#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SNIP1	79753	hgsc.bcm.edu	37	1	38005993	38005993	+	Missense_Mutation	SNP	C	C	G			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr1:38005993C>G	ENST00000296215.6	-	3	763	c.691G>C	c.(691-693)Gca>Cca	p.A231P	SNIP1_ENST00000468040.1_5'Flank	NM_024700.3	NP_078976.2	Q8TAD8	SNIP1_HUMAN	Smad nuclear interacting protein 1	231					I-kappaB kinase/NF-kappaB signaling (GO:0007249)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(2)|endometrium(1)|large_intestine(3)|lung(15)|ovary(1)|upper_aerodigestive_tract(1)	25		Myeloproliferative disorder(586;0.0393)				TCAAGAAGTGCCCCAGAAAGT	0.502																																					p.A231P		Atlas-SNP	.											.	SNIP1	44	.	0			c.G691C						PASS	.						66.0	69.0	68.0					1																	38005993		2203	4300	6503	SO:0001583	missense	79753	exon3			GAAGTGCCCCAGA		CCDS419.1	1p34.3	2010-07-06			ENSG00000163877	ENSG00000163877			30587	protein-coding gene	gene with protein product		608241				10887155, 15378006	Standard	NM_024700		Approved		uc001cbi.4	Q8TAD8	OTTHUMG00000004225	ENST00000296215.6:c.691G>C	chr1.hg19:g.38005993C>G	ENSP00000296215:p.Ala231Pro	113.0	0.0	.		118.0	63.0	.	NM_024700	Q96SP9|Q9H9T7	Missense_Mutation	SNP	ENST00000296215.6	hg19	CCDS419.1	.	.	.	.	.	.	.	.	.	.	C	32	5.162524	0.94727	.	.	ENSG00000163877	ENST00000296215;ENST00000436196	T	0.51071	0.72	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.73094	0.3543	M	0.87682	2.9	0.80722	D	1	D	0.69078	0.997	D	0.66602	0.945	T	0.72931	-0.4142	10	0.39692	T	0.17	-4.7851	20.1865	0.98220	0.0:1.0:0.0:0.0	.	231	Q8TAD8	SNIP1_HUMAN	P	231;215	ENSP00000296215:A231P	ENSP00000296215:A231P	A	-	1	0	SNIP1	37778580	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.440000	0.80464	2.775000	0.95449	0.655000	0.94253	GCA	.	.	.	none		0.502	SNIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012169.2	NM_024700	
CRTC2	200186	hgsc.bcm.edu	37	1	153926765	153926765	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr1:153926765A>G	ENST00000368633.1	-	4	527	c.400T>C	c.(400-402)Tac>Cac	p.Y134H	CRTC2_ENST00000368630.3_Intron|CRTC2_ENST00000476883.1_5'UTR	NM_181715.2	NP_859066.1	Q53ET0	CRTC2_HUMAN	CREB regulated transcription coactivator 2	134					gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|histone H3-K9 acetylation (GO:0043970)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	cAMP response element binding protein binding (GO:0008140)			NS(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	27	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GGAGATAAGTAGGCAGGACTA	0.512																																					p.Y134H		Atlas-SNP	.											.	CRTC2	58	.	0			c.T400C						PASS	.						61.0	54.0	56.0					1																	153926765		2203	4300	6503	SO:0001583	missense	200186	exon4			ATAAGTAGGCAGG	AY360172	CCDS30875.1	1q21.3	2008-02-05			ENSG00000160741	ENSG00000160741			27301	protein-coding gene	gene with protein product		608972				14506290, 14536081	Standard	NM_181715		Approved	TORC2	uc021pab.1	Q53ET0	OTTHUMG00000037156	ENST00000368633.1:c.400T>C	chr1.hg19:g.153926765A>G	ENSP00000357622:p.Tyr134His	70.0	0.0	.		46.0	16.0	.	NM_181715	Q6UUV8|Q7Z3X7|Q8N332	Missense_Mutation	SNP	ENST00000368633.1	hg19	CCDS30875.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.253357	0.80135	.	.	ENSG00000160741	ENST00000368633	T	0.38240	1.15	4.89	4.89	0.63831	.	0.000000	0.64402	D	0.000001	T	0.26702	0.0653	M	0.66297	2.02	0.40914	D	0.984258	P	0.38020	0.615	B	0.40134	0.32	T	0.16453	-1.0402	10	0.54805	T	0.06	-12.6013	10.82	0.46599	1.0:0.0:0.0:0.0	.	134	Q53ET0	CRTC2_HUMAN	H	134	ENSP00000357622:Y134H	ENSP00000357622:Y134H	Y	-	1	0	CRTC2	152193389	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	6.516000	0.73755	2.065000	0.61736	0.397000	0.26171	TAC	.	.	.	none		0.512	CRTC2-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090272.3	NM_181715	
C1orf27	54953	hgsc.bcm.edu	37	1	186355194	186355194	+	Silent	SNP	T	T	C			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr1:186355194T>C	ENST00000287859.6	+	4	434	c.309T>C	c.(307-309)gaT>gaC	p.D103D	C1orf27_ENST00000432021.3_Silent_p.D103D|C1orf27_ENST00000419367.3_Intron|C1orf27_ENST00000367470.3_Silent_p.D103D	NM_017847.5	NP_060317.3	Q5SWX8	ODR4_HUMAN	chromosome 1 open reading frame 27	103						integral component of membrane (GO:0016021)	oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)	9						TGGCAAATGATTTTCAAAATG	0.289																																					p.D103D		Atlas-SNP	.											.	C1orf27	41	.	0			c.T309C						PASS	.						46.0	44.0	44.0					1																	186355194		1786	4058	5844	SO:0001819	synonymous_variant	54953	exon4			AAATGATTTTCAA	BC003397	CCDS53448.1, CCDS53449.1, CCDS53450.1	1q25	2012-06-25			ENSG00000157181	ENSG00000157181			24299	protein-coding gene	gene with protein product	"""transactivated by recombinant transforming growth factor beta"""	609335				12868032	Standard	NM_017847		Approved	FLJ20505, odr-4, TTG1	uc021pgj.1	Q5SWX8	OTTHUMG00000035579	ENST00000287859.6:c.309T>C	chr1.hg19:g.186355194T>C		117.0	0.0	.		84.0	37.0	.	NM_001164245	B4DNY0|E9PFR7|Q19CC6|Q8WYB6|Q9BTS2|Q9H6A6|Q9NX06	Silent	SNP	ENST00000287859.6	hg19	CCDS53448.1																																																																																			.	.	.	none		0.289	C1orf27-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086352.2	NM_017847	
ERCC3	2071	hgsc.bcm.edu	37	2	128051097	128051097	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr2:128051097G>T	ENST00000285398.2	-	2	320	c.226C>A	c.(226-228)Ctc>Atc	p.L76I	ERCC3_ENST00000493187.2_Missense_Mutation_p.L12I	NM_000122.1	NP_000113.1	P19447	ERCC3_HUMAN	excision repair cross-complementation group 3	76					7-methylguanosine mRNA capping (GO:0006370)|apoptotic process (GO:0006915)|DNA repair (GO:0006281)|DNA topological change (GO:0006265)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA duplex unwinding (GO:0000717)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein localization (GO:0008104)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|response to UV (GO:0009411)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' DNA helicase activity (GO:0043138)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|damaged DNA binding (GO:0003684)|dATP binding (GO:0032564)|DNA binding (GO:0003677)|GTP binding (GO:0005525)|peptide binding (GO:0042277)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	31	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.073)		ACCACCCAGAGGGGCCTGGAG	0.572			"""Mis, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.L76I		Atlas-SNP	.	yes	Rec		Xeroderma pigmentosum (B)	2	2q21	2071	"""excision repair cross-complementing rodent repair deficiency, complementation group 3 (xeroderma pigmentosum group B complementing)"""		E	.	ERCC3	73	.	0			c.C226A						PASS	.						71.0	63.0	66.0					2																	128051097		2203	4300	6503	SO:0001583	missense	2071	exon2	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	CCCAGAGGGGCCT	M31899	CCDS2144.1	2q21	2014-09-17	2014-03-07		ENSG00000163161	ENSG00000163161		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	3435	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group B complementing"""	133510	"""excision repair cross-complementing rodent repair deficiency, complementation group 3"""			8202161	Standard	NM_000122		Approved	XPB, BTF2, RAD25, TFIIH, GTF2H	uc002toh.1	P19447	OTTHUMG00000131530	ENST00000285398.2:c.226C>A	chr2.hg19:g.128051097G>T	ENSP00000285398:p.Leu76Ile	59.0	0.0	.		51.0	18.0	.	NM_000122	Q53QM0	Missense_Mutation	SNP	ENST00000285398.2	hg19	CCDS2144.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.575903	0.86645	.	.	ENSG00000163161	ENST00000285398;ENST00000493187	T;T	0.77877	-1.13;-1.13	4.4	4.4	0.53042	.	0.000000	0.85682	D	0.000000	T	0.76695	0.4023	L	0.39020	1.185	0.80722	D	1	B;P	0.36465	0.177;0.554	P;P	0.45946	0.498;0.498	T	0.75303	-0.3365	10	0.33141	T	0.24	-17.9364	17.1634	0.86809	0.0:0.0:1.0:0.0	.	76;76	A8K359;P19447	.;ERCC3_HUMAN	I	76;12	ENSP00000285398:L76I;ENSP00000444796:L12I	ENSP00000285398:L76I	L	-	1	0	ERCC3	127767567	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	6.997000	0.76270	2.277000	0.76020	0.563000	0.77884	CTC	.	.	.	none		0.572	ERCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331028.1	NM_000122	
CHL1	10752	hgsc.bcm.edu	37	3	383612	383612	+	Missense_Mutation	SNP	C	C	A			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr3:383612C>A	ENST00000256509.2	+	7	1168	c.526C>A	c.(526-528)Caa>Aaa	p.Q176K	CHL1_ENST00000397491.2_Missense_Mutation_p.Q176K	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	578	Glu-rich.|Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		ACACATCGAACAAGATGAAAG	0.378																																					p.Q176K		Atlas-SNP	.											.	CHL1	242	.	0			c.C526A						PASS	.						70.0	64.0	66.0					3																	383612		2203	4300	6503	SO:0001583	missense	10752	exon5			ATCGAACAAGATG	AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.526C>A	chr3.hg19:g.383612C>A	ENSP00000256509:p.Gln176Lys	199.0	0.0	.		190.0	89.0	.	NM_001253388	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000256509.2	hg19	CCDS2556.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.654162	0.88056	.	.	ENSG00000134121	ENST00000256509;ENST00000397491;ENST00000435603	T;T;T	0.60672	1.1;1.1;0.17	5.43	5.43	0.79202	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.74566	0.3733	L	0.61387	1.9	0.80722	D	1	D;D;D	0.71674	0.989;0.98;0.998	P;P;D	0.91635	0.87;0.746;0.999	T	0.76337	-0.2996	10	0.87932	D	0	.	17.7511	0.88434	0.0:1.0:0.0:0.0	.	176;176;176	B3KX75;O00533;O00533-2	.;CHL1_HUMAN;.	K	176	ENSP00000256509:Q176K;ENSP00000380628:Q176K;ENSP00000397445:Q176K	ENSP00000256509:Q176K	Q	+	1	0	CHL1	358612	1.000000	0.71417	0.957000	0.39632	0.774000	0.43823	6.928000	0.75846	2.696000	0.92011	0.591000	0.81541	CAA	.	.	.	none		0.378	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207155.2	NM_006614	
FYCO1	79443	hgsc.bcm.edu	37	3	46000087	46000087	+	Nonsense_Mutation	SNP	G	G	C			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr3:46000087G>C	ENST00000296137.2	-	13	3817	c.3612C>G	c.(3610-3612)taC>taG	p.Y1204*	FYCO1_ENST00000535325.1_Nonsense_Mutation_p.Y1204*|FYCO1_ENST00000438446.1_5'UTR	NM_024513.3	NP_078789.2	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	1204					plus-end-directed vesicle transport along microtubule (GO:0072383)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)			NS(4)|breast(3)|central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(17)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	54				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		TGCAGCAGTAGTAACAGAAGA	0.547																																					p.Y1204X		Atlas-SNP	.											.	FYCO1	115	.	0			c.C3612G						PASS	.						72.0	70.0	71.0					3																	46000087		2203	4300	6503	SO:0001587	stop_gained	79443	exon13			GCAGTAGTAACAG	AJ292348	CCDS2734.1	3p21.3	2008-02-05			ENSG00000163820	ENSG00000163820		"""Zinc fingers, FYVE domain containing"""	14673	protein-coding gene	gene with protein product		607182				11896456	Standard	NM_024513		Approved	FLJ13335, ZFYVE7	uc003cpb.5	Q9BQS8	OTTHUMG00000133447	ENST00000296137.2:c.3612C>G	chr3.hg19:g.46000087G>C	ENSP00000296137:p.Tyr1204*	146.0	0.0	.		117.0	62.0	.	NM_024513	B7ZKT7|Q3MJE6|Q86T41|Q86TB1|Q8TEF9|Q96IV5|Q9H8P9	Nonsense_Mutation	SNP	ENST00000296137.2	hg19	CCDS2734.1	.	.	.	.	.	.	.	.	.	.	G	46	12.162409	0.99642	.	.	ENSG00000163820	ENST00000296137;ENST00000535325	.	.	.	5.74	3.92	0.45320	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-19.7307	10.5363	0.45007	0.1343:0.0:0.8657:0.0	.	.	.	.	X	1204	.	.	Y	-	3	2	FYCO1	45975091	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.280000	0.51677	2.709000	0.92574	0.655000	0.94253	TAC	.	.	.	none		0.547	FYCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257320.2	NM_024513	
CELSR3	1951	hgsc.bcm.edu	37	3	48699894	48699894	+	Silent	SNP	G	G	A			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr3:48699894G>A	ENST00000164024.4	-	1	454	c.174C>T	c.(172-174)ggC>ggT	p.G58G	RP11-148G20.1_ENST00000421275.1_RNA|CELSR3_ENST00000544264.1_Silent_p.G58G	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	58					axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CTAAGGCTCCGCCACCGATAT	0.682																																					p.G58G		Atlas-SNP	.											.	CELSR3	237	.	0			c.C174T						PASS	.						21.0	26.0	25.0					3																	48699894		2117	4162	6279	SO:0001819	synonymous_variant	1951	exon1			GGCTCCGCCACCG	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.174C>T	chr3.hg19:g.48699894G>A		61.0	0.0	.		36.0	17.0	.	NM_001407	O75092	Silent	SNP	ENST00000164024.4	hg19	CCDS2775.1																																																																																			.	.	.	none		0.682	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407	
FRMD4B	23150	hgsc.bcm.edu	37	3	69230503	69230503	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr3:69230503G>A	ENST00000398540.3	-	21	2481	c.2398C>T	c.(2398-2400)Ccg>Tcg	p.P800S	FRMD4B_ENST00000478263.1_Missense_Mutation_p.P452S|FRMD4B_ENST00000542259.1_Missense_Mutation_p.P746S	NM_015123.1	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B	800					establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|ruffle (GO:0001726)				NS(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(3)|skin(2)	19		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)		CTGGAAGACGGTGGCTCCTGA	0.433																																					p.P800S		Atlas-SNP	.											.	FRMD4B	90	.	0			c.C2398T						PASS	.						73.0	72.0	73.0					3																	69230503		1939	4143	6082	SO:0001583	missense	23150	exon21			AAGACGGTGGCTC	AL832231	CCDS46863.1	3p14.2	2006-04-12			ENSG00000114541	ENSG00000114541			24886	protein-coding gene	gene with protein product						10231032, 11445584	Standard	XM_005264720		Approved	KIAA1013, GRSP1	uc003dnv.2	Q9Y2L6	OTTHUMG00000158772	ENST00000398540.3:c.2398C>T	chr3.hg19:g.69230503G>A	ENSP00000381549:p.Pro800Ser	72.0	0.0	.		102.0	6.0	.	NM_015123	Q8TAI3	Missense_Mutation	SNP	ENST00000398540.3	hg19	CCDS46863.1	.	.	.	.	.	.	.	.	.	.	G	13.15	2.152377	0.38021	.	.	ENSG00000114541	ENST00000398540;ENST00000542259;ENST00000478263	D;D	0.86956	-2.19;-2.18	5.83	4.95	0.65309	.	0.224065	0.47455	D	0.000237	D	0.84813	0.5555	M	0.63843	1.955	0.09310	N	1	B;P	0.42203	0.058;0.773	B;B	0.35114	0.022;0.196	T	0.79351	-0.1839	10	0.72032	D	0.01	-1.8047	16.2232	0.82269	0.0:0.0:0.8659:0.1341	.	644;800	B4DHD5;Q9Y2L6	.;FRM4B_HUMAN	S	800;746;452	ENSP00000381549:P800S;ENSP00000437658:P746S	ENSP00000381549:P800S	P	-	1	0	FRMD4B	69313193	0.959000	0.32827	0.066000	0.19879	0.545000	0.35147	2.106000	0.41835	1.441000	0.47550	-0.293000	0.09583	CCG	.	.	.	none		0.433	FRMD4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352111.1		
AFAP1	60312	hgsc.bcm.edu	37	4	7783233	7783233	+	Intron	SNP	G	G	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr4:7783233G>T	ENST00000360265.4	-	12	1765				AFAP1_ENST00000358461.2_Intron|AFAP1_ENST00000420658.1_Missense_Mutation_p.P551H|AFAP1-AS1_ENST00000608442.1_RNA|AFAP1_ENST00000513842.1_5'UTR|AFAP1_ENST00000382543.3_Missense_Mutation_p.P551H			Q8N556	AFAP1_HUMAN	actin filament associated protein 1							cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|skin(4)|stomach(2)	32						TCTGTCAGCAGGAGAGTAGCG	0.532																																					p.P551H		Atlas-SNP	.											.	AFAP1	93	.	0			c.C1652A						PASS	.						123.0	119.0	120.0					4																	7783233		692	1591	2283	SO:0001627	intron_variant	60312	exon13			TCAGCAGGAGAGT	AB209676	CCDS3397.1, CCDS47010.1	4p16	2014-02-12	2007-02-07		ENSG00000196526	ENSG00000196526		"""Pleckstrin homology (PH) domain containing"""	24017	protein-coding gene	gene with protein product		608252				14755689, 11641786, 11607843	Standard	NM_198595		Approved	AFAP-110, AFAP	uc011bwk.1	Q8N556	OTTHUMG00000125515	ENST00000360265.4:c.1531-2630C>A	chr4.hg19:g.7783233G>T		121.0	0.0	.		106.0	40.0	.	NM_001134647	A8K442|B4DMU2|E9PDT7|Q59EY5|Q9HBY1	Missense_Mutation	SNP	ENST00000360265.4	hg19	CCDS3397.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.848151	0.91277	.	.	ENSG00000196526	ENST00000420658;ENST00000382543	T;T	0.16597	2.33;2.33	5.8	5.8	0.92144	.	.	.	.	.	T	0.21427	0.0516	L	0.36672	1.1	0.80722	D	1	D	0.61697	0.99	P	0.45946	0.498	T	0.00287	-1.1846	9	0.45353	T	0.12	.	20.0706	0.97721	0.0:0.0:1.0:0.0	.	551	E9PDT7	.	H	551	ENSP00000410689:P551H;ENSP00000371983:P551H	ENSP00000371983:P551H	P	-	2	0	AFAP1	7834133	1.000000	0.71417	0.588000	0.28705	0.985000	0.73830	7.463000	0.80869	2.744000	0.94065	0.655000	0.94253	CCT	.	.	.	none		0.532	AFAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246842.2	NM_021638	
CTNND2	1501	hgsc.bcm.edu	37	5	10992734	10992734	+	Missense_Mutation	SNP	C	C	T	rs367931998		TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr5:10992734C>T	ENST00000304623.8	-	19	3329	c.3140G>A	c.(3139-3141)cGg>cAg	p.R1047Q	CTNND2_ENST00000503622.1_Missense_Mutation_p.R710Q|CTNND2_ENST00000359640.2_Missense_Mutation_p.R989Q|CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000511377.1_Missense_Mutation_p.R956Q|CTNND2_ENST00000458100.2_Missense_Mutation_p.R614Q	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	1047					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						GGGCCTTTGCCGGTCCCTCTC	0.587																																					p.R1047Q		Atlas-SNP	.											CTNND2,mucosal,malignant_melanoma,0,1	CTNND2	289	.	0			c.G3140A						PASS	.						134.0	120.0	125.0					5																	10992734		2203	4300	6503	SO:0001583	missense	1501	exon19			CTTTGCCGGTCCC	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.3140G>A	chr5.hg19:g.10992734C>T	ENSP00000307134:p.Arg1047Gln	47.0	0.0	.		49.0	25.0	.	NM_001332	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	ENST00000304623.8	hg19	CCDS3881.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.691098	0.88735	.	.	ENSG00000169862	ENST00000304623;ENST00000359640;ENST00000511377;ENST00000538638;ENST00000458100;ENST00000503622	T;T;T;T;T	0.79554	-1.22;-1.28;-1.22;-1.25;-1.25	5.18	4.3	0.51218	.	0.063175	0.64402	D	0.000009	D	0.84497	0.5485	L	0.39245	1.2	0.80722	D	1	D;D;D	0.69078	0.997;0.997;0.993	D;D;P	0.70227	0.968;0.968;0.543	D	0.83914	0.0297	10	0.40728	T	0.16	-11.8165	14.9681	0.71210	0.1441:0.8559:0.0:0.0	.	710;639;1047	B4DRK2;B4DG58;Q9UQB3	.;.;CTND2_HUMAN	Q	1047;989;956;142;614;710	ENSP00000307134:R1047Q;ENSP00000352661:R989Q;ENSP00000426510:R956Q;ENSP00000391155:R614Q;ENSP00000426887:R710Q	ENSP00000307134:R1047Q	R	-	2	0	CTNND2	11045734	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.337000	0.79256	1.159000	0.42565	0.650000	0.86243	CGG	.	.	.	weak		0.587	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332	
RP3-470B24.5	0	hgsc.bcm.edu	37	6	168377288	168377288	+	lincRNA	SNP	T	T	C			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr6:168377288T>C	ENST00000538528.1	-	0	331																											TGGGGGTCATTCCCCCTGCAG	0.642																																					p.G15G		Atlas-SNP	.											.	.	.	.	0			c.A45G						PASS	.						19.0	20.0	20.0					6																	168377288		692	1591	2283			0	exon1			GGTCATTCCCCCT																													chr6.hg19:g.168377288T>C		164.0	0.0	.		129.0	34.0	.	NM_001129895		Silent	SNP	ENST00000538528.1	hg19																																																																																				.	.	.	none		0.642	RP3-470B24.5-201	KNOWN	basic	lincRNA	lincRNA			
MEOX2	4223	hgsc.bcm.edu	37	7	15725797	15725797	+	Silent	SNP	A	A	G	rs113582077	byFrequency	TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr7:15725797A>G	ENST00000262041.5	-	1	640	c.231T>C	c.(229-231)caT>caC	p.H77H	AC005550.5_ENST00000438923.1_lincRNA|AC005550.4_ENST00000442176.1_lincRNA	NM_005924.4	NP_005915.2	P50222	MEOX2_HUMAN	mesenchyme homeobox 2	77	Poly-His.				angiogenesis (GO:0001525)|blood circulation (GO:0008015)|limb development (GO:0060173)|multicellular organismal development (GO:0007275)|neuron death (GO:0070997)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle tissue development (GO:0007519)|somite specification (GO:0001757)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (126;0.0822)		gatggtggtgatggtggtggt	0.617																																					p.H77H	Esophageal Squamous(140;197 1769 16409 18257 29929)	Atlas-SNP	.											MEOX2,rectum,carcinoma,0,2	MEOX2	68	.	0			c.T231C						PASS	.						21.0	22.0	22.0					7																	15725797		2203	4300	6503	SO:0001819	synonymous_variant	4223	exon1			GTGGTGATGGTGG		CCDS34605.1	7p22.1-p21.3	2014-07-15	2005-12-22		ENSG00000106511	ENSG00000106511		"""Homeoboxes / ANTP class : HOXL subclass"""	7014	protein-coding gene	gene with protein product	"""growth arrest-specific homeobox"""	600535	"""mesenchyme homeo box 2 (growth arrest-specific homeo box)"", ""mesenchyme homeobox 2 (growth arrest-specific homeo box)"""	GAX		7713505	Standard	NM_005924		Approved	MOX2	uc003stc.3	P50222	OTTHUMG00000152390	ENST00000262041.5:c.231T>C	chr7.hg19:g.15725797A>G		41.0	0.0	.		69.0	7.0	.	NM_005924	B2R8I7|O75263|Q9UPL6	Silent	SNP	ENST00000262041.5	hg19	CCDS34605.1																																																																																			.	.	.	none		0.617	MEOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326058.2	NM_005924	
MEOX2	4223	hgsc.bcm.edu	37	7	15725800	15725800	+	Silent	SNP	G	G	A	rs113582077	byFrequency	TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr7:15725800G>A	ENST00000262041.5	-	1	637	c.228C>T	c.(226-228)caC>caT	p.H76H	AC005550.5_ENST00000438923.1_lincRNA|AC005550.4_ENST00000442176.1_lincRNA	NM_005924.4	NP_005915.2	P50222	MEOX2_HUMAN	mesenchyme homeobox 2	76	Poly-His.				angiogenesis (GO:0001525)|blood circulation (GO:0008015)|limb development (GO:0060173)|multicellular organismal development (GO:0007275)|neuron death (GO:0070997)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle tissue development (GO:0007519)|somite specification (GO:0001757)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding (GO:0043565)	p.H80delH(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (126;0.0822)		ggtggtgatggtggtggtggt	0.612																																					p.H76H	Esophageal Squamous(140;197 1769 16409 18257 29929)	Atlas-SNP	.											.	MEOX2	68	.	1	Deletion - In frame(1)	stomach(1)	c.C228T						PASS	.						11.0	13.0	13.0					7																	15725800		2192	4293	6485	SO:0001819	synonymous_variant	4223	exon1			GTGATGGTGGTGG		CCDS34605.1	7p22.1-p21.3	2014-07-15	2005-12-22		ENSG00000106511	ENSG00000106511		"""Homeoboxes / ANTP class : HOXL subclass"""	7014	protein-coding gene	gene with protein product	"""growth arrest-specific homeobox"""	600535	"""mesenchyme homeo box 2 (growth arrest-specific homeo box)"", ""mesenchyme homeobox 2 (growth arrest-specific homeo box)"""	GAX		7713505	Standard	NM_005924		Approved	MOX2	uc003stc.3	P50222	OTTHUMG00000152390	ENST00000262041.5:c.228C>T	chr7.hg19:g.15725800G>A		11.0	0.0	.		35.0	9.0	.	NM_005924	B2R8I7|O75263|Q9UPL6	Silent	SNP	ENST00000262041.5	hg19	CCDS34605.1																																																																																			.	.	.	none		0.612	MEOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326058.2	NM_005924	
DFNA5	1687	hgsc.bcm.edu	37	7	24784199	24784199	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr7:24784199A>T	ENST00000342947.3	-	3	811	c.386T>A	c.(385-387)aTc>aAc	p.I129N	DFNA5_ENST00000545231.1_5'UTR|DFNA5_ENST00000409970.1_5'UTR|DFNA5_ENST00000409775.3_Missense_Mutation_p.I129N|DFNA5_ENST00000419307.1_5'UTR	NM_004403.2	NP_004394.1	O60443	DFNA5_HUMAN	deafness, autosomal dominant 5	129					apoptotic process (GO:0006915)|inner ear receptor cell differentiation (GO:0060113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(3)|stomach(1)	19						AGAGTCTCTGATGAGCTGCTG	0.507																																					p.I129N	GBM(78;184 1250 20134 20900 23600)	Atlas-SNP	.											.	DFNA5	51	.	0			c.T386A						PASS	.						119.0	115.0	116.0					7																	24784199		2203	4300	6503	SO:0001583	missense	1687	exon3			TCTCTGATGAGCT	AF007790	CCDS5389.1, CCDS47563.1	7p15	2011-07-01			ENSG00000105928	ENSG00000105928			2810	protein-coding gene	gene with protein product		608798				8589696, 9450185	Standard	NM_004403		Approved	ICERE-1	uc010kus.1	O60443	OTTHUMG00000023237	ENST00000342947.3:c.386T>A	chr7.hg19:g.24784199A>T	ENSP00000339587:p.Ile129Asn	70.0	0.0	.		66.0	12.0	.	NM_001127453	A4D156|B2RAX9|B3KT05|O14590|Q08AQ8|Q9UBV3	Missense_Mutation	SNP	ENST00000342947.3	hg19	CCDS5389.1	.	.	.	.	.	.	.	.	.	.	A	17.33	3.361849	0.61403	.	.	ENSG00000105928	ENST00000342947;ENST00000409775	T;T	0.21932	1.98;1.98	5.59	5.59	0.84812	.	0.432748	0.26662	N	0.023150	T	0.42966	0.1226	M	0.67953	2.075	0.80722	D	1	D;D	0.61080	0.989;0.989	D;D	0.63283	0.913;0.913	T	0.22730	-1.0208	10	0.45353	T	0.12	-8.2661	15.7667	0.78131	1.0:0.0:0.0:0.0	.	129;129	A4FTY0;O60443	.;DFNA5_HUMAN	N	129	ENSP00000339587:I129N;ENSP00000386670:I129N	ENSP00000339587:I129N	I	-	2	0	DFNA5	24750724	1.000000	0.71417	0.742000	0.31022	0.252000	0.25951	5.678000	0.68153	2.138000	0.66242	0.528000	0.53228	ATC	.	.	.	none		0.507	DFNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214060.2	NM_004403	
POR	5447	hgsc.bcm.edu	37	7	75615290	75615290	+	Silent	SNP	T	T	C			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr7:75615290T>C	ENST00000461988.1	+	14	1824	c.1719T>C	c.(1717-1719)gaT>gaC	p.D573D	POR_ENST00000419840.1_Intron|POR_ENST00000450476.1_Silent_p.D472D|TMEM120A_ENST00000338761.4_RNA|TMEM120A_ENST00000493111.2_RNA|POR_ENST00000394893.1_Silent_p.D573D|POR_ENST00000439269.1_Silent_p.D311D|POR_ENST00000545601.1_Silent_p.D381D	NM_000941.2	NP_000932.3	P16435	NCPR_HUMAN	P450 (cytochrome) oxidoreductase	570					carnitine metabolic process (GO:0009437)|cellular organofluorine metabolic process (GO:0090346)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to peptide hormone stimulus (GO:0071375)|demethylation (GO:0070988)|fatty acid oxidation (GO:0019395)|flavonoid metabolic process (GO:0009812)|internal peptidyl-lysine acetylation (GO:0018393)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of lipase activity (GO:0060192)|nitrate catabolic process (GO:0043602)|nitric oxide catabolic process (GO:0046210)|oxidation-reduction process (GO:0055114)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of monooxygenase activity (GO:0032770)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|regulation of growth plate cartilage chondrocyte proliferation (GO:0003420)|response to drug (GO:0042493)|response to nutrient (GO:0007584)	endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|hydrolase activity (GO:0016787)|iron ion binding (GO:0005506)|iron-cytochrome-c reductase activity (GO:0047726)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric oxide dioxygenase activity (GO:0008941)			central_nervous_system(1)|endometrium(2)|kidney(2)|lung(3)|ovary(1)	9					Benzphetamine(DB00865)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Ethylmorphine(DB01466)|Flavin adenine dinucleotide(DB03147)|Lipoic Acid(DB00166)|Mitomycin(DB00305)|Nilutamide(DB00665)|Nitrofurantoin(DB00698)	GCCGCTCGGATGAGGACTACC	0.692																																					p.D573D		Atlas-SNP	.											.	POR	46	.	0			c.T1719C						PASS	.						11.0	17.0	15.0					7																	75615290		1973	4109	6082	SO:0001819	synonymous_variant	5447	exon14			CTCGGATGAGGAC	AF258341	CCDS5579.1	7q11.2	2006-12-05			ENSG00000127948	ENSG00000127948			9208	protein-coding gene	gene with protein product		124015				2516426	Standard	NM_000941		Approved	CYPOR, FLJ26468	uc003udy.3	P16435	OTTHUMG00000130413	ENST00000461988.1:c.1719T>C	chr7.hg19:g.75615290T>C		58.0	0.0	.		81.0	18.0	.	NM_000941	Q16455|Q197M5|Q8N181|Q9H3M8|Q9UDT3	Silent	SNP	ENST00000461988.1	hg19	CCDS5579.1	.	.	.	.	.	.	.	.	.	.	T	6.335	0.429939	0.11987	.	.	ENSG00000127948	ENST00000447222	.	.	.	3.59	-1.16	0.09678	.	.	.	.	.	.	.	.	.	.	.	0.41802	D	0.989923	.	.	.	.	.	.	.	.	.	.	.	.	.	-26.2896	4.2567	0.10721	0.1605:0.2767:0.0:0.5628	.	.	.	.	R	624	.	.	X	+	1	0	POR	75453226	0.000000	0.05858	0.885000	0.34714	0.753000	0.42808	-2.270000	0.01167	-0.213000	0.10094	-0.496000	0.04628	TGA	.	.	.	none		0.692	POR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252796.7	NM_000941	
PTCD1	26024	hgsc.bcm.edu	37	7	99022430	99022430	+	Silent	SNP	G	G	A			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr7:99022430G>A	ENST00000292478.4	-	6	1975	c.1725C>T	c.(1723-1725)ctC>ctT	p.L575L	ATP5J2-PTCD1_ENST00000413834.1_Silent_p.L624L|PTCD1_ENST00000555673.1_Silent_p.L624L	NM_015545.3	NP_056360.2	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	575					tRNA 3'-end processing (GO:0042780)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			endometrium(5)|large_intestine(3)|lung(16)|ovary(2)|skin(1)	27	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			TCATGTCTGTGAGAAGCTGTA	0.612																																					p.L624L		Atlas-SNP	.											.	.	.	.	0			c.C1872T						PASS	.						52.0	53.0	53.0					7																	99022430		2203	4300	6503	SO:0001819	synonymous_variant	100526740	exon7			GTCTGTGAGAAGC	AB014532	CCDS34691.1	7q22.1	2006-01-27				ENSG00000106246			22198	protein-coding gene	gene with protein product		614774					Standard	NM_015545		Approved	KIAA0632		O75127		ENST00000292478.4:c.1725C>T	chr7.hg19:g.99022430G>A		35.0	0.0	.		30.0	9.0	.	NM_001198879	Q3ZB78|Q66K60|Q9UDV2	Silent	SNP	ENST00000292478.4	hg19	CCDS34691.1																																																																																			.	.	.	none		0.612	PTCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336391.1	NM_015545	
CTSB	1508	hgsc.bcm.edu	37	8	11705226	11705226	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr8:11705226G>T	ENST00000353047.6	-	7	891	c.638C>A	c.(637-639)cCt>cAt	p.P213H	CTSB_ENST00000415599.2_3'UTR|RP11-589N15.2_ENST00000602711.1_RNA|CTSB_ENST00000453527.2_Missense_Mutation_p.P213H|CTSB_ENST00000345125.3_Missense_Mutation_p.P213H|CTSB_ENST00000533455.1_Missense_Mutation_p.P213H|CTSB_ENST00000534510.1_Missense_Mutation_p.P213H|CTSB_ENST00000530640.2_Missense_Mutation_p.P213H|CTSB_ENST00000525076.1_5'Flank|CTSB_ENST00000531089.1_Missense_Mutation_p.P213H|CTSB_ENST00000434271.1_Missense_Mutation_p.P213H	NM_001908.3	NP_001899.1	P07858	CATB_HUMAN	cathepsin B	213					cellular response to thyroid hormone stimulus (GO:0097067)|collagen catabolic process (GO:0030574)|decidualization (GO:0046697)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of apoptotic process (GO:0042981)|regulation of catalytic activity (GO:0050790)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|perinuclear region of cytoplasm (GO:0048471)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|peptidase activity (GO:0008233)|proteoglycan binding (GO:0043394)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(1)	16	all_epithelial(15;0.205)		STAD - Stomach adenocarcinoma(15;0.00546)	COAD - Colon adenocarcinoma(149;0.184)		GCTGTAGCCAGGCTCACAGAT	0.647																																					p.P213H		Atlas-SNP	.											.	CTSB	24	.	0			c.C638A						PASS	.						109.0	104.0	105.0					8																	11705226		2203	4300	6503	SO:0001583	missense	1508	exon9			TAGCCAGGCTCAC	M14221	CCDS5986.1	8p23.1	2012-10-02			ENSG00000164733	ENSG00000164733	3.4.22.1	"""Cathepsins"""	2527	protein-coding gene	gene with protein product		116810				8112600, 3463996	Standard	XM_006716244		Approved		uc003wuq.3	P07858	OTTHUMG00000090799	ENST00000353047.6:c.638C>A	chr8.hg19:g.11705226G>T	ENSP00000345672:p.Pro213His	62.0	0.0	.		53.0	24.0	.	NM_147780	B3KQR5|B3KRR5|Q503A6|Q96D87	Missense_Mutation	SNP	ENST00000353047.6	hg19	CCDS5986.1	.	.	.	.	.	.	.	.	.	.	G	14.30	2.493396	0.44352	.	.	ENSG00000164733	ENST00000434271;ENST00000540571;ENST00000353047;ENST00000530640;ENST00000531089;ENST00000453527;ENST00000345125;ENST00000533455;ENST00000534510;ENST00000541328	D;D;D;D;D;D;D;D	0.86865	-2.18;-2.18;-2.18;-2.18;-2.18;-2.18;-2.18;-2.18	5.17	3.16	0.36331	Peptidase C1A, papain C-terminal (2);	0.662303	0.15592	N	0.254378	D	0.90765	0.7101	M	0.76838	2.35	0.45295	D	0.99829	D;P;P;D;D	0.60575	0.988;0.73;0.85;0.988;0.985	P;P;P;P;P	0.56163	0.752;0.512;0.512;0.723;0.793	D	0.90644	0.4577	10	0.52906	T	0.07	.	12.4013	0.55414	0.0:0.0:0.6427:0.3573	.	150;213;119;213;150	B3KUJ8;A8K2H4;B4DMY4;P07858;F5H2P9	.;.;.;CATB_HUMAN;.	H	213;150;213;213;213;213;213;213;213;119	ENSP00000415889:P213H;ENSP00000345672:P213H;ENSP00000435105:P213H;ENSP00000433215:P213H;ENSP00000409917:P213H;ENSP00000342070:P213H;ENSP00000432244:P213H;ENSP00000434217:P213H	ENSP00000342070:P213H	P	-	2	0	CTSB	11742635	0.137000	0.22531	0.501000	0.27601	0.244000	0.25665	2.483000	0.45233	2.397000	0.81536	0.561000	0.74099	CCT	.	.	.	none		0.647	CTSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207586.3	NM_147780	
DCAF4L2	138009	hgsc.bcm.edu	37	8	88885869	88885869	+	Missense_Mutation	SNP	C	C	G			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr8:88885869C>G	ENST00000319675.3	-	1	427	c.331G>C	c.(331-333)Gag>Cag	p.E111Q		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	111										breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						ACCCGGAGCTCAGGGGTCGTC	0.542																																					p.E111Q		Atlas-SNP	.											.	DCAF4L2	187	.	0			c.G331C						PASS	.						138.0	133.0	135.0					8																	88885869		2203	4300	6503	SO:0001583	missense	138009	exon1			GGAGCTCAGGGGT	AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.331G>C	chr8.hg19:g.88885869C>G	ENSP00000316496:p.Glu111Gln	88.0	0.0	.		85.0	32.0	.	NM_152418		Missense_Mutation	SNP	ENST00000319675.3	hg19	CCDS6245.1	.	.	.	.	.	.	.	.	.	.	C	10.06	1.247732	0.22880	.	.	ENSG00000176566	ENST00000319675	T	0.61510	0.1	1.39	0.34	0.15985	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.699660	0.15847	N	0.241732	T	0.38480	0.1042	L	0.29908	0.895	0.09310	N	1	P	0.37330	0.59	B	0.33846	0.171	T	0.22452	-1.0216	10	0.72032	D	0.01	.	6.1683	0.20402	0.3004:0.6996:0.0:0.0	.	111	Q8NA75	DC4L2_HUMAN	Q	111	ENSP00000316496:E111Q	ENSP00000316496:E111Q	E	-	1	0	DCAF4L2	88954985	0.999000	0.42202	0.001000	0.08648	0.010000	0.07245	1.840000	0.39230	-0.115000	0.11915	0.467000	0.42956	GAG	.	.	.	none		0.542	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375302.1	NM_152418	
PHYHIPL	84457	hgsc.bcm.edu	37	10	60936661	60936661	+	Silent	SNP	C	C	A			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr10:60936661C>A	ENST00000373880.4	+	1	312	c.48C>A	c.(46-48)ccC>ccA	p.P16P	PHYHIPL_ENST00000373878.3_5'Flank|PHYHIPL_ENST00000433653.1_Silent_p.P16P	NM_032439.3	NP_115815.2	Q96FC7	PHIPL_HUMAN	phytanoyl-CoA 2-hydroxylase interacting protein-like	16						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)				NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(3)|skin(1)|urinary_tract(1)	18						CCACCAGCCCCTGTGAGGAGG	0.627																																					p.P16P		Atlas-SNP	.											.	PHYHIPL	44	.	0			c.C48A						PASS	.						64.0	58.0	60.0					10																	60936661		2203	4300	6503	SO:0001819	synonymous_variant	84457	exon1			CAGCCCCTGTGAG	AL834339	CCDS7254.1, CCDS44405.1	10q21.1	2013-02-11	2006-01-09		ENSG00000165443	ENSG00000165443		"""Fibronectin type III domain containing"""	29378	protein-coding gene	gene with protein product			"""phytanoyl-CoA hydroxylase interacting protein-like"""			11347906	Standard	NM_032439		Approved	KIAA1796, Em:AC025038.1	uc001jkk.4	Q96FC7	OTTHUMG00000018276	ENST00000373880.4:c.48C>A	chr10.hg19:g.60936661C>A		40.0	0.0	.		46.0	17.0	.	NM_032439	B7WP61|Q68DF3|Q6UXY3|Q8N3W3|Q96JM9|Q96NP7	Silent	SNP	ENST00000373880.4	hg19	CCDS7254.1																																																																																			.	.	.	none		0.627	PHYHIPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048156.1	NM_032439	
MRPL11	65003	hgsc.bcm.edu	37	11	66204727	66204727	+	Missense_Mutation	SNP	C	C	G			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr11:66204727C>G	ENST00000310999.7	-	4	414	c.321G>C	c.(319-321)gaG>gaC	p.E107D	MRPL11_ENST00000329819.4_Missense_Mutation_p.E107D|MRPL11_ENST00000524576.1_5'UTR|MRPL11_ENST00000430466.2_Missense_Mutation_p.E81D	NM_016050.3	NP_057134.1	Q9Y3B7	RM11_HUMAN	mitochondrial ribosomal protein L11	107					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(3)|lung(2)|ovary(1)|prostate(1)	7						GGCCTGCCACCTCTTTCCCTG	0.547																																					p.E107D		Atlas-SNP	.											.	MRPL11	25	.	0			c.G321C						PASS	.						82.0	76.0	78.0					11																	66204727		2200	4295	6495	SO:0001583	missense	65003	exon4			TGCCACCTCTTTC	AB051338	CCDS8139.1, CCDS8140.1, CCDS44655.1	11q13.2	2012-11-14			ENSG00000174547	ENSG00000174547		"""Mitochondrial ribosomal proteins / large subunits"""	14042	protein-coding gene	gene with protein product		611826					Standard	XR_247672		Approved		uc001ohz.4	Q9Y3B7	OTTHUMG00000167097	ENST00000310999.7:c.321G>C	chr11.hg19:g.66204727C>G	ENSP00000308897:p.Glu107Asp	38.0	0.0	.		41.0	22.0	.	NM_170739	A6NLT0|A8K219|Q32P46|Q96Q73	Missense_Mutation	SNP	ENST00000310999.7	hg19	CCDS8139.1	.	.	.	.	.	.	.	.	.	.	C	17.48	3.399495	0.62177	.	.	ENSG00000174547	ENST00000310999;ENST00000430466;ENST00000329819	.	.	.	5.79	1.92	0.25849	Ribosomal protein L11, C-terminal (3);	0.099158	0.64402	D	0.000002	T	0.61123	0.2322	L	0.45352	1.415	0.58432	D	0.999993	D;D;D	0.71674	0.993;0.995;0.998	D;D;D	0.71184	0.953;0.962;0.972	T	0.54649	-0.8262	9	0.27785	T	0.31	-33.3697	7.3258	0.26555	0.0:0.5948:0.0:0.4052	.	81;107;107	Q9Y3B7-2;Q9Y3B7;A6NLT0	.;RM11_HUMAN;.	D	107;81;107	.	ENSP00000308897:E107D	E	-	3	2	MRPL11	65961303	0.998000	0.40836	1.000000	0.80357	0.858000	0.48976	0.534000	0.23098	0.384000	0.24942	-0.123000	0.14984	GAG	.	.	.	none		0.547	MRPL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393098.2	NM_016050	
MTL5	9633	hgsc.bcm.edu	37	11	68518126	68518126	+	Start_Codon_SNP	SNP	C	C	A			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr11:68518126C>A	ENST00000255087.5	-	2	186	c.3G>T	c.(1-3)atG>atT	p.M1I	MTL5_ENST00000544963.1_Start_Codon_SNP_p.M1I|MTL5_ENST00000443940.2_Start_Codon_SNP_p.M1I|MTL5_ENST00000540869.1_5'Flank	NM_004923.3	NP_004914.2	Q9Y4I5	MTL5_HUMAN	metallothionein-like 5, testis-specific (tesmin)	1					cell differentiation (GO:0030154)|cellular metal ion homeostasis (GO:0006875)|multicellular organismal development (GO:0007275)|response to metal ion (GO:0010038)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)	15	Esophageal squamous(3;4.37e-12)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.185)			GGCCCTCCTCCATGGCGCAGG	0.736																																					p.M1I		Atlas-SNP	.											.	MTL5	37	.	0			c.G3T						PASS	.						5.0	6.0	6.0					11																	68518126		2027	3960	5987	SO:0001582	initiator_codon_variant	9633	exon2			CTCCTCCATGGCG	U86074	CCDS8184.1, CCDS44661.1	11q13.2-q13.3	2007-01-03			ENSG00000132749	ENSG00000132749			7446	protein-coding gene	gene with protein product	"""CXC domain containing 2"""	604374				1091092	Standard	XR_428932		Approved	CXCDC2	uc001ooc.3	Q9Y4I5	OTTHUMG00000167891	ENST00000255087.5:c.3G>T	chr11.hg19:g.68518126C>A	ENSP00000255087:p.Met1Ile	33.0	0.0	.		33.0	18.0	.	NM_001039656	A8K8J3|Q4G182|Q6P2E2|Q8NCC8	Missense_Mutation	SNP	ENST00000255087.5	hg19	CCDS8184.1	.	.	.	.	.	.	.	.	.	.	c	16.50	3.140663	0.56936	.	.	ENSG00000132749	ENST00000255087;ENST00000443940;ENST00000544963	T;T;T	0.46063	1.53;0.88;1.47	3.48	3.48	0.39840	.	0.175065	0.27258	U	0.020187	T	0.59280	0.2182	.	.	.	0.80722	D	1	P;P	0.52577	0.954;0.851	D;P	0.63597	0.916;0.775	T	0.63422	-0.6641	9	0.72032	D	0.01	-17.219	10.3557	0.43962	0.0:1.0:0.0:0.0	.	1;1	Q9Y4I5-3;Q9Y4I5	.;MTL5_HUMAN	I	1	ENSP00000255087:M1I;ENSP00000403086:M1I;ENSP00000440968:M1I	ENSP00000255087:M1I	M	-	3	0	MTL5	68274702	1.000000	0.71417	0.976000	0.42696	0.112000	0.19704	1.942000	0.40243	1.792000	0.52537	0.298000	0.19748	ATG	.	.	.	none		0.736	MTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396844.1	NM_004923	Missense_Mutation
SRGAP1	57522	hgsc.bcm.edu	37	12	64377795	64377795	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr12:64377795C>T	ENST00000355086.3	+	2	660	c.136C>T	c.(136-138)Ctc>Ttc	p.L46F	SRGAP1_ENST00000543397.1_Missense_Mutation_p.L6F|SRGAP1_ENST00000357825.3_Missense_Mutation_p.L46F	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	46	F-BAR domain.|FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.				axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		AGTTCAGCTTCTCCAGGATCT	0.428																																					p.L46F		Atlas-SNP	.											.	SRGAP1	146	.	0			c.C136T						PASS	.						105.0	110.0	108.0					12																	64377795		2203	4300	6503	SO:0001583	missense	57522	exon2			CAGCTTCTCCAGG	AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.136C>T	chr12.hg19:g.64377795C>T	ENSP00000347198:p.Leu46Phe	84.0	0.0	.		59.0	24.0	.	NM_020762	Q9H8A3|Q9P2P2	Missense_Mutation	SNP	ENST00000355086.3	hg19	CCDS8967.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.872961	0.91664	.	.	ENSG00000196935	ENST00000355086;ENST00000357825;ENST00000543397	T;T;T	0.24151	1.87;1.87;1.87	5.1	5.1	0.69264	Fps/Fes/Fer/CIP4 homology (3);	0.000000	0.31760	U	0.007120	T	0.53190	0.1781	M	0.74389	2.26	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.85130	0.996;0.994;0.997	T	0.52381	-0.8583	9	.	.	.	.	18.9008	0.92442	0.0:1.0:0.0:0.0	.	46;6;46	Q7Z6B7;G5EA48;Q7Z6B7-2	SRGP1_HUMAN;.;.	F	46;46;6	ENSP00000347198:L46F;ENSP00000350480:L46F;ENSP00000437948:L6F	.	L	+	1	0	SRGAP1	62664062	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	7.755000	0.85180	2.548000	0.85928	0.585000	0.79938	CTC	.	.	.	none		0.428	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400896.1		
ARL1	400	hgsc.bcm.edu	37	12	101799660	101799660	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr12:101799660T>C	ENST00000261636.8	-	2	278	c.104A>G	c.(103-105)tAc>tGc	p.Y35C	ARL1_ENST00000536227.1_Missense_Mutation_p.Y18C|RP11-321F8.4_ENST00000547360.1_lincRNA|ARL1_ENST00000551828.1_Missense_Mutation_p.Y18C|ARL1_ENST00000549302.1_5'UTR|ARL1_ENST00000551688.1_Intron|ARL1_ENST00000539055.1_Intron|ARL1_ENST00000551671.1_Missense_Mutation_p.Y35C	NM_001177.4	NP_001168.1	P40616	ARL1_HUMAN	ADP-ribosylation factor-like 1	35					activation of phospholipase D activity (GO:0031584)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|GTP catabolic process (GO:0006184)|protein localization to Golgi apparatus (GO:0034067)|retrograde transport, endosome to Golgi (GO:0042147)|small GTPase mediated signal transduction (GO:0007264)|toxin metabolic process (GO:0009404)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	enzyme activator activity (GO:0008047)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			central_nervous_system(1)|upper_aerodigestive_tract(1)	2		Lung NSC(355;2.1e-05)|Breast(359;0.00015)|Myeloproliferative disorder(1001;0.163)		GBM - Glioblastoma multiforme(134;1.67e-09)|BRCA - Breast invasive adenocarcinoma(302;0.0125)		TTGTAATCTGTACAAAATTGT	0.368																																					p.Y35C		Atlas-SNP	.											.	ARL1	12	.	0			c.A104G						PASS	.						82.0	73.0	76.0					12																	101799660		1850	4074	5924	SO:0001583	missense	400	exon2			AATCTGTACAAAA	BX537387	CCDS44958.1, CCDS73510.1	12q23.3	2014-05-09						"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	692	protein-coding gene	gene with protein product		603425					Standard	XM_005268869		Approved	ARFL1	uc001tib.3	P40616	OTTHUMG00000170271	ENST00000261636.8:c.104A>G	chr12.hg19:g.101799660T>C	ENSP00000261636:p.Tyr35Cys	123.0	0.0	.		83.0	39.0	.	NM_001177	B4DWW1|P80417|Q53XB1	Missense_Mutation	SNP	ENST00000261636.8	hg19	CCDS44958.1	.	.	.	.	.	.	.	.	.	.	T	26.0	4.691681	0.88735	.	.	ENSG00000120805	ENST00000261636;ENST00000536227;ENST00000551828;ENST00000551671	D;D;D;D	0.82803	-1.65;-1.65;-1.65;-1.65	5.79	5.79	0.91817	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.95069	0.8403	H	0.98818	4.34	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.97048	0.9762	10	0.72032	D	0.01	-8.9448	16.1803	0.81892	0.0:0.0:0.0:1.0	.	35;35	F8VYN9;P40616	.;ARL1_HUMAN	C	35;18;18;35	ENSP00000261636:Y35C;ENSP00000441808:Y18C;ENSP00000448850:Y18C;ENSP00000448912:Y35C	ENSP00000261636:Y35C	Y	-	2	0	ARL1	100323791	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.930000	0.87610	2.229000	0.72834	0.524000	0.50904	TAC	.	.	.	none		0.368	ARL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408246.1	NM_001177	
USP30	84749	hgsc.bcm.edu	37	12	109490532	109490532	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr12:109490532A>T	ENST00000257548.5	+	1	142	c.49A>T	c.(49-51)Atc>Ttc	p.I17F	USP30_ENST00000392784.2_Intron|USP30-AS1_ENST00000478808.2_RNA	NM_032663.3	NP_116052.2	Q70CQ3	UBP30_HUMAN	ubiquitin specific peptidase 30	17					mitochondrial fusion (GO:0008053)|mitochondrion degradation (GO:0000422)|protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(7)|kidney(1)|large_intestine(1)|liver(2)|lung(11)|prostate(1)|skin(3)|stomach(2)	28						CGACAGGGCCATCCAGCGCTT	0.741																																					p.I17F		Atlas-SNP	.											.	USP30	48	.	0			c.A49T						PASS	.						6.0	7.0	7.0					12																	109490532		1633	3539	5172	SO:0001583	missense	84749	exon1			AGGGCCATCCAGC	BC022094	CCDS9123.2	12q23.3	2006-01-20	2005-08-08		ENSG00000135093	ENSG00000135093		"""Ubiquitin-specific peptidases"""	20065	protein-coding gene	gene with protein product		612492	"""ubiquitin specific protease 30"""			12838346	Standard	XM_005253962		Approved	MGC10702, FLJ40511	uc010sxi.2	Q70CQ3	OTTHUMG00000133613	ENST00000257548.5:c.49A>T	chr12.hg19:g.109490532A>T	ENSP00000257548:p.Ile17Phe	72.0	0.0	.		55.0	26.0	.	NM_032663	Q8WTU7|Q96JX4|Q9BSS3	Missense_Mutation	SNP	ENST00000257548.5	hg19	CCDS9123.2	.	.	.	.	.	.	.	.	.	.	A	20.9	4.071460	0.76301	.	.	ENSG00000135093	ENST00000257548;ENST00000536393	T	0.36699	1.24	4.83	-3.67	0.04476	.	0.525534	0.20286	N	0.095347	T	0.17746	0.0426	N	0.14661	0.345	0.36723	D	0.881283	B	0.02656	0.0	B	0.01281	0.0	T	0.03394	-1.1041	10	0.62326	D	0.03	-15.0275	9.4412	0.38670	0.2273:0.6458:0.0:0.1269	.	17	Q70CQ3	UBP30_HUMAN	F	17	ENSP00000257548:I17F	ENSP00000257548:I17F	I	+	1	0	USP30	107974915	0.830000	0.29337	0.983000	0.44433	0.992000	0.81027	-0.415000	0.07106	-0.293000	0.08986	0.482000	0.46254	ATC	.	.	.	none		0.741	USP30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257733.2	NM_032663	
N4BP2L1	90634	hgsc.bcm.edu	37	13	32972588	32972588	+	IGR	SNP	A	A	C			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr13:32972588A>C	ENST00000380130.2	-	0	3046				BRCA2_ENST00000544455.1_Missense_Mutation_p.K3313T|BRCA2_ENST00000380152.3_Missense_Mutation_p.K3313T	NM_052818.2	NP_438169.2	Q5TBK1	N42L1_HUMAN	NEDD4 binding protein 2-like 1											large_intestine(1)|lung(2)|ovary(1)|skin(1)	5		Lung SC(185;0.0262)		all cancers(112;6.3e-06)|Epithelial(112;3.51e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00607)|BRCA - Breast invasive adenocarcinoma(63;0.0171)		ACACCCATAAAGAAAAAAGAA	0.393																																					p.K3313T		Atlas-SNP	.											.	BRCA2	812	.	0			c.A9938C						PASS	.						69.0	72.0	71.0					13																	32972588		2203	4300	6503	SO:0001628	intergenic_variant	675	exon27			CCATAAAGAAAAA	U50527	CCDS9345.2, CCDS41877.1	13q13.1	2008-11-05			ENSG00000139597	ENSG00000139597			25037	protein-coding gene	gene with protein product	"""hypothetical gene CG018"""					8812419	Standard	NM_052818		Approved	CG018	uc001uuc.3	Q5TBK1	OTTHUMG00000016697		chr13.hg19:g.32972588A>C		104.0	0.0	.		125.0	51.0	.	NM_000059	A4QN21|Q5TBK0	Missense_Mutation	SNP	ENST00000380130.2	hg19	CCDS9345.2	.	.	.	.	.	.	.	.	.	.	A	16.59	3.166079	0.57476	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	T;T	0.00816	5.66;5.66	5.19	1.43	0.22495	.	0.585853	0.16656	N	0.205002	T	0.02688	0.0081	L	0.55834	1.745	0.29155	N	0.87815	D	0.71674	0.998	P	0.62560	0.904	T	0.30446	-0.9978	10	0.51188	T	0.08	.	8.9414	0.35731	0.7861:0.0:0.2139:0.0	.	3313	P51587	BRCA2_HUMAN	T	3313	ENSP00000369497:K3313T;ENSP00000439902:K3313T	ENSP00000369497:K3313T	K	+	2	0	BRCA2	31870588	0.216000	0.23585	0.108000	0.21378	0.601000	0.36947	2.044000	0.41241	0.111000	0.17947	0.383000	0.25322	AAG	.	.	.	none		0.393	N4BP2L1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_052818	
SPRY2	10253	hgsc.bcm.edu	37	13	80911824	80911824	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr13:80911824T>C	ENST00000377102.1	-	2	994	c.17A>G	c.(16-18)cAg>cGg	p.Q6R	SPRY2_ENST00000540649.1_Missense_Mutation_p.Q6R|SPRY2_ENST00000377104.3_Missense_Mutation_p.Q6R			O43597	SPY2_HUMAN	sprouty homolog 2 (Drosophila)	6					bud elongation involved in lung branching (GO:0060449)|cell fate commitment (GO:0045165)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment of mitotic spindle orientation (GO:0000132)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inner ear morphogenesis (GO:0042472)|lung growth (GO:0060437)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of Ras GTPase activity (GO:0034261)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|sensory perception of sound (GO:0007605)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase inhibitor activity (GO:0030291)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	12	Medulloblastoma(90;0.18)	Acute lymphoblastic leukemia(28;0.218)|Breast(118;0.244)		GBM - Glioblastoma multiforme(99;0.0318)		GTTGCCACTCTGAGCTCTGGC	0.602																																					p.Q6R		Atlas-SNP	.											.	SPRY2	28	.	0			c.A17G						PASS	.						36.0	39.0	38.0					13																	80911824		2203	4300	6503	SO:0001583	missense	10253	exon2			CCACTCTGAGCTC	AF039843	CCDS9463.1	13q31.1	2008-05-14	2001-11-28		ENSG00000136158	ENSG00000136158			11270	protein-coding gene	gene with protein product		602466	"""sprouty (Drosophila) homolog 2"""			9458049	Standard	NM_005842		Approved	hSPRY2	uc001vlj.3	O43597	OTTHUMG00000017140	ENST00000377102.1:c.17A>G	chr13.hg19:g.80911824T>C	ENSP00000366306:p.Gln6Arg	13.0	0.0	.		32.0	17.0	.	NM_005842	B2R9J9|Q5T6Z7	Missense_Mutation	SNP	ENST00000377102.1	hg19	CCDS9463.1	.	.	.	.	.	.	.	.	.	.	T	18.75	3.690500	0.68271	.	.	ENSG00000136158	ENST00000377104;ENST00000377102;ENST00000541655;ENST00000540649	T;T;T	0.57273	0.41;0.41;0.41	5.2	5.2	0.72013	.	0.258022	0.39687	N	0.001300	T	0.58380	0.2118	M	0.70275	2.135	0.58432	D	0.999996	P	0.51791	0.948	P	0.45610	0.487	T	0.66408	-0.5931	10	0.87932	D	0	2.2461	15.1453	0.72647	0.0:0.0:0.0:1.0	.	6	O43597	SPY2_HUMAN	R	6	ENSP00000366308:Q6R;ENSP00000366306:Q6R;ENSP00000439027:Q6R	ENSP00000366306:Q6R	Q	-	2	0	SPRY2	79809825	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.437000	0.80417	1.989000	0.58080	0.529000	0.55759	CAG	.	.	.	none		0.602	SPRY2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045387.1		
ITPK1	3705	hgsc.bcm.edu	37	14	93408247	93408247	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr14:93408247A>T	ENST00000267615.6	-	11	1077	c.904T>A	c.(904-906)Tac>Aac	p.Y302N	ITPK1_ENST00000556603.2_Missense_Mutation_p.Y302N|ITPK1_ENST00000354313.3_Intron|ITPK1_ENST00000555495.1_Missense_Mutation_p.Y183N			Q13572	ITPK1_HUMAN	inositol-tetrakisphosphate 1-kinase	302	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.				blood coagulation (GO:0007596)|dephosphorylation (GO:0016311)|inositol phosphate metabolic process (GO:0043647)|inositol trisphosphate metabolic process (GO:0032957)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|inositol tetrakisphosphate 1-kinase activity (GO:0047325)|inositol-1,3,4,5,6-pentakisphosphate 1-phosphatase activity (GO:0052825)|inositol-1,3,4,6-tetrakisphosphate 1-phosphatase activity (GO:0052831)|inositol-1,3,4,6-tetrakisphosphate 6-phosphatase activity (GO:0052830)|inositol-1,3,4-trisphosphate 5-kinase activity (GO:0052726)|inositol-1,3,4-trisphosphate 6-kinase activity (GO:0052725)|inositol-3,4,6-trisphosphate 1-kinase activity (GO:0052835)|isomerase activity (GO:0016853)|magnesium ion binding (GO:0000287)			endometrium(1)|large_intestine(3)|lung(6)|ovary(1)	11		all_cancers(154;0.077)|all_epithelial(191;0.247)		Epithelial(152;0.124)|all cancers(159;0.169)		ACGCCCTCGTAGCCTGGGGGT	0.652																																					p.Y302N		Atlas-SNP	.											.	ITPK1	53	.	0			c.T904A						PASS	.						19.0	15.0	17.0					14																	93408247		2087	4121	6208	SO:0001583	missense	3705	exon11			CCTCGTAGCCTGG	U51336	CCDS9907.1, CCDS45157.1	14q32.12	2012-08-16	2011-04-28		ENSG00000100605	ENSG00000100605	2.7.1.134		6177	protein-coding gene	gene with protein product		601838	"""inositol 1,3,4-triphosphate 5/6 kinase"""			8662638, 11042108	Standard	NM_014216		Approved		uc001ybh.3	Q13572	OTTHUMG00000171226	ENST00000267615.6:c.904T>A	chr14.hg19:g.93408247A>T	ENSP00000267615:p.Tyr302Asn	42.0	0.0	.		31.0	18.0	.	NM_001142593	Q9BTL6|Q9H2E7	Missense_Mutation	SNP	ENST00000267615.6	hg19	CCDS9907.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.272145	0.80469	.	.	ENSG00000100605	ENST00000405174;ENST00000556603;ENST00000555495;ENST00000267615;ENST00000311458	.	.	.	4.59	4.59	0.56863	ATP-grasp fold (1);ATP-grasp fold, subdomain 2 (1);	0.000000	0.85682	D	0.000000	T	0.79764	0.4502	M	0.84082	2.675	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.83445	0.0045	9	0.87932	D	0	-1.445	13.993	0.64378	1.0:0.0:0.0:0.0	.	302	Q13572	ITPK1_HUMAN	N	332;302;183;302;302	.	ENSP00000267615:Y302N	Y	-	1	0	ITPK1	92478000	1.000000	0.71417	1.000000	0.80357	0.840000	0.47671	8.912000	0.92726	1.717000	0.51406	0.460000	0.39030	TAC	.	.	.	none		0.652	ITPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412421.2	NM_014216	
WDR20	91833	hgsc.bcm.edu	37	14	102675840	102675840	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr14:102675840A>G	ENST00000342702.3	+	3	1364	c.1333A>G	c.(1333-1335)Agc>Ggc	p.S445G	WDR20_ENST00000424963.2_Missense_Mutation_p.S321G|WDR20_ENST00000499851.2_Missense_Mutation_p.S188G|WDR20_ENST00000454394.2_Missense_Mutation_p.S476G|WDR20_ENST00000299135.6_3'UTR|WDR20_ENST00000556807.1_Missense_Mutation_p.S384G|WDR20_ENST00000556511.2_Missense_Mutation_p.S384G|WDR20_ENST00000322340.5_Intron|WDR20_ENST00000335263.5_Missense_Mutation_p.S445G|WDR20_ENST00000545563.1_Missense_Mutation_p.S272G	NM_001242418.1|NM_144574.3	NP_001229347.1|NP_653175.2	Q8TBZ3	WDR20_HUMAN	WD repeat domain 20	445										breast(1)|large_intestine(2)|lung(4)|prostate(1)	8						AAATGCTGGCAGCAAAAGCAG	0.532											OREG0022939	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S476G		Atlas-SNP	.											.	WDR20	35	.	0			c.A1426G						PASS	.						101.0	103.0	102.0					14																	102675840		2203	4300	6503	SO:0001583	missense	91833	exon4			GCTGGCAGCAAAA	BC028387	CCDS9968.1, CCDS9969.1, CCDS9970.1, CCDS55942.1, CCDS55943.1, CCDS55944.1, CCDS55945.1	14q32.31	2013-01-09				ENSG00000140153		"""WD repeat domain containing"""	19667	protein-coding gene	gene with protein product							Standard	NM_181291		Approved	DMR, MGC33177, FLJ33659	uc010txu.2	Q8TBZ3		ENST00000342702.3:c.1333A>G	chr14.hg19:g.102675840A>G	ENSP00000341037:p.Ser445Gly	78.0	0.0	.	1368	73.0	31.0	.	NM_001242417	B4DN18|E7EUY8|F8W9S4|G3V2F8|G3V5R0|H0YJJ1|Q86TU2|Q8NCN7|Q8WXX2|Q9UF86	Missense_Mutation	SNP	ENST00000342702.3	hg19	CCDS9969.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	6.709|6.709	0.499566|0.499566	0.12762|0.12762	.|.	.|.	ENSG00000140153|ENSG00000140153	ENST00000556511|ENST00000335263;ENST00000299135;ENST00000424963;ENST00000342702;ENST00000556807;ENST00000499851;ENST00000454394;ENST00000401892;ENST00000545563	.|T;T;T;T;T;T;T	.|0.67698	.|-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28	5.73|5.73	5.73|5.73	0.89815|0.89815	.|.	.|0.162599	.|0.64402	.|D	.|0.000002	T|T	0.56277|0.56277	0.1974|0.1974	L|L	0.32530|0.32530	0.975|0.975	0.80722|0.80722	D|D	1|1	.|B;B;B;B;B;B;B	.|0.24882	.|0.001;0.113;0.001;0.0;0.0;0.043;0.0	.|B;B;B;B;B;B;B	.|0.24006	.|0.001;0.05;0.001;0.0;0.002;0.027;0.002	T|T	0.52087|0.52087	-0.8622|-0.8622	5|10	.|0.19590	.|T	.|0.45	.|.	16.0225|16.0225	0.80509|0.80509	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|476;457;384;445;384;321;445	.|E7EUY8;Q5JPH5;G3V2F8;Q8TBZ3-2;F8W9S4;B3KR43;Q8TBZ3	.|.;.;.;.;.;.;WDR20_HUMAN	R|G	375|445;384;321;445;384;188;476;375;272	.|ENSP00000335434:S445G;ENSP00000395793:S321G;ENSP00000341037:S445G;ENSP00000450636:S384G;ENSP00000443641:S188G;ENSP00000406084:S476G;ENSP00000437927:S272G	.|ENSP00000299135:S384G	Q|S	+|+	2|1	0|0	WDR20|WDR20	101745593|101745593	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.951000|0.951000	0.60555|0.60555	7.099000|7.099000	0.76981|0.76981	2.198000|2.198000	0.70561|0.70561	0.533000|0.533000	0.62120|0.62120	CAG|AGC	.	.	.	none		0.532	WDR20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414963.1	NM_181291	
GLCE	26035	hgsc.bcm.edu	37	15	69548696	69548696	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr15:69548696T>C	ENST00000261858.2	+	3	779	c.551T>C	c.(550-552)gTc>gCc	p.V184A	GLCE_ENST00000559420.2_Missense_Mutation_p.V120A	NM_015554.1	NP_056369.1	O94923	GLCE_HUMAN	glucuronic acid epimerase	184					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|small molecule metabolic process (GO:0044281)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	heparosan-N-sulfate-glucuronate 5-epimerase activity (GO:0047464)|racemase and epimerase activity, acting on carbohydrates and derivatives (GO:0016857)|UDP-glucuronate 5'-epimerase activity (GO:0050379)			NS(1)|breast(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	18						AATGTGGAAGTCCGAGACAGA	0.428																																					p.V184A		Atlas-SNP	.											.	GLCE	48	.	0			c.T551C						PASS	.						101.0	101.0	101.0					15																	69548696		2200	4297	6497	SO:0001583	missense	26035	exon3			TGGAAGTCCGAGA	AB020643	CCDS32277.1	15q23	2007-01-30	2007-01-30			ENSG00000138604	5.1.3.12		17855	protein-coding gene	gene with protein product	"""heparan sulfate epimerase"""	612134	"""D-glucuronyl C5-epimerase"", ""UDP-glucuronic acid epimerase"""			15853773	Standard	NM_015554		Approved	KIAA0836, HSEPI	uc002ary.1	O94923		ENST00000261858.2:c.551T>C	chr15.hg19:g.69548696T>C	ENSP00000261858:p.Val184Ala	58.0	0.0	.		46.0	16.0	.	NM_015554	Q6GUQ2	Missense_Mutation	SNP	ENST00000261858.2	hg19	CCDS32277.1	.	.	.	.	.	.	.	.	.	.	T	16.89	3.246289	0.59103	.	.	ENSG00000138604	ENST00000261858	T	0.30714	1.52	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.36880	0.0983	M	0.79475	2.455	0.80722	D	1	B	0.22080	0.064	B	0.17722	0.019	T	0.20207	-1.0282	10	0.41790	T	0.15	-8.6789	14.1808	0.65574	0.0:0.0:0.0:1.0	.	184	O94923	GLCE_HUMAN	A	184	ENSP00000261858:V184A	ENSP00000261858:V184A	V	+	2	0	GLCE	67335750	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.831000	0.86748	2.084000	0.62774	0.533000	0.62120	GTC	.	.	.	none		0.428	GLCE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_015554	
MYO9A	4649	hgsc.bcm.edu	37	15	72190184	72190184	+	Missense_Mutation	SNP	C	C	G			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr15:72190184C>G	ENST00000356056.5	-	25	5132	c.4660G>C	c.(4660-4662)Gta>Cta	p.V1554L	MYO9A_ENST00000566885.1_Missense_Mutation_p.V1174L|MYO9A_ENST00000444904.1_Missense_Mutation_p.V1535L|MYO9A_ENST00000424560.1_Missense_Mutation_p.V1554L|MYO9A_ENST00000564571.1_Missense_Mutation_p.V1554L|MYO9A_ENST00000563542.1_5'UTR	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	1554	Tail.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						GGCCTCTCTACTCTTTGCTTT	0.423																																					p.V1554L		Atlas-SNP	.											.	MYO9A	203	.	0			c.G4660C						PASS	.						76.0	66.0	70.0					15																	72190184		2199	4297	6496	SO:0001583	missense	4649	exon25			TCTCTACTCTTTG	AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.4660G>C	chr15.hg19:g.72190184C>G	ENSP00000348349:p.Val1554Leu	76.0	0.0	.		93.0	42.0	.	NM_006901	B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Missense_Mutation	SNP	ENST00000356056.5	hg19	CCDS10239.1	.	.	.	.	.	.	.	.	.	.	C	10.20	1.285329	0.23478	.	.	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000444904	D;D;D	0.83992	-1.79;-1.79;-1.79	5.92	1.58	0.23477	.	.	.	.	.	T	0.66597	0.2805	L	0.27053	0.805	0.09310	N	1	B;B;B	0.12013	0.001;0.005;0.001	B;B;B	0.08055	0.002;0.003;0.001	T	0.50583	-0.8811	9	0.30078	T	0.28	.	0.594	0.00733	0.2435:0.3197:0.1226:0.3143	.	1535;1554;1554	B2RTY4-2;B2RTY4-4;B2RTY4	.;.;MYO9A_HUMAN	L	1554;1554;1535	ENSP00000348349:V1554L;ENSP00000399162:V1554L;ENSP00000398250:V1535L	ENSP00000348349:V1554L	V	-	1	0	MYO9A	69977238	0.001000	0.12720	0.003000	0.11579	0.983000	0.72400	0.281000	0.18810	0.024000	0.15214	0.650000	0.86243	GTA	.	.	.	none		0.423	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257308.1	NM_006901	
TMEM202	338949	hgsc.bcm.edu	37	15	72698982	72698982	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr15:72698982T>A	ENST00000341689.3	+	3	431	c.377T>A	c.(376-378)gTc>gAc	p.V126D	TMEM202_ENST00000567679.1_Missense_Mutation_p.S41T	NM_001080462.1	NP_001073931.1	A6NGA9	TM202_HUMAN	transmembrane protein 202	126						integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	18						CTCATCTCTGTCTTTACCATA	0.468																																					p.V126D		Atlas-SNP	.											.	TMEM202	40	.	0			c.T377A						PASS	.						180.0	160.0	167.0					15																	72698982		2199	4297	6496	SO:0001583	missense	338949	exon3			TCTCTGTCTTTAC		CCDS32287.1	15q24.1	2007-12-18				ENSG00000187806			33733	protein-coding gene	gene with protein product							Standard	NM_001080462		Approved	FLJ27523	uc002auq.3	A6NGA9		ENST00000341689.3:c.377T>A	chr15.hg19:g.72698982T>A	ENSP00000340212:p.Val126Asp	124.0	0.0	.		115.0	55.0	.	NM_001080462		Missense_Mutation	SNP	ENST00000341689.3	hg19	CCDS32287.1	.	.	.	.	.	.	.	.	.	.	T	12.61	1.990387	0.35131	.	.	ENSG00000187806	ENST00000341689	T	0.66815	-0.23	5.42	1.84	0.25277	.	1.663070	0.03249	N	0.181492	T	0.71459	0.3342	L	0.53249	1.67	0.09310	N	1	P	0.47191	0.891	P	0.51355	0.667	T	0.54214	-0.8327	10	0.87932	D	0	-26.7102	6.0845	0.19960	0.0:0.3095:0.0:0.6905	.	126	A6NGA9	TM202_HUMAN	D	126	ENSP00000340212:V126D	ENSP00000340212:V126D	V	+	2	0	TMEM202	70486036	0.002000	0.14202	0.000000	0.03702	0.006000	0.05464	0.033000	0.13754	0.514000	0.28300	0.533000	0.62120	GTC	.	.	.	none		0.468	TMEM202-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435756.1	NM_001080462	
SCAMP5	192683	hgsc.bcm.edu	37	15	75309011	75309011	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr15:75309011G>T	ENST00000361900.6	+	5	421	c.214G>T	c.(214-216)Ggc>Tgc	p.G72C	SCAMP5_ENST00000545456.1_Intron|SCAMP5_ENST00000565923.1_3'UTR|SCAMP5_ENST00000562212.1_Missense_Mutation_p.G72C|SCAMP5_ENST00000425597.3_Missense_Mutation_p.G72C|SCAMP5_ENST00000568081.1_5'Flank	NM_001178111.1	NP_001171582.1	Q8TAC9	SCAM5_HUMAN	secretory carrier membrane protein 5	72					exocytosis (GO:0006887)|negative regulation of endocytosis (GO:0045806)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|positive regulation of cytokine secretion (GO:0050715)|protein transport (GO:0015031)|response to endoplasmic reticulum stress (GO:0034976)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|synapse (GO:0045202)|trans-Golgi network membrane (GO:0032588)				large_intestine(1)|lung(1)|ovary(1)|urinary_tract(2)	5						CACCAACTTTGGCCTCGCCTT	0.602																																					p.G72C		Atlas-SNP	.											.	SCAMP5	34	.	0			c.G214T						PASS	.						138.0	140.0	139.0					15																	75309011		2150	4256	6406	SO:0001583	missense	192683	exon5			AACTTTGGCCTCG	AL833230	CCDS45306.1	15q24.2	2014-05-20			ENSG00000198794	ENSG00000198794		"""Secretory carrier membrane proteins"""	30386	protein-coding gene	gene with protein product		613766				12477932	Standard	NM_001178111		Approved	MGC24969	uc002azk.2	Q8TAC9	OTTHUMG00000172704	ENST00000361900.6:c.214G>T	chr15.hg19:g.75309011G>T	ENSP00000355387:p.Gly72Cys	47.0	0.0	.		39.0	17.0	.	NM_001178111	B3KPJ7|B7Z762|D3DW71|Q8N3M4	Missense_Mutation	SNP	ENST00000361900.6	hg19	CCDS45306.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.024083	0.93462	.	.	ENSG00000198794	ENST00000361900;ENST00000425597	T;T	0.20332	2.08;2.08	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.56381	0.1981	M	0.90977	3.165	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.68194	-0.5473	10	0.87932	D	0	-0.2016	17.294	0.87164	0.0:0.0:1.0:0.0	.	72;72	Q8TAC9-2;Q8TAC9	.;SCAM5_HUMAN	C	72	ENSP00000355387:G72C;ENSP00000406547:G72C	ENSP00000355387:G72C	G	+	1	0	SCAMP5	73096064	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.690000	0.98676	2.391000	0.81399	0.561000	0.74099	GGC	.	.	.	none		0.602	SCAMP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420015.2	NM_138967	
LCAT	3931	hgsc.bcm.edu	37	16	67976796	67976796	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr16:67976796G>T	ENST00000264005.5	-	3	424	c.395C>A	c.(394-396)tCt>tAt	p.S132Y	CTC-479C5.17_ENST00000590594.1_lincRNA	NM_000229.1	NP_000220.1	P04180	LCAT_HUMAN	lecithin-cholesterol acyltransferase	132					cholesterol esterification (GO:0034435)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|high-density lipoprotein particle remodeling (GO:0034375)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein metabolic process (GO:0042157)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|regulation of high-density lipoprotein particle assembly (GO:0090107)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|very-low-density lipoprotein particle remodeling (GO:0034372)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)	apolipoprotein A-I binding (GO:0034186)|phosphatidylcholine-sterol O-acyltransferase activity (GO:0004607)			cervix(4)|endometrium(4)|large_intestine(1)|lung(6)|ovary(1)	16		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00418)|Epithelial(162;0.0183)|all cancers(182;0.12)		GTACTCCACAGAGTAGGTCTT	0.662																																					p.S132Y		Atlas-SNP	.											.	LCAT	31	.	0			c.C395A						PASS	.						62.0	68.0	66.0					16																	67976796		2198	4300	6498	SO:0001583	missense	3931	exon3			TCCACAGAGTAGG		CCDS10854.1	16q22.1	2012-10-02			ENSG00000213398	ENSG00000213398	2.3.1.43		6522	protein-coding gene	gene with protein product		606967					Standard	NM_000229		Approved		uc002euy.1	P04180	OTTHUMG00000137551	ENST00000264005.5:c.395C>A	chr16.hg19:g.67976796G>T	ENSP00000264005:p.Ser132Tyr	40.0	0.0	.		29.0	12.0	.	NM_000229	Q53XQ3	Missense_Mutation	SNP	ENST00000264005.5	hg19	CCDS10854.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.685825	0.88639	.	.	ENSG00000213398	ENST00000264005	D	0.97161	-4.27	5.98	5.98	0.97165	.	0.138327	0.49916	U	0.000130	D	0.98573	0.9523	M	0.91920	3.255	0.46654	D	0.999148	D	0.52996	0.957	P	0.59171	0.853	D	0.99257	1.0889	10	0.87932	D	0	-13.366	18.0148	0.89236	0.0:0.0:1.0:0.0	.	132	P04180	LCAT_HUMAN	Y	132	ENSP00000264005:S132Y	ENSP00000264005:S132Y	S	-	2	0	LCAT	66534297	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.289000	0.96061	2.861000	0.98227	0.650000	0.86243	TCT	.	.	.	none		0.662	LCAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268885.3		
TMEM104	54868	hgsc.bcm.edu	37	17	72781730	72781730	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr17:72781730T>A	ENST00000335464.5	+	3	317	c.155T>A	c.(154-156)cTg>cAg	p.L52Q	TMEM104_ENST00000582330.1_Missense_Mutation_p.L52Q|TMEM104_ENST00000582773.1_Missense_Mutation_p.L52Q|TMEM104_ENST00000417024.2_Intron	NM_017728.3	NP_060198.3	Q8NE00	TM104_HUMAN	transmembrane protein 104	52						integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(5)|ovary(1)	19	all_lung(278;0.23)					CTGGTGTTCCTGGGCTTCATG	0.632																																					p.L52Q		Atlas-SNP	.											.	TMEM104	49	.	0			c.T155A						PASS	.						76.0	56.0	63.0					17																	72781730		2203	4300	6503	SO:0001583	missense	54868	exon3			TGTTCCTGGGCTT	AK074029	CCDS32723.1	17q25.1	2005-12-19				ENSG00000109066			25984	protein-coding gene	gene with protein product							Standard	NM_017728		Approved	FLJ20255, FLJ00021	uc002jls.4	Q8NE00		ENST00000335464.5:c.155T>A	chr17.hg19:g.72781730T>A	ENSP00000334849:p.Leu52Gln	52.0	0.0	.		60.0	34.0	.	NM_017728	Q8TEU1|Q9NT56|Q9NXH1	Missense_Mutation	SNP	ENST00000335464.5	hg19	CCDS32723.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.482735	0.84747	.	.	ENSG00000109066	ENST00000335464	T	0.02498	4.27	4.98	4.98	0.66077	.	0.074254	0.53938	D	0.000043	T	0.16769	0.0403	M	0.84585	2.705	0.80722	D	1	D;D	0.76494	0.966;0.999	P;D	0.71656	0.869;0.974	T	0.00624	-1.1639	10	0.72032	D	0.01	-10.1576	14.642	0.68732	0.0:0.0:0.0:1.0	.	52;52	Q8NE00-2;Q8NE00	.;TM104_HUMAN	Q	52	ENSP00000334849:L52Q	ENSP00000334849:L52Q	L	+	2	0	TMEM104	70293325	1.000000	0.71417	1.000000	0.80357	0.785000	0.44390	7.568000	0.82369	1.872000	0.54250	0.260000	0.18958	CTG	.	.	.	none		0.632	TMEM104-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444442.1	NM_017728	
ACER1	125981	hgsc.bcm.edu	37	19	6312214	6312214	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr19:6312214C>T	ENST00000301452.4	-	3	373	c.296G>A	c.(295-297)gGc>gAc	p.G99D		NM_133492.2	NP_597999.1	Q8TDN7	ACER1_HUMAN	alkaline ceramidase 1	99					cell differentiation (GO:0030154)|cellular response to calcium ion (GO:0071277)|ceramide catabolic process (GO:0046514)|epidermis development (GO:0008544)|keratinocyte differentiation (GO:0030216)|regulation of lipid metabolic process (GO:0019216)|response to alkaline pH (GO:0010446)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ceramidase activity (GO:0017040)|dihydroceramidase activity (GO:0071633)			NS(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(4)|pancreas(1)	15						TATGCTATAGCCACTGCCCAG	0.607																																					p.G99D		Atlas-SNP	.											.	ACER1	38	.	0			c.G296A						PASS	.						59.0	51.0	54.0					19																	6312214		2203	4300	6503	SO:0001583	missense	125981	exon3			CTATAGCCACTGC	AF347024	CCDS12161.1	19p13.3	2013-01-25	2008-12-19	2008-12-19	ENSG00000167769	ENSG00000167769	3.5.1.23	"""Alkaline ceramidase"""	18356	protein-coding gene	gene with protein product		613491	"""N-acylsphingosine amidohydrolase (alkaline ceramidase) 3"""	ASAH3		12783875	Standard	NM_133492		Approved		uc002mel.2	Q8TDN7		ENST00000301452.4:c.296G>A	chr19.hg19:g.6312214C>T	ENSP00000301452:p.Gly99Asp	87.0	0.0	.		68.0	24.0	.	NM_133492		Missense_Mutation	SNP	ENST00000301452.4	hg19	CCDS12161.1	.	.	.	.	.	.	.	.	.	.	C	8.699	0.909265	0.17833	.	.	ENSG00000167769	ENST00000301452	T	0.42900	0.96	5.13	0.47	0.16747	.	0.527539	0.21637	N	0.071397	T	0.37210	0.0995	M	0.73598	2.24	0.22851	N	0.998658	P	0.42518	0.782	B	0.39503	0.301	T	0.32561	-0.9902	10	0.72032	D	0.01	-15.663	4.4791	0.11759	0.278:0.5108:0.1345:0.0768	.	99	Q8TDN7	ACER1_HUMAN	D	99	ENSP00000301452:G99D	ENSP00000301452:G99D	G	-	2	0	ACER1	6263214	0.936000	0.31750	0.029000	0.17559	0.086000	0.17979	1.990000	0.40717	-0.045000	0.13468	-1.740000	0.00687	GGC	.	.	.	none		0.607	ACER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452982.1	NM_133492	
C21orf2	755	hgsc.bcm.edu	37	21	45750162	45750162	+	Missense_Mutation	SNP	C	C	A			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr21:45750162C>A	ENST00000339818.4	-	7	897	c.690G>T	c.(688-690)gaG>gaT	p.E230D	C21orf2_ENST00000325223.7_Missense_Mutation_p.E229D|C21orf2_ENST00000397956.3_Missense_Mutation_p.E349D|C21orf2_ENST00000496321.1_5'UTR|AP001062.7_ENST00000448927.1_RNA|AP001062.8_ENST00000422357.1_RNA	NM_001271440.1|NM_004928.2	NP_001258369.1|NP_004919.1	O43822	CU002_HUMAN	chromosome 21 open reading frame 2	230					cilium morphogenesis (GO:0060271)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				endometrium(2)	2				Colorectal(79;0.0806)		CCTCCAGCCCCTCTGCATCCA	0.697																																					p.E349D		Atlas-SNP	.											.	C21orf2	10	.	0			c.G1047T						PASS	.						15.0	15.0	15.0					21																	45750162		2189	4284	6473	SO:0001583	missense	755	exon7			CAGCCCCTCTGCA	Y11392	CCDS13709.1, CCDS59444.1, CCDS59445.1	21q22.3	2014-03-24			ENSG00000160226	ENSG00000160226			1260	protein-coding gene	gene with protein product	"""nuclear encoded mitochondrial protein"", ""leucine rich repeat containing 76"""	603191				9465297	Standard	NM_004928		Approved	YF5, A2, LRRC76	uc002zeq.2	O43822	OTTHUMG00000086909	ENST00000339818.4:c.690G>T	chr21.hg19:g.45750162C>A	ENSP00000344566:p.Glu230Asp	46.0	0.0	.		55.0	23.0	.	NM_001271441	A8MPS9|O14993|Q8N5X6|Q99837|Q99838	Missense_Mutation	SNP	ENST00000339818.4	hg19	CCDS13709.1	.	.	.	.	.	.	.	.	.	.	C	18.28	3.589994	0.66105	.	.	ENSG00000160226	ENST00000339818;ENST00000397956;ENST00000325223	T;T;T	0.50813	1.46;0.73;1.47	5.13	3.29	0.37713	.	0.111298	0.64402	D	0.000014	T	0.57242	0.2040	M	0.69823	2.125	0.34719	D	0.728514	D;D;D;D	0.67145	0.986;0.996;0.976;0.986	P;P;P;P	0.58266	0.737;0.836;0.551;0.737	T	0.65747	-0.6093	10	0.29301	T	0.29	-28.6583	9.0929	0.36621	0.0:0.8222:0.0:0.1778	.	229;349;230;189	G5E952;Q8N5X6;O43822;O43822-2	.;.;CU002_HUMAN;.	D	230;349;229	ENSP00000344566:E230D;ENSP00000381047:E349D;ENSP00000317302:E229D	ENSP00000317302:E229D	E	-	3	2	C21orf2	44574590	1.000000	0.71417	0.986000	0.45419	0.343000	0.28985	2.457000	0.45005	1.153000	0.42468	0.655000	0.94253	GAG	.	.	.	none		0.697	C21orf2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000195799.1	NM_004928	
MN1	4330	hgsc.bcm.edu	37	22	28192976	28192976	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr22:28192976C>T	ENST00000302326.4	-	1	4510	c.3556G>A	c.(3556-3558)Gcc>Acc	p.A1186T		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	1186					intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						GCCCCGACGGCGCACTCACCC	0.647			T	ETV6	"""AML, meningioma"""																																p.A1186T		Atlas-SNP	.		Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	.	MN1	122	.	0			c.G3556A						PASS	.						18.0	20.0	19.0					22																	28192976		2099	4221	6320	SO:0001583	missense	4330	exon1			CGACGGCGCACTC	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.3556G>A	chr22.hg19:g.28192976C>T	ENSP00000304956:p.Ala1186Thr	26.0	0.0	.		35.0	16.0	.	NM_002430	A9Z1V9	Missense_Mutation	SNP	ENST00000302326.4	hg19	CCDS42998.1	.	.	.	.	.	.	.	.	.	.	C	16.84	3.233669	0.58886	.	.	ENSG00000169184	ENST00000302326	T	0.47869	0.83	5.04	1.75	0.24633	.	0.148707	0.45361	D	0.000368	T	0.22126	0.0533	N	0.08118	0	0.24692	N	0.993302	B	0.02656	0.0	B	0.06405	0.002	T	0.10132	-1.0643	10	0.37606	T	0.19	-5.5453	4.928	0.13903	0.0:0.5962:0.1578:0.2459	.	1186	Q10571	MN1_HUMAN	T	1186	ENSP00000304956:A1186T	ENSP00000304956:A1186T	A	-	1	0	MN1	26522976	0.758000	0.28405	0.850000	0.33497	0.970000	0.65996	0.490000	0.22403	0.512000	0.28257	0.456000	0.33151	GCC	.	.	.	none		0.647	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320737.1	NM_002430	
MID1IP1	58526	hgsc.bcm.edu	37	X	38664368	38664368	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chrX:38664368G>T	ENST00000336949.6	+	2	1114	c.169G>T	c.(169-171)Ggc>Tgc	p.G57C	MID1IP1_ENST00000378474.3_Missense_Mutation_p.G57C|MID1IP1-AS1_ENST00000436893.1_RNA|MID1IP1_ENST00000457894.1_Missense_Mutation_p.G57C	NM_021242.4	NP_067065.1	Q9NPA3	M1IP1_HUMAN	MID1 interacting protein 1	57					lipid metabolic process (GO:0006629)|negative regulation of microtubule depolymerization (GO:0007026)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of ligase activity (GO:0051351)|protein polymerization (GO:0051258)|regulation of lipid biosynthetic process (GO:0046890)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				kidney(1)|large_intestine(3)|lung(2)|prostate(1)	7						CGTGGAGGTAGGCGGCAGTGG	0.662																																					p.G57C		Atlas-SNP	.											.	MID1IP1	12	.	0			c.G169T						PASS	.						42.0	33.0	37.0					X																	38664368		2202	4300	6502	SO:0001583	missense	58526	exon2			GAGGTAGGCGGCA		CCDS14249.1	Xp11.4	2012-02-23	2012-02-23		ENSG00000165175	ENSG00000165175			20715	protein-coding gene	gene with protein product	"""gastrulation specific G12 homolog (zebrafish)"""		"""MID1 interacting protein 1 (gastrulation specific G12-like (zebrafish))"""				Standard	NM_001098790		Approved	STRAIT11499, FLJ10386, MIG12, THRSPL, G12-like	uc010ngz.3	Q9NPA3	OTTHUMG00000024092	ENST00000336949.6:c.169G>T	chrX.hg19:g.38664368G>T	ENSP00000338706:p.Gly57Cys	151.0	0.0	.		151.0	74.0	.	NM_021242	D3DWB2	Missense_Mutation	SNP	ENST00000336949.6	hg19	CCDS14249.1	.	.	.	.	.	.	.	.	.	.	G	15.88	2.964421	0.53507	.	.	ENSG00000165175	ENST00000457894;ENST00000378474;ENST00000336949	.	.	.	4.84	1.05	0.20165	.	0.159061	0.29286	N	0.012584	T	0.43277	0.1240	L	0.40543	1.245	0.33031	D	0.530214	D	0.58620	0.983	P	0.51297	0.665	T	0.54589	-0.8271	9	0.59425	D	0.04	-14.4554	6.8616	0.24069	0.4221:0.0:0.5779:0.0	.	57	Q9NPA3	M1IP1_HUMAN	C	57	.	ENSP00000338706:G57C	G	+	1	0	MID1IP1	38549312	0.735000	0.28153	0.940000	0.37924	0.993000	0.82548	0.654000	0.24918	0.136000	0.18733	0.529000	0.55759	GGC	.	.	.	none		0.662	MID1IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060655.1		
RPA4	29935	hgsc.bcm.edu	37	X	96139635	96139635	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chrX:96139635G>A	ENST00000373040.3	+	1	729	c.326G>A	c.(325-327)gGt>gAt	p.G109D	DIAPH2_ENST00000324765.8_Intron|DIAPH2_ENST00000355827.4_Intron|DIAPH2_ENST00000373049.4_Intron|DIAPH2_ENST00000373054.4_Intron|DIAPH2_ENST00000373061.3_Intron	NM_013347.4	NP_037479.1	Q13156	RFA4_HUMAN	replication protein A4, 30kDa	109					DNA damage checkpoint (GO:0000077)|DNA recombination (GO:0006310)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)	DNA replication factor A complex (GO:0005662)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	single-stranded DNA binding (GO:0003697)			endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)	13						CAGTGGTTTGGTAGAGAGAAA	0.463								Other identified genes with known or suspected DNA repair function																													p.G109D		Atlas-SNP	.											.	RPA4	29	.	0			c.G326A						PASS	.						101.0	87.0	92.0					X																	96139635		2203	4300	6503	SO:0001583	missense	29935	exon1			GGTTTGGTAGAGA	U24186	CCDS35345.1	Xq21	2010-04-09	2010-04-09		ENSG00000204086	ENSG00000204086			30305	protein-coding gene	gene with protein product		300767	"""replication protein A4, 34kDa"""			7760808	Standard	NM_013347		Approved	HSU24186	uc004efv.4	Q13156	OTTHUMG00000021987	ENST00000373040.3:c.326G>A	chrX.hg19:g.96139635G>A	ENSP00000362131:p.Gly109Asp	70.0	0.0	.		61.0	33.0	.	NM_013347	Q3SY03	Missense_Mutation	SNP	ENST00000373040.3	hg19	CCDS35345.1	.	.	.	.	.	.	.	.	.	.	G	0.245	-1.011087	0.02095	.	.	ENSG00000204086	ENST00000373040	T	0.37235	1.21	3.66	-0.387	0.12463	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);Nucleic acid binding, OB-fold, tRNA/helicase-type (1);	.	.	.	.	T	0.08313	0.0207	N	0.01086	-1.025	0.09310	N	1	B	0.25904	0.137	B	0.25759	0.063	T	0.29274	-1.0017	9	0.02654	T	1	-20.9474	2.3223	0.04214	0.1176:0.3079:0.405:0.1696	.	109	Q13156	RFA4_HUMAN	D	109	ENSP00000362131:G109D	ENSP00000362131:G109D	G	+	2	0	RPA4	96026291	0.001000	0.12720	0.000000	0.03702	0.019000	0.09904	0.691000	0.25467	-0.217000	0.10033	0.600000	0.82982	GGT	.	.	.	none		0.463	RPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057464.1	NM_013347	
RBMX2	51634	hgsc.bcm.edu	37	X	129546641	129546641	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chrX:129546641A>T	ENST00000305536.6	+	6	852	c.788A>T	c.(787-789)aAg>aTg	p.K263M		NM_016024.2	NP_057108.2	Q9Y388	RBMX2_HUMAN	RNA binding motif protein, X-linked 2	263	Arg-rich.						nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(2)|large_intestine(1)|liver(4)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	19						AGAGAAGAAAAGACCAGGATT	0.527																																					p.K263M		Atlas-SNP	.											.	RBMX2	46	.	0			c.A788T						PASS	.						69.0	67.0	68.0					X																	129546641		1931	4135	6066	SO:0001583	missense	51634	exon6			AAGAAAAGACCAG	AF078865	CCDS43993.1	Xq26.1	2013-02-12			ENSG00000134597	ENSG00000134597		"""RNA binding motif (RRM) containing"""	24282	protein-coding gene	gene with protein product						10810093	Standard	NM_016024		Approved	CGI-79	uc004evt.3	Q9Y388	OTTHUMG00000022395	ENST00000305536.6:c.788A>T	chrX.hg19:g.129546641A>T	ENSP00000339090:p.Lys263Met	233.0	1.0	.		201.0	91.0	.	NM_016024	A8K9Z0|Q5JY82|Q9Y3I8	Missense_Mutation	SNP	ENST00000305536.6	hg19	CCDS43993.1	.	.	.	.	.	.	.	.	.	.	A	11.99	1.804392	0.31869	.	.	ENSG00000134597	ENST00000305536;ENST00000538614	T	0.14516	2.5	4.9	-0.267	0.12938	.	0.462561	0.21532	N	0.073035	T	0.12987	0.0315	L	0.29908	0.895	0.18873	N	0.999989	P	0.50943	0.94	P	0.50231	0.635	T	0.13019	-1.0525	10	0.66056	D	0.02	.	7.4457	0.27209	0.5412:0.0:0.4588:0.0	.	263	Q9Y388	RBMX2_HUMAN	M	263	ENSP00000339090:K263M	ENSP00000339090:K263M	K	+	2	0	RBMX2	129374322	0.289000	0.24334	0.029000	0.17559	0.223000	0.24884	0.054000	0.14205	-0.329000	0.08527	0.417000	0.27973	AAG	.	.	.	none		0.527	RBMX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058265.1	NM_016024	
FCGR1B	2210	hgsc.bcm.edu	37	1	120927211	120927212	+	Frame_Shift_Del	DEL	GC	GC	-			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr1:120927211_120927212delGC	ENST00000369384.4	-	5	810_811	c.768_769delGC	c.(766-771)gagctgfs	p.EL256fs	RP11-439A17.10_ENST00000426275.1_RNA|FCGR1B_ENST00000472543.1_5'Flank|RP11-439A17.9_ENST00000457996.1_RNA|FCGR1B_ENST00000369383.4_Frame_Shift_Del_p.EL164fs	NM_001017986.3	NP_001017986.1	Q92637	FCGRB_HUMAN	Fc fragment of IgG, high affinity Ib, receptor (CD64)	256					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|Fc receptor signaling pathway (GO:0038093)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)	clathrin-coated endocytic vesicle membrane (GO:0030669)|early endosome membrane (GO:0031901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	immunoglobulin receptor activity (GO:0019763)			breast(1)|endometrium(1)|lung(2)	4	all_neural(166;0.181)	all_lung(203;7.27e-05)|Lung NSC(69;0.000389)|all_epithelial(167;0.068)		Lung(183;0.0327)|LUSC - Lung squamous cell carcinoma(189;0.19)	Intravenous Immunoglobulin(DB00028)	TGACATTTCAGCTCTTCTTCTA	0.465																																					p.257_257del		Atlas-INDEL	.											.	FCGR1B	14	.	0			c.769_770del						PASS	.																																			SO:0001589	frameshift_variant	2210	exon5			.		CCDS72844.1, CCDS72845.1, CCDS72846.1	1p11.2	2013-01-11	2005-02-02		ENSG00000198019	ENSG00000198019		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3614	protein-coding gene	gene with protein product		601502	"""Fc fragment of IgG, high affinity Ib, receptor for (CD64)"""			8697799, 9763663	Standard	NM_001017986		Approved	CD64b	uc001eip.3	Q92637	OTTHUMG00000040903	ENST00000369384.4:c.768_769delGC	chr1.hg19:g.120927211_120927212delGC	ENSP00000358391:p.Glu256fs	611.0	0.0	0		508.0	66.0	0.129921	NM_001017986	Q7KZ13|Q92638	Frame_Shift_Del	DEL	ENST00000369384.4	hg19	CCDS30821.1																																																																																			.	.	.	none		0.465	FCGR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098241.1		
SERPINI2	5276	hgsc.bcm.edu	37	3	167189524	167189526	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	AAG	AAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr3:167189524_167189526delAAG	ENST00000476257.1	-	3	395_397	c.97_99delCTT	c.(97-99)cttdel	p.L33del	SERPINI2_ENST00000465031.1_5'UTR|SERPINI2_ENST00000264677.4_In_Frame_Del_p.L33del|SERPINI2_ENST00000461846.1_In_Frame_Del_p.L33del|SERPINI2_ENST00000471111.1_In_Frame_Del_p.L33del			O75830	SPI2_HUMAN	serpin peptidase inhibitor, clade I (pancpin), member 2	33					cellular component movement (GO:0006928)|negative regulation of endopeptidase activity (GO:0010951)|regulation of cell adhesion (GO:0030155)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(20)|prostate(1)|skin(5)|urinary_tract(1)	41						CCTCTTGATAAAGATCCACTGCA	0.384																																					p.43_44del		Atlas-INDEL	.											.	SERPINI2	85	.	0			c.128_130del						PASS	.																																			SO:0001651	inframe_deletion	5276	exon3			.	AB006423	CCDS3200.1, CCDS75047.1	3q26.1	2014-02-18	2005-08-18		ENSG00000114204	ENSG00000114204		"""Serine (or cysteine) peptidase inhibitors"""	8945	protein-coding gene	gene with protein product		605587	"""serine (or cysteine) proteinase inhibitor, clade I (neuroserpin), member 2"", ""serine (or cysteine) proteinase inhibitor, clade I (pancpin), member 2"""	PI14		9624529, 24172014	Standard	NM_006217		Approved	PANCPIN, TSA2004, MEPI, pancpin	uc003fes.2	O75830	OTTHUMG00000158231	ENST00000476257.1:c.97_99delCTT	chr3.hg19:g.167189524_167189526delAAG	ENSP00000420621:p.Leu33del	89.0	0.0	0		75.0	35.0	0.466667	NM_001012303		In_Frame_Del	DEL	ENST00000476257.1	hg19	CCDS3200.1																																																																																			.	.	.	none		0.384	SERPINI2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350450.1	NM_006217	
ADD1	118	hgsc.bcm.edu	37	4	2930230	2930232	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	AAG	AAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr4:2930230_2930232delAAG	ENST00000398129.1	+	14	2214_2216	c.2194_2196delAAG	c.(2194-2196)aagdel	p.K734del	ADD1_ENST00000446856.1_In_Frame_Del_p.K734del|ADD1_ENST00000398123.2_3'UTR|ADD1_ENST00000398125.1_3'UTR|ADD1_ENST00000355842.3_3'UTR|ADD1_ENST00000513328.2_3'UTR|ADD1_ENST00000264758.7_In_Frame_Del_p.K765del|ADD1_ENST00000503455.2_3'UTR			P35611	ADDA_HUMAN	adducin 1 (alpha)	734	Interaction with calmodulin. {ECO:0000255}.				actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cell morphogenesis (GO:0000902)|cell volume homeostasis (GO:0006884)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to retinoic acid (GO:0071300)|endoplasmic reticulum unfolded protein response (GO:0030968)|erythrocyte differentiation (GO:0030218)|hemoglobin metabolic process (GO:0020027)|homeostasis of number of cells within a tissue (GO:0048873)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein binding (GO:0032092)	cytosol (GO:0005829)|dendritic spine (GO:0043197)|F-actin capping protein complex (GO:0008290)|focal adhesion (GO:0005925)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)|transcription factor binding (GO:0008134)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GAAGAAGAGCAAGAAGAAGAGTG	0.616																																					p.762_763del	Esophageal Squamous(71;505 1201 20414 34538 37449)	Atlas-Indel,Pindel	.											.	ADD1	56	.	0			c.2286_2288del						PASS	.		,,,	2,4264		0,2,2131					,,,	5.2	1.0			63	0,8254		0,0,4127	no	utr-3,utr-3,coding,coding	ADD1	NM_176801.2,NM_014190.3,NM_014189.3,NM_001119.4	,,,	0,2,6258	A1A1,A1R,RR		0.0,0.0469,0.016	,,,	,,,		2,12518				SO:0001651	inframe_deletion	118	exon15			.	L07261	CCDS3363.1, CCDS3364.1, CCDS43205.1, CCDS75094.1	4p16.3	2009-04-22			ENSG00000087274	ENSG00000087274			243	protein-coding gene	gene with protein product		102680				1840603	Standard	NM_001119		Approved		uc003gfq.3	P35611	OTTHUMG00000122080	ENST00000398129.1:c.2194_2196delAAG	chr4.hg19:g.2930236_2930238delAAG	ENSP00000381197:p.Lys734del	157.0	0.0	0		117.0	50.0	0.42735	NM_014189	A2A3N8|A2A3P0|B4DI79|D3DVR3|D3DVR4|D3DVR5|Q13734|Q14729|Q16156|Q86XM2|Q9UJB6	In_Frame_Del	DEL	ENST00000398129.1	hg19	CCDS43205.1																																																																																			.	.	.	none		0.616	ADD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242840.1	NM_014189	
RPS2	6187	hgsc.bcm.edu	37	16	2014483	2014484	+	In_Frame_Ins	INS	-	-	CGGCCT			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr16:2014483_2014484insCGGCCT	ENST00000343262.4	-	2	199_200	c.143_144insAGGCCG	c.(142-144)cgc>cgAGGCCGc	p.48_48R>RGR	SNORA10_ENST00000384084.1_RNA|SNORA64_ENST00000384674.1_RNA|RPS2_ENST00000526522.1_In_Frame_Ins_p.48_48R>RGR|SNHG9_ENST00000459373.1_lincRNA|RNF151_ENST00000569714.1_5'Flank|RNF151_ENST00000321392.3_5'Flank|RPS2_ENST00000529806.1_In_Frame_Ins_p.48_48R>RGR|RNF151_ENST00000569210.2_5'Flank|RPS2_ENST00000530225.1_In_Frame_Ins_p.48_48R>RGR	NM_002952.3	NP_002943.2	P15880	RS2_HUMAN	ribosomal protein S2	48	Arg/Gly-rich.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of transferase activity (GO:0051347)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|urinary_tract(2)	7						CGCGAGCTCCGCGGCCTCGGCC	0.757																																					p.R48delinsRGR		Atlas-INDEL	.											.	RPS2	18	.	0			c.144_145insAGGCCG						PASS	.																																			SO:0001652	inframe_insertion	6187	exon2			.	AB007147	CCDS10452.1	16p13.3	2011-04-05			ENSG00000140988	ENSG00000140988		"""S ribosomal proteins"""	10404	protein-coding gene	gene with protein product		603624				9582194	Standard	NM_002952		Approved	LLREP3, S2	uc002cno.2	P15880	OTTHUMG00000128708	ENST00000343262.4:c.138_143dupAGGCCG	chr16.hg19:g.2014484_2014489dupCGGCCT	ENSP00000341885:p.GlyArg48dup	55.0	0.0	0		59.0	19.0	0.322034	NM_002952	B2R5G0|D3DU82|Q3MIB1	In_Frame_Ins	INS	ENST00000343262.4	hg19	CCDS10452.1																																																																																			.	.	.	none		0.757	RPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250613.2	NM_002952	
LARS	51520	hgsc.bcm.edu	37	5	145547749	145547751	+	In_Frame_Del	DEL	TCC	TCC	-			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	TCC	TCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr5:145547749_145547751delTCC	ENST00000394434.2	-	5	538_540	c.372_374delGGA	c.(370-375)gaggaa>gaa	p.124_125EE>E	LARS_ENST00000545646.1_Intron|LARS_ENST00000510191.1_In_Frame_Del_p.70_71EE>E|LARS_ENST00000511505.1_Intron|LARS_ENST00000274562.9_In_Frame_Del_p.97_98EE>E	NM_020117.9	NP_064502.9	Q9P2J5	SYLC_HUMAN	leucyl-tRNA synthetase	124					gene expression (GO:0010467)|leucyl-tRNA aminoacylation (GO:0006429)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|leucine-tRNA ligase activity (GO:0004823)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|prostate(1)|skin(2)|stomach(8)	34			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		L-Leucine(DB00149)	ACTGGTTTCTTCCTCTTCCTCTT	0.33																																					p.125_125del		Atlas-Indel,Pindel	.											.	LARS	100	.	0			c.373_375del						PASS	.																																			SO:0001651	inframe_deletion	51520	exon5			.	AF151026	CCDS34265.1	5q32	2012-10-02			ENSG00000133706	ENSG00000133706	6.1.1.4	"""Aminoacyl tRNA synthetases / Class I"""	6512	protein-coding gene	gene with protein product	"""leucine tRNA ligase 1, cytoplasmic"""	151350				6933703	Standard	NM_020117		Approved	HSPC192, FLJ10595, FLJ21788, LARS1, LEUS, RNTLS	uc003lnx.1	Q9P2J5	OTTHUMG00000163429	ENST00000394434.2:c.372_374delGGA	chr5.hg19:g.145547749_145547751delTCC	ENSP00000377954:p.Glu126del	105.0	0.0	0		88.0	28.0	0.318182	NM_020117	A2RRR4|A7E266|B4DJ10|Q2TU79|Q9NSE1	In_Frame_Del	DEL	ENST00000394434.2	hg19	CCDS34265.1																																																																																			.	.	.	none		0.330	LARS-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000373367.1	NM_020117	
PCDHGC5	56097	hgsc.bcm.edu	37	5	140870632	140870633	+	Frame_Shift_Ins	INS	-	-	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr5:140870632_140870633insT	ENST00000252087.1	+	1	1825_1826	c.1825_1826insT	c.(1825-1827)ctgfs	p.L609fs	PCDHGA8_ENST00000398604.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGC4_ENST00000306593.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_018929.2|NM_032403.2|NM_032407.1	NP_061752.1|NP_115779.1|NP_115783.1	Q9Y5F6	PCDGM_HUMAN	protocadherin gamma subfamily C, 5	609	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(4)|lung(10)|ovary(4)|prostate(1)|urinary_tract(2)	35			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCCTACTCACTGTTGCCACAG	0.619																																					p.L609fs		Atlas-Indel,Pindel	.											.	PCDHGC5	199	.	0			c.1825_1826insT						PASS	.																																			SO:0001589	frameshift_variant	56097	exon1			.	AF152526	CCDS4263.1, CCDS75350.1	5q31	2010-01-26			ENSG00000240764	ENSG00000240764		"""Cadherins / Protocadherins : Clustered"""	8718	other	protocadherin		606306				10380929	Standard	NM_018929		Approved	PCDH-GAMMA-C5	uc003lla.2	Q9Y5F6	OTTHUMG00000129624	ENST00000252087.1:c.1826dupT	chr5.hg19:g.140870633_140870633dupT	ENSP00000252087:p.Leu609fs	40.0	0.0	0		38.0	19.0	0.5	NM_018929	Q9Y5C2	Frame_Shift_Ins	INS	ENST00000252087.1	hg19	CCDS4263.1																																																																																			.	.	.	none		0.619	PCDHGC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251819.1	NM_018929	
FCGR1A	2209	hgsc.bcm.edu	37	1	149762998	149762999	+	Frame_Shift_Del	DEL	GC	GC	-			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr1:149762998_149762999delGC	ENST00000369168.4	+	6	1104_1105	c.1050_1051delGC	c.(1048-1053)gagctgfs	p.EL350fs	RP11-196G18.21_ENST00000420462.1_RNA|RP11-196G18.3_ENST00000428289.1_RNA|HIST2H2BF_ENST00000545683.1_Intron	NM_000566.3	NP_000557.1	P12314	FCGR1_HUMAN	Fc fragment of IgG, high affinity Ia, receptor (CD64)	350					antibody-dependent cellular cytotoxicity (GO:0001788)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|intracellular signal transduction (GO:0035556)|phagocytosis, engulfment (GO:0006911)|phagocytosis, recognition (GO:0006910)|positive regulation of phagocytosis (GO:0050766)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation of type III hypersensitivity (GO:0001805)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin-coated endocytic vesicle membrane (GO:0030669)|early endosome membrane (GO:0031901)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	IgG receptor activity (GO:0019770)|receptor signaling protein activity (GO:0005057)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)	10	Breast(34;0.0124)|all_hematologic(923;0.127)				Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Methyl aminolevulinate(DB00992)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Porfimer(DB00707)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	TAGAAGAAGAGCTGAAATGTCA	0.475																																					p.350_350del		Atlas-INDEL	.											.	FCGR1A	27	.	0			c.1049_1050del						PASS	.																																			SO:0001589	frameshift_variant	2209	exon6			.	BC032634	CCDS933.1	1q21.2-q21.3	2014-09-17	2005-02-02		ENSG00000150337	ENSG00000150337		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3613	protein-coding gene	gene with protein product		146760	"""Fc fragment of IgG, high affinity Ia, receptor for (CD64)"""			8697799, 9763663	Standard	NM_000566		Approved	CD64, CD64A	uc001esp.4	P12314	OTTHUMG00000012089	ENST00000369168.4:c.1050_1051delGC	chr1.hg19:g.149762998_149762999delGC	ENSP00000358165:p.Glu350fs	431.0	0.0	0		416.0	26.0	0.0625	NM_000566	P12315|Q5QNW7|Q92495|Q92663	Frame_Shift_Del	DEL	ENST00000369168.4	hg19	CCDS933.1																																																																																			.	.	.	none		0.475	FCGR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033446.1	NM_000566	
ACSBG2	81616	hgsc.bcm.edu	37	19	6165945	6165945	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr19:6165945delG	ENST00000586696.1	+	7	933	c.657delG	c.(655-657)cagfs	p.Q219fs	ACSBG2_ENST00000252669.5_Frame_Shift_Del_p.Q219fs|ACSBG2_ENST00000591403.1_Frame_Shift_Del_p.Q219fs|ACSBG2_ENST00000588485.1_Frame_Shift_Del_p.Q32fs|ACSBG2_ENST00000588304.1_Frame_Shift_Del_p.Q169fs|ACSBG2_ENST00000591741.1_3'UTR			Q5FVE4	ACBG2_HUMAN	acyl-CoA synthetase bubblegum family member 2	219					cell differentiation (GO:0030154)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid metabolic process (GO:0001676)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acyl-CoA hydrolase activity (GO:0047617)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(3)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TCGAGAGCCAGAAGGCGAATC	0.517											OREG0025194	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q219fs		Atlas-Indel,Pindel	.											.	ACSBG2	83	.	0			c.656delA						PASS	.						163.0	130.0	141.0					19																	6165945		2203	4300	6503	SO:0001589	frameshift_variant	81616	exon7			.		CCDS12159.1, CCDS74269.1	19p13.3	2012-10-02			ENSG00000130377	ENSG00000130377		"""Acyl-CoA synthetase family"""	24174	protein-coding gene	gene with protein product	"""bubblegum related protein"""	614363				11230166	Standard	XM_005259653		Approved	BGR, PRTD-NY3, DKFZp434K1635	uc002meh.1	Q5FVE4	OTTHUMG00000180754	ENST00000586696.1:c.657delG	chr19.hg19:g.6165945delG	ENSP00000465589:p.Gln219fs	70.0	0.0	0	632	56.0	18.0	0.321429	NM_030924	B3KSF2|Q6UWJ3|Q7Z5A0|Q8WW03|Q96M36|Q9BYZ3|Q9H0C4	Frame_Shift_Del	DEL	ENST00000586696.1	hg19	CCDS12159.1																																																																																			.	.	.	none		0.517	ACSBG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452898.1	NM_030924	
SERPINI2	5276	hgsc.bcm.edu	37	3	167189524	167189527	+	Frame_Shift_Del	DEL	AAGA	AAGA	-			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	AAGA	AAGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr3:167189524_167189527delAAGA	ENST00000476257.1	-	3	394_397	c.96_99delTCTT	c.(94-99)gatcttfs	p.DL32fs	SERPINI2_ENST00000465031.1_5'UTR|SERPINI2_ENST00000264677.4_Frame_Shift_Del_p.DL32fs|SERPINI2_ENST00000461846.1_Frame_Shift_Del_p.DL32fs|SERPINI2_ENST00000471111.1_Frame_Shift_Del_p.DL32fs			O75830	SPI2_HUMAN	serpin peptidase inhibitor, clade I (pancpin), member 2	32					cellular component movement (GO:0006928)|negative regulation of endopeptidase activity (GO:0010951)|regulation of cell adhesion (GO:0030155)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(20)|prostate(1)|skin(5)|urinary_tract(1)	41						CCTCTTGATAAAGATCCACTGCAA	0.382																																					p.43_44del		Pindel	.											.	SERPINI2	85	.	0			c.127_130del						PASS	.																																			SO:0001589	frameshift_variant	5276	exon3			.	AB006423	CCDS3200.1, CCDS75047.1	3q26.1	2014-02-18	2005-08-18		ENSG00000114204	ENSG00000114204		"""Serine (or cysteine) peptidase inhibitors"""	8945	protein-coding gene	gene with protein product		605587	"""serine (or cysteine) proteinase inhibitor, clade I (neuroserpin), member 2"", ""serine (or cysteine) proteinase inhibitor, clade I (pancpin), member 2"""	PI14		9624529, 24172014	Standard	NM_006217		Approved	PANCPIN, TSA2004, MEPI, pancpin	uc003fes.2	O75830	OTTHUMG00000158231	ENST00000476257.1:c.96_99delTCTT	chr3.hg19:g.167189524_167189527delAAGA	ENSP00000420621:p.Asp32fs	87.0	0.0	.		79.0	30.0	0.380	NM_001012303		Frame_Shift_Del	DEL	ENST00000476257.1	hg19	CCDS3200.1																																																																																			.	.	.	none		0.382	SERPINI2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350450.1	NM_006217	
BCL6B	255877	hgsc.bcm.edu	37	17	6928020	6928031	+	In_Frame_Del	DEL	CAGCAGCAGCAG	CAGCAGCAGCAG	-	rs72254884|rs386385552		TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	CAGCAGCAGCAG	CAGCAGCAGCAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr17:6928020_6928031delCAGCAGCAGCAG	ENST00000293805.5	+	4	794_805	c.702_713delCAGCAGCAGCAG	c.(700-714)tccagcagcagcagc>tcc	p.234_238SSSSS>S		NM_181844.3	NP_862827	Q8N143	BCL6B_HUMAN	B-cell CLL/lymphoma 6, member B	234	Ser-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			skin(1)	1						ACGAGGCCTCcagcagcagcagcagcagcagc	0.59																																					p.234_238del		Pindel	.											.,22	BCL6B	85	.	0			c.701_712del						PASS	.																																			SO:0001651	inframe_deletion	255877	exon4			.	AI672318	CCDS42248.1	17p13.1	2014-06-10	2010-04-14		ENSG00000161940	ENSG00000161940		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1002	protein-coding gene	gene with protein product		608992	"""zinc finger protein 62"", ""B-cell CLL/lymphoma 6, member B (zinc finger protein)"""	ZNF62		9632807	Standard	NM_181844		Approved	ZBTB28, BAZF	uc010clt.1	Q8N143	OTTHUMG00000177882	ENST00000293805.5:c.702_713delCAGCAGCAGCAG	chr17.hg19:g.6928020_6928031delCAGCAGCAGCAG	ENSP00000293805:p.Ser238_Ser241del	64.0	0.0	.		67.0	23.0	0.343	NM_181844	Q6PCB4	In_Frame_Del	DEL	ENST00000293805.5	hg19	CCDS42248.1																																																																																			.	.	.	alt		0.590	BCL6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439455.2	NM_181844	
