1_RNA	NM_001159522.1	NP_001152994.1	A8MUV8	ZN727_HUMAN	zinc finger protein 727	450					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|skin(1)|stomach(1)|urinary_tract(1)	8						CTGGAGAGAAGCCCTACAAAT	0.408																																					p.K450K		Atlas-SNP	.											ZNF727,NS,carcinoma,0,1	ZNF727	35	.	0			c.G1350A						PASS	.						47.0	44.0	45.0					7																	63538777		692	1591	2283	SO:0001819	synonymous_variant	442319	exon4			AGAGAAGCCCTAC			7q11.21	2014-09-09	2014-09-09	2014-09-09	ENSG00000214652	ENSG00000214652		"""Zinc fingers, C2H2-type"", ""-"""	22785	pseudogene	pseudogene			"""zinc finger protein 727, pseudogene"""	ZNF727P			Standard	NM_001159522		Approved		uc011kdm.2	A8MUV8	OTTHUMG00000156536	ENST00000550760.3:c.1350G>A	chr7.hg19:g.63538777G>A		54.0	0.0	.		95.0	5.0	.	NM_001159522		Silent	SNP	ENST00000550760.3	hg19	CCDS55113.1																																																																																			.	.	.	none		0.408	ZNF727-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001159522	
PCLO	27445	hgsc.bcm.edu	37	7	82581494	82581494	+	Missense_Mutation	SNP	T	T	A	rs78195222		TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr7:82581494T>A	ENST00000333891.9	-	5	9112	c.8775A>T	c.(8773-8775)gaA>gaT	p.E2925D	PCLO_ENST00000423517.2_Missense_Mutation_p.E2925D|PCLO_ENST00000437081.1_5'Flank	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.E2925D(2)|p.E2856D(1)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GTTTTTCATCTTCTATTATTT	0.438																																					p.E2925D		Atlas-SNP	.											Q9Y6V0-3,rectum,carcinoma,0,15	PCLO	1506	.	3	Substitution - Missense(3)	central_nervous_system(3)	c.A8775T						PASS	.						139.0	137.0	137.0					7																	82581494		1905	4127	6032	SO:0001583	missense	27445	exon5			TTCATCTTCTATT	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.8775A>T	chr7.hg19:g.82581494T>A	ENSP00000334319:p.Glu2925Asp	40.0	1.0	.		90.0	11.0	.	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	hg19	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	T	9.279	1.047607	0.19827	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.18810	2.19;2.2	5.68	0.559	0.17272	.	.	.	.	.	T	0.19005	0.0456	M	0.61703	1.905	0.80722	D	1	B;B	0.24043	0.096;0.096	B;B	0.19666	0.026;0.026	T	0.05920	-1.0856	9	0.87932	D	0	.	5.3684	0.16127	0.1196:0.2007:0.0:0.6797	.	2925;2925	Q9Y6V0-5;Q9Y6V0-6	.;.	D	2856;2925;2925	ENSP00000334319:E2925D;ENSP00000388393:E2925D	ENSP00000334319:E2925D	E	-	3	2	PCLO	82419430	0.999000	0.42202	1.000000	0.80357	0.858000	0.48976	0.471000	0.22100	0.071000	0.16664	-0.490000	0.04691	GAA	.	T|0.500;A|0.500	0.500	weak		0.438	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
NFX1	4799	hgsc.bcm.edu	37	9	33319097	33319097	+	Silent	SNP	C	C	T			TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr9:33319097C>T	ENST00000379540.3	+	9	1940	c.1878C>T	c.(1876-1878)tgC>tgT	p.C626C	NFX1_ENST00000379521.4_Silent_p.C626C|NFX1_ENST00000318524.6_Silent_p.C626C	NM_002504.4	NP_002495.2	Q12986	NFX1_HUMAN	nuclear transcription factor, X-box binding 1	626					inflammatory response (GO:0006954)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25			LUSC - Lung squamous cell carcinoma(29;0.00506)	GBM - Glioblastoma multiforme(74;0.224)		GAAAAGTGTGCGGCAAGCCTC	0.453																																					p.C626C		Atlas-SNP	.											.	NFX1	85	.	0			c.C1878T						PASS	.						70.0	70.0	70.0					9																	33319097		2203	4300	6503	SO:0001819	synonymous_variant	4799	exon9			AGTGTGCGGCAAG	U19759	CCDS6538.1, CCDS6539.1, CCDS6540.1	9p12	2013-12-13			ENSG00000086102	ENSG00000086102			7803	protein-coding gene	gene with protein product		603255				7964459, 2511169	Standard	NM_002504		Approved	NFX2, MGC20369, Tex42, TEG-42	uc003zsq.3	Q12986	OTTHUMG00000019772	ENST00000379540.3:c.1878C>T	chr9.hg19:g.33319097C>T		97.0	0.0	.		96.0	4.0	.	NM_147134	A8K6H8|Q5VXW6|Q96EL5|Q9BXI1	Silent	SNP	ENST00000379540.3	hg19	CCDS6538.1																																																																																			.	.	.	none		0.453	NFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052069.1		
LAMC3	10319	hgsc.bcm.edu	37	9	133948708	133948708	+	Splice_Site	SNP	G	G	A			TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr9:133948708G>A	ENST00000361069.4	+	20	3627	c.3494G>A	c.(3493-3495)aGc>aAc	p.S1165N	LAMC3_ENST00000480883.1_Intron	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	1165	Domain II and I.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		CTCGCCAGGAGGTGAGTCCCA	0.607																																					p.S1165N		Atlas-SNP	.											.	LAMC3	167	.	0			c.G3494A						PASS	.						46.0	46.0	46.0					9																	133948708		2203	4300	6503	SO:0001630	splice_region_variant	10319	exon20			CCAGGAGGTGAGT	AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.3494+1G>A	chr9.hg19:g.133948708G>A		55.0	0.0	.		17.0	7.0	.	NM_006059	B1APX9|B1APY0|Q59H72	Missense_Mutation	SNP	ENST00000361069.4	hg19	CCDS6938.1	.	.	.	.	.	.	.	.	.	.	G	10.79	1.450700	0.26074	.	.	ENSG00000050555	ENST00000361069;ENST00000355048	T	0.29655	1.56	4.23	4.23	0.50019	.	0.177619	0.64402	D	0.000012	T	0.34221	0.0890	M	0.68317	2.08	0.39455	D	0.967477	P	0.36789	0.57	B	0.40038	0.317	T	0.15093	-1.0449	10	0.17832	T	0.49	.	14.3309	0.66556	0.0:0.0:1.0:0.0	.	1165	Q9Y6N6	LAMC3_HUMAN	N	1165	ENSP00000354360:S1165N	ENSP00000347156:S1165N	S	+	2	0	LAMC3	132938529	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	6.044000	0.71012	2.365000	0.80145	0.555000	0.69702	AGC	.	.	.	none		0.607	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054717.3	NM_006059	Missense_Mutation
ARHGAP21	57584	hgsc.bcm.edu	37	10	24873803	24873803	+	Silent	SNP	T	T	C			TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr10:24873803T>C	ENST00000396432.2	-	26	5901	c.5415A>G	c.(5413-5415)ggA>ggG	p.G1805G		NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	1804	Interaction with CTNNA1.				establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						CTCTGTGCCCTCCTAGTGTAT	0.488																																					p.G1805G		Atlas-SNP	.											.	ARHGAP21	185	.	0			c.A5415G						PASS	.						50.0	50.0	50.0					10																	24873803		2203	4300	6503	SO:0001819	synonymous_variant	57584	exon26			GTGCCCTCCTAGT	AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.5415A>G	chr10.hg19:g.24873803T>C		77.0	0.0	.		86.0	32.0	.	NM_020824	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Silent	SNP	ENST00000396432.2	hg19	CCDS7144.2																																																																																			.	.	.	none		0.488	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047229.4	NM_020824	
ARHGAP1	392	hgsc.bcm.edu	37	11	46702650	46702650	+	Silent	SNP	G	G	A			TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr11:46702650G>A	ENST00000311956.4	-	7	643	c.546C>T	c.(544-546)ttC>ttT	p.F182F		NM_004308.3	NP_004299.1	Q07960	RHG01_HUMAN	Rho GTPase activating protein 1	182	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	Rac GTPase activator activity (GO:0030675)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			endometrium(1)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	11		Lung NSC(402;1.76e-12)|all_lung(304;1.3e-11)		GBM - Glioblastoma multiforme(35;5.17e-06)|BRCA - Breast invasive adenocarcinoma(625;0.00112)|Lung(87;0.153)		TCTTCTGCCCGAACTTGAAGC	0.602																																					p.F182F		Atlas-SNP	.											ARHGAP1,NS,carcinoma,0,1	ARHGAP1	27	.	0			c.C546T						PASS	.						84.0	90.0	88.0					11																	46702650		2201	4299	6500	SO:0001819	synonymous_variant	392	exon7			CTGCCCGAACTTG	BC018118	CCDS7922.1	11p11.2	2006-04-11			ENSG00000175220	ENSG00000175220		"""Rho GTPase activating proteins"""	673	protein-coding gene	gene with protein product		602732				8288572	Standard	NM_004308		Approved	RhoGAP, p50rhoGAP, CDC42GAP, Cdc42GAP	uc001ndd.4	Q07960	OTTHUMG00000166567	ENST00000311956.4:c.546C>T	chr11.hg19:g.46702650G>A		106.0	0.0	.		58.0	5.0	.	NM_004308	D3DQQ6	Silent	SNP	ENST00000311956.4	hg19	CCDS7922.1	.	.	.	.	.	.	.	.	.	.	G	9.301	1.052993	0.19907	.	.	ENSG00000175220	ENST00000528837	.	.	.	5.28	1.37	0.22104	.	.	.	.	.	T	0.57770	0.2076	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51356	-0.8716	4	.	.	.	.	9.3727	0.38264	0.7873:0.0:0.2127:0.0	.	.	.	.	W	136	.	.	R	-	1	2	ARHGAP1	46659226	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	1.205000	0.32308	0.323000	0.23307	-0.459000	0.05422	CGG	.	.	.	none		0.602	ARHGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390472.1	NM_004308	
AHNAK	79026	hgsc.bcm.edu	37	11	62296065	62296065	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr11:62296065C>T	ENST00000378024.4	-	5	6098	c.5824G>A	c.(5824-5826)Gtg>Atg	p.V1942M	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	1942					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				GGCACCGACACATCCACATCC	0.502																																					p.V1942M		Atlas-SNP	.											.	AHNAK	532	.	0			c.G5824A						PASS	.						216.0	226.0	223.0					11																	62296065		2202	4299	6501	SO:0001583	missense	79026	exon5			CCGACACATCCAC	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.5824G>A	chr11.hg19:g.62296065C>T	ENSP00000367263:p.Val1942Met	194.0	0.0	.		188.0	14.0	.	NM_001620	A1A586	Missense_Mutation	SNP	ENST00000378024.4	hg19	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	c	6.228	0.410192	0.11812	.	.	ENSG00000124942	ENST00000244934;ENST00000378024	T	0.01272	5.07	2.29	1.33	0.21861	.	.	.	.	.	T	0.03608	0.0103	M	0.88105	2.93	0.27412	N	0.95455	P	0.41131	0.739	B	0.40602	0.334	T	0.14643	-1.0465	9	0.66056	D	0.02	.	7.0623	0.25133	0.0:0.8577:0.0:0.1423	.	1942	Q09666	AHNK_HUMAN	M	31;1942	ENSP00000367263:V1942M	ENSP00000244934:V31M	V	-	1	0	AHNAK	62052641	0.700000	0.27796	0.013000	0.15412	0.006000	0.05464	-0.172000	0.09868	0.317000	0.23160	0.186000	0.17326	GTG	.	.	.	none		0.502	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
PC	5091	hgsc.bcm.edu	37	11	66636384	66636384	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr11:66636384T>C	ENST00000393958.2	-	9	1048	c.955A>G	c.(955-957)Aag>Gag	p.K319E	PC_ENST00000393955.2_Missense_Mutation_p.K319E|PC_ENST00000524491.1_Missense_Mutation_p.K279E|PC_ENST00000393960.1_Missense_Mutation_p.K319E|PC_ENST00000355677.3_Missense_Mutation_p.K319E	NM_000920.3	NP_000911.2	P11498	PYC_HUMAN	pyruvate carboxylase	319	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.|Biotin carboxylation.				biotin metabolic process (GO:0006768)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|oxaloacetate metabolic process (GO:0006107)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|pyruvate carboxylase activity (GO:0004736)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	AAGTAGTGCTTGCCGTGCCTG	0.687																																					p.K319E		Atlas-SNP	.											.	PC	116	.	0			c.A955G						PASS	.						92.0	81.0	84.0					11																	66636384		2200	4295	6495	SO:0001583	missense	5091	exon9			AGTGCTTGCCGTG	U04641	CCDS8152.1	11q13.4-q13.5	2012-07-11			ENSG00000173599	ENSG00000173599	6.4.1.1		8636	protein-coding gene	gene with protein product		608786				6548474	Standard	NM_022172		Approved	PCB	uc001ojn.1	P11498	OTTHUMG00000167099	ENST00000393958.2:c.955A>G	chr11.hg19:g.66636384T>C	ENSP00000377530:p.Lys319Glu	336.0	1.0	.		190.0	65.0	.	NM_000920	B4DN00|Q16705	Missense_Mutation	SNP	ENST00000393958.2	hg19	CCDS8152.1	.	.	.	.	.	.	.	.	.	.	T	13.76	2.333430	0.41297	.	.	ENSG00000173599	ENST00000393955;ENST00000393958;ENST00000393960;ENST00000524491;ENST00000355677	D;D;D;D;D	0.97256	-4.31;-4.31;-4.31;-4.31;-4.31	4.65	4.65	0.58169	ATP-grasp fold (1);ATP-grasp fold, subdomain 2 (1);Carbamoyl-phosphate synthetase, large subunit, ATP-binding (1);Biotin carboxylation domain (1);	0.063886	0.64402	D	0.000015	D	0.91643	0.7359	N	0.13352	0.335	0.43226	D	0.995117	B	0.09022	0.002	B	0.21360	0.034	D	0.87584	0.2486	10	0.13108	T	0.6	-19.2405	12.029	0.53388	0.0:0.0:0.0:1.0	.	319	P11498	PYC_HUMAN	E	319;319;319;279;319	ENSP00000377527:K319E;ENSP00000377530:K319E;ENSP00000377532:K319E;ENSP00000434192:K279E;ENSP00000347900:K319E	ENSP00000347900:K319E	K	-	1	0	PC	66392960	0.994000	0.37717	1.000000	0.80357	0.938000	0.57974	1.707000	0.37888	1.730000	0.51580	0.459000	0.35465	AAG	.	.	.	none		0.687	PC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393115.1	NM_001040716	
MAML2	84441	hgsc.bcm.edu	37	11	95825248	95825248	+	Silent	SNP	C	C	T			TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr11:95825248C>T	ENST00000524717.1	-	2	3231	c.1947G>A	c.(1945-1947)caG>caA	p.Q649Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	649					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gttgctgctgctgctgctgtt	0.517			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.Q649Q		Atlas-SNP	.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	.	MAML2	94	.	0			c.G1947A						PASS	.						33.0	39.0	37.0					11																	95825248		2115	4166	6281	SO:0001819	synonymous_variant	84441	exon2			CTGCTGCTGCTGC	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1947G>A	chr11.hg19:g.95825248C>T		80.0	0.0	.		139.0	25.0	.	NM_032427	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	hg19	CCDS44714.1																																																																																			.	.	.	none		0.517	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
MAML2	84441	hgsc.bcm.edu	37	11	95825254	95825254	+	Silent	SNP	C	C	T	rs61749250		TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr11:95825254C>T	ENST00000524717.1	-	2	3225	c.1941G>A	c.(1939-1941)caG>caA	p.Q647Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	647					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.Q647Q(1)	CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgctgctgctgttgttgct	0.512			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.Q647Q		Atlas-SNP	.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	MAML2,caecum,carcinoma,0,2	MAML2	94	.	1	Substitution - coding silent(1)	endometrium(1)	c.G1941A						PASS	.	C		0,4198		0,0,2099	35.0	40.0	38.0		1941	1.7	0.1	11	dbSNP_129	38	5,8237		0,5,4116	no	coding-synonymous	MAML2	NM_032427.1		0,5,6215	TT,TC,CC		0.0607,0.0,0.0402		647/1157	95825254	5,12435	2099	4121	6220	SO:0001819	synonymous_variant	84441	exon2			CTGCTGCTGTTGT	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1941G>A	chr11.hg19:g.95825254C>T		75.0	1.0	.		140.0	28.0	.	NM_032427	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	hg19	CCDS44714.1																																																																																			.	.	.	weak		0.512	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
SLC6A12	6539	hgsc.bcm.edu	37	12	306024	306024	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr12:306024A>G	ENST00000428720.1	-	11	1843	c.1100T>C	c.(1099-1101)tTc>tCc	p.F367S	SLC6A12_ENST00000538272.1_5'Flank|RP11-283I3.1_ENST00000544067.1_RNA|SLC6A12_ENST00000536824.1_Missense_Mutation_p.F367S|SLC6A12_ENST00000424061.2_Missense_Mutation_p.F367S|SLC6A12_ENST00000359674.4_Missense_Mutation_p.F367S|SLC6A12_ENST00000397296.2_Missense_Mutation_p.F367S	NM_001122848.2	NP_001116320.1	P48065	S6A12_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 12	367					amino acid transport (GO:0006865)|cellular hyperosmotic response (GO:0071474)|cellular water homeostasis (GO:0009992)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|response to organic substance (GO:0010033)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(8)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0172)|all_epithelial(11;0.0283)|all_lung(10;0.0392)|Lung NSC(10;0.0567)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00227)			AGCCTTGGGGAAGGCGATGAA	0.587																																					p.F367S		Atlas-SNP	.											.	SLC6A12	60	.	0			c.T1100C						PASS	.						107.0	96.0	100.0					12																	306024		2203	4300	6503	SO:0001583	missense	6539	exon11			TTGGGGAAGGCGA	L42300	CCDS8501.1	12p13	2013-07-19	2013-07-19		ENSG00000111181	ENSG00000111181		"""Solute carriers"""	11045	protein-coding gene	gene with protein product	"""betaine/GABA transporter-1"""	603080	"""solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12"""			7589472	Standard	NM_003044		Approved	BGT-1	uc009zdh.2	P48065	OTTHUMG00000090309	ENST00000428720.1:c.1100T>C	chr12.hg19:g.306024A>G	ENSP00000388184:p.Phe367Ser	116.0	0.0	.		85.0	24.0	.	NM_001122848	A0AV52|B2R992|D3DUN8	Missense_Mutation	SNP	ENST00000428720.1	hg19	CCDS8501.1	.	.	.	.	.	.	.	.	.	.	A	19.19	3.780522	0.70222	.	.	ENSG00000111181	ENST00000359674;ENST00000397296;ENST00000428720;ENST00000424061;ENST00000536824	T;T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24;-1.24	4.26	4.26	0.50523	.	0.067703	0.64402	D	0.000013	D	0.86644	0.5982	M	0.85777	2.775	0.44261	D	0.997113	D	0.58268	0.982	D	0.70935	0.971	D	0.87360	0.2343	10	0.87932	D	0	.	7.5395	0.27729	0.6532:0.0:0.0:0.3468	.	367	P48065	S6A12_HUMAN	S	367	ENSP00000352702:F367S;ENSP00000380464:F367S;ENSP00000388184:F367S;ENSP00000399136:F367S;ENSP00000444268:F367S	ENSP00000352702:F367S	F	-	2	0	SLC6A12	176285	1.000000	0.71417	0.987000	0.45799	0.802000	0.45316	6.483000	0.73617	1.782000	0.52362	0.391000	0.25812	TTC	.	.	.	none		0.587	SLC6A12-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206671.2	NM_003044	
GALNT9	50614	hgsc.bcm.edu	37	12	132834320	132834320	+	Silent	SNP	G	G	A	rs554022886		TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr12:132834320G>A	ENST00000328957.8	-	5	866	c.867C>T	c.(865-867)aaC>aaT	p.N289N	GALNT9_ENST00000535208.1_5'Flank|GALNT9_ENST00000535228.1_5'Flank	NM_001122636.1	NP_001116108.1	Q9HCQ5	GALT9_HUMAN	polypeptide N-acetylgalactosaminyltransferase 9	289					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(1)|endometrium(1)|large_intestine(2)|lung(5)	9	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.241)		OV - Ovarian serous cystadenocarcinoma(86;7.49e-08)|Epithelial(86;3.55e-07)|all cancers(50;2.09e-05)		CATGGGCGGCGTTCGCATACT	0.632													g|||	1	0.000199681	0.0008	0.0	5008	,	,		12187	0.0		0.0	False		,,,				2504	0.0				p.N289N	Colon(186;2147 2752 13553 41466)	Atlas-SNP	.											.	GALNT9	74	.	0			c.C867T						PASS	.						27.0	32.0	30.0					12																	132834320		692	1591	2283	SO:0001819	synonymous_variant	50614	exon5			GGCGGCGTTCGCA	AB040672	CCDS41866.1	12q24.33	2014-03-13	2014-03-13		ENSG00000182870	ENSG00000182870	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4131	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 9"""	606251	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9)"""			10978536, 12407114	Standard	NM_021808		Approved	GALNAC-T9	uc001ukc.4	Q9HCQ5	OTTHUMG00000168256	ENST00000328957.8:c.867C>T	chr12.hg19:g.132834320G>A		95.0	0.0	.		72.0	18.0	.	NM_001122636	Q52LR8|Q6NT54|Q8NFR1	Silent	SNP	ENST00000328957.8	hg19																																																																																				.	.	.	none		0.632	GALNT9-009	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000402967.1	NM_001122636	
GPR12	2835	hgsc.bcm.edu	37	13	27332981	27332981	+	Silent	SNP	C	C	T			TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr13:27332981C>T	ENST00000381436.2	-	1	1446	c.984G>A	c.(982-984)gcG>gcA	p.A328A	GPR12_ENST00000405846.3_Silent_p.A328A			P47775	GPR12_HUMAN	G protein-coupled receptor 12	328					cellular calcium ion homeostasis (GO:0006874)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|phosphatidylcholine binding (GO:0031210)			endometrium(7)|kidney(2)|large_intestine(6)|lung(14)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33	Colorectal(5;5.77e-05)	Breast(139;0.198)		Epithelial(112;9.37e-07)|OV - Ovarian serous cystadenocarcinoma(117;1.16e-06)|all cancers(112;8.31e-06)|GBM - Glioblastoma multiforme(144;0.00121)|Lung(94;0.111)|LUSC - Lung squamous cell carcinoma(192;0.184)		TGGGCGAGCGCGCTCTCTGGG	0.537																																					p.A328A		Atlas-SNP	.											.	GPR12	67	.	0			c.G984A						PASS	.						65.0	67.0	66.0					13																	27332981		2203	4300	6503	SO:0001819	synonymous_variant	2835	exon2			CGAGCGCGCTCTC	U18548	CCDS9319.1	13q12	2014-06-12			ENSG00000132975	ENSG00000132975		"""GPCR / Class A : Orphans"""	4466	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 84"""	600752				8262253, 8530049	Standard	NM_005288		Approved	GPCR21, PPP1R84	uc010aal.3	P47775	OTTHUMG00000016620	ENST00000381436.2:c.984G>A	chr13.hg19:g.27332981C>T		155.0	0.0	.		127.0	56.0	.	NM_005288	Q5T8P3	Silent	SNP	ENST00000381436.2	hg19	CCDS9319.1																																																																																			.	.	.	none		0.537	GPR12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044257.2		
FRY	10129	hgsc.bcm.edu	37	13	32823745	32823745	+	Missense_Mutation	SNP	G	G	T	rs372186855		TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr13:32823745G>T	ENST00000380250.3	+	49	7587	c.7091G>T	c.(7090-7092)cGg>cTg	p.R2364L		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	2364						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		GCCGTCACCCGGAGCACATCT	0.542																																					p.R2364L		Atlas-SNP	.											.	FRY	312	.	0			c.G7091T						PASS	.						73.0	76.0	75.0					13																	32823745		2015	4173	6188	SO:0001583	missense	10129	exon49			TCACCCGGAGCAC	AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.7091G>T	chr13.hg19:g.32823745G>T	ENSP00000369600:p.Arg2364Leu	67.0	0.0	.		77.0	4.0	.	NM_023037	Q9Y3N6	Missense_Mutation	SNP	ENST00000380250.3	hg19	CCDS41875.1	.	.	.	.	.	.	.	.	.	.	G	35	5.453660	0.96223	.	.	ENSG00000073910	ENST00000380250;ENST00000380257;ENST00000380235	T	0.25085	1.82	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.32823	0.0842	L	0.54323	1.7	0.80722	D	1	P	0.46784	0.884	B	0.42214	0.38	T	0.02821	-1.1106	10	0.54805	T	0.06	.	20.6634	0.99662	0.0:0.0:1.0:0.0	.	2364	Q5TBA9	FRY_HUMAN	L	2364;1174;5	ENSP00000369600:R2364L	ENSP00000369567:R5L	R	+	2	0	FRY	31721745	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.894000	0.99253	0.655000	0.94253	CGG	.	.	.	alt		0.542	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044405.1	NM_023037	
PRPF39	55015	hgsc.bcm.edu	37	14	45564665	45564665	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr14:45564665G>A	ENST00000355765.6	+	2	393	c.223G>A	c.(223-225)Gca>Aca	p.A75T		NM_017922.3	NP_060392.3	Q86UA1	PRP39_HUMAN	pre-mRNA processing factor 39	75					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(2)|endometrium(2)|kidney(4)|lung(3)|ovary(1)	12						AGAAACAGAAGCAAATTTCCC	0.403																																					p.A75T		Atlas-SNP	.											.	PRPF39	46	.	0			c.G223A						PASS	.						46.0	47.0	46.0					14																	45564665		2031	4212	6243	SO:0001583	missense	55015	exon2			ACAGAAGCAAATT	AK000673	CCDS9682.2	14q21.1	2013-10-03	2013-10-03		ENSG00000185246	ENSG00000185246			20314	protein-coding gene	gene with protein product		614907	"""PRP39 pre-mRNA processing factor 39 homolog (yeast)"", ""PRP39 pre-mRNA processing factor 39 homolog (S. cerevisiae)"""				Standard	NM_017922		Approved	FLJ20666, FLJ11128	uc001wvz.4	Q86UA1	OTTHUMG00000140265	ENST00000355765.6:c.223G>A	chr14.hg19:g.45564665G>A	ENSP00000348010:p.Ala75Thr	52.0	0.0	.		55.0	23.0	.	NM_017922	Q08AL1|Q08AL2|Q9NUU5	Missense_Mutation	SNP	ENST00000355765.6	hg19	CCDS9682.2	.	.	.	.	.	.	.	.	.	.	G	12.40	1.927796	0.34002	.	.	ENSG00000185246	ENST00000355765;ENST00000553605	T	0.46819	0.86	5.72	4.83	0.62350	.	.	.	.	.	T	0.32675	0.0837	N	0.20986	0.625	0.26211	N	0.979309	B	0.19817	0.039	B	0.23018	0.043	T	0.20538	-1.0272	9	0.15499	T	0.54	-21.2955	10.525	0.44943	0.1491:0.0:0.8509:0.0	.	75	Q86UA1	PRP39_HUMAN	T	75	ENSP00000348010:A75T	ENSP00000348010:A75T	A	+	1	0	PRPF39	44634415	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.367000	0.52350	1.429000	0.47314	0.591000	0.81541	GCA	.	.	.	none		0.403	PRPF39-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319683.2		
SIN3A	25942	hgsc.bcm.edu	37	15	75673957	75673957	+	Silent	SNP	T	T	A			TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr15:75673957T>A	ENST00000394947.3	-	18	3599	c.3285A>T	c.(3283-3285)gcA>gcT	p.A1095A	SIN3A_ENST00000360439.4_Silent_p.A1095A|SIN3A_ENST00000394949.4_Silent_p.A1095A	NM_001145358.1	NP_001138830.1			SIN3 transcription regulator family member A											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	63						CTCATACCTCTGCTTCCACAG	0.527																																					p.A1095A		Atlas-SNP	.											.	SIN3A	152	.	0			c.A3285T						PASS	.						227.0	191.0	203.0					15																	75673957		2197	4294	6491	SO:0001819	synonymous_variant	25942	exon18			TACCTCTGCTTCC	AK027559	CCDS10279.1	15q22.33	2013-08-21	2013-08-21		ENSG00000169375	ENSG00000169375			19353	protein-coding gene	gene with protein product		607776	"""SIN3 homolog A, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog A (yeast)"""			10773092, 7601471	Standard	NM_001145357		Approved	KIAA0700, DKFZP434K2235	uc002bai.3	Q96ST3	OTTHUMG00000142834	ENST00000394947.3:c.3285A>T	chr15.hg19:g.75673957T>A		152.0	0.0	.		170.0	77.0	.	NM_001145358		Silent	SNP	ENST00000394947.3	hg19	CCDS10279.1																																																																																			.	.	.	none		0.527	SIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286469.1	NM_015477	
SIN3A	25942	hgsc.bcm.edu	37	15	75673982	75673982	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr15:75673982T>A	ENST00000394947.3	-	18	3574	c.3260A>T	c.(3259-3261)gAg>gTg	p.E1087V	SIN3A_ENST00000360439.4_Missense_Mutation_p.E1087V|SIN3A_ENST00000394949.4_Missense_Mutation_p.E1087V	NM_001145358.1	NP_001138830.1			SIN3 transcription regulator family member A											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	63						ATCCGAATTCTCCTCTTCTGT	0.502																																					p.E1087V		Atlas-SNP	.											.	SIN3A	152	.	0			c.A3260T						PASS	.						219.0	188.0	199.0					15																	75673982		2197	4294	6491	SO:0001583	missense	25942	exon18			GAATTCTCCTCTT	AK027559	CCDS10279.1	15q22.33	2013-08-21	2013-08-21		ENSG00000169375	ENSG00000169375			19353	protein-coding gene	gene with protein product		607776	"""SIN3 homolog A, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog A (yeast)"""			10773092, 7601471	Standard	NM_001145357		Approved	KIAA0700, DKFZP434K2235	uc002bai.3	Q96ST3	OTTHUMG00000142834	ENST00000394947.3:c.3260A>T	chr15.hg19:g.75673982T>A	ENSP00000378402:p.Glu1087Val	169.0	0.0	.		173.0	75.0	.	NM_001145358		Missense_Mutation	SNP	ENST00000394947.3	hg19	CCDS10279.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.186474	0.78789	.	.	ENSG00000169375	ENST00000394947;ENST00000394949;ENST00000360439	T;T;T	0.47528	0.84;0.84;0.84	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.47248	0.1435	L	0.61387	1.9	0.80722	D	1	B	0.28998	0.23	B	0.30716	0.119	T	0.41215	-0.9521	10	0.30078	T	0.28	-25.6466	14.6847	0.69042	0.0:0.0:0.0:1.0	.	1087	Q96ST3	SIN3A_HUMAN	V	1087	ENSP00000378402:E1087V;ENSP00000378403:E1087V;ENSP00000353622:E1087V	ENSP00000353622:E1087V	E	-	2	0	SIN3A	73461035	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.939000	0.87685	2.073000	0.62155	0.402000	0.26972	GAG	.	.	.	none		0.502	SIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286469.1	NM_015477	
FA2H	79152	hgsc.bcm.edu	37	16	74750468	74750468	+	Missense_Mutation	SNP	G	G	C			TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr16:74750468G>C	ENST00000219368.3	-	6	885	c.816C>G	c.(814-816)ttC>ttG	p.F272L	FA2H_ENST00000544337.1_Missense_Mutation_p.F59L	NM_024306.4	NP_077282.3	Q7L5A8	FA2H_HUMAN	fatty acid 2-hydroxylase	272					cell death (GO:0008219)|central nervous system myelin maintenance (GO:0032286)|fatty acid biosynthetic process (GO:0006633)|lipid modification (GO:0030258)|peripheral nervous system myelin maintenance (GO:0032287)|regulation of cell proliferation (GO:0042127)|regulation of hair cycle (GO:0042634)|sebaceous gland cell differentiation (GO:0001949)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	fatty acid alpha-hydroxylase activity (GO:0080132)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			endometrium(2)|large_intestine(4)|lung(3)|skin(1)	10						GCACAGGGGGGAAGACCAGGC	0.677																																					p.F272L		Atlas-SNP	.											.	FA2H	21	.	0			c.C816G						PASS	.						16.0	15.0	15.0					16																	74750468		2194	4297	6491	SO:0001583	missense	79152	exon6			AGGGGGGAAGACC	BC002679	CCDS10911.1	16q23	2013-03-04	2003-10-29	2003-10-31	ENSG00000103089	ENSG00000103089		"""Fatty acid hydroxylase domain containing"""	21197	protein-coding gene	gene with protein product	"""fatty acid hydroxylase"""	611026	"""fatty acid hydroxylase domain containing 1"", ""spastic paraplegia 35 (autosomal recessive)"""	FAXDC1, SPG35		20104589	Standard	NM_024306		Approved	FAAH, FLJ25287	uc002fde.2	Q7L5A8	OTTHUMG00000137603	ENST00000219368.3:c.816C>G	chr16.hg19:g.74750468G>C	ENSP00000219368:p.Phe272Leu	34.0	0.0	.		39.0	16.0	.	NM_024306	B7Z8T6|O75213|Q96DK1|Q9H1A5	Missense_Mutation	SNP	ENST00000219368.3	hg19	CCDS10911.1	.	.	.	.	.	.	.	.	.	.	g	23.5	4.426263	0.83667	.	.	ENSG00000103089	ENST00000219368;ENST00000544337	D;D	0.83506	-1.73;-1.73	5.07	3.07	0.35406	Fatty acid hydroxylase (1);	0.000000	0.85682	D	0.000000	D	0.89203	0.6648	M	0.75264	2.295	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.87214	0.2249	10	0.40728	T	0.16	0.1308	11.6853	0.51483	0.1462:0.0:0.8538:0.0	.	272;180	Q7L5A8;B2RDE6	FA2H_HUMAN;.	L	272;59	ENSP00000219368:F272L;ENSP00000442334:F59L	ENSP00000219368:F272L	F	-	3	2	FA2H	73307969	1.000000	0.71417	0.997000	0.53966	0.948000	0.59901	2.233000	0.43027	0.524000	0.28502	0.651000	0.88453	TTC	.	.	.	none		0.677	FA2H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269015.2	NM_024306	
WDR81	124997	hgsc.bcm.edu	37	17	1630052	1630052	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr17:1630052C>T	ENST00000409644.1	+	1	1799	c.1799C>T	c.(1798-1800)cCc>cTc	p.P600L	WDR81_ENST00000446363.1_Intron|WDR81_ENST00000309182.5_Intron|WDR81_ENST00000419248.1_Intron|WDR81_ENST00000437219.2_Intron|RP11-961A15.1_ENST00000576540.1_RNA	NM_001163809.1	NP_001157281.1	Q562E7	WDR81_HUMAN	WD repeat domain 81	600	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.				negative regulation of phosphatase activity (GO:0010923)		transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|kidney(3)|lung(6)|ovary(2)|prostate(2)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		GCCCTTGCCCCCGAGCCTCCC	0.657																																					p.P600L		Atlas-SNP	.											.	WDR81	180	.	0			c.C1799T						PASS	.						14.0	18.0	17.0					17																	1630052		692	1589	2281	SO:0001583	missense	124997	exon1			TTGCCCCCGAGCC	AK074111	CCDS54061.1, CCDS54062.1, CCDS54063.1	17p13.3	2014-06-13			ENSG00000167716	ENSG00000167716		"""WD repeat domain containing"""	26600	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 166"""	614218					Standard	NM_001163673		Approved	FLJ33817, PPP1R166	uc002ftj.2	Q562E7	OTTHUMG00000153941	ENST00000409644.1:c.1799C>T	chr17.hg19:g.1630052C>T	ENSP00000386609:p.Pro600Leu	19.0	0.0	.		35.0	20.0	.	NM_001163809	B3KW16|B3KXU1|B7Z579|E9PHG7|Q24JP6|Q8N277|Q8N3F3|Q8TEL1	Missense_Mutation	SNP	ENST00000409644.1	hg19	CCDS54062.1	.	.	.	.	.	.	.	.	.	.	C	5.306	0.241738	0.10077	.	.	ENSG00000167716	ENST00000409644	T	0.51574	0.7	5.43	5.43	0.79202	.	.	.	.	.	T	0.39545	0.1082	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.12528	-1.0544	6	0.09590	T	0.72	.	12.5648	0.56304	0.0:0.9236:0.0:0.0764	.	.	.	.	L	600	ENSP00000386609:P600L	ENSP00000386609:P600L	P	+	2	0	WDR81	1576802	0.524000	0.26282	0.970000	0.41538	0.006000	0.05464	4.407000	0.59754	2.546000	0.85860	0.462000	0.41574	CCC	.	.	.	none		0.657	WDR81-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333118.2	NM_152348	
MYBBP1A	10514	hgsc.bcm.edu	37	17	4445767	4445767	+	Missense_Mutation	SNP	G	G	T	rs200492249	byFrequency	TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr17:4445767G>T	ENST00000254718.4	-	22	3385	c.3079C>A	c.(3079-3081)Cgt>Agt	p.R1027S	MYBBP1A_ENST00000381556.2_Missense_Mutation_p.R1027S			Q9BQG0	MBB1A_HUMAN	MYB binding protein (P160) 1a	1027					cellular response to glucose starvation (GO:0042149)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleocytoplasmic transport (GO:0006913)|osteoblast differentiation (GO:0001649)|positive regulation of cell cycle arrest (GO:0071158)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|NLS-dependent protein nuclear import complex (GO:0042564)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA-directed DNA polymerase activity (GO:0003887)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)	24						ACCTGATGACGGGGCCGCACC	0.627																																					p.R1027S		Atlas-SNP	.											.	MYBBP1A	69	.	0			c.C3079A						PASS	.						69.0	80.0	76.0					17																	4445767		2203	4300	6503	SO:0001583	missense	10514	exon22			GATGACGGGGCCG	AF147709	CCDS11046.1, CCDS42238.1	17p13.3	2008-07-18			ENSG00000132382	ENSG00000132382			7546	protein-coding gene	gene with protein product	"""p53-activated protein-2"""	604885				10644447	Standard	NM_014520		Approved	P160, PAP2, FLJ37886	uc002fxz.4	Q9BQG0	OTTHUMG00000090747	ENST00000254718.4:c.3079C>A	chr17.hg19:g.4445767G>T	ENSP00000254718:p.Arg1027Ser	116.0	0.0	.		149.0	48.0	.	NM_014520	Q86VM3|Q9BW49|Q9P0V5|Q9UF99	Missense_Mutation	SNP	ENST00000254718.4	hg19	CCDS11046.1	.	.	.	.	.	.	.	.	.	.	G	13.30	2.195223	0.38806	.	.	ENSG00000132382	ENST00000381556;ENST00000254718	T;T	0.67698	-0.28;-0.28	5.3	4.12	0.48240	Armadillo-type fold (1);	0.258408	0.43579	D	0.000546	T	0.68568	0.3015	M	0.65975	2.015	0.30663	N	0.754172	P;P	0.48407	0.854;0.91	B;P	0.49683	0.414;0.619	T	0.69591	-0.5104	10	0.38643	T	0.18	-19.6389	9.7224	0.40311	0.1107:0.0:0.8893:0.0	.	1027;1027	Q9BQG0;Q9BQG0-2	MBB1A_HUMAN;.	S	1027	ENSP00000370968:R1027S;ENSP00000254718:R1027S	ENSP00000254718:R1027S	R	-	1	0	MYBBP1A	4392516	1.000000	0.71417	0.995000	0.50966	0.009000	0.06853	2.897000	0.48664	2.473000	0.83533	0.561000	0.74099	CGT	.	G|0.999;A|0.001	.	alt		0.627	MYBBP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207488.2	NM_014520	
CDC27	996	hgsc.bcm.edu	37	17	45234397	45234397	+	Missense_Mutation	SNP	G	G	A	rs7350908		TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr17:45234397G>A	ENST00000066544.3	-	7	817	c.724C>T	c.(724-726)Cct>Tct	p.P242S	CDC27_ENST00000531206.1_Missense_Mutation_p.P242S|CDC27_ENST00000527547.1_Missense_Mutation_p.P242S|CDC27_ENST00000446365.2_Missense_Mutation_p.P181S|CDC27_ENST00000528748.1_5'Flank	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	242					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						ACAGTATCAGGTGAAATTACA	0.363																																					p.P242S		Atlas-SNP	.											.	CDC27	337	.	0			c.C724T						PASS	.						44.0	48.0	47.0					17																	45234397		2191	4293	6484	SO:0001583	missense	996	exon7			TATCAGGTGAAAT	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.724C>T	chr17.hg19:g.45234397G>A	ENSP00000066544:p.Pro242Ser	45.0	0.0	.		49.0	4.0	.	NM_001114091	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	hg19	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	G	14.01	2.407694	0.42715	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	T;T;T;T;T	0.67523	-0.26;-0.27;0.01;-0.27;0.49	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.51517	0.1679	L	0.29908	0.895	0.80722	D	1	B;B;B;B	0.26195	0.0;0.014;0.0;0.144	B;B;B;B	0.20955	0.001;0.008;0.001;0.032	T	0.50004	-0.8878	10	0.06099	T	0.92	-16.7932	16.7505	0.85484	0.0:0.0:1.0:0.0	rs7350908;rs52796638;rs7350908	181;242;242;242	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	S	242;242;181;242;242	ENSP00000066544:P242S;ENSP00000434614:P242S;ENSP00000392802:P181S;ENSP00000437339:P242S;ENSP00000432105:P242S	ENSP00000066544:P242S	P	-	1	0	CDC27	42589396	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.436000	0.80404	2.555000	0.86185	0.460000	0.39030	CCT	.	G|1.000;|0.000	.	weak		0.363	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
PPM1E	22843	hgsc.bcm.edu	37	17	56833457	56833457	+	Silent	SNP	G	G	C	rs3834568|rs201186780|rs74256772	byFrequency	TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr17:56833457G>C	ENST00000308249.2	+	1	228	c.99G>C	c.(97-99)ccG>ccC	p.P33P		NM_014906.4	NP_055721.3	Q96MI6	PPM1M_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1E	0	PP2C-like.				protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|manganese ion binding (GO:0030145)			biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			agccggagccggaacccgaac	0.672																																					p.P33P		Atlas-SNP	.											PPM1E,colon,carcinoma,0,1	PPM1E	97	.	0			c.G99C						PASS	.						14.0	20.0	18.0					17																	56833457		2188	4284	6472	SO:0001819	synonymous_variant	22843	exon1			GGAGCCGGAACCC	AB028995	CCDS11613.1	17q24.2	2012-04-17	2010-03-05		ENSG00000175175	ENSG00000175175		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19322	protein-coding gene	gene with protein product	"""partner of PIX 1"", ""nuclear calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1E (PP2C domain containing)"""			11864573, 10470851	Standard	NR_048561		Approved	POPX1, KIAA1072, PP2CH, CaMKP-N	uc002iwx.4	Q8WY54		ENST00000308249.2:c.99G>C	chr17.hg19:g.56833457G>C		44.0	0.0	.		34.0	3.0	.	NM_014906	Q8N8J9|Q96DB8	Silent	SNP	ENST00000308249.2	hg19	CCDS11613.1																																																																																			.	.	.	weak		0.672	PPM1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445458.1	NM_014906	
SIN3B	23309	hgsc.bcm.edu	37	19	16977317	16977317	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr19:16977317G>T	ENST00000248054.5	+	12	1777	c.1756G>T	c.(1756-1758)Gcc>Tcc	p.A586S	SIN3B_ENST00000595541.1_Missense_Mutation_p.A176S|SIN3B_ENST00000379803.1_Missense_Mutation_p.A618S					SIN3 transcription regulator family member B											endometrium(4)|kidney(2)|large_intestine(8)|lung(8)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26						CGACACCAAGGCCCTGCGCTC	0.602																																					p.A618S		Atlas-SNP	.											.	SIN3B	90	.	0			c.G1852T						PASS	.						147.0	105.0	119.0					19																	16977317		2203	4300	6503	SO:0001583	missense	23309	exon13			ACCAAGGCCCTGC	AB014600	CCDS32946.1, CCDS74308.1	19p13.12	2013-08-21	2013-08-21						19354	protein-coding gene	gene with protein product		607777	"""SIN3 homolog B, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog B (yeast)"""			9734811	Standard	XM_005259832		Approved	KIAA0700	uc002ney.2	O75182		ENST00000248054.5:c.1756G>T	chr19.hg19:g.16977317G>T	ENSP00000248054:p.Ala586Ser	164.0	0.0	.		116.0	5.0	.	NM_015260		Missense_Mutation	SNP	ENST00000248054.5	hg19		.	.	.	.	.	.	.	.	.	.	G	32	5.177469	0.94846	.	.	ENSG00000127511	ENST00000379803;ENST00000248054	T;T	0.49720	0.81;0.77	4.96	4.96	0.65561	.	0.107077	0.64402	D	0.000006	T	0.49592	0.1566	L	0.49778	1.585	0.80722	D	1	P;P;P	0.49862	0.929;0.851;0.781	P;P;P	0.47102	0.537;0.525;0.459	T	0.41378	-0.9512	10	0.20046	T	0.44	-4.1143	18.1922	0.89810	0.0:0.0:1.0:0.0	.	176;586;618	B7Z392;O75182-2;O75182	.;.;SIN3B_HUMAN	S	618;586	ENSP00000369131:A618S;ENSP00000248054:A586S	ENSP00000248054:A586S	A	+	1	0	SIN3B	16838317	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.611000	0.98342	2.282000	0.76494	0.491000	0.48974	GCC	.	.	.	none		0.602	SIN3B-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000462846.1	NM_015260	
ZNF880	400713	hgsc.bcm.edu	37	19	52877551	52877551	+	Splice_Site	SNP	G	G	A			TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr19:52877551G>A	ENST00000422689.2	+	3	154		c.e3-1		ZNF880_ENST00000597976.1_Splice_Site|ZNF880_ENST00000344085.5_Splice_Site|ZNF880_ENST00000600321.1_Splice_Site|ZNF880_ENST00000424032.2_Splice_Site	NM_001145434.1	NP_001138906.1	Q6PDB4	ZN880_HUMAN	zinc finger protein 880						regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	10						TTTTTAAATAGGAATCTGTCT	0.403																																					.		Atlas-SNP	.											.	ZNF880	45	.	0			c.140-1G>A						PASS	.						52.0	43.0	46.0					19																	52877551		692	1591	2283	SO:0001630	splice_region_variant	400713	exon3			TAAATAGGAATCT	BC058819	CCDS46164.1	19q13.41	2013-01-08			ENSG00000221923	ENSG00000221923		"""Zinc fingers, C2H2-type"", ""-"""	37249	protein-coding gene	gene with protein product							Standard	NM_001145434		Approved		uc002pzc.3	Q6PDB4	OTTHUMG00000167972	ENST00000422689.2:c.140-1G>A	chr19.hg19:g.52877551G>A		58.0	0.0	.		78.0	11.0	.	NM_001145434	B4DNA6	Splice_Site	SNP	ENST00000422689.2	hg19	CCDS46164.1	.	.	.	.	.	.	.	.	.	.	g	4.728	0.135350	0.09032	.	.	ENSG00000221923	ENST00000424032;ENST00000344085;ENST00000422689	.	.	.	1.13	1.13	0.20643	.	.	.	.	.	.	.	.	.	.	.	0.23483	N	0.997585	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.6302	0.17506	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZNF880	57569363	0.003000	0.15002	0.027000	0.17364	0.231000	0.25187	0.510000	0.22723	0.920000	0.36970	0.448000	0.29417	.	.	.	.	none		0.403	ZNF880-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397374.1	NM_001145434	Intron
TSPYL2	64061	hgsc.bcm.edu	37	X	53114044	53114044	+	Silent	SNP	C	C	A			TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chrX:53114044C>A	ENST00000375442.4	+	3	1125	c.993C>A	c.(991-993)cgC>cgA	p.R331R		NM_022117.3	NP_071400.1	Q9H2G4	TSYL2_HUMAN	TSPY-like 2	331					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell cycle (GO:0007049)|cellular protein metabolic process (GO:0044267)|chromatin modification (GO:0016568)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA replication (GO:0008156)|nucleosome assembly (GO:0006334)|regulation of protein kinase activity (GO:0045859)|regulation of signal transduction (GO:0009966)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	rDNA binding (GO:0000182)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(1)	19						AGCGCAACCGCTCAGGTAAGT	0.498																																					p.R331R		Atlas-SNP	.											.	TSPYL2	53	.	0			c.C993A						PASS	.						105.0	85.0	92.0					X																	53114044		2203	4300	6503	SO:0001819	synonymous_variant	64061	exon3			CAACCGCTCAGGT	AF273046	CCDS14350.1	Xp11	2014-06-09			ENSG00000184205	ENSG00000184205			24358	protein-coding gene	gene with protein product		300564				11318608, 11395479	Standard	NM_022117		Approved	SE20-4, HRIHFB2216, CTCL, DENTT, CDA1, CINAP, TSPX	uc004drw.3	Q9H2G4	OTTHUMG00000021597	ENST00000375442.4:c.993C>A	chrX.hg19:g.53114044C>A		75.0	0.0	.		60.0	56.0	.	NM_022117	O94799|Q96DG7|Q9BZW6	Silent	SNP	ENST00000375442.4	hg19	CCDS14350.1																																																																																			.	.	.	none		0.498	TSPYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056718.1	NM_022117	
HOXD8	3234	hgsc.bcm.edu	37	2	176996164	176996165	+	Frame_Shift_Ins	INS	-	-	CCCTAGCCCT			TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr2:176996164_176996165insCCCTAGCCCT	ENST00000313173.4	+	2	1324_1325	c.697_698insCCCTAGCCCT	c.(697-699)gccfs	p.-236fs	HOXD8_ENST00000429017.1_Frame_Shift_Ins_p.-52fs|HOXD8_ENST00000544999.1_Frame_Shift_Ins_p.-235fs|HOXD8_ENST00000450510.2_Frame_Shift_Ins_p.-235fs|HOXD-AS2_ENST00000440016.2_RNA|HOXD8_ENST00000548663.1_Frame_Shift_Ins_p.-132fs	NM_001199746.1|NM_019558.3	NP_001186675.1|NP_062458.1	P13378	HXD8_HUMAN	homeobox D8						anterior/posterior axis specification, embryo (GO:0008595)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|lung(5)|skin(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.195)	Colorectal(32;0.0224)|READ - Rectum adenocarcinoma(9;0.0556)		GGTTTCCCACGCCCTAGCCCTC	0.446																																					p.A233fs		Atlas-Indel,Pindel	.											.	HOXD8	24	.	0			c.697_698insCCCTAGCCCT						PASS	.																																			SO:0001589	frameshift_variant	3234	exon2			.		CCDS2268.1, CCDS56148.1, CCDS56149.1	2q31.1	2011-06-20	2005-12-22		ENSG00000175879	ENSG00000175879		"""Homeoboxes / ANTP class : HOXL subclass"""	5139	protein-coding gene	gene with protein product		142985	"""homeo box D8"""	HOX4, HOX4E		1973146, 1358459	Standard	NM_001199747		Approved		uc002uko.3	P13378	OTTHUMG00000132513	ENST00000313173.4:c.698_707dupCCCTAGCCCT	chr2.hg19:g.176996165_176996174dupCCCTAGCCCT	ENSP00000315949:p.Leu236fs	87.0	0.0	0		52.0	11.0	0.211538	NM_019558	F8WBG7|Q5BL00|Q8IXZ1	Frame_Shift_Ins	INS	ENST00000313173.4	hg19	CCDS2268.1																																																																																			.	.	.	none		0.446	HOXD8-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255694.1		
LAMTOR5	10542	hgsc.bcm.edu	37	1	110950347	110950347	+	5'Flank	DEL	C	C	-	rs201420127		TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr1:110950347delC	ENST00000602318.1	-	0	0				LAMTOR5_ENST00000602858.1_5'Flank|LAMTOR5-AS1_ENST00000598454.1_RNA|LAMTOR5-AS1_ENST00000608499.1_RNA|LAMTOR5-AS1_ENST00000457535.1_RNA|LAMTOR5-AS1_ENST00000609244.1_RNA|LAMTOR5_ENST00000256644.4_Frame_Shift_Del_p.A48fs|LAMTOR5-AS1_ENST00000608486.1_RNA|LAMTOR5_ENST00000474861.2_5'Flank|LAMTOR5-AS1_ENST00000610148.1_RNA|LAMTOR5-AS1_ENST00000608602.1_RNA|LAMTOR5_ENST00000483260.1_5'Flank|LAMTOR5-AS1_ENST00000587691.1_RNA|LAMTOR5-AS1_ENST00000590413.1_RNA|LAMTOR5-AS1_ENST00000609512.1_RNA|LAMTOR5-AS1_ENST00000608253.1_RNA|LAMTOR5-AS1_ENST00000590826.1_RNA|LAMTOR5-AS1_ENST00000609709.1_RNA|LAMTOR5-AS1_ENST00000608067.1_RNA			O43504	LTOR5_HUMAN	late endosomal/lysosomal adaptor, MAPK and MTOR activator 5						cellular response to amino acid stimulus (GO:0071230)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of GTPase activity (GO:0043547)|positive regulation of TOR signaling (GO:0032008)|protein localization to lysosome (GO:0061462)|regulation of cell size (GO:0008361)|response to virus (GO:0009615)|viral genome replication (GO:0019079)	cytosol (GO:0005829)|lysosome (GO:0005764)|Ragulator complex (GO:0071986)											CGTAACGGCGCCTCCAAAGGG	0.617																																					p.A48fs		Pindel	.											.	.	.	.	0			c.143delC						PASS	.						87.0	74.0	78.0					1																	110950347		2203	4300	6503	SO:0001631	upstream_gene_variant	10542	exon1			.	AF029890	CCDS824.1	1p12	2012-09-24	2012-09-24	2012-09-24	ENSG00000134248	ENSG00000134248			17955	protein-coding gene	gene with protein product	"""HBx-interacting protein"", ""hepatitis B virus x-interacting protein (9.6kD)"""	608521	"""hepatitis B virus x interacting protein"""	HBXIP		9499022, 22980980	Standard	NM_006402		Approved	XIP, MGC71071	uc001dzr.3	O43504	OTTHUMG00000011568		chr1.hg19:g.110950347delC	Exception_encountered	297.0	0.0	.		216.0	42.0	0.194	NM_006402	Q6IBD8	Frame_Shift_Del	DEL	ENST00000602318.1	hg19																																																																																				.	.	.	none		0.617	LAMTOR5-007	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467909.1	NM_006402	
TAF15	8148	hgsc.bcm.edu	37	17	34171711	34171755	+	In_Frame_Del	DEL	GGCTATGGAGGAGACCGAGGAGGTGGCTATGGAGGAGATCGAGGT	GGCTATGGAGGAGACCGAGGAGGTGGCTATGGAGGAGATCGAGGT	-	rs543739946|rs569473616|rs144910879|rs187380389|rs368600342|rs577544142|rs144917137|rs181978759	byFrequency	TCGA-B1-A47N-01A-11D-A25F-10	TCGA-B1-A47N-10A-01D-A25F-10	GGCTATGGAGGAGACCGAGGAGGTGGCTATGGAGGAGATCGAGGT	GGCTATGGAGGAGACCGAGGAGGTGGCTATGGAGGAGATCGAGGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd2cc59d-f5ce-46ed-beb0-4c80b24cbe71	2041c373-06a2-4ba8-b9f8-3c11c313e0db	g.chr17:34171711_34171755delGGCTATGGAGGAGACCGAGGAGGTGGCTATGGAGGAGATCGAGGT	ENST00000588240.1	+	15	1523_1567	c.1408_1452delGGCTATGGAGGAGACCGAGGAGGTGGCTATGGAGGAGATCGAGGT	c.(1408-1452)ggctatggaggagaccgaggaggtggctatggaggagatcgaggtdel	p.GYGGDRGGGYGGDRG485del	TAF15_ENST00000311979.3_In_Frame_Del_p.GYGGDRGGGYGGDRG482del|TAF15_ENST00000592237.1_Intron	NM_003487.3|NM_139215.2	NP_003478.1|NP_631961.1	Q16514	TAF12_HUMAN	TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa	0					chromatin organization (GO:0006325)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone H3 acetylation (GO:0043966)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of RNA biosynthetic process (GO:2001141)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)		TAF15/NR4A3(33)	lung(1)|ovary(1)|skin(2)|stomach(1)	5		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		cagaggaggcggctatggaggagaccgaggaggtggctatggaggagatcgaggtggctatggag	0.612			T	"""TEC, CHN1, ZNF384"""	"""extraskeletal myxoid chondrosarcomas, ALL"""																																p.469_484del		Pindel	.		Dom	yes		17	17q11.1-q11.2	8148	"""TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa"""		"""L, M"""	.	TAF15	46	.	0			c.1407_1451del						PASS	.		,	40,224,3996		2,0,36,14,196,1882					,	-3.9	0.1			9	54,332,7866		1,0,52,25,282,3766	no	codingComplex,codingComplex	TAF15	NM_139215.1,NM_003487.2	,	3,0,88,39,478,5648	A1A1,A1A2,A1R,A2A2,A2R,RR		4.6777,6.1972,5.195	,	,		94,556,11862				SO:0001651	inframe_deletion	8148	exon15			.	U51334	CCDS32623.1, CCDS59279.1	17q11.1-q11.2	2013-02-12	2002-08-29	2001-12-07		ENSG00000270647		"""RNA binding motif (RRM) containing"""	11547	protein-coding gene	gene with protein product		601574	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, N, 68kD (RNA-binding protein 56)"""	TAF2N		8954779, 9795213	Standard	NM_003487		Approved	hTAFII68, RBP56, Npl3	uc002hkd.4	Q92804		ENST00000588240.1:c.1408_1452delGGCTATGGAGGAGACCGAGGAGGTGGCTATGGAGGAGATCGAGGT	chr17.hg19:g.34171711_34171755delGGCTATGGAGGAGACCGAGGAGGTGGCTATGGAGGAGATCGAGGT	ENSP00000466950:p.Gly485_Gly499del	53.0	0.0	.		68.0	10.0	0.147	NM_139215	D3DPM5|Q15775|Q5T077	In_Frame_Del	DEL	ENST00000588240.1	hg19	CCDS32623.1																																																																																			.	.	.	none		0.612	TAF15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449134.1	NM_139215	
