#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ATP13A2	23400	hgsc.bcm.edu	37	1	17318334	17318334	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr1:17318334G>T	ENST00000326735.8	-	20	2179	c.2146C>A	c.(2146-2148)Ctg>Atg	p.L716M	ATP13A2_ENST00000452699.1_Missense_Mutation_p.L711M|RP1-37C10.3_ENST00000446261.1_RNA|ATP13A2_ENST00000341676.5_Missense_Mutation_p.L711M			Q9NQ11	AT132_HUMAN	ATPase type 13A2	716					cell death (GO:0008219)|cellular response to manganese ion (GO:0071287)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(11)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)		AGGAGGCTCAGGTCTCCTTCC	0.632																																					p.L716M		Atlas-SNP	.											.	ATP13A2	85	.	0			c.C2146A						PASS	.						68.0	65.0	66.0					1																	17318334		2203	4300	6503	SO:0001583	missense	23400	exon20			GGCTCAGGTCTCC	AL354615	CCDS175.1, CCDS44072.1, CCDS44073.1	1p36	2014-09-17			ENSG00000159363	ENSG00000159363		"""ATPases / P-type"", ""Parkinson disease"""	30213	protein-coding gene	gene with protein product		610513	"""Parkinson disease (autosomal recessive) 9 (Kufor-Rakeb syndrome)"""	PARK9		15381061, 16964263	Standard	XM_005245809		Approved	HSA9947, CLN12	uc001baa.2	Q9NQ11	OTTHUMG00000002293	ENST00000326735.8:c.2146C>A	chr1.hg19:g.17318334G>T	ENSP00000327214:p.Leu716Met	91.0	0.0	.		64.0	18.0	.	NM_022089	O75700|Q5JXY1|Q5JXY2|Q6S9Z9	Missense_Mutation	SNP	ENST00000326735.8	hg19	CCDS175.1	.	.	.	.	.	.	.	.	.	.	G	11.38	1.621251	0.28889	.	.	ENSG00000159363	ENST00000326735;ENST00000341676;ENST00000452699;ENST00000503552	T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05	4.7	2.82	0.32997	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.199920	0.45606	D	0.000358	T	0.81451	0.4825	L	0.47190	1.495	0.37079	D	0.898894	D;D;D	0.69078	0.995;0.966;0.997	D;P;D	0.75020	0.985;0.756;0.971	T	0.80919	-0.1167	10	0.39692	T	0.17	-15.6307	9.9597	0.41688	0.1542:0.0:0.8458:0.0	.	711;711;716	Q5JXY1;Q6S9Z9;Q9NQ11	.;.;AT132_HUMAN	M	716;711;711;186	ENSP00000327214:L716M;ENSP00000341115:L711M;ENSP00000413307:L711M;ENSP00000421126:L186M	ENSP00000327214:L716M	L	-	1	2	ATP13A2	17190921	0.553000	0.26513	0.638000	0.29380	0.383000	0.30230	0.854000	0.27791	0.590000	0.29694	0.491000	0.48974	CTG	.	.	.	none		0.632	ATP13A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000006617.1	NM_022089	
RAP1GAP	5909	hgsc.bcm.edu	37	1	21936724	21936724	+	Silent	SNP	G	G	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr1:21936724G>C	ENST00000374765.4	-	14	1088	c.888C>G	c.(886-888)gtC>gtG	p.V296V	RAP1GAP_ENST00000374757.3_5'Flank|RAP1GAP_ENST00000542643.2_Silent_p.V296V|RAP1GAP_ENST00000374761.2_Silent_p.V327V|RAP1GAP_ENST00000374763.2_Silent_p.V296V|RAP1GAP_ENST00000290101.4_Silent_p.V360V	NM_002885.2	NP_002876.2	P47736	RPGP1_HUMAN	RAP1 GTPase activating protein	296	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				GTP catabolic process (GO:0006184)|positive regulation of Rap GTPase activity (GO:0032854)|regulation of Ras GTPase activity (GO:0032318)|signal transduction (GO:0007165)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|protein homodimerization activity (GO:0042803)|Rap GTPase activator activity (GO:0046582)|Ras GTPase binding (GO:0017016)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	17		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000861)|all_lung(284;0.000901)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;2.3e-26)|COAD - Colon adenocarcinoma(152;1.59e-05)|GBM - Glioblastoma multiforme(114;2.7e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000354)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00862)|READ - Rectum adenocarcinoma(331;0.0625)|Lung(427;0.146)		CATCCTGGAAGACCACAGCCA	0.637																																					p.V360V		Atlas-SNP	.											.	RAP1GAP	119	.	0			c.C1080G						PASS	.						112.0	87.0	96.0					1																	21936724		2203	4300	6503	SO:0001819	synonymous_variant	5909	exon14			CTGGAAGACCACA	BC054490	CCDS218.1, CCDS53276.1, CCDS53277.1	1p36.1-p35	2009-09-14	2006-04-12	2006-04-12	ENSG00000076864	ENSG00000076864			9858	protein-coding gene	gene with protein product		600278	"""RAP1, GTPase activating protein 1"""	RAP1GA1		1904317	Standard	NM_001145657		Approved	KIAA0474, RAP1GAP1, RAP1GAPII	uc001bew.3	P47736	OTTHUMG00000007513	ENST00000374765.4:c.888C>G	chr1.hg19:g.21936724G>C		156.0	0.0	.		191.0	52.0	.	NM_001145658	J3QSS6|O75062|Q5T3S9|Q5T3T4|Q7Z5S8|Q9UQ51	Silent	SNP	ENST00000374765.4	hg19	CCDS218.1																																																																																			.	.	.	none		0.637	RAP1GAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000019759.2	NM_002885	
RPS8	6202	hgsc.bcm.edu	37	1	45242407	45242407	+	Missense_Mutation	SNP	C	C	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr1:45242407C>G	ENST00000396651.3	+	3	332	c.172C>G	c.(172-174)Ctg>Gtg	p.L58V	SNORD46_ENST00000364043.1_RNA|SNORD38B_ENST00000384690.1_RNA|RPS8_ENST00000485390.1_3'UTR|RPS8_ENST00000372209.3_Intron|SNORD38A_ENST00000365161.1_RNA|SNORD55_ENST00000581525.1_RNA|RP11-269F19.2_ENST00000428791.1_RNA			P62241	RS8_HUMAN	ribosomal protein S8	58					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(2)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)	10	Acute lymphoblastic leukemia(166;0.155)					ATACCGTGCCCTGAGGTTGGA	0.547																																					p.L58V		Atlas-SNP	.											.	RPS8	19	.	0			c.C172G						PASS	.						73.0	64.0	67.0					1																	45242407		2203	4300	6503	SO:0001583	missense	6202	exon3			CGTGCCCTGAGGT	BC070875	CCDS513.1	1p34.1-p32	2011-04-05			ENSG00000142937	ENSG00000142937		"""S ribosomal proteins"""	10441	protein-coding gene	gene with protein product		600357				8432552	Standard	NM_001012		Approved	S8	uc001cmi.3	P62241	OTTHUMG00000008494	ENST00000396651.3:c.172C>G	chr1.hg19:g.45242407C>G	ENSP00000379888:p.Leu58Val	38.0	0.0	.		30.0	13.0	.	NM_001012	P09058|Q6IRL7	Missense_Mutation	SNP	ENST00000396651.3	hg19	CCDS513.1	.	.	.	.	.	.	.	.	.	.	C	15.76	2.927456	0.52759	.	.	ENSG00000142937	ENST00000396651	T	0.37915	1.17	4.8	1.74	0.24563	.	0.000000	0.64402	D	0.000001	T	0.41003	0.1140	M	0.86953	2.85	0.80722	D	1	B	0.32101	0.356	B	0.31547	0.132	T	0.37619	-0.9698	10	0.87932	D	0	-24.8377	8.7594	0.34665	0.0:0.7558:0.0:0.2442	.	58	P62241	RS8_HUMAN	V	58	ENSP00000379888:L58V	ENSP00000379888:L58V	L	+	1	2	RPS8	45014994	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	2.400000	0.44504	0.166000	0.19597	0.655000	0.94253	CTG	.	.	.	none		0.547	RPS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023439.1	NM_001012	
AMPD1	270	hgsc.bcm.edu	37	1	115221050	115221050	+	Silent	SNP	A	A	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr1:115221050A>G	ENST00000520113.2	-	8	1110	c.1095T>C	c.(1093-1095)taT>taC	p.Y365Y	AMPD1_ENST00000353928.6_Silent_p.Y332Y|AMPD1_ENST00000369538.3_Silent_p.Y361Y			P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1	365					IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(3)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	45	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	CTTTGGTGCTATAGACCACTC	0.408																																					p.Y365Y		Atlas-SNP	.											.	AMPD1	223	.	0			c.T1095C						PASS	.						160.0	155.0	157.0					1																	115221050		2203	4300	6503	SO:0001819	synonymous_variant	270	exon8			GGTGCTATAGACC	M60092	CCDS876.1, CCDS876.2, CCDS53349.1	1p13	2010-02-10	2010-02-10		ENSG00000116748	ENSG00000116748	3.5.4.6		468	protein-coding gene	gene with protein product	"""AMPD isoform M"", ""skeletal muscle AMPD"""	102770	"""adenosine monophosphate deaminase 1 (isoform M)"""			1400401	Standard	NM_001172626		Approved	MAD, MADA	uc001efe.2	P23109	OTTHUMG00000011892	ENST00000520113.2:c.1095T>C	chr1.hg19:g.115221050A>G		76.0	0.0	.		86.0	30.0	.	NM_000036	A8K5N4|B2RAM1|F2Z3B3|Q5TF00|Q5TF02	Silent	SNP	ENST00000520113.2	hg19	CCDS876.2																																																																																			.	.	.	none		0.408	AMPD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000032860.4		
MYT1L	23040	hgsc.bcm.edu	37	2	1805513	1805513	+	Silent	SNP	T	T	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr2:1805513T>C	ENST00000399161.2	-	23	3978	c.3231A>G	c.(3229-3231)gaA>gaG	p.E1077E	MYT1L_ENST00000428368.2_Silent_p.E1075E|MYT1L_ENST00000407844.1_Silent_p.E73E	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	1077					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		GGGAATTGGATTCATTTAGCT	0.333																																					p.E1075E		Atlas-SNP	.											.	MYT1L	241	.	0			c.A3225G						PASS	.						232.0	228.0	229.0					2																	1805513		1805	4085	5890	SO:0001819	synonymous_variant	23040	exon23			ATTGGATTCATTT	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.3231A>G	chr2.hg19:g.1805513T>C		69.0	0.0	.		76.0	22.0	.	NM_015025	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Silent	SNP	ENST00000399161.2	hg19																																																																																				.	.	.	none		0.333	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025	
SMC6	79677	hgsc.bcm.edu	37	2	17896324	17896324	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr2:17896324T>A	ENST00000448223.2	-	16	1803	c.1534A>T	c.(1534-1536)Att>Ttt	p.I512F	SMC6_ENST00000402989.1_Missense_Mutation_p.I512F|SMC6_ENST00000351948.4_Missense_Mutation_p.I512F|SMC6_ENST00000381272.4_Missense_Mutation_p.I538F	NM_001142286.1	NP_001135758.1	Q96SB8	SMC6_HUMAN	structural maintenance of chromosomes 6	512	Flexible hinge.				cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|intracellular (GO:0005622)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)			NS(1)|biliary_tract(1)|breast(6)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					CGAAGATGAATGCAAGCTCCT	0.368																																					p.I512F		Atlas-SNP	.											.	SMC6	102	.	0			c.A1534T						PASS	.						71.0	74.0	73.0					2																	17896324		2203	4300	6503	SO:0001583	missense	79677	exon16			GATGAATGCAAGC	AJ310551	CCDS1690.1	2p24.3	2008-02-05	2006-07-06	2006-07-06	ENSG00000163029	ENSG00000163029		"""Structural maintenance of chromosomes proteins"""	20466	protein-coding gene	gene with protein product		609387	"""SMC6 structural maintenance of chromosomes 6-like 1 (yeast)"""	SMC6L1		11230166	Standard	NM_024624		Approved	FLJ22116	uc002rcn.3	Q96SB8	OTTHUMG00000090675	ENST00000448223.2:c.1534A>T	chr2.hg19:g.17896324T>A	ENSP00000404092:p.Ile512Phe	70.0	0.0	.		66.0	28.0	.	NM_001142286	A8K8Q6|D6W518|Q05BV4|Q9H0X3|Q9H6M0	Missense_Mutation	SNP	ENST00000448223.2	hg19	CCDS1690.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.349589	0.82132	.	.	ENSG00000163029	ENST00000448223;ENST00000351948;ENST00000381272;ENST00000402989;ENST00000446852	T;T;T;T;T	0.31247	2.1;2.1;1.62;2.1;1.5	6.16	6.16	0.99307	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	T	0.54967	0.1891	M	0.74647	2.275	0.80722	D	1	D;D;D	0.71674	0.997;0.998;0.997	D;D;D	0.74674	0.961;0.984;0.977	T	0.57860	-0.7738	10	0.62326	D	0.03	.	13.2153	0.59856	0.0:0.0:0.1324:0.8676	.	538;538;512	C9JMN1;Q96SB8-2;Q96SB8	.;.;SMC6_HUMAN	F	512;512;538;512;538	ENSP00000404092:I512F;ENSP00000323439:I512F;ENSP00000370672:I538F;ENSP00000384539:I512F;ENSP00000408644:I538F	ENSP00000323439:I512F	I	-	1	0	SMC6	17759805	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.172000	0.65003	2.367000	0.80283	0.528000	0.53228	ATT	.	.	.	none		0.368	SMC6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207359.1	NM_024624	
RHOB	388	hgsc.bcm.edu	37	2	20647312	20647312	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr2:20647312A>G	ENST00000272233.4	+	1	478	c.86A>G	c.(85-87)gAg>gGg	p.E29G		NM_004040.2	NP_004031.1	P62745	RHOB_HUMAN	ras homolog family member B	29					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to ionizing radiation (GO:0071479)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|GTP catabolic process (GO:0006184)|negative regulation of cell cycle (GO:0045786)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|transformed cell apoptotic process (GO:0006927)	cleavage furrow (GO:0032154)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|kidney(1)|lung(2)|ovary(1)|urinary_tract(2)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)	all_epithelial(98;4.19e-09)|Lung NSC(108;0.00452)|Ovarian(717;0.0164)		OV - Ovarian serous cystadenocarcinoma(76;1.14e-22)|Epithelial(75;7.84e-19)	Botulinum Toxin Type A(DB00083)	AGTAAGGACGAGTTCCCCGAG	0.662																																					p.E29G		Atlas-SNP	.											.	RHOB	18	.	0			c.A86G						PASS	.						121.0	120.0	120.0					2																	20647312		2203	4300	6503	SO:0001583	missense	388	exon1			AGGACGAGTTCCC		CCDS1699.1	2p24	2012-02-27	2012-02-27	2004-03-24	ENSG00000143878	ENSG00000143878			668	protein-coding gene	gene with protein product	"""oncogene RHO H6"""	165370	"""ras homolog gene family, member B"""	ARH6, ARHB		3283705, 16278215	Standard	NM_004040		Approved	RhoB, RHOH6, MST081	uc002rdv.3	P62745	OTTHUMG00000090755	ENST00000272233.4:c.86A>G	chr2.hg19:g.20647312A>G	ENSP00000272233:p.Glu29Gly	66.0	0.0	.		85.0	26.0	.	NM_004040	B2R692|P01121|Q5U0H6|Q7RTN5|Q7RTR9|Q9CUV7	Missense_Mutation	SNP	ENST00000272233.4	hg19	CCDS1699.1	.	.	.	.	.	.	.	.	.	.	A	13.04	2.117942	0.37339	.	.	ENSG00000143878	ENST00000272233	T	0.78246	-1.16	5.74	4.56	0.56223	Small GTP-binding protein domain (1);	0.000000	0.85682	U	0.000000	T	0.76471	0.3992	L	0.58810	1.83	0.53688	D	0.999978	B	0.29716	0.255	B	0.35727	0.209	T	0.74559	-0.3625	10	0.56958	D	0.05	-19.0458	12.9321	0.58292	0.8645:0.1355:0.0:0.0	.	29	P62745	RHOB_HUMAN	G	29	ENSP00000272233:E29G	ENSP00000272233:E29G	E	+	2	0	RHOB	20510793	1.000000	0.71417	1.000000	0.80357	0.018000	0.09664	9.156000	0.94705	0.963000	0.38082	0.533000	0.62120	GAG	.	.	.	none		0.662	RHOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207500.1	NM_004040	
SLC5A6	8884	hgsc.bcm.edu	37	2	27427730	27427730	+	Silent	SNP	G	G	C	rs376306193		TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr2:27427730G>C	ENST00000310574.3	-	8	1277	c.804C>G	c.(802-804)ctC>ctG	p.L268L	SLC5A6_ENST00000461319.1_5'Flank|SLC5A6_ENST00000408041.1_Silent_p.L268L	NM_021095.2	NP_066918.2	Q9Y289	SC5A6_HUMAN	solute carrier family 5 (sodium/multivitamin and iodide cotransporter), member 6	268					biotin metabolic process (GO:0006768)|biotin transport (GO:0015878)|pantothenate metabolic process (GO:0015939)|pantothenate transmembrane transport (GO:0015887)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)			endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|ovary(3)|prostate(1)|skin(1)	20	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Biotin(DB00121)|gabapentin enacarbil(DB08872)|Lipoic Acid(DB00166)	CGTATAAGGAGAGCATCATGA	0.587																																					p.L268L		Atlas-SNP	.											SLC5A6,NS,carcinoma,0,1	SLC5A6	63	.	0			c.C804G						PASS	.	G		0,4406		0,0,2203	103.0	95.0	98.0		804	-2.5	1.0	2		98	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SLC5A6	NM_021095.2		0,1,6502	CC,CG,GG		0.0116,0.0,0.0077		268/636	27427730	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	8884	exon8			TAAGGAGAGCATC	AF069307	CCDS1740.1	2p23	2013-07-19	2013-07-19		ENSG00000138074	ENSG00000138074		"""Solute carriers"""	11041	protein-coding gene	gene with protein product		604024	"""solute carrier family 5 (sodium-dependent vitamin transporter), member 6"""			9516450, 10329687	Standard	NM_021095		Approved	SMVT	uc002rjd.3	Q9Y289	OTTHUMG00000097075	ENST00000310574.3:c.804C>G	chr2.hg19:g.27427730G>C		24.0	0.0	.		30.0	10.0	.	NM_021095	B2RB85|D6W549|Q969Y5	Silent	SNP	ENST00000310574.3	hg19	CCDS1740.1																																																																																			.	.	.	weak		0.587	SLC5A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214194.1	NM_021095	
INO80B	83444	hgsc.bcm.edu	37	2	74684908	74684908	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr2:74684908T>A	ENST00000233331.7	+	5	1082	c.988T>A	c.(988-990)Tgt>Agt	p.C330S	WBP1_ENST00000393972.3_5'Flank|WBP1_ENST00000233615.2_5'Flank|WBP1_ENST00000409737.1_5'Flank	NM_031288.3	NP_112578.2	Q9C086	IN80B_HUMAN	INO80 complex subunit B	330					chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(5)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	13						CCAGGCACTCTGTAGTCTTCA	0.682																																					p.C330S		Atlas-SNP	.											.	INO80B	37	.	0			c.T988A						PASS	.						18.0	20.0	19.0					2																	74684908		2117	4148	6265	SO:0001583	missense	83444	exon5			GCACTCTGTAGTC	AB054538	CCDS1942.2	2p13.1	2011-07-06	2008-08-07	2008-08-07	ENSG00000115274	ENSG00000115274		"""Zinc fingers, HIT-type"", ""INO80 complex subunits"""	13324	protein-coding gene	gene with protein product	"""PAP-1 binding protein"", ""IES2 homolog (S. cerevisiae)"""		"""high mobility group AT-hook 1-like 4"", ""zinc finger, HIT type 4"""	HMGA1L4, ZNHIT4		16230350	Standard	NM_031288		Approved	HMGIYL4, PAPA-1, hIes2, PAP-1BP, IES2	uc002slg.3	Q9C086	OTTHUMG00000129959	ENST00000233331.7:c.988T>A	chr2.hg19:g.74684908T>A	ENSP00000233331:p.Cys330Ser	21.0	0.0	.		25.0	8.0	.	NM_031288		Missense_Mutation	SNP	ENST00000233331.7	hg19	CCDS1942.2	.	.	.	.	.	.	.	.	.	.	T	27.9	4.869691	0.91587	.	.	ENSG00000115274	ENST00000233331	D	0.99042	-5.36	5.27	5.27	0.74061	Zinc finger, HIT-type (1);	0.000000	0.85682	D	0.000000	D	0.98927	0.9636	L	0.58354	1.805	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.87578	0.998;0.995;0.995	D	0.99671	1.0996	10	0.87932	D	0	-20.6182	13.1927	0.59719	0.0:0.0:0.0:1.0	.	348;315;330	B4DJ31;B4DJ22;Q9C086	.;.;IN80B_HUMAN	S	330	ENSP00000233331:C330S	ENSP00000233331:C330S	C	+	1	0	INO80B	74538416	1.000000	0.71417	0.996000	0.52242	0.864000	0.49448	5.346000	0.65992	2.211000	0.71520	0.459000	0.35465	TGT	.	.	.	none		0.682	INO80B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252223.2	NM_031288	
RPIA	22934	hgsc.bcm.edu	37	2	89037541	89037541	+	Missense_Mutation	SNP	T	T	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr2:89037541T>G	ENST00000283646.4	+	8	841	c.786T>G	c.(784-786)ttT>ttG	p.F262L		NM_144563.2	NP_653164.2	P49247	RPIA_HUMAN	ribose 5-phosphate isomerase A	262					carbohydrate metabolic process (GO:0005975)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, non-oxidative branch (GO:0009052)|ribose phosphate metabolic process (GO:0019693)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	monosaccharide binding (GO:0048029)|ribose-5-phosphate isomerase activity (GO:0004751)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|skin(1)	18		Acute lymphoblastic leukemia(2;0.000456)|all_hematologic(2;0.00287)				ACTGGAAGTTTGACCGGGTAC	0.438																																					p.F262L		Atlas-SNP	.											.	RPIA	35	.	0			c.T786G						PASS	.						154.0	143.0	146.0					2																	89037541		1889	4125	6014	SO:0001583	missense	22934	exon8			GAAGTTTGACCGG	L35035	CCDS2004.2	2p11.2	2008-07-31	2008-07-31		ENSG00000153574	ENSG00000153574	5.3.1.6		10297	protein-coding gene	gene with protein product	"""ribose 5-phosphate epimerase"""	180430				7758956	Standard	NM_144563		Approved		uc002ste.3	P49247	OTTHUMG00000130333	ENST00000283646.4:c.786T>G	chr2.hg19:g.89037541T>G	ENSP00000283646:p.Phe262Leu	92.0	0.0	.		114.0	9.0	.	NM_144563	Q541P9|Q96BJ6	Missense_Mutation	SNP	ENST00000283646.4	hg19	CCDS2004.2	.	.	.	.	.	.	.	.	.	.	T	23.9	4.473758	0.84640	.	.	ENSG00000153574	ENST00000283646;ENST00000543560	T	0.76186	-1.0	5.55	1.74	0.24563	.	0.000000	0.85682	D	0.000000	T	0.82144	0.4973	M	0.70842	2.15	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.78321	-0.2249	10	0.42905	T	0.14	-10.0604	9.4754	0.38869	0.0:0.2052:0.0:0.7948	.	262	P49247	RPIA_HUMAN	L	262;128	ENSP00000283646:F262L	ENSP00000283646:F262L	F	+	3	2	RPIA	88818656	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.082000	0.30803	0.056000	0.16144	0.383000	0.25322	TTT	.	.	.	none		0.438	RPIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252683.2		
FER1L5	90342	hgsc.bcm.edu	37	2	97368368	97368368	+	RNA	SNP	A	A	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr2:97368368A>C	ENST00000457909.1	+	0	4790							A0AVI2	FR1L5_HUMAN	fer-1-like family member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(9)|large_intestine(9)|lung(6)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	38						GGACATGCAGAAGACAGACAT	0.602																																					p.K1799Q		Atlas-SNP	.											.	FER1L5	113	.	0			c.A5395C						PASS	.						39.0	45.0	43.0					2																	97368368		2131	4257	6388			90342	exon47			ATGCAGAAGACAG	BC126368		2q11.2	2014-06-27	2014-06-27		ENSG00000249715	ENSG00000249715			19044	protein-coding gene	gene with protein product			"""fer-1-like 5 (C. elegans)"""				Standard	XM_006712826		Approved	DKFZp434I0121	uc010fia.3	A0AVI2	OTTHUMG00000154929		chr2.hg19:g.97368368A>C		56.0	0.0	.		64.0	24.0	.	NM_001113382	Q17RH2|Q6ZU24	Missense_Mutation	SNP	ENST00000457909.1	hg19		.	.	.	.	.	.	.	.	.	.	A	12.29	1.894586	0.33442	.	.	ENSG00000214272	ENST00000414152;ENST00000436930;ENST00000397978	.	.	.	5.29	4.14	0.48551	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.139522	0.32068	U	0.006626	T	0.71256	0.3318	M	0.72576	2.205	.	.	.	D;D;D	0.71674	0.981;0.998;0.989	P;D;P	0.69479	0.77;0.964;0.885	T	0.79436	-0.1804	8	0.87932	D	0	-9.4277	10.0645	0.42295	0.9196:0.0:0.0804:0.0	.	507;1799;508	B7ZLI3;A0AVI2;A0AVI2-2	.;FR1L5_HUMAN;.	Q	1799;1803;508	.	ENSP00000442027:K508Q	K	+	1	0	FER1L5	96732095	0.999000	0.42202	1.000000	0.80357	0.680000	0.39746	2.466000	0.45084	0.865000	0.35603	0.459000	0.35465	AAG	.	.	.	none		0.602	FER1L5-001	KNOWN	basic|exp_conf	retained_intron	pseudogene	OTTHUMT00000339030.1	NM_001077400	
XIRP2	129446	hgsc.bcm.edu	37	2	168108259	168108259	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr2:168108259C>T	ENST00000409195.1	+	9	10446	c.10357C>T	c.(10357-10359)Cat>Tat	p.H3453Y	XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.H3231Y|XIRP2_ENST00000295237.9_Missense_Mutation_p.H3453Y|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409728.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	3278					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TGACTTCAAGCATGCCCCACC	0.408																																					p.H3453Y		Atlas-SNP	.											.	XIRP2	914	.	0			c.C10357T						PASS	.						61.0	61.0	61.0					2																	168108259		1916	4139	6055	SO:0001583	missense	129446	exon9			TTCAAGCATGCCC	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.10357C>T	chr2.hg19:g.168108259C>T	ENSP00000386840:p.His3453Tyr	158.0	0.0	.		148.0	59.0	.	NM_152381	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	hg19	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	C	17.42	3.385682	0.61956	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273;ENST00000413534	T;T;T	0.02916	4.12;4.12;4.11	6.16	5.29	0.74685	.	0.224814	0.46145	N	0.000309	T	0.14141	0.0342	M	0.71581	2.175	0.49483	D	0.99979	D;D;B	0.76494	0.999;0.999;0.368	D;D;B	0.80764	0.986;0.994;0.15	T	0.00213	-1.1913	10	0.87932	D	0	-12.9779	14.5412	0.67997	0.0:0.9292:0.0:0.0708	.	3278;3278;3231	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	Y	3453;3453;3231;867	ENSP00000386840:H3453Y;ENSP00000295237:H3453Y;ENSP00000387255:H3231Y	ENSP00000295237:H3453Y	H	+	1	0	XIRP2	167816505	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.228000	0.51270	1.628000	0.50416	-0.145000	0.13849	CAT	.	.	.	none		0.408	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
TTN	7273	hgsc.bcm.edu	37	2	179577514	179577514	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr2:179577514C>T	ENST00000591111.1	-	92	26511	c.26287G>A	c.(26287-26289)Gat>Aat	p.D8763N	TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.D7836N|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.D9080N			Q8WZ42	TITIN_HUMAN	titin	12916	Ig-like 70.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTATCTACATCGAACAACTCC	0.418																																					p.D9080N		Atlas-SNP	.											.	TTN	18412	.	0			c.G27238A						PASS	.						88.0	84.0	85.0					2																	179577514		1928	4120	6048	SO:0001583	missense	7273	exon94			CTACATCGAACAA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.26287G>A	chr2.hg19:g.179577514C>T	ENSP00000465570:p.Asp8763Asn	56.0	0.0	.		74.0	20.0	.	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	C	13.16	2.153386	0.38021	.	.	ENSG00000155657	ENST00000342992	T	0.38560	1.13	5.48	5.48	0.80851	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.23094	0.0558	N	0.03304	-0.355	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.08146	-1.0736	9	0.87932	D	0	.	12.9963	0.58648	0.0:0.9258:0.0:0.0742	.	8763	Q8WZ42	TITIN_HUMAN	N	7836	ENSP00000343764:D7836N	ENSP00000343764:D7836N	D	-	1	0	TTN	179285759	0.999000	0.42202	1.000000	0.80357	0.992000	0.81027	1.843000	0.39259	2.722000	0.93159	0.655000	0.94253	GAT	.	.	.	none		0.418	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
FASTKD2	22868	hgsc.bcm.edu	37	2	207655323	207655323	+	Silent	SNP	T	T	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr2:207655323T>C	ENST00000236980.6	+	11	2274	c.1926T>C	c.(1924-1926)tcT>tcC	p.S642S	FASTKD2_ENST00000402774.3_Silent_p.S642S|FASTKD2_ENST00000403094.3_Silent_p.S642S	NM_014929.3	NP_055744.2	Q9NYY8	FAKD2_HUMAN	FAST kinase domains 2	642	RAP. {ECO:0000255|PROSITE- ProRule:PRU00619}.				cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(2)	21				LUSC - Lung squamous cell carcinoma(261;0.0718)|Epithelial(149;0.119)|Lung(261;0.138)		TTTCCAGATCTGCTTATTGTT	0.363																																					p.S642S		Atlas-SNP	.											.	FASTKD2	49	.	0			c.T1926C						PASS	.						159.0	159.0	159.0					2																	207655323		2203	4300	6503	SO:0001819	synonymous_variant	22868	exon11			CAGATCTGCTTAT	BC001544	CCDS2371.1	2q33.3	2008-02-05	2006-07-07	2006-07-07	ENSG00000118246	ENSG00000118246			29160	protein-coding gene	gene with protein product		612322	"""KIAA0971"""	KIAA0971			Standard	NM_014929		Approved		uc002vbx.3	Q9NYY8	OTTHUMG00000132917	ENST00000236980.6:c.1926T>C	chr2.hg19:g.207655323T>C		64.0	0.0	.		43.0	14.0	.	NM_001136193	Q9NVX6|Q9Y2H7	Silent	SNP	ENST00000236980.6	hg19	CCDS2371.1																																																																																			.	.	.	none		0.363	FASTKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256428.2	NM_014929	
LRRFIP1	9208	hgsc.bcm.edu	37	2	238666100	238666100	+	Intron	SNP	A	A	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr2:238666100A>T	ENST00000392000.4	+	9	864				LRRFIP1_ENST00000244815.5_Intron|LRRFIP1_ENST00000308482.9_Splice_Site_p.E378V|LRRFIP1_ENST00000289175.6_Intron	NM_001137552.1	NP_001131024.1	Q32MZ4	LRRF1_HUMAN	leucine rich repeat (in FLII) interacting protein 1						innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|protein homodimerization activity (GO:0042803)			NS(1)|breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	29		Breast(86;0.00257)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;9.75e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.01e-10)|Kidney(56;4.85e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.31e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000151)|Lung(119;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0325)|COAD - Colon adenocarcinoma(134;0.228)		TTTCCTCAGGAAATCCGACAG	0.473																																					p.E378V		Atlas-SNP	.											.	LRRFIP1	171	.	0			c.A1133T						PASS	.						32.0	29.0	30.0					2																	238666100		1567	3579	5146	SO:0001627	intron_variant	9208	exon17			CTCAGGAAATCCG	AJ223075	CCDS2521.1, CCDS46551.1, CCDS46552.1, CCDS46553.1	2q37.3	2010-09-30			ENSG00000124831	ENSG00000124831			6702	protein-coding gene	gene with protein product	"""GC-binding factor 2"""	603256				9705290, 9525888, 16199883	Standard	NM_004735		Approved	FLAP-1, FLIIAP1, TRIP, GCF-2, HUFI-1	uc002vxe.3	Q32MZ4	OTTHUMG00000133339	ENST00000392000.4:c.747+1270A>T	chr2.hg19:g.238666100A>T		270.0	0.0	.		221.0	66.0	.	NM_001137550	E9PGZ2|O75766|O75799|Q32MZ5|Q53T49|Q6PKG2|Q9Y607	Missense_Mutation	SNP	ENST00000392000.4	hg19	CCDS46552.1	.	.	.	.	.	.	.	.	.	.	A	18.72	3.683862	0.68157	.	.	ENSG00000124831	ENST00000308482;ENST00000391999	T	0.53640	0.61	5.51	5.51	0.81932	.	.	.	.	.	T	0.51109	0.1655	M	0.75085	2.285	0.80722	D	1	B	0.32604	0.377	B	0.32465	0.146	T	0.57207	-0.7851	9	0.87932	D	0	.	14.8382	0.70201	1.0:0.0:0.0:0.0	.	378	E9PGZ2	.	V	378;368	ENSP00000310109:E378V	ENSP00000310109:E378V	E	+	2	0	LRRFIP1	238330839	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.546000	0.90661	2.097000	0.63578	0.533000	0.62120	GAA	.	.	.	none		0.473	LRRFIP1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000317198.1	NM_004735	
ZKSCAN7	55888	hgsc.bcm.edu	37	3	44612087	44612087	+	Silent	SNP	T	T	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr3:44612087T>C	ENST00000273320.3	+	6	1914	c.1485T>C	c.(1483-1485)taT>taC	p.Y495Y	ZKSCAN7_ENST00000431636.1_Intron|ZKSCAN7_ENST00000341840.3_Intron|RP11-944L7.5_ENST00000419137.1_Intron|RP11-944L7.4_ENST00000457331.1_RNA|ZKSCAN7_ENST00000426540.1_Silent_p.Y495Y	NM_018651.2	NP_061121.2	Q9P0L1	ZKSC7_HUMAN	zinc finger with KRAB and SCAN domains 7	495					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										AGAAACCTTATGAATGCAATG	0.448																																					p.Y495Y		Atlas-SNP	.											.	.	.	.	0			c.T1485C						PASS	.						116.0	118.0	117.0					3																	44612087		2203	4300	6503	SO:0001819	synonymous_variant	55888	exon6			ACCTTATGAATGC	L32164, AY280798	CCDS2714.1, CCDS2715.1, CCDS74924.1	3p21.32	2013-01-09	2013-01-09	2013-01-09	ENSG00000196345	ENSG00000196345		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12955	protein-coding gene	gene with protein product			"""zinc finger protein 64"", ""zinc finger protein 448"", ""zinc finger protein 167"""	ZNF64, ZNF448, ZNF167		7814019, 1505991	Standard	XM_005265323		Approved	FLJ12738, ZSCAN39	uc003cnj.3	Q9P0L1	OTTHUMG00000133094	ENST00000273320.3:c.1485T>C	chr3.hg19:g.44612087T>C		88.0	0.0	.		91.0	9.0	.	NM_018651	A0PJV3|A8K5H0|Q6WL09|Q96FQ2	Silent	SNP	ENST00000273320.3	hg19	CCDS2715.1																																																																																			.	.	.	none		0.448	ZKSCAN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256752.4	NM_018651	
VPRBP	9730	hgsc.bcm.edu	37	3	51452313	51452313	+	Splice_Site	SNP	T	T	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr3:51452313T>G	ENST00000335891.5	-	11	2266		c.e11-2					Q9Y4B6	VPRBP_HUMAN	Vpr (HIV-1) binding protein						B cell differentiation (GO:0030183)|cell competition in a multicellular organism (GO:0035212)|histone H2A-T120 phosphorylation (GO:1990245)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone kinase activity (H2A-T120 specific) (GO:1990244)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		ATCATAAATCTTTAGAGAAGA	0.373																																					.		Atlas-SNP	.											.	VPRBP	107	.	0			c.3442-2A>C						PASS	.						58.0	51.0	53.0					3																	51452313		1852	4108	5960	SO:0001630	splice_region_variant	9730	exon18			TAAATCTTTAGAG	AB018343	CCDS74943.1, CCDS74944.1	3p21.2	2011-06-17			ENSG00000145041	ENSG00000145041		"""DDB1 and CUL4 associated factors"""	30911	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 1"""					8195203, 11223251	Standard	NM_014703		Approved	KIAA0800, MGC102804, DCAF1	uc003dbe.2	Q9Y4B6	OTTHUMG00000156895	ENST00000335891.5:c.2257-2A>C	chr3.hg19:g.51452313T>G		82.0	0.0	.		70.0	6.0	.	NM_001171904	Q2YD74|Q8TBD9|Q9HCA1|Q9UG37	Splice_Site	SNP	ENST00000335891.5	hg19		.	.	.	.	.	.	.	.	.	.	T	25.0	4.587425	0.86851	.	.	ENSG00000145041	ENST00000423656;ENST00000335891	.	.	.	5.88	5.88	0.94601	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2997	0.82804	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	VPRBP	51427353	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.422000	0.80217	2.250000	0.74265	0.528000	0.53228	.	.	.	.	none		0.373	VPRBP-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_014703	Intron
MME	4311	hgsc.bcm.edu	37	3	154858036	154858036	+	Silent	SNP	A	A	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr3:154858036A>G	ENST00000460393.1	+	10	1032	c.912A>G	c.(910-912)acA>acG	p.T304T	MME_ENST00000462745.1_Silent_p.T304T|MME_ENST00000492661.1_Silent_p.T304T|MME_ENST00000360490.2_Silent_p.T304T|MME_ENST00000493237.1_Silent_p.T304T	NM_000902.3|NM_007287.2	NP_000893.2|NP_009218.2	P08473	NEP_HUMAN	membrane metallo-endopeptidase	304				T -> R (in Ref. 4; AAA51915). {ECO:0000305}.	angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cellular protein metabolic process (GO:0044267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to UV-A (GO:0071492)|cellular response to UV-B (GO:0071493)|creatinine metabolic process (GO:0046449)|kidney development (GO:0001822)|peptide metabolic process (GO:0006518)|proteolysis (GO:0006508)|replicative senescence (GO:0090399)|sensory perception of pain (GO:0019233)	axon (GO:0030424)|brush border (GO:0005903)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(31)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)|Liraglutide(DB06655)	ACAAGATGACATTGGCCCAGA	0.323																																					p.T304T		Atlas-SNP	.											.	MME	133	.	0			c.A912G						PASS	.						74.0	69.0	71.0					3																	154858036		2203	4298	6501	SO:0001819	synonymous_variant	4311	exon10			GATGACATTGGCC		CCDS3172.1	3q25.2	2012-01-31	2007-02-21		ENSG00000196549	ENSG00000196549	3.4.24.11	"""CD molecules"""	7154	protein-coding gene	gene with protein product	"""neutral endopeptidase"", ""enkephalinase"", ""neprilysin"""	120520					Standard	NM_007287		Approved	CALLA, CD10, NEP	uc003fad.1	P08473	OTTHUMG00000158455	ENST00000460393.1:c.912A>G	chr3.hg19:g.154858036A>G		293.0	0.0	.		324.0	109.0	.	NM_007287	A8K6U6|D3DNJ9|Q3MIX4	Silent	SNP	ENST00000460393.1	hg19	CCDS3172.1																																																																																			.	.	.	none		0.323	MME-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351076.1	NM_000902	
AFAP1	60312	hgsc.bcm.edu	37	4	7811366	7811366	+	Silent	SNP	T	T	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr4:7811366T>C	ENST00000360265.4	-	8	1263	c.1029A>G	c.(1027-1029)tcA>tcG	p.S343S	AFAP1_ENST00000420658.1_Silent_p.S343S|AFAP1_ENST00000382543.3_Silent_p.S343S|AFAP1_ENST00000358461.2_Silent_p.S343S			Q8N556	AFAP1_HUMAN	actin filament associated protein 1	343						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|skin(4)|stomach(2)	32						CTTCCTCAGCTGAGGAGGTCT	0.537																																					p.S343S		Atlas-SNP	.											.	AFAP1	93	.	0			c.A1029G						PASS	.						145.0	115.0	125.0					4																	7811366		2203	4300	6503	SO:0001819	synonymous_variant	60312	exon9			CTCAGCTGAGGAG	AB209676	CCDS3397.1, CCDS47010.1	4p16	2014-02-12	2007-02-07		ENSG00000196526	ENSG00000196526		"""Pleckstrin homology (PH) domain containing"""	24017	protein-coding gene	gene with protein product		608252				14755689, 11641786, 11607843	Standard	NM_198595		Approved	AFAP-110, AFAP	uc011bwk.1	Q8N556	OTTHUMG00000125515	ENST00000360265.4:c.1029A>G	chr4.hg19:g.7811366T>C		50.0	0.0	.		55.0	18.0	.	NM_001134647	A8K442|B4DMU2|E9PDT7|Q59EY5|Q9HBY1	Silent	SNP	ENST00000360265.4	hg19	CCDS3397.1																																																																																			.	.	.	none		0.537	AFAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246842.2	NM_021638	
GUF1	60558	hgsc.bcm.edu	37	4	44688034	44688034	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr4:44688034T>C	ENST00000281543.5	+	7	922	c.728T>C	c.(727-729)aTc>aCc	p.I243T	GUF1_ENST00000506793.1_3'UTR	NM_021927.2	NP_068746.2			GUF1 GTPase homolog (S. cerevisiae)											breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	19						ATTGAAAGAATCCCCCCGTGA	0.318																																					p.I243T		Atlas-SNP	.											.,1	GUF1	72	.	0			c.T728C						PASS	.						139.0	141.0	140.0					4																	44688034		2203	4298	6501	SO:0001583	missense	60558	exon7			AAAGAATCCCCCC		CCDS3468.1	4p13	2006-02-16			ENSG00000151806	ENSG00000151806			25799	protein-coding gene	gene with protein product						8553703	Standard	NM_021927		Approved	FLJ13220	uc003gww.4	Q8N442	OTTHUMG00000128608	ENST00000281543.5:c.728T>C	chr4.hg19:g.44688034T>C	ENSP00000281543:p.Ile243Thr	40.0	0.0	.		42.0	11.0	.	NM_021927		Missense_Mutation	SNP	ENST00000281543.5	hg19	CCDS3468.1	.	.	.	.	.	.	.	.	.	.	T	19.13	3.768731	0.69878	.	.	ENSG00000151806	ENST00000281543	T	0.72615	-0.67	5.72	5.72	0.89469	Protein synthesis factor, GTP-binding (1);	0.045776	0.85682	D	0.000000	T	0.79082	0.4386	M	0.73430	2.235	0.80722	D	1	P	0.48834	0.916	P	0.51701	0.677	T	0.82159	-0.0595	10	0.87932	D	0	-21.9459	15.1683	0.72846	0.0:0.0:0.0:1.0	.	243	Q8N442	GUF1_HUMAN	T	243	ENSP00000281543:I243T	ENSP00000281543:I243T	I	+	2	0	GUF1	44382791	1.000000	0.71417	1.000000	0.80357	0.482000	0.33219	7.594000	0.82698	2.169000	0.68431	0.460000	0.39030	ATC	.	.	.	none		0.318	GUF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250469.3	NM_021927	
PRDM8	56978	hgsc.bcm.edu	37	4	81123265	81123265	+	Missense_Mutation	SNP	C	C	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr4:81123265C>G	ENST00000504452.1	+	8	1488	c.649C>G	c.(649-651)Cag>Gag	p.Q217E	PRDM8_ENST00000339711.4_Missense_Mutation_p.Q217E|PRDM8_ENST00000415738.2_Missense_Mutation_p.Q217E			Q9NQV8	PRDM8_HUMAN	PR domain containing 8	217	Gly-rich.|Poly-Gln.				corpus callosum morphogenesis (GO:0021540)|corticospinal tract morphogenesis (GO:0021957)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(2)	10						gcagcagcagcagGAGGCACC	0.672											OREG0016246	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q217E		Atlas-SNP	.											.	PRDM8	44	.	0			c.C649G						PASS	.						18.0	24.0	22.0					4																	81123265		2023	4187	6210	SO:0001583	missense	56978	exon4			CAGCAGCAGGAGG	AF275815	CCDS43243.1	4q21	2008-08-21				ENSG00000152784			13993	protein-coding gene	gene with protein product							Standard	NM_020226		Approved		uc003hmc.4	Q9NQV8		ENST00000504452.1:c.649C>G	chr4.hg19:g.81123265C>G	ENSP00000423985:p.Gln217Glu	80.0	0.0	.	1203	100.0	4.0	.	NM_001099403	A8K7X2|Q6IQ36	Missense_Mutation	SNP	ENST00000504452.1	hg19	CCDS43243.1	.	.	.	.	.	.	.	.	.	.	C	13.05	2.122577	0.37436	.	.	ENSG00000152784	ENST00000504452;ENST00000515013;ENST00000339711;ENST00000415738	T;T;T;T	0.63417	-0.04;0.54;-0.04;-0.04	4.66	4.66	0.58398	.	0.633514	0.14982	N	0.287212	T	0.46386	0.1390	N	0.24115	0.695	0.23889	N	0.996557	B	0.25105	0.118	B	0.24006	0.05	T	0.15263	-1.0443	10	0.02654	T	1	.	17.3364	0.87282	0.0:1.0:0.0:0.0	.	217	Q9NQV8	PRDM8_HUMAN	E	217	ENSP00000423985:Q217E;ENSP00000425149:Q217E;ENSP00000339764:Q217E;ENSP00000406998:Q217E	ENSP00000339764:Q217E	Q	+	1	0	PRDM8	81342289	0.010000	0.17322	0.510000	0.27712	0.511000	0.34104	1.329000	0.33770	2.420000	0.82092	0.313000	0.20887	CAG	.	.	.	none		0.672	PRDM8-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362793.1		
PKD2	5311	hgsc.bcm.edu	37	4	88996109	88996109	+	Missense_Mutation	SNP	G	G	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr4:88996109G>C	ENST00000508588.1	+	9	1317	c.922G>C	c.(922-924)Gag>Cag	p.E308Q	PKD2_ENST00000237596.2_Missense_Mutation_p.E890Q|PKD2_ENST00000511337.1_3'UTR|PKD2_ENST00000502363.1_Missense_Mutation_p.E308Q			Q9BZL6	KPCD2_HUMAN	polycystic kidney disease 2 (autosomal dominant)	0					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(2)|lung(15)|skin(4)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)		TGGGGTGGCCGAGGTCAGTAG	0.468																																					p.E890Q		Atlas-SNP	.											.	PKD2	82	.	0			c.G2668C						PASS	.						138.0	108.0	118.0					4																	88996109		2203	4300	6503	SO:0001583	missense	5311	exon14			GTGGCCGAGGTCA	U50928	CCDS3627.1	4q22.1	2014-01-28			ENSG00000118762	ENSG00000118762		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""EF-hand domain containing"""	9009	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 2"""	173910				8298643	Standard	NM_000297		Approved	PKD4, PC2, Pc-2, TRPP2	uc003hre.3	Q13563	OTTHUMG00000160982	ENST00000508588.1:c.922G>C	chr4.hg19:g.88996109G>C	ENSP00000427131:p.Glu308Gln	113.0	0.0	.		87.0	18.0	.	NM_000297	Q8TB08|Q9P0T6|Q9Y3X8	Missense_Mutation	SNP	ENST00000508588.1	hg19		.	.	.	.	.	.	.	.	.	.	G	23.9	4.473075	0.84640	.	.	ENSG00000118762	ENST00000237596;ENST00000508588;ENST00000502363	T;D;D	0.92752	-0.39;-3.1;-3.1	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	D	0.95007	0.8384	L	0.54323	1.7	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	D	0.95429	0.8514	10	0.66056	D	0.02	-21.5133	18.3522	0.90342	0.0:0.0:1.0:0.0	.	890	Q13563	PKD2_HUMAN	Q	890;308;308	ENSP00000237596:E890Q;ENSP00000427131:E308Q;ENSP00000425289:E308Q	ENSP00000237596:E890Q	E	+	1	0	PKD2	89215133	1.000000	0.71417	0.985000	0.45067	0.635000	0.38103	9.576000	0.98192	2.318000	0.78349	0.650000	0.86243	GAG	.	.	.	none		0.468	PKD2-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000363253.2	NM_000297	
DNAH5	1767	hgsc.bcm.edu	37	5	13839483	13839483	+	Missense_Mutation	SNP	A	A	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr5:13839483A>C	ENST00000265104.4	-	35	5968	c.5864T>G	c.(5863-5865)aTa>aGa	p.I1955R		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1955	AAA 1. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					AAGTGGAGTTATTACAAGCCT	0.418									Kartagener syndrome																												p.I1955R		Atlas-SNP	.											.	DNAH5	868	.	0			c.T5864G						PASS	.						126.0	129.0	128.0					5																	13839483		2203	4300	6503	SO:0001583	missense	1767	exon35	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	GGAGTTATTACAA	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.5864T>G	chr5.hg19:g.13839483A>C	ENSP00000265104:p.Ile1955Arg	60.0	0.0	.		55.0	19.0	.	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	hg19	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.138855	0.77775	.	.	ENSG00000039139	ENST00000265104	T	0.14391	2.51	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	T	0.43678	0.1258	M	0.89163	3.01	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.53236	-0.8467	10	0.87932	D	0	.	13.8028	0.63212	1.0:0.0:0.0:0.0	.	1955	Q8TE73	DYH5_HUMAN	R	1955	ENSP00000265104:I1955R	ENSP00000265104:I1955R	I	-	2	0	DNAH5	13892483	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.307000	0.96226	1.870000	0.54199	0.533000	0.62120	ATA	.	.	.	none		0.418	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
AMACR	23600	hgsc.bcm.edu	37	5	33998825	33998825	+	Silent	SNP	A	A	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr5:33998825A>G	ENST00000335606.6	-	4	748	c.660T>C	c.(658-660)taT>taC	p.Y220Y	AMACR_ENST00000502637.1_Silent_p.Y205Y|AMACR_ENST00000512079.1_Silent_p.Y220Y|AMACR_ENST00000514195.1_5'UTR|RP11-1084J3.4_ENST00000382079.3_3'UTR|AMACR_ENST00000382072.2_Missense_Mutation_p.Y167H|AMACR_ENST00000382085.3_Silent_p.Y220Y|AMACR_ENST00000426255.2_Silent_p.Y220Y|AMACR_ENST00000382068.3_Missense_Mutation_p.Y167H|AMACR_ENST00000441713.2_Missense_Mutation_p.Y167H	NM_001167595.1|NM_014324.5	NP_001161067.1|NP_055139.4	Q9UHK6	AMACR_HUMAN	alpha-methylacyl-CoA racemase	220					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	alpha-methylacyl-CoA racemase activity (GO:0008111)|receptor binding (GO:0005102)			endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|stomach(1)|urinary_tract(1)	19						TGTAAGTCGTATAGAAAGGTG	0.458																																					p.Y167H		Atlas-SNP	.											.	AMACR	38	.	0			c.T499C						PASS	.						150.0	134.0	139.0					5																	33998825		2203	4300	6503	SO:0001819	synonymous_variant	23600	exon3			AGTCGTATAGAAA	AF047020	CCDS3902.1, CCDS3903.1, CCDS54836.1	5p13.2	2012-05-16			ENSG00000242110	ENSG00000242110	5.1.99.4		451	protein-coding gene	gene with protein product		604489				9307041	Standard	NM_014324		Approved	RACE	uc003jij.3	Q9UHK6	OTTHUMG00000090734	ENST00000335606.6:c.660T>C	chr5.hg19:g.33998825A>G		135.0	0.0	.		106.0	34.0	.	NM_203382	A5YM47|B8Y916|B8Y918|F8W9N1|O43673|Q3KT79|Q96GH1|Q9Y3Q1	Missense_Mutation	SNP	ENST00000335606.6	hg19	CCDS3902.1	.	.	.	.	.	.	.	.	.	.	A	11.20	1.568213	0.28003	.	.	ENSG00000242110	ENST00000382072;ENST00000441713	T;T	0.70164	-0.36;-0.46	5.34	0.947	0.19555	.	0.056699	0.64402	D	0.000001	T	0.45756	0.1358	.	.	.	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.14755	-1.0461	9	0.15499	T	0.54	-10.3866	8.1708	0.31254	0.5779:0.0:0.4221:0.0	.	167;167	Q6VRU4;Q9UHK6-4	.;.	H	167	ENSP00000371504:Y167H;ENSP00000403800:Y167H	ENSP00000371504:Y167H	Y	-	1	0	AMACR	34034582	0.996000	0.38824	0.997000	0.53966	0.411000	0.31082	0.457000	0.21875	0.241000	0.21283	-0.468000	0.05107	TAC	.	.	.	none		0.458	AMACR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207467.1	NM_014324	
ADAMTS6	11174	hgsc.bcm.edu	37	5	64766709	64766709	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr5:64766709C>T	ENST00000536360.1	-	3	1171	c.358G>A	c.(358-360)Gga>Aga	p.G120R				Q9UKP5	ATS6_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 6	120						proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|pancreas(1)|prostate(1)|skin(3)	18		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)		CACTGGGGTCCATCTTTCCCC	0.373																																					p.G120R		Atlas-SNP	.											.	ADAMTS6	174	.	0			c.G358A						PASS	.						110.0	109.0	109.0					5																	64766709		2203	4300	6503	SO:0001583	missense	11174	exon3			GGGGTCCATCTTT	AF140674	CCDS3983.2	5q13	2008-07-18	2005-08-19		ENSG00000049192	ENSG00000049192		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	222	protein-coding gene	gene with protein product	"""a disintegrin and metalloproteinase with thrombospondin motifs 6"""	605008	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 6"""			10464288	Standard	NM_197941		Approved	ADAM-TS6	uc003jtp.3	Q9UKP5	OTTHUMG00000074079	ENST00000536360.1:c.358G>A	chr5.hg19:g.64766709C>T	ENSP00000440995:p.Gly120Arg	77.0	0.0	.		84.0	22.0	.	NM_197941	Q59EX6|Q5IR87|Q5IR88|Q5IR89|Q68DL1	Missense_Mutation	SNP	ENST00000536360.1	hg19		.	.	.	.	.	.	.	.	.	.	C	25.7	4.664354	0.88251	.	.	ENSG00000049192	ENST00000381055;ENST00000261306;ENST00000464680;ENST00000536360	T;T;T	0.12039	2.72;2.72;2.72	5.78	5.78	0.91487	Peptidase M12B, propeptide (1);	0.000000	0.85682	D	0.000000	T	0.28830	0.0715	L	0.60455	1.87	0.80722	D	1	B	0.33857	0.429	P	0.47134	0.539	T	0.00599	-1.1651	10	0.28530	T	0.3	.	20.3754	0.98918	0.0:1.0:0.0:0.0	.	120	Q9UKP5	ATS6_HUMAN	R	120	ENSP00000370443:G120R;ENSP00000423551:G120R;ENSP00000440995:G120R	ENSP00000261306:G120R	G	-	1	0	ADAMTS6	64802465	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.112000	0.77086	2.894000	0.99253	0.591000	0.81541	GGA	.	.	.	none		0.373	ADAMTS6-201	KNOWN	basic	protein_coding	protein_coding		NM_197941	
PCDHGA5	56110	hgsc.bcm.edu	37	5	140745640	140745640	+	Silent	SNP	C	C	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr5:140745640C>T	ENST00000518069.1	+	1	1743	c.1743C>T	c.(1741-1743)tcC>tcT	p.S581S	PCDHGB2_ENST00000522605.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018918.2|NM_032054.1	NP_061741.1|NP_114443.1	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5	581	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|upper_aerodigestive_tract(3)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCCTCGCTCCGCAGAACCTG	0.627																																					p.S581S		Atlas-SNP	.											.	PCDHGA5	215	.	0			c.C1743T						PASS	.						97.0	108.0	105.0					5																	140745640		2203	4300	6503	SO:0001819	synonymous_variant	56110	exon1			TCGCTCCGCAGAA	AF152512	CCDS54925.1, CCDS75333.1	5q31	2010-01-26				ENSG00000253485		"""Cadherins / Protocadherins : Clustered"""	8703	other	protocadherin	"""cadherin ME3"""	606292				10380929	Standard	NM_018918		Approved	CDH-GAMMA-A5, ME3, PCDH-GAMMA-A5		Q9Y5G8		ENST00000518069.1:c.1743C>T	chr5.hg19:g.140745640C>T		96.0	0.0	.		104.0	35.0	.	NM_032054	Q2M3F5|Q9Y5D2	Silent	SNP	ENST00000518069.1	hg19	CCDS54925.1																																																																																			.	.	.	none		0.627	PCDHGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374742.1	NM_018918	
UBTD2	92181	hgsc.bcm.edu	37	5	171661228	171661228	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr5:171661228C>T	ENST00000393792.2	-	2	610	c.205G>A	c.(205-207)Gag>Aag	p.E69K		NM_152277.2	NP_689490.2	Q8WUN7	UBTD2_HUMAN	ubiquitin domain containing 2	69						cytoplasm (GO:0005737)				cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(1)|prostate(1)|skin(1)	10	Renal(175;0.000159)|Lung NSC(126;0.00976)|all_lung(126;0.0156)	Medulloblastoma(196;0.00853)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TCCCAAATCTCTTTCCGGCCT	0.438																																					p.E69K		Atlas-SNP	.											UBTD2,colon,carcinoma,0,1	UBTD2	26	.	0			c.G205A						PASS	.						165.0	142.0	150.0					5																	171661228		2203	4300	6503	SO:0001583	missense	92181	exon2			AAATCTCTTTCCG	AF251700	CCDS4379.2	5q35.1	2008-10-30			ENSG00000168246	ENSG00000168246			24463	protein-coding gene	gene with protein product	"""dendritic cell derived ubiquitin like protein"""	610174				12507522	Standard	NM_152277		Approved	DC-UbP, MGC30022	uc003mbp.1	Q8WUN7	OTTHUMG00000130519	ENST00000393792.2:c.205G>A	chr5.hg19:g.171661228C>T	ENSP00000377381:p.Glu69Lys	100.0	0.0	.		93.0	32.0	.	NM_152277	Q8TDQ3	Missense_Mutation	SNP	ENST00000393792.2	hg19	CCDS4379.2	.	.	.	.	.	.	.	.	.	.	C	29.8	5.035386	0.93630	.	.	ENSG00000168246	ENST00000393792	T	0.64260	-0.09	5.51	5.51	0.81932	.	0.047322	0.85682	D	0.000000	D	0.84014	0.5379	M	0.93328	3.405	0.80722	D	1	D	0.54772	0.968	D	0.66847	0.947	D	0.87994	0.2751	10	0.87932	D	0	.	16.9267	0.86178	0.0:1.0:0.0:0.0	.	69	Q8WUN7	UBTD2_HUMAN	K	69	ENSP00000377381:E69K	ENSP00000377381:E69K	E	-	1	0	UBTD2	171593833	1.000000	0.71417	1.000000	0.80357	0.653000	0.38743	7.640000	0.83355	2.584000	0.87258	0.563000	0.77884	GAG	.	.	.	none		0.438	UBTD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252936.1	NM_152277	
RGS14	10636	hgsc.bcm.edu	37	5	176798989	176798989	+	Silent	SNP	C	C	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr5:176798989C>T	ENST00000408923.3	+	15	1802	c.1614C>T	c.(1612-1614)ccC>ccT	p.P538P	RGS14_ENST00000506944.1_3'UTR	NM_006480.4	NP_006471.2	O43566	RGS14_HUMAN	regulator of G-protein signaling 14	538					cell division (GO:0051301)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mitotic nuclear division (GO:0007067)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of synaptic plasticity (GO:0031914)|nucleocytoplasmic transport (GO:0006913)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of GTPase activity (GO:0043547)|positive regulation of neurogenesis (GO:0050769)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to oxidative stress (GO:0006979)|spindle organization (GO:0007051)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual learning (GO:0008542)|zygote asymmetric cell division (GO:0010070)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|microtubule (GO:0005874)|nuclear body (GO:0016604)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|spindle (GO:0005819)|spindle pole (GO:0000922)	GDP-dissociation inhibitor activity (GO:0005092)|GTPase activator activity (GO:0005096)|microtubule binding (GO:0008017)|receptor signaling complex scaffold activity (GO:0030159)|receptor signaling protein activity (GO:0005057)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|skin(3)|upper_aerodigestive_tract(1)	12	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCCAAGGGCCCAGCTCCGAGG	0.627																																					p.P538P	NSCLC(47;353 1896 28036)	Atlas-SNP	.											.	RGS14	34	.	0			c.C1614T						PASS	.						108.0	130.0	123.0					5																	176798989		2003	4169	6172	SO:0001819	synonymous_variant	10636	exon15			AGGGCCCAGCTCC	AF037195	CCDS43405.1	5q35.3	2008-02-05	2007-08-14		ENSG00000169220	ENSG00000169220		"""Regulators of G-protein signaling"""	9996	protein-coding gene	gene with protein product		602513	"""regulator of G-protein signalling 14"""				Standard	NM_006480		Approved		uc003mgf.3	O43566	OTTHUMG00000163324	ENST00000408923.3:c.1614C>T	chr5.hg19:g.176798989C>T		60.0	0.0	.		44.0	18.0	.	NM_006480	O43565|Q506M1|Q6ZWA4|Q8TD62	Silent	SNP	ENST00000408923.3	hg19	CCDS43405.1	.	.	.	.	.	.	.	.	.	.	C	2.400	-0.337801	0.05278	.	.	ENSG00000169220	ENST00000511890	T	0.45276	0.9	4.52	1.21	0.21127	.	0.378652	0.25866	N	0.027786	T	0.45975	0.1369	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.44922	-0.9296	7	0.87932	D	0	-6.9952	11.7553	0.51872	0.4686:0.5314:0.0:0.0	.	.	.	.	L	409	ENSP00000422329:P409L	ENSP00000422329:P409L	P	+	2	0	RGS14	176731595	0.000000	0.05858	0.363000	0.25875	0.442000	0.32017	-0.925000	0.03992	0.463000	0.27118	0.644000	0.83932	CCA	.	.	.	none		0.627	RGS14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372676.1	NM_006480	
HIST1H2BJ	8970	hgsc.bcm.edu	37	6	27100264	27100264	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr6:27100264G>A	ENST00000607124.1	-	1	265	c.266C>T	c.(265-267)aCc>aTc	p.T89I	HIST1H2AG_ENST00000359193.2_5'Flank|HIST1H2BJ_ENST00000339812.2_Missense_Mutation_p.T89I|HIST1H2BJ_ENST00000541790.1_Missense_Mutation_p.T89I			P06899	H2B1J_HUMAN	histone cluster 1, H2bj	89					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|kidney(2)|lung(5)|ovary(1)|prostate(1)	10						GGAGGTGATGGTCGAGCGCTT	0.602																																					p.T89I		Atlas-SNP	.											.	HIST1H2BJ	21	.	0			c.C266T						PASS	.						93.0	94.0	94.0					6																	27100264		2203	4297	6500	SO:0001583	missense	8970	exon1			GTGATGGTCGAGC	X00088	CCDS4618.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000124635	ENSG00000124635		"""Histones / Replication-dependent"""	4761	protein-coding gene	gene with protein product		615044	"""H2B histone family, member R"", ""histone 1, H2bj"""	H2BFR		6647026, 12408966	Standard	NM_021058		Approved	H2B/r	uc003niv.3	P06899	OTTHUMG00000014470	ENST00000607124.1:c.266C>T	chr6.hg19:g.27100264G>A	ENSP00000476136:p.Thr89Ile	62.0	0.0	.		33.0	12.0	.	NM_021058	B2R4J4|O60816	Missense_Mutation	SNP	ENST00000607124.1	hg19	CCDS4618.1	.	.	.	.	.	.	.	.	.	.	G	31	5.078432	0.94000	.	.	ENSG00000124635	ENST00000541790;ENST00000339812	T;T	0.41758	0.99;0.99	4.16	4.16	0.48862	Histone-fold (2);Histone core (1);	0.000000	0.44097	U	0.000487	T	0.67590	0.2909	M	0.93241	3.395	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.77512	-0.2560	10	0.87932	D	0	.	14.7851	0.69796	0.0:0.0:1.0:0.0	.	89	P06899	H2B1J_HUMAN	I	89	ENSP00000445633:T89I;ENSP00000342886:T89I	ENSP00000342886:T89I	T	-	2	0	HIST1H2BJ	27208243	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.903000	0.92573	2.268000	0.75426	0.585000	0.79938	ACC	.	.	.	none		0.602	HIST1H2BJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040138.2	NM_021058	
KCNK16	83795	hgsc.bcm.edu	37	6	39285639	39285639	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr6:39285639G>T	ENST00000373229.5	-	3	431	c.418C>A	c.(418-420)Ctc>Atc	p.L140I	KCNK16_ENST00000507712.1_Missense_Mutation_p.L75I|KCNK16_ENST00000437525.2_Missense_Mutation_p.L140I|KCNK16_ENST00000425054.2_Missense_Mutation_p.L140I|KCNK16_ENST00000373227.4_Missense_Mutation_p.L140I	NM_032115.3	NP_115491.1	Q96T55	KCNKG_HUMAN	potassium channel, subfamily K, member 16	140					potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)	13						AGGTGGTTGAGGAAGATCACG	0.592																																					p.L140I		Atlas-SNP	.											.	KCNK16	59	.	0			c.C418A						PASS	.						63.0	52.0	56.0					6																	39285639		2203	4300	6503	SO:0001583	missense	83795	exon3			GGTTGAGGAAGAT	AF358909	CCDS4843.1, CCDS47420.1, CCDS47421.1, CCDS47422.1	6p21.2-p21.1	2012-03-07			ENSG00000095981	ENSG00000095981		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14464	protein-coding gene	gene with protein product		607369				11263999, 16382106	Standard	NM_032115		Approved	K2p16.1, TALK-1, TALK1	uc003ooq.3	Q96T55	OTTHUMG00000014645	ENST00000373229.5:c.418C>A	chr6.hg19:g.39285639G>T	ENSP00000362326:p.Leu140Ile	67.0	0.0	.		60.0	7.0	.	NM_001135106	B5TJL9|Q2M2N9|Q5TCF3|Q6X6Z3|Q6X6Z4|Q6X6Z5|Q9H591	Missense_Mutation	SNP	ENST00000373229.5	hg19	CCDS4843.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.504087	0.85176	.	.	ENSG00000095981	ENST00000373229;ENST00000425054;ENST00000507712;ENST00000373227;ENST00000437525	T;T;T;T;T	0.21734	1.99;1.99;1.99;1.99;1.99	5.65	4.78	0.61160	Ion transport 2 (1);	0.065126	0.64402	D	0.000007	T	0.26702	0.0653	L	0.41632	1.29	0.45979	D	0.998796	P;P;D;D	0.76494	0.939;0.707;0.986;0.999	P;P;P;D	0.77557	0.589;0.624;0.793;0.99	T	0.00599	-1.1651	10	0.39692	T	0.17	.	14.537	0.67969	0.0721:0.0:0.9279:0.0	.	140;140;140;140	B5TJL9;Q96T55-5;Q96T55-4;Q96T55	.;.;.;KCNKG_HUMAN	I	140;140;75;140;140	ENSP00000362326:L140I;ENSP00000391498:L140I;ENSP00000423842:L75I;ENSP00000362324:L140I;ENSP00000415375:L140I	ENSP00000362324:L140I	L	-	1	0	KCNK16	39393617	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	5.106000	0.64597	2.667000	0.90743	0.561000	0.74099	CTC	.	.	.	none		0.592	KCNK16-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040452.2	NM_032115	
PRSS35	167681	hgsc.bcm.edu	37	6	84233613	84233613	+	Silent	SNP	C	C	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr6:84233613C>T	ENST00000369700.3	+	2	630	c.453C>T	c.(451-453)tcC>tcT	p.S151S	PRSS35_ENST00000536636.1_Silent_p.S151S	NM_153362.2	NP_699193.2	Q8N3Z0	PRS35_HUMAN	protease, serine, 35	151	Peptidase S1.					extracellular region (GO:0005576)|mitochondrion (GO:0005739)	serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(2)|large_intestine(12)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	32		all_cancers(76;0.000113)|Acute lymphoblastic leukemia(125;1.09e-08)|all_hematologic(105;3.12e-05)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0768)		TGAAGCTTTCCACGGGCTGTA	0.463																																					p.S151S		Atlas-SNP	.											.	PRSS35	60	.	0			c.C453T						PASS	.						101.0	100.0	101.0					6																	84233613		2203	4300	6503	SO:0001819	synonymous_variant	167681	exon2			GCTTTCCACGGGC	BC037170	CCDS4999.1	6q14.2	2010-05-12	2004-07-09	2004-07-09	ENSG00000146250	ENSG00000146250		"""Serine peptidases / Serine peptidases"""	21387	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 158"""	C6orf158			Standard	NM_153362		Approved	MGC46520, dJ223E3.1	uc003pjz.3	Q8N3Z0	OTTHUMG00000015113	ENST00000369700.3:c.453C>T	chr6.hg19:g.84233613C>T		129.0	0.0	.		115.0	40.0	.	NM_153362	A8K7B3|Q9BQP6	Silent	SNP	ENST00000369700.3	hg19	CCDS4999.1																																																																																			.	.	.	none		0.463	PRSS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041352.1	NM_153362	
ENPP3	5169	hgsc.bcm.edu	37	6	132059234	132059234	+	Missense_Mutation	SNP	A	A	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr6:132059234A>C	ENST00000414305.1	+	24	2559	c.2231A>C	c.(2230-2232)aAt>aCt	p.N744T	ENPP3_ENST00000358229.5_3'UTR|ENPP3_ENST00000357639.3_Missense_Mutation_p.N744T			O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 3	744	Nuclease.		N -> H (in dbSNP:rs36094194).		immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		AATGGAGTAAATGTGGTTAGT	0.303																																					p.N744T		Atlas-SNP	.											.	ENPP3	117	.	0			c.A2231C						PASS	.						114.0	125.0	121.0					6																	132059234		2203	4297	6500	SO:0001583	missense	5169	exon23			GAGTAAATGTGGT	AF005632	CCDS5148.1	6q22	2010-06-23			ENSG00000154269	ENSG00000154269	3.1.4.1, 3.6.1.9	"""CD molecules"""	3358	protein-coding gene	gene with protein product		602182		PDNP3		9344668	Standard	NM_005021		Approved	PD-IBETA, gp130RB13-6, B10, CD203c	uc003qcv.3	O14638	OTTHUMG00000016292	ENST00000414305.1:c.2231A>C	chr6.hg19:g.132059234A>C	ENSP00000406261:p.Asn744Thr	91.0	0.0	.		78.0	29.0	.	NM_005021	Q5JTL3	Missense_Mutation	SNP	ENST00000414305.1	hg19	CCDS5148.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.286561	0.80803	.	.	ENSG00000154269	ENST00000414305;ENST00000357639	T;T	0.69040	-0.37;-0.37	6.08	6.08	0.98989	DNA/RNA non-specific endonuclease (2);Extracellular Endonuclease, subunit A (2);	0.196594	0.45867	D	0.000330	D	0.83036	0.5167	M	0.89534	3.04	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86746	0.1957	10	0.87932	D	0	-31.3676	16.6512	0.85203	1.0:0.0:0.0:0.0	.	744	O14638	ENPP3_HUMAN	T	744	ENSP00000406261:N744T;ENSP00000350265:N744T	ENSP00000350265:N744T	N	+	2	0	ENPP3	132100927	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.974000	0.88039	2.333000	0.79357	0.482000	0.46254	AAT	.	.	.	none		0.303	ENPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043627.2		
SNX9	51429	hgsc.bcm.edu	37	6	158358486	158358486	+	Missense_Mutation	SNP	C	C	A	rs532553158		TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr6:158358486C>A	ENST00000392185.3	+	15	1635	c.1464C>A	c.(1462-1464)ttC>ttA	p.F488L		NM_016224.3	NP_057308.1	Q9Y5X1	SNX9_HUMAN	sorting nexin 9	488	BAR.				cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|lipid tube assembly (GO:0060988)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|positive regulation of GTPase activity (GO:0043547)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of protein oligomerization (GO:0032461)|receptor-mediated endocytosis (GO:0006898)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle membrane (GO:0030659)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	1-phosphatidylinositol binding (GO:0005545)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)	p.F488F(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	20		Breast(66;0.000776)|Ovarian(120;0.0303)|Prostate(117;0.167)		OV - Ovarian serous cystadenocarcinoma(65;8.06e-18)|BRCA - Breast invasive adenocarcinoma(81;4.48e-05)		ATCTCCATTTCCTGATGGAAT	0.378																																					p.F488L		Atlas-SNP	.											SNX9,head_neck,malignant_melanoma,0,1	SNX9	43	.	1	Substitution - coding silent(1)	skin(1)	c.C1464A						PASS	.						149.0	143.0	145.0					6																	158358486		2203	4300	6503	SO:0001583	missense	51429	exon15			CCATTTCCTGATG	AF121859	CCDS5253.1	6q25.1-q26	2008-05-22			ENSG00000130340	ENSG00000130340		"""Sorting nexins"""	14973	protein-coding gene	gene with protein product		605952				10531379, 17609109	Standard	NM_016224		Approved	SH3PX1, SDP1, SH3PXD3A	uc003qqv.1	Q9Y5X1	OTTHUMG00000015903	ENST00000392185.3:c.1464C>A	chr6.hg19:g.158358486C>A	ENSP00000376024:p.Phe488Leu	79.0	0.0	.		80.0	20.0	.	NM_016224	Q9BSI7|Q9BVM1|Q9UJH6|Q9UP20	Missense_Mutation	SNP	ENST00000392185.3	hg19	CCDS5253.1	.	.	.	.	.	.	.	.	.	.	C	18.01	3.528865	0.64860	.	.	ENSG00000130340	ENST00000539592;ENST00000392185;ENST00000252631	T	0.40476	1.03	5.39	2.61	0.31194	Sorting nexin protein, WASP-binding domain (1);	0.045544	0.85682	D	0.000000	T	0.20292	0.0488	L	0.43152	1.355	0.80722	D	1	P	0.52842	0.956	B	0.41619	0.361	T	0.03344	-1.1046	10	0.48119	T	0.1	-10.3916	8.3841	0.32491	0.0:0.6569:0.0:0.3431	.	488	Q9Y5X1	SNX9_HUMAN	L	488;488;288	ENSP00000376024:F488L	ENSP00000252631:F288L	F	+	3	2	SNX9	158278474	0.996000	0.38824	1.000000	0.80357	0.985000	0.73830	0.455000	0.21843	2.673000	0.90976	0.563000	0.77884	TTC	.	.	.	none		0.378	SNX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042856.1		
GCK	2645	hgsc.bcm.edu	37	7	44185276	44185276	+	Missense_Mutation	SNP	C	C	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr7:44185276C>G	ENST00000403799.3	-	9	1542	c.1073G>C	c.(1072-1074)cGa>cCa	p.R358P	GCK_ENST00000345378.2_Missense_Mutation_p.R359P|GCK_ENST00000395796.3_Missense_Mutation_p.R357P|GCK_ENST00000437084.1_Missense_Mutation_p.R341P	NM_000162.3	NP_000153.1	P35557	HXK4_HUMAN	glucokinase (hexokinase 4)	358	Hexokinase type-2.				calcium ion import (GO:0070509)|carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|cellular response to glucose starvation (GO:0042149)|cellular response to insulin stimulus (GO:0032869)|cellular response to leptin stimulus (GO:0044320)|detection of glucose (GO:0051594)|endocrine pancreas development (GO:0031018)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glycogen biosynthetic process (GO:0005978)|glycolytic process (GO:0006096)|hexose transport (GO:0008645)|NADP metabolic process (GO:0006739)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of gluconeogenesis (GO:0045721)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of insulin secretion (GO:0032024)|positive regulation of phosphorylation (GO:0042327)|regulation of glucose transport (GO:0010827)|regulation of glycolytic process (GO:0006110)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transport (GO:0043266)|second-messenger-mediated signaling (GO:0019932)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|secretory granule (GO:0030141)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|glucokinase activity (GO:0004340)|glucose binding (GO:0005536)|magnesium ion binding (GO:0000287)			central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(17)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	37						GGTCGAGGGTCGCAGCCCCAG	0.697																																					p.R359P		Atlas-SNP	.											.	GCK	125	.	0			c.G1076C						PASS	.						30.0	34.0	33.0					7																	44185276		2203	4299	6502	SO:0001583	missense	2645	exon9			GAGGGTCGCAGCC	AF041014	CCDS5479.1, CCDS5480.1, CCDS5481.1	7p15.3-p15.1	2008-02-07	2008-02-07		ENSG00000106633	ENSG00000106633	2.7.1.2, 2.7.1.1		4195	protein-coding gene	gene with protein product		138079	"""maturity onset diabetes of the young 2"""	MODY2		1740341, 1502186	Standard	NM_033507		Approved	HK4	uc003tkk.1	P35557	OTTHUMG00000022903	ENST00000403799.3:c.1073G>C	chr7.hg19:g.44185276C>G	ENSP00000384247:p.Arg358Pro	60.0	0.0	.		70.0	27.0	.	NM_033507	A4D2J2|A4D2J3|Q05810	Missense_Mutation	SNP	ENST00000403799.3	hg19	CCDS5479.1	.	.	.	.	.	.	.	.	.	.	C	11.13	1.547708	0.27652	.	.	ENSG00000106633	ENST00000336642;ENST00000403799;ENST00000395796;ENST00000345378;ENST00000437084	D;D;D;D;D	0.98044	-4.68;-4.68;-4.68;-4.68;-4.68	5.2	4.22	0.49857	Hexokinase, C-terminal (1);	0.488216	0.21760	N	0.069537	D	0.92961	0.7760	N	0.17248	0.465	0.36805	D	0.885564	B;B;B;B;B	0.32128	0.357;0.0;0.308;0.0;0.357	B;B;B;B;B	0.34536	0.094;0.001;0.185;0.003;0.094	D	0.91899	0.5530	10	0.34782	T	0.22	-12.1896	7.8212	0.29288	0.2196:0.6875:0.0:0.0928	.	358;359;357;341;358	P35557;P35557-2;P35557-3;C9JQD1;A7LFL1	HXK4_HUMAN;.;.;.;.	P	42;358;357;359;341	ENSP00000338009:R42P;ENSP00000384247:R358P;ENSP00000379142:R357P;ENSP00000223366:R359P;ENSP00000402840:R341P	ENSP00000338009:R42P	R	-	2	0	GCK	44151801	0.070000	0.21116	0.955000	0.39395	0.307000	0.27823	1.831000	0.39141	2.403000	0.81681	0.462000	0.41574	CGA	.	.	.	none		0.697	GCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251069.2		
POM121C	100101267	hgsc.bcm.edu	37	7	75070316	75070316	+	Missense_Mutation	SNP	A	A	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr7:75070316A>C	ENST00000257665.5	-	3	868	c.869T>G	c.(868-870)cTg>cGg	p.L290R	POM121C_ENST00000453279.2_Missense_Mutation_p.L48R			A8CG34	P121C_HUMAN	POM121 transmembrane nucleoporin C	290	Pore side. {ECO:0000255}.|Required for targeting to the nucleus and nuclear pore complex.				mRNA transport (GO:0051028)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|nuclear pore (GO:0005643)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	14						GAGGGCACTCAGTACAGTCTC	0.438																																					p.L48R		Atlas-SNP	.											.	POM121C	46	.	0			c.T143G						PASS	.						141.0	153.0	149.0					7																	75070316		2203	4298	6501	SO:0001583	missense	100101267	exon5			GCACTCAGTACAG		CCDS47617.1	7q11.23	2012-03-13	2012-03-13		ENSG00000135213	ENSG00000272391			34005	protein-coding gene	gene with protein product		615754	"""POM121 membrane glycoprotein C"""			17900573	Standard	NM_001099415		Approved		uc003udk.4	A8CG34	OTTHUMG00000156238	ENST00000257665.5:c.869T>G	chr7.hg19:g.75070316A>C	ENSP00000257665:p.Leu290Arg	146.0	0.0	.		138.0	33.0	.	NM_001099415	O75115|Q9Y2N3|Q9Y4S7	Missense_Mutation	SNP	ENST00000257665.5	hg19		.	.	.	.	.	.	.	.	.	.	A	13.49	2.253891	0.39896	.	.	ENSG00000135213	ENST00000257665;ENST00000453279	T;T	0.39229	2.64;1.09	4.27	3.09	0.35607	.	0.499492	0.14888	N	0.292593	T	0.62233	0.2411	M	0.81497	2.545	0.44142	D	0.996934	D	0.89917	1.0	D	0.74674	0.984	T	0.60767	-0.7198	10	0.87932	D	0	.	8.0021	0.30304	0.8181:0.0:0.0:0.1819	.	290	A8CG34	P121C_HUMAN	R	290;48	ENSP00000257665:L290R;ENSP00000414208:L48R	ENSP00000257665:L290R	L	-	2	0	POM121C	74908252	1.000000	0.71417	0.998000	0.56505	0.211000	0.24417	6.656000	0.74396	0.601000	0.29879	-0.676000	0.03789	CTG	.	.	.	none		0.438	POM121C-003	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000343919.2	NM_001099415	
LHFPL3	375612	hgsc.bcm.edu	37	7	103969251	103969251	+	Silent	SNP	C	C	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr7:103969251C>T	ENST00000535008.1	+	1	148	c.24C>T	c.(22-24)gcC>gcT	p.A8A	LHFPL3_ENST00000543266.1_Silent_p.A8A|LHFPL3_ENST00000401970.2_5'UTR|LHFPL3_ENST00000424859.1_5'UTR			Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 3	8						integral component of membrane (GO:0016021)		p.A8A(1)		kidney(1)|large_intestine(2)|lung(6)	9						ccgccgctgccgccgccgccg	0.721																																					p.A8A		Atlas-SNP	.											LHFPL3,NS,carcinoma,0,1	LHFPL3	24	.	1	Substitution - coding silent(1)	kidney(1)	c.C24T						PASS	.						11.0	14.0	13.0					7																	103969251		1949	4092	6041	SO:0001819	synonymous_variant	375612	exon1			CGCTGCCGCCGCC	AY260763		7q22.2	2006-06-13			ENSG00000187416	ENSG00000187416			6589	protein-coding gene	gene with protein product		609719	"""lipoma HMGIC fusion partner-like 4"""	LHFPL4		10329012	Standard	NM_199000		Approved		uc003vce.3	Q86UP9	OTTHUMG00000157273	ENST00000535008.1:c.24C>T	chr7.hg19:g.103969251C>T		29.0	1.0	.		37.0	2.0	.	NM_199000	A1L383|A4D0Q5	Silent	SNP	ENST00000535008.1	hg19																																																																																				.	.	.	none		0.721	LHFPL3-201	KNOWN	basic	protein_coding	protein_coding		NM_199000	
MYOM2	9172	hgsc.bcm.edu	37	8	2020508	2020508	+	Missense_Mutation	SNP	G	G	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr8:2020508G>C	ENST00000262113.4	+	9	1018	c.877G>C	c.(877-879)Gag>Cag	p.E293Q	MYOM2_ENST00000523438.1_Intron	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	293	Ig-like C2-type 2.				muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		GAGGGAAGGCGAGACGGTCAC	0.602																																					p.E293Q		Atlas-SNP	.											MYOM2,NS,malignant_melanoma,0,2	MYOM2	251	.	0			c.G877C						PASS	.						85.0	70.0	75.0					8																	2020508		2203	4300	6503	SO:0001583	missense	9172	exon9			GAAGGCGAGACGG		CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.877G>C	chr8.hg19:g.2020508G>C	ENSP00000262113:p.Glu293Gln	37.0	0.0	.		29.0	9.0	.	NM_003970	Q7Z3Y2	Missense_Mutation	SNP	ENST00000262113.4	hg19	CCDS5957.1	.	.	.	.	.	.	.	.	.	.	G	17.83	3.485155	0.63962	.	.	ENSG00000036448	ENST00000262113	T	0.46063	0.88	5.13	4.25	0.50352	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.208574	0.40818	N	0.001006	T	0.46308	0.1386	M	0.63843	1.955	0.80722	D	1	B	0.29136	0.234	B	0.34180	0.177	T	0.50206	-0.8855	10	0.72032	D	0.01	.	15.6628	0.77203	0.0:0.1376:0.8624:0.0	.	293	P54296	MYOM2_HUMAN	Q	293	ENSP00000262113:E293Q	ENSP00000262113:E293Q	E	+	1	0	MYOM2	2007915	1.000000	0.71417	0.800000	0.32199	0.700000	0.40528	4.275000	0.58927	1.132000	0.42129	0.655000	0.94253	GAG	.	.	.	none		0.602	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251249.1	NM_003970	
LOXL2	4017	hgsc.bcm.edu	37	8	23198538	23198538	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr8:23198538G>A	ENST00000389131.3	-	4	1079	c.710C>T	c.(709-711)cCt>cTt	p.P237L	RP11-177H13.2_ENST00000519692.1_RNA	NM_002318.2	NP_002309.1	Q9Y4K0	LOXL2_HUMAN	lysyl oxidase-like 2	237	SRCR 2. {ECO:0000255|PROSITE- ProRule:PRU00196}.				aging (GO:0007568)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|collagen fibril organization (GO:0030199)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|epithelial to mesenchymal transition (GO:0001837)|histone modification (GO:0016570)|negative regulation of transcription, DNA-templated (GO:0045892)|oxidation-reduction process (GO:0055114)|positive regulation of chondrocyte differentiation (GO:0032332)|protein deamination (GO:0018277)|response to copper ion (GO:0046688)|response to hypoxia (GO:0001666)|sprouting angiogenesis (GO:0002040)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|chromosome (GO:0005694)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|methylated histone binding (GO:0035064)|oligosaccharide binding (GO:0070492)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(5)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(55;0.0453)|Breast(100;0.143)		Colorectal(74;0.0288)|COAD - Colon adenocarcinoma(73;0.096)		CCTCTCCCCAGGGAAGCCAAA	0.537																																					p.P237L		Atlas-SNP	.											.	LOXL2	97	.	0			c.C710T						PASS	.						163.0	132.0	142.0					8																	23198538		2203	4300	6503	SO:0001583	missense	4017	exon4			TCCCCAGGGAAGC	U89942	CCDS34864.1	8p21.3	2008-05-15				ENSG00000134013			6666	protein-coding gene	gene with protein product		606663				9722957	Standard	NM_002318		Approved	WS9-14	uc003xdh.1	Q9Y4K0		ENST00000389131.3:c.710C>T	chr8.hg19:g.23198538G>A	ENSP00000373783:p.Pro237Leu	45.0	0.0	.		45.0	15.0	.	NM_002318	B2R5Q0|Q53HV3|Q9BW70|Q9Y5Y8	Missense_Mutation	SNP	ENST00000389131.3	hg19	CCDS34864.1	.	.	.	.	.	.	.	.	.	.	G	19.94	3.920583	0.73213	.	.	ENSG00000134013	ENST00000389131	T	0.60424	0.19	5.83	5.83	0.93111	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.047123	0.85682	D	0.000000	T	0.78381	0.4274	M	0.83118	2.625	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.80636	-0.1294	10	0.72032	D	0.01	.	16.8345	0.85953	0.0:0.0:1.0:0.0	.	237	Q9Y4K0	LOXL2_HUMAN	L	237	ENSP00000373783:P237L	ENSP00000373783:P237L	P	-	2	0	LOXL2	23254483	1.000000	0.71417	0.975000	0.42487	0.192000	0.23643	9.751000	0.98889	2.750000	0.94351	0.655000	0.94253	CCT	.	.	.	none		0.537	LOXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375603.1		
EXOSC4	54512	hgsc.bcm.edu	37	8	145134932	145134932	+	Silent	SNP	C	C	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr8:145134932C>T	ENST00000316052.5	+	2	361	c.258C>T	c.(256-258)cgC>cgT	p.R86R	GPAA1_ENST00000361036.6_5'Flank|EXOSC4_ENST00000525936.1_Intron|GPAA1_ENST00000355091.4_5'Flank|CTD-3065J16.9_ENST00000524499.1_RNA	NM_019037.2	NP_061910.1	Q9NPD3	EXOS4_HUMAN	exosome component 4	86					defense response to virus (GO:0051607)|DNA deamination (GO:0045006)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|maturation of 5.8S rRNA (GO:0000460)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of cell growth (GO:0030307)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	3'-5'-exoribonuclease activity (GO:0000175)|AU-rich element binding (GO:0017091)			lung(4)|prostate(1)|upper_aerodigestive_tract(2)	7	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;3.48e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CAGGTGAGCGCAAGCGACGGC	0.627																																					p.R86R		Atlas-SNP	.											EXOSC4,right_upper_lobe,carcinoma,0,1	EXOSC4	19	.	0			c.C258T						PASS	.						84.0	83.0	83.0					8																	145134932		2203	4300	6503	SO:0001819	synonymous_variant	54512	exon2			TGAGCGCAAGCGA	AF281133	CCDS6414.1	8q24.3	2004-03-26			ENSG00000178896	ENSG00000178896			18189	protein-coding gene	gene with protein product	"""exosome component Rrp41"""	606491				11110791	Standard	NM_019037		Approved	hRrp41p, FLJ20591, Rrp41p, RRP41, RRP41A, Ski6p, SKI6, p12A	uc003zau.3	Q9NPD3	OTTHUMG00000165437	ENST00000316052.5:c.258C>T	chr8.hg19:g.145134932C>T		86.0	0.0	.		118.0	40.0	.	NM_019037		Silent	SNP	ENST00000316052.5	hg19	CCDS6414.1																																																																																			.	.	.	none		0.627	EXOSC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384065.1	NM_019037	
SLC39A4	55630	hgsc.bcm.edu	37	8	145640398	145640398	+	Missense_Mutation	SNP	G	G	T	rs200044971		TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr8:145640398G>T	ENST00000301305.3	-	4	869	c.764C>A	c.(763-765)cCc>cAc	p.P255H	SLC39A4_ENST00000276833.5_Missense_Mutation_p.P230H|SLC39A4_ENST00000531013.1_5'Flank	NM_130849.2	NP_570901	Q6P5W5	S39A4_HUMAN	solute carrier family 39 (zinc transporter), member 4	255					cellular response to zinc ion starvation (GO:0034224)|cellular zinc ion homeostasis (GO:0006882)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	14	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;1.12e-40)|all cancers(56;8.17e-36)|BRCA - Breast invasive adenocarcinoma(115;0.0407)|Colorectal(110;0.055)			GCTGATGAGGGGCACAGGGTC	0.672																																					p.P255H		Atlas-SNP	.											.	SLC39A4	54	.	0			c.C764A						PASS	.						40.0	45.0	43.0					8																	145640398		2203	4300	6503	SO:0001583	missense	55630	exon4			ATGAGGGGCACAG	AK025537	CCDS6424.1, CCDS43782.1	8q24.3	2013-05-22			ENSG00000147804	ENSG00000147804		"""Solute carriers"""	17129	protein-coding gene	gene with protein product		607059	"""acrodermatitis enteropathica, zinc-deficiency type"""	AEZ		12801924, 12659941, 14709598	Standard	NM_017767		Approved	ZIP4, AWMS2	uc003zcq.3	Q6P5W5		ENST00000301305.3:c.764C>A	chr8.hg19:g.145640398G>T	ENSP00000301305:p.Pro255His	32.0	0.0	.		38.0	15.0	.	NM_130849	Q7L5S5|Q9H6T8|Q9NXC4	Missense_Mutation	SNP	ENST00000301305.3	hg19	CCDS6424.1	.	.	.	.	.	.	.	.	.	.	G	15.50	2.850768	0.51270	.	.	ENSG00000147804	ENST00000276833;ENST00000301305;ENST00000526658	T;T;T	0.57436	0.4;0.4;0.4	5.0	-4.46	0.03536	.	3.799390	0.00575	N	0.000304	T	0.39989	0.1099	L	0.47716	1.5	0.09310	N	1	B;B	0.18461	0.028;0.028	B;B	0.16722	0.016;0.016	T	0.09662	-1.0664	10	0.38643	T	0.18	-5.3671	0.812	0.01095	0.3985:0.1207:0.2362:0.2446	.	255;230	Q6P5W5;A6NDY5	S39A4_HUMAN;.	H	230;255;161	ENSP00000276833:P230H;ENSP00000301305:P255H;ENSP00000434512:P161H	ENSP00000276833:P230H	P	-	2	0	SLC39A4	145611206	0.002000	0.14202	0.000000	0.03702	0.037000	0.13140	-0.570000	0.05895	-0.723000	0.04915	-0.320000	0.08662	CCC	.	G|0.998;A|0.002	.	alt		0.672	SLC39A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382688.1		
CCDC171	203238	hgsc.bcm.edu	37	9	15729747	15729747	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr9:15729747T>C	ENST00000380701.3	+	16	2328	c.2000T>C	c.(1999-2001)cTa>cCa	p.L667P	CCDC171_ENST00000297641.3_Missense_Mutation_p.L667P	NM_173550.2	NP_775821.2	Q6TFL3	CC171_HUMAN	coiled-coil domain containing 171	667																	AAGAAGGAACTAGAGCTGCAG	0.463																																					p.L667P		Atlas-SNP	.											.	.	.	.	0			c.T2000C						PASS	.						96.0	99.0	98.0					9																	15729747		2203	4299	6502	SO:0001583	missense	203238	exon16			AGGAACTAGAGCT	AY422473	CCDS6481.1	9p22.2	2012-03-26	2012-03-26	2012-03-26	ENSG00000164989	ENSG00000164989			29828	protein-coding gene	gene with protein product	"""myosin tail domain containing protein"""		"""chromosome 9 open reading frame 93"""	C9orf93		14702039	Standard	NM_173550		Approved	FLJ39267, FLJ46740, Em:AL513423.1, bA778P13.1, bA536D16.1	uc003zmd.3	Q6TFL3	OTTHUMG00000019584	ENST00000380701.3:c.2000T>C	chr9.hg19:g.15729747T>C	ENSP00000370077:p.Leu667Pro	101.0	0.0	.		120.0	35.0	.	NM_173550	B7ZM22|Q5SU58|Q6P1W1|Q6ZR13|Q8N1Z4|Q8N8L3|Q8TBR2	Missense_Mutation	SNP	ENST00000380701.3	hg19	CCDS6481.1	.	.	.	.	.	.	.	.	.	.	T	16.14	3.037598	0.54896	.	.	ENSG00000164989	ENST00000297641;ENST00000380701	T;T	0.25912	1.77;1.77	5.61	5.61	0.85477	.	0.250009	0.33650	N	0.004693	T	0.39253	0.1071	L	0.27053	0.805	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.76575	0.988;0.982;0.982	T	0.30563	-0.9974	10	0.72032	D	0.01	-6.1701	15.7924	0.78376	0.0:0.0:0.0:1.0	.	675;667;667	B7ZM22;Q6TFL3-3;Q6TFL3	.;.;CI093_HUMAN	P	667	ENSP00000297641:L667P;ENSP00000370077:L667P	ENSP00000297641:L667P	L	+	2	0	C9orf93	15719747	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	5.833000	0.69349	2.130000	0.65690	0.477000	0.44152	CTA	.	.	.	none		0.463	CCDC171-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051768.4	NM_173550	
NPR2	4882	hgsc.bcm.edu	37	9	35792786	35792786	+	Silent	SNP	T	T	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr9:35792786T>C	ENST00000342694.2	+	1	636	c.381T>C	c.(379-381)tcT>tcC	p.S127S		NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2	127					bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	CTGTGGCCTCTGGTTTTTCGG	0.602																																					p.S127S		Atlas-SNP	.											.	NPR2	162	.	0			c.T381C						PASS	.						125.0	106.0	112.0					9																	35792786		2203	4300	6503	SO:0001819	synonymous_variant	4882	exon1			GGCCTCTGGTTTT	AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871	ENST00000342694.2:c.381T>C	chr9.hg19:g.35792786T>C		67.0	0.0	.		70.0	14.0	.	NM_003995	B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Silent	SNP	ENST00000342694.2	hg19	CCDS6590.1																																																																																			.	.	.	none		0.602	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052345.1		
OR1N2	138882	hgsc.bcm.edu	37	9	125315955	125315955	+	Silent	SNP	C	C	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr9:125315955C>T	ENST00000373688.2	+	1	565	c.507C>T	c.(505-507)acC>acT	p.T169T		NM_001004457.1	NP_001004457.1	Q8NGR9	OR1N2_HUMAN	olfactory receptor, family 1, subfamily N, member 2	169						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(3)	26						GGGTGCTAACCAACTGTCCTG	0.532																																					p.T169T		Atlas-SNP	.											.	OR1N2	51	.	0			c.C507T						PASS	.						141.0	123.0	129.0					9																	125315955		2203	4300	6503	SO:0001819	synonymous_variant	138882	exon1			GCTAACCAACTGT		CCDS35123.1	9q33.2	2013-09-20			ENSG00000171501	ENSG00000171501		"""GPCR / Class A : Olfactory receptors"""	15111	protein-coding gene	gene with protein product							Standard	NM_001004457		Approved		uc011lyx.2	Q8NGR9	OTTHUMG00000020607	ENST00000373688.2:c.507C>T	chr9.hg19:g.125315955C>T		44.0	0.0	.		48.0	19.0	.	NM_001004457	A3KFM2|B2RNY4|Q6IF17|Q96RA3	Silent	SNP	ENST00000373688.2	hg19	CCDS35123.1																																																																																			.	.	.	none		0.532	OR1N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053937.2		
MED27	9442	hgsc.bcm.edu	37	9	134889753	134889753	+	Silent	SNP	A	A	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr9:134889753A>G	ENST00000292035.5	-	3	513	c.450T>C	c.(448-450)gcT>gcC	p.A150A	MED27_ENST00000357028.2_Silent_p.A150A	NM_004269.3	NP_004260.2	Q6P2C8	MED27_HUMAN	mediator complex subunit 27	150					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|mediator complex (GO:0016592)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	18		Myeloproliferative disorder(178;0.206)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000193)		TTGTGGGCTGAGCCTTTGGTC	0.428																																					p.A150A	Colon(41;784 923 6932 42329 52483)	Atlas-SNP	.											.	MED27	37	.	0			c.T450C						PASS	.						152.0	129.0	137.0					9																	134889753		2203	4300	6503	SO:0001819	synonymous_variant	9442	exon3			GGGCTGAGCCTTT	AF104252	CCDS6945.1, CCDS59153.1, CCDS69689.1	9q34.13	2008-02-05	2007-07-30	2007-07-30	ENSG00000160563	ENSG00000160563			2377	protein-coding gene	gene with protein product		605044	"""cofactor required for Sp1 transcriptional activation, subunit 8, 34kDa"""	CRSP8		9989412	Standard	NM_004269		Approved	TRAP37, CRSP34	uc004cbe.2	Q6P2C8	OTTHUMG00000020833	ENST00000292035.5:c.450T>C	chr9.hg19:g.134889753A>G		134.0	0.0	.		80.0	12.0	.	NM_001253881	O95401|Q4F964|Q5VTA4|Q5VTA5|Q9BU57|Q9NYR4|V9GYV9	Silent	SNP	ENST00000292035.5	hg19	CCDS6945.1																																																																																			.	.	.	none		0.428	MED27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054770.2	NM_004269	
GJD4	219770	hgsc.bcm.edu	37	10	35896876	35896876	+	Silent	SNP	C	C	A			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr10:35896876C>A	ENST00000321660.1	+	2	593	c.435C>A	c.(433-435)atC>atA	p.I145I	RP11-425A6.5_ENST00000609313.1_RNA	NM_153368.2	NP_699199.2	Q96KN9	CXD4_HUMAN	gap junction protein, delta 4, 40.1kDa	145					cell communication (GO:0007154)|regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014717)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16						GCTACATCATCCACCTCCTCC	0.692																																					p.I145I		Atlas-SNP	.											.	GJD4	38	.	0			c.C435A						PASS	.						17.0	18.0	18.0					10																	35896876		2196	4293	6489	SO:0001819	synonymous_variant	219770	exon2			CATCATCCACCTC	AJ414564	CCDS7191.1	10p11.22	2007-11-27			ENSG00000177291	ENSG00000177291		"""Ion channels / Gap junction proteins (connexins)"""	23296	protein-coding gene	gene with protein product	"""connexin 40.1"""	611922				12477932	Standard	NM_153368		Approved	CX40.1, FLJ90023	uc001iyy.1	Q96KN9	OTTHUMG00000017957	ENST00000321660.1:c.435C>A	chr10.hg19:g.35896876C>A		19.0	0.0	.		23.0	8.0	.	NM_153368	Q8N2R7	Silent	SNP	ENST00000321660.1	hg19	CCDS7191.1																																																																																			.	.	.	none		0.692	GJD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047576.1	NM_153368	
ADAMTS14	140766	hgsc.bcm.edu	37	10	72513573	72513573	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr10:72513573G>T	ENST00000373207.1	+	19	2747	c.2747G>T	c.(2746-2748)tGg>tTg	p.W916L	ADAMTS14_ENST00000373208.1_Missense_Mutation_p.W919L	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	916	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						ACGGAGGAGTGGGGTGCCTGC	0.622																																					p.W919L		Atlas-SNP	.											.	ADAMTS14	148	.	0			c.G2756T						PASS	.						16.0	12.0	14.0					10																	72513573		2194	4295	6489	SO:0001583	missense	140766	exon19			AGGAGTGGGGTGC	AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.2747G>T	chr10.hg19:g.72513573G>T	ENSP00000362303:p.Trp916Leu	43.0	0.0	.		39.0	8.0	.	NM_139155	Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Missense_Mutation	SNP	ENST00000373207.1	hg19	CCDS7306.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.956346	0.73902	.	.	ENSG00000138316	ENST00000373208;ENST00000373207	T;T	0.74315	-0.83;-0.83	4.58	4.58	0.56647	.	0.000000	0.64402	D	0.000001	D	0.92195	0.7525	H	0.99325	4.515	0.58432	D	0.999995	D;D	0.89917	0.967;1.0	P;D	0.80764	0.897;0.994	D	0.95625	0.8684	10	0.87932	D	0	.	17.1757	0.86841	0.0:0.0:1.0:0.0	.	916;919	Q8WXS8;Q5T4G1	ATS14_HUMAN;.	L	919;916	ENSP00000362304:W919L;ENSP00000362303:W916L	ENSP00000362303:W916L	W	+	2	0	ADAMTS14	72183579	1.000000	0.71417	0.963000	0.40424	0.270000	0.26580	9.601000	0.98297	2.378000	0.81104	0.563000	0.77884	TGG	.	.	.	none		0.622	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048522.1	NM_080722	
C10orf11	83938	hgsc.bcm.edu	37	10	77818509	77818509	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr10:77818509A>G	ENST00000372499.1	+	4	615	c.400A>G	c.(400-402)Aga>Gga	p.R134G	C10orf11_ENST00000593699.1_3'UTR	NM_032024.3	NP_114413.1	Q9H2I8	CJ011_HUMAN	chromosome 10 open reading frame 11	134	LRRCT.				melanocyte differentiation (GO:0030318)					endometrium(1)|large_intestine(4)|lung(4)|stomach(1)	10	Prostate(51;0.0095)|all_epithelial(25;0.0221)					GGCGTTGGTCAGAGGAGTCTT	0.488																																					p.R134G		Atlas-SNP	.											.	C10orf11	19	.	0			c.A400G						PASS	.						148.0	136.0	140.0					10																	77818509		2203	4300	6503	SO:0001583	missense	83938	exon4			TTGGTCAGAGGAG	AF267860	CCDS7351.1	10q22.3	2013-08-22			ENSG00000148655	ENSG00000148655			23405	protein-coding gene	gene with protein product	"""oculocutaneous albinism 7, autosomal recessive"""	614537				23395477	Standard	NM_032024		Approved	CDA017, OCA7	uc001jxi.3	Q9H2I8	OTTHUMG00000018532	ENST00000372499.1:c.400A>G	chr10.hg19:g.77818509A>G	ENSP00000361577:p.Arg134Gly	105.0	0.0	.		89.0	13.0	.	NM_032024	B1AVW6	Missense_Mutation	SNP	ENST00000372499.1	hg19	CCDS7351.1	.	.	.	.	.	.	.	.	.	.	A	18.82	3.704846	0.68615	.	.	ENSG00000148655	ENST00000354343;ENST00000372499	T	0.37235	1.21	5.66	4.46	0.54185	.	0.000000	0.85682	D	0.000000	T	0.51702	0.1690	M	0.83012	2.62	0.41798	D	0.989901	P	0.41313	0.745	P	0.49226	0.603	T	0.56974	-0.7890	10	0.46703	T	0.11	-22.7506	12.4457	0.55649	0.8601:0.1398:0.0:0.0	.	134	Q9H2I8	CJ011_HUMAN	G	162;134	ENSP00000361577:R134G	ENSP00000346310:R162G	R	+	1	2	C10orf11	77488515	0.984000	0.35163	1.000000	0.80357	0.977000	0.68977	2.280000	0.43443	2.164000	0.68074	0.533000	0.62120	AGA	.	.	.	none		0.488	C10orf11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048839.1	NM_032024	
C10orf12	26148	hgsc.bcm.edu	37	10	98744160	98744160	+	Missense_Mutation	SNP	A	A	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr10:98744160A>C	ENST00000286067.2	+	1	3120	c.3013A>C	c.(3013-3015)Aat>Cat	p.N1005H		NM_015652.2	NP_056467.2	Q8N655	CJ012_HUMAN	chromosome 10 open reading frame 12	1005										NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(3)|prostate(2)|skin(2)|stomach(4)	45		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		AAAATATTCCAATATTCGAGG	0.453																																					p.N1005H		Atlas-SNP	.											.	C10orf12	94	.	0			c.A3013C						PASS	.						50.0	56.0	54.0					10																	98744160		2203	4300	6503	SO:0001583	missense	26148	exon1			TATTCCAATATTC	BC024315	CCDS7452.1	10q24.2	2014-03-11			ENSG00000155640	ENSG00000155640			23420	protein-coding gene	gene with protein product						24550272	Standard	NM_015652		Approved	DKFZP564P1916, FLJ13022	uc001kmv.3	Q8N655	OTTHUMG00000018840	ENST00000286067.2:c.3013A>C	chr10.hg19:g.98744160A>C	ENSP00000286067:p.Asn1005His	49.0	0.0	.		60.0	21.0	.	NM_015652	Q9H945|Q9Y457	Missense_Mutation	SNP	ENST00000286067.2	hg19	CCDS7452.1	.	.	.	.	.	.	.	.	.	.	A	14.01	2.409208	0.42715	.	.	ENSG00000155640	ENST00000286067;ENST00000539886	T	0.11169	2.8	5.71	4.57	0.56435	.	0.273469	0.25106	U	0.033088	T	0.19005	0.0456	L	0.47716	1.5	0.34487	D	0.70458	D	0.55385	0.971	P	0.53224	0.721	T	0.18777	-1.0326	10	0.72032	D	0.01	-16.6286	12.7429	0.57264	0.7424:0.2576:0.0:0.0	.	1005	Q8N655	CJ012_HUMAN	H	1005;839	ENSP00000286067:N1005H	ENSP00000286067:N1005H	N	+	1	0	C10orf12	98734150	1.000000	0.71417	1.000000	0.80357	0.738000	0.42128	5.768000	0.68858	0.989000	0.38761	-0.313000	0.08912	AAT	.	.	.	none		0.453	C10orf12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049627.1	NM_015652	
ERLIN1	10613	hgsc.bcm.edu	37	10	101935785	101935785	+	Missense_Mutation	SNP	G	G	C	rs369477049		TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr10:101935785G>C	ENST00000421367.2	-	5	3054	c.347C>G	c.(346-348)aCc>aGc	p.T116S	ERLIN1_ENST00000407654.3_Missense_Mutation_p.T116S	NM_001100626.1|NM_006459.3	NP_001094096.1|NP_006450.2	O75477	ERLN1_HUMAN	ER lipid raft associated 1	114					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)							Colorectal(252;0.234)		Epithelial(162;3.85e-10)|all cancers(201;3.25e-08)		GAAGATTAAGGTCTTGTCATA	0.393																																					p.T116S		Atlas-SNP	.											.	.	.	.	0			c.C347G						PASS	.						161.0	145.0	150.0					10																	101935785		2203	4300	6503	SO:0001583	missense	10613	exon5			ATTAAGGTCTTGT	AF064093	CCDS7487.2	10q24.31	2014-03-03	2007-01-26	2007-01-26	ENSG00000107566	ENSG00000107566			16947	protein-coding gene	gene with protein product	"""Band_7 23-211 Keo4 (Interim) similar to C.elegans protein C42C1.9"""	611604	"""chromosome 10 open reading frame 69"", ""SPFH domain family, member 1"""	C10orf69, SPFH1		11118313, 16835267, 24482476	Standard	NM_006459		Approved	KE04, Erlin-1, SPG62	uc001kqo.4	O75477	OTTHUMG00000018900	ENST00000421367.2:c.347C>G	chr10.hg19:g.101935785G>C	ENSP00000410964:p.Thr116Ser	95.0	0.0	.		97.0	35.0	.	NM_006459	B0QZ42|Q53HV0	Missense_Mutation	SNP	ENST00000421367.2	hg19	CCDS7487.2	.	.	.	.	.	.	.	.	.	.	G	16.19	3.053929	0.55218	.	.	ENSG00000107566	ENST00000421367;ENST00000407654;ENST00000370410;ENST00000370408	D;D;D	0.94417	-3.42;-3.42;-3.42	4.96	4.96	0.65561	.	0.114986	0.64402	U	0.000019	D	0.95020	0.8388	M	0.78456	2.415	0.58432	D	0.999999	B;B	0.29270	0.24;0.24	B;B	0.42959	0.403;0.403	D	0.92339	0.5880	10	0.09590	T	0.72	-17.5613	16.0678	0.80897	0.0:0.0:1.0:0.0	.	114;116	O75477;D3DR65	ERLN1_HUMAN;.	S	116;116;32;116	ENSP00000410964:T116S;ENSP00000384900:T116S;ENSP00000359436:T116S	ENSP00000359436:T116S	T	-	2	0	ERLIN1	101925775	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	9.771000	0.98977	2.456000	0.83038	0.561000	0.74099	ACC	.	.	.	none		0.393	ERLIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049840.2	NM_006459	
CFAP46	54777	hgsc.bcm.edu	37	10	134733640	134733640	+	Silent	SNP	C	C	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr10:134733640C>T	ENST00000368586.5	-	14	1753	c.1653G>A	c.(1651-1653)aaG>aaA	p.K551K	TTC40_ENST00000368582.2_Silent_p.K551K	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						GGTGCCACGCCTTCGCACAGA	0.637																																					p.K551K		Atlas-SNP	.											.	TTC40	100	.	0			c.G1653A						PASS	.																																			SO:0001819	synonymous_variant	54777	exon14			CCACGCCTTCGCA																												ENST00000368586.5:c.1653G>A	chr10.hg19:g.134733640C>T		43.0	0.0	.		54.0	18.0	.	NM_001200049		Silent	SNP	ENST00000368586.5	hg19	CCDS58101.1																																																																																			.	.	.	none		0.637	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051095.3		
HIPK3	10114	hgsc.bcm.edu	37	11	33374883	33374883	+	Silent	SNP	T	T	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr11:33374883T>C	ENST00000303296.4	+	17	3722	c.3417T>C	c.(3415-3417)tcT>tcC	p.S1139S	AL122015.1_ENST00000411202.1_RNA|HIPK3_ENST00000525975.1_Silent_p.S1118S|HIPK3_ENST00000379016.3_Silent_p.S1118S|HIPK3_ENST00000456517.1_Silent_p.S1118S	NM_005734.3	NP_005725.3	Q9H422	HIPK3_HUMAN	homeodomain interacting protein kinase 3	1139					apoptotic process (GO:0006915)|mRNA transcription (GO:0009299)|negative regulation of apoptotic process (GO:0043066)|negative regulation of JUN kinase activity (GO:0043508)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			endometrium(3)|kidney(3)|large_intestine(9)|liver(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	39						TGTTAGCCTCTCCGTGTACCT	0.517																																					p.S1139S		Atlas-SNP	.											.	HIPK3	92	.	0			c.T3417C						PASS	.						216.0	178.0	191.0					11																	33374883		2202	4298	6500	SO:0001819	synonymous_variant	10114	exon17			AGCCTCTCCGTGT	AF004849	CCDS7884.1, CCDS41634.1	11p13	2008-07-18	2001-11-29		ENSG00000110422	ENSG00000110422			4915	protein-coding gene	gene with protein product		604424	"""homeodomain-interacting protein kinase 3"""			9373137, 9748262	Standard	NM_005734		Approved	PKY, DYRK6, YAK1, FIST3	uc031pzm.1	Q9H422	OTTHUMG00000132269	ENST00000303296.4:c.3417T>C	chr11.hg19:g.33374883T>C		125.0	0.0	.		112.0	31.0	.	NM_005734	O14632|Q2PBG4|Q2PBG5|Q92632|Q9HAS2	Silent	SNP	ENST00000303296.4	hg19	CCDS7884.1																																																																																			.	.	.	none		0.517	HIPK3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255358.1	NM_005734	
ATG13	9776	hgsc.bcm.edu	37	11	46666907	46666907	+	Nonsense_Mutation	SNP	C	C	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr11:46666907C>T	ENST00000434074.1	+	3	777	c.88C>T	c.(88-90)Cag>Tag	p.Q30*	ATG13_ENST00000529655.1_Nonsense_Mutation_p.Q30*|ATG13_ENST00000528494.1_Nonsense_Mutation_p.Q30*|ATG13_ENST00000451945.1_Nonsense_Mutation_p.Q30*|ATG13_ENST00000359513.4_Nonsense_Mutation_p.Q30*|ATG13_ENST00000526508.1_Nonsense_Mutation_p.Q30*|ATG13_ENST00000312040.4_Nonsense_Mutation_p.Q30*|ATG13_ENST00000524625.1_Nonsense_Mutation_p.Q30*|ATG13_ENST00000530500.1_5'UTR	NM_001205120.1	NP_001192049.1	O75143	ATG13_HUMAN	autophagy related 13	30					autophagic vacuole assembly (GO:0000045)	ATG1/UKL1 signaling complex (GO:0034273)|cytosol (GO:0005829)|pre-autophagosomal structure (GO:0000407)|ULK1-ATG13-FIP200 complex (GO:0070969)	protein kinase binding (GO:0019901)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(5)|prostate(1)|skin(1)	15						AGTGATTGTCCAGGCTCGGCT	0.373																																					p.Q30X		Atlas-SNP	.											.	ATG13	60	.	0			c.C88T						PASS	.						95.0	90.0	91.0					11																	46666907		2201	4299	6500	SO:0001587	stop_gained	9776	exon4			ATTGTCCAGGCTC	AB014552	CCDS7921.1, CCDS44582.1, CCDS55760.1, CCDS55761.1	11p11.2	2014-02-12	2012-06-06	2010-06-29	ENSG00000175224	ENSG00000175224			29091	protein-coding gene	gene with protein product		615088	"""KIAA0652"", ""ATG13 autophagy related 13 homolog (S. cerevisiae)"""	KIAA0652		15169610, 18339812, 17204848	Standard	NM_001205120		Approved		uc001nda.3	O75143	OTTHUMG00000166538	ENST00000434074.1:c.88C>T	chr11.hg19:g.46666907C>T	ENSP00000400642:p.Gln30*	78.0	0.0	.		91.0	5.0	.	NM_001142673	B4DFI4|D3DQQ1|D3DQQ2|E9PQZ8|Q53EN6|Q9BRL3|Q9H8B0	Nonsense_Mutation	SNP	ENST00000434074.1	hg19	CCDS44582.1	.	.	.	.	.	.	.	.	.	.	C	37	6.442003	0.97568	.	.	ENSG00000175224	ENST00000395549;ENST00000434074;ENST00000312040;ENST00000451945;ENST00000529655;ENST00000533325;ENST00000526508;ENST00000524625;ENST00000359513;ENST00000528494;ENST00000526078	.	.	.	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-10.2057	19.4568	0.94895	0.0:1.0:0.0:0.0	.	.	.	.	X	30	.	ENSP00000310321:Q30X	Q	+	1	0	ATG13	46623483	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.103000	0.77014	2.832000	0.97577	0.655000	0.94253	CAG	.	.	.	none		0.373	ATG13-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390300.2	NM_014741	
PCNXL3	399909	hgsc.bcm.edu	37	11	65397996	65397996	+	Missense_Mutation	SNP	A	A	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr11:65397996A>C	ENST00000355703.3	+	27	4930	c.4391A>C	c.(4390-4392)tAt>tCt	p.Y1464S	PCNXL3_ENST00000531280.1_3'UTR	NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)	1464						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						CTGGAGGGCTATAGCATTAGT	0.572																																					p.Y1464S		Atlas-SNP	.											.	PCNXL3	140	.	0			c.A4391C						PASS	.						86.0	92.0	90.0					11																	65397996		2116	4217	6333	SO:0001583	missense	399909	exon27			AGGGCTATAGCAT	BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539	ENST00000355703.3:c.4391A>C	chr11.hg19:g.65397996A>C	ENSP00000347931:p.Tyr1464Ser	135.0	0.0	.		122.0	41.0	.	NM_032223	Q6MZN8	Missense_Mutation	SNP	ENST00000355703.3	hg19	CCDS44650.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.559339	0.86335	.	.	ENSG00000197136	ENST00000355703	T	0.23552	1.9	5.02	5.02	0.67125	.	0.072055	0.56097	D	0.000021	T	0.55657	0.1934	M	0.88450	2.955	0.51767	D	0.999931	D;D	0.71674	0.982;0.998	D;D	0.73708	0.967;0.981	T	0.64516	-0.6389	10	0.87932	D	0	.	12.7937	0.57549	1.0:0.0:0.0:0.0	.	351;1464	Q9H6A9-3;Q9H6A9	.;PCX3_HUMAN	S	1464	ENSP00000347931:Y1464S	ENSP00000347931:Y1464S	Y	+	2	0	PCNXL3	65154572	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.753000	0.91637	2.131000	0.65755	0.529000	0.55759	TAT	.	.	.	none		0.572	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390321.1	NM_032223	
MRE11A	4361	hgsc.bcm.edu	37	11	94225958	94225958	+	Missense_Mutation	SNP	C	C	A			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr11:94225958C>A	ENST00000323929.3	-	2	232	c.10G>T	c.(10-12)Gca>Tca	p.A4S	ANKRD49_ENST00000544253.1_5'Flank|MRE11A_ENST00000407439.3_5'UTR|MRE11A_ENST00000393241.4_Missense_Mutation_p.A4S|MRE11A_ENST00000536144.1_5'UTR|ANKRD49_ENST00000540349.1_5'Flank|MRE11A_ENST00000323977.3_Missense_Mutation_p.A4S|ANKRD49_ENST00000544612.1_5'Flank|MRE11A_ENST00000540013.1_Missense_Mutation_p.A4S	NM_005591.3	NP_005582.1	P49959	MRE11_HUMAN	MRE11 meiotic recombination 11 homolog A (S. cerevisiae)	4					base-excision repair (GO:0006284)|cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|double-strand break repair via nonhomologous end joining (GO:0006303)|innate immune response (GO:0045087)|intra-S DNA damage checkpoint (GO:0031573)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of DNA endoreduplication (GO:0032876)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair (GO:0006289)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of type I interferon production (GO:0032481)|reciprocal meiotic recombination (GO:0007131)|regulation of mitotic recombination (GO:0000019)|sister chromatid cohesion (GO:0007062)|synapsis (GO:0007129)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromatin (GO:0000785)|cytosol (GO:0005829)|Mre11 complex (GO:0030870)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	3'-5' exonuclease activity (GO:0008408)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|manganese ion binding (GO:0030145)|nuclease activity (GO:0004518)|protein C-terminus binding (GO:0008022)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			breast(5)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	29		Acute lymphoblastic leukemia(157;2.37e-05)|all_hematologic(158;0.00824)				AGTGCATCTGCAGTACTCATT	0.423								Homologous recombination	Ataxia-Telangiectasia-Like Disorder																												p.A4S		Atlas-SNP	.											.	MRE11A	145	.	0			c.G10T						PASS	.						113.0	103.0	107.0					11																	94225958		2201	4298	6499	SO:0001583	missense	4361	exon2	Familial Cancer Database	ATLD	CATCTGCAGTACT	BC063458	CCDS8298.1, CCDS8299.1	11q21	2014-09-17	2001-11-28		ENSG00000020922	ENSG00000020922			7230	protein-coding gene	gene with protein product	"""AT-like disease"""	600814	"""meiotic recombination (S. cerevisiae) 11 homolog A"""	MRE11		8530104	Standard	XM_005274007		Approved	ATLD	uc001peu.2	P49959	OTTHUMG00000167780	ENST00000323929.3:c.10G>T	chr11.hg19:g.94225958C>A	ENSP00000325863:p.Ala4Ser	57.0	0.0	.		72.0	7.0	.	NM_005591	O43475	Missense_Mutation	SNP	ENST00000323929.3	hg19	CCDS8299.1	.	.	.	.	.	.	.	.	.	.	C	7.672	0.687277	0.14973	.	.	ENSG00000020922	ENST00000323929;ENST00000323977;ENST00000393241;ENST00000540013;ENST00000536754;ENST00000538923	T;T;T;T;T	0.76709	-0.84;-0.82;-0.84;-1.03;-1.04	5.01	-0.599	0.11645	.	0.961041	0.08657	N	0.913092	T	0.51109	0.1655	N	0.11255	0.115	0.23572	N	0.997382	B;B	0.06786	0.001;0.0	B;B	0.10450	0.005;0.002	T	0.30416	-0.9979	10	0.09843	T	0.71	.	2.2535	0.04049	0.1419:0.4157:0.2764:0.1661	.	4;4	P49959-2;P49959	.;MRE11_HUMAN	S	4	ENSP00000325863:A4S;ENSP00000326094:A4S;ENSP00000376933:A4S;ENSP00000440986:A4S;ENSP00000439511:A4S	ENSP00000325863:A4S	A	-	1	0	MRE11A	93865606	0.867000	0.29959	0.427000	0.26684	0.159000	0.22180	-0.223000	0.09177	-0.420000	0.07427	0.561000	0.74099	GCA	.	.	.	none		0.423	MRE11A-001	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396237.3	NM_005591	
ASB8	140461	hgsc.bcm.edu	37	12	48543736	48543736	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr12:48543736C>T	ENST00000317697.3	-	4	449	c.280G>A	c.(280-282)Gca>Aca	p.A94T	ASB8_ENST00000535055.1_3'UTR|ASB8_ENST00000539528.1_3'UTR|ASB8_ENST00000537754.1_5'UTR|ASB8_ENST00000536549.1_Missense_Mutation_p.A94T|ASB8_ENST00000536953.1_3'UTR|ASB8_ENST00000536071.1_3'UTR	NM_024095.3	NP_077000.1	Q9H765	ASB8_HUMAN	ankyrin repeat and SOCS box containing 8	94					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				breast(1)|kidney(2)|large_intestine(2)|lung(5)|soft_tissue(1)	11						TCTTTCTCTGCTGCATAGTGG	0.498																																					p.A94T		Atlas-SNP	.											.	ASB8	25	.	0			c.G280A						PASS	.						67.0	62.0	64.0					12																	48543736		2203	4300	6503	SO:0001583	missense	140461	exon4			TCTCTGCTGCATA	AK024908	CCDS8761.1	12q13.12	2013-01-10	2011-01-25			ENSG00000177981		"""Ankyrin repeat domain containing"""	17183	protein-coding gene	gene with protein product		615053	"""ankyrin repeat and SOCS box-containing 8"""			12076535	Standard	NM_024095		Approved	MGC5540, FLJ21255	uc001rrh.3	Q9H765		ENST00000317697.3:c.280G>A	chr12.hg19:g.48543736C>T	ENSP00000320893:p.Ala94Thr	59.0	0.0	.		83.0	26.0	.	NM_024095	A8K1P2|Q547Q2	Missense_Mutation	SNP	ENST00000317697.3	hg19	CCDS8761.1	.	.	.	.	.	.	.	.	.	.	C	32	5.172801	0.94807	.	.	ENSG00000177981	ENST00000317697;ENST00000536549;ENST00000446549;ENST00000539503;ENST00000545791;ENST00000540212	T;T;T;T;T	0.71934	-0.61;-0.61;-0.6;-0.37;-0.37	5.3	5.3	0.74995	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.81269	0.4787	L	0.49126	1.545	0.80722	D	1	D	0.71674	0.998	D	0.79108	0.992	T	0.81008	-0.1127	10	0.51188	T	0.08	-9.6125	18.938	0.92594	0.0:1.0:0.0:0.0	.	94	Q9H765	ASB8_HUMAN	T	94	ENSP00000320893:A94T;ENSP00000445622:A94T;ENSP00000444093:A94T;ENSP00000437769:A94T;ENSP00000442639:A94T	ENSP00000320893:A94T	A	-	1	0	ASB8	46830003	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.227000	0.78070	2.648000	0.89879	0.563000	0.77884	GCA	.	.	.	none		0.498	ASB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396497.1		
SERPINA12	145264	hgsc.bcm.edu	37	14	94964196	94964196	+	Missense_Mutation	SNP	A	A	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr14:94964196A>C	ENST00000341228.2	-	3	1334	c.539T>G	c.(538-540)tTt>tGt	p.F180C	SERPINA12_ENST00000556881.1_Missense_Mutation_p.F180C	NM_173850.2	NP_776249.1	Q8IW75	SPA12_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12	180					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	33				COAD - Colon adenocarcinoma(157;0.235)		TTGACTGATAAAGTCATTGAT	0.393																																					p.F180C		Atlas-SNP	.											.	SERPINA12	93	.	0			c.T539G						PASS	.						93.0	91.0	92.0					14																	94964196		2203	4300	6503	SO:0001583	missense	145264	exon3			CTGATAAAGTCAT	AY177692	CCDS9926.1	14q32.13	2014-02-21	2005-08-18		ENSG00000165953	ENSG00000165953		"""Serine (or cysteine) peptidase inhibitors"""	18359	protein-coding gene	gene with protein product			"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12"""			24172014	Standard	NM_173850		Approved	OL-64, Vaspin	uc001ydj.3	Q8IW75	OTTHUMG00000171349	ENST00000341228.2:c.539T>G	chr14.hg19:g.94964196A>C	ENSP00000342109:p.Phe180Cys	130.0	0.0	.		82.0	39.0	.	NM_173850		Missense_Mutation	SNP	ENST00000341228.2	hg19	CCDS9926.1	.	.	.	.	.	.	.	.	.	.	A	10.99	1.508445	0.27036	.	.	ENSG00000165953	ENST00000556881;ENST00000341228	D;D	0.84589	-1.87;-1.87	5.49	4.34	0.51931	Serpin domain (3);	0.119433	0.38111	N	0.001802	D	0.87692	0.6241	L	0.46819	1.47	0.20196	N	0.99993	D	0.71674	0.998	P	0.61275	0.886	T	0.80627	-0.1298	10	0.87932	D	0	.	11.607	0.51037	0.1385:0.0:0.0:0.8615	.	180	Q8IW75	SPA12_HUMAN	C	180	ENSP00000451738:F180C;ENSP00000342109:F180C	ENSP00000342109:F180C	F	-	2	0	SERPINA12	94033949	0.995000	0.38212	0.009000	0.14445	0.037000	0.13140	3.607000	0.54102	0.903000	0.36546	-0.339000	0.08088	TTT	.	.	.	none		0.393	SERPINA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413097.1	NM_173850	
RASGRP1	10125	hgsc.bcm.edu	37	15	38798102	38798102	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr15:38798102T>C	ENST00000310803.5	-	10	1439	c.1262A>G	c.(1261-1263)tAc>tGc	p.Y421C	RASGRP1_ENST00000561180.1_Missense_Mutation_p.Y472C|RASGRP1_ENST00000450598.2_Missense_Mutation_p.Y421C|RP11-102L12.2_ENST00000560231.1_RNA|RASGRP1_ENST00000558164.1_Missense_Mutation_p.Y421C|RASGRP1_ENST00000539159.1_Missense_Mutation_p.Y373C|RASGRP1_ENST00000559830.1_Missense_Mutation_p.Y421C	NM_001128602.1|NM_005739.3	NP_001122074.1|NP_005730.2	O95267	GRP1_HUMAN	RAS guanyl releasing protein 1 (calcium and DAG-regulated)	421	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				activation of Rho GTPase activity (GO:0032862)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response to antigenic stimulus (GO:0002437)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|platelet activation (GO:0030168)|Ras protein signal transduction (GO:0007265)|regulation of phosphatidylinositol 3-kinase signaling (GO:0014066)|secretory granule localization (GO:0032252)|signal transduction (GO:0007165)|vesicle transport along microtubule (GO:0047496)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20		all_cancers(109;6.38e-17)|all_epithelial(112;5.51e-15)|Lung NSC(122;2.12e-11)|all_lung(180;5.63e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;1.97e-07)|BRCA - Breast invasive adenocarcinoma(123;0.00248)		ATCCTCAGTGTAGTAAAGATC	0.448																																					p.Y421C		Atlas-SNP	.											.	RASGRP1	50	.	0			c.A1262G						PASS	.						75.0	74.0	74.0					15																	38798102		1892	4109	6001	SO:0001583	missense	10125	exon10			TCAGTGTAGTAAA	AF106071	CCDS45221.1, CCDS45222.1	15q15	2013-01-10				ENSG00000172575		"""EF-hand domain containing"""	9878	protein-coding gene	gene with protein product		603962				10087292, 9789079	Standard	NM_005739		Approved	CalDAG-GEFII, RASGRP	uc001zke.4	O95267		ENST00000310803.5:c.1262A>G	chr15.hg19:g.38798102T>C	ENSP00000310244:p.Tyr421Cys	68.0	0.0	.		68.0	25.0	.	NM_001128602	Q56CZ0|Q58G75|Q59HB1|Q5I3A8|Q6GV31|Q6NX39|Q7LDG6|Q9UI94|Q9UNN9	Missense_Mutation	SNP	ENST00000310803.5	hg19	CCDS45222.1	.	.	.	.	.	.	.	.	.	.	T	18.55	3.649116	0.67358	.	.	ENSG00000172575	ENST00000310803;ENST00000450598;ENST00000415523;ENST00000431814;ENST00000539159;ENST00000414708;ENST00000541438	T;T;T;T	0.50277	0.75;0.75;0.75;0.75	4.6	4.6	0.57074	Guanine-nucleotide dissociation stimulator CDC25 (3);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	T	0.69351	0.3101	M	0.79805	2.47	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.999;1.0	D;D;D;D	0.91635	0.999;0.976;0.989;0.995	T	0.74278	-0.3717	10	0.62326	D	0.03	-19.3572	14.1614	0.65450	0.0:0.0:0.0:1.0	.	421;421;421;421	C9JM27;C9JCE5;O95267;O95267-2	.;.;GRP1_HUMAN;.	C	421;421;421;421;373;421;421	ENSP00000310244:Y421C;ENSP00000388540:Y421C;ENSP00000444762:Y373C;ENSP00000413105:Y421C	ENSP00000310244:Y421C	Y	-	2	0	RASGRP1	36585394	1.000000	0.71417	0.998000	0.56505	0.724000	0.41520	7.525000	0.81892	1.909000	0.55274	0.533000	0.62120	TAC	.	.	.	none		0.448	RASGRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418223.1	NM_005739	
DISP2	85455	hgsc.bcm.edu	37	15	40660678	40660678	+	Missense_Mutation	SNP	C	C	G	rs375551948		TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr15:40660678C>G	ENST00000267889.3	+	8	2452	c.2365C>G	c.(2365-2367)Cct>Gct	p.P789A	RP11-64K12.4_ENST00000558421.1_RNA	NM_033510.1	NP_277045.1	A7MBM2	DISP2_HUMAN	dispatched homolog 2 (Drosophila)	789					smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)	30		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.39e-06)|Colorectal(105;0.0114)|READ - Rectum adenocarcinoma(2;0.0649)|BRCA - Breast invasive adenocarcinoma(123;0.0798)|Lung(196;0.15)|LUAD - Lung adenocarcinoma(183;0.247)		CCCTCTGGACCCTCGTAGCAA	0.687																																					p.P789A		Atlas-SNP	.											.	DISP2	86	.	0			c.C2365G						PASS	.						76.0	84.0	81.0					15																	40660678		2203	4300	6503	SO:0001583	missense	85455	exon8			CTGGACCCTCGTA	AB051529	CCDS10056.1	15q14	2004-01-15			ENSG00000140323	ENSG00000140323			19712	protein-coding gene	gene with protein product		607503				11214970, 10619433	Standard	NM_033510		Approved	DISPB, KIAA1742, HsT16908	uc001zlk.1	A7MBM2	OTTHUMG00000129983	ENST00000267889.3:c.2365C>G	chr15.hg19:g.40660678C>G	ENSP00000267889:p.Pro789Ala	59.0	0.0	.		66.0	19.0	.	NM_033510	Q6AHW3|Q9C0C1	Missense_Mutation	SNP	ENST00000267889.3	hg19	CCDS10056.1	.	.	.	.	.	.	.	.	.	.	C	16.57	3.158992	0.57368	.	.	ENSG00000140323	ENST00000267889	T	0.30981	1.51	5.14	4.2	0.49525	.	0.052280	0.85682	D	0.000000	T	0.58119	0.2100	M	0.83483	2.645	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.63651	-0.6589	10	0.48119	T	0.1	-12.1506	14.8747	0.70485	0.1445:0.8555:0.0:0.0	.	789	A7MBM2	DISP2_HUMAN	A	789	ENSP00000267889:P789A	ENSP00000267889:P789A	P	+	1	0	DISP2	38447970	1.000000	0.71417	1.000000	0.80357	0.561000	0.35649	7.645000	0.83430	1.343000	0.45638	0.561000	0.74099	CCT	.	.	.	alt		0.687	DISP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252249.1	NM_033510	
MGA	23269	hgsc.bcm.edu	37	15	42005518	42005518	+	Missense_Mutation	SNP	G	G	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr15:42005518G>C	ENST00000570161.1	+	8	3254	c.3254G>C	c.(3253-3255)aGa>aCa	p.R1085T	MGA_ENST00000389936.4_Missense_Mutation_p.R1085T|MGA_ENST00000545763.1_Missense_Mutation_p.R1085T|MGA_ENST00000566586.1_Missense_Mutation_p.R1085T|MGA_ENST00000219905.7_Missense_Mutation_p.R1085T			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TGTTTGAAAAGAAAAGTTGTA	0.458																																					p.R1085T		Atlas-SNP	.											.	MGA	264	.	0			c.G3254C						PASS	.						98.0	94.0	96.0					15																	42005518		1937	4124	6061	SO:0001583	missense	23269	exon9			TGAAAAGAAAAGT	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.3254G>C	chr15.hg19:g.42005518G>C	ENSP00000457035:p.Arg1085Thr	106.0	0.0	.		80.0	24.0	.	NM_001080541	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000570161.1	hg19	CCDS55959.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.245765	0.80024	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	T;T;T	0.17370	2.28;2.28;2.28	5.75	5.75	0.90469	.	0.177622	0.46758	D	0.000265	T	0.28433	0.0703	L	0.27053	0.805	0.35184	D	0.772759	D;D	0.76494	0.997;0.999	D;D	0.73708	0.981;0.931	T	0.25779	-1.0122	10	0.87932	D	0	.	13.1821	0.59660	0.0727:0.0:0.9273:0.0	.	1085;1085	F5H7K2;E7ENI0	.;.	T	1085	ENSP00000219905:R1085T;ENSP00000374586:R1085T;ENSP00000442467:R1085T	ENSP00000219905:R1085T	R	+	2	0	MGA	39792810	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.511000	0.53400	2.716000	0.92895	0.655000	0.94253	AGA	.	.	.	none		0.458	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1	
ALPK3	57538	hgsc.bcm.edu	37	15	85400827	85400827	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr15:85400827A>T	ENST00000258888.5	+	6	3631	c.3464A>T	c.(3463-3465)gAc>gTc	p.D1155V		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	1155					heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CGGAGCTGTGACCCTGGCCTC	0.627																																					p.D1155V		Atlas-SNP	.											.	ALPK3	289	.	0			c.A3464T						PASS	.						42.0	49.0	47.0					15																	85400827		2203	4299	6502	SO:0001583	missense	57538	exon6			GCTGTGACCCTGG	AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.3464A>T	chr15.hg19:g.85400827A>T	ENSP00000258888:p.Asp1155Val	64.0	0.0	.		62.0	19.0	.	NM_020778	Q9P2L6	Missense_Mutation	SNP	ENST00000258888.5	hg19	CCDS10333.1	.	.	.	.	.	.	.	.	.	.	A	19.25	3.792367	0.70452	.	.	ENSG00000136383	ENST00000258888	T	0.68624	-0.34	5.17	5.17	0.71159	.	0.513935	0.19872	N	0.104179	T	0.72590	0.3479	L	0.32530	0.975	0.54753	D	0.999988	D	0.89917	1.0	D	0.85130	0.997	T	0.74607	-0.3609	10	0.72032	D	0.01	-24.6636	11.4077	0.49908	1.0:0.0:0.0:0.0	.	1155	Q96L96	ALPK3_HUMAN	V	1155	ENSP00000258888:D1155V	ENSP00000258888:D1155V	D	+	2	0	ALPK3	83201831	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	2.636000	0.46545	1.958000	0.56883	0.460000	0.39030	GAC	.	.	.	none		0.627	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308997.1	NM_020778	
CACNA1H	8912	hgsc.bcm.edu	37	16	1268594	1268594	+	Missense_Mutation	SNP	C	C	A			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr16:1268594C>A	ENST00000348261.5	+	33	6078	c.5830C>A	c.(5830-5832)Cac>Aac	p.H1944N	CACNA1H_ENST00000565831.1_Missense_Mutation_p.H1938N|CACNA1H_ENST00000358590.4_Missense_Mutation_p.H1938N	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	1944					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	CTCGGCGCCCCACCCCCGCCC	0.662																																					p.H1944N		Atlas-SNP	.											.	CACNA1H	317	.	0			c.C5830A						PASS	.						14.0	17.0	16.0					16																	1268594		1988	4120	6108	SO:0001583	missense	8912	exon33			GCGCCCCACCCCC	AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.5830C>A	chr16.hg19:g.1268594C>A	ENSP00000334198:p.His1944Asn	87.0	0.0	.		91.0	28.0	.	NM_021098	B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	ENST00000348261.5	hg19	CCDS45375.1	.	.	.	.	.	.	.	.	.	.	C	7.903	0.734914	0.15574	.	.	ENSG00000196557	ENST00000348261;ENST00000358590	D;D	0.96554	-4.05;-3.99	3.75	1.55	0.23275	.	3.133360	0.01371	N	0.012566	D	0.90823	0.7118	N	0.22421	0.69	0.09310	N	1	B;B;B;B;B	0.30973	0.034;0.029;0.0;0.302;0.039	B;B;B;B;B	0.24006	0.023;0.021;0.0;0.05;0.015	D	0.84424	0.0573	10	0.27082	T	0.32	.	2.7944	0.05397	0.2401:0.5032:0.0:0.2567	.	690;679;685;1938;1944	A2SX38;A2SX35;A2SX37;O95180-2;O95180	.;.;.;.;CAC1H_HUMAN	N	1944;1938	ENSP00000334198:H1944N;ENSP00000351401:H1938N	ENSP00000334198:H1944N	H	+	1	0	CACNA1H	1208595	0.947000	0.32204	0.001000	0.08648	0.001000	0.01503	0.399000	0.20916	0.806000	0.34183	0.563000	0.77884	CAC	.	.	.	none		0.662	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421601.1	NM_001005407	
CLEC19A	728276	hgsc.bcm.edu	37	16	19320374	19320374	+	Intron	SNP	T	T	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr16:19320374T>C	ENST00000493231.1	+	2	367				AC003003.5_ENST00000468219.1_RNA			Q6UXS0	CL19A_HUMAN	C-type lectin domain family 19, member A							extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)										TTCCCCTTTGTCTGCAAAATC	0.453																																					p.V177A		Atlas-SNP	.											.	CLEC19A	4	.	0			c.T530C						PASS	.																																			SO:0001627	intron_variant	728276	exon5			CCTTTGTCTGCAA			16p12.3	2013-01-07			ENSG00000261210	ENSG00000261210		"""C-type lectin domain containing"""	34522	protein-coding gene	gene with protein product							Standard	NM_001256720		Approved		uc031qvg.1	Q6UXS0	OTTHUMG00000177218	ENST00000493231.1:c.254+10214T>C	chr16.hg19:g.19320374T>C		55.0	0.0	.		51.0	6.0	.	NM_001256720	Q0VF32	Missense_Mutation	SNP	ENST00000493231.1	hg19																																																																																				.	.	.	none		0.453	CLEC19A-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000438114.1	NM_00125672	
ZKSCAN2	342357	hgsc.bcm.edu	37	16	25266603	25266603	+	Missense_Mutation	SNP	C	C	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr16:25266603C>G	ENST00000328086.7	-	2	1313	c.510G>C	c.(508-510)gaG>gaC	p.E170D		NM_001012981.4	NP_001012999.3	Q63HK3	ZKSC2_HUMAN	zinc finger with KRAB and SCAN domains 2	170					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(15)|ovary(3)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	36				GBM - Glioblastoma multiforme(48;0.0378)		TTCCAGGTTCCTCCCGAGACA	0.622																																					p.E170D		Atlas-SNP	.											.	ZKSCAN2	90	.	0			c.G510C						PASS	.						88.0	78.0	82.0					16																	25266603		2197	4300	6497	SO:0001583	missense	342357	exon2			AGGTTCCTCCCGA	AK026852	CCDS32410.1	16p12.1	2013-01-09	2007-02-20	2007-02-20		ENSG00000155592		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	25677	protein-coding gene	gene with protein product			"""zinc finger protein 694"""	ZNF694			Standard	NM_001012981		Approved	FLJ23199, ZSCAN34	uc002dod.4	Q63HK3		ENST00000328086.7:c.510G>C	chr16.hg19:g.25266603C>G	ENSP00000331626:p.Glu170Asp	43.0	0.0	.		46.0	12.0	.	NM_001012981	A1L3B4|Q6ZN77	Missense_Mutation	SNP	ENST00000328086.7	hg19	CCDS32410.1	.	.	.	.	.	.	.	.	.	.	C	14.86	2.660995	0.47572	.	.	ENSG00000155592	ENST00000328086;ENST00000536768	T	0.14766	2.48	5.3	-2.75	0.05914	.	0.376195	0.25654	N	0.029181	T	0.11495	0.0280	L	0.55743	1.74	0.29398	N	0.862144	B;B	0.20550	0.046;0.003	B;B	0.27608	0.081;0.005	T	0.11251	-1.0595	10	0.52906	T	0.07	-11.4516	6.0464	0.19762	0.0:0.4411:0.1273:0.4316	.	170;170	Q63HK3-2;Q63HK3	.;ZKSC2_HUMAN	D	170	ENSP00000331626:E170D	ENSP00000331626:E170D	E	-	3	2	ZKSCAN2	25174104	0.027000	0.19231	0.445000	0.26908	0.501000	0.33797	-1.330000	0.02675	-0.703000	0.05049	0.555000	0.69702	GAG	.	.	.	none		0.622	ZKSCAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435739.1	NM_001012981	
CCDC79	283847	hgsc.bcm.edu	37	16	66804098	66804098	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr16:66804098C>T	ENST00000558713.2	-	13	1459	c.1387G>A	c.(1387-1389)Gat>Aat	p.D463N	CCDC79_ENST00000433574.1_Missense_Mutation_p.D463N|CCDC79_ENST00000561333.1_5'UTR|CCDC79_ENST00000432602.1_Missense_Mutation_p.D463N|CCDC79_ENST00000433154.1_Missense_Mutation_p.D463N|CCDC79_ENST00000415744.1_Missense_Mutation_p.D421N			Q8NA31	TERB1_HUMAN	coiled-coil domain containing 79	463					meiotic telomere clustering (GO:0045141)|synapsis (GO:0007129)	chromosome, telomeric region (GO:0000781)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|skin(2)	7						TTATCCTCATCTTCTGCTTTG	0.368																																					p.D463N		Atlas-SNP	.											.	CCDC79	32	.	0			c.G1387A						PASS	.						261.0	198.0	217.0					16																	66804098		692	1591	2283	SO:0001583	missense	283847	exon14			CCTCATCTTCTGC	AK093213		16q22.1	2012-10-03			ENSG00000249961	ENSG00000249961			26675	protein-coding gene	gene with protein product							Standard	NM_001136505		Approved	FLJ35894	uc010viv.2	Q8NA31	OTTHUMG00000133562	ENST00000558713.2:c.1387G>A	chr16.hg19:g.66804098C>T	ENSP00000462883:p.Asp463Asn	100.0	0.0	.		107.0	40.0	.	NM_001136505	A0AUW1	Missense_Mutation	SNP	ENST00000558713.2	hg19		.	.	.	.	.	.	.	.	.	.	C	6.946	0.544308	0.13312	.	.	ENSG00000177461	ENST00000433154;ENST00000432602;ENST00000433574;ENST00000415744	T;T;T	0.21191	2.02;2.02;2.02	5.01	-1.62	0.08372	.	0.457877	0.20987	N	0.082105	T	0.16599	0.0399	L	0.57536	1.79	0.19575	N	0.999961	B;B	0.12630	0.006;0.004	B;B	0.11329	0.004;0.006	T	0.17745	-1.0359	10	0.56958	D	0.05	-11.2096	5.1151	0.14831	0.0:0.3293:0.1598:0.5109	.	463;463	Q8NA31;Q8NA31-2	CCD79_HUMAN;.	N	463;463;463;421	ENSP00000463762:D463N;ENSP00000462977:D463N;ENSP00000462037:D463N	ENSP00000440822:D421N	D	-	1	0	CCDC79	65361599	0.034000	0.19679	0.560000	0.28344	0.145000	0.21501	-0.197000	0.09518	-0.106000	0.12110	0.563000	0.77884	GAT	.	.	.	none		0.368	CCDC79-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000418864.2		
TP53	7157	hgsc.bcm.edu	37	17	7578271	7578271	+	Missense_Mutation	SNP	T	T	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr17:7578271T>G	ENST00000269305.4	-	6	767	c.578A>C	c.(577-579)cAt>cCt	p.H193P	TP53_ENST00000413465.2_Missense_Mutation_p.H193P|TP53_ENST00000455263.2_Missense_Mutation_p.H193P|TP53_ENST00000574684.1_Intron|TP53_ENST00000445888.2_Missense_Mutation_p.H193P|TP53_ENST00000359597.4_Missense_Mutation_p.H193P|TP53_ENST00000420246.2_Missense_Mutation_p.H193P	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	193	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		H -> D (in sporadic cancers; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> R (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7887414}.|H -> Y (in sporadic cancers; somatic mutation).|QH -> HN (in a sporadic cancer; somatic mutation).|QH -> HY (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.H193R(80)|p.H193L(42)|p.H193P(18)|p.0?(8)|p.?(6)|p.H61R(4)|p.H100R(4)|p.H100L(4)|p.H61L(4)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.H193fs*16(3)|p.P191fs*53(2)|p.H61P(2)|p.H100P(2)|p.A189fs*53(1)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.P191fs*15(1)|p.P98_E105>Q(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCGGATAAGATGCTGAGGAGG	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.H193P	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,NS,carcinoma,0,1	TP53	33396	.	193	Substitution - Missense(160)|Whole gene deletion(8)|Complex - deletion inframe(6)|Unknown(6)|Deletion - In frame(5)|Deletion - Frameshift(4)|Insertion - Frameshift(3)|Complex - frameshift(1)	lung(36)|upper_aerodigestive_tract(26)|ovary(20)|breast(18)|oesophagus(14)|haematopoietic_and_lymphoid_tissue(12)|endometrium(12)|biliary_tract(10)|liver(9)|stomach(7)|central_nervous_system(6)|large_intestine(6)|urinary_tract(5)|skin(5)|bone(4)|pancreas(2)|prostate(1)	c.A578C	GRCh37	CM083194|CM951225	TP53	M		PASS	.						97.0	87.0	90.0					17																	7578271		2203	4300	6503	SO:0001583	missense	7157	exon6	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	ATAAGATGCTGAG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.578A>C	chr17.hg19:g.7578271T>G	ENSP00000269305:p.His193Pro	120.0	1.0	.		123.0	29.0	.	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	13.91	2.377907	0.42105	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99855	-7.2;-7.2;-7.2;-7.2;-7.2;-7.2;-7.2;-7.2	5.41	4.33	0.51752	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99840	0.9927	M	0.88906	2.99	0.58432	D	0.999998	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.97320	0.9943	10	0.87932	D	0	-29.0766	9.707	0.40222	0.0:0.0827:0.0:0.9173	.	154;193;193;100;193;193;193	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	P	193;193;193;193;193;193;182;100;61;100;61	ENSP00000410739:H193P;ENSP00000352610:H193P;ENSP00000269305:H193P;ENSP00000398846:H193P;ENSP00000391127:H193P;ENSP00000391478:H193P;ENSP00000425104:H61P;ENSP00000423862:H100P	ENSP00000269305:H193P	H	-	2	0	TP53	7518996	1.000000	0.71417	0.814000	0.32528	0.023000	0.10783	7.996000	0.88334	1.001000	0.39076	-0.256000	0.11100	CAT	.	.	.	none		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
BRCA1	672	hgsc.bcm.edu	37	17	41203099	41203099	+	Silent	SNP	G	G	A	rs273901762		TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr17:41203099G>A	ENST00000357654.3	-	20	5431	c.5313C>T	c.(5311-5313)ccC>ccT	p.P1771P	BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000352993.3_Silent_p.P629P|BRCA1_ENST00000309486.4_Silent_p.P1475P|BRCA1_ENST00000471181.2_Silent_p.P1792P|BRCA1_ENST00000346315.3_Silent_p.P1532P|BRCA1_ENST00000491747.2_Silent_p.P667P|BRCA1_ENST00000354071.3_Silent_p.P1506P|BRCA1_ENST00000591534.1_Silent_p.P262P|BRCA1_ENST00000586385.1_Silent_p.P81P|BRCA1_ENST00000351666.3_Silent_p.P588P|BRCA1_ENST00000493795.1_Silent_p.P1724P|BRCA1_ENST00000468300.1_Silent_p.P667P	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	1771	BRCT 2. {ECO:0000255|PROSITE- ProRule:PRU00033}.				androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TGTTGGTGAAGGGCCCATAGC	0.478			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																											p.P1792P		Atlas-SNP	.	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	.	BRCA1	304	.	0			c.C5376T						PASS	.						70.0	69.0	69.0					17																	41203099		2203	4300	6503	SO:0001819	synonymous_variant	672	exon21	Familial Cancer Database		GGTGAAGGGCCCA	U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.5313C>T	chr17.hg19:g.41203099G>A		53.0	0.0	.		63.0	24.0	.	NM_007300	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Silent	SNP	ENST00000357654.3	hg19	CCDS11453.1																																																																																			.	.	.	none		0.478	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348798.2	NM_007294	
HEATR6	63897	hgsc.bcm.edu	37	17	58121036	58121036	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr17:58121036G>T	ENST00000184956.6	-	20	3450	c.3434C>A	c.(3433-3435)cCa>cAa	p.P1145Q	AC005702.4_ENST00000583144.1_RNA|MIR4737_ENST00000583979.1_RNA|HEATR6_ENST00000585976.1_Missense_Mutation_p.P1033Q|AC005702.2_ENST00000577558.1_RNA|AC005702.3_ENST00000582298.1_RNA|AC005702.1_ENST00000581326.1_RNA	NM_022070.4	NP_071353.4	Q6AI08	HEAT6_HUMAN	HEAT repeat containing 6	1145							poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	44	all_cancers(5;2.25e-13)|Breast(5;4.84e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		BRCA - Breast invasive adenocarcinoma(1;5.93e-19)|Epithelial(12;7.59e-12)|all cancers(12;1.26e-10)			GTCTCCAGTTGGTGCCTGGAT	0.542																																					p.P1145Q		Atlas-SNP	.											.	HEATR6	98	.	0			c.C3434A						PASS	.						129.0	115.0	120.0					17																	58121036		2203	4300	6503	SO:0001583	missense	63897	exon20			CCAGTTGGTGCCT	BX640819	CCDS11623.1	17q23.2	2007-05-01				ENSG00000068097			24076	protein-coding gene	gene with protein product	"""amplified in breast cancer 1"""					12755490	Standard	NM_022070		Approved	ABC1, FLJ22087	uc002iyk.1	Q6AI08		ENST00000184956.6:c.3434C>A	chr17.hg19:g.58121036G>T	ENSP00000184956:p.Pro1145Gln	130.0	0.0	.		207.0	49.0	.	NM_022070	B3KXP3|Q6MZX1|Q6MZY2|Q8TDM9|Q9H6B3|Q9H6M7	Missense_Mutation	SNP	ENST00000184956.6	hg19	CCDS11623.1	.	.	.	.	.	.	.	.	.	.	G	0.083	-1.180886	0.01633	.	.	ENSG00000068097	ENST00000184956;ENST00000393017	T	0.64438	-0.1	4.96	0.0386	0.14201	Armadillo-type fold (1);	1.078860	0.07032	N	0.828585	T	0.32941	0.0846	N	0.03608	-0.345	0.09310	N	1	B;B	0.17268	0.021;0.0	B;B	0.13407	0.009;0.001	T	0.19451	-1.0305	10	0.20519	T	0.43	0.0678	3.9945	0.09551	0.5137:0.0:0.2773:0.209	.	880;1145	E7ESB9;Q6AI08	.;HEAT6_HUMAN	Q	1145;880	ENSP00000184956:P1145Q	ENSP00000184956:P1145Q	P	-	2	0	HEATR6	55475818	0.000000	0.05858	0.002000	0.10522	0.010000	0.07245	-0.029000	0.12329	0.348000	0.23949	-0.312000	0.09012	CCA	.	.	.	none		0.542	HEATR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449165.1	NM_022070	
HELZ	9931	hgsc.bcm.edu	37	17	65162707	65162707	+	Silent	SNP	T	T	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr17:65162707T>C	ENST00000358691.5	-	15	1948	c.1782A>G	c.(1780-1782)caA>caG	p.Q594Q	HELZ_ENST00000580168.1_Silent_p.Q594Q	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	594						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					ATCGATTTAATTGAAACTGAA	0.393																																					p.Q594Q		Atlas-SNP	.											.	HELZ	160	.	0			c.A1782G						PASS	.						104.0	96.0	98.0					17																	65162707		1858	4110	5968	SO:0001819	synonymous_variant	9931	exon15			ATTTAATTGAAAC	D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.1782A>G	chr17.hg19:g.65162707T>C		85.0	0.0	.		117.0	9.0	.	NM_014877	I6L9H4	Silent	SNP	ENST00000358691.5	hg19	CCDS42374.1																																																																																			.	.	.	none		0.393	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1	NM_014877	
FSCN2	25794	hgsc.bcm.edu	37	17	79496379	79496379	+	Silent	SNP	G	G	A			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr17:79496379G>A	ENST00000417245.2	+	1	958	c.822G>A	c.(820-822)cgG>cgA	p.R274R	RP13-766D20.2_ENST00000442532.1_RNA|RP13-766D20.2_ENST00000430912.1_RNA|FSCN2_ENST00000334850.7_Silent_p.R274R	NM_001077182.2|NM_012418.3	NP_001070650.1|NP_036550.1	O14926	FSCN2_HUMAN	fascin actin-bundling protein 2, retinal	274					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|anatomical structure morphogenesis (GO:0009653)|eye photoreceptor cell development (GO:0042462)|visual perception (GO:0007601)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|stereocilium (GO:0032420)	actin binding (GO:0003779)|actin filament binding (GO:0051015)			endometrium(1)|lung(1)|prostate(1)|urinary_tract(1)	4	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			TCTCTGTGCGGCAAGGTAGGG	0.647																																					p.R274R		Atlas-SNP	.											.	FSCN2	35	.	0			c.G822A						PASS	.						9.0	10.0	10.0					17																	79496379		2169	4246	6415	SO:0001819	synonymous_variant	25794	exon1			TGTGCGGCAAGGT	AF030165	CCDS45810.1, CCDS45811.1	17q25	2014-02-03	2014-02-03		ENSG00000186765	ENSG00000186765		"""Fascins"""	3960	protein-coding gene	gene with protein product		607643	"""fascin (Strongylocentrotus purpuratus) homolog 2 (actin-bundling protein, retinal)"", ""fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus)"""			10234509	Standard	NM_012418		Approved	RP30, RFSN	uc010wuo.2	O14926	OTTHUMG00000167477	ENST00000417245.2:c.822G>A	chr17.hg19:g.79496379G>A		83.0	0.0	.		123.0	73.0	.	NM_001077182	A0AVC4|A8MRA6	Silent	SNP	ENST00000417245.2	hg19	CCDS45811.1																																																																																			.	.	.	none		0.647	FSCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394746.1	NM_012418	
PCYT2	5833	hgsc.bcm.edu	37	17	79865647	79865647	+	Splice_Site	SNP	A	A	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr17:79865647A>G	ENST00000538936.2	-	5	601		c.e5+1		PCYT2_ENST00000538721.2_Splice_Site|PCYT2_ENST00000571105.1_Splice_Site|PCYT2_ENST00000570388.1_Splice_Site|PCYT2_ENST00000331285.3_Splice_Site|PCYT2_ENST00000570391.1_Splice_Site	NM_001256435.1|NM_002861.3	NP_001243364.1|NP_002852.1	Q99447	PCY2_HUMAN	phosphate cytidylyltransferase 2, ethanolamine						glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)	ethanolamine-phosphate cytidylyltransferase activity (GO:0004306)			breast(2)|endometrium(1)|lung(4)|ovary(1)	8	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)		Lamivudine(DB00709)	CCGCCGACTCACCTGGCTGCT	0.667																																					.		Atlas-SNP	.											.	PCYT2	23	.	0			c.258+2T>C						PASS	.						55.0	45.0	49.0					17																	79865647		2203	4300	6503	SO:0001630	splice_region_variant	5833	exon6			CGACTCACCTGGC	D84307	CCDS11791.1, CCDS54178.1, CCDS58610.1, CCDS62364.1	17q25.3	2008-07-18				ENSG00000185813			8756	protein-coding gene	gene with protein product		602679				9083101	Standard	XM_005256386		Approved	ET	uc002kch.2	Q99447		ENST00000538936.2:c.492+1T>C	chr17.hg19:g.79865647A>G		46.0	0.0	.		52.0	14.0	.	NM_001256435	B7Z7A5|B7ZAS0|F5H8B1|Q6IBM3|Q96G08	Splice_Site	SNP	ENST00000538936.2	hg19	CCDS11791.1	.	.	.	.	.	.	.	.	.	.	A	15.43	2.829822	0.50845	.	.	ENSG00000185813	ENST00000538721;ENST00000538936;ENST00000331285	.	.	.	4.34	4.34	0.51931	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.2492	0.54589	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PCYT2	77458939	1.000000	0.71417	1.000000	0.80357	0.632000	0.37999	8.242000	0.89818	1.812000	0.52913	0.459000	0.35465	.	.	.	.	none		0.667	PCYT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439939.1	NM_002861	Intron
KCNG2	26251	hgsc.bcm.edu	37	18	77659162	77659162	+	Silent	SNP	G	G	A	rs140841838		TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr18:77659162G>A	ENST00000316249.3	+	2	747	c.747G>A	c.(745-747)gcG>gcA	p.A249A	KCNG2_ENST00000590307.1_3'UTR	NM_012283.1	NP_036415.1	Q9UJ96	KCNG2_HUMAN	potassium voltage-gated channel, subfamily G, member 2	249					energy reserve metabolic process (GO:0006112)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of heart contraction (GO:0008016)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(2)|endometrium(4)|lung(7)|skin(1)|upper_aerodigestive_tract(4)	18		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;6.92e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0244)		TCCTGCGCGCGCCACTCAACA	0.677																																					p.A249A		Atlas-SNP	.											.	KCNG2	48	.	0			c.G747A						PASS	.	G		0,4404		0,0,2202	43.0	39.0	40.0		747	-3.4	0.0	18	dbSNP_134	40	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	KCNG2	NM_012283.1		0,1,6501	AA,AG,GG		0.0116,0.0,0.0077		249/467	77659162	1,13003	2202	4300	6502	SO:0001819	synonymous_variant	26251	exon2			GCGCGCGCCACTC	AJ011021	CCDS12019.1	18q23	2011-07-05			ENSG00000178342	ENSG00000178342		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6249	protein-coding gene	gene with protein product		605696				10551266, 16382104	Standard	NM_012283		Approved	Kv6.2, KCNF2	uc010xfl.2	Q9UJ96	OTTHUMG00000044541	ENST00000316249.3:c.747G>A	chr18.hg19:g.77659162G>A		32.0	0.0	.		26.0	6.0	.	NM_012283		Silent	SNP	ENST00000316249.3	hg19	CCDS12019.1																																																																																			.	G|1.000;A|0.000	0.000	weak		0.677	KCNG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103906.1	NM_012283	
ICAM1	3383	hgsc.bcm.edu	37	19	10395839	10395839	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr19:10395839T>A	ENST00000264832.3	+	7	1800	c.1475T>A	c.(1474-1476)aTa>aAa	p.I492K	ICAM4_ENST00000380770.3_5'Flank|ICAM1_ENST00000423829.2_Missense_Mutation_p.I270K|ICAM4_ENST00000340992.4_5'Flank|ICAM4_ENST00000393717.2_5'Flank|CTD-2369P2.8_ENST00000589379.1_RNA|CTD-2369P2.5_ENST00000592893.1_RNA	NM_000201.2	NP_000192.2	P05362	ICAM1_HUMAN	intercellular adhesion molecule 1	492					adhesion of symbiont to host (GO:0044406)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell aging (GO:0007569)|cellular response to alkaloid (GO:0071312)|cellular response to glucose stimulus (GO:0071333)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to nutrient levels (GO:0031669)|cellular response to tumor necrosis factor (GO:0071356)|cytokine-mediated signaling pathway (GO:0019221)|establishment of endothelial barrier (GO:0061028)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|membrane to membrane docking (GO:0022614)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|ovarian follicle development (GO:0001541)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cellular extravasation (GO:0002693)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of vasoconstriction (GO:0045907)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of cell adhesion (GO:0030155)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of leukocyte mediated cytotoxicity (GO:0001910)|regulation of ruffle assembly (GO:1900027)|response to amino acid (GO:0043200)|response to amphetamine (GO:0001975)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to gonadotropin (GO:0034698)|response to ionizing radiation (GO:0010212)|response to organic cyclic compound (GO:0014070)|response to sulfur dioxide (GO:0010477)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)|T cell antigen processing and presentation (GO:0002457)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|virus receptor activity (GO:0001618)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(20;1.39e-09)|Epithelial(33;2.81e-06)|all cancers(31;6.56e-06)		Hyaluronan(DB08818)|Natalizumab(DB00108)	GCCGCAGTCATAATGGGCACT	0.547																																					p.I492K		Atlas-SNP	.											.	ICAM1	32	.	0			c.T1475A						PASS	.						103.0	105.0	104.0					19																	10395839		2203	4300	6503	SO:0001583	missense	3383	exon7			CAGTCATAATGGG		CCDS12231.1	19p13.3-p13.2	2014-01-30	2008-07-18			ENSG00000090339		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	5344	protein-coding gene	gene with protein product	"""human rhinovirus receptor"""	147840				2453850, 3871395	Standard	NM_000201		Approved	BB2, CD54	uc002mnq.2	P05362		ENST00000264832.3:c.1475T>A	chr19.hg19:g.10395839T>A	ENSP00000264832:p.Ile492Lys	67.0	0.0	.		83.0	29.0	.	NM_000201	B2R6M3|Q5NKV7|Q96B50	Missense_Mutation	SNP	ENST00000264832.3	hg19	CCDS12231.1	.	.	.	.	.	.	.	.	.	.	T	12.45	1.941110	0.34283	.	.	ENSG00000090339	ENST00000264832;ENST00000423829	T;T	0.05199	4.24;3.48	5.22	3.07	0.35406	.	4.242400	0.00744	N	0.001020	T	0.05593	0.0147	N	0.19112	0.55	0.09310	N	0.999997	B;B	0.27286	0.142;0.174	B;B	0.22880	0.042;0.028	T	0.29305	-1.0016	10	0.42905	T	0.14	-14.6127	4.9491	0.14004	0.1651:0.0921:0.0:0.7428	.	270;492	E7ESS4;P05362	.;ICAM1_HUMAN	K	492;270	ENSP00000264832:I492K;ENSP00000413124:I270K	ENSP00000264832:I492K	I	+	2	0	ICAM1	10256839	0.000000	0.05858	0.006000	0.13384	0.011000	0.07611	0.007000	0.13174	0.909000	0.36697	0.459000	0.35465	ATA	.	.	.	none		0.547	ICAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451207.1		
PLEKHG2	64857	hgsc.bcm.edu	37	19	39913652	39913652	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr19:39913652G>A	ENST00000409794.3	+	18	2808	c.1958G>A	c.(1957-1959)gGt>gAt	p.G653D	CTB-60E11.4_ENST00000601124.1_lincRNA|PLEKHG2_ENST00000378550.1_Intron|PLEKHG2_ENST00000409797.2_Intron|PLEKHG2_ENST00000425673.1_Missense_Mutation_p.G624D|PLEKHG2_ENST00000458508.2_Missense_Mutation_p.G594D	NM_022835.2	NP_073746.2	Q9H7P9	PKHG2_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 2	653					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|pancreas(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	40	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			ATTCCCGAAGGTTCTCGCCTT	0.517																																					p.G653D		Atlas-SNP	.											.	PLEKHG2	329	.	0			c.G1958A						PASS	.						95.0	100.0	98.0					19																	39913652		2203	4300	6503	SO:0001583	missense	64857	exon18			CCGAAGGTTCTCG	AK024429	CCDS33022.2	19q13.2	2013-01-11			ENSG00000090924	ENSG00000090924		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	29515	protein-coding gene	gene with protein product		611893				11839748, 18045877	Standard	NM_022835		Approved	CLG, FLJ00018, ARHGEF42	uc010xuz.2	Q9H7P9	OTTHUMG00000152570	ENST00000409794.3:c.1958G>A	chr19.hg19:g.39913652G>A	ENSP00000386733:p.Gly653Asp	80.0	0.0	.		87.0	5.0	.	NM_022835	B8ZZK6|C9J0Y4|Q6DHV6|Q96BU2|Q96D18|Q9H699	Missense_Mutation	SNP	ENST00000409794.3	hg19	CCDS33022.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	2.825|2.825	-0.243916|-0.243916	0.05906|0.05906	.|.	.|.	ENSG00000090924|ENSG00000090924	ENST00000409794;ENST00000425673;ENST00000458508|ENST00000205135	T;T;T|.	0.69040|.	-0.25;-0.25;-0.37|.	3.44|3.44	0.133|0.133	0.14766|0.14766	.|.	1.062390|.	0.07458|.	N|.	0.900138|.	T|T	0.14830|0.14830	0.0358|0.0358	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B;B;B|.	0.30361|.	0.263;0.261;0.277|.	B;B;B|.	0.25987|.	0.065;0.044;0.043|.	T|T	0.26121|0.26121	-1.0112|-1.0112	10|5	0.46703|.	T|.	0.11|.	.|.	4.0591|4.0591	0.09831|0.09831	0.0:0.2305:0.195:0.5745|0.0:0.2305:0.195:0.5745	.|.	624;653;594|.	Q9H7P9-3;Q9H7P9;E7ESZ3|.	.;PKHG2_HUMAN;.|.	D|I	653;624;594|521	ENSP00000386733:G653D;ENSP00000392906:G624D;ENSP00000408857:G594D|.	ENSP00000386733:G653D|.	G|V	+|+	2|1	0|0	PLEKHG2|PLEKHG2	44605492|44605492	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.010000|0.010000	0.07245|0.07245	-0.226000|-0.226000	0.09139|0.09139	-0.034000|-0.034000	0.13713|0.13713	-0.467000|-0.467000	0.05162|0.05162	GGT|GTT	.	.	.	none		0.517	PLEKHG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326802.1	NM_022835	
TRPM4	54795	hgsc.bcm.edu	37	19	49674876	49674876	+	Silent	SNP	C	C	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr19:49674876C>T	ENST00000252826.5	+	8	1026	c.900C>T	c.(898-900)ctC>ctT	p.L300L	TRPM4_ENST00000427978.2_Silent_p.L300L|TRPM4_ENST00000601347.1_3'UTR|TRPM4_ENST00000355712.5_Silent_p.L17L	NM_017636.3	NP_060106.2	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel, subfamily M, member 4	300					calcium ion transmembrane transport (GO:0070588)|cardiac conduction (GO:0061337)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|protein sumoylation (GO:0016925)|regulation of membrane potential (GO:0042391)|regulation of T cell cytokine production (GO:0002724)|transmembrane transport (GO:0055085)|vasoconstriction (GO:0042310)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)			breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(18)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	49		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)		CATGTCTCCTCGTGGCTGGCT	0.592																																					p.L300L		Atlas-SNP	.											TRPM4,NS,carcinoma,0,1	TRPM4	119	.	0			c.C900T						PASS	.						37.0	42.0	41.0					19																	49674876		2202	4300	6502	SO:0001819	synonymous_variant	54795	exon8			TCTCCTCGTGGCT	AK000048	CCDS33073.1, CCDS56098.1	19q13.3	2011-12-14				ENSG00000130529		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17993	protein-coding gene	gene with protein product		606936				11535825, 16382100	Standard	NM_017636		Approved	FLJ20041	uc002pmw.3	Q8TD43		ENST00000252826.5:c.900C>T	chr19.hg19:g.49674876C>T		66.0	0.0	.		72.0	23.0	.	NM_001195227	A2RU25|Q7Z5D9|Q96L84|Q9NXV1	Silent	SNP	ENST00000252826.5	hg19	CCDS33073.1																																																																																			.	.	.	none		0.592	TRPM4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465543.2	NM_017636	
ZNF175	7728	hgsc.bcm.edu	37	19	52091298	52091298	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr19:52091298T>C	ENST00000262259.2	+	5	2072	c.1714T>C	c.(1714-1716)Tct>Cct	p.S572P	ZNF175_ENST00000436511.2_Intron	NM_007147.2	NP_009078.1	Q9Y473	ZN175_HUMAN	zinc finger protein 175	572					defense response to virus (GO:0051607)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000426)|OV - Ovarian serous cystadenocarcinoma(262;0.0257)		CACTTCTAAGTCTCAATTCAA	0.453																																					p.S572P		Atlas-SNP	.											.	ZNF175	65	.	0			c.T1714C						PASS	.						87.0	85.0	86.0					19																	52091298		2203	4300	6503	SO:0001583	missense	7728	exon5			TCTAAGTCTCAAT	D50419	CCDS12837.1	19q13.4	2013-01-08			ENSG00000105497	ENSG00000105497		"""Zinc fingers, C2H2-type"", ""-"""	12964	protein-coding gene	gene with protein product		601139				8838321	Standard	NM_007147		Approved	OTK18	uc002pxb.3	Q9Y473	OTTHUMG00000167771	ENST00000262259.2:c.1714T>C	chr19.hg19:g.52091298T>C	ENSP00000262259:p.Ser572Pro	63.0	0.0	.		68.0	20.0	.	NM_007147	A8K9H2	Missense_Mutation	SNP	ENST00000262259.2	hg19	CCDS12837.1	.	.	.	.	.	.	.	.	.	.	T	13.83	2.354614	0.41700	.	.	ENSG00000105497	ENST00000262259	T	0.18657	2.2	2.18	1.09	0.20402	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.36963	0.0986	M	0.78344	2.41	0.09310	N	0.999999	D	0.65815	0.995	P	0.57911	0.829	T	0.13255	-1.0516	9	0.72032	D	0.01	.	6.4454	0.21873	0.0:0.0:0.2498:0.7502	.	572	Q9Y473	ZN175_HUMAN	P	572	ENSP00000262259:S572P	ENSP00000262259:S572P	S	+	1	0	ZNF175	56783110	0.000000	0.05858	0.703000	0.30354	0.992000	0.81027	-0.482000	0.06544	0.258000	0.21686	0.533000	0.62120	TCT	.	.	.	none		0.453	ZNF175-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396205.1	NM_007147	
BRWD1	54014	hgsc.bcm.edu	37	21	40665927	40665927	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr21:40665927G>T	ENST00000333229.2	-	8	968	c.641C>A	c.(640-642)tCa>tAa	p.S214*	BRWD1_ENST00000342449.3_Nonsense_Mutation_p.S214*|BRWD1_ENST00000380800.3_Nonsense_Mutation_p.S214*	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	214					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				ATTATGTGTTGACCAAATCTT	0.328																																					p.S214X	Melanoma(170;988 1986 4794 16843 39731)	Atlas-SNP	.											.	BRWD1	325	.	0			c.C641A						PASS	.						82.0	77.0	79.0					21																	40665927		2203	4300	6503	SO:0001587	stop_gained	54014	exon8			TGTGTTGACCAAA	AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.641C>A	chr21.hg19:g.40665927G>T	ENSP00000330753:p.Ser214*	104.0	0.0	.		90.0	32.0	.	NM_018963	C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Nonsense_Mutation	SNP	ENST00000333229.2	hg19	CCDS13662.1	.	.	.	.	.	.	.	.	.	.	G	37	6.060061	0.97246	.	.	ENSG00000185658	ENST00000333229;ENST00000342449;ENST00000380800	.	.	.	5.12	4.18	0.49190	.	0.110931	0.39985	N	0.001212	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.83	15.0594	0.71939	0.0:0.1423:0.8577:0.0	.	.	.	.	X	214	.	ENSP00000330753:S214X	S	-	2	0	BRWD1	39587797	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.477000	0.73591	2.388000	0.81334	0.655000	0.94253	TCA	.	.	.	none		0.328	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141398.3	NM_033656	
RFPL3	10738	hgsc.bcm.edu	37	22	32754194	32754195	+	Missense_Mutation	DNP	TA	TA	AT			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T|A	T|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr22:32754194_32754195TA>AT	ENST00000249007.4	+	1	341_342	c.136_137TA>AT	c.(136-138)TAt>ATt	p.Y46I	RFPL3_ENST00000397468.1_Missense_Mutation_p.Y17I|RFPL3_ENST00000382088.3_Missense_Mutation_p.Y17I|RFPL3S_ENST00000461833.1_5'Flank	NM_001098535.1	NP_001092005.1	O75679	RFPL3_HUMAN	ret finger protein-like 3	46							zinc ion binding (GO:0008270)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(2)|stomach(1)	15						CTGCTCAGACTATCTGGAAAAA	0.52																																					p.Y46N|p.Y46F		Atlas-SNP	.											.	RFPL3	91	.	0			c.T136A|c.A137T						PASS	.																																			SO:0001583	missense	10738	exon1			TCAGACTATCTGG|CAGACTATCTGGA	AJ010232	CCDS13904.1, CCDS43011.1	22q12	2006-04-25			ENSG00000128276	ENSG00000128276			9980	protein-coding gene	gene with protein product		605970				10508838	Standard	NM_006604		Approved		uc010gwn.3	O75679	OTTHUMG00000030290	Exception_encountered	chr22.hg19:g.32754194_32754195delinsAT	ENSP00000249007:p.Tyr46Ile	134.0	0.0	.		149.0|150.0	40.0	.	NM_001098535	A2A279|Q6IC03|Q6IC04|Q6NSX3|Q8N5R4	Missense_Mutation	SNP	ENST00000249007.4	hg19	CCDS43011.1																																																																																			.	.	.	none		0.520	RFPL3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000075172.3	NM_006604	
ERCC6L	54821	hgsc.bcm.edu	37	X	71427693	71427693	+	Silent	SNP	G	G	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chrX:71427693G>T	ENST00000334463.3	-	2	1059	c.924C>A	c.(922-924)gcC>gcA	p.A308A	ERCC6L_ENST00000373657.1_Silent_p.A185A|PIN4_ENST00000423432.2_Intron	NM_017669.2	NP_060139.2	Q2NKX8	ERC6L_HUMAN	excision repair cross-complementation group 6-like	308					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			breast(2)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(9)|lung(9)|ovary(3)|skin(1)	38	Renal(35;0.156)					TAAATCCCAAGGCTTTTTCTC	0.388																																					p.A308A		Atlas-SNP	.											.	ERCC6L	98	.	0			c.C924A						PASS	.						80.0	82.0	81.0					X																	71427693		2203	4299	6502	SO:0001819	synonymous_variant	54821	exon2			TCCCAAGGCTTTT	AK000112	CCDS35329.1	Xq13.1	2014-03-07	2014-03-07		ENSG00000186871	ENSG00000186871			20794	protein-coding gene	gene with protein product	"""PLK1-interacting checkpoint helicase"""	300687	"""excision repair cross-complementing rodent repair deficiency, complementation group 6-like"""			17218258	Standard	NM_017669		Approved	FLJ20105, PICH, RAD26L	uc004eaq.1	Q2NKX8	OTTHUMG00000021810	ENST00000334463.3:c.924C>A	chrX.hg19:g.71427693G>T		222.0	0.0	.		149.0	6.0	.	NM_017669	Q8NCI1|Q96H93|Q9NXQ8	Silent	SNP	ENST00000334463.3	hg19	CCDS35329.1																																																																																			.	.	.	none		0.388	ERCC6L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057174.2	NM_017669	
TCEAL4	79921	hgsc.bcm.edu	37	X	102841991	102841991	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chrX:102841991A>G	ENST00000472745.1	+	3	940	c.388A>G	c.(388-390)Act>Gct	p.T130A	TCEAL4_ENST00000415568.2_Missense_Mutation_p.T130A|TCEAL4_ENST00000494801.1_Missense_Mutation_p.T130A|TCEAL4_ENST00000468024.1_Missense_Mutation_p.T130A|TCEAL4_ENST00000372629.4_Missense_Mutation_p.T273A|TCEAL4_ENST00000472484.1_Missense_Mutation_p.T130A			Q96EI5	TCAL4_HUMAN	transcription elongation factor A (SII)-like 4	130					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(2)|skin(2)	6						CAAAAGAAAAACTAATAAGGG	0.458																																					p.T130A		Atlas-SNP	.											.	TCEAL4	18	.	0			c.A388G						PASS	.						103.0	105.0	104.0					X																	102841991		2203	4300	6503	SO:0001583	missense	79921	exon3			AGAAAAACTAATA	AF314542	CCDS14510.2, CCDS76004.1	Xq22.2	2014-03-21			ENSG00000133142	ENSG00000133142			26121	protein-coding gene	gene with protein product						14702039, 16221301	Standard	XM_005262192		Approved	FLJ21174, WEX7	uc004ekn.3	Q96EI5	OTTHUMG00000022103	ENST00000472745.1:c.388A>G	chrX.hg19:g.102841991A>G	ENSP00000424314:p.Thr130Ala	259.0	0.0	.		166.0	74.0	.	NM_001006935	Q8WY12|Q9H2H1|Q9H775	Missense_Mutation	SNP	ENST00000472745.1	hg19	CCDS14510.2	.	.	.	.	.	.	.	.	.	.	A	16.75	3.208774	0.58343	.	.	ENSG00000133142	ENST00000372629;ENST00000468024;ENST00000472484;ENST00000415568;ENST00000414064;ENST00000472745;ENST00000494801	T;T;T;T;T;T	0.10288	2.89;2.89;2.89;2.89;2.89;2.89	3.99	2.8	0.32819	.	0.000000	0.48767	D	0.000161	T	0.24812	0.0602	M	0.74258	2.255	0.24242	N	0.995359	D	0.67145	0.996	P	0.62649	0.905	T	0.03296	-1.1051	10	0.56958	D	0.05	.	6.7545	0.23505	0.7622:0.2378:0.0:0.0	.	130	Q96EI5	TCAL4_HUMAN	A	273;130;130;130;101;130;130	ENSP00000361712:T273A;ENSP00000421857:T130A;ENSP00000421156:T130A;ENSP00000415564:T130A;ENSP00000424314:T130A;ENSP00000427494:T130A	ENSP00000361712:T273A	T	+	1	0	TCEAL4	102728647	1.000000	0.71417	0.931000	0.37212	0.715000	0.41141	1.685000	0.37659	0.692000	0.31613	0.352000	0.21897	ACT	.	.	.	none		0.458	TCEAL4-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252339.2	NM_024863	
H2BFM	286436	hgsc.bcm.edu	37	X	103294650	103294650	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chrX:103294650A>T	ENST00000355016.3	+	1	135	c.107A>T	c.(106-108)cAg>cTg	p.Q36L	H2BFM_ENST00000243297.5_Missense_Mutation_p.Q139L	NM_001164416.1	NP_001157888.1	P0C1H6	H2BFM_HUMAN	H2B histone family, member M	36						nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|lung(1)|ovary(1)	3						GCCCAGAAGCAGAAGAGGCGA	0.657																																					p.Q36L		Atlas-SNP	.											.	H2BFM	25	.	0			c.A107T						PASS	.						21.0	25.0	24.0					X																	103294650		692	1591	2283	SO:0001583	missense	286436	exon1			AGAAGCAGAAGAG	AK093522	CCDS55468.1	Xq22.2	2011-01-27			ENSG00000101812	ENSG00000101812		"""Histones / Replication-independent"""	27867	protein-coding gene	gene with protein product							Standard	NM_001164416		Approved		uc004els.2	P0C1H6	OTTHUMG00000022122	ENST00000355016.3:c.107A>T	chrX.hg19:g.103294650A>T	ENSP00000347119:p.Gln36Leu	131.0	0.0	.		92.0	44.0	.	NM_001164416	A6NP82	Missense_Mutation	SNP	ENST00000355016.3	hg19	CCDS55468.1	.	.	.	.	.	.	.	.	.	.	.	16.73	3.204807	0.58234	.	.	ENSG00000101812	ENST00000243297;ENST00000355016	T;T	0.22743	1.94;1.94	2.65	1.44	0.22558	Histone-fold (2);	.	.	.	.	T	0.23926	0.0579	N	0.24115	0.695	0.28820	N	0.897758	D	0.54601	0.967	P	0.62382	0.901	T	0.11470	-1.0586	9	0.72032	D	0.01	.	4.4197	0.11474	0.6716:0.0:0.3284:0.0	.	139	P0C1H6	H2BFM_HUMAN	L	139;36	ENSP00000243297:Q139L;ENSP00000347119:Q36L	ENSP00000243297:Q139L	Q	+	2	0	H2BFM	103181306	0.002000	0.14202	0.678000	0.29963	0.081000	0.17604	0.010000	0.13242	0.191000	0.20236	0.412000	0.27726	CAG	.	.	.	none		0.657	H2BFM-001	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057758.2	XM_210048	
MT-ND5	4540	hgsc.bcm.edu	37	M	14015	14015	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chrM:14015A>G	ENST00000361567.2	+	1	1679	c.1679A>G	c.(1678-1680)aAg>aGg	p.K560R	MT-TE_ENST00000387459.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TT_ENST00000387460.2_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	560					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						CTGACTAGAAAAGCTATTACC	0.443																																					p.K560X		Atlas-SNP	.											.	.	.	.	0			c.A1679G						PASS	.																																			SO:0001583	missense	0	exon1			TAGAAAAGCTATT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.1679A>G	chrM.hg19:g.14015A>G	ENSP00000354813:p.Lys560Arg	11.0	0.0	.		144.0	6.0	.	ENST00000361567	Q34773|Q8WCY3	Nonsense_Mutation	SNP	ENST00000361567.2	hg19																																																																																				.	.	.	none		0.443	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
STARD3	10948	hgsc.bcm.edu	37	17	37814678	37814685	+	Frame_Shift_Del	DEL	TGGCTACC	TGGCTACC	-			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	TGGCTACC	TGGCTACC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr17:37814678_37814685delTGGCTACC	ENST00000336308.5	+	6	668_675	c.450_457delTGGCTACC	c.(448-459)tttggctacctgfs	p.GYL151fs	STARD3_ENST00000544210.2_Frame_Shift_Del_p.LAT146fs|STARD3_ENST00000394250.4_Frame_Shift_Del_p.GYL133fs|STARD3_ENST00000578232.1_3'UTR|STARD3_ENST00000580611.1_Frame_Shift_Del_p.GYL125fs	NM_001165937.1|NM_006804.3	NP_001159409.1|NP_006795.3	Q14849	STAR3_HUMAN	StAR-related lipid transfer (START) domain containing 3	151	MENTAL. {ECO:0000255|PROSITE- ProRule:PRU00770}.				cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|mitochondrial transport (GO:0006839)|progesterone biosynthetic process (GO:0006701)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)	cholesterol binding (GO:0015485)			endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|pancreas(1)|prostate(2)|stomach(1)	14	Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|BRCA - Breast invasive adenocarcinoma(8;1.04e-44)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			AAGGGGCATTTGGCTACCTGCTCCCCAT	0.582																																					p.150_152del		Atlas-Indel,Pindel	.											.	STARD3	33	.	0			c.449_456del						PASS	.																																			SO:0001589	frameshift_variant	10948	exon6			.		CCDS11341.1, CCDS54117.1, CCDS54118.1	17q11-q12	2011-09-12	2007-08-16		ENSG00000131748	ENSG00000131748		"""StAR-related lipid transfer (START) domain containing"""	17579	protein-coding gene	gene with protein product		607048	"""START domain containing 3"""				Standard	NM_006804		Approved	es64, MLN64	uc002hsd.3	Q14849	OTTHUMG00000133213	ENST00000336308.5:c.450_457delTGGCTACC	chr17.hg19:g.37814678_37814685delTGGCTACC	ENSP00000337446:p.Gly151fs	46.0	0.0	0		50.0	14.0	0.28	NM_006804	A8MXA4|B4DUY1|F5H0G2|Q53Y53|Q96HM9	Frame_Shift_Del	DEL	ENST00000336308.5	hg19	CCDS11341.1																																																																																			.	.	.	none		0.582	STARD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256933.1		
ZNF826P	664701	hgsc.bcm.edu	37	19	20578766	20578768	+	RNA	DEL	TGA	TGA	-			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	TGA	TGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr19:20578766_20578768delTGA	ENST00000502675.1	-	0	484_486				MIR1270-2_ENST00000408220.1_RNA	NR_036455.1		Q6ZT77	ZN826_HUMAN	zinc finger protein 826, pseudogene						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(4)	4						ATTTGAAAATTGATGAAAGACTT	0.33																																					.		Atlas-Indel,Pindel	.											.	ZNF826P	5	.	0			.						PASS	.																																					664701	.			.	BC016785		19p12	2010-08-03	2010-08-03	2010-08-03	ENSG00000231205	ENSG00000231205			33875	pseudogene	pseudogene			"""zinc finger protein 826"""	ZNF826			Standard	NR_036455		Approved	FLJ44894	uc021urn.2	Q6ZT77	OTTHUMG00000162773		chr19.hg19:g.20578769_20578771delTGA		77.0	0.0	0		78.0	15.0	0.192308	.		RNA	DEL	ENST00000502675.1	hg19																																																																																				.	.	.	none		0.330	ZNF826P-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000370365.1	NM_001039884	
SLC25A12	8604	hgsc.bcm.edu	37	2	172700922	172700937	+	Frame_Shift_Del	DEL	CGGTTATGCCCAAAAT	CGGTTATGCCCAAAAT	-			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	CGGTTATGCCCAAAAT	CGGTTATGCCCAAAAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr2:172700922_172700937delCGGTTATGCCCAAAAT	ENST00000422440.2	-	5	444_459	c.407_422delATTTTGGGCATAACCG	c.(406-423)cattttgggcataaccggfs	p.HFGHNR136fs	SLC25A12_ENST00000392592.4_Frame_Shift_Del_p.HFGHNR29fs|SLC25A12_ENST00000472748.1_5'UTR	NM_003705.4	NP_003696.2	O75746	CMC1_HUMAN	solute carrier family 25 (aspartate/glutamate carrier), member 12	136	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				aspartate transport (GO:0015810)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|L-glutamate transport (GO:0015813)|malate-aspartate shuttle (GO:0043490)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|upper_aerodigestive_tract(1)	23			OV - Ovarian serous cystadenocarcinoma(117;0.216)		L-Aspartic Acid(DB00128)	ATGCTTCTTCCGGTTATGCCCAAAATGCAGTCGGAT	0.352																																					p.136_141del		Atlas-Indel,Pindel	.											.	SLC25A12	59	.	0			c.408_423del						PASS	.																																			SO:0001589	frameshift_variant	8604	exon5			.	Y14494	CCDS33327.1	2q24	2013-05-22	2012-03-29		ENSG00000115840	ENSG00000115840		"""Solute carriers"", ""EF-hand domain containing"""	10982	protein-coding gene	gene with protein product		603667	"""solute carrier family 25 (mitochondrial carrier, Aralar), member 12"""			9722566, 10702666, 11566871	Standard	NM_003705		Approved	Aralar	uc002uhh.3	O75746	OTTHUMG00000134290	ENST00000422440.2:c.407_422delATTTTGGGCATAACCG	chr2.hg19:g.172700922_172700937delCGGTTATGCCCAAAAT	ENSP00000388658:p.His136fs	109.0	0.0	0		101.0	13.0	0.128713	NM_003705	B3KR64|Q96AM8	Frame_Shift_Del	DEL	ENST00000422440.2	hg19	CCDS33327.1																																																																																			.	.	.	none		0.352	SLC25A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259010.2	NM_003705	
CEP152	22995	hgsc.bcm.edu	37	15	49074426	49074426	+	Splice_Site	DEL	C	C	-			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr15:49074426delC	ENST00000380950.2	-	11	1510	c.1323delG	c.(1321-1323)ggg>gg	p.G441fs	CEP152_ENST00000399334.3_Splice_Site_p.G441fs|CEP152_ENST00000325747.5_Splice_Site_p.G348fs|RP11-485O10.2_ENST00000558304.1_RNA	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	441					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		CTTGTACTGACCCTGCAGAGG	0.443																																					p.S442fs		Atlas-INDEL	.											.	CEP152	145	.	0			c.1324delT						PASS	.						86.0	82.0	83.0					15																	49074426		1973	4175	6148	SO:0001630	splice_region_variant	22995	exon11			.	AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.1322-1G>-	chr15.hg19:g.49074426delC		27.0	0.0	0		30.0	10.0	0.333333	NM_014985	E7ER66|Q17RV1|Q6NTA0	Frame_Shift_Del	DEL	ENST00000380950.2	hg19	CCDS58361.1																																																																																			.	.	.	none		0.443	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417365.1	NM_014985	Frame_Shift_Del
NFATC2	4773	hgsc.bcm.edu	37	20	50051812	50051813	+	Frame_Shift_Del	DEL	GC	GC	-			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr20:50051812_50051813delGC	ENST00000396009.3	-	8	2163_2164	c.1944_1945delGC	c.(1942-1947)aagcatfs	p.H649fs	NFATC2_ENST00000610033.1_Frame_Shift_Del_p.H430fs|NFATC2_ENST00000371564.3_Frame_Shift_Del_p.H649fs|NFATC2_ENST00000609943.1_Frame_Shift_Del_p.H629fs|NFATC2_ENST00000609507.1_Frame_Shift_Del_p.H430fs|NFATC2_ENST00000414705.1_Frame_Shift_Del_p.H629fs	NM_001258297.1|NM_173091.3	NP_001245226.1|NP_775114.1	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	649					B cell receptor signaling pathway (GO:0050853)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/NFATC2(9)	breast(2)|endometrium(7)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	53	Hepatocellular(150;0.248)					GTGCGGATATGCTTGTTCCGAT	0.436																																					p.649_649del		Atlas-Indel,Pindel	.											.	NFATC2	112	.	0			c.1945_1946del						PASS	.																																			SO:0001589	frameshift_variant	4773	exon8			.	U43342, U43341	CCDS13437.1, CCDS33488.1, CCDS46614.1, CCDS68156.1, CCDS68157.1	20q13.2	2009-11-24			ENSG00000101096	ENSG00000101096		"""Nuclear factor of activated T-cells"""	7776	protein-coding gene	gene with protein product		600490				8202141	Standard	NM_012340		Approved	NF-ATP, NFATp, NFAT1	uc002xwd.4	Q13469	OTTHUMG00000032747	ENST00000396009.3:c.1944_1945delGC	chr20.hg19:g.50051812_50051813delGC	ENSP00000379330:p.His649fs	69.0	0.0	0		84.0	25.0	0.297619	NM_012340	B5B2N8|B5B2N9|B5B2P0|B5B2P2|B5B2P3|Q13468|Q5TFW7|Q5TFW8|Q9NPX6|Q9NQH3|Q9UJR2	Frame_Shift_Del	DEL	ENST00000396009.3	hg19	CCDS13437.1																																																																																			.	.	.	none		0.436	NFATC2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079730.2	NM_012340	
CACNA1A	773	hgsc.bcm.edu	37	19	13418985	13418985	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr19:13418985delA	ENST00000360228.5	-	14	1861	c.1862delT	c.(1861-1863)ttcfs	p.F621fs	CACNA1A_ENST00000573710.2_Frame_Shift_Del_p.F622fs	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	622					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	AATGAACAGGAAAAGGAGAAA	0.542																																					p.F622fs		Atlas-Indel,Pindel	.											.	CACNA1A	715	.	0			c.1866delC						PASS	.						95.0	98.0	97.0					19																	13418985		2088	4230	6318	SO:0001589	frameshift_variant	773	exon14			.	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.1862delT	chr19.hg19:g.13418985delA	ENSP00000353362:p.Phe621fs	137.0	0.0	0		126.0	42.0	0.333333	NM_001127221	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Frame_Shift_Del	DEL	ENST00000360228.5	hg19	CCDS45998.1																																																																																			.	.	.	none		0.542	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068	
GALNT6	11226	hgsc.bcm.edu	37	12	51758036	51758036	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr12:51758036delA	ENST00000543196.2	-	5	1123	c.918delT	c.(916-918)tttfs	p.F306fs	GALNT6_ENST00000356317.3_Frame_Shift_Del_p.F306fs			Q8NCL4	GALT6_HUMAN	polypeptide N-acetylgalactosaminyltransferase 6	306					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			endometrium(2)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						TGGCGAACTCAAAAGTATTAA	0.577																																					p.E307fs		Atlas-Indel,Pindel	.											.	GALNT6	63	.	0			c.919delG						PASS	.						91.0	85.0	87.0					12																	51758036		2203	4300	6503	SO:0001589	frameshift_variant	11226	exon6			.	Y08565	CCDS8813.1	12q13	2014-03-13	2014-03-13		ENSG00000139629	ENSG00000139629		"""Glycosyltransferase family 2 domain containing"""	4128	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 6"""	605148	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)"""			10464263	Standard	NM_007210		Approved	GalNAc-T6	uc001ryl.1	Q8NCL4		ENST00000543196.2:c.918delT	chr12.hg19:g.51758036delA	ENSP00000444171:p.Phe306fs	98.0	0.0	0		110.0	35.0	0.318182	NM_007210	Q8IYH4|Q9H6G2|Q9UIV5	Frame_Shift_Del	DEL	ENST00000543196.2	hg19	CCDS8813.1																																																																																			.	.	.	none		0.577	GALNT6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469735.1	NM_007210	
RGS6	9628	hgsc.bcm.edu	37	14	72939649	72939649	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr14:72939649delC	ENST00000553530.1	+	9	813	c.606delC	c.(604-606)gtcfs	p.V202fs	RGS6_ENST00000343854.6_Frame_Shift_Del_p.V202fs|RGS6_ENST00000402788.2_Frame_Shift_Del_p.V202fs|RGS6_ENST00000553690.1_3'UTR|RGS6_ENST00000434263.2_Frame_Shift_Del_p.V133fs|RGS6_ENST00000554782.1_Frame_Shift_Del_p.V63fs|RGS6_ENST00000555571.1_Frame_Shift_Del_p.V202fs|RGS6_ENST00000556437.1_Frame_Shift_Del_p.V202fs|RGS6_ENST00000406236.4_Frame_Shift_Del_p.V202fs|RGS6_ENST00000407322.4_Frame_Shift_Del_p.V202fs|RGS6_ENST00000355512.6_Frame_Shift_Del_p.V202fs|RGS6_ENST00000553525.1_Frame_Shift_Del_p.V202fs|RGS6_ENST00000404301.2_Frame_Shift_Del_p.V202fs	NM_001204417.1|NM_001204418.1|NM_001204420.1|NM_001204421.1|NM_001204422.1|NM_004296.5	NP_001191346.1|NP_001191347.1|NP_001191349.1|NP_001191350.1|NP_001191351.1|NP_004287.3	P49758	RGS6_HUMAN	regulator of G-protein signaling 6	202					G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of neuron differentiation (GO:0045666)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		TTTGGGATGTCCACAGGCCTG	0.373																																					p.V202fs	Ovarian(143;1926 2468 21071 48641)	Atlas-Indel,Pindel	.											.	RGS6	92	.	0			c.605delT						PASS	.						137.0	153.0	148.0					14																	72939649		2203	4300	6503	SO:0001589	frameshift_variant	9628	exon9			.	AF073920	CCDS9808.1, CCDS55924.1, CCDS73655.1	14q24.3	2008-07-28	2007-08-14			ENSG00000182732		"""Regulators of G-protein signaling"""	10002	protein-coding gene	gene with protein product		603894	"""regulator of G-protein signalling 6"""			10083744, 14734556	Standard	NM_004296		Approved		uc010ttn.2	P49758		ENST00000553530.1:c.606delC	chr14.hg19:g.72939649delC	ENSP00000452331:p.Val202fs	197.0	0.0	0		150.0	70.0	0.466667	NM_001204424	C9JE95|F8W7W5|O75576|O75577|Q7Z4K3|Q7Z4K4|Q7Z4K5|Q7Z4K6|Q8TE13|Q8TE14|Q8TE15|Q8TE16|Q8TE17|Q8TE18|Q8TE19|Q8TE20|Q8TE21|Q8TE22|Q9UDS8|Q9UDT0|Q9Y245|Q9Y647	Frame_Shift_Del	DEL	ENST00000553530.1	hg19	CCDS9808.1																																																																																			.	.	.	none		0.373	RGS6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413033.2		
SMEK2	57223	hgsc.bcm.edu	37	2	55806886	55806886	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr2:55806886delA	ENST00000345102.5	-	9	1698	c.1397delT	c.(1396-1398)ttcfs	p.F466fs	SMEK2_ENST00000272313.5_Frame_Shift_Del_p.F466fs|SMEK2_ENST00000407823.3_Frame_Shift_Del_p.F466fs	NM_001122964.1	NP_001116436	Q5MIZ7	P4R3B_HUMAN	SMEK homolog 2, suppressor of mek1 (Dictyostelium)	466					positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)				kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	16			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			ATGGTTGTAGAAAAAATTTAG	0.303																																					p.F466fs		Atlas-Indel,Pindel	.											.	SMEK2	86	.	0			c.1398delC						PASS	.						76.0	80.0	79.0					2																	55806886		2203	4298	6501	SO:0001589	frameshift_variant	57223	exon9			.	AB037808	CCDS1855.1, CCDS46289.1, CCDS62913.1	2p16.1	2008-09-15			ENSG00000138041				29267	protein-coding gene	gene with protein product		610352				16085932, 18614045	Standard	NM_001122964		Approved	PSY2, FLFL2, KIAA1387, FLJ31474	uc002rzc.3	Q5MIZ7	OTTHUMG00000129336	ENST00000345102.5:c.1397delT	chr2.hg19:g.55806886delA	ENSP00000339769:p.Phe466fs	78.0	0.0	0		67.0	21.0	0.313433	NM_001122964	Q6P9B0|Q86XB8|Q9BQJ0|Q9BRK2|Q9H913|Q9P2G0	Frame_Shift_Del	DEL	ENST00000345102.5	hg19	CCDS46289.1																																																																																			.	.	.	none		0.303	SMEK2-002	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251483.1	NM_020463	
CSF3R	1441	hgsc.bcm.edu	37	1	36939407	36939408	+	In_Frame_Ins	INS	-	-	GTC	rs145989033		TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr1:36939407_36939408insGTC	ENST00000373106.1	-	5	989_990	c.442_443insGAC	c.(442-444)cct>cGACct	p.147_148insR	CSF3R_ENST00000418048.2_In_Frame_Ins_p.147_148insR|CSF3R_ENST00000361632.4_In_Frame_Ins_p.147_148insR|CSF3R_ENST00000373103.1_In_Frame_Ins_p.147_148insR|CSF3R_ENST00000331941.5_In_Frame_Ins_p.147_148insR|CSF3R_ENST00000487540.2_5'Flank|CSF3R_ENST00000440588.2_In_Frame_Ins_p.147_148insR|CSF3R_ENST00000338937.5_In_Frame_Ins_p.147_148insR|CSF3R_ENST00000373104.1_In_Frame_Ins_p.147_148insR	NM_000760.3	NP_000751.1	Q99062	CSF3R_HUMAN	colony stimulating factor 3 receptor (granulocyte)	147	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|defense response (GO:0006952)|neutrophil chemotaxis (GO:0030593)|odontogenesis of dentin-containing tooth (GO:0042475)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)			Filgrastim(DB00099)|Pegfilgrastim(DB00019)	GTGGGTCTCAGGTCCTGGCTCC	0.599																																					p.P148delinsRP		Atlas-Indel,Pindel	.											.	CSF3R	157	.	0			c.443_444insGAC						PASS	.																																			SO:0001652	inframe_insertion	1441	exon5			.	M59820	CCDS412.1, CCDS413.1, CCDS414.1	1p35-p34.3	2014-09-17			ENSG00000119535	ENSG00000119535		"""CD molecules"", ""Fibronectin type III domain containing"""	2439	protein-coding gene	gene with protein product		138971		CD114		1371413	Standard	NM_000760		Approved	GCSFR	uc001cax.2	Q99062	OTTHUMG00000008010	ENST00000373106.1:c.440_442dupGAC	chr1.hg19:g.36939408_36939410dupGTC	ENSP00000362198:p.Gly147_Pro148insArg	79.0	0.0	0		76.0	25.0	0.328947	NM_156039		In_Frame_Ins	INS	ENST00000373106.1	hg19	CCDS413.1																																																																																			.	.	.	none		0.599	CSF3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021997.2	NM_156039	
SCIN	85477	hgsc.bcm.edu	37	7	12680013	12680013	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr7:12680013delT	ENST00000297029.5	+	11	1553	c.1452delT	c.(1450-1452)agtfs	p.S484fs	SCIN_ENST00000519209.1_Frame_Shift_Del_p.S237fs|SCIN_ENST00000445618.2_Frame_Shift_Del_p.S237fs	NM_001112706.2	NP_001106177.1	Q9Y6U3	ADSV_HUMAN	scinderin	484	Ca(2+)-dependent actin binding.				actin filament capping (GO:0051693)|actin filament severing (GO:0051014)|actin nucleation (GO:0045010)|calcium ion-dependent exocytosis (GO:0017156)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of secretion (GO:0051047)|regulation of chondrocyte differentiation (GO:0032330)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	1-phosphatidylinositol binding (GO:0005545)|actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)	17				UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		ACCTACTGAGTTTGTTCAAAG	0.453																																					p.S484fs		Atlas-Indel,Pindel	.											.	SCIN	105	.	0			c.1451delG						PASS	.						58.0	56.0	57.0					7																	12680013		1863	4100	5963	SO:0001589	frameshift_variant	85477	exon11			.	AF276507	CCDS47545.1, CCDS47546.1	7p21.3	2006-04-25			ENSG00000006747	ENSG00000006747			21695	protein-coding gene	gene with protein product		613416					Standard	NM_033128		Approved	adseverin, KIAA1905	uc003ssn.4	Q9Y6U3	OTTHUMG00000152385	ENST00000297029.5:c.1452delT	chr7.hg19:g.12680013delT	ENSP00000297029:p.Ser484fs	59.0	0.0	0		51.0	17.0	0.333333	NM_001112706	A8K2U8|Q8NBZ6|Q8WU97|Q96JC7|Q96PY2	Frame_Shift_Del	DEL	ENST00000297029.5	hg19	CCDS47545.1																																																																																			.	.	.	none		0.453	SCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326041.1	NM_033128	
CYP4X1	260293	hgsc.bcm.edu	37	1	47489659	47489659	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr1:47489659delA	ENST00000371901.3	+	1	420	c.170delA	c.(169-171)cacfs	p.H57fs	CYP4X1_ENST00000538609.1_Intron	NM_178033.1	NP_828847.1	Q8N118	CP4X1_HUMAN	cytochrome P450, family 4, subfamily X, polypeptide 1	57						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	17						TTCCTTGGGCACCagaaggta	0.682																																					p.H57fs		Atlas-Indel,Pindel	.											.	CYP4X1	58	.	0			c.169delC						PASS	.						13.0	15.0	14.0					1																	47489659		2197	4293	6490	SO:0001589	frameshift_variant	260293	exon1			.	AK091806	CCDS544.1	1p33	2008-02-05			ENSG00000186377	ENSG00000186377		"""Cytochrome P450s"""	20244	protein-coding gene	gene with protein product		614999				12176035	Standard	NM_178033		Approved	MGC40051	uc001cqt.3	Q8N118	OTTHUMG00000008017	ENST00000371901.3:c.170delA	chr1.hg19:g.47489659delA	ENSP00000360968:p.His57fs	77.0	0.0	0		79.0	25.0	0.316456	NM_178033	G3V1U1|Q5VVE5|Q6ZN67|Q8NAZ3	Frame_Shift_Del	DEL	ENST00000371901.3	hg19	CCDS544.1																																																																																			.	.	.	none		0.682	CYP4X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022017.1	NM_178033	
ARHGAP5	394	hgsc.bcm.edu	37	14	32560648	32560648	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr14:32560648delA	ENST00000345122.3	+	2	1088	c.773delA	c.(772-774)tatfs	p.Y258fs	ARHGAP5_ENST00000539826.2_Frame_Shift_Del_p.Y258fs|ARHGAP5_ENST00000432921.1_Frame_Shift_Del_p.Y258fs|ARHGAP5_ENST00000433497.1_Intron|ARHGAP5_ENST00000556611.1_Frame_Shift_Del_p.Y258fs|ARHGAP5_ENST00000396582.2_Intron	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	258					cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		ATTATTCCCTATTTGGATGCT	0.358																																					p.Y258fs	NSCLC(9;77 350 3443 29227 41353)	Atlas-Indel,Pindel	.											.	ARHGAP5	166	.	0			c.772delT						PASS	.						115.0	131.0	125.0					14																	32560648		2203	4299	6502	SO:0001589	frameshift_variant	394	exon2			.	U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.773delA	chr14.hg19:g.32560648delA	ENSP00000371897:p.Tyr258fs	279.0	0.0	0		167.0	85.0	0.508982	NM_001030055	A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Frame_Shift_Del	DEL	ENST00000345122.3	hg19	CCDS32062.1																																																																																			.	.	.	none		0.358	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409735.1	NM_001030055	
NPR2	4882	hgsc.bcm.edu	37	9	35800822	35800822	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B1-A655-01A-11D-A31Z-10	TCGA-B1-A655-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10597e71-58d4-4013-97c4-efe9f0d395ea	4f069099-30a3-4559-b812-caa5ee9002f9	g.chr9:35800822delC	ENST00000342694.2	+	6	1590	c.1335delC	c.(1333-1335)gacfs	p.D445fs		NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2	445					bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	ACTTGGACGACCCATCCTGTG	0.582																																					p.D445fs		Atlas-Indel,Pindel	.											.	NPR2	162	.	0			c.1334delA						PASS	.						126.0	103.0	111.0					9																	35800822		2203	4300	6503	SO:0001589	frameshift_variant	4882	exon6			.	AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871	ENST00000342694.2:c.1335delC	chr9.hg19:g.35800822delC	ENSP00000341083:p.Asp445fs	60.0	0.0	0		82.0	21.0	0.256098	NM_003995	B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Frame_Shift_Del	DEL	ENST00000342694.2	hg19	CCDS6590.1																																																																																			.	.	.	none		0.582	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052345.1		
