#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
GABRD	2563	hgsc.bcm.edu	37	1	1960690	1960690	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr1:1960690G>A	ENST00000378585.4	+	7	915	c.832G>A	c.(832-834)Gcc>Acc	p.A278T		NM_000815.4	NP_000806.2	O14764	GBRD_HUMAN	gamma-aminobutyric acid (GABA) A receptor, delta	278					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			central_nervous_system(2)|endometrium(3)|kidney(2)|lung(8)|ovary(2)|prostate(1)|skin(2)	20	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;2.7e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.17e-24)|GBM - Glioblastoma multiforme(42;9.56e-08)|Colorectal(212;4.12e-05)|COAD - Colon adenocarcinoma(227;0.000194)|Kidney(185;0.00231)|BRCA - Breast invasive adenocarcinoma(365;0.00441)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0344)|Lung(427;0.2)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GGCGGTGCCCGCCAGGGTGTC	0.682																																					p.A278T		Atlas-SNP	.											.	GABRD	49	.	0			c.G832A						PASS	.						37.0	32.0	34.0					1																	1960690		2180	4269	6449	SO:0001583	missense	2563	exon7			GTGCCCGCCAGGG	BC033801	CCDS36.1	1p36.3	2012-06-22			ENSG00000187730	ENSG00000187730		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4084	protein-coding gene	gene with protein product	"""GABA(A) receptor, delta"""	137163				2176788, 10965146	Standard	NM_000815		Approved		uc001aip.2	O14764	OTTHUMG00000041064	ENST00000378585.4:c.832G>A	chr1.hg19:g.1960690G>A	ENSP00000367848:p.Ala278Thr	74.0	0.0	.		56.0	9.0	.	NM_000815	Q8N4N9	Missense_Mutation	SNP	ENST00000378585.4	hg19	CCDS36.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.624127	0.87560	.	.	ENSG00000187730	ENST00000378585	D	0.86164	-2.08	4.23	4.23	0.50019	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.95198	0.8443	H	0.94771	3.58	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.96541	0.9400	10	0.87932	D	0	-18.1939	16.1634	0.81734	0.0:0.0:1.0:0.0	.	278	O14764	GBRD_HUMAN	T	278	ENSP00000367848:A278T	ENSP00000367848:A278T	A	+	1	0	GABRD	1950550	1.000000	0.71417	0.998000	0.56505	0.588000	0.36517	9.302000	0.96175	2.367000	0.80283	0.655000	0.94253	GCC	.	.	.	none		0.682	GABRD-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098493.1	NM_000815	
FGR	2268	hgsc.bcm.edu	37	1	27943445	27943445	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr1:27943445T>A	ENST00000374005.3	-	7	893	c.605A>T	c.(604-606)aAa>aTa	p.K202I	FGR_ENST00000399173.1_Missense_Mutation_p.K202I|FGR_ENST00000545953.1_Missense_Mutation_p.K136I|FGR_ENST00000374004.1_Missense_Mutation_p.K202I	NM_005248.2	NP_005239.1	P09769	FGR_HUMAN	FGR proto-oncogene, Src family tyrosine kinase	202	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				blood coagulation (GO:0007596)|defense response to Gram-positive bacterium (GO:0050830)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of innate immune response (GO:0045088)|regulation of phagocytosis (GO:0050764)|regulation of protein kinase activity (GO:0045859)|response to virus (GO:0009615)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|Fc-gamma receptor I complex binding (GO:0034988)|immunoglobulin receptor binding (GO:0034987)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphotyrosine binding (GO:0001784)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(4)	16		all_lung(284;2.05e-05)|Colorectal(325;3.46e-05)|Lung NSC(340;3.67e-05)|Renal(390;0.00121)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00244)|KIRC - Kidney renal clear cell carcinoma(1967;0.0027)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		CATGTCCAGTTTGCGGATCTT	0.562																																					p.K202I		Atlas-SNP	.											.	FGR	39	.	0			c.A605T						PASS	.						172.0	152.0	159.0					1																	27943445		2203	4300	6503	SO:0001583	missense	2268	exon7			TCCAGTTTGCGGA	BC064382	CCDS305.1	1p36.2-p36.1	2014-06-25	2014-06-25		ENSG00000000938	ENSG00000000938		"""SH2 domain containing"""	3697	protein-coding gene	gene with protein product		164940	"""Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog"", ""v-fgr feline Gardner-Rasheed sarcoma viral oncogene homolog"", ""feline Gardner-Rasheed sarcoma viral oncogene homolog"""	SRC2		3922831	Standard	NM_001042729		Approved	c-fgr, p55c-fgr	uc001bom.3	P09769	OTTHUMG00000003516	ENST00000374005.3:c.605A>T	chr1.hg19:g.27943445T>A	ENSP00000363117:p.Lys202Ile	199.0	0.0	.		139.0	29.0	.	NM_001042729	D3DPL7|Q9UIQ3	Missense_Mutation	SNP	ENST00000374005.3	hg19	CCDS305.1	.	.	.	.	.	.	.	.	.	.	T	16.35	3.098543	0.56183	.	.	ENSG00000000938	ENST00000374005;ENST00000545953;ENST00000399173;ENST00000374004;ENST00000374003;ENST00000457296	D;D;D;D;D;D	0.89415	-2.51;-2.51;-2.51;-2.51;-2.51;-2.51	4.38	4.38	0.52667	SH2 motif (5);	0.000000	0.56097	D	0.000024	D	0.90662	0.7071	M	0.81497	2.545	0.32422	N	0.549198	B	0.22080	0.064	B	0.36289	0.221	D	0.92358	0.5895	10	0.62326	D	0.03	.	13.1133	0.59285	0.0:0.0:0.0:1.0	.	202	P09769	FGR_HUMAN	I	202;136;202;202;202;202	ENSP00000363117:K202I;ENSP00000445302:K136I;ENSP00000382126:K202I;ENSP00000363116:K202I;ENSP00000363115:K202I;ENSP00000407670:K202I	ENSP00000363115:K202I	K	-	2	0	FGR	27816032	1.000000	0.71417	0.927000	0.36925	0.561000	0.35649	8.040000	0.89188	1.903000	0.55091	0.402000	0.26972	AAA	.	.	.	none		0.562	FGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009772.1	NM_005248	
MRPS15	64960	hgsc.bcm.edu	37	1	36921882	36921882	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr1:36921882A>G	ENST00000373116.5	-	7	703	c.542T>C	c.(541-543)aTa>aCa	p.I181T	MRPS15_ENST00000488606.1_5'UTR	NM_031280.3	NP_112570.2	P82914	RT15_HUMAN	mitochondrial ribosomal protein S15	181					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)	14		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CCCCCAGCATATCTTCTCAAA	0.498																																					p.I181T		Atlas-SNP	.											.	MRPS15	21	.	0			c.T542C						PASS	.						93.0	87.0	89.0					1																	36921882		2203	4300	6503	SO:0001583	missense	64960	exon7			CAGCATATCTTCT	AB049946	CCDS411.1	1p34.3	2012-09-13			ENSG00000116898	ENSG00000116898		"""Mitochondrial ribosomal proteins / small subunits"""	14504	protein-coding gene	gene with protein product		611979					Standard	NM_031280		Approved	FLJ11564	uc001cas.2	P82914	OTTHUMG00000008042	ENST00000373116.5:c.542T>C	chr1.hg19:g.36921882A>G	ENSP00000362208:p.Ile181Thr	67.0	0.0	.		72.0	22.0	.	NM_031280	B2RD82|Q9H2K1	Missense_Mutation	SNP	ENST00000373116.5	hg19	CCDS411.1	.	.	.	.	.	.	.	.	.	.	A	0.013	-1.615508	0.00828	.	.	ENSG00000116898	ENST00000373116	.	.	.	6.17	-2.05	0.07321	S15/NS1, RNA-binding (2);	0.501132	0.23960	N	0.042864	T	0.19846	0.0477	N	0.14661	0.345	0.09310	N	0.999999	B	0.09022	0.002	B	0.09377	0.004	T	0.29971	-0.9994	9	0.07813	T	0.8	-14.528	12.7078	0.57070	0.5586:0.0:0.4414:0.0	.	181	P82914	RT15_HUMAN	T	181	.	ENSP00000362208:I181T	I	-	2	0	MRPS15	36694469	0.606000	0.26949	0.007000	0.13788	0.015000	0.08874	1.243000	0.32767	-0.243000	0.09653	-0.899000	0.02877	ATA	.	.	.	none		0.498	MRPS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022052.2	NM_031280	
BCAR3	8412	hgsc.bcm.edu	37	1	94033045	94033045	+	Missense_Mutation	SNP	G	G	C			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr1:94033045G>C	ENST00000370244.1	-	13	2378	c.2090C>G	c.(2089-2091)tCc>tGc	p.S697C	BCAR3_ENST00000260502.6_Missense_Mutation_p.S697C|BCAR3_ENST00000370247.3_Missense_Mutation_p.S606C|BCAR3_ENST00000370243.1_Missense_Mutation_p.S697C|BCAR3_ENST00000539242.1_Missense_Mutation_p.S373C	NM_001261408.1	NP_001248337.1	O75815	BCAR3_HUMAN	breast cancer anti-estrogen resistance 3	697	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				lens morphogenesis in camera-type eye (GO:0002089)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|response to drug (GO:0042493)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)		guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(1)	25		all_lung(203;0.00145)|Lung NSC(277;0.00662)		all cancers(265;0.0126)|GBM - Glioblastoma multiforme(16;0.0467)|Epithelial(280;0.166)		AACACATGTGGACTCTGAAGA	0.463																																					p.S697C		Atlas-SNP	.											.	BCAR3	62	.	0			c.C2090G						PASS	.						103.0	107.0	105.0					1																	94033045		2203	4300	6503	SO:0001583	missense	8412	exon11			CATGTGGACTCTG	U92715	CCDS745.1, CCDS58010.1	1p22.1	2013-02-14			ENSG00000137936	ENSG00000137936		"""SH2 domain containing"""	973	protein-coding gene	gene with protein product		604704				9582273	Standard	NM_001261408		Approved	NSP2, SH2D3B	uc001dpz.4	O75815	OTTHUMG00000010301	ENST00000370244.1:c.2090C>G	chr1.hg19:g.94033045G>C	ENSP00000359264:p.Ser697Cys	99.0	0.0	.		63.0	14.0	.	NM_001261409	D3DT43|Q5TEW3|Q6UW40|Q9BR50	Missense_Mutation	SNP	ENST00000370244.1	hg19	CCDS745.1	.	.	.	.	.	.	.	.	.	.	G	17.79	3.475298	0.63737	.	.	ENSG00000137936	ENST00000370247;ENST00000260502;ENST00000370244;ENST00000370243;ENST00000539242	T;T;T;T;T	0.34667	1.35;1.35;1.35;1.35;1.35	5.85	4.92	0.64577	Guanine-nucleotide dissociation stimulator CDC25 (3);Ras guanine nucleotide exchange factor, domain (1);	0.709965	0.14950	N	0.288969	T	0.26521	0.0648	L	0.53249	1.67	0.09310	N	1	P;P	0.52692	0.955;0.955	P;P	0.52598	0.703;0.703	T	0.12400	-1.0549	10	0.38643	T	0.18	-19.933	7.5531	0.27808	0.1189:0.0:0.7329:0.1482	.	697;606	O75815;Q5TEW3	BCAR3_HUMAN;.	C	606;697;697;697;373	ENSP00000359267:S606C;ENSP00000260502:S697C;ENSP00000359264:S697C;ENSP00000359263:S697C;ENSP00000441343:S373C	ENSP00000260502:S697C	S	-	2	0	BCAR3	93805633	1.000000	0.71417	0.201000	0.23476	0.452000	0.32318	3.862000	0.56009	1.434000	0.47414	0.655000	0.94253	TCC	.	.	.	none		0.463	BCAR3-003	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028420.1		
GON4L	54856	hgsc.bcm.edu	37	1	155734744	155734744	+	Intron	SNP	A	A	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr1:155734744A>G	ENST00000368331.1	-	21	4522				GON4L_ENST00000471341.1_5'UTR|GON4L_ENST00000437809.1_Intron|GON4L_ENST00000361040.5_Missense_Mutation_p.M1507T|GON4L_ENST00000271883.5_Intron	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)						regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					TAAGTGATACATATTACTGAG	0.398																																					p.M1507T		Atlas-SNP	.											.	GON4L	392	.	0			c.T4520C						PASS	.						84.0	76.0	78.0					1																	155734744		2203	4300	6503	SO:0001627	intron_variant	54856	exon21			TGATACATATTAC	AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.4473+46T>C	chr1.hg19:g.155734744A>G		299.0	0.0	.		303.0	86.0	.	NM_032292	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Missense_Mutation	SNP	ENST00000368331.1	hg19		.	.	.	.	.	.	.	.	.	.	A	10.67	1.416623	0.25552	.	.	ENSG00000116580	ENST00000361040	T	0.11277	2.79	4.47	-0.731	0.11151	.	.	.	.	.	T	0.01489	0.0048	N	0.08118	0	0.09310	N	1	B	0.13594	0.008	B	0.11329	0.006	T	0.46693	-0.9173	9	0.87932	D	0	.	4.9844	0.14182	0.5165:0.3159:0.1676:0.0	.	1507	Q3T8J9-2	.	T	1507	ENSP00000354322:M1507T	ENSP00000354322:M1507T	M	-	2	0	GON4L	154001368	0.000000	0.05858	0.000000	0.03702	0.121000	0.20230	-0.744000	0.04839	-0.308000	0.08792	0.378000	0.23410	ATG	.	.	.	none		0.398	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_032292	
GORAB	92344	hgsc.bcm.edu	37	1	170508438	170508438	+	Missense_Mutation	SNP	A	A	C			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr1:170508438A>C	ENST00000367763.3	+	2	244	c.224A>C	c.(223-225)aAa>aCa	p.K75T	GORAB_ENST00000367762.1_Missense_Mutation_p.K75T|GORAB_ENST00000465717.1_3'UTR	NM_152281.2	NP_689494.2	Q5T7V8	GORAB_HUMAN	golgin, RAB6-interacting	75						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)				endometrium(2)|large_intestine(3)|liver(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	17						CAAAGCCAAAAACTTGGGCTT	0.443																																					p.K75T		Atlas-SNP	.											.	GORAB	41	.	0			c.A224C						PASS	.						107.0	102.0	104.0					1																	170508438		2203	4300	6503	SO:0001583	missense	92344	exon2			GCCAAAAACTTGG	AK021814	CCDS1289.1, CCDS53428.1	1q24.2	2009-02-13	2009-02-13	2009-02-13	ENSG00000120370	ENSG00000120370			25676	protein-coding gene	gene with protein product	"""gerodermia osteodysplastica"""	607983	"""SCY1-like 1 binding protein 1"""	SCYL1BP1		12783284, 15781263, 18997784	Standard	NM_152281		Approved	FLJ11752, NTKL-BP1, GO	uc001gha.2	Q5T7V8	OTTHUMG00000035228	ENST00000367763.3:c.224A>C	chr1.hg19:g.170508438A>C	ENSP00000356737:p.Lys75Thr	164.0	0.0	.		149.0	39.0	.	NM_152281	Q49A22|Q6P1P9|Q9HAE6|Q9Y350	Missense_Mutation	SNP	ENST00000367763.3	hg19	CCDS1289.1	.	.	.	.	.	.	.	.	.	.	A	16.66	3.186138	0.57909	.	.	ENSG00000120370	ENST00000367763;ENST00000367762	T;T	0.63580	-0.05;-0.05	5.49	4.37	0.52481	.	0.297450	0.41194	D	0.000932	T	0.62307	0.2417	M	0.70275	2.135	0.32365	N	0.556672	D	0.71674	0.998	D	0.66351	0.943	T	0.66268	-0.5966	10	0.56958	D	0.05	-12.6953	6.2817	0.21011	0.7838:0.0:0.0755:0.1408	.	75	Q5T7V8	GORAB_HUMAN	T	75	ENSP00000356737:K75T;ENSP00000356736:K75T	ENSP00000356736:K75T	K	+	2	0	GORAB	168775062	1.000000	0.71417	1.000000	0.80357	0.654000	0.38779	2.106000	0.41835	0.919000	0.36945	0.528000	0.53228	AAA	.	.	.	none		0.443	GORAB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085226.1	NM_152281	
EIF2D	1939	hgsc.bcm.edu	37	1	206767112	206767112	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr1:206767112C>T	ENST00000271764.2	-	14	1748	c.1540G>A	c.(1540-1542)Ggt>Agt	p.G514S	EIF2D_ENST00000472709.2_Intron|EIF2D_ENST00000367114.3_Missense_Mutation_p.G390S	NM_006893.2	NP_008824.2	P41214	EIF2D_HUMAN	eukaryotic translation initiation factor 2D	514	SUI1. {ECO:0000255|PROSITE- ProRule:PRU00200}.				formation of translation preinitiation complex (GO:0001731)|intracellular protein transport (GO:0006886)|IRES-dependent translational initiation (GO:0002192)|ribosome disassembly (GO:0032790)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	receptor activity (GO:0004872)|translation initiation factor activity (GO:0003743)			autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23						GGGTCCAGACCATAGGCCTCC	0.622																																					p.G514S		Atlas-SNP	.											.	EIF2D	42	.	0			c.G1540A						PASS	.						59.0	53.0	55.0					1																	206767112		2203	4300	6503	SO:0001583	missense	1939	exon14			CCAGACCATAGGC	BC001585	CCDS1465.1, CCDS55680.1	1q32.1	2014-05-06	2011-01-19	2011-01-19	ENSG00000143486	ENSG00000143486			6583	protein-coding gene	gene with protein product		613709				20566627	Standard	NM_001201478		Approved	LGTN	uc001heh.2	P41214	OTTHUMG00000184619	ENST00000271764.2:c.1540G>A	chr1.hg19:g.206767112C>T	ENSP00000271764:p.Gly514Ser	45.0	0.0	.		37.0	8.0	.	NM_006893	Q5SY40|Q8IXV3|Q96DG3|Q96TG7|Q9NR27|Q9NSN0|Q9NV18|Q9NZ21	Missense_Mutation	SNP	ENST00000271764.2	hg19	CCDS1465.1	.	.	.	.	.	.	.	.	.	.	C	35	5.545011	0.96488	.	.	ENSG00000143486	ENST00000367114;ENST00000271764	T;T	0.31510	1.49;1.49	5.68	5.68	0.88126	Translation initiation factor SUI1 (3);	0.000000	0.85682	D	0.000000	T	0.55273	0.1910	M	0.72479	2.2	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.97110	1.0;0.976	T	0.44050	-0.9353	10	0.21540	T	0.41	-19.8057	18.7742	0.91904	0.0:1.0:0.0:0.0	.	390;514	P41214-2;P41214	.;EIF2D_HUMAN	S	390;514	ENSP00000356081:G390S;ENSP00000271764:G514S	ENSP00000271764:G514S	G	-	1	0	EIF2D	204833735	1.000000	0.71417	0.991000	0.47740	0.995000	0.86356	7.586000	0.82596	2.676000	0.91093	0.563000	0.77884	GGT	.	.	.	none		0.622	EIF2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088475.1	NM_006893	
TP53BP2	7159	hgsc.bcm.edu	37	1	223983631	223983631	+	Missense_Mutation	SNP	C	C	A	rs376978247		TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr1:223983631C>A	ENST00000343537.7	-	13	2901	c.2610G>T	c.(2608-2610)gaG>gaT	p.E870D	TP53BP2_ENST00000498843.1_5'UTR|TP53BP2_ENST00000391878.2_Missense_Mutation_p.E741D|TP53BP2_ENST00000391879.2_Missense_Mutation_p.E103D	NM_001031685.2	NP_001026855.2	Q13625	ASPP2_HUMAN	tumor protein p53 binding protein 2	864	Pro-rich.				cell cycle (GO:0007049)|central nervous system development (GO:0007417)|embryo development ending in birth or egg hatching (GO:0009792)|heart development (GO:0007507)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)|positive regulation of signal transduction (GO:0009967)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(131;0.0958)		GAGGGTACTCCTCCAGGTACA	0.572																																					p.E870D		Atlas-SNP	.											.	TP53BP2	144	.	0			c.G2610T						PASS	.						104.0	105.0	105.0					1																	223983631		2203	4300	6503	SO:0001583	missense	7159	exon13			GTACTCCTCCAGG	U09582	CCDS1538.1, CCDS44319.1	1q41	2014-06-24	2014-06-24		ENSG00000143514	ENSG00000143514		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	12000	protein-coding gene	gene with protein product		602143	"""tumor protein p53-binding protein, 2"""			8668206, 8016121	Standard	NM_005426		Approved	PPP1R13A, ASPP2, 53BP2	uc010pvb.2	Q13625	OTTHUMG00000037379	ENST00000343537.7:c.2610G>T	chr1.hg19:g.223983631C>A	ENSP00000341957:p.Glu870Asp	81.0	0.0	.		72.0	19.0	.	NM_001031685	B4DG66|Q12892|Q86X75|Q96KQ3	Missense_Mutation	SNP	ENST00000343537.7	hg19	CCDS44319.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.85|16.85	3.235801|3.235801	0.58886|0.58886	.|.	.|.	ENSG00000143514|ENSG00000143514	ENST00000391878;ENST00000343537;ENST00000391879|ENST00000494100	T;T;T|.	0.54279|.	0.68;0.85;0.58|.	5.55|5.55	3.32|3.32	0.38043|0.38043	Src homology-3 domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.60702|.	0.2289|.	L|L	0.60455|0.60455	1.87|1.87	0.80722|0.80722	D|D	1|1	D;D|.	0.69078|.	0.997;0.997|.	D;D|.	0.72625|.	0.978;0.978|.	T|.	0.54938|.	-0.8218|.	10|.	0.34782|.	T|.	0.22|.	.|.	9.5862|9.5862	0.39517|0.39517	0.0:0.7192:0.0:0.2808|0.0:0.7192:0.0:0.2808	.|.	870;864|.	B4DG66;Q13625|.	.;ASPP2_HUMAN|.	D|X	741;870;103|204	ENSP00000375750:E741D;ENSP00000341957:E870D;ENSP00000375751:E103D|.	ENSP00000341957:E870D|.	E|G	-|-	3|1	2|0	TP53BP2|TP53BP2	222050254|222050254	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.740000|0.740000	0.42216|0.42216	1.205000|1.205000	0.32308|0.32308	0.441000|0.441000	0.26529|0.26529	0.563000|0.563000	0.77884|0.77884	GAG|GGA	.	.	.	none		0.572	TP53BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090985.3	NM_001031685, NM_005426	
MYCN	4613	hgsc.bcm.edu	37	2	16082258	16082258	+	Silent	SNP	A	A	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr2:16082258A>G	ENST00000281043.3	+	2	369	c.72A>G	c.(70-72)ctA>ctG	p.L24L	MYCNOS_ENST00000419083.1_RNA|MYCNOS_ENST00000453400.1_RNA|MYCNOS_ENST00000420452.1_RNA|MYCNOS_ENST00000439180.1_RNA|MYCNOS_ENST00000448719.1_RNA	NM_005378.4	NP_005369.2	P04198	MYCN_HUMAN	v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog	24					branching morphogenesis of an epithelial tube (GO:0048754)|cartilage condensation (GO:0001502)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|lung development (GO:0030324)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|positive regulation of cell death (GO:0010942)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromatin (GO:0000785)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	31	all_cancers(1;1.35e-08)|all_neural(1;2.92e-24)|Lung SC(1;3.26e-07)|Medulloblastoma(1;6.9e-06)|all_lung(1;1.26e-05)|Glioma(3;0.135)|Acute lymphoblastic leukemia(172;0.155)|all_epithelial(1;0.169)|all_hematologic(175;0.197)		GBM - Glioblastoma multiforme(3;0.000332)			TTGACTCGCTACAGCCCTGCT	0.642			A		neuroblastoma																																p.L24L		Atlas-SNP	.		Dom	yes		2	2p24.1	4613	"""v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)"""		O	.	MYCN	63	.	0			c.A72G						PASS	.						54.0	56.0	56.0					2																	16082258		2203	4300	6503	SO:0001819	synonymous_variant	4613	exon2			CTCGCTACAGCCC	BC002712	CCDS1687.1	2p24.3	2013-08-14	2013-07-09		ENSG00000134323	ENSG00000134323		"""Basic helix-loop-helix proteins"""	7559	protein-coding gene	gene with protein product		164840		NMYC			Standard	XM_006711886		Approved	bHLHe37, N-myc, MYCNOT	uc002rci.3	P04198	OTTHUMG00000039579	ENST00000281043.3:c.72A>G	chr2.hg19:g.16082258A>G		264.0	0.0	.		216.0	58.0	.	NM_005378	Q53XS5|Q6LDT9	Silent	SNP	ENST00000281043.3	hg19	CCDS1687.1																																																																																			.	.	.	none		0.642	MYCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095469.2	NM_005378	
DPY30	84661	hgsc.bcm.edu	37	2	32264491	32264491	+	Splice_Site	SNP	T	T	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr2:32264491T>A	ENST00000342166.5	-	2	150	c.35A>T	c.(34-36)cAg>cTg	p.Q12L	DPY30_ENST00000295066.3_Splice_Site_p.Q12L			Q9C005	DPY30_HUMAN	dpy-30 homolog (C. elegans)	12					endosomal transport (GO:0016197)|histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)|trans-Golgi network (GO:0005802)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)			large_intestine(2)	2	Acute lymphoblastic leukemia(172;0.155)					TCCTGATACCTGCGTTTGTCC	0.567																																					p.Q12L		Atlas-SNP	.											.	DPY30	6	.	0			c.A35T						PASS	.						104.0	103.0	103.0					2																	32264491		2203	4300	6503	SO:0001630	splice_region_variant	84661	exon2			GATACCTGCGTTT		CCDS1777.1	2p22.3	2013-09-09			ENSG00000162961	ENSG00000162961			24590	protein-coding gene	gene with protein product		612032				12477932	Standard	XM_006712117		Approved	Saf19, HDPY-30, Cps25	uc002roa.1	Q9C005	OTTHUMG00000128457	ENST00000342166.5:c.36+1A>T	chr2.hg19:g.32264491T>A		117.0	0.0	.		103.0	29.0	.	NM_032574	D6W578	Missense_Mutation	SNP	ENST00000342166.5	hg19	CCDS1777.1	.	.	.	.	.	.	.	.	.	.	T	13.66	2.302365	0.40694	.	.	ENSG00000162961	ENST00000342166;ENST00000295066	.	.	.	5.92	3.54	0.40534	.	0.158879	0.56097	D	0.000023	T	0.44498	0.1296	.	.	.	0.41659	D	0.989174	B	0.14438	0.01	B	0.10450	0.005	T	0.45264	-0.9273	8	0.48119	T	0.1	-14.8864	9.1274	0.36824	0.0:0.0721:0.136:0.7919	.	12	Q9C005	DPY30_HUMAN	L	12	.	ENSP00000295066:Q12L	Q	-	2	0	DPY30	32117995	1.000000	0.71417	1.000000	0.80357	0.814000	0.46013	2.804000	0.47931	2.274000	0.75844	0.533000	0.62120	CAG	.	.	.	none		0.567	DPY30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250255.2	NM_032574	Missense_Mutation
EPAS1	2034	hgsc.bcm.edu	37	2	46607787	46607787	+	Missense_Mutation	SNP	C	C	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr2:46607787C>G	ENST00000263734.3	+	12	2486	c.1976C>G	c.(1975-1977)aCa>aGa	p.T659R		NM_001430.4	NP_001421.2	Q99814	EPAS1_HUMAN	endothelial PAS domain protein 1	659					angiogenesis (GO:0001525)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to hypoxia (GO:0071456)|embryonic placenta development (GO:0001892)|erythrocyte differentiation (GO:0030218)|lung development (GO:0030324)|mitochondrion organization (GO:0007005)|myoblast fate commitment (GO:0048625)|norepinephrine metabolic process (GO:0042415)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart rate (GO:0002027)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|surfactant homeostasis (GO:0043129)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|histone acetyltransferase binding (GO:0035035)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	LUSC - Lung squamous cell carcinoma(58;0.151)			GATCAGCGCACAGAGTTCTTG	0.592																																					p.T659R		Atlas-SNP	.											.	EPAS1	83	.	0			c.C1976G						PASS	.						71.0	83.0	79.0					2																	46607787		2199	4290	6489	SO:0001583	missense	2034	exon12			AGCGCACAGAGTT	U81984	CCDS1825.1	2p21-p16	2013-05-21			ENSG00000116016	ENSG00000116016		"""Basic helix-loop-helix proteins"""	3374	protein-coding gene	gene with protein product	"""HIF-1 alpha-like factor"""	603349				9000051, 9079689, 18378852	Standard	NM_001430		Approved	MOP2, PASD2, HIF2A, HLF, bHLHe73	uc002ruv.3	Q99814	OTTHUMG00000128818	ENST00000263734.3:c.1976C>G	chr2.hg19:g.46607787C>G	ENSP00000263734:p.Thr659Arg	90.0	0.0	.		76.0	17.0	.	NM_001430	Q86VA2|Q99630	Missense_Mutation	SNP	ENST00000263734.3	hg19	CCDS1825.1	.	.	.	.	.	.	.	.	.	.	C	9.602	1.128965	0.21041	.	.	ENSG00000116016	ENST00000263734	T	0.46451	0.87	4.89	3.08	0.35506	.	1.373260	0.04589	N	0.396496	T	0.30823	0.0777	N	0.22421	0.69	0.09310	N	1	B	0.23316	0.083	B	0.25405	0.06	T	0.26155	-1.0111	10	0.24483	T	0.36	.	6.4229	0.21754	0.1452:0.7017:0.0:0.1531	.	659	Q99814	EPAS1_HUMAN	R	659	ENSP00000263734:T659R	ENSP00000263734:T659R	T	+	2	0	EPAS1	46461291	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	1.108000	0.31123	0.480000	0.27534	-0.237000	0.12165	ACA	.	.	.	none		0.592	EPAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250752.2	NM_001430	
CNTNAP5	129684	hgsc.bcm.edu	37	2	125175092	125175092	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr2:125175092G>A	ENST00000431078.1	+	4	818	c.454G>A	c.(454-456)Gtt>Att	p.V152I		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	152	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		AGCCCGATTTGTTCGCTTTGT	0.498																																					p.V152I		Atlas-SNP	.											CNTNAP5,NS,haematopoietic_neoplasm,0,1	CNTNAP5	405	.	0			c.G454A						PASS	.						96.0	100.0	99.0					2																	125175092		1990	4172	6162	SO:0001583	missense	129684	exon4			CGATTTGTTCGCT	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.454G>A	chr2.hg19:g.125175092G>A	ENSP00000399013:p.Val152Ile	122.0	1.0	.		125.0	41.0	.	NM_130773	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	hg19	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	G	15.92	2.974606	0.53720	.	.	ENSG00000155052	ENST00000431078	D	0.97642	-4.47	6.17	-6.25	0.02039	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.767069	0.11093	N	0.600490	D	0.90116	0.6912	N	0.16656	0.425	0.29732	N	0.837787	B	0.02656	0.0	B	0.10450	0.005	T	0.79266	-0.1874	10	0.20046	T	0.44	.	9.7379	0.40399	0.4913:0.3858:0.1229:0.0	.	152	Q8WYK1	CNTP5_HUMAN	I	152	ENSP00000399013:V152I	ENSP00000399013:V152I	V	+	1	0	CNTNAP5	124891562	0.005000	0.15991	0.001000	0.08648	0.952000	0.60782	0.076000	0.14712	-1.035000	0.03291	0.655000	0.94253	GTT	.	.	.	none		0.498	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3		
CCDC141	285025	hgsc.bcm.edu	37	2	179843225	179843225	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr2:179843225C>A	ENST00000409284.1	-	3	520	c.403G>T	c.(403-405)Gaa>Taa	p.E135*	CCDC141_ENST00000420890.2_Nonsense_Mutation_p.E135*			Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	135										NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			AAGGCATTTTCAAAAAATTCA	0.413																																					p.E135X		Atlas-SNP	.											.,2	CCDC141	362	.	0			c.G403T						PASS	.																																			SO:0001587	stop_gained	285025	exon3			CATTTTCAAAAAA	AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000409284.1:c.403G>T	chr2.hg19:g.179843225C>A	ENSP00000386503:p.Glu135*	127.0	0.0	.		100.0	16.0	.	NM_173648	H7C0P1|J3KNW6|Q8N8H3	Nonsense_Mutation	SNP	ENST00000409284.1	hg19		.	.	.	.	.	.	.	.	.	.	C	34	5.311347	0.95655	.	.	ENSG00000163492	ENST00000420890;ENST00000443758;ENST00000446116;ENST00000409284	.	.	.	6.16	4.33	0.51752	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.7277	0.46079	0.0:0.6819:0.2519:0.0662	.	.	.	.	X	135	.	.	E	-	1	0	CCDC141	179551470	1.000000	0.71417	1.000000	0.80357	0.819000	0.46315	2.308000	0.43690	1.581000	0.49865	0.650000	0.86243	GAA	.	.	.	none		0.413	CCDC141-003	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000335873.1	NM_173648	
NEU2	4759	hgsc.bcm.edu	37	2	233898967	233898967	+	Silent	SNP	C	C	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr2:233898967C>T	ENST00000233840.3	+	2	343	c.343C>T	c.(343-345)Ctg>Ttg	p.L115L		NM_005383.2	NP_005374.2	Q9Y3R4	NEUR2_HUMAN	sialidase 2 (cytosolic sialidase)	115					ganglioside catabolic process (GO:0006689)|glycosphingolipid metabolic process (GO:0006687)|oligosaccharide catabolic process (GO:0009313)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	exo-alpha-(2->3)-sialidase activity (GO:0052794)|exo-alpha-(2->6)-sialidase activity (GO:0052795)|exo-alpha-(2->8)-sialidase activity (GO:0052796)			endometrium(3)|large_intestine(2)|lung(10)|skin(2)|urinary_tract(1)	18		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0271)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0839)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000311)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)|GBM - Glioblastoma multiforme(43;0.0488)	Oseltamivir(DB00198)|Zanamivir(DB00558)	GCAACAGCAGCTGCAGACCAG	0.627																																					p.L115L		Atlas-SNP	.											.	NEU2	42	.	0			c.C343T						PASS	.						89.0	72.0	78.0					2																	233898967		2203	4300	6503	SO:0001819	synonymous_variant	4759	exon2			CAGCAGCTGCAGA	Y16535	CCDS2501.1	2q37	2008-05-27			ENSG00000115488	ENSG00000115488			7759	protein-coding gene	gene with protein product	"""N-acetyl-alpha-neuraminidase 2"""	605528				10191093, 14613940	Standard	NM_005383		Approved	SIAL2	uc010zmn.2	Q9Y3R4	OTTHUMG00000133274	ENST00000233840.3:c.343C>T	chr2.hg19:g.233898967C>T		111.0	0.0	.		64.0	14.0	.	NM_005383	Q3KNW4|Q6NTB4	Silent	SNP	ENST00000233840.3	hg19	CCDS2501.1																																																																																			.	.	.	none		0.627	NEU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257053.2	NM_005383	
HDAC11	79885	hgsc.bcm.edu	37	3	13525052	13525052	+	Silent	SNP	T	T	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr3:13525052T>G	ENST00000295757.3	+	3	423	c.240T>G	c.(238-240)ctT>ctG	p.L80L	HDAC11_ENST00000446613.2_Intron|HDAC11_ENST00000405025.1_Silent_p.L52L|HDAC11_ENST00000404040.1_Silent_p.L80L|HDAC11_ENST00000433119.1_Silent_p.L52L|HDAC11_ENST00000402271.1_Silent_p.L80L|HDAC11_ENST00000402259.1_Intron|HDAC11_ENST00000437379.2_Silent_p.L52L|HDAC11_ENST00000404548.1_Silent_p.L80L|HDAC11_ENST00000522202.1_Silent_p.L52L	NM_024827.3	NP_079103.2	Q96DB2	HDA11_HUMAN	histone deacetylase 11	80	Histone deacetylase.				chromatin modification (GO:0016568)|histone deacetylation (GO:0016575)|oligodendrocyte development (GO:0014003)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone deacetylase activity (GO:0004407)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|transcription factor binding (GO:0008134)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(4)|prostate(3)	13						GGCGCTATCTTAATGAGCTCA	0.647																																					p.L80L		Atlas-SNP	.											.	HDAC11	39	.	0			c.T240G						PASS	.						63.0	72.0	69.0					3																	13525052		2203	4300	6503	SO:0001819	synonymous_variant	79885	exon3			CTATCTTAATGAG	AK025426	CCDS2615.1, CCDS46760.1	3p25.1	2008-07-18			ENSG00000163517	ENSG00000163517	3.5.1.98		19086	protein-coding gene	gene with protein product		607226				11948178	Standard	NM_001136041		Approved		uc003bxy.3	Q96DB2	OTTHUMG00000129800	ENST00000295757.3:c.240T>G	chr3.hg19:g.13525052T>G		180.0	0.0	.		105.0	65.0	.	NM_024827	B4DDK1|Q9H6I7|Q9H6X3|Q9NTC9	Silent	SNP	ENST00000295757.3	hg19	CCDS2615.1																																																																																			.	.	.	none		0.647	HDAC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252028.5	NM_024827	
TRAK1	22906	hgsc.bcm.edu	37	3	42218379	42218379	+	Silent	SNP	G	G	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr3:42218379G>A	ENST00000327628.5	+	3	760	c.360G>A	c.(358-360)gaG>gaA	p.E120E	TRAK1_ENST00000449246.1_Silent_p.E46E|TRAK1_ENST00000487159.1_3'UTR|TRAK1_ENST00000341421.3_Silent_p.E62E|TRAK1_ENST00000396175.1_Silent_p.E62E	NM_001042646.2	NP_001036111.1	Q9UPV9	TRAK1_HUMAN	trafficking protein, kinesin binding 1	120	HAP1 N-terminal.				endosome to lysosome transport (GO:0008333)|protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	22						GGCTTCTTGAGGAGGTAAGTG	0.388																																					p.E120E	GBM(44;195 884 22595 31865 41850)	Atlas-SNP	.											TRAK1_ENST00000543338,NS,carcinoma,0,3	TRAK1	188	.	0			c.G360A						PASS	.						157.0	164.0	162.0					3																	42218379		2203	4300	6503	SO:0001819	synonymous_variant	22906	exon3			TCTTGAGGAGGTA		CCDS2695.1, CCDS43072.1, CCDS58826.1, CCDS74922.1	3p22.1	2012-03-05			ENSG00000182606	ENSG00000182606			29947	protein-coding gene	gene with protein product	"""OGT(O Glc NAc transferase) interacting protein 106 KDa"", ""O-linked N-acetylglucosamine transferase interacting protein 106"", ""milton homolog 1 (Drosophila)"""	608112				10470851, 12435728, 16380713, 20230862	Standard	NM_014965		Approved	OIP106, KIAA1042, MILT1	uc003cky.4	Q9UPV9	OTTHUMG00000131795	ENST00000327628.5:c.360G>A	chr3.hg19:g.42218379G>A		126.0	0.0	.		82.0	39.0	.	NM_001265608	E9PDS2|J3KNT7|Q63HR0|Q659B5|Q96B69	Silent	SNP	ENST00000327628.5	hg19	CCDS43072.1																																																																																			.	.	.	none		0.388	TRAK1-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343413.1	NM_014965	
SNRK	54861	hgsc.bcm.edu	37	3	43388848	43388848	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr3:43388848A>T	ENST00000296088.7	+	7	1401	c.1097A>T	c.(1096-1098)aAa>aTa	p.K366I	RP11-188P20.3_ENST00000607513.1_RNA|SNRK_ENST00000454177.1_Missense_Mutation_p.K366I|SNRK_ENST00000437827.1_Missense_Mutation_p.K160I|SNRK_ENST00000429705.2_Missense_Mutation_p.K366I|SNRK-AS1_ENST00000422681.1_RNA	NM_017719.4	NP_060189.3			SNF related kinase											breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(5)|prostate(1)|skin(2)|stomach(1)	27				KIRC - Kidney renal clear cell carcinoma(284;0.0636)|Kidney(284;0.0792)		TGGCCAACCAAAATTGATGTA	0.483																																					p.K366I		Atlas-SNP	.											.	SNRK	118	.	0			c.A1097T						PASS	.						104.0	110.0	108.0					3																	43388848		1980	4155	6135	SO:0001583	missense	54861	exon7			CAACCAAAATTGA	D43636	CCDS43075.1	3p22.1	2005-08-09			ENSG00000163788	ENSG00000163788			30598	protein-coding gene	gene with protein product		612760				8654423, 7788527	Standard	NM_017719		Approved	FLJ20224, HSNFRK, KIAA0096	uc003cmt.4	Q9NRH2	OTTHUMG00000156491	ENST00000296088.7:c.1097A>T	chr3.hg19:g.43388848A>T	ENSP00000296088:p.Lys366Ile	55.0	0.0	.		27.0	16.0	.	NM_017719		Missense_Mutation	SNP	ENST00000296088.7	hg19	CCDS43075.1	.	.	.	.	.	.	.	.	.	.	A	14.78	2.636679	0.47049	.	.	ENSG00000163788	ENST00000454177;ENST00000429705;ENST00000296088;ENST00000437827	T;T;T;T	0.66460	-0.21;-0.21;-0.21;2.71	5.07	3.91	0.45181	.	0.175030	0.49305	N	0.000150	T	0.48960	0.1529	N	0.19112	0.55	0.49687	D	0.999812	B	0.23735	0.09	B	0.21360	0.034	T	0.49244	-0.8960	10	0.42905	T	0.14	.	10.4529	0.44533	0.9229:0.0:0.0771:0.0	.	366	Q9NRH2	SNRK_HUMAN	I	366;366;366;160	ENSP00000401246:K366I;ENSP00000411375:K366I;ENSP00000296088:K366I;ENSP00000409516:K160I	ENSP00000296088:K366I	K	+	2	0	SNRK	43363852	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.731000	0.68554	2.049000	0.60858	0.533000	0.62120	AAA	.	.	.	none		0.483	SNRK-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344325.1	NM_017719	
SH3TC1	54436	hgsc.bcm.edu	37	4	8230146	8230146	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr4:8230146T>C	ENST00000245105.3	+	12	2792	c.2725T>C	c.(2725-2727)Ttc>Ctc	p.F909L	SH3TC1_ENST00000539824.1_Missense_Mutation_p.F833L	NM_018986.3	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1	909										NS(1)|breast(3)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33						GCTGGCCAACTTCGGGGCCCT	0.706																																					p.F909L	NSCLC(145;2298 2623 35616 37297)	Atlas-SNP	.											.	SH3TC1	105	.	0			c.T2725C						PASS	.						32.0	39.0	37.0					4																	8230146		2202	4298	6500	SO:0001583	missense	54436	exon12			GCCAACTTCGGGG	AK074093	CCDS3399.1	4p16.1	2013-01-11			ENSG00000125089	ENSG00000125089		"""Tetratricopeptide (TTC) repeat domain containing"""	26009	protein-coding gene	gene with protein product							Standard	NM_018986		Approved	FLJ20356	uc003gkv.4	Q8TE82	OTTHUMG00000160934	ENST00000245105.3:c.2725T>C	chr4.hg19:g.8230146T>C	ENSP00000245105:p.Phe909Leu	73.0	0.0	.		82.0	24.0	.	NM_018986	Q4W5G5	Missense_Mutation	SNP	ENST00000245105.3	hg19	CCDS3399.1	.	.	.	.	.	.	.	.	.	.	T	3.669	-0.067891	0.07228	.	.	ENSG00000125089	ENST00000382516;ENST00000245105;ENST00000539824;ENST00000535265	T;T	0.56103	0.48;0.48	4.63	0.869	0.19096	Tetratricopeptide-like helical (1);	0.456640	0.23165	N	0.051183	T	0.31765	0.0807	L	0.29908	0.895	0.32645	N	0.520198	B	0.21225	0.053	B	0.25759	0.063	T	0.40327	-0.9569	10	0.02654	T	1	-12.4248	8.0727	0.30699	0.0:0.2424:0.0:0.7576	.	909	Q8TE82	S3TC1_HUMAN	L	647;909;833;738	ENSP00000245105:F909L;ENSP00000441045:F833L	ENSP00000245105:F909L	F	+	1	0	SH3TC1	8281046	1.000000	0.71417	0.984000	0.44739	0.251000	0.25915	1.897000	0.39799	0.167000	0.19631	0.459000	0.35465	TTC	.	.	.	none		0.706	SH3TC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206991.2	NM_018986	
NPFFR2	10886	hgsc.bcm.edu	37	4	73012854	73012854	+	Silent	SNP	C	C	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr4:73012854C>G	ENST00000308744.6	+	4	992	c.894C>G	c.(892-894)tcC>tcG	p.S298S	NPFFR2_ENST00000395999.1_Silent_p.S199S|NPFFR2_ENST00000344413.5_3'UTR|NPFFR2_ENST00000506359.1_3'UTR|NPFFR2_ENST00000358749.3_Silent_p.S196S	NM_004885.2	NP_004876.2	Q9Y5X5	NPFF2_HUMAN	neuropeptide FF receptor 2	298					detection of abiotic stimulus (GO:0009582)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of adenylate cyclase activity (GO:0045761)|regulation of cAMP-dependent protein kinase activity (GO:2000479)|regulation of MAPK cascade (GO:0043408)	actin cytoskeleton (GO:0015629)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(24)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43			Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)			GACTCAACTCCCAGAATAAAA	0.443																																					p.S298S		Atlas-SNP	.											.	NPFFR2	98	.	0			c.C894G						PASS	.						121.0	117.0	119.0					4																	73012854		2203	4300	6503	SO:0001819	synonymous_variant	10886	exon4			CAACTCCCAGAAT	AF236083	CCDS3551.1, CCDS3552.1, CCDS47072.1	4q21	2012-08-10	2006-02-15	2006-02-15	ENSG00000056291	ENSG00000056291		"""GPCR / Class A :  Neuropeptide receptors : FF/AF"", ""GPCR / Class A : RF amide peptide receptors"""	4525	protein-coding gene	gene with protein product	"""neuropeptide FF 2"""	607449	"""G protein-coupled receptor 74"""	GPR74		10079187, 10851242	Standard	NM_001144756		Approved	NPFF2, NPGPR	uc003hgg.2	Q9Y5X5	OTTHUMG00000129918	ENST00000308744.6:c.894C>G	chr4.hg19:g.73012854C>G		82.0	0.0	.		58.0	15.0	.	NM_004885	Q96RV1|Q9NR49	Silent	SNP	ENST00000308744.6	hg19	CCDS3551.1																																																																																			.	.	.	none		0.443	NPFFR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252170.2	NM_004885	
FAM13A	10144	hgsc.bcm.edu	37	4	89658657	89658657	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr4:89658657T>A	ENST00000264344.5	-	21	2819	c.2612A>T	c.(2611-2613)gAg>gTg	p.E871V	FAM13A_ENST00000513837.1_Missense_Mutation_p.E517V|FAM13A_ENST00000511976.1_Missense_Mutation_p.E457V|FAM13A_ENST00000508369.1_Missense_Mutation_p.E545V|FAM13A_ENST00000395002.2_Intron|FAM13A_ENST00000503556.1_Missense_Mutation_p.E531V	NM_014883.3	NP_055698.2	O94988	FA13A_HUMAN	family with sequence similarity 13, member A	871					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	55						AGTTTCGCCCTCGATAATTGG	0.542																																					p.E871V		Atlas-SNP	.											.	FAM13A	181	.	0			c.A2612T						PASS	.						103.0	100.0	101.0					4																	89658657		2203	4300	6503	SO:0001583	missense	10144	exon21			TCGCCCTCGATAA	AB020721	CCDS34029.1, CCDS43251.1, CCDS58911.1, CCDS58912.1, CCDS58913.1	4q22.1	2011-09-07	2009-01-20	2009-01-20	ENSG00000138640	ENSG00000138640		"""Rho GTPase activating proteins"""	19367	protein-coding gene	gene with protein product		613299	"""family with sequence similarity 13, member A1"""	FAM13A1			Standard	NM_014883		Approved	KIAA0914, ARHGAP48	uc003hse.2	O94988	OTTHUMG00000161006	ENST00000264344.5:c.2612A>T	chr4.hg19:g.89658657T>A	ENSP00000264344:p.Glu871Val	115.0	0.0	.		85.0	24.0	.	NM_014883	B4DLC1|Q24JP0|Q5PR21|Q8NBA3	Missense_Mutation	SNP	ENST00000264344.5	hg19	CCDS34029.1	.	.	.	.	.	.	.	.	.	.	T	25.5	4.640552	0.87859	.	.	ENSG00000138640	ENST00000264344;ENST00000503556;ENST00000511976;ENST00000508369;ENST00000513837	T;T;T;T;T	0.51817	1.33;0.69;0.77;0.7;0.71	4.84	4.84	0.62591	.	0.109676	0.64402	D	0.000010	T	0.66636	0.2809	M	0.71036	2.16	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;1.0;0.999;0.999	D;D;D;D;D	0.71870	0.974;0.975;0.963;0.974;0.974	T	0.71377	-0.4611	10	0.87932	D	0	.	14.5853	0.68320	0.0:0.0:0.0:1.0	.	517;457;871;531;545	O94988-6;E9PGM7;O94988;O94988-5;O94988-1	.;.;FA13A_HUMAN;.;.	V	871;531;457;545;517	ENSP00000264344:E871V;ENSP00000427189:E531V;ENSP00000421914:E457V;ENSP00000421562:E545V;ENSP00000423252:E517V	ENSP00000264344:E871V	E	-	2	0	FAM13A	89877680	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.507000	0.81676	2.023000	0.59567	0.477000	0.44152	GAG	.	.	.	none		0.542	FAM13A-022	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363371.1		
KIAA0922	23240	hgsc.bcm.edu	37	4	154542029	154542029	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr4:154542029C>A	ENST00000409663.3	+	27	3738	c.3686C>A	c.(3685-3687)tCa>tAa	p.S1229*	KIAA0922_ENST00000409959.3_Nonsense_Mutation_p.S1230*|KIAA0922_ENST00000440693.1_Nonsense_Mutation_p.S1146*	NM_015196.3	NP_056011.3	A2VDJ0	T131L_HUMAN	KIAA0922	1229						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(16)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	63	all_hematologic(180;0.093)	Renal(120;0.118)				GCTCCAGTCTCAAGGTGCGTA	0.303																																					p.S1230X		Atlas-SNP	.											.	KIAA0922	214	.	0			c.C3689A						PASS	.						94.0	112.0	106.0					4																	154542029		2203	4300	6503	SO:0001587	stop_gained	23240	exon27			CAGTCTCAAGGTG	AK096538	CCDS3783.2, CCDS47148.1	4q31.3	2008-02-05			ENSG00000121210	ENSG00000121210			29146	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_015196		Approved	DKFZp586H1322, TMEM131L	uc010ipp.3	A2VDJ0	OTTHUMG00000153244	ENST00000409663.3:c.3686C>A	chr4.hg19:g.154542029C>A	ENSP00000386574:p.Ser1229*	671.0	0.0	.		651.0	188.0	.	NM_001131007	B3KRV3|Q7LGA7|Q86Y92|Q8WU56|Q9H065|Q9Y2D7	Nonsense_Mutation	SNP	ENST00000409663.3	hg19	CCDS3783.2	.	.	.	.	.	.	.	.	.	.	C	40	7.923983	0.98563	.	.	ENSG00000121210	ENST00000409663;ENST00000440693;ENST00000409959;ENST00000240487	.	.	.	5.5	3.61	0.41365	.	1.125250	0.06486	N	0.733676	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	0.0653	9.2055	0.37287	0.0:0.8085:0.0:0.1915	.	.	.	.	X	1229;1146;1230;1007	.	ENSP00000240487:S1007X	S	+	2	0	KIAA0922	154761479	0.021000	0.18746	0.003000	0.11579	0.003000	0.03518	1.282000	0.33226	0.532000	0.28657	0.563000	0.77884	TCA	.	.	.	none		0.303	KIAA0922-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330370.1	NM_015196	
F2R	2149	hgsc.bcm.edu	37	5	76029290	76029290	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr5:76029290A>G	ENST00000319211.4	+	2	1505	c.1240A>G	c.(1240-1242)Aac>Gac	p.N414D		NM_001992.3	NP_001983.2	P25116	PAR1_HUMAN	coagulation factor II (thrombin) receptor	414					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPKK activity (GO:0000186)|anatomical structure morphogenesis (GO:0009653)|blood coagulation (GO:0007596)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|G-protein coupled receptor signaling pathway (GO:0007186)|homeostasis of number of cells within a tissue (GO:0048873)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of renin secretion into blood stream (GO:1900134)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|platelet dense granule organization (GO:0060155)|positive regulation of blood coagulation (GO:0030194)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasoconstriction (GO:0045907)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of blood coagulation (GO:0030193)|regulation of interleukin-1 beta production (GO:0032651)|regulation of sensory perception of pain (GO:0051930)|release of sequestered calcium ion into cytosol (GO:0051209)|response to lipopolysaccharide (GO:0032496)|response to wounding (GO:0009611)|STAT protein import into nucleus (GO:0007262)|tyrosine phosphorylation of STAT protein (GO:0007260)	caveola (GO:0005901)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|platelet dense tubular network (GO:0031094)|postsynaptic membrane (GO:0045211)	G-protein alpha-subunit binding (GO:0001965)|G-protein beta-subunit binding (GO:0031681)|G-protein coupled receptor activity (GO:0004930)|receptor binding (GO:0005102)|thrombin receptor activity (GO:0015057)			NS(1)|breast(1)|endometrium(3)|kidney(1)|lung(7)|ovary(3)	16		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Prostate(461;0.00955)|Ovarian(174;0.0129)		all cancers(79;4.43e-43)	Streptokinase(DB00086)	CTGCTCTAGTAACCTGAATAA	0.388																																					p.N414D		Atlas-SNP	.											.	F2R	58	.	0			c.A1240G						PASS	.						69.0	74.0	72.0					5																	76029290		2200	4300	6500	SO:0001583	missense	2149	exon2			TCTAGTAACCTGA	M62424	CCDS4032.1	5q13	2012-08-08			ENSG00000181104	ENSG00000181104		"""GPCR / Class A : Protease activated receptors"""	3537	protein-coding gene	gene with protein product		187930				8395910	Standard	NM_001992		Approved	TR, CF2R, PAR1, PAR-1	uc003ken.4	P25116	OTTHUMG00000131299	ENST00000319211.4:c.1240A>G	chr5.hg19:g.76029290A>G	ENSP00000321326:p.Asn414Asp	143.0	0.0	.		121.0	21.0	.	NM_001992	Q53XV0|Q96RF7|Q9BUN4	Missense_Mutation	SNP	ENST00000319211.4	hg19	CCDS4032.1	.	.	.	.	.	.	.	.	.	.	A	14.69	2.610635	0.46527	.	.	ENSG00000181104	ENST00000319211	T	0.75938	-0.98	4.79	1.18	0.20946	.	0.606938	0.17367	N	0.176834	T	0.67477	0.2897	L	0.59436	1.845	0.29406	N	0.861551	P	0.35433	0.501	B	0.32864	0.154	T	0.59968	-0.7354	10	0.34782	T	0.22	-19.7943	13.2149	0.59854	0.7302:0.2698:0.0:0.0	.	414	P25116	PAR1_HUMAN	D	414	ENSP00000321326:N414D	ENSP00000321326:N414D	N	+	1	0	F2R	76065046	0.204000	0.23447	0.988000	0.46212	0.977000	0.68977	0.936000	0.28938	0.110000	0.17919	0.379000	0.24179	AAC	.	.	.	none		0.388	F2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254068.2		
TMEM173	340061	hgsc.bcm.edu	37	5	138855862	138855862	+	Missense_Mutation	SNP	C	C	T	rs117897081	byFrequency	TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr5:138855862C>T	ENST00000330794.4	-	8	1457	c.1124G>A	c.(1123-1125)cGc>cAc	p.R375H	TMEM173_ENST00000511850.1_5'Flank	NM_198282.2	NP_938023.1	Q86WV6	STING_HUMAN	transmembrane protein 173	375	C-terminal tail (CTT).				activation of innate immune response (GO:0002218)|apoptotic process (GO:0006915)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|interferon-beta production (GO:0032608)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of protein binding (GO:0032092)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytoplasmic vesicle membrane (GO:0030659)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	cyclic-di-GMP binding (GO:0035438)|cyclic-GMP-AMP binding (GO:0061507)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|transcription factor binding (GO:0008134)			endometrium(1)|kidney(1)|lung(6)|upper_aerodigestive_tract(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GAAATCCGTGCGGAGAGGGAG	0.597																																					p.R375H		Atlas-SNP	.											.	TMEM173	19	.	0			c.G1124A						PASS	.						44.0	44.0	44.0					5																	138855862		2203	4300	6503	SO:0001583	missense	340061	exon8			TCCGTGCGGAGAG		CCDS4215.1	5q31.2	2009-11-06			ENSG00000184584	ENSG00000184584			27962	protein-coding gene	gene with protein product		612374				12477932	Standard	XM_005268445		Approved	FLJ38577, NET23	uc003lep.3	Q86WV6	OTTHUMG00000129239	ENST00000330794.4:c.1124G>A	chr5.hg19:g.138855862C>T	ENSP00000331288:p.Arg375His	105.0	0.0	.		90.0	38.0	.	NM_198282	A8K3P6|B6EB35|D6RBX0|D6RE01|D6RID9	Missense_Mutation	SNP	ENST00000330794.4	hg19	CCDS4215.1	.	.	.	.	.	.	.	.	.	.	C	13.97	2.395533	0.42512	.	.	ENSG00000184584	ENST00000330794	T	0.30448	1.53	5.36	3.48	0.39840	.	0.070055	0.53938	N	0.000050	T	0.36744	0.0978	M	0.70595	2.14	0.35562	D	0.804743	D	0.60160	0.987	P	0.50537	0.643	T	0.49532	-0.8930	10	0.42905	T	0.14	-17.9707	5.749	0.18136	0.1568:0.6785:0.0:0.1647	.	375	Q86WV6	TM173_HUMAN	H	375	ENSP00000331288:R375H	ENSP00000331288:R375H	R	-	2	0	TMEM173	138836046	0.671000	0.27521	0.933000	0.37362	0.148000	0.21650	0.972000	0.29409	1.268000	0.44264	-0.369000	0.07265	CGC	.	C|0.995;A|0.005	.	alt		0.597	TMEM173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251338.1	NM_198282	
UNC5A	90249	hgsc.bcm.edu	37	5	176305475	176305475	+	Splice_Site	SNP	G	G	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr5:176305475G>A	ENST00000329542.4	+	13	2293		c.e13-1		UNC5A_ENST00000261961.3_Splice_Site	NM_133369.2	NP_588610.2	Q6ZN44	UNC5A_HUMAN	unc-5 homolog A (C. elegans)						anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.?(1)		endometrium(4)|kidney(3)|large_intestine(2)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	34	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ATCCCCATCAGGAGATCCCCT	0.612																																					.		Atlas-SNP	.											UNC5A,NS,carcinoma,0,1	UNC5A	76	.	1	Unknown(1)	kidney(1)	c.2020-1G>A						PASS	.						89.0	83.0	85.0					5																	176305475		2203	4300	6503	SO:0001630	splice_region_variant	90249	exon13			CCATCAGGAGATC	AB075856	CCDS34299.1	5q35.3	2013-01-11	2001-11-28		ENSG00000113763	ENSG00000113763		"""Immunoglobulin superfamily / I-set domain containing"""	12567	protein-coding gene	gene with protein product		607869	"""unc5 (C.elegans homolog) a"""				Standard	XM_006714927		Approved	KIAA1976, UNC5H1	uc003mey.3	Q6ZN44	OTTHUMG00000163225	ENST00000329542.4:c.2020-1G>A	chr5.hg19:g.176305475G>A		115.0	0.0	.		110.0	24.0	.	NM_133369	B2RXE6|Q8TF26|Q96GP4	Splice_Site	SNP	ENST00000329542.4	hg19	CCDS34299.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.275028	0.80580	.	.	ENSG00000113763	ENST00000329542;ENST00000261961	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.176	0.89761	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UNC5A	176238081	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	9.860000	0.99555	2.641000	0.89580	0.491000	0.48974	.	.	.	.	none		0.612	UNC5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372166.1	XM_030300	Intron
COL19A1	1310	hgsc.bcm.edu	37	6	70646796	70646796	+	Silent	SNP	A	A	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr6:70646796A>G	ENST00000322773.4	+	8	969	c.867A>G	c.(865-867)ccA>ccG	p.P289P		NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	289					cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						AGTGCATTCCAAACAAGGTAT	0.448																																					p.P289P		Atlas-SNP	.											.	COL19A1	232	.	0			c.A867G						PASS	.						145.0	136.0	139.0					6																	70646796		2203	4300	6503	SO:0001819	synonymous_variant	1310	exon8			CATTCCAAACAAG		CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.867A>G	chr6.hg19:g.70646796A>G		122.0	0.0	.		102.0	28.0	.	NM_001858	Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Silent	SNP	ENST00000322773.4	hg19	CCDS4970.1																																																																																			.	.	.	none		0.448	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041127.1		
LIMK1	3984	hgsc.bcm.edu	37	7	73535230	73535230	+	Silent	SNP	G	G	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr7:73535230G>A	ENST00000336180.2	+	15	1683	c.1632G>A	c.(1630-1632)ggG>ggA	p.G544G	LIMK1_ENST00000418310.1_Silent_p.G574G|LIMK1_ENST00000538333.3_Silent_p.G510G	NM_002314.3	NP_002305.1	P53667	LIMK1_HUMAN	LIM domain kinase 1	544	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|nervous system development (GO:0007399)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of axon extension (GO:0045773)|positive regulation of stress fiber assembly (GO:0051496)|protein phosphorylation (GO:0006468)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)	ATP binding (GO:0005524)|heat shock protein binding (GO:0031072)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	21		Lung NSC(55;0.137)			Dabrafenib(DB08912)	AGATCATCGGGCGGGTGAACG	0.647																																					p.G544G		Atlas-SNP	.											.	LIMK1	55	.	0			c.G1632A						PASS	.						86.0	82.0	84.0					7																	73535230		2203	4300	6503	SO:0001819	synonymous_variant	3984	exon15			CATCGGGCGGGTG	D26309	CCDS5563.1, CCDS56491.1	7q11.23	2005-01-21			ENSG00000106683	ENSG00000106683			6613	protein-coding gene	gene with protein product		601329				8673124, 8812460	Standard	NM_002314		Approved	LIMK	uc003uaa.2	P53667	OTTHUMG00000023448	ENST00000336180.2:c.1632G>A	chr7.hg19:g.73535230G>A		135.0	0.0	.		126.0	6.0	.	NM_002314	B7Z6I8|D3DXF4|D3DXF5|O15283|Q15820|Q15821|Q75MU3|Q9Y5Q1	Silent	SNP	ENST00000336180.2	hg19	CCDS5563.1																																																																																			.	.	.	none		0.647	LIMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252335.2	NM_002314	
SRRT	51593	hgsc.bcm.edu	37	7	100485704	100485704	+	Missense_Mutation	SNP	C	C	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr7:100485704C>A	ENST00000347433.4	+	18	2526	c.2368C>A	c.(2368-2370)Cag>Aag	p.Q790K	SRRT_ENST00000457580.2_Missense_Mutation_p.Q786K|SRRT_ENST00000388793.4_Missense_Mutation_p.Q789K|SRRT_ENST00000432932.1_Missense_Mutation_p.Q785K			Q9BXP5	SRRT_HUMAN	serrate, RNA effector molecule	790	Pro-rich.				cell proliferation (GO:0008283)|neuronal stem cell maintenance (GO:0097150)|primary miRNA processing (GO:0031053)|regulation of transcription, DNA-templated (GO:0006355)|response to arsenic-containing substance (GO:0046685)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						CTACCCACACCAGACTCCCCA	0.612																																					p.Q790K		Atlas-SNP	.											.	SRRT	108	.	0			c.C2368A						PASS	.						52.0	56.0	55.0					7																	100485704		2203	4300	6503	SO:0001583	missense	51593	exon18			CCACACCAGACTC		CCDS34709.1, CCDS47665.1, CCDS47666.1, CCDS47667.1	7q21	2014-04-14	2014-04-14		ENSG00000087087	ENSG00000087087			24101	protein-coding gene	gene with protein product	"""arsenite resistance protein"""	614469	"""serrate RNA effector molecule homolog (Arabidopsis)"""			11239002, 11230166	Standard	NM_015908		Approved	Asr2, serrate, ARS2	uc003uwy.2	Q9BXP5	OTTHUMG00000157031	ENST00000347433.4:c.2368C>A	chr7.hg19:g.100485704C>A	ENSP00000314491:p.Gln790Lys	157.0	0.0	.		148.0	69.0	.	NM_015908	A4D2E5|A4D2E6|A6NK22|B4DJL4|B4DZA6|O95808|Q32MI4|Q6NT74|Q8TDQ5|Q9BWP6|Q9BXP4|Q9Y4S4	Missense_Mutation	SNP	ENST00000347433.4	hg19	CCDS34709.1	.	.	.	.	.	.	.	.	.	.	C	16.78	3.217920	0.58560	.	.	ENSG00000087087	ENST00000457580;ENST00000388793;ENST00000342198;ENST00000432932;ENST00000347433;ENST00000448764;ENST00000445337	.	.	.	4.91	4.91	0.64330	Arsenite-resistance protein 2 (1);	0.000000	0.85682	D	0.000000	T	0.50446	0.1616	N	0.08118	0	0.51767	D	0.999935	B;P;P;D	0.53885	0.206;0.954;0.954;0.963	B;D;D;D	0.71414	0.058;0.954;0.954;0.973	T	0.46789	-0.9166	9	0.15952	T	0.53	.	15.6172	0.76775	0.0:1.0:0.0:0.0	.	789;785;786;790	Q9BXP5-3;Q9BXP5-4;Q9BXP5-2;Q9BXP5	.;.;.;SRRT_HUMAN	K	786;789;155;785;790;420;67	.	ENSP00000344670:Q155K	Q	+	1	0	SRRT	100323640	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.964000	0.63701	2.545000	0.85829	0.484000	0.47621	CAG	.	.	.	none		0.612	SRRT-004	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347168.1	NM_015908	
ANK1	286	hgsc.bcm.edu	37	8	41551436	41551436	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr8:41551436C>T	ENST00000347528.4	-	29	3595	c.3512G>A	c.(3511-3513)cGc>cAc	p.R1171H	ANK1_ENST00000396945.1_Missense_Mutation_p.R1171H|ANK1_ENST00000265709.8_Missense_Mutation_p.R1212H|ANK1_ENST00000379758.2_Missense_Mutation_p.R1171H|ANK1_ENST00000396942.1_Missense_Mutation_p.R1171H|ANK1_ENST00000289734.7_Missense_Mutation_p.R1171H|ANK1_ENST00000352337.4_Missense_Mutation_p.R1171H	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	1171	ZU5 2. {ECO:0000255|PROSITE- ProRule:PRU00485}.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.R1171H(1)		breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			GCAAAGCAGGCGCAGGCTGGT	0.647																																					p.R1212H		Atlas-SNP	.											ANK1,caecum,carcinoma,0,1	ANK1	497	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3635A						PASS	.						31.0	28.0	29.0					8																	41551436		2203	4300	6503	SO:0001583	missense	286	exon30			AGCAGGCGCAGGC	M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.3512G>A	chr8.hg19:g.41551436C>T	ENSP00000339620:p.Arg1171His	176.0	0.0	.		161.0	37.0	.	NM_001142446	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	ENST00000347528.4	hg19	CCDS6119.1	.	.	.	.	.	.	.	.	.	.	C	35	5.421819	0.96111	.	.	ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	T;T;T;T;T;T;T	0.73469	-0.72;-0.72;-0.69;-0.68;-0.69;-0.67;-0.75	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	D	0.87018	0.6073	M	0.80183	2.485	0.80722	D	1	D;D;D;P;D;D	0.89917	0.988;0.996;0.994;0.914;0.988;1.0	D;P;P;P;D;D	0.73708	0.91;0.821;0.677;0.498;0.91;0.981	D	0.88810	0.3291	10	0.87932	D	0	.	18.7318	0.91738	0.0:1.0:0.0:0.0	.	1212;1171;1171;1171;1171;487	P16157-21;P16157-4;P16157;P16157-5;P16157-3;B3KX39	.;.;ANK1_HUMAN;.;.;.	H	1171;1171;1171;1171;1171;1171;1212;1171	ENSP00000339620:R1171H;ENSP00000289734:R1171H;ENSP00000369082:R1171H;ENSP00000380149:R1171H;ENSP00000380147:R1171H;ENSP00000309131:R1171H;ENSP00000265709:R1212H	ENSP00000265709:R1212H	R	-	2	0	ANK1	41670593	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.794000	0.85869	2.493000	0.84123	0.313000	0.20887	CGC	.	.	.	none		0.647	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475	
RFX3	5991	hgsc.bcm.edu	37	9	3271084	3271084	+	Missense_Mutation	SNP	C	C	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr9:3271084C>G	ENST00000382004.3	-	11	1432	c.1121G>C	c.(1120-1122)aGc>aCc	p.S374T	RFX3_ENST00000358730.2_Missense_Mutation_p.S374T|RFX3_ENST00000302303.1_Missense_Mutation_p.S374T	NM_001282116.1|NM_134428.1	NP_001269045.1|NP_602304.1	P48380	RFX3_HUMAN	regulatory factor X, 3 (influences HLA class II expression)	374					cell maturation (GO:0048469)|cilium assembly (GO:0042384)|cilium-dependent cell motility (GO:0060285)|endocrine pancreas development (GO:0031018)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type B pancreatic cell development (GO:2000078)|regulation of insulin secretion (GO:0050796)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell maturation (GO:0072560)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(11)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(50;0.00124)|Lung(2;0.0337)		TTCTATCAGGCTAAATTGAAG	0.388																																					p.S374T		Atlas-SNP	.											.	RFX3	156	.	0			c.G1121C						PASS	.						166.0	152.0	156.0					9																	3271084		2203	4300	6503	SO:0001583	missense	5991	exon11			ATCAGGCTAAATT	AI811824	CCDS6449.1, CCDS6450.1, CCDS75809.1	9p24.2	2008-02-05			ENSG00000080298	ENSG00000080298			9984	protein-coding gene	gene with protein product		601337				8289803	Standard	XM_005251534		Approved		uc003zhr.3	P48380	OTTHUMG00000019456	ENST00000382004.3:c.1121G>C	chr9.hg19:g.3271084C>G	ENSP00000371434:p.Ser374Thr	111.0	0.0	.		122.0	35.0	.	NM_134428	A8K0H5|D3DRH8|D3DRH9|Q5JTL7|Q5JTL8|Q6NW13|Q8WTU4|Q95HL5|Q95HL6	Missense_Mutation	SNP	ENST00000382004.3	hg19	CCDS6449.1	.	.	.	.	.	.	.	.	.	.	c	5.417	0.262094	0.10239	.	.	ENSG00000080298	ENST00000382004;ENST00000358730;ENST00000302303	T;T;T	0.08102	3.13;3.13;3.13	5.76	4.85	0.62838	.	0.039316	0.85682	D	0.000000	T	0.03695	0.0105	N	0.04508	-0.205	0.48632	D	0.999686	B;B;B	0.09022	0.002;0.0;0.002	B;B;B	0.12156	0.007;0.007;0.004	T	0.43877	-0.9364	10	0.09338	T	0.73	-10.837	11.3803	0.49752	0.0:0.8614:0.0:0.1386	.	374;374;374	P48380-3;P48380-2;P48380	.;.;RFX3_HUMAN	T	374	ENSP00000371434:S374T;ENSP00000351574:S374T;ENSP00000303847:S374T	ENSP00000303847:S374T	S	-	2	0	RFX3	3261084	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.760000	0.55235	2.738000	0.93877	0.645000	0.84053	AGC	.	.	.	none		0.388	RFX3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051545.1	NM_002919	
STXBP1	6812	hgsc.bcm.edu	37	9	130438137	130438137	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr9:130438137G>A	ENST00000373299.1	+	14	1280	c.1165G>A	c.(1165-1167)Gcc>Acc	p.A389T	STXBP1_ENST00000373302.3_Missense_Mutation_p.A389T|STXBP1_ENST00000481942.1_3'UTR	NM_001032221.3	NP_001027392.1	P61764	STXB1_HUMAN	syntaxin binding protein 1	389					axon target recognition (GO:0007412)|energy reserve metabolic process (GO:0006112)|glutamate secretion (GO:0014047)|long term synaptic depression (GO:0060292)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|protein stabilization (GO:0050821)|protein transport (GO:0015031)|regulation of insulin secretion (GO:0050796)|regulation of SNARE complex assembly (GO:0035542)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|regulation of synaptic vesicle priming (GO:0010807)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|synaptic vesicle maturation (GO:0016188)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|protein complex (GO:0043234)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|SNARE binding (GO:0000149)|syntaxin binding (GO:0019905)|syntaxin-1 binding (GO:0017075)			breast(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(7)|skin(2)	23						CCCTATGCGAGCCATCGTCCC	0.507																																					p.A389T		Atlas-SNP	.											.	STXBP1	99	.	0			c.G1165A						PASS	.						157.0	112.0	127.0					9																	130438137		2203	4300	6503	SO:0001583	missense	6812	exon14			ATGCGAGCCATCG	AF004563	CCDS6874.1, CCDS35146.1	9q34.1	2008-07-21			ENSG00000136854	ENSG00000136854			11444	protein-coding gene	gene with protein product	"""syntaxin-binding protein 1"""	602926				9545644	Standard	NM_001032221		Approved	hUNC18, MUNC18-1, UNC18, rbSec1	uc004brk.2	P61764	OTTHUMG00000020713	ENST00000373299.1:c.1165G>A	chr9.hg19:g.130438137G>A	ENSP00000362396:p.Ala389Thr	123.0	0.0	.		92.0	22.0	.	NM_001032221	B1AM97|Q28208|Q62759|Q64320|Q96TG8	Missense_Mutation	SNP	ENST00000373299.1	hg19	CCDS35146.1	.	.	.	.	.	.	.	.	.	.	G	14.01	2.406455	0.42715	.	.	ENSG00000136854	ENST00000535154;ENST00000373302;ENST00000541198;ENST00000373299	T;T	0.80033	-1.33;-1.33	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.62913	0.2467	N	0.04203	-0.255	0.58432	D	0.999998	B;B	0.14012	0.009;0.008	B;B	0.18263	0.021;0.012	T	0.59369	-0.7467	10	0.13108	T	0.6	-12.1555	17.491	0.87703	0.0:0.0:1.0:0.0	.	389;389	P61764;P61764-2	STXB1_HUMAN;.	T	343;389;221;389	ENSP00000362399:A389T;ENSP00000362396:A389T	ENSP00000362396:A389T	A	+	1	0	STXBP1	129477958	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.669000	0.68081	2.793000	0.96121	0.655000	0.94253	GCC	.	.	.	none		0.507	STXBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054229.1	NM_003165	
ASB6	140459	hgsc.bcm.edu	37	9	132400146	132400146	+	Nonsense_Mutation	SNP	T	T	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr9:132400146T>A	ENST00000277458.4	-	6	1354	c.1189A>T	c.(1189-1191)Aaa>Taa	p.K397*	RP11-483H20.4_ENST00000455074.1_RNA|ASB6_ENST00000277459.4_3'UTR|ASB6_ENST00000450050.2_Nonsense_Mutation_p.K318*	NM_017873.3	NP_060343.1	Q9NWX5	ASB6_HUMAN	ankyrin repeat and SOCS box containing 6	397	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				NS(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)	15		Ovarian(14;0.00556)				GGCAGGGCTTTGACCTTCACA	0.607																																					p.K397X		Atlas-SNP	.											.	ASB6	31	.	0			c.A1189T						PASS	.						66.0	63.0	64.0					9																	132400146		2203	4300	6503	SO:0001587	stop_gained	140459	exon6			GGGCTTTGACCTT		CCDS6924.1, CCDS6925.1, CCDS75919.1	9q34.13	2013-01-10	2011-01-25		ENSG00000148331	ENSG00000148331		"""Ankyrin repeat domain containing"""	17181	protein-coding gene	gene with protein product		615051	"""ankyrin repeat and SOCS box-containing 6"""				Standard	NM_017873		Approved		uc004byf.2	Q9NWX5	OTTHUMG00000020787	ENST00000277458.4:c.1189A>T	chr9.hg19:g.132400146T>A	ENSP00000277458:p.Lys397*	47.0	0.0	.		29.0	9.0	.	NM_017873	Q5SZB7|Q9BV15	Nonsense_Mutation	SNP	ENST00000277458.4	hg19	CCDS6924.1	.	.	.	.	.	.	.	.	.	.	T	37	6.123362	0.97305	.	.	ENSG00000148331	ENST00000277458;ENST00000450050	.	.	.	4.95	0.937	0.19494	.	0.300887	0.39759	N	0.001264	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.0669	11.7516	0.51852	0.0:0.0:0.4323:0.5677	.	.	.	.	X	397;318	.	ENSP00000277458:K397X	K	-	1	0	ASB6	131439967	0.998000	0.40836	0.854000	0.33618	0.993000	0.82548	1.584000	0.36589	-0.003000	0.14444	0.379000	0.24179	AAA	.	.	.	none		0.607	ASB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054594.1	NM_017873	
ALOX5	240	hgsc.bcm.edu	37	10	45936826	45936826	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr10:45936826T>A	ENST00000374391.2	+	9	1273	c.1220T>A	c.(1219-1221)aTc>aAc	p.I407N	ALOX5_ENST00000542434.1_Missense_Mutation_p.I407N	NM_000698.3|NM_001256153.1	NP_000689.1|NP_001243082.1	P09917	LOX5_HUMAN	arachidonate 5-lipoxygenase	407	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|leukotriene production involved in inflammatory response (GO:0002540)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nuclear envelope (GO:0005635)|nuclear envelope lumen (GO:0005641)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)	arachidonate 5-lipoxygenase activity (GO:0004051)|iron ion binding (GO:0005506)			breast(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Lung SC(717;0.0257)			Aminosalicylic Acid(DB00233)|Balsalazide(DB01014)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Mesalazine(DB00244)|Minocycline(DB01017)|Montelukast(DB00471)|Sulfasalazine(DB00795)|Vitamin E(DB00163)|Zileuton(DB00744)	ACCATTGCAATCAACACCAAG	0.627																																					p.I407N		Atlas-SNP	.											.	ALOX5	88	.	0			c.T1220A						PASS	.						180.0	169.0	173.0					10																	45936826		2203	4300	6503	SO:0001583	missense	240	exon9			TTGCAATCAACAC	J03571	CCDS7212.1, CCDS58078.1	10q11.2	2008-03-18			ENSG00000012779	ENSG00000012779	1.13.11.34	"""Arachidonate lipoxygenases"""	435	protein-coding gene	gene with protein product		152390				2565035	Standard	NM_001256153		Approved	5-LOX	uc001jce.4	P09917	OTTHUMG00000018081	ENST00000374391.2:c.1220T>A	chr10.hg19:g.45936826T>A	ENSP00000363512:p.Ile407Asn	94.0	0.0	.		67.0	24.0	.	NM_000698	B7ZLS0|E5FPY5|E5FPY7|E5FPY8|Q5JQ14	Missense_Mutation	SNP	ENST00000374391.2	hg19	CCDS7212.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.185478	0.78677	.	.	ENSG00000012779	ENST00000542434;ENST00000374391	D;D	0.94000	-3.33;-3.33	5.45	5.45	0.79879	Lipoxygenase, C-terminal (3);	0.047406	0.85682	D	0.000000	D	0.97399	0.9149	M	0.93197	3.39	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.989;0.995	D	0.98292	1.0514	10	0.87932	D	0	-34.9933	13.4602	0.61223	0.0:0.0:0.0:1.0	.	407;407;407	B7ZLS0;E5FPY8;P09917	.;.;LOX5_HUMAN	N	407	ENSP00000437634:I407N;ENSP00000363512:I407N	ENSP00000363512:I407N	I	+	2	0	ALOX5	45256832	1.000000	0.71417	1.000000	0.80357	0.638000	0.38207	7.996000	0.88334	2.054000	0.61138	0.533000	0.62120	ATC	.	.	.	none		0.627	ALOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047780.1		
NCOA4	8031	hgsc.bcm.edu	37	10	51585173	51585173	+	Silent	SNP	G	G	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr10:51585173G>A	ENST00000443446.1	+	8	1501	c.1272G>A	c.(1270-1272)aaG>aaA	p.K424K	NCOA4_ENST00000374087.4_Silent_p.K424K|NCOA4_ENST00000438493.1_Silent_p.K440K|NCOA4_ENST00000430396.2_Silent_p.K324K|NCOA4_ENST00000452682.1_Silent_p.K440K|NCOA4_ENST00000414907.2_Silent_p.K258K|NCOA4_ENST00000344348.6_Silent_p.K424K|NCOA4_ENST00000374082.1_Silent_p.K424K	NM_001145262.1	NP_001138734.1	Q13772	NCOA4_HUMAN	nuclear receptor coactivator 4	424					androgen receptor signaling pathway (GO:0030521)|male gonad development (GO:0008584)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|transcription coactivator activity (GO:0003713)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|skin(1)	5						ATTGTGAGAAGGAGGCTCTGT	0.478			T	RET	papillary thyroid																																p.K440K		Atlas-SNP	.		Dom	yes		10	10q11.2	8031	nuclear receptor coactivator 4 - PTC3 (ELE1)		E	.	NCOA4	58	.	0			c.G1320A						PASS	.						70.0	75.0	73.0					10																	51585173		2203	4300	6503	SO:0001819	synonymous_variant	8031	exon9			TGAGAAGGAGGCT	L49399	CCDS73092.1, CCDS73093.1, CCDS73094.1	10q11.2	2014-04-10			ENSG00000138293	ENSG00000266412			7671	protein-coding gene	gene with protein product	"""RET-activating gene ELE1"""	601984				8290261, 8643607, 24695223	Standard	NM_001145260		Approved	ARA70, RFG, ELE1, PTC3, DKFZp762E1112	uc009xon.3	Q13772	OTTHUMG00000188314	ENST00000443446.1:c.1272G>A	chr10.hg19:g.51585173G>A		175.0	0.0	.		151.0	47.0	.	NM_001145261	A8K8W5|B4E260|E9PAV7|J3KQN8|Q14239	Silent	SNP	ENST00000443446.1	hg19	CCDS7237.1																																																																																			.	.	.	none		0.478	NCOA4-204	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048052.1	NM_005437	
NUDT13	25961	hgsc.bcm.edu	37	10	74879906	74879906	+	Missense_Mutation	SNP	A	A	C			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr10:74879906A>C	ENST00000357321.4	+	3	332	c.214A>C	c.(214-216)Agc>Cgc	p.S72R	NUDT13_ENST00000544879.1_5'UTR|NUDT13_ENST00000488223.1_3'UTR|NUDT13_ENST00000372997.3_Missense_Mutation_p.S72R|NUDT13_ENST00000537969.1_5'UTR|NUDT13_ENST00000349051.5_Missense_Mutation_p.S72R	NM_001283016.1|NM_015901.4	NP_001269945.1|NP_056985.3			nudix (nucleoside diphosphate linked moiety X)-type motif 13											large_intestine(2)|lung(5)	7	Prostate(51;0.0119)					CCCCCGGCACAGCCTGTTAGG	0.498																																					p.S72R		Atlas-SNP	.											.	NUDT13	16	.	0			c.A214C						PASS	.						55.0	56.0	56.0					10																	74879906		2203	4300	6503	SO:0001583	missense	25961	exon3			CGGCACAGCCTGT	AL050114	CCDS31220.1, CCDS60551.1, CCDS60552.1, CCDS60553.1, CCDS73148.1	10q22.3	2014-04-24			ENSG00000166321	ENSG00000166321		"""Nudix motif containing"""	18827	protein-coding gene	gene with protein product		609233				15164054	Standard	NM_001283019		Approved	DKFZp586P2219	uc001jtj.3	Q86X67	OTTHUMG00000018453	ENST00000357321.4:c.214A>C	chr10.hg19:g.74879906A>C	ENSP00000349874:p.Ser72Arg	78.0	0.0	.		52.0	17.0	.	NM_015901		Missense_Mutation	SNP	ENST00000357321.4	hg19	CCDS31220.1	.	.	.	.	.	.	.	.	.	.	A	12.27	1.887191	0.33348	.	.	ENSG00000166321	ENST00000357321;ENST00000349051;ENST00000372997	T;T;T	0.32515	1.45;1.45;1.45	5.63	5.63	0.86233	NADH pyrophosphatase-like, N-terminal (1);	0.319618	0.40302	N	0.001140	T	0.25419	0.0618	L	0.38531	1.155	0.80722	D	1	B;B;B	0.33755	0.424;0.045;0.079	B;B;B	0.29942	0.109;0.102;0.092	T	0.03453	-1.1035	10	0.35671	T	0.21	.	15.0175	0.71597	1.0:0.0:0.0:0.0	.	72;72;72	Q86X67-2;Q5SQM6;Q86X67	.;.;NUD13_HUMAN	R	72	ENSP00000349874:S72R;ENSP00000335326:S72R;ENSP00000362088:S72R	ENSP00000335326:S72R	S	+	1	0	NUDT13	74549912	0.996000	0.38824	0.776000	0.31678	0.176000	0.22953	3.633000	0.54295	2.148000	0.66965	0.533000	0.62120	AGC	.	.	.	none		0.498	NUDT13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048614.1	NM_015901	
ZMIZ1	57178	hgsc.bcm.edu	37	10	80968102	80968102	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr10:80968102A>T	ENST00000334512.5	+	6	642	c.70A>T	c.(70-72)Aat>Tat	p.N24Y		NM_020338.3	NP_065071.1	Q9ULJ6	ZMIZ1_HUMAN	zinc finger, MIZ-type containing 1	24					artery morphogenesis (GO:0048844)|cell aging (GO:0007569)|developmental growth (GO:0048589)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)|vitellogenesis (GO:0007296)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(2)|prostate(3)|skin(1)	30	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)			GCACTTACAGAATCCTGCCAA	0.622																																					p.N24Y		Atlas-SNP	.											.	ZMIZ1	101	.	0			c.A70T						PASS	.						68.0	56.0	60.0					10																	80968102		2203	4300	6503	SO:0001583	missense	57178	exon6			TTACAGAATCCTG	AB033050	CCDS7357.1	10q22.3	2012-11-30	2006-10-24	2006-10-24	ENSG00000108175	ENSG00000108175		"""Zinc fingers, MIZ-type"""	16493	protein-coding gene	gene with protein product		607159	"""retinoic acid induced 17"""	RAI17		15626329	Standard	NM_020338		Approved	RP11-519K18.1, KIAA1224, FLJ13541, hZIMP10, Zimp10, MIZ	uc001kaf.2	Q9ULJ6	OTTHUMG00000018560	ENST00000334512.5:c.70A>T	chr10.hg19:g.80968102A>T	ENSP00000334474:p.Asn24Tyr	70.0	0.0	.		63.0	16.0	.	NM_020338	Q5JSH9|Q7Z7E6	Missense_Mutation	SNP	ENST00000334512.5	hg19	CCDS7357.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.022073	0.75275	.	.	ENSG00000108175	ENST00000334512;ENST00000394592	T	0.34667	1.35	5.23	4.1	0.47936	.	.	.	.	.	T	0.52645	0.1747	L	0.60455	1.87	0.80722	D	1	D;D	0.65815	0.995;0.993	D;P	0.72982	0.979;0.885	T	0.52793	-0.8528	9	0.87932	D	0	-6.037	9.9202	0.41459	0.9182:0.0:0.0818:0.0	.	24;24	Q9ULJ6;A0JLS3	ZMIZ1_HUMAN;.	Y	24	ENSP00000334474:N24Y	ENSP00000334474:N24Y	N	+	1	0	ZMIZ1	80638108	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	8.717000	0.91425	0.846000	0.35142	0.379000	0.24179	AAT	.	.	.	none		0.622	ZMIZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048944.2	NM_020338	
SORCS1	114815	hgsc.bcm.edu	37	10	108371744	108371744	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr10:108371744G>T	ENST00000263054.6	-	22	2965	c.2958C>A	c.(2956-2958)aaC>aaA	p.N986K	SORCS1_ENST00000369698.1_Missense_Mutation_p.N521K|SORCS1_ENST00000478809.2_5'UTR|SORCS1_ENST00000344440.6_Missense_Mutation_p.N986K	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	986					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		AGTCATCCAGGTTTGGAGAAA	0.463																																					p.N986K		Atlas-SNP	.											.	SORCS1	534	.	0			c.C2958A						PASS	.						113.0	103.0	106.0					10																	108371744		2203	4300	6503	SO:0001583	missense	114815	exon22			ATCCAGGTTTGGA	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.2958C>A	chr10.hg19:g.108371744G>T	ENSP00000263054:p.Asn986Lys	161.0	0.0	.		158.0	44.0	.	NM_001206572	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	ENST00000263054.6	hg19	CCDS7559.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.41|19.41	3.822407|3.822407	0.71028|0.71028	.|.	.|.	ENSG00000108018|ENSG00000108018	ENST00000369698;ENST00000263054;ENST00000344440|ENST00000452214	T;T;T|.	0.24908|.	1.83;2.4;2.4|.	5.4|5.4	4.49|4.49	0.54785|0.54785	.|.	0.048600|.	0.85682|.	D|.	0.000000|.	T|T	0.73869|0.73869	0.3642|0.3642	M|M	0.80183|0.80183	2.485|2.485	0.44359|0.44359	D|D	0.997259|0.997259	D;D;D;D;D|.	0.58620|.	0.972;0.983;0.983;0.972;0.983|.	P;P;P;P;P|.	0.62298|.	0.797;0.9;0.9;0.797;0.9|.	T|T	0.75391|0.75391	-0.3334|-0.3334	9|5	.|.	.|.	.|.	-33.8428|-33.8428	11.7072|11.7072	0.51603|0.51603	0.1432:0.0:0.8568:0.0|0.1432:0.0:0.8568:0.0	.|.	986;986;986;986;986|.	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2|.	.;.;.;SORC1_HUMAN;.|.	K|N	521;986;986|1	ENSP00000358712:N521K;ENSP00000263054:N986K;ENSP00000345964:N986K|.	.|.	N|T	-|-	3|2	2|0	SORCS1|SORCS1	108361734|108361734	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.681000|1.681000	0.37618|0.37618	1.406000|1.406000	0.46857|0.46857	0.650000|0.650000	0.86243|0.86243	AAC|ACC	.	.	.	none		0.463	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918	
OR5P2	120065	hgsc.bcm.edu	37	11	7818418	7818420	+	Missense_Mutation	TNP	TGG	TGG	AAT			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T|G|G	T|G|G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr11:7818418_7818420TGG>AAT	ENST00000329434.2	-	1	100_102	c.70_72CCA>ATT	c.(70-72)CCA>ATT	p.P24I	RP11-35J10.5_ENST00000527565.1_lincRNA	NM_153444.1	NP_703145.1	Q8WZ92	OR5P2_HUMAN	olfactory receptor, family 5, subfamily P, member 2	24						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)	22				Epithelial(150;8.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CTCGAAGGATTGGATCATCTGTT	0.429																																					p.P24P|p.P24L|p.P24T		Atlas-SNP	.											.	OR5P2	68	.	0			c.A72T|c.C71T|c.C70A						PASS	.																																			SO:0001583	missense	120065	exon1			AAGGATTGGATCA|AGGATTGGATCAT|GGATTGGATCATC	AF173006	CCDS7782.1	11p15.4	2012-08-09			ENSG00000183303	ENSG00000183303		"""GPCR / Class A : Olfactory receptors"""	14783	protein-coding gene	gene with protein product							Standard	NM_153444		Approved	JCG3	uc001mfp.1	Q8WZ92	OTTHUMG00000165668	ENST00000329434.2:c.70_72CCA>ATT	chr11.hg19:g.7818418TGG>AAT	ENSP00000331823:p.Pro24Ile	68.0|67.0|67.0	0.0	.		63.0|62.0|61.0	15.0	.	NM_153444	Q3MIS8	Silent|Missense_Mutation|Missense_Mutation	SNP	ENST00000329434.2	hg19	CCDS7782.1																																																																																			.	.	.	none		0.429	OR5P2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385696.1	NM_153444	
LGR4	55366	hgsc.bcm.edu	37	11	27402259	27402259	+	Splice_Site	SNP	C	C	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr11:27402259C>G	ENST00000379214.4	-	9	1274		c.e9-1		LGR4_ENST00000389858.4_Splice_Site	NM_018490.2	NP_060960.2	Q9BXB1	LGR4_HUMAN	leucine-rich repeat containing G protein-coupled receptor 4						bone mineralization (GO:0030282)|bone remodeling (GO:0046849)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cell differentiation involved in metanephros development (GO:0072202)|epithelial cell proliferation (GO:0050673)|innate immune response (GO:0045087)|male genitalia development (GO:0030539)|metanephric glomerulus development (GO:0072224)|metanephric nephron tubule morphogenesis (GO:0072282)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast differentiation (GO:0001649)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(10)|ovary(1)	32						ATACAAATGTCTGTGAAAATA	0.299																																					.		Atlas-SNP	.											.	LGR4	87	.	0			c.831-1G>C						PASS	.						49.0	52.0	51.0					11																	27402259		2201	4289	6490	SO:0001630	splice_region_variant	55366	exon10			AAATGTCTGTGAA	AF257182	CCDS31449.1	11p14-p13	2012-08-21	2011-01-25	2004-11-12	ENSG00000205213	ENSG00000205213		"""GPCR / Class A : Orphans"""	13299	protein-coding gene	gene with protein product		606666	"""G protein-coupled receptor 48"", ""leucine-rich repeat-containing G protein-coupled receptor 4"""	GPR48		10894923	Standard	NM_018490		Approved		uc001mrj.4	Q9BXB1	OTTHUMG00000133508	ENST00000379214.4:c.831-1G>C	chr11.hg19:g.27402259C>G		232.0	0.0	.		223.0	73.0	.	NM_018490	A6NCH3|G5E9B3|Q8N537|Q9NYD1	Splice_Site	SNP	ENST00000379214.4	hg19	CCDS31449.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.067334	0.76301	.	.	ENSG00000205213	ENST00000379214;ENST00000389858	.	.	.	5.51	5.51	0.81932	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7788	0.96409	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LGR4	27358835	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.487000	0.81328	2.749000	0.94314	0.460000	0.39030	.	.	.	.	none		0.299	LGR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257467.1	NM_018490	Intron
PLCB3	5331	hgsc.bcm.edu	37	11	64034708	64034708	+	Nonsense_Mutation	SNP	C	C	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr11:64034708C>T	ENST00000540288.1	+	30	3569	c.3466C>T	c.(3466-3468)Cag>Tag	p.Q1156*	PLCB3_ENST00000279230.6_Nonsense_Mutation_p.Q1156*|PLCB3_ENST00000325234.5_Nonsense_Mutation_p.Q1089*	NM_000932.2	NP_000923.1	Q01970	PLCB3_HUMAN	phospholipase C, beta 3 (phosphatidylinositol-specific)	1156					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|regulation of systemic arterial blood pressure (GO:0003073)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|urinary_tract(1)	33						TGGGCAGCAGCAGGTCCTGCA	0.672																																					p.Q1156X		Atlas-SNP	.											.	PLCB3	103	.	0			c.C3466T						PASS	.						19.0	18.0	18.0					11																	64034708		1955	3784	5739	SO:0001587	stop_gained	5331	exon30			CAGCAGCAGGTCC	Z26649	CCDS8064.1, CCDS53654.1	11q13	2008-03-18			ENSG00000149782	ENSG00000149782	3.1.4.11		9056	protein-coding gene	gene with protein product		600230				7849701	Standard	NM_000932		Approved		uc009ypg.2	Q01970	OTTHUMG00000167816	ENST00000540288.1:c.3466C>T	chr11.hg19:g.64034708C>T	ENSP00000443631:p.Gln1156*	138.0	0.0	.		101.0	30.0	.	NM_000932	A5PKZ6|G5E960|Q8N1A4	Nonsense_Mutation	SNP	ENST00000540288.1	hg19	CCDS8064.1	.	.	.	.	.	.	.	.	.	.	C	39	7.682014	0.98431	.	.	ENSG00000149782	ENST00000279230;ENST00000540288;ENST00000325234	.	.	.	4.42	4.42	0.53409	.	0.339854	0.29830	N	0.011090	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	.	11.0366	0.47804	0.0:0.6842:0.3158:0.0	.	.	.	.	X	1156;1156;1089	.	ENSP00000279230:Q1156X	Q	+	1	0	PLCB3	63791284	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.151000	0.58105	2.297000	0.77311	0.561000	0.74099	CAG	.	.	.	none		0.672	PLCB3-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396405.1		
NAALADL1	10004	hgsc.bcm.edu	37	11	64813975	64813975	+	Silent	SNP	G	G	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr11:64813975G>A	ENST00000358658.3	-	14	1650	c.1623C>T	c.(1621-1623)taC>taT	p.Y541Y	NAALADL1_ENST00000340252.4_Silent_p.Y592Y|NAALADL1_ENST00000355369.2_Intron|NAALADL1_ENST00000526799.1_5'UTR|NAALADL1_ENST00000528884.1_Intron|NAALADL1_ENST00000355721.3_Silent_p.Y500Y|NAALADL1_ENST00000339885.2_Missense_Mutation_p.T511I|NAALADL1_ENST00000356632.3_Silent_p.Y506Y	NM_005468.2	NP_005459.2	Q9UQQ1	NALDL_HUMAN	N-acetylated alpha-linked acidic dipeptidase-like 1	541	NAALADase.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	29						GGTAGGTGGGGTAGATCCTGG	0.552																																					p.Y541Y		Atlas-SNP	.											.	NAALADL1	58	.	0			c.C1623T						PASS	.						130.0	109.0	116.0					11																	64813975		2201	4297	6498	SO:0001819	synonymous_variant	10004	exon14			GGTGGGGTAGATC	AF010141	CCDS31604.1	11q12	2011-08-16			ENSG00000168060	ENSG00000168060			23536	protein-coding gene	gene with protein product	"""ileal peptidase I100"""	602640				10085079	Standard	NM_005468		Approved		uc001ocn.3	Q9UQQ1	OTTHUMG00000165595	ENST00000358658.3:c.1623C>T	chr11.hg19:g.64813975G>A		184.0	0.0	.		138.0	31.0	.	NM_005468	C9J8A1|C9J964|C9JL35|C9JSN0|O43176	Silent	SNP	ENST00000358658.3	hg19	CCDS31604.1	.	.	.	.	.	.	.	.	.	.	G	18.25	3.583064	0.65992	.	.	ENSG00000168060	ENST00000339885	T	0.48522	0.81	5.53	4.63	0.57726	.	.	.	.	.	T	0.49609	0.1567	.	.	.	0.26194	N	0.979542	.	.	.	.	.	.	T	0.48317	-0.9046	6	0.87932	D	0	-29.7051	8.5374	0.33371	0.1733:0.0:0.8267:0.0	.	.	.	.	I	511	ENSP00000340111:T511I	ENSP00000340111:T511I	T	-	2	0	NAALADL1	64570551	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.241000	0.51376	1.370000	0.46153	0.561000	0.74099	ACC	.	.	.	none		0.552	NAALADL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385162.1	NM_005468	
CLPB	81570	hgsc.bcm.edu	37	11	72145214	72145214	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr11:72145214T>A	ENST00000294053.3	-	1	478	c.305A>T	c.(304-306)gAc>gTc	p.D102V	CLPB_ENST00000538039.1_Missense_Mutation_p.D102V|CLPB_ENST00000437826.2_Silent_p.G21G|CLPB_ENST00000543042.1_5'UTR|CLPB_ENST00000542555.1_5'Flank|CLPB_ENST00000340729.5_Missense_Mutation_p.D102V|CLPB_ENST00000445069.2_Intron	NM_001258394.1|NM_030813.4	NP_001245323.1|NP_110440.1	Q9H078	CLPB_HUMAN	ClpB caseinolytic peptidase B homolog (E. coli)	102					cellular response to heat (GO:0034605)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)			endometrium(3)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	19						GTTCCAGCTGTCCTGTCCTGG	0.662											OREG0021194	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D102V		Atlas-SNP	.											.	CLPB	45	.	0			c.A305T						PASS	.						45.0	49.0	47.0					11																	72145214		2200	4292	6492	SO:0001583	missense	81570	exon1			CAGCTGTCCTGTC	BC006404	CCDS8215.1, CCDS58152.1, CCDS58153.1, CCDS58154.1	11q13.4	2013-01-10			ENSG00000162129	ENSG00000162129		"""Ankyrin repeat domain containing"""	30664	protein-coding gene	gene with protein product	"""suppressor of potassium transport defect 3"""					11230166, 7835694	Standard	NM_030813		Approved	HSP78, SKD3, FLJ13152	uc010rqy.3	Q9H078	OTTHUMG00000167902	ENST00000294053.3:c.305A>T	chr11.hg19:g.72145214T>A	ENSP00000294053:p.Asp102Val	96.0	0.0	.	1135	69.0	15.0	.	NM_001258392	B4DXJ7|B4DXP7|E7EWN6|F8W7P6|Q8ND11|Q9H8Y0	Missense_Mutation	SNP	ENST00000294053.3	hg19	CCDS8215.1	.	.	.	.	.	.	.	.	.	.	T	15.88	2.964448	0.53507	.	.	ENSG00000162129	ENST00000294053;ENST00000538039;ENST00000340729	T;T;T	0.69175	1.9;1.08;-0.38	5.04	2.43	0.29744	.	0.289184	0.26286	N	0.025253	T	0.45856	0.1363	N	0.14661	0.345	0.80722	D	1	P;B;P	0.37955	0.514;0.437;0.612	B;B;B	0.38880	0.284;0.189;0.203	T	0.43637	-0.9379	10	0.72032	D	0.01	-12.7372	5.6906	0.17827	0.1674:0.0:0.1731:0.6594	.	102;102;102	F8W7P6;Q9H078-2;Q9H078	.;.;CLPB_HUMAN	V	102	ENSP00000294053:D102V;ENSP00000441518:D102V;ENSP00000340385:D102V	ENSP00000294053:D102V	D	-	2	0	CLPB	71822862	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	1.637000	0.37155	0.808000	0.34231	0.533000	0.62120	GAC	.	.	.	none		0.662	CLPB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000396889.1	NM_030813	
KCNE3	10008	hgsc.bcm.edu	37	11	74168349	74168350	+	Missense_Mutation	DNP	TT	TT	AA			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr11:74168349_74168350TT>AA	ENST00000310128.4	-	3	678_679	c.259_260AA>TT	c.(259-261)AAg>TTg	p.K87L	KCNE3_ENST00000525550.1_Missense_Mutation_p.K87L|RP11-702H23.4_ENST00000533008.1_RNA|RP11-702H23.6_ENST00000530510.1_RNA	NM_005472.4	NP_005463.1	Q9Y6H6	KCNE3_HUMAN	potassium voltage-gated channel, Isk-related family, member 3	87					regulation of potassium ion transport (GO:0043266)	integral component of membrane (GO:0016021)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			cervix(1)|large_intestine(1)|lung(1)|ovary(1)	4	Breast(11;2.86e-06)					GTCACTACGCTTGTCCACTTTG	0.495																																					p.K87M|p.K87X		Atlas-SNP	.											.	KCNE3	7	.	0			c.A260T|c.A259T						PASS	.																																			SO:0001583	missense	10008	exon3			CTACGCTTGTCCA|TACGCTTGTCCAC	AF076531	CCDS8232.1	11q13.4	2014-09-17				ENSG00000175538		"""Potassium channels"""	6243	protein-coding gene	gene with protein product		604433				10219239	Standard	NM_005472		Approved	MiRP2, HOKPP	uc001ovc.3	Q9Y6H6		ENST00000310128.4:c.259_260delinsAA	chr11.hg19:g.74168349_74168350delinsAA	ENSP00000310557:p.Lys87Leu	119.0|120.0	0.0	.		87.0	19.0	.	NM_005472		Missense_Mutation|Nonsense_Mutation	SNP	ENST00000310128.4	hg19	CCDS8232.1																																																																																			.	.	.	none		0.495	KCNE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385531.1	NM_005472	
FZD4	8322	hgsc.bcm.edu	37	11	86663362	86663362	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr11:86663362T>C	ENST00000531380.1	-	2	741	c.436A>G	c.(436-438)Agc>Ggc	p.S146G	PRSS23_ENST00000533902.2_3'UTR	NM_012193.3	NP_036325.2	Q9ULV1	FZD4_HUMAN	frizzled class receptor 4	146	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|cerebellum vasculature morphogenesis (GO:0061301)|extracellular matrix-cell signaling (GO:0035426)|locomotion involved in locomotory behavior (GO:0031987)|negative regulation of cell-substrate adhesion (GO:0010812)|neuron differentiation (GO:0030182)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal blood vessel morphogenesis (GO:0061304)|sensory perception of sound (GO:0007605)|substrate adhesion-dependent cell spreading (GO:0034446)|vasculogenesis (GO:0001570)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine binding (GO:0019955)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|kidney(1)|large_intestine(3)|lung(9)|prostate(6)|skin(1)	21		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				GGGAATTTGCTGCAGTTCAGA	0.557																																					p.S146G		Atlas-SNP	.											.	FZD4	52	.	0			c.A436G						PASS	.						91.0	94.0	93.0					11																	86663362		2201	4299	6500	SO:0001583	missense	8322	exon2			ATTTGCTGCAGTT	AB032417	CCDS8279.1	11q14-q21	2014-01-29	2014-01-29			ENSG00000174804		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4042	protein-coding gene	gene with protein product		604579	"""frizzled (Drosophila) homolog 4"", ""exudative vitreoretinopathy 1"", ""frizzled homolog 4 (Drosophila)"", ""frizzled 4, seven transmembrane spanning receptor"", ""frizzled family receptor 4"""	EVR1		10544037, 15024691	Standard	NM_012193		Approved	CD344	uc001pce.3	Q9ULV1		ENST00000531380.1:c.436A>G	chr11.hg19:g.86663362T>C	ENSP00000434034:p.Ser146Gly	146.0	0.0	.		101.0	20.0	.	NM_012193	A8K9Q3|Q14C97|Q6S9E4	Missense_Mutation	SNP	ENST00000531380.1	hg19	CCDS8279.1	.	.	.	.	.	.	.	.	.	.	T	15.71	2.915066	0.52546	.	.	ENSG00000174804	ENST00000531380	T	0.80393	-1.37	5.82	5.82	0.92795	Frizzled domain (5);	0.000000	0.85682	D	0.000000	D	0.82426	0.5034	M	0.77712	2.385	0.58432	D	0.999999	B	0.25441	0.126	B	0.32289	0.143	T	0.79037	-0.1967	9	.	.	.	.	16.1832	0.81925	0.0:0.0:0.0:1.0	.	146	Q9ULV1	FZD4_HUMAN	G	146	ENSP00000434034:S146G	.	S	-	1	0	FZD4	86341010	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.221000	0.58574	2.228000	0.72767	0.533000	0.62120	AGC	.	.	.	none		0.557	FZD4-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393818.2	NM_012193	
LRIG3	121227	hgsc.bcm.edu	37	12	59268266	59268266	+	Missense_Mutation	SNP	T	T	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr12:59268266T>G	ENST00000320743.3	-	17	3071	c.2785A>C	c.(2785-2787)Atg>Ctg	p.M929L	LRIG3_ENST00000379141.4_Missense_Mutation_p.M869L	NM_153377.4	NP_700356.2	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like domains 3	929					otolith morphogenesis (GO:0032474)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)			LRIG3/ROS1(2)	breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(12)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48			GBM - Glioblastoma multiforme(1;1.17e-18)			TTCAAATACATAGGGCCTGTG	0.428			T	ROS1	NSCLC																																p.M929L		Atlas-SNP	.		Dom	yes		12	12q14.1	121227	leucine-rich repeats and immunoglobulin-like domains 3		E	.	LRIG3	120	.	0			c.A2785C						PASS	.						148.0	135.0	139.0					12																	59268266		2203	4300	6503	SO:0001583	missense	121227	exon17			AATACATAGGGCC	AY505340	CCDS8960.1, CCDS44933.1	12q13.2	2013-01-11				ENSG00000139263		"""Immunoglobulin superfamily / I-set domain containing"""	30991	protein-coding gene	gene with protein product		608870					Standard	NM_153377		Approved	FLJ90440, KIAA3016	uc001sqr.4	Q6UXM1	OTTHUMG00000169940	ENST00000320743.3:c.2785A>C	chr12.hg19:g.59268266T>G	ENSP00000326759:p.Met929Leu	146.0	0.0	.		130.0	48.0	.	NM_153377	Q6UXL7|Q8NC72	Missense_Mutation	SNP	ENST00000320743.3	hg19	CCDS8960.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	4.815|4.815	0.151595|0.151595	0.09185|0.09185	.|.	.|.	ENSG00000139263|ENSG00000139263	ENST00000379141;ENST00000320743|ENST00000550825	T;T|.	0.54479|.	0.62;0.57|.	6.03|6.03	5.14|5.14	0.70334|0.70334	.|.	0.517740|.	0.14462|.	N|.	0.318092|.	T|T	0.19366|0.19366	0.0465|0.0465	N|N	0.12182|0.12182	0.205|0.205	0.18873|0.18873	N|N	0.999984|0.999984	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.01281|.	0.0;0.0|.	T|T	0.16453|0.16453	-1.0402|-1.0402	9|5	.|.	.|.	.|.	.|.	4.6325|4.6325	0.12509|0.12509	0.2843:0.5306:0.0:0.1851|0.2843:0.5306:0.0:0.1851	.|.	869;929|.	Q6UXM1-2;Q6UXM1|.	.;LRIG3_HUMAN|.	L|S	869;929|30	ENSP00000368436:M869L;ENSP00000326759:M929L|.	.|.	M|Y	-|-	1|2	0|0	LRIG3|LRIG3	57554533|57554533	0.449000|0.449000	0.25689|0.25689	0.998000|0.998000	0.56505|0.56505	0.018000|0.018000	0.09664|0.09664	0.724000|0.724000	0.25954|0.25954	1.568000|1.568000	0.49683|0.49683	-0.132000|-0.132000	0.14878|0.14878	ATG|TAT	.	.	.	none		0.428	LRIG3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406623.1	NM_153377	
GPN3	51184	hgsc.bcm.edu	37	12	110902939	110902939	+	Silent	SNP	T	T	C			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr12:110902939T>C	ENST00000228827.3	-	2	191	c.129A>G	c.(127-129)gcA>gcG	p.A43A	GPN3_ENST00000537466.2_Silent_p.A53A|GPN3_ENST00000552180.1_5'UTR|GPN3_ENST00000543199.1_Silent_p.A82A	NM_016301.3	NP_057385.3			GPN-loop GTPase 3											endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|urinary_tract(1)	8						TGAAGTGTTCTGCTGCTGGAT	0.547																																					p.A82A		Atlas-SNP	.											.	GPN3	37	.	0			c.A246G						PASS	.						190.0	151.0	164.0					12																	110902939		2203	4300	6503	SO:0001819	synonymous_variant	51184	exon2			GTGTTCTGCTGCT	BC008416	CCDS9147.1, CCDS53830.1, CCDS53831.1	12q24.11	2012-12-18	2008-04-30	2008-04-30	ENSG00000111231	ENSG00000111231		"""GPN-loop GTPases"""	30186	protein-coding gene	gene with protein product			"""ATP binding domain 1 family, member C"""	ATPBD1C		12975309	Standard	NM_016301		Approved	MGC14560	uc021rdu.1	Q9UHW5	OTTHUMG00000169524	ENST00000228827.3:c.129A>G	chr12.hg19:g.110902939T>C		111.0	0.0	.		106.0	18.0	.	NM_001164372		Silent	SNP	ENST00000228827.3	hg19	CCDS9147.1																																																																																			.	.	.	none		0.547	GPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404607.1	NM_016301	
FAM155A	728215	hgsc.bcm.edu	37	13	108518698	108518698	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr13:108518698G>T	ENST00000375915.2	-	1	385	c.247C>A	c.(247-249)Cag>Aag	p.Q83K		NM_001080396.2	NP_001073865.1	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	83	Poly-Gln.					integral component of membrane (GO:0016021)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						tgctgctgctgctgctgctgc	0.706																																					p.Q83K		Atlas-SNP	.											.	FAM155A	82	.	0			c.C247A						PASS	.						16.0	22.0	20.0					13																	108518698		1929	3762	5691	SO:0001583	missense	728215	exon1			GCTGCTGCTGCTG	L10374	CCDS32006.1	13q33.3	2008-04-15			ENSG00000204442	ENSG00000204442			33877	protein-coding gene	gene with protein product							Standard	NM_001080396		Approved		uc001vql.3	B1AL88	OTTHUMG00000017326	ENST00000375915.2:c.247C>A	chr13.hg19:g.108518698G>T	ENSP00000365080:p.Gln83Lys	16.0	0.0	.		28.0	5.0	.	NM_001080396	B2RUV1|B7Z334	Missense_Mutation	SNP	ENST00000375915.2	hg19	CCDS32006.1	.	.	.	.	.	.	.	.	.	.	G	10.92	1.487166	0.26686	.	.	ENSG00000204442	ENST00000375915	T	0.62364	0.03	4.45	4.45	0.53987	Armadillo-like helical (1);	0.715687	0.11618	N	0.546038	T	0.55146	0.1902	L	0.43923	1.385	0.25117	N	0.990675	B	0.13594	0.008	B	0.13407	0.009	T	0.45308	-0.9270	10	0.36615	T	0.2	.	12.5709	0.56337	0.0:0.0:1.0:0.0	.	83	B1AL88	F155A_HUMAN	K	83	ENSP00000365080:Q83K	ENSP00000365080:Q83K	Q	-	1	0	FAM155A	107316699	1.000000	0.71417	0.893000	0.35052	0.674000	0.39518	4.577000	0.60922	2.027000	0.59764	0.561000	0.74099	CAG	.	.	.	none		0.706	FAM155A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045736.2	NM_001080396	
THBS1	7057	hgsc.bcm.edu	37	15	39877738	39877738	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr15:39877738A>G	ENST00000260356.5	+	7	1259	c.1094A>G	c.(1093-1095)gAt>gGt	p.D365G		NM_003246.2	NP_003237.2	P07996	TSP1_HUMAN	thrombospondin 1	365	VWFC. {ECO:0000255|PROSITE- ProRule:PRU00220}.				activation of MAPK activity (GO:0000187)|behavioral response to pain (GO:0048266)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to tumor necrosis factor (GO:0071356)|chronic inflammatory response (GO:0002544)|endocardial cushion development (GO:0003197)|engulfment of apoptotic cell (GO:0043652)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|immune response (GO:0006955)|negative regulation of angiogenesis (GO:0016525)|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002581)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cGMP-mediated signaling (GO:0010754)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell antigen processing and presentation (GO:0002605)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of plasminogen activation (GO:0010757)|outflow tract morphogenesis (GO:0003151)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of translation (GO:0045727)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to magnesium ion (GO:0032026)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|response to unfolded protein (GO:0006986)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|sarcoplasmic reticulum (GO:0016529)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|collagen V binding (GO:0070052)|fibrinogen binding (GO:0070051)|fibroblast growth factor binding (GO:0017134)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|proteoglycan binding (GO:0043394)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(5)|large_intestine(15)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	53		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)		ACAGTTCCTGATGGAGAATGC	0.507																																					p.D365G		Atlas-SNP	.											.	THBS1	106	.	0			c.A1094G						PASS	.						218.0	152.0	174.0					15																	39877738		2200	4297	6497	SO:0001583	missense	7057	exon7			TTCCTGATGGAGA		CCDS32194.1	15q15	2009-04-08			ENSG00000137801	ENSG00000137801			11785	protein-coding gene	gene with protein product	"""thrombospondin-1p180"""	188060				2341158, 2335352	Standard	NM_003246		Approved	TSP1, THBS, TSP, THBS-1, TSP-1	uc001zkh.3	P07996	OTTHUMG00000133665	ENST00000260356.5:c.1094A>G	chr15.hg19:g.39877738A>G	ENSP00000260356:p.Asp365Gly	35.0	0.0	.		34.0	7.0	.	NM_003246	A8K6H4|B4E3J7|B9EGH6|Q15667|Q59E99	Missense_Mutation	SNP	ENST00000260356.5	hg19	CCDS32194.1	.	.	.	.	.	.	.	.	.	.	A	31	5.103828	0.94245	.	.	ENSG00000137801	ENST00000260356	T	0.65364	-0.15	5.86	5.86	0.93980	von Willebrand factor, type C (4);	0.000000	0.34676	N	0.003775	T	0.77751	0.4177	M	0.69463	2.115	0.58432	D	0.999998	D	0.76494	0.999	D	0.85130	0.997	T	0.79640	-0.1719	10	0.66056	D	0.02	-17.1145	15.4256	0.75048	1.0:0.0:0.0:0.0	.	365	P07996	TSP1_HUMAN	G	365	ENSP00000260356:D365G	ENSP00000260356:D365G	D	+	2	0	THBS1	37665030	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	9.339000	0.96797	2.237000	0.73441	0.533000	0.62120	GAT	.	.	.	none		0.507	THBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257831.2	NM_003246	
SPINT1	6692	hgsc.bcm.edu	37	15	41136856	41136856	+	Missense_Mutation	SNP	C	C	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr15:41136856C>A	ENST00000344051.4	+	2	338	c.104C>A	c.(103-105)gCc>gAc	p.A35D	SPINT1_ENST00000562057.1_Missense_Mutation_p.A35D|SPINT1_ENST00000431806.1_Missense_Mutation_p.A35D|RP11-532F12.5_ENST00000568419.1_RNA|RP11-532F12.5_ENST00000565315.1_RNA|RP11-532F12.5_ENST00000564302.1_RNA|RP11-532F12.5_ENST00000568525.1_RNA			O43278	SPIT1_HUMAN	serine peptidase inhibitor, Kunitz type 1	35					branching involved in labyrinthine layer morphogenesis (GO:0060670)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|placenta blood vessel development (GO:0060674)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	16		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		GGCACCCAGGCCGGGCCACCG	0.761																																					p.A35D		Atlas-SNP	.											.	SPINT1	28	.	0			c.C104A						PASS	.						6.0	8.0	8.0					15																	41136856		2067	4058	6125	SO:0001583	missense	6692	exon2			CCCAGGCCGGGCC		CCDS10067.1, CCDS45231.1	15q13.3	2008-02-05	2005-08-17		ENSG00000166145	ENSG00000166145			11246	protein-coding gene	gene with protein product		605123	"""serine protease inhibitor, Kunitz type 1"""				Standard	XM_006720657		Approved	HAI, MANSC2	uc001zna.3	O43278	OTTHUMG00000130068	ENST00000344051.4:c.104C>A	chr15.hg19:g.41136856C>A	ENSP00000342098:p.Ala35Asp	15.0	0.0	.		77.0	23.0	.	NM_181642	Q7Z7D2	Missense_Mutation	SNP	ENST00000344051.4	hg19	CCDS10067.1	.	.	.	.	.	.	.	.	.	.	C	18.06	3.538187	0.65085	.	.	ENSG00000166145	ENST00000344051;ENST00000431806	D;D	0.95656	-3.76;-3.77	5.02	3.07	0.35406	.	0.452065	0.24688	N	0.036402	D	0.89591	0.6759	N	0.08118	0	0.09310	N	1	P;P;P	0.48162	0.906;0.9;0.906	B;P;P	0.49999	0.425;0.628;0.521	T	0.82341	-0.0505	10	0.29301	T	0.29	-21.5589	6.2982	0.21097	0.0:0.7099:0.1902:0.1	.	35;35;35	B2RBU9;O43278-2;O43278	.;.;SPIT1_HUMAN	D	35	ENSP00000342098:A35D;ENSP00000409935:A35D	ENSP00000342098:A35D	A	+	2	0	SPINT1	38924148	0.876000	0.30132	0.328000	0.25416	0.002000	0.02628	3.594000	0.54008	1.206000	0.43276	0.563000	0.77884	GCC	.	.	.	none		0.761	SPINT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252359.2	NM_003710	
LRRC57	255252	hgsc.bcm.edu	37	15	42837381	42837381	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr15:42837381C>T	ENST00000323443.2	-	4	939	c.572G>A	c.(571-573)aGc>aAc	p.S191N	LRRC57_ENST00000563454.1_Missense_Mutation_p.S191N|LRRC57_ENST00000397130.3_Missense_Mutation_p.S191N			Q8N9N7	LRC57_HUMAN	leucine rich repeat containing 57	191						extracellular vesicular exosome (GO:0070062)				breast(1)|kidney(1)|lung(5)|prostate(1)	8		all_cancers(109;1.99e-12)|all_epithelial(112;5.11e-11)|Lung NSC(122;4.53e-07)|all_lung(180;1.64e-06)|Melanoma(134;0.0262)		GBM - Glioblastoma multiforme(94;6.87e-07)		GGGAAGCATGCTGAGCTCAAG	0.423																																					p.S191N		Atlas-SNP	.											.	LRRC57	20	.	0			c.G572A						PASS	.						99.0	94.0	96.0					15																	42837381		2203	4299	6502	SO:0001583	missense	255252	exon5			AGCATGCTGAGCT	AK094891	CCDS10089.1	15q15.1	2006-02-13			ENSG00000180979	ENSG00000180979			26719	protein-coding gene	gene with protein product							Standard	NM_153260		Approved	FLJ36812	uc001zqc.3	Q8N9N7	OTTHUMG00000130679	ENST00000323443.2:c.572G>A	chr15.hg19:g.42837381C>T	ENSP00000326817:p.Ser191Asn	85.0	0.0	.		74.0	26.0	.	NM_153260	Q7Z2Z6|Q8N1T6	Missense_Mutation	SNP	ENST00000323443.2	hg19	CCDS10089.1	.	.	.	.	.	.	.	.	.	.	C	16.88	3.243740	0.58995	.	.	ENSG00000180979	ENST00000323443;ENST00000397130	T;T	0.46451	0.87;0.87	5.36	4.43	0.53597	.	0.131595	0.64402	D	0.000001	T	0.32763	0.0840	L	0.33339	1.005	0.54753	D	0.999984	B	0.11235	0.004	B	0.09377	0.004	T	0.08126	-1.0737	10	0.34782	T	0.22	.	14.3053	0.66380	0.0:0.9273:0.0:0.0727	.	191	Q8N9N7	LRC57_HUMAN	N	191	ENSP00000326817:S191N;ENSP00000380319:S191N	ENSP00000326817:S191N	S	-	2	0	LRRC57	40624673	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.969000	0.49232	2.520000	0.84964	0.557000	0.71058	AGC	.	.	.	none		0.423	LRRC57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253174.1	NM_153260	
SHC4	399694	hgsc.bcm.edu	37	15	49148178	49148178	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr15:49148178G>T	ENST00000332408.4	-	8	1642	c.1214C>A	c.(1213-1215)cCc>cAc	p.P405H	SHC4_ENST00000396535.3_Missense_Mutation_p.P162H|SHC4_ENST00000537958.1_Missense_Mutation_p.P119H	NM_203349.3	NP_976224.3	Q6S5L8	SHC4_HUMAN	SHC (Src homology 2 domain containing) family, member 4	405	CH1.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of cell proliferation (GO:0008284)|regulation of gene expression (GO:0010468)|stem cell differentiation (GO:0048863)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(2)|large_intestine(8)|lung(11)|ovary(3)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	29		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)		ACACTGTATGGGGCAGTAAGC	0.408																																					p.P405H		Atlas-SNP	.											.	SHC4	70	.	0			c.C1214A						PASS	.						140.0	128.0	132.0					15																	49148178		2197	4294	6491	SO:0001583	missense	399694	exon8			TGTATGGGGCAGT	AY358250	CCDS10130.1	15q21.1-q21.2	2013-02-14			ENSG00000185634	ENSG00000185634		"""SH2 domain containing"""	16743	protein-coding gene	gene with protein product	"""rai-like protein"""						Standard	NM_203349		Approved	RaLP	uc001zxb.1	Q6S5L8	OTTHUMG00000131513	ENST00000332408.4:c.1214C>A	chr15.hg19:g.49148178G>T	ENSP00000329668:p.Pro405His	145.0	0.0	.		117.0	28.0	.	NM_203349	Q6UXQ3|Q8IYW3	Missense_Mutation	SNP	ENST00000332408.4	hg19	CCDS10130.1	.	.	.	.	.	.	.	.	.	.	G	17.07	3.293981	0.60086	.	.	ENSG00000185634	ENST00000332408;ENST00000396535;ENST00000537958	T;T;T	0.31769	3.48;1.48;1.5	5.03	5.03	0.67393	.	0.200639	0.36134	N	0.002762	T	0.44435	0.1293	L	0.43923	1.385	0.46521	D	0.999085	P;D	0.69078	0.575;0.997	B;P	0.60886	0.211;0.88	T	0.31194	-0.9952	10	0.59425	D	0.04	-10.6953	15.38	0.74648	0.0:0.0:1.0:0.0	.	162;405	Q6S5L8-2;Q6S5L8	.;SHC4_HUMAN	H	405;162;119	ENSP00000329668:P405H;ENSP00000379786:P162H;ENSP00000443300:P119H	ENSP00000329668:P405H	P	-	2	0	SHC4	46935470	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.871000	0.69628	2.612000	0.88384	0.655000	0.94253	CCC	.	.	.	none		0.408	SHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254371.1	NM_203349	
FBXL22	283807	hgsc.bcm.edu	37	15	63889797	63889797	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr15:63889797C>T	ENST00000360587.2	+	1	246	c.206C>T	c.(205-207)cCg>cTg	p.P69L	USP3-AS1_ENST00000561256.1_RNA|USP3-AS1_ENST00000558831.1_RNA|USP3-AS1_ENST00000561191.1_RNA|USP3-AS1_ENST00000559737.1_RNA|FBXL22_ENST00000534939.1_Missense_Mutation_p.P69L|USP3-AS1_ENST00000560962.1_RNA|USP3-AS1_ENST00000559861.1_RNA|USP3-AS1_ENST00000560622.1_RNA|FBXL22_ENST00000539570.3_Missense_Mutation_p.P63L	NM_203373.2	NP_976307.2	Q6P050	FXL22_HUMAN	F-box and leucine-rich repeat protein 22	69					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				lung(4)	4						CTCCTGGGCCCGGCACTCCGC	0.617																																					p.P69L		Atlas-SNP	.											.	FBXL22	4	.	0			c.C206T						PASS	.						47.0	38.0	41.0					15																	63889797		2203	4300	6503	SO:0001583	missense	283807	exon1			TGGGCCCGGCACT	BC065833	CCDS10187.1, CCDS10187.2	15q22.1	2012-04-05			ENSG00000197361	ENSG00000197361		"""F-boxes / Leucine-rich repeats"""	27537	protein-coding gene	gene with protein product		609088				12477932	Standard	NM_203373		Approved	Fbl22, FLJ39626	uc002amn.4	Q6P050	OTTHUMG00000132905	ENST00000360587.2:c.206C>T	chr15.hg19:g.63889797C>T	ENSP00000353794:p.Pro69Leu	58.0	0.0	.		25.0	6.0	.	NM_203373		Missense_Mutation	SNP	ENST00000360587.2	hg19	CCDS10187.2	.	.	.	.	.	.	.	.	.	.	C	27.1	4.799631	0.90538	.	.	ENSG00000197361	ENST00000360587;ENST00000539570	T;T	0.38722	1.12;1.12	5.72	5.72	0.89469	.	0.183522	0.48767	D	0.000162	T	0.58352	0.2116	L	0.48642	1.525	0.58432	D	0.999999	D	0.76494	0.999	D	0.63957	0.92	T	0.58940	-0.7547	10	0.87932	D	0	-2.5763	18.8613	0.92273	0.0:1.0:0.0:0.0	.	63	Q6P050	FXL22_HUMAN	L	69;63	ENSP00000353794:P69L;ENSP00000442112:P63L	ENSP00000353794:P69L	P	+	2	0	FBXL22	61676850	1.000000	0.71417	0.959000	0.39883	0.594000	0.36715	7.583000	0.82559	2.699000	0.92147	0.563000	0.77884	CCG	.	.	.	none		0.617	FBXL22-001	KNOWN	downstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256412.4	NM_203373	
LARP6	55323	hgsc.bcm.edu	37	15	71128826	71128826	+	Silent	SNP	T	T	C			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr15:71128826T>C	ENST00000299213.8	-	2	289	c.219A>G	c.(217-219)ggA>ggG	p.G73G		NM_018357.2	NP_060827.2	Q9BRS8	LARP6_HUMAN	La ribonucleoprotein domain family, member 6	73					regulation of translation (GO:0006417)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	19						CGTTCTCACCTCCACTTGCAG	0.522																																					p.G73G		Atlas-SNP	.											.	LARP6	43	.	0			c.A219G						PASS	.						70.0	72.0	71.0					15																	71128826		2199	4297	6496	SO:0001819	synonymous_variant	55323	exon2			CTCACCTCCACTT	BC009446	CCDS10236.1, CCDS32281.1	15q23	2012-11-19			ENSG00000166173	ENSG00000166173		"""La ribonucleoprotein domain containing"""	24012	protein-coding gene	gene with protein product		611300				12477932	Standard	NM_018357		Approved	acheron, FLJ11196	uc002ass.3	Q9BRS8	OTTHUMG00000172179	ENST00000299213.8:c.219A>G	chr15.hg19:g.71128826T>C		81.0	0.0	.		70.0	24.0	.	NM_018357	Q5XKE4|Q8N3N2|Q9NUR0	Silent	SNP	ENST00000299213.8	hg19	CCDS32281.1																																																																																			.	.	.	none		0.522	LARP6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417197.2	NM_018357	
NTRK3	4916	hgsc.bcm.edu	37	15	88680721	88680721	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr15:88680721T>C	ENST00000360948.2	-	6	697	c.536A>G	c.(535-537)gAg>gGg	p.E179G	NTRK3_ENST00000357724.2_Missense_Mutation_p.E179G|NTRK3_ENST00000558676.1_Missense_Mutation_p.E179G|NTRK3_ENST00000557856.1_Missense_Mutation_p.E179G|NTRK3_ENST00000355254.2_Missense_Mutation_p.E179G|NTRK3_ENST00000540489.2_Missense_Mutation_p.E179G|NTRK3_ENST00000394480.2_Missense_Mutation_p.E179G|NTRK3_ENST00000317501.3_Missense_Mutation_p.E179G|NTRK3_ENST00000542733.2_Missense_Mutation_p.E81G	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	179	LRRCT.				activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			GAGCTTGGCCTCCCCCTGCTC	0.567			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																											p.E179G		Atlas-SNP	.		Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	.	NTRK3	587	.	0			c.A536G						PASS	.						124.0	94.0	104.0					15																	88680721		2201	4299	6500	SO:0001583	missense	4916	exon7			TTGGCCTCCCCCT	U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.536A>G	chr15.hg19:g.88680721T>C	ENSP00000354207:p.Glu179Gly	56.0	0.0	.		41.0	4.0	.	NM_001243101	B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Missense_Mutation	SNP	ENST00000360948.2	hg19	CCDS32322.1	.	.	.	.	.	.	.	.	.	.	T	16.79	3.219821	0.58560	.	.	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254;ENST00000542733;ENST00000540489;ENST00000317501	D;D;D;D;D;D;D	0.89875	-2.58;-2.58;-2.58;-2.58;-2.58;-2.58;-2.58	5.71	5.71	0.89125	Cysteine-rich flanking region, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.92331	0.7567	L	0.51422	1.61	0.58432	D	0.999993	D;D;P;D;D;P	0.76494	0.999;0.999;0.47;0.999;0.998;0.47	D;D;B;D;D;B	0.81914	0.995;0.986;0.244;0.995;0.993;0.244	D	0.91792	0.5444	10	0.40728	T	0.16	.	15.1854	0.72996	0.0:0.0:0.0:1.0	.	81;179;179;179;179;179	B7Z7U4;E9PG56;B7Z4C5;Q96CY4;Q16288-3;Q16288	.;.;.;.;.;NTRK3_HUMAN	G	179;179;179;179;81;179;179	ENSP00000377990:E179G;ENSP00000354207:E179G;ENSP00000350356:E179G;ENSP00000347397:E179G;ENSP00000437773:E81G;ENSP00000444673:E179G;ENSP00000318328:E179G	ENSP00000318328:E179G	E	-	2	0	NTRK3	86481725	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.723000	0.68492	2.171000	0.68590	0.528000	0.53228	GAG	.	.	.	none		0.567	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding			
PARN	5073	hgsc.bcm.edu	37	16	14678281	14678281	+	Splice_Site	SNP	T	T	C			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr16:14678281T>C	ENST00000437198.2	-	16	1147		c.e16-2		PARN_ENST00000539279.1_Splice_Site|PARN_ENST00000420015.2_Splice_Site|PARN_ENST00000341484.7_Splice_Site	NM_001134477.2|NM_002582.3	NP_001127949.1|NP_002573.1	O95453	PARN_HUMAN	poly(A)-specific ribonuclease						female gamete generation (GO:0007292)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|RNA metabolic process (GO:0016070)|RNA modification (GO:0009451)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|mRNA 3'-UTR binding (GO:0003730)|nuclease activity (GO:0004518)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(A)-specific ribonuclease activity (GO:0004535)|protein kinase binding (GO:0019901)			cervix(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|urinary_tract(1)	21						AATGATATCCTGCAAACCACG	0.383																																					.		Atlas-SNP	.											.	PARN	72	.	0			c.868-2A>G						PASS	.						52.0	50.0	51.0					16																	14678281		1825	4081	5906	SO:0001630	splice_region_variant	5073	exon16			ATATCCTGCAAAC	AJ005698	CCDS45419.1, CCDS45420.1, CCDS58425.1	16p13	2014-08-08	2011-07-07		ENSG00000140694	ENSG00000140694	3.1.13.4		8609	protein-coding gene	gene with protein product	"""deadenylation nuclease"""	604212	"""poly(A)-specific ribonuclease (deadenylation nuclease)"""			10640832	Standard	NM_002582		Approved	DAN	uc010uzd.2	O95453	OTTHUMG00000173199	ENST00000437198.2:c.1006-2A>G	chr16.hg19:g.14678281T>C		95.0	0.0	.		60.0	22.0	.	NM_001242992	B2RCB3|B4DDG8|B4DWR4|B4E1H6	Splice_Site	SNP	ENST00000437198.2	hg19	CCDS45419.1	.	.	.	.	.	.	.	.	.	.	T	19.70	3.876641	0.72180	.	.	ENSG00000140694	ENST00000437198;ENST00000341484;ENST00000420015;ENST00000539279	.	.	.	5.75	5.75	0.90469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9377	0.70970	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	PARN	14585782	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	6.627000	0.74258	2.198000	0.70561	0.456000	0.33151	.	.	.	.	none		0.383	PARN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422383.1	NM_002582	Intron
ACSM2A	123876	hgsc.bcm.edu	37	16	20489950	20489950	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr16:20489950G>A	ENST00000573854.1	+	10	1346	c.1232G>A	c.(1231-1233)gGc>gAc	p.G411D	ACSM2A_ENST00000396104.2_Missense_Mutation_p.G411D|ACSM2A_ENST00000575690.1_Missense_Mutation_p.G411D|ACSM2A_ENST00000219054.6_Missense_Mutation_p.G411D|ACSM2A_ENST00000575558.1_3'UTR|ACSM2A_ENST00000417235.2_Missense_Mutation_p.G332D|ACSM2A_ENST00000536134.1_Missense_Mutation_p.G183D	NM_001010845.2	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member 2A	411					fatty acid metabolic process (GO:0006631)|glucose homeostasis (GO:0042593)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|triglyceride homeostasis (GO:0070328)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(34)|ovary(1)|skin(6)|stomach(1)	51						GGAGACATTGGCATCAGGGTC	0.527																																					p.G411D		Atlas-SNP	.											.	ACSM2A	120	.	0			c.G1232A						PASS	.						103.0	87.0	92.0					16																	20489950		2203	4297	6500	SO:0001583	missense	123876	exon11			ACATTGGCATCAG	AK091878, AK096039	CCDS32401.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000183747	ENSG00000183747		"""Acyl-CoA synthetase family"""	32017	protein-coding gene	gene with protein product		614358	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2			Standard	NM_001010845		Approved	A-923A4.1, MGC150530	uc010bwe.3	Q08AH3	OTTHUMG00000177401	ENST00000573854.1:c.1232G>A	chr16.hg19:g.20489950G>A	ENSP00000459451:p.Gly411Asp	89.0	0.0	.		67.0	24.0	.	NM_001010845	B3KTT9|O75202	Missense_Mutation	SNP	ENST00000573854.1	hg19	CCDS32401.1	.	.	.	.	.	.	.	.	.	.	G	9.906	1.208165	0.22205	.	.	ENSG00000183747	ENST00000417235;ENST00000219054;ENST00000536134;ENST00000396104	T;T;T;T	0.40476	1.03;1.03;1.03;1.03	3.33	0.71	0.18157	AMP-dependent synthetase/ligase (1);	0.312022	0.23048	N	0.052540	T	0.57975	0.2090	M	0.68952	2.095	0.20638	N	0.99987	D;D	0.76494	0.999;0.999	D;D	0.74674	0.977;0.984	T	0.52313	-0.8592	10	0.87932	D	0	-4.1522	11.8873	0.52610	0.0:0.6828:0.3172:0.0	.	332;411	B7Z8R0;Q08AH3	.;ACS2A_HUMAN	D	332;411;183;411	ENSP00000392169:G332D;ENSP00000219054:G411D;ENSP00000445082:G183D;ENSP00000379411:G411D	ENSP00000219054:G411D	G	+	2	0	ACSM2A	20397451	0.419000	0.25449	0.008000	0.14137	0.141000	0.21300	0.682000	0.25335	0.408000	0.25621	0.289000	0.19496	GGC	.	.	.	none		0.527	ACSM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436764.1	NM_001010845	
TNRC6A	27327	hgsc.bcm.edu	37	16	24801321	24801321	+	Missense_Mutation	SNP	C	C	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr16:24801321C>G	ENST00000395799.3	+	6	1487	c.1358C>G	c.(1357-1359)cCa>cGa	p.P453R	TNRC6A_ENST00000315183.7_Missense_Mutation_p.P453R	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	453	Interaction with argonaute family proteins.|Sufficient for interaction with AGO1, AGO3 and AGO4.|Sufficient for interaction with AGO2.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.P453Q(1)		breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		ATGACTGGACCAAATAACACT	0.438																																					p.P453R		Atlas-SNP	.											TNRC6A,NS,carcinoma,0,1	TNRC6A	171	.	1	Substitution - Missense(1)	lung(1)	c.C1358G						PASS	.						58.0	56.0	57.0					16																	24801321		2197	4300	6497	SO:0001583	missense	27327	exon6			CTGGACCAAATAA	U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.1358C>G	chr16.hg19:g.24801321C>G	ENSP00000379144:p.Pro453Arg	106.0	0.0	.		102.0	25.0	.	NM_014494	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Missense_Mutation	SNP	ENST00000395799.3	hg19	CCDS10624.2	.	.	.	.	.	.	.	.	.	.	C	16.88	3.243926	0.58995	.	.	ENSG00000090905	ENST00000315183;ENST00000395799	T;T	0.44881	0.91;1.02	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.67069	0.2854	M	0.69823	2.125	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.989;0.999;0.998	T	0.67138	-0.5746	10	0.72032	D	0.01	-7.5051	20.3594	0.98849	0.0:1.0:0.0:0.0	.	200;453;453	Q8NDV7-2;Q8NDV7-6;Q8NDV7	.;.;TNR6A_HUMAN	R	453	ENSP00000326900:P453R;ENSP00000379144:P453R	ENSP00000326900:P453R	P	+	2	0	TNRC6A	24708822	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.247000	0.78257	2.816000	0.96949	0.563000	0.77884	CCA	.	.	.	none		0.438	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1	NM_020847	
PYDC1	260434	hgsc.bcm.edu	37	16	31228204	31228204	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr16:31228204A>G	ENST00000302964.3	-	1	476	c.146T>C	c.(145-147)aTc>aCc	p.I49T	TRIM72_ENST00000322122.3_Intron|PYDC1_ENST00000568383.1_5'Flank	NM_152901.2	NP_690865.1	Q8WXC3	PYDC1_HUMAN	PYD (pyrin domain) containing 1	49	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of interleukin-1 beta secretion (GO:0050718)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(2)|lung(1)	5						GAGGTCCACGATATCTAGCTG	0.652																																					p.I49T		Atlas-SNP	.											.	PYDC1	7	.	0			c.T146C						PASS	.						68.0	61.0	63.0					16																	31228204		2197	4300	6497	SO:0001583	missense	260434	exon1			TCCACGATATCTA		CCDS10710.1	16p11.2	2008-02-05	2005-12-02		ENSG00000169900	ENSG00000169900			30261	protein-coding gene	gene with protein product		615700	"""pyrin domain containing 1"""			11786556, 16905547	Standard	NM_152901		Approved	ASC2, POP1	uc002ebo.3	Q8WXC3	OTTHUMG00000132407	ENST00000302964.3:c.146T>C	chr16.hg19:g.31228204A>G	ENSP00000304336:p.Ile49Thr	172.0	0.0	.		98.0	23.0	.	NM_152901	B2R8L4|Q8NFP8	Missense_Mutation	SNP	ENST00000302964.3	hg19	CCDS10710.1	.	.	.	.	.	.	.	.	.	.	A	10.48	1.362629	0.24684	.	.	ENSG00000169900	ENST00000302964	T	0.45276	0.9	4.3	0.865	0.19074	Pyrin (2);DEATH-like (2);	2.187950	0.03117	U	0.163273	T	0.29355	0.0731	.	.	.	0.09310	N	1	P	0.42296	0.775	B	0.40864	0.342	T	0.18209	-1.0344	9	0.18710	T	0.47	.	5.5097	0.16874	0.124:0.4356:0.4404:0.0	.	49	Q8WXC3	PYDC1_HUMAN	T	49	ENSP00000304336:I49T	ENSP00000304336:I49T	I	-	2	0	PYDC1	31135705	0.000000	0.05858	0.000000	0.03702	0.091000	0.18340	-0.903000	0.04084	0.401000	0.25424	-0.415000	0.06103	ATC	.	.	.	none		0.652	PYDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255543.2	NM_152901	
N4BP1	9683	hgsc.bcm.edu	37	16	48576974	48576974	+	Silent	SNP	G	G	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr16:48576974G>A	ENST00000262384.3	-	7	2768	c.2532C>T	c.(2530-2532)ccC>ccT	p.P844P	N4BP1_ENST00000565423.1_5'UTR	NM_153029.3	NP_694574.3	O75113	N4BP1_HUMAN	NEDD4 binding protein 1	844					cellular response to UV (GO:0034644)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein ubiquitination (GO:0031397)	nucleolus (GO:0005730)|PML body (GO:0016605)				breast(3)|kidney(2)|lung(11)|urinary_tract(1)	17		all_cancers(37;0.179)|all_lung(18;0.11)				GAGCTGGCATGGGCAGGTTCT	0.577																																					p.P844P		Atlas-SNP	.											.	N4BP1	121	.	0			c.C2532T						PASS	.						53.0	52.0	53.0					16																	48576974		1974	4170	6144	SO:0001819	synonymous_variant	9683	exon7			TGGCATGGGCAGG	AK026937	CCDS45479.1	16q12.1	2008-01-18				ENSG00000102921			29850	protein-coding gene	gene with protein product						9734811, 11717310	Standard	NM_153029		Approved		uc002efp.3	O75113		ENST00000262384.3:c.2532C>T	chr16.hg19:g.48576974G>A		76.0	0.0	.		68.0	9.0	.	NM_153029	A7MD49|Q2YDX1	Silent	SNP	ENST00000262384.3	hg19	CCDS45479.1																																																																																			.	.	.	none		0.577	N4BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429920.1	NM_014664	
HS3ST3A1	9955	hgsc.bcm.edu	37	17	13504436	13504436	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr17:13504436G>T	ENST00000284110.1	-	1	808	c.11C>A	c.(10-12)cCg>cAg	p.P4Q		NM_006042.1	NP_006033.1	Q9Y663	HS3SA_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 3A1	4					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 3 activity (GO:0033872)|sulfotransferase activity (GO:0008146)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_lung(20;0.114)		UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		GGCCGGGCCCGGAGGGGCCAT	0.711																																					p.P4Q		Atlas-SNP	.											.	HS3ST3A1	39	.	0			c.C11A						PASS	.						21.0	21.0	21.0					17																	13504436		2176	4264	6440	SO:0001583	missense	9955	exon1			GGGCCCGGAGGGG	AF105376	CCDS11165.1	17p12	2007-04-02			ENSG00000153976	ENSG00000153976	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5196	protein-coding gene	gene with protein product		604057				9988767	Standard	NM_006042		Approved	3OST3A1, 30ST3A1	uc002gob.1	Q9Y663	OTTHUMG00000058768	ENST00000284110.1:c.11C>A	chr17.hg19:g.13504436G>T	ENSP00000284110:p.Pro4Gln	66.0	0.0	.		67.0	15.0	.	NM_006042	A8K7N2	Missense_Mutation	SNP	ENST00000284110.1	hg19	CCDS11165.1	.	.	.	.	.	.	.	.	.	.	G	11.91	1.778371	0.31502	.	.	ENSG00000153976	ENST00000284110	T	0.50548	0.74	2.79	-0.456	0.12190	.	0.327925	0.15205	U	0.274780	T	0.30854	0.0778	N	0.24115	0.695	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.05632	-1.0873	10	0.66056	D	0.02	.	9.3973	0.38410	0.3961:0.0:0.6039:0.0	.	4	Q9Y663	HS3SA_HUMAN	Q	4	ENSP00000284110:P4Q	ENSP00000284110:P4Q	P	-	2	0	HS3ST3A1	13445161	0.000000	0.05858	0.792000	0.32020	0.729000	0.41735	-0.271000	0.08572	-0.327000	0.08551	-1.119000	0.02030	CCG	.	.	.	none		0.711	HS3ST3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129952.1	NM_006042	
ZNF830	91603	hgsc.bcm.edu	37	17	33288777	33288777	+	Silent	SNP	C	C	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr17:33288777C>A	ENST00000361952.3	+	1	229	c.192C>A	c.(190-192)ctC>ctA	p.L64L	CCT6B_ENST00000436961.3_5'Flank|CCT6B_ENST00000314144.5_5'Flank|CCT6B_ENST00000421975.3_5'Flank	NM_052857.3	NP_443089.3	Q96NB3	ZN830_HUMAN	zinc finger protein 830	64					blastocyst growth (GO:0001832)|mitotic nuclear division (GO:0007067)|nuclear cell cycle DNA replication (GO:0033260)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|large_intestine(1)|liver(2)|lung(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		Ovarian(249;0.17)				AGAGCGAGCTCCTGTGGCAGA	0.582																																					p.L64L		Atlas-SNP	.											.	ZNF830	26	.	0			c.C192A						PASS	.						93.0	90.0	91.0					17																	33288777		2203	4300	6503	SO:0001819	synonymous_variant	91603	exon1			CGAGCTCCTGTGG	AK055707	CCDS32618.1	17q12	2013-10-23	2008-03-25	2008-03-25	ENSG00000198783	ENSG00000198783			28291	protein-coding gene	gene with protein product	"""orphan maintenance of genome 1"""		"""coiled-coil domain containing 16"""	CCDC16		23066043	Standard	NM_052857		Approved	MGC20398, OMCG1	uc002hih.4	Q96NB3	OTTHUMG00000179771	ENST00000361952.3:c.192C>A	chr17.hg19:g.33288777C>A		117.0	0.0	.		128.0	53.0	.	NM_052857	Q96F60|Q96GZ5|Q9BU38	Silent	SNP	ENST00000361952.3	hg19	CCDS32618.1																																																																																			.	.	.	none		0.582	ZNF830-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448018.1	NM_052857	
GGNBP2	79893	hgsc.bcm.edu	37	17	34934557	34934557	+	Silent	SNP	C	C	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr17:34934557C>T	ENST00000304718.4	+	7	1102	c.786C>T	c.(784-786)tgC>tgT	p.C262C		NM_024835.3	NP_079111.1	Q9H3C7	GGNB2_HUMAN	gametogenetin binding protein 2	262					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)		p.C262C(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)	38		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		TACATGTTTGCTGTGAAACAG	0.463																																					p.C262C		Atlas-SNP	.											GGNBP2,NS,carcinoma,0,1	GGNBP2	72	.	1	Substitution - coding silent(1)	lung(1)	c.C786T						PASS	.						216.0	194.0	201.0					17																	34934557		2203	4300	6503	SO:0001819	synonymous_variant	79893	exon7			TGTTTGCTGTGAA	AF126964	CCDS11314.1	17q21.1	2014-05-06	2007-08-20	2007-08-20	ENSG00000005955	ENSG00000278311			19357	protein-coding gene	gene with protein product		612275	"""zinc finger protein 403"""	ZNF403		11728448	Standard	NM_024835		Approved	ZFP403, LZK1, FLJ22561, FLJ21230, DIF-3, DIF3	uc002hnb.3	Q9H3C7	OTTHUMG00000188440	ENST00000304718.4:c.786C>T	chr17.hg19:g.34934557C>T		131.0	0.0	.		108.0	24.0	.	NM_024835	B2RPK7|Q96T90|Q9GZR8|Q9H767	Silent	SNP	ENST00000304718.4	hg19	CCDS11314.1																																																																																			.	.	.	none		0.463	GGNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256684.2	NM_024835	
RPRML	388394	hgsc.bcm.edu	37	17	45056083	45056083	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr17:45056083G>T	ENST00000322329.3	-	1	531	c.291C>A	c.(289-291)agC>agA	p.S97R	LRRC37A17P_ENST00000570478.1_RNA|RP11-156P1.2_ENST00000571841.1_Intron|GOSR2_ENST00000439730.2_Intron	NM_203400.4	NP_981945.1	Q8N4K4	RPRML_HUMAN	reprimo-like	97						integral component of membrane (GO:0016021)				lung(1)	1						AGTTGATCATGCTCTCGGACT	0.652																																					p.S97R		Atlas-SNP	.											.	RPRML	2	.	0			c.C291A						PASS	.						34.0	32.0	33.0					17																	45056083		2201	4300	6501	SO:0001583	missense	388394	exon1			GATCATGCTCTCG	BC033942	CCDS11508.1	17q21.32	2006-09-26				ENSG00000179673			32422	protein-coding gene	gene with protein product							Standard	NM_203400		Approved	MGC43894	uc002ilb.3	Q8N4K4		ENST00000322329.3:c.291C>A	chr17.hg19:g.45056083G>T	ENSP00000318032:p.Ser97Arg	106.0	0.0	.		102.0	28.0	.	NM_203400		Missense_Mutation	SNP	ENST00000322329.3	hg19	CCDS11508.1	.	.	.	.	.	.	.	.	.	.	G	17.66	3.444031	0.63067	.	.	ENSG00000179673	ENST00000322329	.	.	.	3.72	2.72	0.32119	.	0.000000	0.85682	D	0.000000	T	0.66655	0.2811	L	0.52573	1.65	0.58432	D	0.999997	D	0.76494	0.999	D	0.72075	0.976	T	0.65561	-0.6138	9	0.52906	T	0.07	-8.687	10.3405	0.43875	0.103:0.0:0.897:0.0	.	97	Q8N4K4	RPRML_HUMAN	R	97	.	ENSP00000318032:S97R	S	-	3	2	RPRML	42411082	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.546000	0.45778	0.727000	0.32360	0.313000	0.20887	AGC	.	.	.	none		0.652	RPRML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440919.1	NM_203400	
CEP192	55125	hgsc.bcm.edu	37	18	13055803	13055803	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr18:13055803A>T	ENST00000325971.8	+	17	3019	c.1426A>T	c.(1426-1428)Acc>Tcc	p.T476S	CEP192_ENST00000506447.1_Missense_Mutation_p.T1072S|CEP192_ENST00000430049.2_Missense_Mutation_p.T597S			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	476					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						CGAGTTGAGTACCACAATTAT	0.368																																					p.T1072S		Atlas-SNP	.											.	CEP192	340	.	0			c.A3214T						PASS	.						57.0	57.0	57.0					18																	13055803		2203	4300	6503	SO:0001583	missense	55125	exon19			TTGAGTACCACAA	AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.1426A>T	chr18.hg19:g.13055803A>T	ENSP00000317156:p.Thr476Ser	67.0	0.0	.		42.0	14.0	.	NM_032142	A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Missense_Mutation	SNP	ENST00000325971.8	hg19		.	.	.	.	.	.	.	.	.	.	A	19.71	3.878317	0.72294	.	.	ENSG00000101639	ENST00000506447;ENST00000325971;ENST00000399863;ENST00000430049	T;T;T	0.21031	2.03;2.03;2.03	4.5	4.5	0.54988	.	0.111905	0.39687	N	0.001284	T	0.22704	0.0548	L	0.39397	1.21	0.42538	D	0.993064	B;B;P	0.43973	0.291;0.291;0.823	B;B;P	0.44477	0.214;0.214;0.451	T	0.02307	-1.1179	10	0.44086	T	0.13	-5.7927	14.1063	0.65091	1.0:0.0:0.0:0.0	.	597;1072;476	C9JT09;E9PF99;Q8TEP8	.;.;CE192_HUMAN	S	1072;476;476;597	ENSP00000427550:T1072S;ENSP00000317156:T476S;ENSP00000389190:T597S	ENSP00000317156:T476S	T	+	1	0	CEP192	13045803	1.000000	0.71417	0.998000	0.56505	0.797000	0.45037	6.760000	0.74939	1.790000	0.52503	0.460000	0.39030	ACC	.	.	.	none		0.368	CEP192-201	KNOWN	basic	protein_coding	protein_coding		NM_032142	
PHLPP1	23239	hgsc.bcm.edu	37	18	60384475	60384475	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr18:60384475T>A	ENST00000262719.5	+	1	1793	c.1559T>A	c.(1558-1560)cTc>cAc	p.L520H	PHLPP1_ENST00000400316.4_Missense_Mutation_p.L8H			O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein phosphatase 1	520					apoptotic process (GO:0006915)|entrainment of circadian clock (GO:0009649)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			endometrium(2)|kidney(2)|lung(13)	17						ATTGGCTGCCTCATCCGCTTC	0.537																																					p.L520H		Atlas-SNP	.											.	PHLPP1	164	.	0			c.T1559A						PASS	.						76.0	88.0	84.0					18																	60384475		2032	4181	6213	SO:0001583	missense	23239	exon1			GCTGCCTCATCCG	AB011178	CCDS45881.1, CCDS45881.2	18q21.32	2013-01-11	2009-05-26	2009-05-26	ENSG00000081913	ENSG00000081913		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	20610	protein-coding gene	gene with protein product		609396	"""pleckstrin homology domain containing, family E (with leucine rich repeats) member 1"", ""PH domain and leucine rich repeat protein phosphatase"""	PLEKHE1, PHLPP		10570941, 15808505	Standard	NM_194449		Approved	KIAA0606, SCOP	uc021ule.1	O60346	OTTHUMG00000150629	ENST00000262719.5:c.1559T>A	chr18.hg19:g.60384475T>A	ENSP00000262719:p.Leu520His	80.0	0.0	.		46.0	16.0	.	NM_194449	A1A4F5|Q641Q7|Q6P4C4|Q6PJI6|Q86TN6|Q96FK2|Q9NUY1	Missense_Mutation	SNP	ENST00000262719.5	hg19	CCDS45881.2	.	.	.	.	.	.	.	.	.	.	T	21.9	4.221833	0.79464	.	.	ENSG00000081913	ENST00000400316;ENST00000262719	T;T	0.35605	1.52;1.3	3.91	3.91	0.45181	.	.	.	.	.	T	0.49932	0.1586	L	0.43923	1.385	0.45272	D	0.998273	D	0.89917	1.0	D	0.87578	0.998	T	0.51498	-0.8698	9	0.66056	D	0.02	-10.6803	11.9254	0.52817	0.0:0.0:0.0:1.0	.	520	O60346	PHLP1_HUMAN	H	8;520	ENSP00000383170:L8H;ENSP00000262719:L520H	ENSP00000262719:L520H	L	+	2	0	PHLPP1	58535455	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.650000	0.74368	1.653000	0.50694	0.454000	0.30748	CTC	.	.	.	none		0.537	PHLPP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319249.2	NM_194449	
FEM1A	55527	hgsc.bcm.edu	37	19	4792820	4792820	+	Silent	SNP	C	C	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr19:4792820C>A	ENST00000269856.3	+	1	1093	c.954C>A	c.(952-954)gcC>gcA	p.A318A	AC005523.2_ENST00000601192.1_RNA|AC005523.2_ENST00000596170.1_RNA|AC005523.3_ENST00000598782.1_lincRNA	NM_018708.2	NP_061178.1	Q9BSK4	FEM1A_HUMAN	fem-1 homolog a (C. elegans)	318					negative regulation of inflammatory response (GO:0050728)|regulation of ubiquitin-protein transferase activity (GO:0051438)	cytoplasm (GO:0005737)	EP4 subtype prostaglandin E2 receptor binding (GO:0031867)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	17		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)		TGCTTGGGGCCCTTAAACACT	0.597																																					p.A318A		Atlas-SNP	.											.	FEM1A	41	.	0			c.C954A						PASS	.						47.0	51.0	50.0					19																	4792820		2203	4299	6502	SO:0001819	synonymous_variant	55527	exon1			TGGGGCCCTTAAA	BC004988	CCDS12135.1	19p13.3	2013-01-10	2006-11-08		ENSG00000141965	ENSG00000141965		"""Ankyrin repeat domain containing"""	16934	protein-coding gene	gene with protein product		613538				11441184	Standard	NM_018708		Approved		uc002mbf.3	Q9BSK4		ENST00000269856.3:c.954C>A	chr19.hg19:g.4792820C>A		159.0	0.0	.		108.0	32.0	.	NM_018708	B2RDI3|Q711P8|Q9NPN7|Q9NPW8	Silent	SNP	ENST00000269856.3	hg19	CCDS12135.1																																																																																			.	.	.	none		0.597	FEM1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459000.1		
ZNF558	148156	hgsc.bcm.edu	37	19	8922694	8922694	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr19:8922694A>G	ENST00000601372.1	-	10	1183	c.472T>C	c.(472-474)Ttt>Ctt	p.F158L	ZNF558_ENST00000301475.1_Missense_Mutation_p.F158L|ZNF558_ENST00000444186.2_Missense_Mutation_p.F87L			Q96NG5	ZN558_HUMAN	zinc finger protein 558	158					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	15						AAGACTTTAAAACACTGATTA	0.338																																					p.F158L		Atlas-SNP	.											.	ZNF558	43	.	0			c.T472C						PASS	.						42.0	38.0	40.0					19																	8922694		2203	4300	6503	SO:0001583	missense	148156	exon6			CTTTAAAACACTG	AK055494	CCDS12208.1	19p13.2	2013-09-20			ENSG00000167785	ENSG00000167785		"""Zinc fingers, C2H2-type"", ""-"""	26422	protein-coding gene	gene with protein product							Standard	NM_144693		Approved	FLJ30932	uc002mkn.1	Q96NG5	OTTHUMG00000182196	ENST00000601372.1:c.472T>C	chr19.hg19:g.8922694A>G	ENSP00000471277:p.Phe158Leu	84.0	0.0	.		72.0	9.0	.	NM_144693	A8K5F0|B7Z798	Missense_Mutation	SNP	ENST00000601372.1	hg19	CCDS12208.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.492197	0.84962	.	.	ENSG00000167785	ENST00000301475;ENST00000444186	T;T	0.07216	3.21;3.21	5.07	4.0	0.46444	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.44688	D	0.000434	T	0.04137	0.0115	N	0.12182	0.205	0.34332	D	0.687801	P	0.39250	0.665	B	0.30716	0.119	T	0.30208	-0.9986	10	0.72032	D	0.01	-19.1944	8.9778	0.35946	0.7058:0.2942:0.0:0.0	.	158	Q96NG5	ZN558_HUMAN	L	158;87	ENSP00000301475:F158L;ENSP00000410703:F87L	ENSP00000301475:F158L	F	-	1	0	ZNF558	8783694	0.975000	0.34042	0.999000	0.59377	0.988000	0.76386	1.844000	0.39269	2.128000	0.65567	0.482000	0.46254	TTT	.	.	.	none		0.338	ZNF558-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459955.2	NM_144693	
ZNF426	79088	hgsc.bcm.edu	37	19	9639297	9639297	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr19:9639297G>A	ENST00000535489.1	-	6	1760	c.1424C>T	c.(1423-1425)cCc>cTc	p.P475L	ZNF426_ENST00000593003.1_Missense_Mutation_p.P437L|ZNF426_ENST00000253115.2_Missense_Mutation_p.P475L			Q9BUY5	ZN426_HUMAN	zinc finger protein 426	475					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(3)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	20						ACACTCATAGGGTTTTTCTCC	0.428																																					p.P475L		Atlas-SNP	.											.	ZNF426	56	.	0			c.C1424T						PASS	.						95.0	93.0	94.0					19																	9639297		2203	4300	6503	SO:0001583	missense	79088	exon8			TCATAGGGTTTTT	AK095759	CCDS12215.1, CCDS74279.1	19p13.2	2013-01-08				ENSG00000130818		"""Zinc fingers, C2H2-type"", ""-"""	20725	protein-coding gene	gene with protein product							Standard	NM_024106		Approved	MGC2663	uc002mlq.3	Q9BUY5		ENST00000535489.1:c.1424C>T	chr19.hg19:g.9639297G>A	ENSP00000439017:p.Pro475Leu	147.0	0.0	.		114.0	29.0	.	NM_024106	B3KTL2	Missense_Mutation	SNP	ENST00000535489.1	hg19	CCDS12215.1	.	.	.	.	.	.	.	.	.	.	G	17.19	3.326242	0.60743	.	.	ENSG00000130818	ENST00000545189;ENST00000253115;ENST00000535489	T;T	0.17054	2.3;2.3	1.52	1.52	0.23074	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.36717	0.0977	M	0.74546	2.27	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.99	T	0.24012	-1.0172	9	0.72032	D	0.01	.	8.9649	0.35869	0.0:0.0:1.0:0.0	.	462;475	Q59EH4;Q9BUY5	.;ZN426_HUMAN	L	462;475;475	ENSP00000253115:P475L;ENSP00000439017:P475L	ENSP00000253115:P475L	P	-	2	0	ZNF426	9500297	0.426000	0.25506	0.005000	0.12908	0.100000	0.18952	1.495000	0.35627	1.133000	0.42147	0.563000	0.77884	CCC	.	.	.	none		0.428	ZNF426-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449905.1	NM_024106	
ICAM3	3385	hgsc.bcm.edu	37	19	10444569	10444569	+	Silent	SNP	T	T	A	rs369252388		TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr19:10444569T>A	ENST00000160262.5	-	7	1816	c.1608A>T	c.(1606-1608)acA>acT	p.T536T	RAVER1_ENST00000293677.6_5'Flank|ICAM3_ENST00000589261.1_Silent_p.T459T	NM_002162.3	NP_002153.2	P32942	ICAM3_HUMAN	intercellular adhesion molecule 3	536					extracellular matrix organization (GO:0030198)|regulation of immune response (GO:0050776)|single organismal cell-cell adhesion (GO:0016337)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	13			OV - Ovarian serous cystadenocarcinoma(20;6.13e-09)|Epithelial(33;9.69e-06)|all cancers(31;2.05e-05)			CCATTGCTTCTGTCGGCTGCA	0.567																																					p.T536T		Atlas-SNP	.											.	ICAM3	29	.	0			c.A1608T						PASS	.	T		0,4406		0,0,2203	180.0	166.0	171.0		1608	-8.7	0.0	19		171	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ICAM3	NM_002162.3		0,1,6502	AA,AT,TT		0.0116,0.0,0.0077		536/548	10444569	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	3385	exon7			TGCTTCTGTCGGC		CCDS12235.1	19p13.3-p13.2	2013-01-11				ENSG00000076662		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5346	protein-coding gene	gene with protein product		146631				1448174	Standard	NM_002162		Approved	CDW50, ICAM-R, CD50	uc002mob.2	P32942		ENST00000160262.5:c.1608A>T	chr19.hg19:g.10444569T>A		162.0	0.0	.		121.0	24.0	.	NM_002162	Q6PD68	Silent	SNP	ENST00000160262.5	hg19	CCDS12235.1																																																																																			.	.	.	weak		0.567	ICAM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451234.1		
CYP4F3	4051	hgsc.bcm.edu	37	19	15752256	15752256	+	Missense_Mutation	SNP	C	C	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr19:15752256C>G	ENST00000221307.8	+	2	78	c.31C>G	c.(31-33)Ctt>Gtt	p.L11V	CYP4F3_ENST00000585846.1_Missense_Mutation_p.L11V|CYP4F3_ENST00000591058.1_Missense_Mutation_p.L11V|CYP4F3_ENST00000586182.2_Missense_Mutation_p.L11V	NM_000896.2	NP_000887.2	Q08477	CP4F3_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 3	11					arachidonic acid metabolic process (GO:0019369)|icosanoid metabolic process (GO:0006690)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-tocopherol omega-hydroxylase activity (GO:0052871)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)|monooxygenase activity (GO:0004497)			endometrium(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|stomach(1)	34						CTCGCTGGGCCTTTGGCCAAT	0.652																																					p.L11V		Atlas-SNP	.											.	CYP4F3	69	.	0			c.C31G						PASS	.						56.0	56.0	56.0					19																	15752256		2203	4300	6503	SO:0001583	missense	4051	exon2			CTGGGCCTTTGGC	AB002454	CCDS12332.1, CCDS59362.1	19p13.12	2013-02-21	2003-01-14		ENSG00000186529	ENSG00000186529		"""Cytochrome P450s"""	2646	protein-coding gene	gene with protein product		601270	"""cytochrome P450, subfamily IVF, polypeptide 3 (leukotriene B4 omega hydroxylase)"""	LTB4H		8486631, 9539102	Standard	NM_000896		Approved	CYP4F	uc010xol.2	Q08477	OTTHUMG00000182374	ENST00000221307.8:c.31C>G	chr19.hg19:g.15752256C>G	ENSP00000221307:p.Leu11Val	84.0	0.0	.		64.0	16.0	.	NM_001199209	B7Z8Z3|O60634|Q5U740	Missense_Mutation	SNP	ENST00000221307.8	hg19	CCDS12332.1	.	.	.	.	.	.	.	.	.	.	.	12.16	1.854157	0.32791	.	.	ENSG00000186529	ENST00000221307	D	0.93426	-3.22	3.73	2.65	0.31530	.	0.298234	0.22742	U	0.056184	D	0.92450	0.7603	M	0.73598	2.24	0.09310	N	1	P;P	0.38420	0.63;0.63	B;B	0.43082	0.317;0.407	D	0.85130	0.0974	10	0.42905	T	0.14	.	8.5276	0.33315	0.2301:0.7698:0.0:0.0	.	11;11	B7Z8Z3;Q08477	.;CP4F3_HUMAN	V	11	ENSP00000221307:L11V	ENSP00000221307:L11V	L	+	1	0	CYP4F3	15613256	0.000000	0.05858	0.002000	0.10522	0.028000	0.11728	-0.157000	0.10085	0.504000	0.28082	0.411000	0.27672	CTT	.	.	.	none		0.652	CYP4F3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460819.3	NM_000896	
ZNF506	440515	hgsc.bcm.edu	37	19	19905760	19905760	+	Silent	SNP	G	G	C			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr19:19905760G>C	ENST00000540806.2	-	4	1024	c.936C>G	c.(934-936)ccC>ccG	p.P312P	ZNF506_ENST00000450683.2_Silent_p.P280P|CTC-559E9.6_ENST00000589657.1_RNA|CTC-559E9.4_ENST00000590274.1_lincRNA|CTC-559E9.6_ENST00000591884.1_RNA|ZNF506_ENST00000443905.2_Silent_p.P312P|ZNF506_ENST00000587461.1_Intron			Q5JVG8	ZN506_HUMAN	zinc finger protein 506	312					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|large_intestine(7)|lung(3)|skin(1)|stomach(1)	14						CACATTTGTAGGGTTTCTCTC	0.373																																					p.P312P		Atlas-SNP	.											.	ZNF506	36	.	0			c.C936G						PASS	.						55.0	59.0	57.0					19																	19905760		2197	4300	6497	SO:0001819	synonymous_variant	440515	exon4			TTTGTAGGGTTTC	AK095575	CCDS42531.1, CCDS46027.1	19p13.11	2013-01-08				ENSG00000081665		"""Zinc fingers, C2H2-type"", ""-"""	23780	protein-coding gene	gene with protein product							Standard	NM_001099269		Approved	DKFZp761G1812	uc010eci.2	Q5JVG8		ENST00000540806.2:c.936C>G	chr19.hg19:g.19905760G>C		36.0	0.0	.		39.0	10.0	.	NM_001099269	B3KTH6	Silent	SNP	ENST00000540806.2	hg19	CCDS42531.1																																																																																			.	.	.	none		0.373	ZNF506-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460794.1	XM_036218	
CYP2F1	1572	hgsc.bcm.edu	37	19	41627458	41627458	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr19:41627458C>T	ENST00000331105.2	+	5	652	c.580C>T	c.(580-582)Cgt>Tgt	p.R194C		NM_000774.3	NP_000765.2	P24903	CP2F1_HUMAN	cytochrome P450, family 2, subfamily F, polypeptide 1	194					naphthalene metabolic process (GO:0018931)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|trichloroethylene metabolic process (GO:0018979)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)			central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|liver(2)|lung(11)|ovary(2)|skin(2)	29						TGATGATGAGCGTCTGCTCAC	0.562																																					p.R194C		Atlas-SNP	.											.	CYP2F1	60	.	0			c.C580T						PASS	.						113.0	115.0	115.0					19																	41627458		2181	4299	6480	SO:0001583	missense	1572	exon5			GATGAGCGTCTGC	J02906	CCDS12572.1	19q13.1-q13.2	2008-02-05	2003-01-14		ENSG00000197446	ENSG00000197446		"""Cytochrome P450s"""	2632	protein-coding gene	gene with protein product		124070	"""cytochrome P450, subfamily IIF, polypeptide 1"""	CYP2F			Standard	NM_000774		Approved		uc002opu.1	P24903	OTTHUMG00000167412	ENST00000331105.2:c.580C>T	chr19.hg19:g.41627458C>T	ENSP00000333534:p.Arg194Cys	69.0	0.0	.		43.0	13.0	.	NM_000774	A7KAU6|A7KAU7|A7KAU8|A7KAU9|A7KAV0|Q32MN5|Q8WWJ2	Missense_Mutation	SNP	ENST00000331105.2	hg19	CCDS12572.1	.	.	.	.	.	.	.	.	.	.	c	10.84	1.464169	0.26335	.	.	ENSG00000197446	ENST00000331105	T	0.69435	-0.4	2.87	2.87	0.33458	.	0.714608	0.13306	U	0.397870	T	0.79052	0.4381	M	0.79475	2.455	0.34749	D	0.731557	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.983	T	0.82147	-0.0601	10	0.72032	D	0.01	.	7.7914	0.29123	0.0:0.7393:0.2607:0.0	.	194;194	Q32MN5;P24903	.;CP2F1_HUMAN	C	194	ENSP00000333534:R194C	ENSP00000333534:R194C	R	+	1	0	CYP2F1	46319298	0.000000	0.05858	0.113000	0.21522	0.208000	0.24298	-0.348000	0.07740	1.461000	0.47929	0.064000	0.15345	CGT	.	.	.	none		0.562	CYP2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394527.2		
PSG9	5678	hgsc.bcm.edu	37	19	43772079	43772079	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr19:43772079C>T	ENST00000270077.3	-	2	383	c.287G>A	c.(286-288)aGt>aAt	p.S96N	PSG9_ENST00000418820.2_Missense_Mutation_p.S96N|PSG9_ENST00000593948.1_Missense_Mutation_p.S96N|PSG9_ENST00000443718.3_Missense_Mutation_p.S96N|PSG9_ENST00000291752.5_Missense_Mutation_p.S96N|PSG9_ENST00000596730.1_Missense_Mutation_p.S96N|PSG9_ENST00000244293.7_Missense_Mutation_p.S96N	NM_002784.3	NP_002775.3	Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 9	96	Ig-like V-type.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Prostate(69;0.00682)				TTCTCTTCCACTGTATGCAGG	0.428																																					p.S96N		Atlas-SNP	.											.	PSG9	77	.	0			c.G287A						PASS	.						250.0	239.0	243.0					19																	43772079		2203	4300	6503	SO:0001583	missense	5678	exon2			CTTCCACTGTATG	M34481	CCDS12618.1	19q13.2	2013-01-29			ENSG00000183668	ENSG00000183668		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9526	protein-coding gene	gene with protein product		176398		PSG11		7806221	Standard	XM_005259076		Approved	PSGII	uc002owd.4	Q00887	OTTHUMG00000182826	ENST00000270077.3:c.287G>A	chr19.hg19:g.43772079C>T	ENSP00000270077:p.Ser96Asn	171.0	0.0	.		149.0	44.0	.	NM_002784	B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	Missense_Mutation	SNP	ENST00000270077.3	hg19	CCDS12618.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	10.79|10.79	1.448341|1.448341	0.26074|0.26074	.|.	.|.	ENSG00000183668|ENSG00000183668	ENST00000270077;ENST00000291752;ENST00000443718;ENST00000435220;ENST00000244293|ENST00000418820	T;T;T;T|.	0.69175|.	-0.38;-0.38;-0.38;-0.38|.	1.56|1.56	-1.3|-1.3	0.09259|0.09259	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);|.	.|.	.|.	.|.	.|.	T|T	0.65249|0.65249	0.2673|0.2673	M|M	0.93507|0.93507	3.425|3.425	0.09310|0.09310	N|N	1|1	P;P;D;P;B;B|.	0.53885|.	0.729;0.904;0.963;0.872;0.056;0.184|.	P;D;D;P;B;B|.	0.67231|.	0.826;0.921;0.95;0.686;0.272;0.393|.	T|T	0.59873|0.59873	-0.7372|-0.7372	9|5	0.54805|.	T|.	0.06|.	.|.	7.098|7.098	0.25321|0.25321	0.0:0.4456:0.5544:0.0|0.0:0.4456:0.5544:0.0	.|.	96;45;96;96;96;96|.	E7EW65;Q15225;Q15227;G3XAA7;Q6LEU7;Q00887|.	.;.;.;.;.;PSG9_HUMAN|.	N|M	96;96;96;57;96|83	ENSP00000270077:S96N;ENSP00000291752:S96N;ENSP00000396753:S96N;ENSP00000244293:S96N|.	ENSP00000244293:S96N|.	S|V	-|-	2|1	0|0	PSG9|PSG9	48463919|48463919	0.000000|0.000000	0.05858|0.05858	0.002000|0.002000	0.10522|0.10522	0.052000|0.052000	0.14988|0.14988	-0.107000|-0.107000	0.10873|0.10873	-0.216000|-0.216000	0.10048|0.10048	-0.876000|-0.876000	0.02978|0.02978	AGT|GTG	.	.	.	none		0.428	PSG9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323065.1	NM_002784	
ZNF836	162962	hgsc.bcm.edu	37	19	52660313	52660313	+	Missense_Mutation	SNP	A	A	T	rs186568049		TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr19:52660313A>T	ENST00000322146.8	-	5	1144	c.623T>A	c.(622-624)cTt>cAt	p.L208H	CTC-471J1.8_ENST00000594362.1_RNA|ZNF836_ENST00000597252.1_Missense_Mutation_p.L208H	NM_001102657.1	NP_001096127.1	Q6ZNA1	ZN836_HUMAN	zinc finger protein 836	208					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						TGTTTTCTCAAGTTGGGTGGG	0.373																																					p.L208H		Atlas-SNP	.											.	ZNF836	158	.	0			c.T623A						PASS	.						66.0	64.0	65.0					19																	52660313		1911	4155	6066	SO:0001583	missense	162962	exon5			TTCTCAAGTTGGG	BC011784	CCDS46162.1	19q13.33	2013-01-08			ENSG00000196267	ENSG00000196267		"""Zinc fingers, C2H2-type"", ""-"""	34333	protein-coding gene	gene with protein product							Standard	NM_001102657		Approved	FLJ16287	uc010ydj.2	Q6ZNA1		ENST00000322146.8:c.623T>A	chr19.hg19:g.52660313A>T	ENSP00000325038:p.Leu208His	180.0	0.0	.		177.0	48.0	.	NM_001102657		Missense_Mutation	SNP	ENST00000322146.8	hg19	CCDS46162.1	.	.	.	.	.	.	.	.	.	.	A	0.030	-1.337491	0.01287	.	.	ENSG00000196267	ENST00000322146;ENST00000396443	T	0.06371	3.31	1.8	-0.761	0.11038	.	.	.	.	.	T	0.02380	0.0073	N	0.08118	0	0.09310	N	1	P	0.50943	0.94	B	0.43783	0.431	T	0.13737	-1.0498	9	0.02654	T	1	.	2.5139	0.04663	0.2469:0.1649:0.0:0.5882	.	208	Q6ZNA1	ZN836_HUMAN	H	208;6	ENSP00000325038:L208H	ENSP00000325038:L208H	L	-	2	0	ZNF836	57352125	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	0.440000	0.21592	-0.496000	0.06650	-1.328000	0.01277	CTT	.	A|1.000;C|0.000	.	alt		0.373	ZNF836-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462456.1	NM_001102657	
ZIM2	23619	hgsc.bcm.edu	37	19	57286732	57286732	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr19:57286732C>T	ENST00000391708.3	-	12	1450	c.908G>A	c.(907-909)gGa>gAa	p.G303E	ZIM2_ENST00000601070.1_Missense_Mutation_p.G303E|AC006115.3_ENST00000594400.1_RNA|ZIM2_ENST00000599935.1_Missense_Mutation_p.G303E|ZIM2_ENST00000221722.5_Missense_Mutation_p.G303E|ZIM2_ENST00000593711.1_Missense_Mutation_p.G303E|AC006115.3_ENST00000597946.1_RNA|AC006115.3_ENST00000595954.1_RNA	NM_001146326.1|NM_001146327.1	NP_001139798.1|NP_001139799.1	Q9NZV7	ZIM2_HUMAN	zinc finger, imprinted 2	303					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0314)		GGGATCCTTTCCTAGAGGATC	0.453																																					p.G303E		Atlas-SNP	.											.	ZIM2	511	.	0			c.G908A						PASS	.						119.0	114.0	116.0					19																	57286732		2203	4300	6503	SO:0001583	missense	23619	exon11			TCCTTTCCTAGAG	AF166122	CCDS33123.1	19q13.4	2012-10-31				ENSG00000269699		"""Zinc fingers, C2H2-type"""	12875	protein-coding gene	gene with protein product							Standard	NM_015363		Approved	ZNF656		Q9NZV7		ENST00000391708.3:c.908G>A	chr19.hg19:g.57286732C>T	ENSP00000375589:p.Gly303Glu	112.0	0.0	.		88.0	21.0	.	NM_015363	Q2M3K1	Missense_Mutation	SNP	ENST00000391708.3	hg19	CCDS33123.1	.	.	.	.	.	.	.	.	.	.	C	15.06	2.720643	0.48728	.	.	ENSG00000198300	ENST00000391708;ENST00000221722	T;T	0.04317	3.65;3.65	3.89	0.45	0.16624	.	.	.	.	.	T	0.03220	0.0094	N	0.24115	0.695	.	.	.	B	0.21606	0.058	B	0.20184	0.028	T	0.37911	-0.9685	8	0.49607	T	0.09	.	2.8917	0.05678	0.3745:0.3962:0.0:0.2293	.	303	Q9NZV7	ZIM2_HUMAN	E	303	ENSP00000375589:G303E;ENSP00000221722:G303E	ENSP00000221722:G303E	G	-	2	0	ZIM2	61978544	0.000000	0.05858	0.131000	0.22000	0.731000	0.41821	-0.337000	0.07852	0.176000	0.19873	0.655000	0.94253	GGA	.	.	.	none		0.453	ZIM2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416094.2		
TIAM1	7074	hgsc.bcm.edu	37	21	32639267	32639267	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr21:32639267G>A	ENST00000286827.3	-	5	493	c.22C>T	c.(22-24)Cat>Tat	p.H8Y	TIAM1_ENST00000541036.1_Missense_Mutation_p.H8Y|TIAM1_ENST00000469412.1_Intron	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	8					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						TGCTCTACATGTTGACTTTCT	0.527																																					p.H8Y		Atlas-SNP	.											.	TIAM1	522	.	0			c.C22T						PASS	.						54.0	56.0	55.0					21																	32639267		2203	4300	6503	SO:0001583	missense	7074	exon5			CTACATGTTGACT		CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.22C>T	chr21.hg19:g.32639267G>A	ENSP00000286827:p.His8Tyr	50.0	0.0	.		24.0	7.0	.	NM_003253	B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	ENST00000286827.3	hg19	CCDS13609.1	.	.	.	.	.	.	.	.	.	.	G	13.84	2.358038	0.41801	.	.	ENSG00000156299	ENST00000286827;ENST00000541036;ENST00000455508	T;T	0.39056	1.1;1.1	5.08	2.64	0.31445	.	0.211502	0.47852	D	0.000203	T	0.23611	0.0571	N	0.08118	0	0.21147	N	0.999772	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.22521	-1.0214	10	0.87932	D	0	.	11.7355	0.51763	0.0:0.0:0.3141:0.6859	.	8;8;8	F5GZ53;B7ZLR6;Q13009	.;.;TIAM1_HUMAN	Y	8	ENSP00000286827:H8Y;ENSP00000441570:H8Y	ENSP00000286827:H8Y	H	-	1	0	TIAM1	31561138	1.000000	0.71417	0.978000	0.43139	0.974000	0.67602	5.772000	0.68889	0.251000	0.21505	0.460000	0.39030	CAT	.	.	.	none		0.527	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	NM_003253	
ASMTL	8623	hgsc.bcm.edu	37	X	1540611	1540611	+	Missense_Mutation	SNP	G	G	C			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chrX:1540611G>C	ENST00000381317.3	-	9	1217	c.1185C>G	c.(1183-1185)atC>atG	p.I395M	ASMTL_ENST00000381333.4_Missense_Mutation_p.I379M|ASMTL_ENST00000416733.2_Missense_Mutation_p.I319M|ASMTL_ENST00000534940.1_Missense_Mutation_p.I337M	NM_004192.3	NP_004183.2	O95671	ASML_HUMAN	acetylserotonin O-methyltransferase-like	395	ASMT-like.					cytoplasm (GO:0005737)	O-methyltransferase activity (GO:0008171)			NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(9)|pancreas(1)|soft_tissue(1)	23		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TTCCCTCTCGGATGGCAAACT	0.537																																					p.I395M		Atlas-SNP	.											.	ASMTL	56	.	0			c.C1185G						PASS	.						267.0	279.0	275.0					X																	1540611		2010	4172	6182	SO:0001583	missense	8623	exon9			CTCTCGGATGGCA	Y15521	CCDS43917.1, CCDS55362.1, CCDS55363.1	Xp22.3 and Yp11.3	2008-02-05			ENSG00000169093	ENSG00000169093		"""Pseudoautosomal regions / PAR1"""	751	protein-coding gene	gene with protein product		300162, 400011				9736779	Standard	NM_004192		Approved		uc004cpx.2	O95671	OTTHUMG00000021057	ENST00000381317.3:c.1185C>G	chrX.hg19:g.1540611G>C	ENSP00000370718:p.Ile395Met	561.0	1.0	.		288.0	119.0	.	NM_004192	B4DX75|F5GXH4|J3JS33|Q5JQ53|Q8NBH5|Q96G02|Q9BUL6	Missense_Mutation	SNP	ENST00000381317.3	hg19	CCDS43917.1	.	.	.	.	.	.	.	.	.	.	g	11.19	1.566957	0.28003	.	.	ENSG00000169093	ENST00000416733;ENST00000534940;ENST00000381333;ENST00000381317	T;T;T;T	0.26223	1.75;1.75;1.75;1.75	1.58	-3.16	0.05217	O-methyltransferase, family 2 (1);	0.083070	0.47093	U	0.000252	T	0.24275	0.0588	L	0.38175	1.15	0.09310	N	1	D;D;D	0.60575	0.979;0.988;0.979	P;P;P	0.55713	0.782;0.666;0.582	T	0.14643	-1.0465	10	0.87932	D	0	.	5.5218	0.16938	0.2398:0.184:0.5763:0.0	.	319;379;395	E7ER97;O95671-2;O95671	.;.;ASML_HUMAN	M	319;337;379;395	ENSP00000410578:I319M;ENSP00000446410:I337M;ENSP00000370734:I379M;ENSP00000370718:I395M	ENSP00000370718:I395M	I	-	3	3	ASMTL	1500611	0.986000	0.35501	0.006000	0.13384	0.132000	0.20833	-0.099000	0.11007	-0.451000	0.07097	0.100000	0.15512	ATC	.	.	.	alt		0.537	ASMTL-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055595.1	NM_004192	
ACOT9	23597	hgsc.bcm.edu	37	X	23723161	23723161	+	Silent	SNP	G	G	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chrX:23723161G>A	ENST00000336430.7	-	13	1160	c.1029C>T	c.(1027-1029)atC>atT	p.I343I	ACOT9_ENST00000379295.1_Silent_p.I283I|ACOT9_ENST00000379303.5_Silent_p.I352I	NM_001033583.2	NP_001028755.2	Q9Y305	ACOT9_HUMAN	acyl-CoA thioesterase 9	343					acyl-CoA metabolic process (GO:0006637)	mitochondrion (GO:0005739)	acetyl-CoA hydrolase activity (GO:0003986)|carboxylic ester hydrolase activity (GO:0052689)			breast(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(4)|pancreas(1)|skin(1)	15						TCTGAAACATGATGTCATCTA	0.403																																					p.I352I		Atlas-SNP	.											.	ACOT9	33	.	0			c.C1056T						PASS	.						120.0	109.0	113.0					X																	23723161		2203	4300	6503	SO:0001819	synonymous_variant	23597	exon14			AAACATGATGTCA	AF132950	CCDS35216.1, CCDS43924.1	Xp22.11	2008-02-05			ENSG00000123130	ENSG00000123130		"""Acyl CoA thioesterases"""	17152	protein-coding gene	gene with protein product		300862				10383425, 10810093, 16103133, 16940157	Standard	XM_005274471		Approved	CGI-16, MT-ACT48, ACATE2	uc004dao.3	Q9Y305	OTTHUMG00000021257	ENST00000336430.7:c.1029C>T	chrX.hg19:g.23723161G>A		166.0	0.0	.		161.0	100.0	.	NM_001037171	B3KNC9|B7ZM94	Silent	SNP	ENST00000336430.7	hg19	CCDS35216.1																																																																																			.	.	.	none		0.403	ACOT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056065.1	NM_012332	
AR	367	hgsc.bcm.edu	37	X	66765167	66765167	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chrX:66765167A>T	ENST00000374690.3	+	1	703	c.179A>T	c.(178-180)cAg>cTg	p.Q60L	AR_ENST00000396044.3_Missense_Mutation_p.Q60L|AR_ENST00000504326.1_Missense_Mutation_p.Q60L|AR_ENST00000513847.1_3'UTR	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	60	Gln-rich.|Modulating.|Poly-Gln.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	CTgcagcagcagcagcagcag	0.677									Androgen Insensitivity Syndrome																												p.Q60L		Atlas-SNP	.											.	AR	249	.	0			c.A179T	GRCh37	CI994028	AR	I		PASS	.						6.0	9.0	8.0					X																	66765167		1971	3901	5872	SO:0001583	missense	367	exon1	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	AGCAGCAGCAGCA	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.179A>T	chrX.hg19:g.66765167A>T	ENSP00000363822:p.Gln60Leu	72.0	0.0	.		77.0	7.0	.	NM_000044	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	ENST00000374690.3	hg19	CCDS14387.1	.	.	.	.	.	.	.	.	.	.	a	11.27	1.588228	0.28357	.	.	ENSG00000169083	ENST00000374690;ENST00000504326;ENST00000396044;ENST00000538891	T;T;T	0.57436	0.4;0.4;0.4	.	.	.	.	1.241110	0.06210	N	0.684797	T	0.29288	0.0729	N	0.19112	0.55	0.09310	N	0.999999	P;P;.	0.36048	0.534;0.534;.	B;B;.	0.29862	0.08;0.108;.	T	0.11494	-1.0585	8	0.12103	T	0.63	.	.	.	.	.	60;60;58	E7EVX6;D3YPQ2;P10275	.;.;ANDR_HUMAN	L	60	ENSP00000363822:Q60L;ENSP00000421155:Q60L;ENSP00000379359:Q60L	ENSP00000363822:Q60L	Q	+	2	0	AR	66681892	0.997000	0.39634	0.860000	0.33809	0.513000	0.34164	1.220000	0.32491	0.000000	0.14550	0.000000	0.15137	CAG	.	.	.	none		0.677	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
ZMAT1	84460	hgsc.bcm.edu	37	X	101152941	101152941	+	Silent	SNP	A	A	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chrX:101152941A>T	ENST00000372782.3	-	5	452	c.405T>A	c.(403-405)atT>atA	p.I135I	ZMAT1_ENST00000458570.1_5'UTR|ZMAT1_ENST00000540921.1_Silent_p.I135I	NM_001011657.3	NP_001011657	Q5H9K5	ZMAT1_HUMAN	zinc finger, matrin-type 1	135						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22						GAGACTGAGCAATAAGTGGAG	0.403																																					p.I135I		Atlas-SNP	.											.	ZMAT1	143	.	0			c.T405A						PASS	.						157.0	124.0	135.0					X																	101152941		2203	4300	6503	SO:0001819	synonymous_variant	84460	exon5			CTGAGCAATAAGT	Z69304	CCDS35348.1	Xq21	2012-10-05	2010-09-15		ENSG00000166432	ENSG00000166432		"""Zinc fingers, matrin-type"""	29377	protein-coding gene	gene with protein product							Standard	NM_001011657		Approved	KIAA1789	uc011mrl.2	Q5H9K5	OTTHUMG00000022044	ENST00000372782.3:c.405T>A	chrX.hg19:g.101152941A>T		86.0	0.0	.		76.0	36.0	.	NM_001011657	Q8NDS3|Q96JN6	Silent	SNP	ENST00000372782.3	hg19	CCDS35348.1																																																																																			.	.	.	none		0.403	ZMAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057598.1		
PNCK	139728	hgsc.bcm.edu	37	X	152937048	152937048	+	Missense_Mutation	SNP	G	G	C			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chrX:152937048G>C	ENST00000370150.1	-	6	672	c.494C>G	c.(493-495)gCt>gGt	p.A165G	PNCK_ENST00000393831.2_Missense_Mutation_p.A165G|PNCK_ENST00000340888.3_Missense_Mutation_p.A165G|PNCK_ENST00000475172.1_5'UTR|PNCK_ENST00000370145.4_Missense_Mutation_p.A182G|PNCK_ENST00000447676.2_Missense_Mutation_p.A248G|PNCK_ENST00000370142.1_Missense_Mutation_p.A165G			Q6P2M8	KCC1B_HUMAN	pregnancy up-regulated nonubiquitous CaM kinase	165	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			breast(2)|lung(3)|skin(1)	6	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CATGTTCCCAGCCTGGATTTT	0.602																																					p.A248G		Atlas-SNP	.											.	PNCK	70	.	0			c.C743G						PASS	.						121.0	112.0	115.0					X																	152937048		2203	4300	6503	SO:0001583	missense	139728	exon6			TTCCCAGCCTGGA	BC033746	CCDS35503.2, CCDS48189.1	Xq28	2013-10-14	2013-10-14		ENSG00000130822	ENSG00000130822			13415	protein-coding gene	gene with protein product		300680	"""pregnancy upregulated non-ubiquitously expressed CaM kinase"", ""pregnancy up-regulated non-ubiquitously expressed CaM kinase"""			12477932	Standard	NM_001039582		Approved	MGC45419, CaMK1b	uc011myu.2	Q6P2M8	OTTHUMG00000024216	ENST00000370150.1:c.494C>G	chrX.hg19:g.152937048G>C	ENSP00000359169:p.Ala165Gly	101.0	0.0	.		66.0	39.0	.	NM_001039582	B4DJR8|B4E1A6|B7WPG0|D3DWU7|Q8N4R0	Missense_Mutation	SNP	ENST00000370150.1	hg19		.	.	.	.	.	.	.	.	.	.	g	7.308	0.614372	0.14129	.	.	ENSG00000130822	ENST00000340888;ENST00000370150;ENST00000393831;ENST00000370142;ENST00000370145;ENST00000447676;ENST00000439087;ENST00000422811	T;T;T;T;T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17;-0.17;-0.17;-0.17;-0.17	4.91	3.95	0.45737	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.215813	0.29579	N	0.011742	T	0.32734	0.0839	N	0.01789	-0.72	0.28784	N	0.899677	B;B;B;B	0.28350	0.001;0.208;0.026;0.026	B;B;B;B	0.22152	0.01;0.038;0.022;0.022	T	0.31586	-0.9938	10	0.49607	T	0.09	-9.2523	10.6054	0.45392	0.0:0.0:0.689:0.311	.	192;248;182;165	B4DJG4;Q6P2M8-5;B4E1A6;Q6P2M8	.;.;.;KCC1B_HUMAN	G	165;165;165;165;182;248;165;165	ENSP00000340586:A165G;ENSP00000359169:A165G;ENSP00000377417:A165G;ENSP00000359161:A165G;ENSP00000359164:A182G;ENSP00000405950:A248G;ENSP00000415770:A165G;ENSP00000391772:A165G	ENSP00000340586:A165G	A	-	2	0	PNCK	152590242	0.291000	0.24352	0.998000	0.56505	0.864000	0.49448	3.237000	0.51344	2.005000	0.58758	0.529000	0.55759	GCT	.	.	.	none		0.602	PNCK-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000061044.2	NM_198452	
MT-ND4	4538	hgsc.bcm.edu	37	M	11411	11411	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chrM:11411A>G	ENST00000361381.2	+	1	652	c.652A>G	c.(652-654)Aaa>Gaa	p.K218E	MT-TR_ENST00000387439.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TH_ENST00000387441.1_RNA			P03905	NU4M_HUMAN	mitochondrially encoded NADH dehydrogenase 4	218					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|prostate(1)	13						TATGACTCCCTAAAGCCCATG	0.428																																					p.K218E		Atlas-SNP	.											.	.	.	.	0			c.A652G						PASS	.																																			SO:0001583	missense	0	exon1			CTCCCTAAAGCCC			mitochondria	2014-02-03	2005-02-15	2005-02-16	ENSG00000198886	ENSG00000198886	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7459	protein-coding gene	gene with protein product	"""complex I ND4 subunit"", ""NADH-ubiquinone oxidoreductase chain 4"""	516003	"""NADH dehydrogenase 4"", ""Leber optic neuropathy"""	MTND4, LHON		8103501	Standard			Approved	ND4, NAD4		P03905		ENST00000361381.2:c.652A>G	chrM.hg19:g.11411A>G	ENSP00000354961:p.Lys218Glu	11.0	0.0	.		11.0	8.0	.	ENST00000361381	Q6RL39|Q6RQN9|Q8HNR8	Missense_Mutation	SNP	ENST00000361381.2	hg19																																																																																				.	.	.	none		0.428	MT-ND4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024035	
MT-ND5	4540	hgsc.bcm.edu	37	M	13844	13844	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chrM:13844A>G	ENST00000361567.2	+	1	1508	c.1508A>G	c.(1507-1509)gAc>gGc	p.D503G	MT-TP_ENST00000387461.2_RNA|MT-TE_ENST00000387459.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TT_ENST00000387460.2_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TH_ENST00000387441.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	503			D -> G. {ECO:0000269|PubMed:1757091}.		cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						AACAGCCCTAGACCTCAACTA	0.453																																					p.D503G		Atlas-SNP	.											.	.	.	.	0			c.A1508G						PASS	.																																			SO:0001583	missense	0	exon1			CCCTAGACCTCAA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.1508A>G	chrM.hg19:g.13844A>G	ENSP00000354813:p.Asp503Gly	11.0	0.0	.		13.0	9.0	.	ENST00000361567	Q34773|Q8WCY3	Missense_Mutation	SNP	ENST00000361567.2	hg19																																																																																				.	.	.	alt		0.453	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
MCF2L	23263	hgsc.bcm.edu	37	13	113719317	113719318	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr13:113719317_113719318insG	ENST00000375608.3	+	8	822_823	c.764_765insG	c.(763-768)ctggctfs	p.A256fs	MCF2L_ENST00000421756.1_Frame_Shift_Ins_p.A230fs|MCF2L_ENST00000423482.2_Frame_Shift_Ins_p.A224fs|MCF2L_ENST00000375604.2_Frame_Shift_Ins_p.A283fs|MCF2L_ENST00000397030.1_Frame_Shift_Ins_p.A259fs|MCF2L_ENST00000434480.2_Frame_Shift_Ins_p.A232fs|MCF2L_ENST00000535094.2_Frame_Shift_Ins_p.A226fs|MCF2L_ENST00000442652.2_Frame_Shift_Ins_p.A256fs|MCF2L_ENST00000375597.4_Frame_Shift_Ins_p.A224fs|MCF2L_ENST00000375601.3_Frame_Shift_Ins_p.A230fs			O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming sequence-like	256					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular space (GO:0005615)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			kidney(1)|large_intestine(5)|ovary(1)|stomach(1)	8	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				GGGACCGAGCTGGCTGAAACAG	0.564																																					p.L225fs		Atlas-Indel,Pindel	.											.	MCF2L	182	.	0			c.674_675insG						PASS	.																																			SO:0001589	frameshift_variant	23263	exon7			.	AB002360	CCDS9527.2, CCDS45070.1, CCDS9527.3, CCDS45070.2	13q34	2013-01-10			ENSG00000126217	ENSG00000126217		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14576	protein-coding gene	gene with protein product		609499				9205841	Standard	NM_001112732		Approved	KIAA0362, DBS, OST, ARHGEF14	uc010tjr.2	O15068	OTTHUMG00000017377	ENST00000375608.3:c.766dupG	chr13.hg19:g.113719319_113719319dupG	ENSP00000364758:p.Ala256fs	106.0	0.0	0		76.0	16.0	0.210526	NM_001112732	A2A2X1|A2A2X2|A2A3G6|A2A3G8|B4DHD6|B4DIL6|E9PDN8|Q5JU56|Q5VXT1|Q6ZWD4|Q765G8|Q765G9|Q8N679	Frame_Shift_Ins	INS	ENST00000375608.3	hg19																																																																																				.	.	.	none		0.564	MCF2L-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045849.4		
C12orf40	283461	hgsc.bcm.edu	37	12	40076521	40076521	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr12:40076521delA	ENST00000324616.5	+	8	949	c.795delA	c.(793-795)tcafs	p.S265fs	C12orf40_ENST00000398716.1_Frame_Shift_Del_p.S188fs|C12orf40_ENST00000405531.3_Frame_Shift_Del_p.S265fs	NM_001031748.2	NP_001026918.2	Q86WS4	CL040_HUMAN	chromosome 12 open reading frame 40	265										breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(6)|prostate(1)|skin(2)	38						AAAAACACTCAATACAGCATA	0.353																																					p.S265X		Atlas-Indel,Pindel	.											.	C12orf40	118	.	0			c.794delC						PASS	.						133.0	134.0	134.0					12																	40076521		1841	4086	5927	SO:0001589	frameshift_variant	283461	exon8			.	AK097445	CCDS41770.1	12q12	2008-08-04			ENSG00000180116	ENSG00000180116			26846	protein-coding gene	gene with protein product						12477932	Standard	XM_005268806		Approved	FLJ40126	uc001rmc.3	Q86WS4	OTTHUMG00000133567	ENST00000324616.5:c.795delA	chr12.hg19:g.40076521delA	ENSP00000317671:p.Ser265fs	120.0	0.0	0		154.0	36.0	0.233766	NM_001031748	B7WNU1|Q8IXY6|Q8N818|V9HW02	Frame_Shift_Del	DEL	ENST00000324616.5	hg19	CCDS41770.1																																																																																			.	.	.	none		0.353	C12orf40-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257664.2	NM_173599	
REV1	51455	hgsc.bcm.edu	37	2	100019396	100019397	+	Frame_Shift_Ins	INS	-	-	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr2:100019396_100019397insA	ENST00000258428.3	-	20	3567_3568	c.3339_3340insT	c.(3337-3342)attgatfs	p.D1114fs	REV1_ENST00000393445.3_Frame_Shift_Ins_p.D1113fs|REV1_ENST00000465835.1_5'Flank|RP11-527J8.1_ENST00000608144.1_RNA	NM_001037872.1|NM_016316.2	NP_001032961.1|NP_057400.1	Q9UBZ9	REV1_HUMAN	REV1, polymerase (DNA directed)	1114					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|error-prone translesion synthesis (GO:0042276)|response to UV (GO:0009411)	nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|deoxycytidyl transferase activity (GO:0017125)|DNA-directed DNA polymerase activity (GO:0003887)|magnesium ion binding (GO:0000287)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(12)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						AGAAACCCATCAATTAACTTCT	0.421								Direct reversal of damage																													p.D1114_G1115delinsX		Atlas-Indel,Pindel	.											.	REV1	100	.	0			c.3340_3341insT						PASS	.																																			SO:0001589	frameshift_variant	51455	exon20			.	AF206019	CCDS2045.1, CCDS42722.1	2q11.1-q11.2	2012-05-18	2012-05-18	2006-11-07	ENSG00000135945	ENSG00000135945		"""DNA polymerases"""	14060	protein-coding gene	gene with protein product		606134	"""REV1 (yeast homolog)- like"", ""REV1-like (yeast)"", ""REV1 homolog (S. cerevisiae)"""	REV1L		10536157	Standard	XM_005263968		Approved		uc002tad.3	Q9UBZ9	OTTHUMG00000130636	ENST00000258428.3:c.3340dupT	chr2.hg19:g.100019398_100019398dupA	ENSP00000258428:p.Asp1114fs	124.0	0.0	0		98.0	27.0	0.27551	NM_016316	O95941|Q53SI7|Q9C0J4|Q9NUP2	Frame_Shift_Ins	INS	ENST00000258428.3	hg19	CCDS2045.1																																																																																			.	.	.	none		0.421	REV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253123.2	NM_016316	
PRDX6	9588	hgsc.bcm.edu	37	1	173454533	173454534	+	Frame_Shift_Ins	INS	-	-	AAAAAAA			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr1:173454533_173454534insAAAAAAA	ENST00000340385.5	+	3	418_419	c.286_287insAAAAAAA	c.(286-288)gaafs	p.-96fs	PRDX6_ENST00000470017.1_3'UTR	NM_004905.2	NP_004896.1	P30041	PRDX6_HUMAN	peroxiredoxin 6						hydrogen peroxide catabolic process (GO:0042744)|phospholipid catabolic process (GO:0009395)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|membrane (GO:0016020)	antioxidant activity (GO:0016209)|glutathione peroxidase activity (GO:0004602)|peroxiredoxin activity (GO:0051920)|phospholipase A2 activity (GO:0004623)	p.E96*(1)		NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|urinary_tract(1)	12						AGAGCCCACAGAAAAGTTACCT	0.441																																					p.E96fs		Atlas-Indel,Pindel	.											PRDX6,bladder,carcinoma,0,2	PRDX6	20	.	1	Substitution - Nonsense(1)	urinary_tract(1)	c.286_287insAAAAAAA						PASS	.																																			SO:0001589	frameshift_variant	9588	exon3			.	D14662	CCDS1307.1	1q24.1	2008-02-05			ENSG00000117592	ENSG00000117592			16753	protein-coding gene	gene with protein product		602316				11233154	Standard	NM_004905		Approved	AOP2, KIAA0106, 1-Cys, NSGPx, PRX, aiPLA2, MGC46173, p29	uc001giy.1	P30041	OTTHUMG00000034804	Exception_encountered	chr1.hg19:g.173454533_173454534insAAAAAAA	ENSP00000342026:p.Glu96fs	152.0	0.0	0		134.0	10.0	0.0746269	NM_004905	A8JZY7|P32077|Q5TAH4|Q5ZEZ8	Frame_Shift_Ins	INS	ENST00000340385.5	hg19	CCDS1307.1																																																																																			.	.	.	none		0.441	PRDX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084222.1	NM_004905	
SETD2	29072	hgsc.bcm.edu	37	3	47165390	47165391	+	Frame_Shift_Ins	INS	-	-	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr3:47165390_47165391insA	ENST00000409792.3	-	3	777_778	c.735_736insT	c.(733-738)attgtafs	p.V246fs		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	246	Pro-rich.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		GATTCTGGTACAATTATAATTG	0.381			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.V246fs		Atlas-Indel,Pindel	.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2	721	.	0			c.736_737insT						PASS	.																																			SO:0001589	frameshift_variant	29072	exon3			.	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.736dupT	chr3.hg19:g.47165392_47165392dupA	ENSP00000386759:p.Val246fs	72.0	0.0	0		52.0	30.0	0.576923	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Frame_Shift_Ins	INS	ENST00000409792.3	hg19	CCDS2749.2																																																																																			.	.	.	none		0.381	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
SLC24A2	25769	hgsc.bcm.edu	37	9	19516367	19516367	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr9:19516367delA	ENST00000341998.2	-	10	1831	c.1770delT	c.(1768-1770)attfs	p.I590fs	SLC24A2_ENST00000286344.3_Frame_Shift_Del_p.I573fs	NM_001193288.2|NM_020344.3	NP_001180217.1|NP_065077.1	Q9UI40	NCKX2_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 2	590					cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	cadmium ion binding (GO:0046870)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium, potassium:sodium antiporter activity (GO:0008273)|manganese ion binding (GO:0030145)|nickel cation binding (GO:0016151)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|symporter activity (GO:0015293)			endometrium(3)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33				GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)		GGAATCTGTGAATGACGGTGT	0.547																																					p.H591fs		Atlas-Indel,Pindel	.											.	SLC24A2	93	.	0			c.1771delC						PASS	.						47.0	44.0	45.0					9																	19516367		2203	4300	6503	SO:0001589	frameshift_variant	25769	exon10			.	AF097366	CCDS6493.1, CCDS55297.1	9p22.1	2013-05-22			ENSG00000155886	ENSG00000155886		"""Solute carriers"""	10976	protein-coding gene	gene with protein product		609838				10662833	Standard	NM_020344		Approved	NCKX2	uc003zoa.2	Q9UI40	OTTHUMG00000019646	ENST00000341998.2:c.1770delT	chr9.hg19:g.19516367delA	ENSP00000344801:p.Ile590fs	97.0	0.0	0		86.0	29.0	0.337209	NM_020344	B7ZLL8|Q9NTN5|Q9NZQ4	Frame_Shift_Del	DEL	ENST00000341998.2	hg19	CCDS6493.1																																																																																			.	.	.	none		0.547	SLC24A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051866.2	NM_020344	
SLC20A2	6575	hgsc.bcm.edu	37	8	42302170	42302170	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr8:42302170delT	ENST00000342228.3	-	6	1093	c.724delA	c.(724-726)atafs	p.I242fs	SLC20A2_ENST00000520262.1_Frame_Shift_Del_p.I242fs|SLC20A2_ENST00000520179.1_Frame_Shift_Del_p.I242fs	NM_006749.4	NP_006740.1	Q08357	S20A2_HUMAN	solute carrier family 20 (phosphate transporter), member 2	242					ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic phosphate transmembrane transporter activity (GO:0005315)|receptor activity (GO:0004872)|sodium:phosphate symporter activity (GO:0005436)|virus receptor activity (GO:0001618)			breast(1)|endometrium(6)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|stomach(1)	26	all_lung(13;8.33e-12)|Lung NSC(13;1.41e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;5.73e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00419)|Lung(22;0.0302)|LUSC - Lung squamous cell carcinoma(45;0.0869)			ATACCTGTTATTTTCCTCCGC	0.463																																					p.I242fs		Atlas-Indel,Pindel	.											.	SLC20A2	64	.	0			c.725delT						PASS	.						137.0	120.0	126.0					8																	42302170		2203	4300	6503	SO:0001589	frameshift_variant	6575	exon6			.		CCDS6132.1	8p11.21	2013-05-22			ENSG00000168575	ENSG00000168575		"""Solute carriers"""	10947	protein-coding gene	gene with protein product		158378		MLVAR, GLVR2		7745689, 16790504	Standard	NM_001257180		Approved	PiT-2, Glvr-2	uc010lxm.4	Q08357	OTTHUMG00000164169	ENST00000342228.3:c.724delA	chr8.hg19:g.42302170delT	ENSP00000340465:p.Ile242fs	124.0	0.0	0		126.0	42.0	0.333333	NM_001257180		Frame_Shift_Del	DEL	ENST00000342228.3	hg19	CCDS6132.1																																																																																			.	.	.	none		0.463	SLC20A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377578.1		
MTMR14	64419	hgsc.bcm.edu	37	3	9724897	9724898	+	Frame_Shift_Ins	INS	-	-	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr3:9724897_9724898insA	ENST00000296003.4	+	10	1055_1056	c.933_934insA	c.(934-936)aagfs	p.K312fs	MTMR14_ENST00000351233.5_Frame_Shift_Ins_p.K312fs|MTMR14_ENST00000420925.1_Frame_Shift_Ins_p.K66fs|MTMR14_ENST00000353332.5_Frame_Shift_Ins_p.K312fs	NM_001077525.2	NP_001070993.1	Q8NCE2	MTMRE_HUMAN	myotubularin related protein 14	312					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(2)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	21	Medulloblastoma(99;0.227)					AAAACTACCTGAAGCTGCTGCT	0.431																																					p.L311fs		Atlas-INDEL	.											.	MTMR14	43	.	0			c.933_934insA						PASS	.																																			SO:0001589	frameshift_variant	64419	exon10			.	BC001674	CCDS43043.1, CCDS43044.1, CCDS43045.1	3p26	2011-06-09	2006-12-18	2006-12-18	ENSG00000163719	ENSG00000163719		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	26190	protein-coding gene	gene with protein product	"""egg-derived tyrosine phosphatase homolog (Drosophila)"""	611089	"""chromosome 3 open reading frame 29"""	C3orf29		15186772	Standard	NM_022485		Approved	FLJ22405, FLJ90311, hJumpy, hEDTP	uc003brz.3	Q8NCE2	OTTHUMG00000155111	ENST00000296003.4:c.935dupA	chr3.hg19:g.9724899_9724899dupA	ENSP00000296003:p.Lys312fs	291.0	0.0	0		143.0	67.0	0.468531	NM_001077525	Q0JTH5|Q0JU83|Q6PIZ4|Q6QE21|Q86VK9|Q8IYK1|Q8TCM7|Q9H6C0	Frame_Shift_Ins	INS	ENST00000296003.4	hg19	CCDS43043.1																																																																																			.	.	.	none		0.431	MTMR14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338435.1	NM_022485	
PARP1	142	hgsc.bcm.edu	37	1	226555997	226555999	+	In_Frame_Del	DEL	GAG	GAG	-	rs369734863		TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	GAG	GAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr1:226555997_226555999delGAG	ENST00000366794.5	-	16	2321_2323	c.2178_2180delCTC	c.(2176-2181)gactct>gat	p.S727del	PARP1_ENST00000490921.1_5'UTR	NM_001618.3	NP_001609.2	P09874	PARP1_HUMAN	poly (ADP-ribose) polymerase 1	727	PARP alpha-helical. {ECO:0000255|PROSITE- ProRule:PRU00398}.				base-excision repair (GO:0006284)|cellular response to insulin stimulus (GO:0032869)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|gene expression (GO:0010467)|macrophage differentiation (GO:0030225)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein ADP-ribosylation (GO:0006471)|protein autoprocessing (GO:0016540)|protein poly-ADP-ribosylation (GO:0070212)|regulation of growth rate (GO:0040009)|signal transduction involved in regulation of gene expression (GO:0023019)|telomere maintenance (GO:0000723)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NAD binding (GO:0051287)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(4)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	44	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)		CAGGATCTGAGAGTCGCTGCTGC	0.562								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA																													p.727_727del		Atlas-Indel,Pindel	.											.	PARP1	100	.	0			c.2179_2181del						PASS	.																																			SO:0001651	inframe_deletion	142	exon16			.	BC037545	CCDS1554.1	1q41-q42	2010-02-16	2008-07-28	2004-08-26	ENSG00000143799	ENSG00000143799	2.4.2.30	"""Poly (ADP-ribose) polymerases"""	270	protein-coding gene	gene with protein product		173870	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)"", ""poly (ADP-ribose) polymerase family, member 1"""	PPOL, ADPRT		10964595	Standard	NM_001618		Approved	PARP	uc001hqd.4	P09874	OTTHUMG00000037556	ENST00000366794.5:c.2178_2180delCTC	chr1.hg19:g.226555997_226555999delGAG	ENSP00000355759:p.Ser727del	76.0	0.0	0		66.0	17.0	0.257576	NM_001618	B1ANJ4|Q8IUZ9	In_Frame_Del	DEL	ENST00000366794.5	hg19	CCDS1554.1																																																																																			.	.	.	none		0.562	PARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091519.1	NM_001618	
MTMR14	64419	hgsc.bcm.edu	37	3	9724894	9724896	+	In_Frame_Del	DEL	CCT	CCT	-			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	CCT	CCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr3:9724894_9724896delCCT	ENST00000296003.4	+	10	1052_1054	c.930_932delCCT	c.(928-933)tacctg>tag	p.310_311YL>*	MTMR14_ENST00000351233.5_In_Frame_Del_p.310_311YL>*|MTMR14_ENST00000420925.1_In_Frame_Del_p.64_65YL>*|MTMR14_ENST00000353332.5_In_Frame_Del_p.310_311YL>*	NM_001077525.2	NP_001070993.1	Q8NCE2	MTMRE_HUMAN	myotubularin related protein 14	310					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(2)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	21	Medulloblastoma(99;0.227)					CACAAAACTACCTGAAGCTGCTG	0.429																																					p.310_311del		Atlas-INDEL	.											.	MTMR14	43	.	0			c.929_931del						PASS	.																																			SO:0001651	inframe_deletion	64419	exon10			.	BC001674	CCDS43043.1, CCDS43044.1, CCDS43045.1	3p26	2011-06-09	2006-12-18	2006-12-18	ENSG00000163719	ENSG00000163719		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	26190	protein-coding gene	gene with protein product	"""egg-derived tyrosine phosphatase homolog (Drosophila)"""	611089	"""chromosome 3 open reading frame 29"""	C3orf29		15186772	Standard	NM_022485		Approved	FLJ22405, FLJ90311, hJumpy, hEDTP	uc003brz.3	Q8NCE2	OTTHUMG00000155111	ENST00000296003.4:c.930_932delCCT	chr3.hg19:g.9724894_9724896delCCT	ENSP00000296003:p.Tyr310_Leu311delins*	289.0	0.0	0		141.0	71.0	0.503546	NM_001077525	Q0JTH5|Q0JU83|Q6PIZ4|Q6QE21|Q86VK9|Q8IYK1|Q8TCM7|Q9H6C0	In_Frame_Del	DEL	ENST00000296003.4	hg19	CCDS43043.1																																																																																			.	.	.	none		0.429	MTMR14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338435.1	NM_022485	
ALS2	57679	hgsc.bcm.edu	37	2	202572613	202572623	+	Frame_Shift_Del	DEL	CGGGAATCTGA	CGGGAATCTGA	-	rs374047961		TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	CGGGAATCTGA	CGGGAATCTGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr2:202572613_202572623delCGGGAATCTGA	ENST00000264276.6	-	28	4744_4754	c.4372_4382delTCAGATTCCCG	c.(4372-4383)tcagattcccgafs	p.SDSR1458fs	ALS2_ENST00000457679.2_3'UTR	NM_020919.3	NP_065970.2	Q96Q42	ALS2_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	1458					behavioral fear response (GO:0001662)|cell death (GO:0008219)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|locomotory behavior (GO:0007626)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Rab GTPase activity (GO:0032851)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of Ran GTPase activity (GO:0032853)|protein localization (GO:0008104)|receptor recycling (GO:0001881)|regulation of endosome size (GO:0051036)|response to oxidative stress (GO:0006979)|synaptic transmission, glutamatergic (GO:0035249)|vesicle organization (GO:0016050)	centrosome (GO:0005813)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome (GO:0005769)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|ruffle (GO:0001726)|vesicle (GO:0031982)	protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)	p.R1461Q(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(22)|ovary(1)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	72						TGATTCAGATCGGGAATCTGACTTCCCAGTG	0.488																																					p.1458_1461del		Atlas-INDEL	.											.	ALS2	172	.	1	Substitution - Missense(1)	endometrium(1)	c.4373_4383del						PASS	.																																			SO:0001589	frameshift_variant	57679	exon28			.	AB053305	CCDS42800.1, CCDS46492.1	2q33-q35	2014-09-17	2004-06-23		ENSG00000003393	ENSG00000003393		"""Rho guanine nucleotide exchange factors"""	443	protein-coding gene	gene with protein product	"""alsin"""	606352	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 6"""	ALS2CR6		11586298	Standard	NM_020919		Approved		uc002uyo.3	Q96Q42	OTTHUMG00000154507	ENST00000264276.6:c.4372_4382delTCAGATTCCCG	chr2.hg19:g.202572613_202572623delCGGGAATCTGA	ENSP00000264276:p.Ser1458fs	329.0	0.0	0		251.0	22.0	0.0876494	NM_020919	Q53TT1|Q53TV2|Q8N1E0|Q96PC4|Q96Q41|Q9H973|Q9HCK9	Frame_Shift_Del	DEL	ENST00000264276.6	hg19	CCDS42800.1																																																																																			.	.	.	none		0.488	ALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335562.3	NM_020919	
ALS2	57679	hgsc.bcm.edu	37	2	202572610	202572610	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr2:202572610delG	ENST00000264276.6	-	28	4757	c.4385delC	c.(4384-4386)tctfs	p.S1462fs	ALS2_ENST00000457679.2_3'UTR	NM_020919.3	NP_065970.2	Q96Q42	ALS2_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	1462					behavioral fear response (GO:0001662)|cell death (GO:0008219)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|locomotory behavior (GO:0007626)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Rab GTPase activity (GO:0032851)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of Ran GTPase activity (GO:0032853)|protein localization (GO:0008104)|receptor recycling (GO:0001881)|regulation of endosome size (GO:0051036)|response to oxidative stress (GO:0006979)|synaptic transmission, glutamatergic (GO:0035249)|vesicle organization (GO:0016050)	centrosome (GO:0005813)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome (GO:0005769)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|ruffle (GO:0001726)|vesicle (GO:0031982)	protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(22)|ovary(1)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	72						TGGTGATTCAGATCGGGAATC	0.488																																					p.S1462fs		Atlas-INDEL	.											.	ALS2	172	.	0			c.4386delT						PASS	.						75.0	72.0	73.0					2																	202572610		1869	4110	5979	SO:0001589	frameshift_variant	57679	exon28			.	AB053305	CCDS42800.1, CCDS46492.1	2q33-q35	2014-09-17	2004-06-23		ENSG00000003393	ENSG00000003393		"""Rho guanine nucleotide exchange factors"""	443	protein-coding gene	gene with protein product	"""alsin"""	606352	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 6"""	ALS2CR6		11586298	Standard	NM_020919		Approved		uc002uyo.3	Q96Q42	OTTHUMG00000154507	ENST00000264276.6:c.4385delC	chr2.hg19:g.202572610delG	ENSP00000264276:p.Ser1462fs	328.0	0.0	0		256.0	24.0	0.09375	NM_020919	Q53TT1|Q53TV2|Q8N1E0|Q96PC4|Q96Q41|Q9H973|Q9HCK9	Frame_Shift_Del	DEL	ENST00000264276.6	hg19	CCDS42800.1																																																																																			.	.	.	none		0.488	ALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335562.3	NM_020919	
DLD	1738	hgsc.bcm.edu	37	7	107556127	107556127	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr7:107556127delA	ENST00000205402.5	+	9	1142	c.861delA	c.(859-861)ggafs	p.G287fs	DLD_ENST00000537148.1_Frame_Shift_Del_p.G188fs|DLD_ENST00000440410.1_Frame_Shift_Del_p.G264fs|DLD_ENST00000437604.2_Frame_Shift_Del_p.G239fs	NM_000108.3	NP_000099.2	P09622	DLDH_HUMAN	dihydrolipoamide dehydrogenase	287					branched-chain amino acid catabolic process (GO:0009083)|cell redox homeostasis (GO:0045454)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|gastrulation (GO:0007369)|lysine catabolic process (GO:0006554)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|proteolysis (GO:0006508)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of membrane potential (GO:0042391)|small molecule metabolic process (GO:0044281)|sperm capacitation (GO:0048240)|tricarboxylic acid cycle (GO:0006099)	acrosomal matrix (GO:0043159)|cilium (GO:0005929)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dihydrolipoyl dehydrogenase activity (GO:0004148)|flavin adenine dinucleotide binding (GO:0050660)			NS(1)|breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(1)|lung(10)|prostate(1)	20					Flavin adenine dinucleotide(DB03147)	AGTCAGATGGAAAAATTGATG	0.308																																					p.G287fs		Atlas-INDEL	.											.	DLD	72	.	0			c.860delG						PASS	.						52.0	54.0	54.0					7																	107556127		2203	4300	6503	SO:0001589	frameshift_variant	1738	exon9			.	AB209703	CCDS5749.1	7q31-q32	2006-05-22	2006-05-22		ENSG00000091140	ENSG00000091140	1.8.1.4		2898	protein-coding gene	gene with protein product	"""E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex"""	238331	"""dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex)"""	LAD, GCSL			Standard	NM_000108		Approved	DLDH	uc003vet.3	P09622	OTTHUMG00000154813	ENST00000205402.5:c.861delA	chr7.hg19:g.107556127delA	ENSP00000205402:p.Gly287fs	127.0	0.0	0		125.0	14.0	0.112	NM_000108	B2R5X0|B4DHG0|B4DT69|Q14131|Q14167|Q59EV8|Q8WTS4	Frame_Shift_Del	DEL	ENST00000205402.5	hg19	CCDS5749.1																																																																																			.	.	.	none		0.308	DLD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337194.3	NM_000108	
CDHR3	222256	hgsc.bcm.edu	37	7	105673047	105673047	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr7:105673047delG	ENST00000317716.9	+	19	2642	c.2562delG	c.(2560-2562)ctgfs	p.L854fs	CDHR3_ENST00000478080.1_Frame_Shift_Del_p.L766fs|CDHR3_ENST00000343407.5_3'UTR|CDHR3_ENST00000542731.1_Frame_Shift_Del_p.L854fs	NM_152750.4	NP_689963.2	Q6ZTQ4	CDHR3_HUMAN	cadherin-related family member 3	854					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(1)	23						ATGCTGGTCTGGGTTCCAGAA	0.552																																					p.L854fs		Atlas-Indel,Pindel	.											.	CDHR3	153	.	0			c.2561delT						PASS	.						68.0	76.0	73.0					7																	105673047		2097	4220	6317	SO:0001589	frameshift_variant	222256	exon19			.	AK126338	CCDS47684.1, CCDS75651.1	7q22.2	2011-07-01			ENSG00000128536	ENSG00000128536		"""Cadherins / Cadherin-related"""	26308	protein-coding gene	gene with protein product		615610					Standard	NM_152750		Approved	FLJ44366, FLJ23834, CDH28	uc003vdl.4	Q6ZTQ4	OTTHUMG00000157520	ENST00000317716.9:c.2562delG	chr7.hg19:g.105673047delG	ENSP00000325954:p.Leu854fs	175.0	0.0	0		170.0	37.0	0.217647	NM_152750	Q8TCI7	Frame_Shift_Del	DEL	ENST00000317716.9	hg19	CCDS47684.1																																																																																			.	.	.	none		0.552	CDHR3-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349025.2	NM_152750	
PLCZ1	89869	hgsc.bcm.edu	37	12	18876363	18876364	+	Frame_Shift_Ins	INS	-	-	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr12:18876363_18876364insT	ENST00000266505.7	-	4	511_512	c.248_249insA	c.(247-249)aacfs	p.N83fs	PLCZ1_ENST00000447925.2_Frame_Shift_Ins_p.N81fs|RP11-361I14.2_ENST00000536931.1_RNA|PLCZ1_ENST00000539875.1_Intron|PLCZ1_ENST00000435379.1_Intron					phospholipase C, zeta 1											NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	31	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)					GAATTTTCCGGTTTTCAGAATA	0.332																																					p.N83fs		Pindel	.											.	PLCZ1	107	.	0			c.249_250insA						PASS	.																																			SO:0001589	frameshift_variant	89869	exon4			.	AY035866	CCDS8680.1	12p13.31	2013-01-10			ENSG00000139151	ENSG00000139151	3.1.4.11	"""EF-hand domain containing"""	19218	protein-coding gene	gene with protein product		608075				12117804	Standard	NM_033123		Approved	NYD-SP27, PLCzeta	uc021qvx.2	Q86YW0	OTTHUMG00000168937	ENST00000266505.7:c.249dupA	chr12.hg19:g.18876367_18876367dupT	ENSP00000266505:p.Asn83fs	108.0	0.0	.		171.0	46.0	0.269	NM_033123		Frame_Shift_Ins	INS	ENST00000266505.7	hg19	CCDS8680.1																																																																																			.	.	.	none		0.332	PLCZ1-001	KNOWN	NAGNAG_splice_site|non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000401667.3	NM_033123	
MTMR14	64419	hgsc.bcm.edu	37	3	9724894	9724897	+	Frame_Shift_Del	DEL	CCTG	CCTG	-			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	CCTG	CCTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr3:9724894_9724897delCCTG	ENST00000296003.4	+	10	1052_1055	c.930_933delCCTG	c.(928-933)tacctgfs	p.YL310fs	MTMR14_ENST00000351233.5_Frame_Shift_Del_p.YL310fs|MTMR14_ENST00000420925.1_Frame_Shift_Del_p.YL64fs|MTMR14_ENST00000353332.5_Frame_Shift_Del_p.YL310fs	NM_001077525.2	NP_001070993.1	Q8NCE2	MTMRE_HUMAN	myotubularin related protein 14	310					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(2)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	21	Medulloblastoma(99;0.227)					CACAAAACTACCTGAAGCTGCTGC	0.426																																					p.310_311del		Pindel	.											.	MTMR14	43	.	0			c.929_932del						PASS	.																																			SO:0001589	frameshift_variant	64419	exon10			.	BC001674	CCDS43043.1, CCDS43044.1, CCDS43045.1	3p26	2011-06-09	2006-12-18	2006-12-18	ENSG00000163719	ENSG00000163719		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	26190	protein-coding gene	gene with protein product	"""egg-derived tyrosine phosphatase homolog (Drosophila)"""	611089	"""chromosome 3 open reading frame 29"""	C3orf29		15186772	Standard	NM_022485		Approved	FLJ22405, FLJ90311, hJumpy, hEDTP	uc003brz.3	Q8NCE2	OTTHUMG00000155111	ENST00000296003.4:c.930_933delCCTG	chr3.hg19:g.9724894_9724897delCCTG	ENSP00000296003:p.Tyr310fs	291.0	0.0	.		144.0	54.0	0.375	NM_001077525	Q0JTH5|Q0JU83|Q6PIZ4|Q6QE21|Q86VK9|Q8IYK1|Q8TCM7|Q9H6C0	Frame_Shift_Del	DEL	ENST00000296003.4	hg19	CCDS43043.1																																																																																			.	.	.	none		0.426	MTMR14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338435.1	NM_022485	
AFF4	27125	hgsc.bcm.edu	37	5	132224787	132224791	+	Frame_Shift_Del	DEL	GCTTT	GCTTT	-	rs370588988		TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	GCTTT	GCTTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr5:132224787_132224791delGCTTT	ENST00000265343.5	-	14	3091_3095	c.2712_2716delAAAGC	c.(2710-2718)acaaagcttfs	p.KL905fs		NM_014423.3	NP_055238.1	Q9UHB7	AFF4_HUMAN	AF4/FMR2 family, member 4	905					spermatid development (GO:0007286)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	sequence-specific DNA binding transcription factor activity (GO:0003700)		SEPT8/AFF4(2)	breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(7)|lung(11)|ovary(3)|pancreas(1)|prostate(3)|skin(2)	43		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TCAAAGACAAGCTTTGTTCTCCGAG	0.351																																					p.905_906del	Ovarian(126;889 1733 2942 10745 11605)	Pindel	.											.	AFF4	120	.	0			c.2713_2717del						PASS	.																																			SO:0001589	frameshift_variant	27125	exon14			.	AF197927	CCDS4164.1	5q31	2006-04-28			ENSG00000072364	ENSG00000072364			17869	protein-coding gene	gene with protein product	"""ALL1 fused gene from 5q31"""	604417				10588740	Standard	XM_005271963		Approved	AF5Q31, MCEF	uc003kyd.3	Q9UHB7	OTTHUMG00000059838	ENST00000265343.5:c.2712_2716delAAAGC	chr5.hg19:g.132224787_132224791delGCTTT	ENSP00000265343:p.Lys905fs	429.0	0.0	.		459.0	23.0	0.050	NM_014423	B2RP19|B7WPD2|Q498B2|Q59FB3|Q6P592|Q8TDR1|Q9P0E4	Frame_Shift_Del	DEL	ENST00000265343.5	hg19	CCDS4164.1																																																																																			.	.	.	none		0.351	AFF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133049.1	NM_014423	
ALS2	57679	hgsc.bcm.edu	37	2	202572610	202572623	+	Frame_Shift_Del	DEL	GATCGGGAATCTGA	GATCGGGAATCTGA	-	rs374047961		TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	GATCGGGAATCTGA	GATCGGGAATCTGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr2:202572610_202572623delGATCGGGAATCTGA	ENST00000264276.6	-	28	4744_4757	c.4372_4385delTCAGATTCCCGATC	c.(4372-4386)tcagattcccgatctfs	p.SDSRS1458fs	ALS2_ENST00000457679.2_3'UTR	NM_020919.3	NP_065970.2	Q96Q42	ALS2_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	1458					behavioral fear response (GO:0001662)|cell death (GO:0008219)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|locomotory behavior (GO:0007626)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Rab GTPase activity (GO:0032851)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of Ran GTPase activity (GO:0032853)|protein localization (GO:0008104)|receptor recycling (GO:0001881)|regulation of endosome size (GO:0051036)|response to oxidative stress (GO:0006979)|synaptic transmission, glutamatergic (GO:0035249)|vesicle organization (GO:0016050)	centrosome (GO:0005813)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome (GO:0005769)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|ruffle (GO:0001726)|vesicle (GO:0031982)	protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)	p.R1461Q(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(22)|ovary(1)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	72						TGGTGATTCAGATCGGGAATCTGACTTCCCAGTG	0.486																																					p.1458_1462del		Pindel	.											.	ALS2	172	.	1	Substitution - Missense(1)	endometrium(1)	c.4373_4386del						PASS	.																																			SO:0001589	frameshift_variant	57679	exon28			.	AB053305	CCDS42800.1, CCDS46492.1	2q33-q35	2014-09-17	2004-06-23		ENSG00000003393	ENSG00000003393		"""Rho guanine nucleotide exchange factors"""	443	protein-coding gene	gene with protein product	"""alsin"""	606352	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 6"""	ALS2CR6		11586298	Standard	NM_020919		Approved		uc002uyo.3	Q96Q42	OTTHUMG00000154507	ENST00000264276.6:c.4372_4385delTCAGATTCCCGATC	chr2.hg19:g.202572610_202572623delGATCGGGAATCTGA	ENSP00000264276:p.Ser1458fs	339.0	0.0	.		274.0	32.0	0.117	NM_020919	Q53TT1|Q53TV2|Q8N1E0|Q96PC4|Q96Q41|Q9H973|Q9HCK9	Frame_Shift_Del	DEL	ENST00000264276.6	hg19	CCDS42800.1																																																																																			.	.	.	none		0.486	ALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335562.3	NM_020919	
DLD	1738	hgsc.bcm.edu	37	7	107556131	107556131	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr7:107556131delA	ENST00000205402.5	+	9	1146	c.865delA	c.(865-867)attfs	p.I289fs	DLD_ENST00000537148.1_Frame_Shift_Del_p.I190fs|DLD_ENST00000440410.1_Frame_Shift_Del_p.I266fs|DLD_ENST00000437604.2_Frame_Shift_Del_p.I241fs	NM_000108.3	NP_000099.2	P09622	DLDH_HUMAN	dihydrolipoamide dehydrogenase	289					branched-chain amino acid catabolic process (GO:0009083)|cell redox homeostasis (GO:0045454)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|gastrulation (GO:0007369)|lysine catabolic process (GO:0006554)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|proteolysis (GO:0006508)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of membrane potential (GO:0042391)|small molecule metabolic process (GO:0044281)|sperm capacitation (GO:0048240)|tricarboxylic acid cycle (GO:0006099)	acrosomal matrix (GO:0043159)|cilium (GO:0005929)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dihydrolipoyl dehydrogenase activity (GO:0004148)|flavin adenine dinucleotide binding (GO:0050660)			NS(1)|breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(1)|lung(10)|prostate(1)	20					Flavin adenine dinucleotide(DB03147)	AGATGGAAAAATTGATGTTTC	0.323																																					p.K288fs		Pindel	.											.	DLD	72	.	0			c.864delA						PASS	.						52.0	54.0	53.0					7																	107556131		2203	4300	6503	SO:0001589	frameshift_variant	1738	exon9			.	AB209703	CCDS5749.1	7q31-q32	2006-05-22	2006-05-22		ENSG00000091140	ENSG00000091140	1.8.1.4		2898	protein-coding gene	gene with protein product	"""E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex"""	238331	"""dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex)"""	LAD, GCSL			Standard	NM_000108		Approved	DLDH	uc003vet.3	P09622	OTTHUMG00000154813	ENST00000205402.5:c.865delA	chr7.hg19:g.107556131delA	ENSP00000205402:p.Ile289fs	116.0	0.0	.		122.0	12.0	0.098	NM_000108	B2R5X0|B4DHG0|B4DT69|Q14131|Q14167|Q59EV8|Q8WTS4	Frame_Shift_Del	DEL	ENST00000205402.5	hg19	CCDS5749.1																																																																																			.	.	.	none		0.323	DLD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337194.3	NM_000108	
HOXB4	3214	hgsc.bcm.edu	37	17	46655633	46655634	+	In_Frame_Ins	INS	-	-	CTT			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr17:46655633_46655634insCTT	ENST00000332503.5	-	1	1839_1840	c.48_49insAAG	c.(46-51)aagttc>aagAAGttc	p.16_17insK	HOXB3_ENST00000472863.1_Intron|MIR10A_ENST00000385043.1_RNA|HOXB3_ENST00000489475.1_Intron|HOXB3_ENST00000498678.1_Intron|HOXB3_ENST00000460160.1_Intron|HOXB-AS3_ENST00000465846.2_RNA|HOXB3_ENST00000465120.3_Intron|HOXB3_ENST00000552000.2_Intron|HOXB3_ENST00000476342.1_Intron	NM_024015.4	NP_076920.1	P17483	HXB4_HUMAN	homeobox B4	16	Pro-rich (part of the transcriptional activation domain).				anterior/posterior pattern specification (GO:0009952)|bone marrow development (GO:0048539)|cell proliferation (GO:0008283)|definitive hemopoiesis (GO:0060216)|embryonic skeletal system morphogenesis (GO:0048704)|hematopoietic stem cell differentiation (GO:0060218)|morphogenesis of an epithelial sheet (GO:0002011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of stem cell differentiation (GO:2000738)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|somatic stem cell division (GO:0048103)|spleen development (GO:0048536)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|urinary_tract(2)	9						CATGGAGGGAACTTGGGGTCGA	0.5																																					p.F17delinsKF		Pindel	.											.	HOXB4	16	.	0			c.49_50insAAG						PASS	.																																			SO:0001652	inframe_insertion	3214	exon1			.		CCDS11529.1	17q21.32	2011-06-20	2005-12-22		ENSG00000182742	ENSG00000182742		"""Homeoboxes / ANTP class : HOXL subclass"""	5115	protein-coding gene	gene with protein product		142965	"""homeo box B4"""	HOX2, HOX2F		1973146, 1358459	Standard	NM_024015		Approved		uc002inp.3	P17483	OTTHUMG00000159920	ENST00000332503.5:c.46_48dupAAG	chr17.hg19:g.46655634_46655636dupCTT	ENSP00000328928:p.Lys16_Lys16dup	166.0	0.0	.		188.0	36.0	0.191	NM_024015	Q9NTA0	In_Frame_Ins	INS	ENST00000332503.5	hg19	CCDS11529.1																																																																																			.	.	.	none		0.500	HOXB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358259.2		
