#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
EPHA8	2046	hgsc.bcm.edu	37	1	22902757	22902757	+	Silent	SNP	G	G	A			TCGA-B1-A47O-01A-11D-A25F-10	TCGA-B1-A47O-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca2b9fe2-97e0-4d4f-afd7-a5acf638800f	c023a62c-e498-4e1e-be91-99cf6d7b0708	g.chr1:22902757G>A	ENST00000166244.3	+	3	279	c.207G>A	c.(205-207)acG>acA	p.T69T	EPHA8_ENST00000538803.1_Silent_p.T69T|EPHA8_ENST00000374644.4_Silent_p.T69T	NM_020526.3	NP_065387.1	P29322	EPHA8_HUMAN	EPH receptor A8	69	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|ephrin receptor signaling pathway (GO:0048013)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell adhesion mediated by integrin (GO:0033628)|substrate-dependent cell migration (GO:0006929)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(6)|lung(22)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		CCATCCACACGTACCAGGTTT	0.607																																					p.T69T		Atlas-SNP	.											.	EPHA8	221	.	0			c.G207A						PASS	.						108.0	103.0	105.0					1																	22902757		2203	4300	6503	SO:0001819	synonymous_variant	2046	exon3			CCACACGTACCAG	BC038796	CCDS225.1, CCDS30626.1	1p36.12	2013-02-11	2004-10-28		ENSG00000070886	ENSG00000070886	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3391	protein-coding gene	gene with protein product		176945	"""EphA8"""	EEK		1648701	Standard	NM_001006943		Approved	Hek3	uc001bfx.1	P29322	OTTHUMG00000002892	ENST00000166244.3:c.207G>A	chr1.hg19:g.22902757G>A		301.0	0.0	.		234.0	51.0	.	NM_020526	Q6IN80|Q8IUX6|Q9NUA9|Q9P269	Silent	SNP	ENST00000166244.3	hg19	CCDS225.1																																																																																			.	.	.	none		0.607	EPHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008085.1	NM_020526	
ERI3	79033	hgsc.bcm.edu	37	1	44778900	44778900	+	Splice_Site	SNP	G	G	A			TCGA-B1-A47O-01A-11D-A25F-10	TCGA-B1-A47O-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca2b9fe2-97e0-4d4f-afd7-a5acf638800f	c023a62c-e498-4e1e-be91-99cf6d7b0708	g.chr1:44778900G>A	ENST00000372257.2	-	5	788	c.607C>T	c.(607-609)Ctc>Ttc	p.L203F	ERI3_ENST00000372259.5_Splice_Site_p.L88F|ERI3_ENST00000495828.1_5'UTR|ERI3_ENST00000537474.1_Splice_Site_p.L26F	NM_024066.1	NP_076971.1	O43414	ERI3_HUMAN	ERI1 exoribonuclease family member 3	203	Exonuclease.						exonuclease activity (GO:0004527)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(2)|lung(7)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						ATCCCGGTGAGCTGAAAGGAA	0.498																																					p.L203F		Atlas-SNP	.											.	ERI3	39	.	0			c.C607T						PASS	.						77.0	77.0	77.0					1																	44778900		2203	4300	6503	SO:0001630	splice_region_variant	79033	exon5			CGGTGAGCTGAAA	AF007157	CCDS30696.1	1p34.1	2009-10-07	2009-10-07	2008-12-16	ENSG00000117419	ENSG00000117419		"""Enhanced RNAi three prime mRNA exonucleases"""	17276	protein-coding gene	gene with protein product	"""enhanced RNAi three prime mRNA exonuclease homolog 3 (C.elegans)"", ""exoribonuclease 3"""	609917	"""prion protein interacting protein"""	PRNPIP			Standard	XM_005271184		Approved	FLJ22943, PINT1	uc001clt.3	O43414	OTTHUMG00000007637	ENST00000372257.2:c.607-1C>T	chr1.hg19:g.44778900G>A		139.0	0.0	.		113.0	27.0	.	NM_024066	B1AK98|Q5T2T7|Q5T2T9|Q5TG35|Q9BQA0|Q9UEB4	Missense_Mutation	SNP	ENST00000372257.2	hg19	CCDS30696.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.465812	0.84425	.	.	ENSG00000117419	ENST00000372257;ENST00000372259;ENST00000456170;ENST00000537474;ENST00000433471;ENST00000372253;ENST00000452396;ENST00000457571	T;T;T;T;T;T	0.19806	2.12;2.12;2.12;2.12;2.12;2.12	5.43	5.43	0.79202	Exonuclease (1);Exonuclease, RNase T/DNA polymerase III (1);Ribonuclease H-like (1);	0.167282	0.40908	D	0.000988	T	0.54951	0.1890	M	0.86502	2.82	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.60900	-0.7171	10	0.87932	D	0	.	19.4202	0.94719	0.0:0.0:1.0:0.0	.	201;125;203	F6UGJ8;B4DN03;O43414	.;.;ERI3_HUMAN	F	203;88;42;26;85;69;85;201	ENSP00000361331:L203F;ENSP00000361333:L88F;ENSP00000390710:L42F;ENSP00000438360:L26F;ENSP00000396764:L85F;ENSP00000412291:L201F	ENSP00000361327:L69F	L	-	1	0	ERI3	44551487	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.471000	0.66762	2.825000	0.97269	0.655000	0.94253	CTC	.	.	.	none		0.498	ERI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020243.1	NM_024066	Missense_Mutation
KCNN3	3782	hgsc.bcm.edu	37	1	154680665	154680665	+	Silent	SNP	C	C	T			TCGA-B1-A47O-01A-11D-A25F-10	TCGA-B1-A47O-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca2b9fe2-97e0-4d4f-afd7-a5acf638800f	c023a62c-e498-4e1e-be91-99cf6d7b0708	g.chr1:154680665C>T	ENST00000271915.4	-	8	2298	c.1983G>A	c.(1981-1983)tcG>tcA	p.S661S	KCNN3_ENST00000358505.2_Silent_p.S348S|KCNN3_ENST00000361147.4_Silent_p.S356S|KCNN3_ENST00000515643.1_5'UTR	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	666					potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	GCTCCAGCTTCGACTCCAGGC	0.567																																					p.S676S		Atlas-SNP	.											KCNN3,NS,carcinoma,0,1	KCNN3	141	.	0			c.G2028A						PASS	.						124.0	137.0	133.0					1																	154680665		2203	4300	6503	SO:0001819	synonymous_variant	3782	exon9			CAGCTTCGACTCC	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.1983G>A	chr1.hg19:g.154680665C>T		146.0	0.0	.		111.0	31.0	.	NM_001204087	B1ANX0|O43517|Q86VF9|Q8WXG7	Silent	SNP	ENST00000271915.4	hg19	CCDS30880.1																																																																																			.	.	.	none		0.567	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
SCN2A	6326	hgsc.bcm.edu	37	2	166246020	166246020	+	Missense_Mutation	SNP	C	C	T	rs367833365		TCGA-B1-A47O-01A-11D-A25F-10	TCGA-B1-A47O-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca2b9fe2-97e0-4d4f-afd7-a5acf638800f	c023a62c-e498-4e1e-be91-99cf6d7b0708	g.chr2:166246020C>T	ENST00000375437.2	+	27	5994	c.5704C>T	c.(5704-5706)Cgc>Tgc	p.R1902C	SCN2A_ENST00000375427.2_Missense_Mutation_p.R1902C|SCN2A_ENST00000283256.6_Missense_Mutation_p.R1902C|SCN2A_ENST00000357398.3_Missense_Mutation_p.R1902C	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	1902			R -> T (associated with autism). {ECO:0000269|PubMed:12610651}.		intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CACGTTGAAACGCAAACAAGA	0.433																																					p.R1902C		Atlas-SNP	.											.	SCN2A	589	.	0			c.C5704T	GRCh37	CM034570	SCN2A	M		PASS	.	C	CYS/ARG,CYS/ARG,CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	87.0	81.0	83.0		5704,5704,5704	5.9	1.0	2		83	0,8600		0,0,4300	no	missense,missense,missense	SCN2A	NM_001040142.1,NM_001040143.1,NM_021007.2	180,180,180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging	1902/2006,1902/2006,1902/2006	166246020	1,13005	2203	4300	6503	SO:0001583	missense	6326	exon26			TTGAAACGCAAAC	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.5704C>T	chr2.hg19:g.166246020C>T	ENSP00000364586:p.Arg1902Cys	212.0	0.0	.		205.0	39.0	.	NM_001040143	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	ENST00000375437.2	hg19	CCDS33314.1	.	.	.	.	.	.	.	.	.	.	C	15.37	2.814541	0.50527	2.27E-4	0.0	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.96745	-4.11;-4.11;-4.11;-4.11	5.87	5.87	0.94306	.	0.113909	0.37261	N	0.002173	D	0.98362	0.9456	M	0.90922	3.16	0.58432	D	0.999999	D;D	0.89917	0.994;1.0	P;D	0.87578	0.865;0.998	D	0.98727	1.0711	10	0.66056	D	0.02	.	13.6126	0.62088	0.2709:0.7291:0.0:0.0	.	1902;1902	Q99250-2;Q99250	.;SCN2A_HUMAN	C	1902	ENSP00000364586:R1902C;ENSP00000349973:R1902C;ENSP00000283256:R1902C;ENSP00000364576:R1902C	ENSP00000283256:R1902C	R	+	1	0	SCN2A	165954266	0.998000	0.40836	1.000000	0.80357	0.996000	0.88848	2.510000	0.45468	2.785000	0.95823	0.585000	0.79938	CGC	.	.	.	weak		0.433	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007	
LRP2	4036	hgsc.bcm.edu	37	2	170003429	170003429	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A47O-01A-11D-A25F-10	TCGA-B1-A47O-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca2b9fe2-97e0-4d4f-afd7-a5acf638800f	c023a62c-e498-4e1e-be91-99cf6d7b0708	g.chr2:170003429C>T	ENST00000263816.3	-	69	12916	c.12631G>A	c.(12631-12633)Gag>Aag	p.E4211K		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	4211					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CAGGCAGACTCGATTTTAGGT	0.458																																					p.E4211K		Atlas-SNP	.											.	LRP2	751	.	0			c.G12631A						PASS	.						83.0	63.0	70.0					2																	170003429		2203	4300	6503	SO:0001583	missense	4036	exon69			CAGACTCGATTTT		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.12631G>A	chr2.hg19:g.170003429C>T	ENSP00000263816:p.Glu4211Lys	200.0	0.0	.		195.0	42.0	.	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	hg19	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	C	36	5.742166	0.96873	.	.	ENSG00000081479	ENST00000263816	D	0.93604	-3.25	5.67	5.67	0.87782	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	D	0.97570	0.9204	M	0.91972	3.26	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97877	1.0289	10	0.66056	D	0.02	.	19.7612	0.96319	0.0:1.0:0.0:0.0	.	4211	P98164	LRP2_HUMAN	K	4211	ENSP00000263816:E4211K	ENSP00000263816:E4211K	E	-	1	0	LRP2	169711675	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.818000	0.86416	2.670000	0.90874	0.655000	0.94253	GAG	.	.	.	none		0.458	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
TTN	7273	hgsc.bcm.edu	37	2	179473456	179473456	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-A47O-01A-11D-A25F-10	TCGA-B1-A47O-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca2b9fe2-97e0-4d4f-afd7-a5acf638800f	c023a62c-e498-4e1e-be91-99cf6d7b0708	g.chr2:179473456A>T	ENST00000591111.1	-	224	47583	c.47359T>A	c.(47359-47361)Tgc>Agc	p.C15787S	TTN_ENST00000342992.6_Missense_Mutation_p.C14860S|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.C8488S|TTN_ENST00000460472.2_Missense_Mutation_p.C8363S|TTN_ENST00000589042.1_Missense_Mutation_p.C17428S|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.C8555S|TTN-AS1_ENST00000590807.1_RNA			Q8WZ42	TITIN_HUMAN	titin	15787	Fibronectin type-III 14. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAATATTTGCAATGTCTAAGT	0.398																																					p.C17428S		Atlas-SNP	.											.	TTN	18412	.	0			c.T52282A						PASS	.						116.0	109.0	111.0					2																	179473456		1874	4114	5988	SO:0001583	missense	7273	exon274			ATTTGCAATGTCT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.47359T>A	chr2.hg19:g.179473456A>T	ENSP00000465570:p.Cys15787Ser	120.0	0.0	.		103.0	24.0	.	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	A	13.26	2.183832	0.38609	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.52295	0.67;0.67;0.67;0.67	5.72	5.72	0.89469	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.61590	0.2359	L	0.41124	1.26	0.54753	D	0.999988	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	T	0.64537	-0.6384	9	0.87932	D	0	.	15.9966	0.80256	1.0:0.0:0.0:0.0	.	8363;8488;8555;15787	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	S	14860;8363;8555;8488;8363	ENSP00000343764:C14860S;ENSP00000434586:C8363S;ENSP00000340554:C8555S;ENSP00000352154:C8488S	ENSP00000340554:C8555S	C	-	1	0	TTN	179181701	1.000000	0.71417	0.979000	0.43373	0.994000	0.84299	5.134000	0.64770	2.179000	0.69175	0.460000	0.39030	TGC	.	.	.	none		0.398	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
NSUN3	63899	hgsc.bcm.edu	37	3	93845254	93845254	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A47O-01A-11D-A25F-10	TCGA-B1-A47O-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca2b9fe2-97e0-4d4f-afd7-a5acf638800f	c023a62c-e498-4e1e-be91-99cf6d7b0708	g.chr3:93845254G>T	ENST00000314622.4	+	6	1154	c.943G>T	c.(943-945)Gtg>Ttg	p.V315L		NM_022072.3	NP_071355.1	Q9H649	NSUN3_HUMAN	NOP2/Sun domain family, member 3	315							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|skin(1)	18						TGGGCTCTTAGTGATTCCAGA	0.463																																					p.V315L		Atlas-SNP	.											.	NSUN3	33	.	0			c.G943T						PASS	.						74.0	71.0	72.0					3																	93845254		2203	4300	6503	SO:0001583	missense	63899	exon6			CTCTTAGTGATTC	BC020602	CCDS2927.1	3q11.2	2009-11-23	2009-11-23		ENSG00000178694	ENSG00000178694		"""NOP2/Sun domain containing"""	26208	protein-coding gene	gene with protein product			"""NOL1/NOP2/Sun domain family 3"", ""NOL1/NOP2/Sun domain family, member 3"""			12477932	Standard	NM_022072		Approved	FLJ22609	uc003drl.1	Q9H649	OTTHUMG00000159025	ENST00000314622.4:c.943G>T	chr3.hg19:g.93845254G>T	ENSP00000318986:p.Val315Leu	185.0	0.0	.		173.0	19.0	.	NM_022072	Q6PG41|Q8IXG9|Q9H6M2	Missense_Mutation	SNP	ENST00000314622.4	hg19	CCDS2927.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.523084	0.85600	.	.	ENSG00000178694	ENST00000314622	T	0.08720	3.06	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.34542	0.0901	M	0.81112	2.525	0.58432	D	0.999995	D	0.76494	0.999	D	0.78314	0.991	T	0.02477	-1.1153	10	0.72032	D	0.01	-17.5839	20.2789	0.98501	0.0:0.0:1.0:0.0	.	315	Q9H649	NSUN3_HUMAN	L	315	ENSP00000318986:V315L	ENSP00000318986:V315L	V	+	1	0	NSUN3	95327944	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	7.548000	0.82154	2.788000	0.95919	0.650000	0.86243	GTG	.	.	.	none		0.463	NSUN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352934.1	NM_022072	
DNAH8	1769	hgsc.bcm.edu	37	6	38781879	38781879	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A47O-01A-11D-A25F-10	TCGA-B1-A47O-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca2b9fe2-97e0-4d4f-afd7-a5acf638800f	c023a62c-e498-4e1e-be91-99cf6d7b0708	g.chr6:38781879G>A	ENST00000359357.3	+	23	2910	c.2656G>A	c.(2656-2658)Gaa>Aaa	p.E886K	DNAH8_ENST00000449981.2_Missense_Mutation_p.E1103K|DNAH8_ENST00000441566.1_Missense_Mutation_p.E886K			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	886					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						TATAAAAAGTGAAGTACATCT	0.323																																					p.E1103K		Atlas-SNP	.											.	DNAH8	1239	.	0			c.G3307A						PASS	.						113.0	124.0	120.0					6																	38781879		2203	4300	6503	SO:0001583	missense	1769	exon25			AAAAGTGAAGTAC	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.2656G>A	chr6.hg19:g.38781879G>A	ENSP00000352312:p.Glu886Lys	130.0	0.0	.		118.0	5.0	.	NM_001206927	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	hg19		.	.	.	.	.	.	.	.	.	.	G	16.25	3.071426	0.55646	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.57436	0.4;0.4;0.4	5.33	5.33	0.75918	.	0.128175	0.49916	D	0.000132	T	0.31702	0.0805	L	0.56769	1.78	0.48135	D	0.999592	B	0.16396	0.017	B	0.13407	0.009	T	0.28776	-1.0033	10	0.08599	T	0.76	.	16.803	0.85618	0.0:0.0:1.0:0.0	.	886	Q96JB1	DYH8_HUMAN	K	1091;1091;886;886	ENSP00000333363:E1091K;ENSP00000352312:E886K;ENSP00000402294:E886K	ENSP00000333363:E1091K	E	+	1	0	DNAH8	38889857	1.000000	0.71417	0.985000	0.45067	0.989000	0.77384	5.832000	0.69337	2.503000	0.84419	0.655000	0.94253	GAA	.	.	.	none		0.323	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
IQCE	23288	hgsc.bcm.edu	37	7	2645529	2645529	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A47O-01A-11D-A25F-10	TCGA-B1-A47O-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca2b9fe2-97e0-4d4f-afd7-a5acf638800f	c023a62c-e498-4e1e-be91-99cf6d7b0708	g.chr7:2645529T>C	ENST00000402050.2	+	20	1947	c.1763T>C	c.(1762-1764)gTt>gCt	p.V588A	IQCE_ENST00000404984.1_Missense_Mutation_p.V537A|IQCE_ENST00000325979.7_Missense_Mutation_p.V523A|IQCE_ENST00000438376.2_Missense_Mutation_p.V572A	NM_001100390.1|NM_152558.3	NP_001093860.1|NP_689771.3	Q6IPM2	IQCE_HUMAN	IQ motif containing E	588						mitochondrion (GO:0005739)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.23e-13)		GTGCCCCGCGTTCCGAGCCCC	0.697																																					p.V588A		Atlas-SNP	.											.	IQCE	66	.	0			c.T1763C						PASS	.						26.0	33.0	31.0					7																	2645529		2083	4195	6278	SO:0001583	missense	23288	exon20			CCCGCGTTCCGAG	AL136792	CCDS43542.1, CCDS47527.1, CCDS47527.2, CCDS75559.1, CCDS75560.1	7p22.3	2006-04-12			ENSG00000106012	ENSG00000106012			29171	protein-coding gene	gene with protein product						10470851	Standard	XR_242067		Approved	KIAA1023	uc003smo.4	Q6IPM2	OTTHUMG00000152047	ENST00000402050.2:c.1763T>C	chr7.hg19:g.2645529T>C	ENSP00000385597:p.Val588Ala	160.0	0.0	.		53.0	8.0	.	NM_152558	Q4G0P7|Q6P7T4|Q9H0H7|Q9UPX7	Missense_Mutation	SNP	ENST00000402050.2	hg19	CCDS43542.1	.	.	.	.	.	.	.	.	.	.	T	5.392	0.257572	0.10239	.	.	ENSG00000106012	ENST00000402050;ENST00000404984;ENST00000438376;ENST00000325979;ENST00000423196	T;T;T;T;T	0.29142	2.54;2.51;2.54;2.52;1.58	4.79	-5.48	0.02592	.	1.687250	0.03947	N	0.287950	T	0.17577	0.0422	L	0.32530	0.975	0.09310	N	1	P;P;B;P;B	0.37141	0.524;0.584;0.144;0.524;0.4	B;B;B;B;B	0.34418	0.095;0.182;0.035;0.095;0.121	T	0.18493	-1.0335	10	0.10377	T	0.69	-0.0383	7.0173	0.24895	0.0:0.2771:0.493:0.2299	.	523;572;588;588;572	B4DXN1;B4DDX4;Q6IPM2;B3KRY4;Q6IPM2-4	.;.;IQCE_HUMAN;.;.	A	588;537;572;523;168	ENSP00000385597:V588A;ENSP00000385945:V537A;ENSP00000396178:V572A;ENSP00000313772:V523A;ENSP00000405982:V168A	ENSP00000313772:V523A	V	+	2	0	IQCE	2612055	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.293000	0.08320	-0.613000	0.05694	0.459000	0.35465	GTT	.	.	.	none		0.697	IQCE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325063.2	NM_152558	
PCLO	27445	hgsc.bcm.edu	37	7	82544315	82544315	+	Silent	SNP	A	A	G			TCGA-B1-A47O-01A-11D-A25F-10	TCGA-B1-A47O-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca2b9fe2-97e0-4d4f-afd7-a5acf638800f	c023a62c-e498-4e1e-be91-99cf6d7b0708	g.chr7:82544315A>G	ENST00000333891.9	-	7	13324	c.12987T>C	c.(12985-12987)agT>agC	p.S4329S	PCLO_ENST00000423517.2_Silent_p.S4329S|PCLO_ENST00000437081.1_Silent_p.S1049S	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						ATGATGCATGACTAAAGGAAA	0.428																																					p.S4329S		Atlas-SNP	.											.	PCLO	1506	.	0			c.T12987C						PASS	.						81.0	78.0	79.0					7																	82544315		1889	4111	6000	SO:0001819	synonymous_variant	27445	exon7			TGCATGACTAAAG	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.12987T>C	chr7.hg19:g.82544315A>G		176.0	0.0	.		199.0	56.0	.	NM_014510		Silent	SNP	ENST00000333891.9	hg19	CCDS47630.1																																																																																			.	.	.	none		0.428	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
NDUFB6	4712	hgsc.bcm.edu	37	9	32571048	32571048	+	Silent	SNP	G	G	T			TCGA-B1-A47O-01A-11D-A25F-10	TCGA-B1-A47O-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca2b9fe2-97e0-4d4f-afd7-a5acf638800f	c023a62c-e498-4e1e-be91-99cf6d7b0708	g.chr9:32571048G>T	ENST00000379847.3	-	2	284	c.183C>A	c.(181-183)gtC>gtA	p.V61V	NDUFB6_ENST00000350021.2_Silent_p.V61V	NM_002493.4	NP_002484.1	O95139	NDUB6_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa	61					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|urinary_tract(1)	8			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00199)		ATACCCCATGGACCTGGGGGG	0.328																																					p.V61V		Atlas-SNP	.											.	NDUFB6	12	.	0			c.C183A						PASS	.						39.0	39.0	39.0					9																	32571048		2203	4289	6492	SO:0001819	synonymous_variant	4712	exon2			CCCATGGACCTGG	AF035840	CCDS6528.1, CCDS6529.1, CCDS75826.1	9p13.2	2011-07-04	2002-08-29		ENSG00000165264	ENSG00000165264		"""Mitochondrial respiratory chain complex / Complex I"""	7701	protein-coding gene	gene with protein product	"""NADH-ubiquinone oxidoreductase beta subunit, 6"", ""NADH-ubiquinone oxidoreductase B17 subunit"", ""complex I, mitochondrial respiratory chain, B17 subunit"""	603322	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6 (17kD, B17)"""			9763677, 9760212	Standard	NM_002493		Approved	B17, CI	uc003zre.2	O95139	OTTHUMG00000019741	ENST00000379847.3:c.183C>A	chr9.hg19:g.32571048G>T		147.0	0.0	.		130.0	28.0	.	NM_182739	A8K0Y7|Q5VYT2|Q6IB84	Silent	SNP	ENST00000379847.3	hg19	CCDS6528.1																																																																																			.	.	.	none		0.328	NDUFB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052001.1	NM_002493	
SECISBP2	79048	hgsc.bcm.edu	37	9	91964729	91964729	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A47O-01A-11D-A25F-10	TCGA-B1-A47O-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca2b9fe2-97e0-4d4f-afd7-a5acf638800f	c023a62c-e498-4e1e-be91-99cf6d7b0708	g.chr9:91964729G>A	ENST00000375807.3	+	13	1848	c.1777G>A	c.(1777-1779)Gtt>Att	p.V593I	SECISBP2_ENST00000534113.2_Missense_Mutation_p.V525I|SECISBP2_ENST00000339901.4_Missense_Mutation_p.V520I	NM_001282688.1|NM_001282690.1|NM_024077.3	NP_001269617.1|NP_001269619.1|NP_076982.3	Q96T21	SEBP2_HUMAN	SECIS binding protein 2	593					translation (GO:0006412)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|selenocysteine insertion sequence binding (GO:0035368)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(3)|skin(2)	32						CACTCCTTCGGTTGAGGACAA	0.562																																					p.V593I		Atlas-SNP	.											.	SECISBP2	64	.	0			c.G1777A						PASS	.						149.0	126.0	134.0					9																	91964729		2203	4300	6503	SO:0001583	missense	79048	exon13			CCTTCGGTTGAGG	AF380995	CCDS6683.1, CCDS65076.1, CCDS65077.1	9q22	2008-02-05			ENSG00000187742	ENSG00000187742			30972	protein-coding gene	gene with protein product		607693				11230166	Standard	XM_005252193		Approved		uc004aqj.1	Q96T21	OTTHUMG00000020182	ENST00000375807.3:c.1777G>A	chr9.hg19:g.91964729G>A	ENSP00000364965:p.Val593Ile	192.0	0.0	.		179.0	31.0	.	NM_024077	F8W892|Q5HYY1|Q8IYC0|Q9H0A1	Missense_Mutation	SNP	ENST00000375807.3	hg19	CCDS6683.1	.	.	.	.	.	.	.	.	.	.	G	9.108	1.005789	0.19199	.	.	ENSG00000187742	ENST00000375807;ENST00000395669;ENST00000339901;ENST00000534113	T;T;T	0.72835	-0.69;-0.69;-0.69	4.41	2.53	0.30540	.	1.563310	0.03304	N	0.189460	T	0.68668	0.3026	L	0.54323	1.7	0.09310	N	1	B;B;B	0.20052	0.024;0.041;0.006	B;B;B	0.19946	0.012;0.027;0.012	T	0.48822	-0.9001	10	0.34782	T	0.22	-0.0032	9.8267	0.40916	0.086:0.1414:0.7726:0.0	.	600;520;593	Q59H19;Q96T21-2;Q96T21	.;.;SEBP2_HUMAN	I	593;599;520;525	ENSP00000364965:V593I;ENSP00000364959:V520I;ENSP00000436650:V525I	ENSP00000364959:V520I	V	+	1	0	SECISBP2	91154549	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.188000	0.17018	0.134000	0.18681	-0.797000	0.03246	GTT	.	.	.	none		0.562	SECISBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052990.3	NM_024077	
ERC1	23085	hgsc.bcm.edu	37	12	1372211	1372211	+	Silent	SNP	T	T	A			TCGA-B1-A47O-01A-11D-A25F-10	TCGA-B1-A47O-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca2b9fe2-97e0-4d4f-afd7-a5acf638800f	c023a62c-e498-4e1e-be91-99cf6d7b0708	g.chr12:1372211T>A	ENST00000397203.2	+	14	2905	c.2499T>A	c.(2497-2499)cgT>cgA	p.R833R	ERC1_ENST00000589028.1_Silent_p.R833R|ERC1_ENST00000355446.5_Silent_p.R833R|ERC1_ENST00000543086.3_Silent_p.R805R|ERC1_ENST00000360905.4_Silent_p.R833R|ERC1_ENST00000546231.2_Silent_p.R837R			Q8IUD2	RB6I2_HUMAN	ELKS/RAB6-interacting/CAST family member 1	833					I-kappaB phosphorylation (GO:0007252)|multicellular organismal development (GO:0007275)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|IkappaB kinase complex (GO:0008385)|presynaptic membrane (GO:0042734)	leucine zipper domain binding (GO:0043522)			NS(1)|breast(2)|cervix(2)|endometrium(2)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)			ACAGTCTCCGTAAGAAGGATG	0.423																																					p.R833R		Atlas-SNP	.											.	ERC1	95	.	0			c.T2499A						PASS	.						75.0	70.0	72.0					12																	1372211		2203	4300	6503	SO:0001819	synonymous_variant	23085	exon14			TCTCCGTAAGAAG	AB015617	CCDS8508.1, CCDS53732.1	12p13.3	2008-02-05	2006-08-14	2006-08-14	ENSG00000082805	ENSG00000082805			17072	protein-coding gene	gene with protein product		607127	"""RAB6 interacting protein 2"""	RAB6IP2		10697956, 11929610	Standard	NM_178040		Approved	ELKS, KIAA1081, CAST2, MGC12974	uc001qjb.2	Q8IUD2	OTTHUMG00000130138	ENST00000397203.2:c.2499T>A	chr12.hg19:g.1372211T>A		80.0	0.0	.		52.0	9.0	.	NM_178040	A2RU77|A7E295|D3DUP7|D3DUP8|Q6NVK2|Q8IUD3|Q8IUD4|Q8IUD5|Q8NAS1|Q9NXN5|Q9UIK7|Q9UPS1	Silent	SNP	ENST00000397203.2	hg19	CCDS8508.1																																																																																			.	.	.	none		0.423	ERC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398380.2	NM_015064	
GALNT6	11226	hgsc.bcm.edu	37	12	51757995	51757995	+	Missense_Mutation	SNP	C	C	G	rs138580901	byFrequency	TCGA-B1-A47O-01A-11D-A25F-10	TCGA-B1-A47O-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca2b9fe2-97e0-4d4f-afd7-a5acf638800f	c023a62c-e498-4e1e-be91-99cf6d7b0708	g.chr12:51757995C>G	ENST00000543196.2	-	5	1164	c.959G>C	c.(958-960)cGa>cCa	p.R320P	GALNT6_ENST00000356317.3_Missense_Mutation_p.R320P			Q8NCL4	GALT6_HUMAN	polypeptide N-acetylgalactosaminyltransferase 6	320					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			endometrium(2)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						AAAGTTGCCTCGGCTATGGAC	0.552																																					p.R320P		Atlas-SNP	.											.	GALNT6	63	.	0			c.G959C						PASS	.						114.0	105.0	108.0					12																	51757995		2203	4300	6503	SO:0001583	missense	11226	exon6			TTGCCTCGGCTAT	Y08565	CCDS8813.1	12q13	2014-03-13	2014-03-13		ENSG00000139629	ENSG00000139629		"""Glycosyltransferase family 2 domain containing"""	4128	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 6"""	605148	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)"""			10464263	Standard	NM_007210		Approved	GalNAc-T6	uc001ryl.1	Q8NCL4		ENST00000543196.2:c.959G>C	chr12.hg19:g.51757995C>G	ENSP00000444171:p.Arg320Pro	307.0	0.0	.		237.0	52.0	.	NM_007210	Q8IYH4|Q9H6G2|Q9UIV5	Missense_Mutation	SNP	ENST00000543196.2	hg19	CCDS8813.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.540572	0.85917	.	.	ENSG00000139629	ENST00000543196;ENST00000356317;ENST00000546163	T;T	0.61040	0.14;0.14	4.59	4.59	0.56863	Glycosyl transferase, family 2 (1);	0.414998	0.27720	N	0.018126	T	0.79930	0.4531	M	0.88105	2.93	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82669	-0.0343	10	0.56958	D	0.05	.	17.3609	0.87350	0.0:1.0:0.0:0.0	.	320	Q8NCL4	GALT6_HUMAN	P	320;320;301	ENSP00000444171:R320P;ENSP00000348668:R320P	ENSP00000348668:R320P	R	-	2	0	GALNT6	50044262	1.000000	0.71417	0.995000	0.50966	0.938000	0.57974	5.811000	0.69187	2.837000	0.97791	0.655000	0.94253	CGA	.	C|1.000;T|0.000	.	alt		0.552	GALNT6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469735.1	NM_007210	
HECTD4	283450	hgsc.bcm.edu	37	12	112605266	112605266	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A47O-01A-11D-A25F-10	TCGA-B1-A47O-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca2b9fe2-97e0-4d4f-afd7-a5acf638800f	c023a62c-e498-4e1e-be91-99cf6d7b0708	g.chr12:112605266C>T	ENST00000430131.2	-	71	12268	c.11123G>A	c.(11122-11124)gGg>gAg	p.G3708E	HECTD4_ENST00000550722.1_Missense_Mutation_p.G3984E|HECTD4_ENST00000377560.5_Missense_Mutation_p.G3958E			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	3708	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										AATTGCAATCCCCAGCAGCTG	0.647																																					p.G3996E		Atlas-SNP	.											.	.	.	.	0			c.G11987A						PASS	.						48.0	55.0	53.0					12																	112605266		1986	4146	6132	SO:0001583	missense	283450	exon72			GCAATCCCCAGCA	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.11123G>A	chr12.hg19:g.112605266C>T	ENSP00000404379:p.Gly3708Glu	93.0	0.0	.		89.0	23.0	.	NM_001109662	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	ENST00000430131.2	hg19		.	.	.	.	.	.	.	.	.	.	C	21.4	4.141592	0.77775	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722;ENST00000547085	T;T;T	0.60920	0.15;0.15;0.15	5.39	5.39	0.77823	HECT (4);	.	.	.	.	T	0.81583	0.4853	M	0.89840	3.065	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85365	0.1110	9	0.87932	D	0	.	19.1437	0.93457	0.0:1.0:0.0:0.0	.	3708	Q9Y4D8	K0614_HUMAN	E	3958;3708;3984;173	ENSP00000366783:G3958E;ENSP00000404379:G3708E;ENSP00000449784:G3984E	ENSP00000366783:G3958E	G	-	2	0	C12orf51	111089649	1.000000	0.71417	0.954000	0.39281	0.354000	0.29330	7.336000	0.79245	2.551000	0.86045	0.491000	0.48974	GGG	.	.	.	none		0.647	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	
TMEM132C	92293	hgsc.bcm.edu	37	12	129180556	129180556	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A47O-01A-11D-A25F-10	TCGA-B1-A47O-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca2b9fe2-97e0-4d4f-afd7-a5acf638800f	c023a62c-e498-4e1e-be91-99cf6d7b0708	g.chr12:129180556G>A	ENST00000435159.2	+	7	1837	c.1837G>A	c.(1837-1839)Gca>Aca	p.A613T	TMEM132C_ENST00000315208.8_Missense_Mutation_p.A229T|TMEM132C_ENST00000537538.1_5'UTR	NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	613						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						TCACCTGGTGGCAGACTTCAT	0.612																																					p.A613T		Atlas-SNP	.											.	TMEM132C	142	.	0			c.G1837A						PASS	.						101.0	96.0	97.0					12																	129180556		692	1591	2283	SO:0001583	missense	92293	exon7			CTGGTGGCAGACT	AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.1837G>A	chr12.hg19:g.129180556G>A	ENSP00000410852:p.Ala613Thr	128.0	0.0	.		128.0	30.0	.	NM_001136103	Q69YX8	Missense_Mutation	SNP	ENST00000435159.2	hg19		.	.	.	.	.	.	.	.	.	.	G	4.967	0.179623	0.09443	.	.	ENSG00000181234	ENST00000435159;ENST00000315208	T;T	0.41758	0.99;0.99	4.62	3.59	0.41128	.	0.302373	0.26646	N	0.023240	T	0.16727	0.0402	N	0.05467	-0.045	0.09310	N	1	B	0.15141	0.012	B	0.12156	0.007	T	0.14337	-1.0476	10	0.13108	T	0.6	.	3.0905	0.06293	0.451:0.0:0.549:0.0	.	613	Q8N3T6	T132C_HUMAN	T	613;229	ENSP00000410852:A613T;ENSP00000324458:A229T	ENSP00000324458:A229T	A	+	1	0	TMEM132C	127746509	0.213000	0.23551	0.729000	0.30791	0.895000	0.52256	1.510000	0.35790	2.102000	0.63906	0.655000	0.94253	GCA	.	.	.	none		0.612	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		XM_044062	
MTUS2	23281	hgsc.bcm.edu	37	13	29675028	29675028	+	Silent	SNP	C	C	T			TCGA-B1-A47O-01A-11D-A25F-10	TCGA-B1-A47O-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca2b9fe2-97e0-4d4f-afd7-a5acf638800f	c023a62c-e498-4e1e-be91-99cf6d7b0708	g.chr13:29675028C>T	ENST00000431530.3	+	3	2653	c.2595C>T	c.(2593-2595)gtC>gtT	p.V865V		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	855	Localization to the growing distal tip of microtubules.|Mediates interaction with MAPRE1.|Sufficient for interaction with KIF2C.					cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						TTGGCTTTGTCCGGAGCTCCA	0.622																																					p.V865V		Atlas-SNP	.											.	MTUS2	279	.	0			c.C2595T						PASS	.						9.0	10.0	10.0					13																	29675028		2018	4165	6183	SO:0001819	synonymous_variant	23281	exon3			CTTTGTCCGGAGC	AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.2595C>T	chr13.hg19:g.29675028C>T		62.0	0.0	.		71.0	18.0	.	NM_001033602	A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Silent	SNP	ENST00000431530.3	hg19	CCDS45022.1																																																																																			.	.	.	none		0.622	MTUS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044336.3	XM_166270	
TRIP4	9325	hgsc.bcm.edu	37	15	64702014	64702014	+	Missense_Mutation	SNP	G	G	C			TCGA-B1-A47O-01A-11D-A25F-10	TCGA-B1-A47O-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca2b9fe2-97e0-4d4f-afd7-a5acf638800f	c023a62c-e498-4e1e-be91-99cf6d7b0708	g.chr15:64702014G>C	ENST00000261884.3	+	7	1090	c.1030G>C	c.(1030-1032)Gag>Cag	p.E344Q		NM_016213.4	NP_057297.2	Q15650	TRIP4_HUMAN	thyroid hormone receptor interactor 4	344					positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	21						TTCACTAGCAGAGTATCATAG	0.433																																					p.E344Q		Atlas-SNP	.											.	TRIP4	43	.	0			c.G1030C						PASS	.						79.0	79.0	79.0					15																	64702014		2203	4300	6503	SO:0001583	missense	9325	exon7			CTAGCAGAGTATC	L40371	CCDS10194.1	15q22.1	2014-02-17			ENSG00000103671	ENSG00000103671		"""-"""	12310	protein-coding gene	gene with protein product	"""zinc finger, C2HC5-type"""	604501				7776974	Standard	NM_016213		Approved	HsT17391, ZC2HC5	uc002anm.3	Q15650	OTTHUMG00000133033	ENST00000261884.3:c.1030G>C	chr15.hg19:g.64702014G>C	ENSP00000261884:p.Glu344Gln	44.0	0.0	.		45.0	15.0	.	NM_016213	B2RAS0|Q96ED7|Q9UKH0	Missense_Mutation	SNP	ENST00000261884.3	hg19	CCDS10194.1	.	.	.	.	.	.	.	.	.	.	G	16.88	3.244397	0.59103	.	.	ENSG00000103671	ENST00000261884	.	.	.	5.81	5.81	0.92471	.	0.138874	0.64402	D	0.000005	T	0.78110	0.4232	M	0.80422	2.495	0.53005	D	0.999961	D	0.67145	0.996	P	0.57846	0.828	T	0.76710	-0.2859	9	0.38643	T	0.18	-24.7936	20.0734	0.97734	0.0:0.0:1.0:0.0	.	344	Q15650	TRIP4_HUMAN	Q	344	.	ENSP00000261884:E344Q	E	+	1	0	TRIP4	62489067	1.000000	0.71417	0.934000	0.37439	0.262000	0.26303	4.870000	0.63035	2.751000	0.94390	0.555000	0.69702	GAG	.	.	.	none		0.433	TRIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256635.2	NM_016213	
DNAH2	146754	hgsc.bcm.edu	37	17	7734797	7734797	+	Silent	SNP	C	C	G			TCGA-B1-A47O-01A-11D-A25F-10	TCGA-B1-A47O-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca2b9fe2-97e0-4d4f-afd7-a5acf638800f	c023a62c-e498-4e1e-be91-99cf6d7b0708	g.chr17:7734797C>G	ENST00000572933.1	+	81	14009	c.12549C>G	c.(12547-12549)tcC>tcG	p.S4183S	DNAH2_ENST00000389173.2_Silent_p.S4183S			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	4183					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TCGACCCCTCCCCCCTCAATG	0.547																																					p.S4183S		Atlas-SNP	.											.	DNAH2	498	.	0			c.C12549G						PASS	.						75.0	69.0	71.0					17																	7734797		2203	4300	6503	SO:0001819	synonymous_variant	146754	exon80			CCCCTCCCCCCTC	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.12549C>G	chr17.hg19:g.7734797C>G		138.0	0.0	.		133.0	33.0	.	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Silent	SNP	ENST00000572933.1	hg19	CCDS32551.1																																																																																			.	.	.	none		0.547	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
PIPOX	51268	hgsc.bcm.edu	37	17	27379969	27379969	+	Missense_Mutation	SNP	G	G	C	rs58011977	byFrequency	TCGA-B1-A47O-01A-11D-A25F-10	TCGA-B1-A47O-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca2b9fe2-97e0-4d4f-afd7-a5acf638800f	c023a62c-e498-4e1e-be91-99cf6d7b0708	g.chr17:27379969G>C	ENST00000323372.4	+	3	621	c.295G>C	c.(295-297)Gag>Cag	p.E99Q	PIPOX_ENST00000583215.1_3'UTR	NM_016518.2	NP_057602.2	Q9P0Z9	SOX_HUMAN	pipecolic acid oxidase	99					L-lysine catabolic process to acetyl-CoA via L-pipecolate (GO:0033514)|oxidation-reduction process (GO:0055114)|tetrahydrofolate metabolic process (GO:0046653)	peroxisome (GO:0005777)	L-pipecolate oxidase activity (GO:0050031)|receptor binding (GO:0005102)|sarcosine oxidase activity (GO:0008115)			endometrium(2)|large_intestine(4)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	10	Lung NSC(42;0.015)		Epithelial(11;9.87e-06)|BRCA - Breast invasive adenocarcinoma(11;3.92e-05)|all cancers(11;5.59e-05)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)		Glycine(DB00145)	GGGAATGAAAGAGAATCAAGA	0.448																																					p.E99Q		Atlas-SNP	.											.	PIPOX	42	.	0			c.G295C						PASS	.						77.0	74.0	75.0					17																	27379969		2203	4300	6503	SO:0001583	missense	51268	exon3			ATGAAAGAGAATC	AF134593	CCDS11248.1	17p13.2	2008-07-18			ENSG00000179761	ENSG00000179761			17804	protein-coding gene	gene with protein product	"""L-pipecolic acid oxidase"""					10772957, 10642506	Standard	NM_016518		Approved	LPIPOX	uc002hdr.1	Q9P0Z9	OTTHUMG00000132679	ENST00000323372.4:c.295G>C	chr17.hg19:g.27379969G>C	ENSP00000317721:p.Glu99Gln	148.0	0.0	.		165.0	22.0	.	NM_016518	B3KNH0|Q96H28|Q9C070	Missense_Mutation	SNP	ENST00000323372.4	hg19	CCDS11248.1	.	.	.	.	.	.	.	.	.	.	G	7.939	0.742323	0.15642	.	.	ENSG00000179761	ENST00000323372;ENST00000419875	D	0.82984	-1.67	5.98	5.98	0.97165	FAD dependent oxidoreductase (1);	0.359343	0.34628	N	0.003812	D	0.84009	0.5378	L	0.46741	1.465	0.20074	N	0.999938	P	0.37594	0.601	P	0.45558	0.485	T	0.77993	-0.2378	10	0.48119	T	0.1	-19.736	17.9305	0.88996	0.0:0.0:1.0:0.0	.	99	Q9P0Z9	SOX_HUMAN	Q	99;30	ENSP00000317721:E99Q	ENSP00000317721:E99Q	E	+	1	0	PIPOX	24404095	0.321000	0.24625	0.962000	0.40283	0.014000	0.08584	2.932000	0.48940	2.837000	0.97791	0.591000	0.81541	GAG	.	G|0.999;A|0.001	.	alt		0.448	PIPOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255954.1	NM_016518	
CETN1	1068	hgsc.bcm.edu	37	18	580595	580595	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A47O-01A-11D-A25F-10	TCGA-B1-A47O-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca2b9fe2-97e0-4d4f-afd7-a5acf638800f	c023a62c-e498-4e1e-be91-99cf6d7b0708	g.chr18:580595G>A	ENST00000327228.3	+	1	229	c.187G>A	c.(187-189)Gaa>Aaa	p.E63K		NM_004066.1	NP_004057.1	Q12798	CETN1_HUMAN	centrin, EF-hand protein, 1	63	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cellular response to heat (GO:0034605)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|photoreceptor connecting cilium (GO:0032391)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|calcium ion binding (GO:0005509)|nucleic acid binding (GO:0003676)	p.E63K(1)		breast(2)|cervix(1)|endometrium(3)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(2)	25						GCTGGGCTTCGAACCCAGGAA	0.552																																					p.E63K		Atlas-SNP	.											CETN1,NS,carcinoma,0,1	CETN1	48	.	1	Substitution - Missense(1)	lung(1)	c.G187A						PASS	.						77.0	59.0	65.0					18																	580595		2203	4300	6503	SO:0001583	missense	1068	exon1			GGCTTCGAACCCA	U03270	CCDS11820.1	18p11.32	2013-01-10			ENSG00000177143	ENSG00000177143		"""EF-hand domain containing"""	1866	protein-coding gene	gene with protein product		603187		CETN		8175926	Standard	NM_004066		Approved	CEN1	uc002kko.1	Q12798	OTTHUMG00000131471	ENST00000327228.3:c.187G>A	chr18.hg19:g.580595G>A	ENSP00000319052:p.Glu63Lys	89.0	0.0	.		83.0	25.0	.	NM_004066	B2R536	Missense_Mutation	SNP	ENST00000327228.3	hg19	CCDS11820.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.301757	0.81136	.	.	ENSG00000177143	ENST00000327228	T	0.37058	1.22	5.2	5.2	0.72013	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.46580	0.1400	N	0.21617	0.685	0.80722	D	1	D	0.76494	0.999	D	0.71870	0.975	T	0.46176	-0.9210	10	0.72032	D	0.01	.	16.6478	0.85181	0.0:0.0:1.0:0.0	.	63	Q12798	CETN1_HUMAN	K	63	ENSP00000319052:E63K	ENSP00000319052:E63K	E	+	1	0	CETN1	570595	1.000000	0.71417	0.887000	0.34795	0.129000	0.20672	4.687000	0.61708	2.882000	0.98803	0.655000	0.94253	GAA	.	.	.	none		0.552	CETN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254314.2	NM_004066	
LPIN2	9663	hgsc.bcm.edu	37	18	2937962	2937962	+	Missense_Mutation	SNP	C	C	A			TCGA-B1-A47O-01A-11D-A25F-10	TCGA-B1-A47O-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca2b9fe2-97e0-4d4f-afd7-a5acf638800f	c023a62c-e498-4e1e-be91-99cf6d7b0708	g.chr18:2937962C>A	ENST00000261596.4	-	7	1134	c.896G>T	c.(895-897)cGg>cTg	p.R299L		NM_014646.2	NP_055461.1	Q92539	LPIN2_HUMAN	lipin 2	299					cellular lipid metabolic process (GO:0044255)|dephosphorylation (GO:0016311)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)|transcription coactivator activity (GO:0003713)			autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	29				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		GGGAATTACCCGAAAATGAGT	0.413																																					p.R299L		Atlas-SNP	.											.	LPIN2	75	.	0			c.G896T						PASS	.						151.0	144.0	146.0					18																	2937962		2203	4300	6503	SO:0001583	missense	9663	exon7			ATTACCCGAAAAT	D87436	CCDS11829.1	18p	2014-09-17			ENSG00000101577	ENSG00000101577			14450	protein-coding gene	gene with protein product		605519				11138012, 9039502	Standard	NM_014646		Approved	KIAA0249	uc002klo.3	Q92539	OTTHUMG00000131508	ENST00000261596.4:c.896G>T	chr18.hg19:g.2937962C>A	ENSP00000261596:p.Arg299Leu	93.0	0.0	.		100.0	4.0	.	NM_014646	A7MD25|D3DUH3	Missense_Mutation	SNP	ENST00000261596.4	hg19	CCDS11829.1	.	.	.	.	.	.	.	.	.	.	C	18.91	3.724085	0.68959	.	.	ENSG00000101577	ENST00000261596	T	0.81330	-1.48	5.86	5.86	0.93980	.	0.160462	0.56097	D	0.000036	T	0.79003	0.4373	M	0.70842	2.15	0.58432	D	0.999999	B	0.18166	0.026	B	0.19391	0.025	T	0.73720	-0.3894	10	0.07482	T	0.82	.	18.367	0.90394	0.0:1.0:0.0:0.0	.	299	Q92539	LPIN2_HUMAN	L	299	ENSP00000261596:R299L	ENSP00000261596:R299L	R	-	2	0	LPIN2	2927962	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.670000	0.74467	2.775000	0.95449	0.655000	0.94253	CGG	.	.	.	none		0.413	LPIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254363.2	NM_014646	
MED29	55588	hgsc.bcm.edu	37	19	39879309	39879309	+	5'Flank	SNP	T	T	C			TCGA-B1-A47O-01A-11D-A25F-10	TCGA-B1-A47O-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca2b9fe2-97e0-4d4f-afd7-a5acf638800f	c023a62c-e498-4e1e-be91-99cf6d7b0708	g.chr19:39879309T>C	ENST00000599213.2	+	0	0				PAF1_ENST00000595564.1_Missense_Mutation_p.M240V|PAF1_ENST00000221265.3_Missense_Mutation_p.M250V|MED29_ENST00000594368.1_5'Flank|PAF1_ENST00000221266.7_Missense_Mutation_p.M217V|MED29_ENST00000315588.5_5'Flank			Q9NX70	MED29_HUMAN	mediator complex subunit 29						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	mediator complex (GO:0016592)|nucleus (GO:0005634)				lung(2)|ovary(1)|pancreas(1)	4	all_cancers(60;7.82e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;1.88e-06)|Ovarian(47;0.0512)		Epithelial(26;1.04e-26)|all cancers(26;7.68e-24)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)			TCCTCATCCATCATGCCCCTG	0.532																																					p.M250V		Atlas-SNP	.											.	PAF1	43	.	0			c.A748G						PASS	.						102.0	88.0	93.0					19																	39879309		2203	4300	6503	SO:0001631	upstream_gene_variant	54623	exon10			CATCCATCATGCC	AL137304, AY729650	CCDS33021.1	19q13.2	2007-07-30	2007-07-30	2007-07-30		ENSG00000063322			23074	protein-coding gene	gene with protein product		612914	"""intersex-like (Drosophila)"""	IXL		15555573	Standard	NM_017592		Approved	DKFZp434H247	uc010xux.3	Q9NX70			chr19.hg19:g.39879309T>C	Exception_encountered	307.0	0.0	.		254.0	46.0	.	NM_019088	B4DNQ6|M0R2E4|Q5XX09|Q9NTF4	Missense_Mutation	SNP	ENST00000599213.2	hg19		.	.	.	.	.	.	.	.	.	.	T	10.70	1.423601	0.25639	.	.	ENSG00000006712	ENST00000221265;ENST00000221266;ENST00000416728	.	.	.	5.25	4.23	0.50019	.	0.151964	0.64402	D	0.000008	T	0.33673	0.0871	N	0.16862	0.45	0.58432	D	0.999997	B;B	0.27316	0.175;0.046	B;B	0.26094	0.058;0.066	T	0.08953	-1.0697	9	0.25751	T	0.34	-19.7403	9.6931	0.40141	0.1554:0.0:0.0:0.8446	.	217;250	F8W9Q2;Q8N7H5	.;PAF1_HUMAN	V	250;217;197	.	ENSP00000221265:M250V	M	-	1	0	PAF1	44571149	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.109000	0.77062	0.989000	0.38761	0.528000	0.53228	ATG	.	.	.	none		0.532	MED29-011	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000470870.1	XM_290829	
SPTBN4	57731	hgsc.bcm.edu	37	19	41063170	41063170	+	Missense_Mutation	SNP	G	G	A	rs556623605		TCGA-B1-A47O-01A-11D-A25F-10	TCGA-B1-A47O-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca2b9fe2-97e0-4d4f-afd7-a5acf638800f	c023a62c-e498-4e1e-be91-99cf6d7b0708	g.chr19:41063170G>A	ENST00000352632.3	+	26	5617	c.5531G>A	c.(5530-5532)cGa>cAa	p.R1844Q	SPTBN4_ENST00000595535.1_Missense_Mutation_p.R1844Q|SPTBN4_ENST00000598249.1_Missense_Mutation_p.R1844Q|SPTBN4_ENST00000392023.1_Missense_Mutation_p.R520Q|SPTBN4_ENST00000338932.3_Missense_Mutation_p.R1844Q|SPTBN4_ENST00000392025.1_Missense_Mutation_p.R587Q			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	1844					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AGTGACGCCCGAGAGCTTCAG	0.662													G|||	1	0.000199681	0.0	0.0	5008	,	,		14986	0.001		0.0	False		,,,				2504	0.0				p.R1844Q		Atlas-SNP	.											.	SPTBN4	213	.	0			c.G5531A						PASS	.						26.0	31.0	29.0					19																	41063170		2202	4299	6501	SO:0001583	missense	57731	exon26			ACGCCCGAGAGCT	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.5531G>A	chr19.hg19:g.41063170G>A	ENSP00000263373:p.Arg1844Gln	84.0	0.0	.		38.0	8.0	.	NM_020971	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	ENST00000352632.3	hg19	CCDS12559.1	.	.	.	.	.	.	.	.	.	.	G	16.63	3.175439	0.57692	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000338932;ENST00000392025;ENST00000392023	T;T;T;T	0.34275	1.37;1.37;1.37;1.37	3.63	3.63	0.41609	.	0.000000	0.56097	D	0.000021	T	0.38026	0.1025	L	0.31752	0.955	0.32656	N	0.518776	P;P;D;D	0.64830	0.694;0.765;0.994;0.99	B;B;P;P	0.61397	0.117;0.149;0.888;0.853	T	0.37572	-0.9700	10	0.23891	T	0.37	.	8.599	0.33734	0.1104:0.0:0.8896:0.0	.	587;520;1844;1844	C9JY79;E9PGQ5;Q9H254;Q71S06	.;.;SPTN4_HUMAN;.	Q	1844;1844;1844;587;520	ENSP00000263373:R1844Q;ENSP00000340345:R1844Q;ENSP00000375879:R587Q;ENSP00000375877:R520Q	ENSP00000340345:R1844Q	R	+	2	0	SPTBN4	45755010	0.001000	0.12720	0.978000	0.43139	0.919000	0.55068	0.856000	0.27818	2.036000	0.60181	0.455000	0.32223	CGA	.	.	.	none		0.662	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2		
HRC	3270	hgsc.bcm.edu	37	19	49657889	49657889	+	Silent	SNP	T	T	C	rs57199624|rs147238387|rs551367394|rs542091249		TCGA-B1-A47O-01A-11D-A25F-10	TCGA-B1-A47O-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca2b9fe2-97e0-4d4f-afd7-a5acf638800f	c023a62c-e498-4e1e-be91-99cf6d7b0708	g.chr19:49657889T>C	ENST00000252825.4	-	1	792	c.606A>G	c.(604-606)gaA>gaG	p.E202E	HRC_ENST00000595625.1_Silent_p.E202E	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	202	4 X tandem repeats, acidic.|6 X approximate tandem repeats.|Glu-rich (acidic).				cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		AGGcctcctcttcctcctcct	0.567																																					p.E202E	Melanoma(37;75 1097 24567 25669 30645)	Atlas-SNP	.											.,1	HRC	85	.	0			c.A606G						PASS	.						122.0	91.0	101.0					19																	49657889		2203	4300	6503	SO:0001819	synonymous_variant	3270	exon1			CTCCTCTTCCTCC		CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.606A>G	chr19.hg19:g.49657889T>C		231.0	2.0	.		227.0	19.0	.	NM_002152	Q504Y6	Silent	SNP	ENST00000252825.4	hg19	CCDS12759.1																																																																																			.	.	.	none		0.567	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465649.1	NM_002152	
NLRP11	204801	hgsc.bcm.edu	37	19	56320200	56320200	+	Missense_Mutation	SNP	C	C	G	rs16986626	byFrequency	TCGA-B1-A47O-01A-11D-A25F-10	TCGA-B1-A47O-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca2b9fe2-97e0-4d4f-afd7-a5acf638800f	c023a62c-e498-4e1e-be91-99cf6d7b0708	g.chr19:56320200C>G	ENST00000589093.1	-	3	1869	c.1776G>C	c.(1774-1776)agG>agC	p.R592S	NLRP11_ENST00000443188.1_Missense_Mutation_p.R592S|NLRP11_ENST00000360133.3_Missense_Mutation_p.R592S|NLRP11_ENST00000592953.1_Missense_Mutation_p.R493S|NLRP11_ENST00000589824.2_Missense_Mutation_p.R592S			P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	592							ATP binding (GO:0005524)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	66		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		ACTTAAGTGTCCTCAGGTGAC	0.408																																					p.R592S		Atlas-SNP	.											.	NLRP11	139	.	0			c.G1776C						PASS	.						130.0	118.0	122.0					19																	56320200		2203	4300	6503	SO:0001583	missense	204801	exon5			AAGTGTCCTCAGG	AY095145	CCDS12935.1, CCDS74458.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179873		"""Nucleotide-binding domain and leucine rich repeat containing"""	22945	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 11"""	609664	"""NACHT, leucine rich repeat and PYD containing 11"""	NALP11		12563287, 12019269	Standard	NM_145007		Approved	PYPAF6, NOD17, PAN10, CLR19.6	uc010ygf.2	P59045		ENST00000589093.1:c.1776G>C	chr19.hg19:g.56320200C>G	ENSP00000466285:p.Arg592Ser	128.0	0.0	.		138.0	31.0	.	NM_145007	C9JSF5|Q2TV85|Q2TV86|Q53ZZ0|Q8NBF5	Missense_Mutation	SNP	ENST00000589093.1	hg19	CCDS12935.1	.	.	.	.	.	.	.	.	.	.	C	9.578	1.122803	0.20959	.	.	ENSG00000179873	ENST00000443188;ENST00000360133	T;T	0.53423	0.62;0.62	2.39	0.0904	0.14463	.	.	.	.	.	T	0.38983	0.1061	L	0.42245	1.32	0.80722	P	0.0	B;B	0.33345	0.286;0.409	B;B	0.40199	0.12;0.322	T	0.47129	-0.9141	8	0.56958	D	0.05	.	3.403	0.07331	0.0:0.5605:0.2737:0.1658	.	592;592	P59045;P59045-2	NAL11_HUMAN;.	S	592	ENSP00000409898:R592S;ENSP00000353251:R592S	ENSP00000353251:R592S	R	-	3	2	NLRP11	61012012	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.018000	0.13422	0.099000	0.17552	0.655000	0.94253	AGG	.	C|0.890;N|0.000	.	alt		0.408	NLRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453657.1	NM_145007	
ASIP	434	hgsc.bcm.edu	37	20	32856797	32856797	+	Splice_Site	SNP	A	A	G	rs538816237		TCGA-B1-A47O-01A-11D-A25F-10	TCGA-B1-A47O-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca2b9fe2-97e0-4d4f-afd7-a5acf638800f	c023a62c-e498-4e1e-be91-99cf6d7b0708	g.chr20:32856797A>G	ENST00000568305.1	+	4	425	c.223A>G	c.(223-225)Aag>Gag	p.K75E	RP4-785G19.5_ENST00000512005.1_RNA|ASIP_ENST00000374954.3_Splice_Site_p.K75E			P42127	ASIP_HUMAN	agouti signaling protein	75	Arg/Lys-rich (basic).				adult feeding behavior (GO:0008343)|cell-cell signaling (GO:0007267)|generation of precursor metabolites and energy (GO:0006091)|genetic imprinting (GO:0071514)|hormone-mediated signaling pathway (GO:0009755)|melanin biosynthetic process (GO:0042438)|melanosome organization (GO:0032438)|melanosome transport (GO:0032402)|regulation of molecular function, epigenetic (GO:0040030)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	receptor binding (GO:0005102)			central_nervous_system(1)|lung(2)	3						TCCCACGCAGAAGGAGGCTTC	0.697													A|||	1	0.000199681	0.0	0.0	5008	,	,		12806	0.001		0.0	False		,,,				2504	0.0				p.K75E		Atlas-SNP	.											.	ASIP	6	.	0			c.A223G						PASS	.						8.0	11.0	10.0					20																	32856797		2188	4282	6470	SO:0001630	splice_region_variant	434	exon3			ACGCAGAAGGAGG		CCDS13232.1	20q11.2-q12	2010-06-24	2010-06-24		ENSG00000101440	ENSG00000101440			745	protein-coding gene	gene with protein product	"""nonagouti homolog (mouse)"""	600201	"""agouti (mouse)-signaling protein"", ""agouti signaling protein, nonagouti homolog (mouse)"""	AGTIL		7937887, 7757071	Standard	NM_001672		Approved	ASP	uc002xah.1	P42127	OTTHUMG00000032289	ENST00000568305.1:c.223-1A>G	chr20.hg19:g.32856797A>G		81.0	0.0	.		39.0	8.0	.	NM_001672	Q3SXL2	Missense_Mutation	SNP	ENST00000568305.1	hg19	CCDS13232.1	.	.	.	.	.	.	.	.	.	.	A	15.14	2.744523	0.49151	.	.	ENSG00000101440	ENST00000374954	T	0.31769	1.48	4.61	4.61	0.57282	.	0.063957	0.64402	D	0.000013	T	0.48660	0.1512	M	0.82323	2.585	0.40299	D	0.978584	P	0.51240	0.943	P	0.54346	0.749	T	0.54970	-0.8213	9	.	.	.	.	10.3603	0.43989	1.0:0.0:0.0:0.0	.	75	P42127	ASIP_HUMAN	E	75	ENSP00000364092:K75E	.	K	+	1	0	ASIP	32320458	1.000000	0.71417	1.000000	0.80357	0.127000	0.20565	3.560000	0.53763	1.942000	0.56320	0.397000	0.26171	AAG	.	.	.	none		0.697	ASIP-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430541.1		Missense_Mutation
KRTAP10-5	386680	hgsc.bcm.edu	37	21	45999772	45999772	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A47O-01A-11D-A25F-10	TCGA-B1-A47O-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca2b9fe2-97e0-4d4f-afd7-a5acf638800f	c023a62c-e498-4e1e-be91-99cf6d7b0708	g.chr21:45999772T>C	ENST00000400372.1	-	1	709	c.684A>G	c.(682-684)atA>atG	p.I228M	TSPEAR_ENST00000323084.4_Intron	NM_198694.2	NP_941967.2	P60370	KR105_HUMAN	keratin associated protein 10-5	228	22 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				endometrium(2)|kidney(1)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	14						CGGGCCTGCATATGGGGCGGC	0.677																																					p.I228M		Atlas-SNP	.											KRTAP10-5,NS,carcinoma,0,2	KRTAP10-5	43	.	0			c.A684G						PASS	.						64.0	74.0	71.0					21																	45999772		2203	4300	6503	SO:0001583	missense	386680	exon1			CCTGCATATGGGG	AJ566384	CCDS42958.1	21q22.3	2007-10-05			ENSG00000241123	ENSG00000241123		"""Keratin associated proteins"""	22969	protein-coding gene	gene with protein product				KRTAP18-5			Standard	NM_198694		Approved	KAP10.5, KAP18.5	uc002zfl.1	P60370	OTTHUMG00000057638	ENST00000400372.1:c.684A>G	chr21.hg19:g.45999772T>C	ENSP00000383223:p.Ile228Met	73.0	1.0	.		62.0	3.0	.	NM_198694	Q0VAR7|Q0VAR8|Q70LJ3	Missense_Mutation	SNP	ENST00000400372.1	hg19	CCDS42958.1	.	.	.	.	.	.	.	.	.	.	t	7.084	0.570758	0.13560	.	.	ENSG00000241123	ENST00000400372	T	0.00724	5.78	3.66	1.72	0.24424	.	.	.	.	.	T	0.00637	0.0021	N	0.08118	0	0.22330	N	0.999199	B	0.29766	0.256	B	0.37989	0.262	T	0.50110	-0.8866	9	0.62326	D	0.03	.	3.7735	0.08650	0.0:0.5592:0.2067:0.2341	.	228	P60370	KR105_HUMAN	M	228	ENSP00000383223:I228M	ENSP00000383223:I228M	I	-	3	3	KRTAP10-5	44824200	.	.	0.988000	0.46212	0.040000	0.13550	.	.	0.301000	0.22738	-0.392000	0.06488	ATA	.	.	.	none		0.677	KRTAP10-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128042.1		
SPECC1L	23384	hgsc.bcm.edu	37	22	24720193	24720193	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A47O-01A-11D-A25F-10	TCGA-B1-A47O-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca2b9fe2-97e0-4d4f-afd7-a5acf638800f	c023a62c-e498-4e1e-be91-99cf6d7b0708	g.chr22:24720193G>T	ENST00000314328.9	+	6	2229	c.1944G>T	c.(1942-1944)gaG>gaT	p.E648D	SPECC1L_ENST00000437398.1_Missense_Mutation_p.E648D|SPECC1L-ADORA2A_ENST00000358654.2_Missense_Mutation_p.E648D|SPECC1L_ENST00000541492.1_Missense_Mutation_p.E648D|SPECC1L_ENST00000416735.1_3'UTR	NM_001254733.1|NM_015330.3	NP_001241662.1|NP_056145	Q69YQ0	CYTSA_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1-like	648					actin cytoskeleton organization (GO:0030036)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|negative regulation of actin filament depolymerization (GO:0030835)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|gap junction (GO:0005921)|microtubule organizing center (GO:0005815)				breast(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(6)|ovary(1)|prostate(1)|skin(3)|stomach(2)|urinary_tract(1)	27						CGTAGGTAGAGGATGAATACC	0.368																																					p.E648D		Atlas-SNP	.											.	SPECC1L	85	.	0			c.G1944T						PASS	.						102.0	105.0	104.0					22																	24720193		2203	4300	6503	SO:0001583	missense	23384	exon5			GGTAGAGGATGAA	AK025531	CCDS33619.1, CCDS58797.1	22q11.23	2012-12-20	2010-09-17	2010-09-17	ENSG00000100014	ENSG00000100014			29022	protein-coding gene	gene with protein product	"""cytokinesis and spindle organization A"", ""cytospin A"""	614140	"""SPECC1-like"""			9205841	Standard	NM_001254733		Approved	KIAA0376, CYTSA	uc002zzv.4	Q69YQ0	OTTHUMG00000171450	ENST00000314328.9:c.1944G>T	chr22.hg19:g.24720193G>T	ENSP00000325785:p.Glu648Asp	80.0	0.0	.		86.0	4.0	.	NM_001145468	B7Z758|F5H1H6|O15081	Missense_Mutation	SNP	ENST00000314328.9	hg19	CCDS33619.1	.	.	.	.	.	.	.	.	.	.	G	12.62	1.992942	0.35131	.	.	ENSG00000100014	ENST00000398280;ENST00000437398;ENST00000421374;ENST00000314328;ENST00000541492	T;T;T;T	0.63580	-0.05;2.47;-0.05;2.95	5.42	-0.409	0.12378	.	0.099964	0.64402	D	0.000002	T	0.44871	0.1314	N	0.25890	0.77	0.39772	D	0.972172	B;B	0.24043	0.096;0.0	B;B	0.24006	0.05;0.001	T	0.27773	-1.0064	10	0.45353	T	0.12	-28.2528	10.7545	0.46228	0.5634:0.0:0.4366:0.0	.	648;648	F5H1H6;Q69YQ0	.;CYTSA_HUMAN	D	676;648;648;648;648	ENSP00000393363:E648D;ENSP00000405671:E648D;ENSP00000325785:E648D;ENSP00000439633:E648D	ENSP00000325785:E648D	E	+	3	2	SPECC1L	23050193	0.999000	0.42202	0.995000	0.50966	0.799000	0.45148	0.721000	0.25911	-0.091000	0.12440	-0.469000	0.05056	GAG	.	.	.	none		0.368	SPECC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319986.2	NM_015330	
SULT1C4	27233	hgsc.bcm.edu	37	2	109003803	109003804	+	Frame_Shift_Ins	INS	-	-	CA			TCGA-B1-A47O-01A-11D-A25F-10	TCGA-B1-A47O-10A-01D-A25F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca2b9fe2-97e0-4d4f-afd7-a5acf638800f	c023a62c-e498-4e1e-be91-99cf6d7b0708	g.chr2:109003803_109003804insCA	ENST00000272452.2	+	7	1150_1151	c.824_825insCA	c.(823-828)ttcaccfs	p.FT275fs	SULT1C4_ENST00000409309.3_Frame_Shift_Ins_p.FT200fs	NM_006588.2	NP_006579.2	O75897	ST1C4_HUMAN	sulfotransferase family, cytosolic, 1C, member 4	275					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|small molecule metabolic process (GO:0044281)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	sulfotransferase activity (GO:0008146)			endometrium(1)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)	12						AAGAAACACTTCACCGTGGCTC	0.431																																					p.F275fs		Atlas-Indel,Pindel	.											.	SULT1C4	41	.	0			c.824_825insCA						PASS	.																																			SO:0001589	frameshift_variant	27233	exon7			.	AF055584	CCDS2077.1	2q12.3	2008-09-04	2007-03-16	2007-03-16	ENSG00000198075	ENSG00000198075		"""Sulfotransferases, cytosolic"""	11457	protein-coding gene	gene with protein product		608357	"""sulfotransferase family, cytosolic, 1C, member 2"""	SULT1C2		10783263, 9852044	Standard	NM_006588		Approved	SULT1C	uc002tea.1	O75897	OTTHUMG00000130958	ENST00000272452.2:c.825_826dupCA	chr2.hg19:g.109003804_109003805dupCA	ENSP00000272452:p.Phe275fs	116.0	0.0	0		124.0	25.0	0.201613	NM_006588	Q069I8|Q08AS5|Q53S63	Frame_Shift_Ins	INS	ENST00000272452.2	hg19	CCDS2077.1																																																																																			.	.	.	none		0.431	SULT1C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253561.1	NM_006588	
