#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ACSBG2	81616	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	6183057	6183057	+	Missense_Mutation	SNP	A	A	C			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr19:6183057A>C	ENST00000586696.1	+	10	1372	c.1096A>C	c.(1096-1098)Aat>Cat	p.N366H	ACSBG2_ENST00000591741.1_3'UTR|ACSBG2_ENST00000252669.5_Missense_Mutation_p.N366H|ACSBG2_ENST00000588304.1_Missense_Mutation_p.N316H|ACSBG2_ENST00000591403.1_Missense_Mutation_p.N366H|ACSBG2_ENST00000588485.1_Missense_Mutation_p.N179H			Q5FVE4	ACBG2_HUMAN	acyl-CoA synthetase bubblegum family member 2	366					cell differentiation (GO:0030154)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid metabolic process (GO:0001676)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acyl-CoA hydrolase activity (GO:0047617)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)	p.N366H(2)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(3)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CAGGAAATATAATACTCCCGT	0.522																																																	2	Substitution - Missense(2)	kidney(2)											79.0	76.0	77.0					19																	6183057		2203	4300	6503	SO:0001583	missense	81616				CCDS12159.1, CCDS74269.1	19p13.3	2012-10-02			ENSG00000130377	ENSG00000130377		"""Acyl-CoA synthetase family"""	24174	protein-coding gene	gene with protein product	"""bubblegum related protein"""	614363				11230166	Standard	XM_005259653		Approved	BGR, PRTD-NY3, DKFZp434K1635	uc002meh.1	Q5FVE4	OTTHUMG00000180754	ENST00000586696.1:c.1096A>C	19.37:g.6183057A>C	ENSP00000465589:p.Asn366His		B3KSF2|Q6UWJ3|Q7Z5A0|Q8WW03|Q96M36|Q9BYZ3|Q9H0C4	Missense_Mutation	SNP	ENST00000586696.1	37	CCDS12159.1	.	.	.	.	.	.	.	.	.	.	A	8.146	0.786328	0.16189	.	.	ENSG00000130377	ENST00000252669	T	0.16597	2.33	5.06	2.9	0.33743	AMP-dependent synthetase/ligase (1);	0.811538	0.10389	N	0.680645	T	0.10035	0.0246	N	0.13299	0.325	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.14023	0.01;0.01	T	0.25572	-1.0128	10	0.45353	T	0.12	-26.2533	6.0339	0.19694	0.1776:0.1533:0.6691:0.0	.	366;366	B4DYU1;Q5FVE4	.;ACBG2_HUMAN	H	366	ENSP00000252669:N366H	ENSP00000252669:N366H	N	+	1	0	ACSBG2	6134057	0.001000	0.12720	0.009000	0.14445	0.002000	0.02628	0.633000	0.24598	1.091000	0.41335	-0.248000	0.11899	AAT		0.522	ACSBG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452898.1		NM_030924	
ADAM29	11086	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	175898846	175898846	+	Nonsense_Mutation	SNP	C	C	T			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr4:175898846C>T	ENST00000359240.3	+	5	2840	c.2170C>T	c.(2170-2172)Cga>Tga	p.R724*	ADAM29_ENST00000445694.1_Nonsense_Mutation_p.R724*|ADAM29_ENST00000514159.1_Nonsense_Mutation_p.R724*|RP13-577H12.2_ENST00000507525.1_RNA|ADAM29_ENST00000404450.4_Nonsense_Mutation_p.R724*	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	724					spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R724*(2)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		AATTCAGCGTCGACCTCATGA	0.438																																					Ovarian(140;1727 1835 21805 25838 41440)												2	Substitution - Nonsense(2)	kidney(2)											88.0	84.0	86.0					4																	175898846		2203	4300	6503	SO:0001587	stop_gained	11086			AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.2170C>T	4.37:g.175898846C>T	ENSP00000352177:p.Arg724*		Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Nonsense_Mutation	SNP	ENST00000359240.3	37	CCDS3823.1	.	.	.	.	.	.	.	.	.	.	C	36	5.881771	0.97062	.	.	ENSG00000168594	ENST00000359240;ENST00000445694;ENST00000404450;ENST00000514159	.	.	.	1.24	-2.48	0.06423	.	.	.	.	.	.	.	.	.	.	.	0.42751	D	0.993773	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.3505	0.00348	0.2708:0.3076:0.2237:0.1979	.	.	.	.	X	724	.	.	R	+	1	2	ADAM29	176135421	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.267000	0.18552	-1.153000	0.02829	-0.294000	0.09567	CGA		0.438	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding				
ALG3	10195	broad.mit.edu	37	3	183961713	183961713	+	Silent	SNP	G	G	T			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr3:183961713G>T	ENST00000397676.3	-	6	828	c.798C>A	c.(796-798)cgC>cgA	p.R266R	ALG3_ENST00000455059.1_Silent_p.R226R|MIR1224_ENST00000408193.1_RNA|ALG3_ENST00000445626.2_Silent_p.R218R|ALG3_ENST00000418734.2_Silent_p.R210R|ALG3_ENST00000463495.1_5'UTR|EIF2B5_ENST00000444495.1_Intron	NM_005787.5	NP_005778.1	Q92685	ALG3_HUMAN	ALG3, alpha-1,3- mannosyltransferase	266					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-1,3-mannosyltransferase activity (GO:0000033)|dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase activity (GO:0052925)	p.R218R(1)|p.R266R(1)		kidney(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(1)	9	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			ACAGAAACTGGCGGCCAAGGT	0.622																																																	2	Substitution - coding silent(2)	kidney(2)											39.0	46.0	44.0					3																	183961713		1990	4154	6144	SO:0001819	synonymous_variant	10195			BC002839	CCDS46967.1, CCDS46968.1	3q27.3	2013-02-26	2013-02-26		ENSG00000214160	ENSG00000214160	2.4.1.258	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	23056	protein-coding gene	gene with protein product	"""carbohydrate deficient glycoprotein syndrome type IV"", ""dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase"", ""dol-P-Man dependent alpha-1,3- mannosyltransferase"""	608750	"""asparagine-linked glycosylation 3 homolog (yeast, alpha-1,3-mannosyltransferase)"", ""asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae)"""			1058125	Standard	NM_005787		Approved	NOT56L, Not56, CDGS4, D16Ertd36e	uc003fne.2	Q92685	OTTHUMG00000156823	ENST00000397676.3:c.798C>A	3.37:g.183961713G>T			A8JZZ6|Q9BT71	Silent	SNP	ENST00000397676.3	37	CCDS46968.1	.	.	.	.	.	.	.	.	.	.	G	10.22	1.289780	0.23478	.	.	ENSG00000214160	ENST00000446569	.	.	.	5.58	2.52	0.30459	.	.	.	.	.	T	0.55940	0.1952	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49184	-0.8966	4	.	.	.	-13.0521	7.8726	0.29576	0.2316:0.1925:0.576:0.0	.	.	.	.	T	170	.	.	P	-	1	0	ALG3	185444407	0.998000	0.40836	1.000000	0.80357	0.996000	0.88848	0.436000	0.21526	0.678000	0.31325	0.555000	0.69702	CCA		0.622	ALG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346033.1		NM_005787	
ARX	170302	broad.mit.edu	37	X	25022841	25022841	+	Missense_Mutation	SNP	C	C	A			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chrX:25022841C>A	ENST00000379044.4	-	5	1845	c.1635G>T	c.(1633-1635)caG>caT	p.Q545H		NM_139058.2	NP_620689.1	Q96QS3	ARX_HUMAN	aristaless related homeobox	545					axon guidance (GO:0007411)|cell proliferation in forebrain (GO:0021846)|cerebral cortex GABAergic interneuron migration (GO:0021853)|cerebral cortex tangential migration (GO:0021800)|embryonic olfactory bulb interneuron precursor migration (GO:0021831)|epithelial cell fate commitment (GO:0072148)|globus pallidus development (GO:0021759)|lipid digestion (GO:0044241)|positive regulation of organ growth (GO:0046622)|regulation of cell proliferation (GO:0042127)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)	p.Q545H(1)		kidney(1)|large_intestine(2)|lung(1)	4						GCTGCGTGAGCTGCGCCGCGT	0.721																																																	1	Substitution - Missense(1)	kidney(1)											6.0	7.0	7.0					X																	25022841		1977	3754	5731	SO:0001583	missense	170302			AY038071	CCDS14215.1	Xp21.3	2011-06-20			ENSG00000004848	ENSG00000004848		"""Homeoboxes / PRD class"""	18060	protein-coding gene	gene with protein product	"""cancer/testis antigen 121"""	300382	"""mental retardation, X-linked 54"", ""mental retardation, X-linked 43"", ""mental retardation, X-linked 36"", ""mental retardation, X-linked 29"", ""mental retardation, X-linked 32"", ""mental retardation, X-linked 33"", ""mental retardation, X-linked 38"", ""mental retardation, X-linked 87"", ""mental retardation, X-linked 76"""	MRXS1, PRTS, MRX76, MRX54, MRX43, MRX36, MRX29, MRX32, MRX33, MRX38, MRX87		11889467, 15850492, 17480217	Standard	NM_139058		Approved	ISSX, CT121, EIEE1	uc004dbp.4	Q96QS3	OTTHUMG00000021275	ENST00000379044.4:c.1635G>T	X.37:g.25022841C>A	ENSP00000368332:p.Gln545His			Missense_Mutation	SNP	ENST00000379044.4	37	CCDS14215.1	.	.	.	.	.	.	.	.	.	.	c	15.92	2.974300	0.53720	.	.	ENSG00000004848	ENST00000379044	D	0.91843	-2.92	4.13	2.26	0.28386	.	0.070363	0.64402	N	0.000020	D	0.88016	0.6324	L	0.56769	1.78	0.45883	D	0.998738	B	0.13145	0.007	B	0.15484	0.013	T	0.82218	-0.0566	10	0.40728	T	0.16	.	7.8786	0.29608	0.1584:0.75:0.0:0.0917	.	545	Q96QS3	ARX_HUMAN	H	545	ENSP00000368332:Q545H	ENSP00000368332:Q545H	Q	-	3	2	ARX	24932762	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	2.612000	0.46343	0.729000	0.32403	0.431000	0.28591	CAG		0.721	ARX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056109.1			
BMPER	168667	hgsc.bcm.edu	37	7	34118719	34118730	+	In_Frame_Del	DEL	GCGCATCGCGCT	GCGCATCGCGCT	-			TCGA-B2-4099-01A-02D-1458-08	TCGA-B2-4099-10A-01D-1458-08	GCGCATCGCGCT	GCGCATCGCGCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01c54f7c-84b9-4f5b-ae44-2ac1f661fd29	54cf60f2-947e-4eb0-b5a7-1e644ca10dba	g.chr7:34118719_34118730delGCGCATCGCGCT	ENST00000297161.2	+	13	1703_1714	c.1329_1340delGCGCATCGCGCT	c.(1327-1341)tcgcgcatcgcgctc>tcc	p.RIAL444del	BMPER_ENST00000426693.1_In_Frame_Del_p.RIAL444del	NM_133468.4	NP_597725.1	Q8N8U9	BMPER_HUMAN	BMP binding endothelial regulator	444	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|endothelial cell activation (GO:0042118)|inner ear development (GO:0048839)|negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of endothelial cell migration (GO:0010594)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|ureteric bud development (GO:0001657)	extracellular space (GO:0005615)		p.A446A(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(24)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						GGAACGGCTCGCGCATCGCGCTCCCCTGCCGC	0.656																																																	1	Substitution - coding silent(1)	lung(1)																																								SO:0001651	inframe_deletion	168667				CCDS5442.1	7p14.3	2009-02-18			ENSG00000164619	ENSG00000164619			24154	protein-coding gene	gene with protein product	"""crossveinless-2"""	608699				12897139, 14766204	Standard	NM_133468		Approved	Cv2, CRIM3	uc011kap.2	Q8N8U9	OTTHUMG00000128675	ENST00000297161.2:c.1329_1340delGCGCATCGCGCT	7.37:g.34118719_34118730delGCGCATCGCGCT	ENSP00000297161:p.Arg444_Leu447del		A8K1P8|Q8TF36	In_Frame_Del	DEL	ENST00000297161.2	37	CCDS5442.1																																																																																				0.656	BMPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250570.2		NM_133468	
C17orf80	55028	hgsc.bcm.edu	37	17	71241322	71241325	+	Intron	DEL	GTAA	GTAA	-	rs150601360|rs202220073	byFrequency	TCGA-B2-4099-01A-02D-1458-08	TCGA-B2-4099-10A-01D-1458-08	GTAA	GTAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01c54f7c-84b9-4f5b-ae44-2ac1f661fd29	54cf60f2-947e-4eb0-b5a7-1e644ca10dba	g.chr17:71241322_71241325delGTAA	ENST00000535032.2	+	5	1842				RP11-661C3.2_ENST00000579037.1_RNA|C17orf80_ENST00000426147.2_Frame_Shift_Del_p.RK582fs|C17orf80_ENST00000359042.2_Intron|C17orf80_ENST00000255557.4_Frame_Shift_Del_p.RK546fs|C17orf80_ENST00000577615.1_Intron|C17orf80_ENST00000582793.1_Intron|C17orf80_ENST00000268942.8_Intron			Q9BSJ5	CQ080_HUMAN	chromosome 17 open reading frame 80							extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(5)|lung(2)|skin(2)|stomach(2)|urinary_tract(2)	14			LUSC - Lung squamous cell carcinoma(166;0.197)			CAGCGGTGGCGTAAGTAGTGTTGA	0.422														21	0.00419329	0.0008	0.0029	5008	,	,		17069	0.0		0.0159	False		,,,				2504	0.002																0									,,	10,3874		0,10,1932					,,	4.8	1.0			80	93,7941		2,89,3926	no	intron,frameshift,intron	C17orf80	NM_017941.4,NM_001100622.1,NM_001100621.1	,,	2,99,5858	A1A1,A1R,RR		1.1576,0.2575,0.8642	,,	,,		103,11815				SO:0001627	intron_variant	55028			AY163812	CCDS11694.1, CCDS42377.1, CCDS45767.1, CCDS74145.1	17q25.1	2012-02-24	2012-02-24	2012-02-24	ENSG00000141219	ENSG00000141219			29601	protein-coding gene	gene with protein product	"""sperm-expressed protein 1"", ""migration-inducing protein 3"""					12477932	Standard	NM_017941		Approved	HLC-8, MIG3, FLJ20721, SPEP1	uc002jjl.4	Q9BSJ5		ENST00000535032.2:c.1730-2055GTAA>-	17.37:g.71241322_71241325delGTAA			A8K9X3|Q5JB45|Q6YAU3|Q9H0L9|Q9H5E6|Q9NWN5	Frame_Shift_Del	DEL	ENST00000535032.2	37	CCDS11694.1																																																																																				0.422	C17orf80-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441893.1		NM_017941	
LSMEM2	132228	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	50324620	50324620	+	Missense_Mutation	SNP	A	A	T			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr3:50324620A>T	ENST00000316436.3	+	4	569	c.482A>T	c.(481-483)cAa>cTa	p.Q161L	IFRD2_ENST00000484043.1_5'Flank	NM_153215.1	NP_694947.1	Q8N112	LSME2_HUMAN	leucine-rich single-pass membrane protein 2	161						integral component of membrane (GO:0016021)		p.Q161L(2)									AGTGAGGCCCAAGCACCCAGC	0.612																																																	2	Substitution - Missense(2)	kidney(2)											53.0	52.0	53.0					3																	50324620		2203	4300	6503	SO:0001583	missense	132228			AK095927	CCDS2814.1	3p21.31	2013-03-08	2013-03-08	2013-03-08	ENSG00000179564	ENSG00000179564			26781	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 45"""	C3orf45			Standard	NM_153215		Approved	FLJ38608	uc003cyz.3	Q8N112	OTTHUMG00000156938	ENST00000316436.3:c.482A>T	3.37:g.50324620A>T	ENSP00000315081:p.Gln161Leu			Missense_Mutation	SNP	ENST00000316436.3	37	CCDS2814.1	.	.	.	.	.	.	.	.	.	.	A	12.62	1.993785	0.35131	.	.	ENSG00000179564	ENST00000316436	.	.	.	4.72	-0.487	0.12060	.	0.692000	0.12587	N	0.455867	T	0.17619	0.0423	N	0.08118	0	0.23089	N	0.998315	B	0.24721	0.11	B	0.22601	0.04	T	0.17961	-1.0352	9	0.62326	D	0.03	1.3983	7.9458	0.29985	0.4904:0.0:0.5096:0.0	.	161	Q8N112	CC045_HUMAN	L	161	.	ENSP00000315081:Q161L	Q	+	2	0	C3orf45	50299624	0.001000	0.12720	0.693000	0.30195	0.679000	0.39708	-0.033000	0.12246	-0.306000	0.08818	-0.379000	0.06801	CAA		0.612	LSMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346671.1		NM_153215	
CDC42	998	broad.mit.edu;hgsc.bcm.edu	37	1	22417987	22417987	+	Missense_Mutation	SNP	A	A	T			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr1:22417987A>T	ENST00000344548.3	+	7	804	c.553A>T	c.(553-555)Agc>Tgc	p.S185C	CDC42_ENST00000421089.2_Missense_Mutation_p.S227C|CDC42_ENST00000400259.1_Missense_Mutation_p.S185C	NM_001039802.1	NP_001034891.1	P60953	CDC42_HUMAN	cell division cycle 42	185					actin cytoskeleton organization (GO:0030036)|actin filament branching (GO:0090135)|actin filament bundle assembly (GO:0051017)|adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway (GO:0060070)|cardiac conduction system development (GO:0003161)|cellular protein localization (GO:0034613)|dendritic cell migration (GO:0036336)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell-cell adhesion (GO:0090136)|epithelial-mesenchymal cell signaling (GO:0060684)|establishment of Golgi localization (GO:0051683)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|establishment or maintenance of cell polarity (GO:0007163)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|filopodium assembly (GO:0046847)|Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|heart contraction (GO:0060047)|innate immune response (GO:0045087)|keratinization (GO:0031424)|keratinocyte development (GO:0003334)|macrophage differentiation (GO:0030225)|multicellular organism growth (GO:0035264)|muscle cell differentiation (GO:0042692)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of gene expression (GO:0010629)|negative regulation of protein complex assembly (GO:0031333)|neuron fate determination (GO:0048664)|nuclear migration (GO:0007097)|nucleus localization (GO:0051647)|organelle transport along microtubule (GO:0072384)|positive regulation of cytokinesis (GO:0032467)|positive regulation of DNA replication (GO:0045740)|positive regulation of gene expression (GO:0010628)|positive regulation of hair follicle cell proliferation (GO:0071338)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of JNK cascade (GO:0046330)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of synapse structural plasticity (GO:0051835)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of filopodium assembly (GO:0051489)|regulation of mitosis (GO:0007088)|regulation of protein catabolic process (GO:0042176)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein kinase activity (GO:0045859)|regulation of protein stability (GO:0031647)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|sprouting angiogenesis (GO:0002040)|submandibular salivary gland formation (GO:0060661)|substantia nigra development (GO:0021762)|T cell costimulation (GO:0031295)	apical part of cell (GO:0045177)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|leading edge membrane (GO:0031256)|membrane (GO:0016020)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|spindle midzone (GO:0051233)	apolipoprotein A-I receptor binding (GO:0034191)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|protein kinase binding (GO:0019901)|thioesterase binding (GO:0031996)	p.S185C(2)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(4)	12		Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;6.55e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)|Prostate(1639;0.0792)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0452)|OV - Ovarian serous cystadenocarcinoma(117;7.32e-26)|Colorectal(126;1.35e-07)|COAD - Colon adenocarcinoma(152;7.73e-06)|GBM - Glioblastoma multiforme(114;8.62e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000649)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00767)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.207)		ACCGAAGAAGAGCCGCAGGTG	0.453																																																	2	Substitution - Missense(2)	kidney(2)											55.0	59.0	57.0					1																	22417987		2203	4300	6503	SO:0001583	missense	998			BC018266	CCDS221.1, CCDS222.1	1p36.1	2013-01-17	2013-01-17		ENSG00000070831	ENSG00000070831			1736	protein-coding gene	gene with protein product	"""GTP binding protein, 25kDa"""	116952	"""cell division cycle 42 (GTP-binding protein, 25kD)"", ""cell division cycle 42 (GTP binding protein, 25kDa)"""			2124704, 2122236	Standard	NM_001039802		Approved	G25K, CDC42Hs	uc001bfr.3	P60953	OTTHUMG00000002753	ENST00000344548.3:c.553A>T	1.37:g.22417987A>T	ENSP00000341072:p.Ser185Cys		P21181|P25763|Q7L8R5|Q9UDI2	Missense_Mutation	SNP	ENST00000344548.3	37	CCDS221.1	.	.	.	.	.	.	.	.	.	.	a	12.95	2.090872	0.36855	.	.	ENSG00000070831	ENST00000400259;ENST00000344548;ENST00000421089	T;T;T	0.68181	-0.31;-0.31;0.12	5.22	5.22	0.72569	.	0.692891	0.16269	N	0.221860	T	0.65688	0.2715	M	0.64676	1.99	0.28121	N	0.930613	B;B;B;B	0.06786	0.001;0.001;0.001;0.0	B;B;B;B	0.10450	0.005;0.004;0.005;0.002	T	0.62909	-0.6754	10	0.72032	D	0.01	.	13.9289	0.63981	1.0:0.0:0.0:0.0	.	227;230;227;185	E7ETU3;B4E1U9;B4DMH5;P60953	.;.;.;CDC42_HUMAN	C	185;185;227	ENSP00000383118:S185C;ENSP00000341072:S185C;ENSP00000398592:S227C	ENSP00000341072:S185C	S	+	1	0	CDC42	22290574	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.852000	0.92215	1.978000	0.57642	0.374000	0.22700	AGC		0.453	CDC42-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000007787.1		NM_001791	
CDH18	1016	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	19520813	19520813	+	Missense_Mutation	SNP	C	C	A			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr5:19520813C>A	ENST00000507958.1	-	12	2455	c.1465G>T	c.(1465-1467)Gcc>Tcc	p.A489S	CDH18_ENST00000382275.1_Missense_Mutation_p.A489S|CDH18_ENST00000274170.4_Missense_Mutation_p.A489S|CDH18_ENST00000511273.1_Missense_Mutation_p.A489S|CDH18_ENST00000502796.1_Missense_Mutation_p.A489S|CDH18_ENST00000506372.1_Missense_Mutation_p.A489S			Q13634	CAD18_HUMAN	cadherin 18, type 2	489	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A489S(4)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					TATTCCCTGGCAAGTTCGGGT	0.393																																																	4	Substitution - Missense(4)	kidney(4)											127.0	128.0	128.0					5																	19520813		2203	4300	6503	SO:0001583	missense	1016			U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.1465G>T	5.37:g.19520813C>A	ENSP00000425093:p.Ala489Ser		A8K0I2|B4DHG6|Q8N5Z2	Missense_Mutation	SNP	ENST00000507958.1	37	CCDS3889.1	.	.	.	.	.	.	.	.	.	.	C	13.94	2.386054	0.42308	.	.	ENSG00000145526	ENST00000382275;ENST00000507958;ENST00000542864;ENST00000274170;ENST00000506372;ENST00000502796;ENST00000511273	T;T;T;T;T;T	0.60171	0.21;0.21;0.21;0.21;0.21;0.21	5.22	5.22	0.72569	Cadherin (2);Cadherin-like (1);	0.107611	0.64402	D	0.000006	T	0.50326	0.1609	L	0.52206	1.635	0.37903	D	0.931102	B;B	0.18310	0.021;0.027	B;B	0.18561	0.009;0.022	T	0.49457	-0.8938	9	.	.	.	.	12.7687	0.57408	0.1641:0.8359:0.0:0.0	.	489;489	B4DHG6;Q13634	.;CAD18_HUMAN	S	489	ENSP00000371710:A489S;ENSP00000425093:A489S;ENSP00000274170:A489S;ENSP00000424931:A489S;ENSP00000422138:A489S;ENSP00000425854:A489S	.	A	-	1	0	CDH18	19556570	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.628000	0.54259	2.601000	0.87937	0.650000	0.86243	GCC		0.393	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366747.1		NM_004934	
CLDN3	1365	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	73183930	73183930	+	Silent	SNP	C	C	G			TCGA-B2-4099-01A-02D-1458-08	TCGA-B2-4099-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01c54f7c-84b9-4f5b-ae44-2ac1f661fd29	54cf60f2-947e-4eb0-b5a7-1e644ca10dba	g.chr7:73183930C>G	ENST00000395145.2	-	1	670	c.450G>C	c.(448-450)gtG>gtC	p.V150V		NM_001306.3	NP_001297.1	O15551	CLD3_HUMAN	claudin 3	150					calcium-independent cell-cell adhesion (GO:0016338)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)|transmembrane signaling receptor activity (GO:0004888)	p.V150V(1)		kidney(1)|lung(1)	2		Lung NSC(55;0.159)				CCTCGGGCACCACGGGGTTGT	0.706																																																	1	Substitution - coding silent(1)	kidney(1)											25.0	25.0	25.0					7																	73183930		2198	4299	6497	SO:0001819	synonymous_variant	1365			AF007189	CCDS5559.1	7q11	2008-07-18			ENSG00000165215	ENSG00000165215		"""Claudins"""	2045	protein-coding gene	gene with protein product	"""Clostridium perfringens enterotoxin receptor 2"", ""ventral prostate.1-like protein"", ""claudin-3"", ""CPE-receptor 2"""	602910		C7orf1, CPETR2		9441748, 9892664	Standard	NM_001306		Approved	RVP1, CPE-R2, HRVP1	uc003tzg.4	O15551	OTTHUMG00000023424	ENST00000395145.2:c.450G>C	7.37:g.73183930C>G				Silent	SNP	ENST00000395145.2	37	CCDS5559.1																																																																																				0.706	CLDN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252310.1		NM_001306	
CNST	163882	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	246810555	246810555	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr1:246810555delT	ENST00000366513.4	+	9	1321	c.1052delT	c.(1051-1053)cttfs	p.L351fs	CNST_ENST00000483271.1_3'UTR|CNST_ENST00000366512.3_Frame_Shift_Del_p.L351fs	NM_152609.2	NP_689822.2	Q6PJW8	CNST_HUMAN	consortin, connexin sorting protein	351					negative regulation of phosphatase activity (GO:0010923)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)	connexin binding (GO:0071253)|phosphatase binding (GO:0019902)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|prostate(1)|urinary_tract(2)	28						TCCCCAAGCCTTTCGGTAACT	0.582											OREG0014367	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													84.0	85.0	84.0					1																	246810555		2203	4300	6503	SO:0001589	frameshift_variant	163882			AK056563	CCDS1628.1, CCDS44343.1	1q44	2012-04-17	2009-11-03	2009-11-03	ENSG00000162852	ENSG00000162852		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	26486	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 64"""	613439	"""chromosome 1 open reading frame 71"""	C1orf71		19864490	Standard	NM_152609		Approved	FLJ32001, PPP1R64	uc001ibp.3	Q6PJW8	OTTHUMG00000040090	ENST00000366513.4:c.1052delT	1.37:g.246810555delT	ENSP00000355470:p.Leu351fs	2468	Q5VSY9|Q5VTM7|Q8IYA9|Q8N3L5|Q8NB09|Q8TEI2|Q96MR5	Frame_Shift_Del	DEL	ENST00000366513.4	37	CCDS1628.1																																																																																				0.582	CNST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096780.1		NM_152609	
CUL1	8454	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	148485659	148485659	+	Missense_Mutation	SNP	G	G	A			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr7:148485659G>A	ENST00000325222.4	+	14	1769	c.1490G>A	c.(1489-1491)gGg>gAg	p.G497E	CUL1_ENST00000602748.1_Missense_Mutation_p.G497E|CUL1_ENST00000409469.1_Missense_Mutation_p.G497E	NM_003592.2	NP_003583.2	Q13616	CUL1_HUMAN	cullin 1	497					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|viral process (GO:0016032)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|SCF ubiquitin ligase complex (GO:0019005)		p.G497E(2)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(10)|liver(2)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	40	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			CAAGCTTGCGGGTTCGAGTAC	0.388																																																	2	Substitution - Missense(2)	kidney(2)											100.0	96.0	97.0					7																	148485659		2203	4300	6503	SO:0001583	missense	8454			U58087	CCDS34772.1	7q36.1	2011-05-24			ENSG00000055130	ENSG00000055130			2551	protein-coding gene	gene with protein product		603134				8681378	Standard	NM_003592		Approved		uc003wey.3	Q13616	OTTHUMG00000152776	ENST00000325222.4:c.1490G>A	7.37:g.148485659G>A	ENSP00000326804:p.Gly497Glu		D3DWG3|O60719|Q08AL6|Q8IYW1	Missense_Mutation	SNP	ENST00000325222.4	37	CCDS34772.1	.	.	.	.	.	.	.	.	.	.	G	33	5.218162	0.95104	.	.	ENSG00000055130	ENST00000409469;ENST00000325222;ENST00000543583;ENST00000433865	D;D	0.86956	-2.19;-2.19	5.39	5.39	0.77823	Cullin, N-terminal (1);Cullin homology (3);	0.000000	0.85682	D	0.000000	D	0.96281	0.8787	H	0.97732	4.065	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.97461	1.0034	10	0.87932	D	0	-8.6532	19.5308	0.95228	0.0:0.0:1.0:0.0	.	424;497	E7EWR0;Q13616	.;CUL1_HUMAN	E	497;497;455;424	ENSP00000387160:G497E;ENSP00000326804:G497E	ENSP00000326804:G497E	G	+	2	0	CUL1	148116592	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	9.499000	0.97975	2.684000	0.91462	0.650000	0.86243	GGG		0.388	CUL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467785.1		NM_003592	
CYP4Z2P	163720	broad.mit.edu	37	1	47325354	47325354	+	RNA	SNP	G	G	A	rs4660360		TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr1:47325354G>A	ENST00000505841.1	-	0	1175					NR_002788.2		Q8N1L4	CP4Z2_HUMAN	cytochrome P450, family 4, subfamily Z, polypeptide 2, pseudogene							integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)										CATCTGGAAAGGTAATGGGTT	0.438																																																	0																																												163720			AY262057		1p33	2013-07-25	2013-05-03		ENSG00000154198	ENSG00000154198		"""Cytochrome P450s"""	24426	pseudogene	pseudogene						15059886	Standard	NR_002788		Approved	FLJ40054	uc031pmm.1	Q8N1L4	OTTHUMG00000008024		1.37:g.47325354G>A			Q66ZJ5	RNA	SNP	ENST00000505841.1	37																																																																																					0.438	CYP4Z2P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000361094.1		NR_002788	
DMD	1756	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	31196785	31196785	+	Splice_Site	SNP	C	C	A	rs398123834		TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chrX:31196785C>A	ENST00000357033.4	-	70	10430		c.e70+1		DMD_ENST00000541735.1_Splice_Site|DMD_ENST00000474231.1_Splice_Site|DMD_ENST00000378707.3_Splice_Site|DMD_ENST00000378723.3_Splice_Site|DMD_ENST00000359836.1_Splice_Site|DMD_ENST00000378680.2_Splice_Site|DMD_ENST00000378702.4_Splice_Site|DMD_ENST00000378677.2_Splice_Site|DMD_ENST00000361471.4_Splice_Site|DMD_ENST00000343523.2_Splice_Site	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin						cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.?(12)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CTACTACTCACGTTTCCATGT	0.438																																																	12	Unknown(12)	kidney(12)	GRCh37	CS930792|CS971710	DMD	S							215.0	165.0	182.0					X																	31196785		2202	4300	6502	SO:0001630	splice_region_variant	1756			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.10223+1G>T	X.37:g.31196785C>A			E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Silent	SNP	ENST00000357033.4	37	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.120796	0.77436	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378723;ENST00000358062;ENST00000378677;ENST00000357033;ENST00000359836;ENST00000343523;ENST00000542849;ENST00000535280;ENST00000378707;ENST00000541735;ENST00000378702;ENST00000465285;ENST00000474231;ENST00000361471;ENST00000378680;ENST00000378705	.	.	.	5.0	5.0	0.66597	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.7154	0.88335	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DMD	31106706	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.254000	0.78329	2.458000	0.83093	0.600000	0.82982	.		0.438	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2		NM_004006	Intron
DCAF12L1	139170	broad.mit.edu;hgsc.bcm.edu	37	X	125685459	125685459	+	Missense_Mutation	SNP	C	C	T			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chrX:125685459C>T	ENST00000371126.1	-	1	1375	c.1133G>A	c.(1132-1134)cGg>cAg	p.R378Q		NM_178470.4	NP_848565.2	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	378								p.R378Q(2)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(39)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68						TTTCTGGGCCCGGACGTCATA	0.627																																																	2	Substitution - Missense(2)	kidney(2)											41.0	43.0	43.0					X																	125685459		2203	4300	6503	SO:0001583	missense	139170			BC035674	CCDS14610.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198889	ENSG00000198889		"""WD repeat domain containing"""	29395	protein-coding gene	gene with protein product			"""WD repeat domain 40B"""	WDR40B		12477932	Standard	NM_178470		Approved	KIAA1892L	uc004eul.3	Q5VU92	OTTHUMG00000022353	ENST00000371126.1:c.1133G>A	X.37:g.125685459C>T	ENSP00000360167:p.Arg378Gln		Q8IYK3	Missense_Mutation	SNP	ENST00000371126.1	37	CCDS14610.1	.	.	.	.	.	.	.	.	.	.	C	14.32	2.500277	0.44455	.	.	ENSG00000198889	ENST00000371126	T	0.63580	-0.05	3.64	1.85	0.25348	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.36409	N	0.002610	T	0.75744	0.3891	M	0.83384	2.64	0.29129	N	0.879739	D	0.89917	1.0	D	0.80764	0.994	T	0.68868	-0.5295	10	0.66056	D	0.02	.	7.322	0.26533	0.0:0.7654:0.0:0.2346	.	378	Q5VU92	DC121_HUMAN	Q	378	ENSP00000360167:R378Q	ENSP00000360167:R378Q	R	-	2	0	DCAF12L1	125513140	1.000000	0.71417	0.000000	0.03702	0.097000	0.18754	6.225000	0.72271	0.379000	0.24794	0.429000	0.28392	CGG		0.627	DCAF12L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058186.1		NM_178470	
DNAH7	56171	broad.mit.edu;hgsc.bcm.edu	37	2	196723250	196723250	+	Missense_Mutation	SNP	G	G	T			TCGA-B2-4099-01A-02D-1458-08	TCGA-B2-4099-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01c54f7c-84b9-4f5b-ae44-2ac1f661fd29	54cf60f2-947e-4eb0-b5a7-1e644ca10dba	g.chr2:196723250G>T	ENST00000312428.6	-	43	8115	c.8015C>A	c.(8014-8016)gCc>gAc	p.A2672D		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2672	Stalk. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)	p.A2672D(2)		NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						TATTGGCAAGGCACCTGCCAG	0.453																																																	2	Substitution - Missense(2)	kidney(2)											78.0	74.0	76.0					2																	196723250		1970	4159	6129	SO:0001583	missense	56171			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.8015C>A	2.37:g.196723250G>T	ENSP00000311273:p.Ala2672Asp		B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	37	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	G	18.92	3.725919	0.69074	.	.	ENSG00000118997	ENST00000312428	T	0.80653	-1.4	5.64	5.64	0.86602	Dynein heavy chain, coiled coil stalk (1);	0.000000	0.85682	D	0.000000	D	0.95118	0.8418	H	0.99668	4.69	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96858	0.9630	10	0.87932	D	0	.	19.4873	0.95035	0.0:0.0:1.0:0.0	.	2672	Q8WXX0	DYH7_HUMAN	D	2672	ENSP00000311273:A2672D	ENSP00000311273:A2672D	A	-	2	0	DNAH7	196431495	1.000000	0.71417	0.996000	0.52242	0.004000	0.04260	9.544000	0.98092	2.937000	0.99478	0.650000	0.86243	GCC		0.453	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3		NM_018897	
DNHD1	144132	broad.mit.edu;hgsc.bcm.edu	37	11	6585252	6585252	+	Silent	SNP	C	C	T			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr11:6585252C>T	ENST00000527990.2	+	29	10182	c.10182C>T	c.(10180-10182)tgC>tgT	p.C3394C	DNHD1_ENST00000254579.6_Silent_p.C3394C			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	3394					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)	p.C3394C(2)		NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		CCCACAACTGCGTGGCAAAGA	0.582																																																	2	Substitution - coding silent(2)	endometrium(1)|kidney(1)											59.0	58.0	58.0					11																	6585252		692	1591	2283	SO:0001819	synonymous_variant	144132			AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.10182C>T	11.37:g.6585252C>T			Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Silent	SNP	ENST00000527990.2	37	CCDS44532.1																																																																																				0.582	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384673.2		NM_144666	
DNM2	1785	broad.mit.edu	37	19	10935788	10935788	+	Missense_Mutation	SNP	A	A	G			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr19:10935788A>G	ENST00000355667.6	+	18	2029	c.1949A>G	c.(1948-1950)gAg>gGg	p.E650G	DNM2_ENST00000408974.4_Missense_Mutation_p.E646G|DNM2_ENST00000389253.4_Missense_Mutation_p.E650G|DNM2_ENST00000314646.5_Missense_Mutation_p.E650G|DNM2_ENST00000359692.6_Missense_Mutation_p.E646G|DNM2_ENST00000585892.1_Missense_Mutation_p.E650G	NM_001005360.2|NM_001190716.1	NP_001005360.1|NP_001177645.1	P50570	DYN2_HUMAN	dynamin 2	650			E -> K (in CNM1; COS7 cells show a reduced uptake of transferrin and low- density lipoprotein complex). {ECO:0000269|PubMed:19623537}.		antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|endocytosis (GO:0006897)|G2/M transition of mitotic cell cycle (GO:0000086)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|nitric oxide metabolic process (GO:0046209)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic vesicle transport (GO:0048489)|transferrin transport (GO:0033572)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	enzyme binding (GO:0019899)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|microtubule binding (GO:0008017)	p.E646G(1)|p.E650G(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	42			Epithelial(33;4.17e-05)|all cancers(31;8.48e-05)			CCCCAACTGGAGCGGCAGGTG	0.602			"""F, N, Splice, Mis, O"""		ETP ALL																																			Rec	yes		19	19p13.2	1785	dynamin 2		L	2	Substitution - Missense(2)	kidney(2)											105.0	94.0	98.0					19																	10935788		2203	4300	6503	SO:0001583	missense	1785				CCDS32907.1, CCDS32908.1, CCDS45968.1, CCDS45969.1, CCDS59351.1	19p	2014-09-17						"""Pleckstrin homology (PH) domain containing"""	2974	protein-coding gene	gene with protein product	"""dynamin II"", ""cytoskeletal protein"""	602378				7590285, 9143510	Standard	NM_001190716		Approved	DYNII, DYN2, CMTDIB, CMTDI1, DI-CMTB	uc002mps.2	P50570		ENST00000355667.6:c.1949A>G	19.37:g.10935788A>G	ENSP00000347890:p.Glu650Gly		A8K1B6|E7EV30|E9PEQ4|K7ESI9|Q5I0Y0|Q7Z5S3|Q9UPH4	Missense_Mutation	SNP	ENST00000355667.6	37	CCDS45968.1	.	.	.	.	.	.	.	.	.	.	A	17.35	3.366467	0.61513	.	.	ENSG00000079805	ENST00000408974;ENST00000355667;ENST00000359692;ENST00000389253;ENST00000314646;ENST00000545324	T;T;T;T	0.57595	0.44;0.39;0.44;0.44	5.27	4.24	0.50183	Dynamin GTPase effector (2);	0.000000	0.85682	D	0.000000	T	0.75946	0.3919	M	0.91972	3.26	0.58432	D	0.999998	D;D;D;D;D;D;D	0.89917	1.0;0.998;0.999;0.998;0.999;1.0;0.991	D;D;D;D;D;D;P	0.83275	0.996;0.991;0.989;0.994;0.959;0.994;0.904	T	0.79090	-0.1946	10	0.87932	D	0	-4.4441	10.5737	0.45214	0.8551:0.0:0.0:0.1449	.	244;650;379;646;646;650;650	Q8N1K8;F5H4R9;B4DJ53;A8K1B6;P50570-2;P50570;E9PEQ4	.;.;.;.;.;DYN2_HUMAN;.	G	646;646;650;650;650;257	ENSP00000386192:E646G;ENSP00000352721:E650G;ENSP00000373905:E650G;ENSP00000313164:E650G	ENSP00000313164:E650G	E	+	2	0	DNM2	10796788	1.000000	0.71417	1.000000	0.80357	0.322000	0.28314	9.204000	0.95041	0.823000	0.34589	-0.490000	0.04691	GAG		0.602	DNM2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452592.1		NM_004945	
E2F4	1874	broad.mit.edu;hgsc.bcm.edu	37	16	67235520	67235520	+	IGR	SNP	G	G	A			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr16:67235520G>A	ENST00000379378.3	+	0	2096				ELMO3_ENST00000360833.1_Missense_Mutation_p.R334Q|ELMO3_ENST00000477898.1_Missense_Mutation_p.R185Q|MIR328_ENST00000385213.1_RNA|ELMO3_ENST00000393997.2_Missense_Mutation_p.R351Q	NM_001950.3	NP_001941.2	Q16254	E2F4_HUMAN	E2F transcription factor 4, p107/p130-binding						blood circulation (GO:0008015)|cell volume homeostasis (GO:0006884)|cilium assembly (GO:0042384)|epithelial cell development (GO:0002064)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of cell size (GO:0008361)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.R351Q(2)		breast(4)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)	11		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000697)|Epithelial(162;0.00303)|all cancers(182;0.0325)		CCGCGCATGCGGACGCCCCTG	0.587																																																	2	Substitution - Missense(2)	kidney(2)											47.0	53.0	51.0					16																	67235520		2075	4223	6298	SO:0001628	intergenic_variant	79767			BC021050	CCDS32464.1	16q22.1	2014-05-06			ENSG00000205250	ENSG00000205250			3118	protein-coding gene	gene with protein product		600659				7958924, 7892279	Standard	NM_001950		Approved	E2F-4	uc002erz.3	Q16254	OTTHUMG00000172975		16.37:g.67235520G>A			A6NGR8|B5BU56|Q12991|Q15328	Missense_Mutation	SNP	ENST00000379378.3	37	CCDS32464.1	.	.	.	.	.	.	.	.	.	.	G	6.903	0.536253	0.13188	.	.	ENSG00000102890	ENST00000360833;ENST00000393997	T;T	0.28666	1.6;1.6	5.31	3.35	0.38373	Engulfment/cell motility, ELMO (1);	0.255518	0.43416	N	0.000564	T	0.13286	0.0322	N	0.13235	0.315	0.43628	D	0.996011	P;P;P	0.39404	0.473;0.672;0.672	B;B;B	0.30495	0.115;0.116;0.116	T	0.09271	-1.0682	10	0.22706	T	0.39	-30.0339	8.404	0.32603	0.24:0.0:0.76:0.0	.	298;334;351	Q96BJ8;F8W9E7;Q96BJ8-3	ELMO3_HUMAN;.;.	Q	334;351	ENSP00000354077:R334Q;ENSP00000377566:R351Q	ENSP00000354077:R334Q	R	+	2	0	ELMO3	65793021	1.000000	0.71417	0.850000	0.33497	0.001000	0.01503	1.321000	0.33678	1.243000	0.43853	-0.258000	0.10820	CGG		0.587	E2F4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421565.1		NM_001950	
ESPNP	284729	broad.mit.edu	37	1	17034125	17034126	+	RNA	INS	-	-	AGCT	rs141324796|rs79472512	byFrequency	TCGA-B2-4099-01A-02D-1458-08	TCGA-B2-4099-10A-01D-1458-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01c54f7c-84b9-4f5b-ae44-2ac1f661fd29	54cf60f2-947e-4eb0-b5a7-1e644ca10dba	g.chr1:17034125_17034126insAGCT	ENST00000492551.1	-	0	477_478					NR_026567.1				espin pseudogene																		CAGCAGCAGCCAGCTGAGCACC	0.718														1500	0.299521	0.1188	0.3444	5008	,	,		24180	0.4177		0.3101	False		,,,				2504	0.3793																0																																												284729			AL035288		1p36.13	2013-05-22			ENSG00000268869	ENSG00000268869			23285	pseudogene	pseudogene						15286153	Standard	NR_026567		Approved		uc001azn.1		OTTHUMG00000000803		1.37:g.17034126_17034129dupAGCT				Frame_Shift_Ins	INS	ENST00000492551.1	37																																																																																					0.718	ESPNP-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000326311.1			
CLCNKA	1187	broad.mit.edu	37	1	16361875	16361875	+	IGR	SNP	A	A	G	rs11807054	byFrequency	TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr1:16361875A>G	ENST00000331433.4	+	0	2475							P51800	CLCKA_HUMAN	chloride channel, voltage-sensitive Ka						excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|metal ion binding (GO:0046872)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(1)	19		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	Niflumic Acid(DB04552)	GGAGGGGCTGAGCGAGGAGAA	0.662													G|||	4695	0.9375	0.9198	0.9496	5008	,	,		4994	0.999		0.8966	False		,,,				2504	0.9315																0																																										SO:0001628	intergenic_variant	348487				CCDS167.1, CCDS41269.1, CCDS57973.1	1p36	2012-09-26	2012-02-23		ENSG00000186510	ENSG00000186510		"""Ion channels / Chloride channels : Voltage-sensitive"""	2026	protein-coding gene	gene with protein product		602024	"""chloride channel Ka"""			8544406	Standard	NM_004070		Approved	hClC-Ka	uc001axu.3	P51800	OTTHUMG00000009529		1.37:g.16361875A>G			B4DPD3|E7EPH6|Q5T5P8|Q5T5Q4|Q7Z6D1|Q86VT1	Missense_Mutation	SNP	ENST00000331433.4	37	CCDS167.1																																																																																				0.662	CLCNKA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026326.1			
FNIP1	96459	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	131008580	131008580	+	Missense_Mutation	SNP	T	T	G			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr5:131008580T>G	ENST00000510461.1	-	14	1652	c.1557A>C	c.(1555-1557)ttA>ttC	p.L519F	CTC-432M15.3_ENST00000514667.1_Intron|FNIP1_ENST00000307954.8_Missense_Mutation_p.L474F|FNIP1_ENST00000307968.7_Missense_Mutation_p.L491F	NM_133372.2	NP_588613	Q8TF40	FNIP1_HUMAN	folliculin interacting protein 1	519					cellular response to starvation (GO:0009267)|immature B cell differentiation (GO:0002327)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell apoptotic process (GO:0002904)|positive regulation of GTPase activity (GO:0043547)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|regulation of pro-B cell differentiation (GO:2000973)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.L519F(2)		NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34		all_cancers(142;0.00347)|Lung NSC(810;0.106)|all_lung(232;0.123)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0665)		CAGTCCTTGCTAACCGTACGG	0.403																																																	2	Substitution - Missense(2)	kidney(2)											75.0	78.0	77.0					5																	131008580		2203	4299	6502	SO:0001583	missense	96459			DQ145719	CCDS34226.1, CCDS34227.1	5q23.3	2014-01-28				ENSG00000217128			29418	protein-coding gene	gene with protein product		610594				11853319, 17028174	Standard	NM_001008738		Approved	KIAA1961		Q8TF40		ENST00000510461.1:c.1557A>C	5.37:g.131008580T>G	ENSP00000421985:p.Leu519Phe		D6RJH5|Q86T47|Q9BUT0	Missense_Mutation	SNP	ENST00000510461.1	37	CCDS34227.1	.	.	.	.	.	.	.	.	.	.	T	15.92	2.974557	0.53720	.	.	ENSG00000217128	ENST00000307968;ENST00000307954;ENST00000544351;ENST00000510461	T;T;T	0.36878	1.23;1.23;1.23	5.88	4.71	0.59529	.	.	.	.	.	T	0.56217	0.1970	M	0.77820	2.39	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.91635	0.999;0.999;0.974	T	0.56312	-0.8000	9	0.46703	T	0.11	-1.3374	7.1374	0.25535	0.1302:0.069:0.0:0.8009	.	519;491;519	A8K8V8;Q8TF40-3;Q8TF40	.;.;FNIP1_HUMAN	F	491;474;279;519	ENSP00000309266:L491F;ENSP00000310453:L474F;ENSP00000421985:L519F	ENSP00000310453:L474F	L	-	3	2	FNIP1	131036479	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	2.997000	0.49457	1.046000	0.40249	0.533000	0.62120	TTA		0.403	FNIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370077.1		NM_133372	
FUK	197258	broad.mit.edu	37	16	70508127	70508128	+	In_Frame_Ins	INS	-	-	CCA	rs186275161	byFrequency	TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr16:70508127_70508128insCCA	ENST00000288078.6	+	16	2105_2106	c.1873_1874insCCA	c.(1873-1875)cgg>cCCAgg	p.624_625insP	FUK_ENST00000571514.1_In_Frame_Ins_p.115_116insP|FUK_ENST00000378912.2_In_Frame_Ins_p.656_657insP	NM_145059.2	NP_659496.2	Q8N0W3	FUK_HUMAN	fucokinase	624						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|fucokinase activity (GO:0050201)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(11)|ovary(2)|prostate(2)	23		Ovarian(137;0.0694)				TGGGGGCTTGCGGAGCGGGCCA	0.698																																																	0																																										SO:0001652	inframe_insertion	197258				CCDS10891.2	16q22.1	2008-02-05			ENSG00000157353	ENSG00000157353	2.7.1.52		29500	protein-coding gene	gene with protein product	"""L-fucose kinase"""	608675				12056818	Standard	XM_006721161		Approved	FLJ39408	uc002eyy.3	Q8N0W3	OTTHUMG00000074085	Exception_encountered	16.37:g.70508127_70508128insCCA	ENSP00000288078:p.Leu624_Arg625insPro		Q5PSM3|Q5XKL6|Q6ZRA0|Q96MT9	In_Frame_Ins	INS	ENST00000288078.6	37	CCDS10891.2																																																																																				0.698	FUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157291.2		NM_145059	
GLTSCR2	29997	broad.mit.edu	37	19	48258011	48258011	+	Missense_Mutation	SNP	G	G	A			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr19:48258011G>A	ENST00000246802.5	+	8	954	c.916G>A	c.(916-918)Gat>Aat	p.D306N	SNORD23_ENST00000408876.1_RNA|CTD-2571L23.6_ENST00000602048.1_RNA|GLTSCR2_ENST00000598681.1_3'UTR	NM_015710.4	NP_056525.2	Q9NZM5	GSCR2_HUMAN	glioma tumor suppressor candidate region gene 2	306						intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)	p.D306N(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	15		all_cancers(25;1.47e-06)|all_lung(116;6.89e-05)|all_epithelial(76;0.000108)|Lung NSC(112;0.000117)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000301)|OV - Ovarian serous cystadenocarcinoma(262;0.00031)|Epithelial(262;0.0149)|GBM - Glioblastoma multiforme(486;0.0278)		GGAGGAGTCGGATGGTGAGGG	0.716																																					Colon(58;613 1041 9473 10089 15241)												1	Substitution - Missense(1)	kidney(1)											9.0	14.0	13.0					19																	48258011		2047	4024	6071	SO:0001583	missense	29997			AF182076	CCDS12705.1	19q13.3	2014-01-20				ENSG00000105373			4333	protein-coding gene	gene with protein product		605691				10708517, 16971513, 17657248	Standard	NM_015710		Approved	PICT-1	uc002phm.2	Q9NZM5		ENST00000246802.5:c.916G>A	19.37:g.48258011G>A	ENSP00000246802:p.Asp306Asn		Q9BTC6|Q9HAX6|Q9NPP1|Q9NPR4|Q9UFI2	Missense_Mutation	SNP	ENST00000246802.5	37	CCDS12705.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.670948	0.88348	.	.	ENSG00000105373	ENST00000246802;ENST00000325566	T	0.51817	0.69	3.63	3.63	0.41609	.	0.187320	0.44285	D	0.000473	T	0.63546	0.2520	M	0.70595	2.14	0.35094	D	0.764561	D;P;P	0.71674	0.998;0.822;0.822	D;P;P	0.69824	0.966;0.562;0.506	T	0.73956	-0.3819	10	0.56958	D	0.05	-12.8777	10.9677	0.47422	0.0:0.0:1.0:0.0	.	306;306;304	Q53YP0;Q9NZM5;Q96CS0	.;GSCR2_HUMAN;.	N	306	ENSP00000246802:D306N	ENSP00000246802:D306N	D	+	1	0	GLTSCR2	52949823	0.982000	0.34865	0.273000	0.24645	0.465000	0.32709	5.655000	0.67981	2.011000	0.59026	0.411000	0.27672	GAT		0.716	GLTSCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464870.1		NM_015710	
GLYCTK	132158	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	52324497	52324497	+	Missense_Mutation	SNP	G	G	A			TCGA-B2-4099-01A-02D-1458-08	TCGA-B2-4099-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01c54f7c-84b9-4f5b-ae44-2ac1f661fd29	54cf60f2-947e-4eb0-b5a7-1e644ca10dba	g.chr3:52324497G>A	ENST00000436784.2	+	2	199	c.139G>A	c.(139-141)Ggt>Agt	p.G47S	GLYCTK_ENST00000477382.1_Missense_Mutation_p.G47S|GLYCTK_ENST00000354773.4_Missense_Mutation_p.G47S|GLYCTK-AS1_ENST00000493616.1_RNA|GLYCTK_ENST00000461183.1_Intron|GLYCTK_ENST00000473032.1_Missense_Mutation_p.G47S|GLYCTK_ENST00000471180.1_Intron|GLYCTK_ENST00000305690.8_Missense_Mutation_p.G47S			Q8IVS8	GLCTK_HUMAN	glycerate kinase	47					protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|glycerate kinase activity (GO:0008887)	p.G47S(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|urinary_tract(1)	9				BRCA - Breast invasive adenocarcinoma(193;3.56e-05)|Kidney(197;0.00171)|KIRC - Kidney renal clear cell carcinoma(197;0.00194)|OV - Ovarian serous cystadenocarcinoma(275;0.235)		GAGTGCTGTAGGTGCAGTGCT	0.642																																																	1	Substitution - Missense(1)	kidney(1)											31.0	30.0	30.0					3																	52324497		2203	4300	6503	SO:0001583	missense	132158				CCDS2852.1, CCDS46841.1	3p21.1	2008-01-22			ENSG00000168237	ENSG00000168237	2.7.1.31		24247	protein-coding gene	gene with protein product		610516				16753811	Standard	NM_145262		Approved	HBEBP4, HBEBP2	uc003ddo.3	Q8IVS8	OTTHUMG00000158380	ENST00000436784.2:c.139G>A	3.37:g.52324497G>A	ENSP00000389175:p.Gly47Ser		Q0P630|Q2EZ43|Q6Y2K6|Q7Z6G5|Q86YR8|Q8TED2|Q8WTY2	Missense_Mutation	SNP	ENST00000436784.2	37	CCDS2852.1	.	.	.	.	.	.	.	.	.	.	G	11.21	1.571865	0.28003	.	.	ENSG00000168237	ENST00000473032;ENST00000305690;ENST00000354773;ENST00000436784;ENST00000477382;ENST00000411757	T;T;T;T;T	0.39787	1.06;1.06;1.06;1.06;1.06	5.4	3.44	0.39384	.	0.220732	0.47852	D	0.000201	T	0.16471	0.0396	N	0.04508	-0.205	0.34918	D	0.748133	P;B;B	0.51933	0.949;0.066;0.014	B;B;B	0.42495	0.389;0.018;0.038	T	0.10200	-1.0640	10	0.10111	T	0.7	-7.8395	5.9756	0.19377	0.074:0.1335:0.6546:0.1379	.	47;47;47	Q8IVS8-2;Q8IVS8-4;Q8IVS8	.;.;GLCTK_HUMAN	S	47	ENSP00000418951:G47S;ENSP00000301965:G47S;ENSP00000346825:G47S;ENSP00000389175:G47S;ENSP00000419008:G47S	ENSP00000301965:G47S	G	+	1	0	GLYCTK	52299537	1.000000	0.71417	0.989000	0.46669	0.669000	0.39330	1.605000	0.36815	2.527000	0.85204	0.643000	0.83706	GGT		0.642	GLYCTK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350835.1		NM_145262	
GOLGA6L10	647042	broad.mit.edu	37	15	82635117	82635117	+	IGR	SNP	T	T	C	rs201663151	byFrequency	TCGA-B2-4099-01A-02D-1458-08	TCGA-B2-4099-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01c54f7c-84b9-4f5b-ae44-2ac1f661fd29	54cf60f2-947e-4eb0-b5a7-1e644ca10dba	g.chr15:82635117T>C	ENST00000439287.4	-	0	1540					NM_001164465.1	NP_001157937.1	A6NI86	GG6LA_HUMAN	golgin A6 family-like 10											endometrium(1)|kidney(4)	5						TTTTTCAATTTCTTGACCCGC	0.403																																																	0																																										SO:0001628	intergenic_variant	647042				CCDS45325.1	15q25.2	2014-08-13	2010-02-12		ENSG00000278662				37228	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 10"", ""golgin A6 family-like 18"""	GOLGA6L18			Standard	XM_006720643		Approved		uc021ssn.1	A6NI86	OTTHUMG00000172580		15.37:g.82635117T>C				RNA	SNP	ENST00000439287.4	37	CCDS45325.1																																																																																				0.403	GOLGA6L10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419403.2		NM_001164465	
HEATR6	63897	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	58137396	58137396	+	Missense_Mutation	SNP	G	G	C			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr17:58137396G>C	ENST00000184956.6	-	10	1494	c.1478C>G	c.(1477-1479)tCt>tGt	p.S493C	HEATR6_ENST00000585976.1_Missense_Mutation_p.S493C	NM_022070.4	NP_071353.4	Q6AI08	HEAT6_HUMAN	HEAT repeat containing 6	493							poly(A) RNA binding (GO:0044822)	p.S493C(2)		NS(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	44	all_cancers(5;2.25e-13)|Breast(5;4.84e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		BRCA - Breast invasive adenocarcinoma(1;5.93e-19)|Epithelial(12;7.59e-12)|all cancers(12;1.26e-10)			TTCAGCAACAGAAAGAAACTG	0.433																																																	2	Substitution - Missense(2)	kidney(2)											141.0	138.0	139.0					17																	58137396		2203	4300	6503	SO:0001583	missense	63897			BX640819	CCDS11623.1	17q23.2	2007-05-01				ENSG00000068097			24076	protein-coding gene	gene with protein product	"""amplified in breast cancer 1"""					12755490	Standard	NM_022070		Approved	ABC1, FLJ22087	uc002iyk.1	Q6AI08		ENST00000184956.6:c.1478C>G	17.37:g.58137396G>C	ENSP00000184956:p.Ser493Cys		B3KXP3|Q6MZX1|Q6MZY2|Q8TDM9|Q9H6B3|Q9H6M7	Missense_Mutation	SNP	ENST00000184956.6	37	CCDS11623.1	.	.	.	.	.	.	.	.	.	.	G	16.30	3.083543	0.55861	.	.	ENSG00000068097	ENST00000184956;ENST00000393017	T	0.67345	-0.26	5.68	4.71	0.59529	Armadillo-like helical (1);Armadillo-type fold (1);	0.052110	0.85682	D	0.000000	T	0.65852	0.2731	L	0.58101	1.795	0.52099	D	0.999948	B;B	0.22541	0.071;0.009	B;B	0.26202	0.067;0.017	T	0.65327	-0.6195	10	0.54805	T	0.06	-8.888	16.3064	0.82849	0.0:0.1321:0.8679:0.0	.	340;493	E7ESB9;Q6AI08	.;HEAT6_HUMAN	C	493;340	ENSP00000184956:S493C	ENSP00000184956:S493C	S	-	2	0	HEATR6	55492178	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.448000	0.80631	1.556000	0.49512	0.558000	0.71614	TCT		0.433	HEATR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449165.1		NM_022070	
HIST1H3I	8354	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	27839911	27839911	+	Silent	SNP	C	C	T			TCGA-B2-4099-01A-02D-1458-08	TCGA-B2-4099-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01c54f7c-84b9-4f5b-ae44-2ac1f661fd29	54cf60f2-947e-4eb0-b5a7-1e644ca10dba	g.chr6:27839911C>T	ENST00000328488.2	-	1	188	c.183G>A	c.(181-183)ctG>ctA	p.L61L		NM_003533.2	NP_003524.1	P68431	H31_HUMAN	histone cluster 1, H3i	61					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)	p.L61L(1)		endometrium(2)|kidney(1)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						TCCGGATTAGCAGCTCGGTCG	0.652																																																	1	Substitution - coding silent(1)	kidney(1)											69.0	75.0	73.0					6																	27839911		2203	4300	6503	SO:0001819	synonymous_variant	8354			X83550	CCDS4636.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000182572	ENSG00000275379		"""Histones / Replication-dependent"""	4771	protein-coding gene	gene with protein product		602814	"""H3 histone family, member F"", ""histone 1, H3i"""	H3FF		9031620, 9439656, 12408966	Standard	NM_003533		Approved	H3/f, H3.f	uc003njy.3	P68431	OTTHUMG00000016184	ENST00000328488.2:c.183G>A	6.37:g.27839911C>T			A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Silent	SNP	ENST00000328488.2	37	CCDS4636.1																																																																																				0.652	HIST1H3I-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043452.1		NM_003533	
RP3-470B24.5	0	broad.mit.edu	37	6	168377094	168377094	+	lincRNA	SNP	G	G	A	rs75642682|rs9364375	byFrequency	TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr6:168377094G>A	ENST00000538528.1	-	0	525																											TGCAGTGTGGGGGGAGGAGAA	0.627																																																	0													4.0	6.0	5.0					6																	168377094		639	1519	2158			100128124																															6.37:g.168377094G>A				Missense_Mutation	SNP	ENST00000538528.1	37																																																																																					0.627	RP3-470B24.5-201	KNOWN	basic	lincRNA	lincRNA				
HKR1	284459	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	37854193	37854193	+	Missense_Mutation	SNP	G	G	A			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr19:37854193G>A	ENST00000324411.4	+	6	1765	c.1496G>A	c.(1495-1497)tGt>tAt	p.C499Y	HKR1_ENST00000541583.2_Missense_Mutation_p.C438Y|HKR1_ENST00000591134.1_Intron|HKR1_ENST00000544914.1_Missense_Mutation_p.C226Y|HKR1_ENST00000591471.1_Missense_Mutation_p.C226Y|HKR1_ENST00000589392.1_Missense_Mutation_p.C481Y|HKR1_ENST00000392153.3_Missense_Mutation_p.C480Y	NM_181786.2	NP_861451.1	P10072	HKR1_HUMAN	HKR1, GLI-Kruppel zinc finger family member	499					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C499Y(2)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CCATTTGTATGTACGGAGTGT	0.527																																																	2	Substitution - Missense(2)	kidney(2)											84.0	81.0	82.0					19																	37854193		2203	4300	6503	SO:0001583	missense	284459			M20675	CCDS12502.1	19q13.13	2013-01-08	2010-05-04			ENSG00000181666		"""Zinc fingers, C2H2-type"", ""-"""	4928	protein-coding gene	gene with protein product	"""oncogene HKR1"""	165250	"""GLI-Kruppel family member HKR1"""			2850480, 9813242	Standard	NM_181786		Approved	ZNF875	uc002ogb.3	P10072		ENST00000324411.4:c.1496G>A	19.37:g.37854193G>A	ENSP00000315505:p.Cys499Tyr		A8MRS7|Q6PJD0|Q9BSW9|Q9UM09	Missense_Mutation	SNP	ENST00000324411.4	37	CCDS12502.1	.	.	.	.	.	.	.	.	.	.	G	12.34	1.910115	0.33721	.	.	ENSG00000181666	ENST00000544914;ENST00000414402;ENST00000392153;ENST00000542144;ENST00000324411;ENST00000541583	D;D;D;D	0.85088	-1.94;-1.94;-1.94;-1.94	2.58	2.58	0.30949	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94384	0.8194	H	0.96691	3.865	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.95583	0.8648	9	0.87932	D	0	.	13.0235	0.58802	0.0:0.0:1.0:0.0	.	438;480;499;481	Q7Z6E1;P10072-2;P10072;B4DSY3	.;.;HKR1_HUMAN;.	Y	226;278;480;535;499;438	ENSP00000437774:C226Y;ENSP00000375994:C480Y;ENSP00000315505:C499Y;ENSP00000438261:C438Y	ENSP00000315505:C499Y	C	+	2	0	HKR1	42546033	1.000000	0.71417	0.048000	0.18961	0.143000	0.21401	4.076000	0.57591	1.756000	0.51951	0.650000	0.86243	TGT		0.527	HKR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458375.1		NM_181786	
HMGXB3	22993	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	149403938	149403938	+	Silent	SNP	T	T	C			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr5:149403938T>C	ENST00000502717.1	+	7	1619	c.1155T>C	c.(1153-1155)aaT>aaC	p.N385N	HMGXB3_ENST00000503427.1_Silent_p.N385N	NM_014983.2	NP_055798	Q12766	HMGX3_HUMAN	HMG box domain containing 3	631					phosphorylation (GO:0016310)	nucleus (GO:0005634)	DNA binding (GO:0003677)|kinase activity (GO:0016301)	p.N631N(1)		central_nervous_system(1)|endometrium(3)|kidney(3)|skin(2)	9						CTAAGGAAAATGCCTCCAAAC	0.483																																																	1	Substitution - coding silent(1)	kidney(1)											55.0	56.0	56.0					5																	149403938		692	1591	2283	SO:0001819	synonymous_variant	22993			D83778	CCDS54935.1	5q33.1	2011-07-01		2009-01-05	ENSG00000113716	ENSG00000113716		"""High mobility group / Non-canonical"""	28982	protein-coding gene	gene with protein product				HMGX3		8724849	Standard	NM_014983		Approved	SMF, KIAA0194	uc003lrk.4	Q12766	OTTHUMG00000163493	ENST00000502717.1:c.1155T>C	5.37:g.149403938T>C			G5E9Y4|Q86UG3|Q9UMF4	Silent	SNP	ENST00000502717.1	37	CCDS54935.1																																																																																				0.483	HMGXB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373771.1		XM_001717202	
HOXA10	3206	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	27211532	27211533	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr7:27211532_27211533delAG	ENST00000283921.4	-	2	1217_1218	c.1218_1219delCT	c.(1216-1221)aactttfs	p.F407fs	HOXA9_ENST00000497089.1_5'Flank|HOXA10_ENST00000396344.4_Frame_Shift_Del_p.F91fs|HOXA-AS4_ENST00000519694.1_RNA|RP1-170O19.20_ENST00000470747.4_Intron|MIR196B_ENST00000384852.1_RNA|HOXA10_ENST00000521421.1_5'UTR|RP1-170O19.20_ENST00000465941.1_Intron|HOXA-AS4_ENST00000523790.1_RNA|HOXA-AS4_ENST00000519935.1_RNA	NM_018951.3	NP_061824.3	P31260	HXA10_HUMAN	homeobox A10	407					anterior/posterior pattern specification (GO:0009952)|embryonic limb morphogenesis (GO:0030326)|male gonad development (GO:0008584)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase binding (GO:0042826)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	9						GAAAAATTAAAGTTGGCTGTGA	0.515																																																	0																																										SO:0001589	frameshift_variant	3206				CCDS5410.2	7p15.2	2011-06-20	2005-12-22		ENSG00000253293	ENSG00000253293		"""Homeoboxes / ANTP class : HOXL subclass"""	5100	protein-coding gene	gene with protein product		142957	"""homeo box A10"""	HOX1H, HOX1		1973146, 1358459	Standard	NR_037939		Approved		uc011jzm.2	P31260	OTTHUMG00000023436	ENST00000283921.4:c.1218_1219delCT	7.37:g.27211532_27211533delAG	ENSP00000283921:p.Phe407fs		O43370|O43605|Q15949|Q504T1	Frame_Shift_Del	DEL	ENST00000283921.4	37	CCDS5410.2																																																																																				0.515	HOXA10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358724.2			
KDM4A	9682	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	44128741	44128741	+	Silent	SNP	T	T	C			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr1:44128741T>C	ENST00000372396.3	+	5	740	c.606T>C	c.(604-606)ttT>ttC	p.F202F	KDM4A_ENST00000463151.1_3'UTR	NM_014663.2	NP_055478.2	O75164	KDM4A_HUMAN	lysine (K)-specific demethylase 4A	202	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				cardiac muscle hypertrophy in response to stress (GO:0014898)|histone demethylation (GO:0016577)|histone H3-K36 demethylation (GO:0070544)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|methylated histone binding (GO:0035064)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.F202F(2)		breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(13)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	37						ACCTGCACTTTGGAGAACCAA	0.527																																																	2	Substitution - coding silent(2)	kidney(2)																																								SO:0001819	synonymous_variant	9682			AB014577	CCDS491.1	1p34.1	2013-01-23	2009-04-06	2009-04-06	ENSG00000066135	ENSG00000066135		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	22978	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 3A"", ""tudor domain containing 14A"""	609764	"""jumonji domain containing 2"", ""jumonji domain containing 2A"""	JMJD2, JMJD2A		9734811, 15138608	Standard	XM_005271354		Approved	KIAA0677, JHDM3A, TDRD14A	uc001cjx.3	O75164	OTTHUMG00000007560	ENST00000372396.3:c.606T>C	1.37:g.44128741T>C			Q5VVB1	Silent	SNP	ENST00000372396.3	37	CCDS491.1																																																																																				0.527	KDM4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019960.1		NM_014663	
KIAA0556	23247	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	27689189	27689189	+	Missense_Mutation	SNP	G	G	T			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr16:27689189G>T	ENST00000261588.4	+	7	699	c.680G>T	c.(679-681)aGa>aTa	p.R227I	CTD-2049O4.1_ENST00000564893.1_RNA|KIAA0556_ENST00000567894.1_3'UTR	NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	227						extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.R227I(4)		breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						GGCCATCCCAGACATGACCGC	0.557																																																	4	Substitution - Missense(4)	kidney(4)											65.0	60.0	62.0					16																	27689189		2197	4300	6497	SO:0001583	missense	23247			AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.680G>T	16.37:g.27689189G>T	ENSP00000261588:p.Arg227Ile		A7E2C2	Missense_Mutation	SNP	ENST00000261588.4	37	CCDS32415.1	.	.	.	.	.	.	.	.	.	.	G	7.441	0.640784	0.14386	.	.	ENSG00000047578	ENST00000261588;ENST00000327217	T	0.47869	0.83	5.48	-1.24	0.09435	.	0.579014	0.17405	N	0.175382	T	0.48277	0.1491	L	0.57536	1.79	0.18873	N	0.999989	D;P	0.53151	0.958;0.799	P;B	0.51135	0.66;0.281	T	0.45673	-0.9245	10	0.51188	T	0.08	-3.8208	9.2233	0.37390	0.481:0.0:0.519:0.0	.	135;227	Q8N803;O60303	.;K0556_HUMAN	I	227;134	ENSP00000261588:R227I	ENSP00000261588:R227I	R	+	2	0	KIAA0556	27596690	0.037000	0.19845	0.001000	0.08648	0.002000	0.02628	0.338000	0.19858	-0.165000	0.10908	-0.793000	0.03317	AGA		0.557	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433724.1		NM_015202	
MTCL1	23255	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	8825236	8825236	+	Missense_Mutation	SNP	C	C	T			TCGA-B2-4099-01A-02D-1458-08	TCGA-B2-4099-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01c54f7c-84b9-4f5b-ae44-2ac1f661fd29	54cf60f2-947e-4eb0-b5a7-1e644ca10dba	g.chr18:8825236C>T	ENST00000306329.11	+	13	4685	c.4685C>T	c.(4684-4686)cCc>cTc	p.P1562L	SOGA2_ENST00000400050.3_Missense_Mutation_p.P1202L|SOGA2_ENST00000359865.3_Missense_Mutation_p.P1243L|SOGA2_ENST00000518815.1_Missense_Mutation_p.P568L|SOGA2_ENST00000517570.1_Missense_Mutation_p.P1202L|SOGA2_ENST00000306285.7_Missense_Mutation_p.P568L														p.P1243L(2)									TGCACCTCCCCCAGGCACTCC	0.662																																																	2	Substitution - Missense(2)	kidney(2)											18.0	21.0	20.0					18																	8825236		2197	4295	6492	SO:0001583	missense	0																														ENST00000306329.11:c.4685C>T	18.37:g.8825236C>T	ENSP00000305027:p.Pro1562Leu			Missense_Mutation	SNP	ENST00000306329.11	37		.	.	.	.	.	.	.	.	.	.	C	3.248	-0.153816	0.06585	.	.	ENSG00000168502	ENST00000306329;ENST00000517570;ENST00000359865;ENST00000400050;ENST00000306285	T;T;T;T	0.29397	2.58;2.58;2.58;1.57	5.24	4.35	0.52113	.	0.802924	0.10887	N	0.623129	T	0.25494	0.0620	L	0.34521	1.04	0.09310	N	1	B;B	0.25955	0.138;0.002	B;B	0.21708	0.036;0.006	T	0.19844	-1.0293	10	0.66056	D	0.02	-4.5397	10.3939	0.44190	0.144:0.6963:0.1596:0.0	.	1553;1243	Q9Y4B5;Q9Y4B5-3	CC165_HUMAN;.	L	1264;1202;1243;1202;568	ENSP00000429556:P1202L;ENSP00000352927:P1243L;ENSP00000382924:P1202L;ENSP00000303670:P568L	ENSP00000303670:P568L	P	+	2	0	CCDC165	8815236	0.805000	0.28982	0.092000	0.20876	0.024000	0.10985	1.319000	0.33655	1.176000	0.42840	0.655000	0.94253	CCC		0.662	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000444141.1			
KIAA0895L	653319	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	67214015	67214015	+	Missense_Mutation	SNP	C	C	T			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr16:67214015C>T	ENST00000290881.7	-	3	1425	c.499G>A	c.(499-501)Gag>Aag	p.E167K	KIAA0895L_ENST00000563831.2_Intron|KIAA0895L_ENST00000563902.1_Missense_Mutation_p.E167K|KIAA0895L_ENST00000561621.1_Missense_Mutation_p.E167K			Q68EN5	K895L_HUMAN	KIAA0895-like	167								p.E167K(2)		breast(2)|endometrium(5)|kidney(2)|large_intestine(3)|lung(2)|prostate(2)|skin(1)	17						TCCTGGTACTCAAACTGTGGA	0.577																																																	2	Substitution - Missense(2)	kidney(2)											109.0	117.0	114.0					16																	67214015		2010	4177	6187	SO:0001583	missense	653319			AK092303	CCDS42177.1	16q22.1	2008-11-27				ENSG00000196123			34408	protein-coding gene	gene with protein product							Standard	NM_001040715		Approved	LOC653319	uc002ert.3	Q68EN5		ENST00000290881.7:c.499G>A	16.37:g.67214015C>T	ENSP00000290881:p.Glu167Lys		A2VCS8|Q8N3H9|Q8NAQ5|Q96IE5	Missense_Mutation	SNP	ENST00000290881.7	37	CCDS42177.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.522689	0.85600	.	.	ENSG00000196123	ENST00000290881	.	.	.	4.92	2.93	0.34026	.	0.102384	0.64402	N	0.000004	T	0.50086	0.1595	L	0.31526	0.94	0.48762	D	0.9997	D;D	0.61697	0.99;0.978	P;P	0.59424	0.857;0.847	T	0.39292	-0.9621	9	0.30854	T	0.27	-16.8564	6.869	0.24111	0.0:0.5643:0.3431:0.0926	.	167;167	Q68EN5-2;Q68EN5	.;K895L_HUMAN	K	167	.	ENSP00000290881:E167K	E	-	1	0	KIAA0895L	65771516	0.998000	0.40836	0.980000	0.43619	0.971000	0.66376	2.645000	0.46621	0.636000	0.30508	0.555000	0.69702	GAG		0.577	KIAA0895L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421193.4		NM_001040715	
KIF19	124602	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	72345372	72345372	+	Missense_Mutation	SNP	G	G	T			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr17:72345372G>T	ENST00000389916.4	+	10	1235	c.1097G>T	c.(1096-1098)aGc>aTc	p.S366I		NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	366					ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)	p.S366I(2)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						CAGTACACCAGCATCATCGCT	0.637																																																	2	Substitution - Missense(2)	kidney(2)											80.0	68.0	72.0					17																	72345372		2203	4300	6503	SO:0001583	missense	124602			AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.1097G>T	17.37:g.72345372G>T	ENSP00000374566:p.Ser366Ile		A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Missense_Mutation	SNP	ENST00000389916.4	37	CCDS32718.2	.	.	.	.	.	.	.	.	.	.	G	12.07	1.828382	0.32329	.	.	ENSG00000196169	ENST00000551294;ENST00000389916	T;T	0.72942	-0.7;-0.7	5.9	-2.07	0.07276	.	.	.	.	.	T	0.66076	0.2753	M	0.61703	1.905	0.09310	N	0.999999	P;P;P;P	0.48016	0.904;0.828;0.708;0.708	B;B;B;B	0.43386	0.418;0.354;0.35;0.188	T	0.59674	-0.7410	9	0.37606	T	0.19	.	11.1295	0.48339	0.4522:0.0:0.5477:0.0	.	366;324;324;366	Q2TAC6;F8VW50;Q2TAC6-3;Q2TAC6-2	KIF19_HUMAN;.;.;.	I	324;366	ENSP00000449134:S324I;ENSP00000374566:S366I	ENSP00000374566:S366I	S	+	2	0	KIF19	69856967	1.000000	0.71417	0.000000	0.03702	0.068000	0.16541	2.130000	0.42064	-0.268000	0.09312	-0.265000	0.10407	AGC		0.637	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319644.2		NM_153209	
KIF1A	547	broad.mit.edu	37	2	241660401	241660401	+	Missense_Mutation	SNP	C	C	A			TCGA-B2-4099-01A-02D-1458-08	TCGA-B2-4099-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01c54f7c-84b9-4f5b-ae44-2ac1f661fd29	54cf60f2-947e-4eb0-b5a7-1e644ca10dba	g.chr2:241660401C>A	ENST00000320389.7	-	43	4653	c.4495G>T	c.(4495-4497)Gtg>Ttg	p.V1499L	KIF1A_ENST00000498729.2_Missense_Mutation_p.V1600L	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A	1499					anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)	p.V1499L(1)		NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		AGAGTGGCCACCCCTAGAGGG	0.647																																																	1	Substitution - Missense(1)	kidney(1)											21.0	27.0	25.0					2																	241660401		2000	4165	6165	SO:0001583	missense	547			AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.4495G>T	2.37:g.241660401C>A	ENSP00000322791:p.Val1499Leu		B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	ENST00000320389.7	37	CCDS46561.1	.	.	.	.	.	.	.	.	.	.	C	7.745	0.702152	0.15172	.	.	ENSG00000130294	ENST00000320389;ENST00000498729;ENST00000373308	T;T	0.71341	-0.48;-0.56	4.02	2.17	0.27698	.	0.403999	0.22033	U	0.065565	T	0.52980	0.1768	L	0.29908	0.895	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.06405	0.002;0.002	T	0.33752	-0.9856	10	0.23891	T	0.37	.	8.1737	0.31270	0.0:0.7492:0.1603:0.0904	.	1600;1499	F5H045;Q12756	.;KIF1A_HUMAN	L	1499;1600;1608	ENSP00000322791:V1499L;ENSP00000438388:V1600L	ENSP00000322791:V1499L	V	-	1	0	KIF1A	241309074	0.000000	0.05858	0.346000	0.25655	0.642000	0.38348	-0.005000	0.12855	0.681000	0.31386	-0.150000	0.13652	GTG		0.647	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3		NM_138483	
KLK14	43847	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	51585845	51585845	+	Missense_Mutation	SNP	T	T	G			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr19:51585845T>G	ENST00000156499.2	-	3	293	c.75A>C	c.(73-75)caA>caC	p.Q25H	KLK14_ENST00000391802.1_Missense_Mutation_p.Q25H			Q9P0G3	KLK14_HUMAN	kallikrein-related peptidase 14	25					epidermis morphogenesis (GO:0048730)|fertilization (GO:0009566)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|proteolysis (GO:0006508)|seminal clot liquefaction (GO:0070684)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)	p.Q25H(2)|p.Q9H(2)		kidney(4)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(1)	11		all_neural(266;0.0199)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00422)		TAGCCAGGACTTGAAGTGCTG	0.542																																					GBM(117;2161 2172 2448 22911)												4	Substitution - Missense(4)	kidney(4)											93.0	93.0	93.0					19																	51585845		1907	4117	6024	SO:0001583	missense	43847			AF283670	CCDS12823.2	19q13.3-q13.4	2008-02-05	2006-10-27		ENSG00000129437	ENSG00000129437		"""Kallikreins"""	6362	protein-coding gene	gene with protein product		606135	"""kallikrein 14"""			16800724, 16800723	Standard	XM_006723224		Approved	KLK-L6	uc002pvs.1	Q9P0G3	OTTHUMG00000143721	ENST00000156499.2:c.75A>C	19.37:g.51585845T>G	ENSP00000156499:p.Gln25His		A7UNK5|Q1RMZ2|Q6B089	Missense_Mutation	SNP	ENST00000156499.2	37	CCDS12823.2	.	.	.	.	.	.	.	.	.	.	.	4.595	0.110625	0.08780	.	.	ENSG00000129437	ENST00000156499;ENST00000391802	D;D	0.92805	-3.11;-3.11	4.88	-3.62	0.04543	.	.	.	.	.	T	0.76118	0.3943	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.64257	-0.6450	9	0.14656	T	0.56	.	2.4392	0.04490	0.1402:0.3795:0.3187:0.1616	.	25	Q9P0G3	KLK14_HUMAN	H	25	ENSP00000156499:Q25H;ENSP00000375678:Q25H	ENSP00000156499:Q25H	Q	-	3	2	KLK14	56277657	0.961000	0.32948	0.016000	0.15963	0.088000	0.18126	0.064000	0.14437	-0.317000	0.08677	0.451000	0.29950	CAA		0.542	KLK14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289774.2		NM_022046	
KRTAP9-2	83899	hgsc.bcm.edu	37	17	39383323	39383334	+	In_Frame_Del	DEL	CTGCTGCCAGCC	CTGCTGCCAGCC	-	rs201521857|rs542786200	byFrequency	TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	CTGCTGCCAGCC	CTGCTGCCAGCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr17:39383323_39383334delCTGCTGCCAGCC	ENST00000377721.3	+	1	424_435	c.417_428delCTGCTGCCAGCC	c.(415-429)aactgctgccagccc>aac	p.CCQP140del	KRTAP9-2_ENST00000455970.2_In_Frame_Del_p.CCQP124del	NM_031961.2	NP_114167.2	Q9BYQ4	KRA92_HUMAN	keratin associated protein 9-2	140	17 X 5 AA repeats of C-C-[RQVSGE]-[SPTQ]- [TASP].					keratin filament (GO:0045095)				large_intestine(1)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	11		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			GTGGCTCCAACTGCTGCCAGCCCTGCTGCCGC	0.613														133	0.0265575	0.0038	0.0519	5008	,	,		19177	0.0		0.0646	False		,,,				2504	0.0276																0																																										SO:0001651	inframe_deletion	83899			AJ406946	CCDS32651.1	17q21.2	2013-06-25			ENSG00000239886	ENSG00000239886		"""Keratin associated proteins"""	16926	protein-coding gene	gene with protein product						11279113	Standard	NM_031961		Approved	KAP9.2	uc002hwf.3	Q9BYQ4	OTTHUMG00000133609	ENST00000377721.3:c.417_428delCTGCTGCCAGCC	17.37:g.39383323_39383334delCTGCTGCCAGCC	ENSP00000366950:p.Cys140_Pro143del		Q17RK8|Q2TB15|Q6ISF6	In_Frame_Del	DEL	ENST00000377721.3	37	CCDS32651.1																																																																																				0.613	KRTAP9-2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257717.1			
GBP1P1	400759	broad.mit.edu	37	1	89890132	89890132	+	RNA	SNP	G	G	A			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr1:89890132G>A	ENST00000513638.1	+	0	873					NR_003133.2				guanylate binding protein 1, interferon-inducible pseudogene 1																		TTGCTTACTTGTACTTTTCAA	0.453																																																	0																																												0					1p22.2	2011-03-09			ENSG00000225492	ENSG00000225492			39561	pseudogene	pseudogene							Standard	NR_003133		Approved		uc009wcy.1		OTTHUMG00000010128		1.37:g.89890132G>A				RNA	SNP	ENST00000513638.1	37																																																																																					0.453	GBP1P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000360073.1		NR_003133	
CERS2	29956	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	150939585	150939585	+	Missense_Mutation	SNP	T	T	C			TCGA-B2-4099-01A-02D-1458-08	TCGA-B2-4099-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01c54f7c-84b9-4f5b-ae44-2ac1f661fd29	54cf60f2-947e-4eb0-b5a7-1e644ca10dba	g.chr1:150939585T>C	ENST00000271688.6	-	8	1092	c.706A>G	c.(706-708)Atg>Gtg	p.M236V	CERS2_ENST00000561294.1_Missense_Mutation_p.M227V|CERS2_ENST00000345896.4_5'UTR|RP11-316M1.12_ENST00000560481.1_RNA|RP11-316M1.12_ENST00000561111.1_RNA|CERS2_ENST00000368954.5_Missense_Mutation_p.M236V	NM_181746.3	NP_859530.1	Q96G23	CERS2_HUMAN	ceramide synthase 2	236	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear membrane (GO:0031965)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)	p.M236V(2)									TGCAGAGCCATGATTAGAGTC	0.488																																																	2	Substitution - Missense(2)	kidney(2)											97.0	93.0	95.0					1																	150939585		2203	4300	6503	SO:0001583	missense	0			AF189062	CCDS973.1	1q21.3	2012-09-20	2011-07-08	2011-07-08	ENSG00000143418	ENSG00000143418		"""Homeoboxes / CERS class"""	14076	protein-coding gene	gene with protein product		606920	"""longevity assurance (LAG1, S. cerevisiae) homolog 2"", ""LAG1 longevity assurance homolog 2 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 2"""	LASS2		11543633	Standard	NM_181746		Approved	SP260, FLJ10243	uc001evz.3	Q96G23	OTTHUMG00000035064	ENST00000271688.6:c.706A>G	1.37:g.150939585T>C	ENSP00000271688:p.Met236Val		D3DV06|Q5SZE5|Q9HD96|Q9NW79	Missense_Mutation	SNP	ENST00000271688.6	37	CCDS973.1	.	.	.	.	.	.	.	.	.	.	T	16.34	3.096317	0.56075	.	.	ENSG00000143418	ENST00000368954;ENST00000271688;ENST00000345896;ENST00000368949;ENST00000361419	D;D;D;D;D	0.85861	-2.04;-2.04;-2.04;-2.04;-2.04	5.42	5.42	0.78866	TRAM/LAG1/CLN8 homology domain (3);	0.000000	0.85682	D	0.000000	T	0.82208	0.4987	M	0.82323	2.585	0.80722	D	1	P	0.38148	0.62	B	0.36378	0.223	D	0.86292	0.1674	10	0.87932	D	0	-25.1355	15.1277	0.72494	0.0:0.0:0.0:1.0	.	236	Q96G23	CERS2_HUMAN	V	236;236;86;256;236	ENSP00000357950:M236V;ENSP00000271688:M236V;ENSP00000337842:M86V;ENSP00000357945:M256V;ENSP00000355020:M236V	ENSP00000271688:M236V	M	-	1	0	CERS2	149206209	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	3.980000	0.56895	2.058000	0.61347	0.533000	0.62120	ATG		0.488	CERS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084897.2		NM_022075	
MAD2L1	4085	broad.mit.edu;hgsc.bcm.edu	37	4	120981284	120981284	+	Missense_Mutation	SNP	C	C	T			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr4:120981284C>T	ENST00000296509.6	-	5	946	c.607G>A	c.(607-609)Gtc>Atc	p.V203I		NM_002358.3	NP_002349.1	Q13257	MD2L1_HUMAN	MAD2 mitotic arrest deficient-like 1 (yeast)	203	Required for assuming the closed conformation and for interaction with CDC20.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of apoptotic process (GO:0043066)|negative regulation of mitotic anaphase-promoting complex activity (GO:0060564)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)	p.V203I(2)		breast(2)|kidney(2)|large_intestine(2)|lung(3)	9						CAGTCATTGACAGGAATTTTG	0.353																																																	2	Substitution - Missense(2)	kidney(2)											125.0	120.0	122.0					4																	120981284		2203	4300	6503	SO:0001583	missense	4085			U65410	CCDS3715.1	4q27	2013-01-17	2001-11-28		ENSG00000164109	ENSG00000164109			6763	protein-coding gene	gene with protein product		601467	"""MAD2 (mitotic arrest deficient, yeast, homolog)-like 1"""			8824189, 9345911	Standard	NM_002358		Approved	MAD2, HSMAD2	uc003idl.2	Q13257	OTTHUMG00000132967	ENST00000296509.6:c.607G>A	4.37:g.120981284C>T	ENSP00000296509:p.Val203Ile		Q53F56|Q548X9|Q6IRW7|Q8IZX3	Missense_Mutation	SNP	ENST00000296509.6	37	CCDS3715.1	.	.	.	.	.	.	.	.	.	.	C	14.25	2.480158	0.44044	.	.	ENSG00000164109	ENST00000296509	.	.	.	5.13	4.29	0.51040	DNA-binding HORMA (1);	0.461170	0.23219	N	0.050583	T	0.26159	0.0638	N	0.14661	0.345	0.23620	N	0.997279	B	0.13594	0.008	B	0.08055	0.003	T	0.14671	-1.0464	9	0.37606	T	0.19	-7.8462	11.6639	0.51363	0.0:0.9124:0.0:0.0876	.	203	Q13257	MD2L1_HUMAN	I	203	.	ENSP00000296509:V203I	V	-	1	0	MAD2L1	121200732	1.000000	0.71417	0.999000	0.59377	0.982000	0.71751	2.168000	0.42424	1.293000	0.44690	0.591000	0.81541	GTC		0.353	MAD2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256525.2			
MGST3	4259	hgsc.bcm.edu	37	1	165624711	165624712	+	Frame_Shift_Ins	INS	-	-	T			TCGA-B2-4099-01A-02D-1458-08	TCGA-B2-4099-10A-01D-1458-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01c54f7c-84b9-4f5b-ae44-2ac1f661fd29	54cf60f2-947e-4eb0-b5a7-1e644ca10dba	g.chr1:165624711_165624712insT	ENST00000367889.3	+	6	869_870	c.429_430insT	c.(430-432)ttgfs	p.L144fs	MGST3_ENST00000367884.2_Frame_Shift_Ins_p.L144fs|MGST3_ENST00000367885.1_Frame_Shift_Ins_p.L158fs|MGST3_ENST00000367883.1_Frame_Shift_Ins_p.L158fs|MGST3_ENST00000367886.2_Frame_Shift_Ins_p.L158fs|MGST3_ENST00000367888.4_Intron	NM_004528.3	NP_004519.1	O14880	MGST3_HUMAN	microsomal glutathione S-transferase 3	144					glutathione derivative biosynthetic process (GO:1901687)|lipid metabolic process (GO:0006629)|oxidation-reduction process (GO:0055114)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear envelope (GO:0005635)	glutathione peroxidase activity (GO:0004602)|glutathione transferase activity (GO:0004364)|peroxidase activity (GO:0004601)			endometrium(1)|large_intestine(1)|lung(3)|prostate(1)	6	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				Glutathione(DB00143)	TTAAAAGTGGCTTGGGCAGTGG	0.455																																																	0																																										SO:0001589	frameshift_variant	4259			AF026977	CCDS1249.1	1q23	2012-06-21			ENSG00000143198	ENSG00000143198	2.5.1.18	"""Glutathione S-transferases / Microsomal"""	7064	protein-coding gene	gene with protein product	"""microsomal glutathione S-transferase III"", ""microsomal GST-3"", ""microsomal GST-III"""	604564				9278457	Standard	NM_004528		Approved	GST-III	uc001gdf.3	O14880	OTTHUMG00000034627	ENST00000367889.3:c.431dupT	1.37:g.165624713_165624713dupT	ENSP00000356864:p.Leu144fs		B2R592|Q6ICN4	Frame_Shift_Ins	INS	ENST00000367889.3	37	CCDS1249.1																																																																																				0.455	MGST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083797.3		NM_004528	
MICALCL	84953	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	12376331	12376331	+	Splice_Site	SNP	G	G	T			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr11:12376331G>T	ENST00000256186.2	+	8	2121	c.1830G>T	c.(1828-1830)atG>atT	p.M610I		NM_032867.2	NP_116256.2	Q6ZW33	MICLK_HUMAN	MICAL C-terminal like	610					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	mitogen-activated protein kinase binding (GO:0051019)	p.M610I(2)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(5)|lung(5)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	30				Epithelial(150;0.00177)		TCTCACCCAGGGCCCAGGAAC	0.403																																																	2	Substitution - Missense(2)	kidney(2)											57.0	55.0	55.0					11																	12376331		1827	4079	5906	SO:0001630	splice_region_variant	84953			BK000463	CCDS41620.1	11p15.3	2005-11-01			ENSG00000133808	ENSG00000133808			25933	protein-coding gene	gene with protein product		612355				12110185	Standard	NM_032867		Approved	FLJ14966	uc001mkg.1	Q6ZW33	OTTHUMG00000165777	ENST00000256186.2:c.1830-1G>T	11.37:g.12376331G>T			Q7RTP7|Q96JU6	Missense_Mutation	SNP	ENST00000256186.2	37	CCDS41620.1	.	.	.	.	.	.	.	.	.	.	G	11.16	1.556037	0.27827	.	.	ENSG00000133808	ENST00000256186	T	0.41758	0.99	5.81	5.81	0.92471	Domain of unknown function DUF3585 (1);	0.220439	0.22437	U	0.060069	T	0.29882	0.0747	N	0.25992	0.78	0.80722	D	1	B	0.19583	0.037	B	0.21546	0.035	T	0.08932	-1.0698	9	.	.	.	.	11.4179	0.49962	0.1132:0.0:0.8868:0.0	.	610	Q6ZW33	MICLK_HUMAN	I	610	ENSP00000256186:M610I	.	M	+	3	0	MICALCL	12332907	1.000000	0.71417	1.000000	0.80357	0.453000	0.32348	3.259000	0.51515	2.738000	0.93877	0.655000	0.94253	ATG		0.403	MICALCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386164.1		NM_032867	Missense_Mutation
MYH8	4626	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	10299727	10299727	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr17:10299727G>A	ENST00000403437.2	-	33	4667	c.4573C>T	c.(4573-4575)Caa>Taa	p.Q1525*	RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	1525					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)	p.Q1525*(2)		NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						TCATGAATTTGCTTTCCTCCC	0.408									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																																								2	Substitution - Nonsense(2)	kidney(2)											150.0	134.0	140.0					17																	10299727		2203	4300	6503	SO:0001587	stop_gained	4626	Familial Cancer Database	Carney Complex Variant		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.4573C>T	17.37:g.10299727G>A	ENSP00000384330:p.Gln1525*		Q14910	Nonsense_Mutation	SNP	ENST00000403437.2	37	CCDS11153.1	.	.	.	.	.	.	.	.	.	.	G	43	9.922481	0.99297	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	.	.	.	5.26	5.26	0.73747	.	0.761515	0.10824	U	0.630176	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	9.2401	0.37491	0.0:0.1999:0.6623:0.1378	.	.	.	.	X	1525	.	ENSP00000252173:Q1525X	Q	-	1	0	MYH8	10240452	0.946000	0.32159	1.000000	0.80357	0.939000	0.58152	2.059000	0.41384	2.744000	0.94065	0.650000	0.86243	CAA		0.408	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252724.2		NM_002472	
MYT1L	23040	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	1926721	1926721	+	Missense_Mutation	SNP	C	C	T			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr2:1926721C>T	ENST00000399161.2	-	10	1567	c.820G>A	c.(820-822)Gtt>Att	p.V274I	MYT1L_ENST00000428368.2_Missense_Mutation_p.V274I	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	274					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.V274I(2)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		GAGAGCACAACACCGTGTCCT	0.428																																																	2	Substitution - Missense(2)	kidney(2)											203.0	197.0	199.0					2																	1926721		1999	4175	6174	SO:0001583	missense	23040			AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.820G>A	2.37:g.1926721C>T	ENSP00000382114:p.Val274Ile		A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	ENST00000399161.2	37		.	.	.	.	.	.	.	.	.	.	C	13.68	2.309365	0.40895	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	T;T	0.48201	0.82;0.82	5.87	5.87	0.94306	.	0.343543	0.29892	N	0.010937	T	0.36524	0.0970	N	0.24115	0.695	0.51767	D	0.99993	P;P	0.39782	0.688;0.571	B;B	0.33750	0.169;0.163	T	0.16100	-1.0414	10	0.39692	T	0.17	-24.9365	20.2033	0.98269	0.0:1.0:0.0:0.0	.	274;274	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	I	274;222;274	ENSP00000382114:V274I;ENSP00000396103:V274I	ENSP00000295067:V222I	V	-	1	0	MYT1L	1905728	1.000000	0.71417	0.115000	0.21578	0.184000	0.23303	7.744000	0.85034	2.779000	0.95612	0.655000	0.94253	GTT		0.428	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1		NM_015025	
NEURL3	93082	broad.mit.edu	37	2	97166139	97166139	+	RNA	DEL	C	C	-			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr2:97166139delC	ENST00000310865.3	-	0	752							A8MQ27	NEU1B_HUMAN	neuralized E3 ubiquitin protein ligase 3						Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)										GCCCCCATCTCCCCACCTCCC	0.632																																																	0													11.0	13.0	12.0					2																	97166139		1999	4157	6156			93082				CCDS74541.1, CCDS74542.1	2q11.2	2013-10-24	2013-10-24		ENSG00000163121	ENSG00000163121			25162	protein-coding gene	gene with protein product			"""neuralized homolog 3 (Drosophila) pseudogene"""			15936721	Standard	NM_001285486		Approved	Lincr, LOC93082	uc010yuo.2	Q96EH8	OTTHUMG00000128645		2.37:g.97166139delC			C9DQJ5|C9DQJ6|C9DQJ7	Frame_Shift_Del	DEL	ENST00000310865.3	37																																																																																					0.632	NEURL3-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000250521.1		NM_138397	
NHS	4810	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	17746842	17746842	+	Silent	SNP	C	C	T			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chrX:17746842C>T	ENST00000380060.3	+	7	4571	c.4233C>T	c.(4231-4233)ttC>ttT	p.F1411F	NHS_ENST00000398097.3_Silent_p.F1255F	NM_198270.2	NP_938011.1	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome (congenital cataracts and dental anomalies)	1432					cell differentiation (GO:0030154)|lens development in camera-type eye (GO:0002088)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.F1411F(2)|p.F1255F(2)		breast(5)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(26)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	71	Hepatocellular(33;0.183)					AGGGTGTGTTCGTGTCTCCAA	0.418													C|||	1	0.000264901	0.0	0.0	3775	,	,		13319	0.0		0.0	False		,,,				2504	0.001																4	Substitution - coding silent(4)	kidney(4)											96.0	86.0	89.0					X																	17746842		2203	4300	6503	SO:0001819	synonymous_variant	4810				CCDS14181.1, CCDS48087.1	Xp22.3-p21.1	2014-06-18			ENSG00000188158	ENSG00000188158			7820	protein-coding gene	gene with protein product		300457					Standard	NM_001136024		Approved		uc004cxx.3	Q6T4R5	OTTHUMG00000022799	ENST00000380060.3:c.4233C>T	X.37:g.17746842C>T			B7ZVX8|E2DH69|Q5J7Q0|Q5J7Q1|Q68DR5	Silent	SNP	ENST00000380060.3	37	CCDS14181.1																																																																																				0.418	NHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059120.1		NM_198270	
NOSIP	51070	broad.mit.edu;hgsc.bcm.edu	37	19	50060397	50060397	+	Missense_Mutation	SNP	C	C	G			TCGA-B2-4099-01A-02D-1458-08	TCGA-B2-4099-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01c54f7c-84b9-4f5b-ae44-2ac1f661fd29	54cf60f2-947e-4eb0-b5a7-1e644ca10dba	g.chr19:50060397C>G	ENST00000596358.1	-	5	426	c.368G>C	c.(367-369)aGc>aCc	p.S123T	NOSIP_ENST00000339093.3_Missense_Mutation_p.S123T|NOSIP_ENST00000391853.3_Missense_Mutation_p.S123T	NM_001270960.1	NP_001257889.1	Q9Y314	NOSIP_HUMAN	nitric oxide synthase interacting protein	123					negative regulation of catalytic activity (GO:0043086)|negative regulation of nitric-oxide synthase activity (GO:0051001)|nitric oxide metabolic process (GO:0046209)|regulation of nitric-oxide synthase activity (GO:0050999)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.S123T(2)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|ovary(1)|skin(2)|urinary_tract(1)	11		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00321)|GBM - Glioblastoma multiforme(134;0.0133)		GAGGGGCCGGCTCACGATAGC	0.697																																																	2	Substitution - Missense(2)	kidney(2)											25.0	28.0	27.0					19																	50060397		2203	4300	6503	SO:0001583	missense	51070			AF132959	CCDS12772.1	19q13.3	2008-02-05				ENSG00000142546			17946	protein-coding gene	gene with protein product						11149895, 10810093	Standard	NM_015953		Approved	CGI-25	uc002pol.4	Q9Y314		ENST00000596358.1:c.368G>C	19.37:g.50060397C>G	ENSP00000470034:p.Ser123Thr		Q96FD2	Missense_Mutation	SNP	ENST00000596358.1	37	CCDS12772.1	.	.	.	.	.	.	.	.	.	.	C	10.22	1.290280	0.23478	.	.	ENSG00000142546	ENST00000339093;ENST00000391853	T;T	0.78003	-1.14;-1.14	5.15	4.05	0.47172	.	0.104089	0.64402	D	0.000004	T	0.69860	0.3158	L	0.39514	1.22	0.58432	D	0.999998	D	0.52996	0.957	P	0.45712	0.491	T	0.66348	-0.5946	10	0.10636	T	0.68	-55.6421	14.0315	0.64617	0.0:0.8475:0.1524:0.0	.	123	Q9Y314	NOSIP_HUMAN	T	123	ENSP00000343497:S123T;ENSP00000375726:S123T	ENSP00000343497:S123T	S	-	2	0	NOSIP	54752209	1.000000	0.71417	1.000000	0.80357	0.067000	0.16453	1.868000	0.39509	2.409000	0.81822	0.462000	0.41574	AGC		0.697	NOSIP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465423.1			
NOXO1	124056	hgsc.bcm.edu	37	16	2031172	2031173	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B2-4099-01A-02D-1458-08	TCGA-B2-4099-10A-01D-1458-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01c54f7c-84b9-4f5b-ae44-2ac1f661fd29	54cf60f2-947e-4eb0-b5a7-1e644ca10dba	g.chr16:2031172_2031173insC	ENST00000397280.4	-	1	11_12	c.8_9insG	c.(7-9)ggcfs	p.G3fs	NOXO1_ENST00000356120.4_Frame_Shift_Ins_p.G3fs|TBL3_ENST00000568546.1_3'UTR|AC005606.1_ENST00000598236.1_5'Flank|NOXO1_ENST00000566005.1_Frame_Shift_Ins_p.G3fs|NOXO1_ENST00000354249.4_Frame_Shift_Ins_p.G3fs			Q8NFA2	NOXO1_HUMAN	NADPH oxidase organizer 1	3	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				extracellular matrix disassembly (GO:0022617)|regulation of hydrogen peroxide metabolic process (GO:0010310)|regulation of respiratory burst (GO:0060263)|superoxide metabolic process (GO:0006801)	NADPH oxidase complex (GO:0043020)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)|phospholipid binding (GO:0005543)|superoxide-generating NADPH oxidase activator activity (GO:0016176)			lung(2)	2					Ecabet(DB05265)	GGTATCGGGGGCCTGCCATGGC	0.614																																					Pancreas(104;2811 2841 4129)|Esophageal Squamous(25;910 1225 43728)												0																																										SO:0001589	frameshift_variant	124056			AF532985	CCDS10454.1, CCDS10455.1, CCDS42101.1, CCDS58406.1	16p13.3	2008-02-05			ENSG00000196408	ENSG00000196408			19404	protein-coding gene	gene with protein product		611256					Standard	NM_144603		Approved	P41NOXA, P41NOXB, P41NOXC, SH3PXD5, SNX28	uc002cnx.4	Q8NFA2	OTTHUMG00000128707	ENST00000397280.4:c.9dupG	16.37:g.2031174_2031174dupC	ENSP00000380450:p.Gly3fs		Q86YM1|Q8NFA3|Q96B73	Frame_Shift_Ins	INS	ENST00000397280.4	37	CCDS42101.1																																																																																				0.614	NOXO1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250612.1			
NPM3	10360	hgsc.bcm.edu;ucsc.edu	37	10	103542318	103542319	+	Frame_Shift_Ins	INS	-	-	A			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr10:103542318_103542319insA	ENST00000370110.5	-	3	262_263	c.240_241insT	c.(238-243)aatgtgfs	p.V81fs	NPM3_ENST00000474993.1_5'UTR	NM_006993.2	NP_008924.1	O75607	NPM3_HUMAN	nucleophosmin/nucleoplasmin 3	81					rRNA processing (GO:0006364)|rRNA transcription (GO:0009303)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			large_intestine(3)|lung(1)|skin(1)	5		Colorectal(252;0.122)		Epithelial(162;3.94e-09)|all cancers(201;2.13e-07)		ACTTCTACCACATTACACTCGT	0.569																																																	0																																										SO:0001589	frameshift_variant	10360			AY049737	CCDS7519.1	10q24.31	2009-08-27	2009-08-27		ENSG00000107833	ENSG00000107833			7931	protein-coding gene	gene with protein product		606456				11722795	Standard	NM_006993		Approved		uc001ktt.3	O75607	OTTHUMG00000018942	ENST00000370110.5:c.241dupT	10.37:g.103542319_103542319dupA	ENSP00000359128:p.Val81fs		Q9UNY6	Frame_Shift_Ins	INS	ENST00000370110.5	37	CCDS7519.1																																																																																				0.569	NPM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050003.2		NM_006993	
NSD1	64324	broad.mit.edu;hgsc.bcm.edu	37	5	176665505	176665505	+	Missense_Mutation	SNP	C	C	G			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr5:176665505C>G	ENST00000439151.2	+	7	4234	c.4189C>G	c.(4189-4191)Cca>Gca	p.P1397A	NSD1_ENST00000347982.4_Missense_Mutation_p.P1128A|NSD1_ENST00000361032.4_Missense_Mutation_p.P1294A|NSD1_ENST00000354179.4_Missense_Mutation_p.P1128A	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	1397				P -> Q (in Ref. 3; AAK92049). {ECO:0000305}.	gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.P1397A(4)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		AGTTAAAACGCCAGGTAAGGT	0.478			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																														Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	4	Substitution - Missense(4)	kidney(4)											80.0	81.0	81.0					5																	176665505		2203	4300	6503	SO:0001583	missense	64324	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.4189C>G	5.37:g.176665505C>G	ENSP00000395929:p.Pro1397Ala		Q96PD8|Q96RN7	Missense_Mutation	SNP	ENST00000439151.2	37	CCDS4412.1	.	.	.	.	.	.	.	.	.	.	C	10.76	1.439907	0.25900	.	.	ENSG00000165671	ENST00000354179;ENST00000439151;ENST00000347982;ENST00000361032	D;D;D;D	0.93019	-3.04;-3.07;-3.04;-3.15	5.44	3.33	0.38152	.	0.304822	0.28901	N	0.013764	D	0.83599	0.5289	N	0.14661	0.345	0.29566	N	0.850247	B;B;B	0.20988	0.005;0.05;0.01	B;B;B	0.13407	0.009;0.009;0.006	T	0.74481	-0.3651	10	0.36615	T	0.2	.	5.1439	0.14973	0.2005:0.6795:0.0:0.12	.	1128;1294;1397	Q96L73-2;Q96L73-3;Q96L73	.;.;NSD1_HUMAN	A	1128;1397;1128;1294	ENSP00000346111:P1128A;ENSP00000395929:P1397A;ENSP00000343209:P1128A;ENSP00000354310:P1294A	ENSP00000343209:P1128A	P	+	1	0	NSD1	176598111	0.998000	0.40836	0.999000	0.59377	0.994000	0.84299	0.358000	0.20216	0.763000	0.33175	0.655000	0.94253	CCA		0.478	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253412.2		NM_172349	
OR56A4	120793	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	6024124	6024124	+	Silent	SNP	G	G	A			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr11:6024124G>A	ENST00000330728.4	-	1	300	c.255C>T	c.(253-255)ccC>ccT	p.P85P		NM_001005179.2	NP_001005179.2	Q8NGH8	O56A4_HUMAN	olfactory receptor, family 56, subfamily A, member 4	33						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P85P(2)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(4)|large_intestine(5)|lung(17)|ovary(1)|skin(1)|urinary_tract(1)	32		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GAAGGCTGAGGGGCAGAGACA	0.582																																																	2	Substitution - coding silent(2)	kidney(2)											84.0	80.0	81.0					11																	6024124		2201	4296	6497	SO:0001819	synonymous_variant	120793			BK004255	CCDS31404.1	11p15.4	2012-08-09			ENSG00000183389	ENSG00000183389		"""GPCR / Class A : Olfactory receptors"""	14791	protein-coding gene	gene with protein product							Standard	NM_001005179		Approved		uc010qzv.2	Q8NGH8	OTTHUMG00000165376	ENST00000330728.4:c.255C>T	11.37:g.6024124G>A			B9EH17	Silent	SNP	ENST00000330728.4	37	CCDS31404.1																																																																																				0.582	OR56A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383756.2		NM_001005179	
OR5H1	26341	hgsc.bcm.edu;ucsc.edu	37	3	97852455	97852456	+	Frame_Shift_Ins	INS	-	-	A			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr3:97852455_97852456insA	ENST00000354565.2	+	1	914_915	c.914_915insA	c.(913-918)ttaaaafs	p.LK305fs	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005338.1	NP_001005338.1	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H, member 1	305						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H308fs*3(1)		breast(1)|endometrium(7)|kidney(8)|large_intestine(3)|lung(13)|ovary(1)|skin(1)	34						ACAAAAATGTTAAAAAAACATG	0.322																																																	1	Insertion - Frameshift(1)	large_intestine(1)																																								SO:0001589	frameshift_variant	26341			X64988	CCDS33797.1	3q12.1	2012-08-09			ENSG00000231192	ENSG00000231192		"""GPCR / Class A : Olfactory receptors"""	8346	protein-coding gene	gene with protein product						1370859	Standard	NM_001005338		Approved	HTPCRX14, HSHTPCRX14	uc011bgt.2	A6NKK0	OTTHUMG00000160070	ENST00000354565.2:c.921dupA	3.37:g.97852462_97852462dupA	ENSP00000346575:p.Leu305fs			Frame_Shift_Ins	INS	ENST00000354565.2	37	CCDS33797.1																																																																																				0.322	OR5H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359100.2		NM_001005338	
PABPC1P2	728773	broad.mit.edu	37	2	147346046	147346046	+	IGR	SNP	C	C	A			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr2:147346046C>A								RNU7-2P (443261 upstream) : AC103881.1 (249270 downstream)														p.A169E(1)									GTAGCTAAAGCAGTTACAGCA	0.438																																																	1	Substitution - Missense(1)	kidney(1)																																								SO:0001628	intergenic_variant	728773																															2.37:g.147346046C>A				Missense_Mutation	SNP		37																																																																																				0	0.438									
PBRM1	55193	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	52620529	52620550	+	Frame_Shift_Del	DEL	ACAGAGGCCACGCGAACCACAG	ACAGAGGCCACGCGAACCACAG	-	rs143085435|rs201156614|rs141958485		TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	ACAGAGGCCACGCGAACCACAG	ACAGAGGCCACGCGAACCACAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr3:52620529_52620550delACAGAGGCCACGCGAACCACAG	ENST00000296302.7	-	20	3279_3300	c.3278_3299delCTGTGGTTCGCGTGGCCTCTGT	c.(3277-3300)cctgtggttcgcgtggcctctgtafs	p.PVVRVASV1093fs	PBRM1_ENST00000409767.1_Frame_Shift_Del_p.PVVRVASV1108fs|PBRM1_ENST00000394830.3_Frame_Shift_Del_p.PVVRVASV1068fs|PBRM1_ENST00000356770.4_Frame_Shift_Del_p.PVVRVASV1061fs|PBRM1_ENST00000409114.3_Frame_Shift_Del_p.PVVRVASV1108fs|PBRM1_ENST00000409057.1_Frame_Shift_Del_p.PVVRVASV1093fs|PBRM1_ENST00000410007.1_Frame_Shift_Del_p.PVVRVASV1068fs|PBRM1_ENST00000337303.4_Frame_Shift_Del_p.PVVRVASV1093fs			Q86U86	PB1_HUMAN	polybromo 1	1093					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.V1094fs*13(2)|p.V1062fs*13(1)		breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		ATTTGCAAATACAGAGGCCACGCGAACCACAGGCAGAGGCAC	0.437			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	3	Insertion - Frameshift(3)	kidney(3)																																								SO:0001589	frameshift_variant	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.3278_3299delCTGTGGTTCGCGTGGCCTCTGT	3.37:g.52620529_52620550delACAGAGGCCACGCGAACCACAG	ENSP00000296302:p.Pro1093fs		A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Frame_Shift_Del	DEL	ENST00000296302.7	37																																																																																					0.437	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	
PCDHB6	56130	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	140532190	140532190	+	Silent	SNP	C	C	A	rs146937630		TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr5:140532190C>A	ENST00000231136.1	+	1	2352	c.2352C>A	c.(2350-2352)acC>acA	p.T784T	PCDHB6_ENST00000543635.1_Silent_p.T648T	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	784					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.T784T(3)		cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGGAAGAAACCCCCACCTCTC	0.433																																																	3	Substitution - coding silent(3)	kidney(2)|skin(1)											90.0	99.0	96.0					5																	140532190		2202	4300	6502	SO:0001819	synonymous_variant	56130			AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.2352C>A	5.37:g.140532190C>A			B2R8R9	Silent	SNP	ENST00000231136.1	37	CCDS4248.1																																																																																				0.433	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251818.2		NM_018939	
PCDHGA8	9708	broad.mit.edu	37	5	140774176	140774176	+	Missense_Mutation	SNP	G	G	T			TCGA-B2-4099-01A-02D-1458-08	TCGA-B2-4099-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01c54f7c-84b9-4f5b-ae44-2ac1f661fd29	54cf60f2-947e-4eb0-b5a7-1e644ca10dba	g.chr5:140774176G>T	ENST00000398604.2	+	1	1796	c.1796G>T	c.(1795-1797)gGc>gTc	p.G599V	PCDHGB3_ENST00000576222.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB4_ENST00000519479.1_Intron	NM_032088.1	NP_114477.1	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8	599	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G599V(3)		endometrium(6)|kidney(6)|large_intestine(6)|lung(30)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGAGACTCGGGCCAGAACGCC	0.706																																																	3	Substitution - Missense(3)	kidney(3)																																								SO:0001583	missense	9708			AF152515	CCDS47291.1, CCDS75338.1	5q31	2010-01-26			ENSG00000253767	ENSG00000253767		"""Cadherins / Protocadherins : Clustered"""	8706	other	protocadherin		606295				10380929	Standard	NM_014004		Approved	KIAA0327, PCDH-GAMMA-A8		Q9Y5G5	OTTHUMG00000164053	ENST00000398604.2:c.1796G>T	5.37:g.140774176G>T	ENSP00000381605:p.Gly599Val		A7MCZ4|O15039	Missense_Mutation	SNP	ENST00000398604.2	37	CCDS47291.1	.	.	.	.	.	.	.	.	.	.	.	18.62	3.662262	0.67700	.	.	ENSG00000253767	ENST00000398604	T	0.21361	2.01	4.96	4.96	0.65561	Cadherin (4);Cadherin-like (1);	0.000000	0.31624	U	0.007336	T	0.68751	0.3035	H	0.99697	4.71	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85054	0.0930	10	0.87932	D	0	.	17.843	0.88720	0.0:0.0:1.0:0.0	.	599;599	Q9Y5G5;Q9Y5G5-2	PCDG8_HUMAN;.	V	599	ENSP00000381605:G599V	ENSP00000381605:G599V	G	+	2	0	PCDHGA8	140754360	1.000000	0.71417	0.974000	0.42286	0.997000	0.91878	7.609000	0.82925	2.308000	0.77769	0.655000	0.94253	GGC		0.706	PCDHGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376972.1		NM_032088	
PF4	5196	broad.mit.edu	37	4	74847209	74847209	+	Missense_Mutation	SNP	G	G	A			TCGA-B2-4099-01A-02D-1458-08	TCGA-B2-4099-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01c54f7c-84b9-4f5b-ae44-2ac1f661fd29	54cf60f2-947e-4eb0-b5a7-1e644ca10dba	g.chr4:74847209G>A	ENST00000296029.3	-	2	313	c.143C>T	c.(142-144)tCc>tTc	p.S48F		NM_002619.3	NP_002610.1	P02776	PLF4_HUMAN	platelet factor 4	48					blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|leukocyte chemotaxis (GO:0030595)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cytolysis (GO:0045918)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of megakaryocyte differentiation (GO:0045653)|negative regulation of MHC class II biosynthetic process (GO:0045347)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cAMP metabolic process (GO:0030816)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cell proliferation (GO:0042127)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|platelet alpha granule lumen (GO:0031093)	chemokine activity (GO:0008009)|CXCR3 chemokine receptor binding (GO:0048248)|heparin binding (GO:0008201)	p.S48F(1)		kidney(1)|lung(1)	2	Breast(15;0.00136)		all cancers(17;0.0034)|Lung(101;0.196)		Drotrecogin alfa(DB00055)	ACGGACCTGGGAGGTGGTCTT	0.602																																																	1	Substitution - Missense(1)	kidney(1)											68.0	62.0	64.0					4																	74847209		2203	4296	6499	SO:0001583	missense	5196			M25897	CCDS3562.1	4q12-q21	2012-10-02	2008-08-29		ENSG00000163737	ENSG00000163737			8861	protein-coding gene	gene with protein product	"""chemokine (C-X-C motif) ligand 4"""	173460	"""platelet factor 4"""			3622011	Standard	NM_002619		Approved	SCYB4, CXCL4	uc003hhi.3	P02776	OTTHUMG00000130009	ENST00000296029.3:c.143C>T	4.37:g.74847209G>A	ENSP00000296029:p.Ser48Phe		Q53X61|Q9UC64|Q9UC65	Missense_Mutation	SNP	ENST00000296029.3	37	CCDS3562.1	.	.	.	.	.	.	.	.	.	.	G	17.89	3.500403	0.64298	.	.	ENSG00000163737	ENST00000296029	T	0.06068	3.35	2.63	1.63	0.23807	CXC chemokine, conserved site (1);Chemokine interleukin-8-like domain (3);	0.576564	0.18332	N	0.144449	T	0.24470	0.0593	M	0.89904	3.07	0.09310	N	1	D	0.89917	1.0	D	0.79108	0.992	T	0.01795	-1.1272	10	0.87932	D	0	.	5.9293	0.19130	0.0:0.0:0.69:0.31	.	48	P02776	PLF4_HUMAN	F	48	ENSP00000296029:S48F	ENSP00000296029:S48F	S	-	2	0	PF4	75066073	0.001000	0.12720	0.002000	0.10522	0.978000	0.69477	0.727000	0.25999	1.472000	0.48140	0.305000	0.20034	TCC		0.602	PF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252282.1			
PIGO	84720	broad.mit.edu	37	9	35095479	35095479	+	Silent	SNP	G	G	A			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr9:35095479G>A	ENST00000378617.3	-	2	478	c.84C>T	c.(82-84)ttC>ttT	p.F28F	PIGO_ENST00000298004.5_Silent_p.F28F|PIGO_ENST00000341666.3_Silent_p.F28F|PIGO_ENST00000492770.1_5'UTR|RP11-182N22.8_ENST00000431804.1_RNA|PIGO_ENST00000361778.2_Silent_p.F28F	NM_032634.3	NP_116023.2	Q8TEQ8	PIGO_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class O	28					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)	p.F28F(1)		endometrium(3)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)	38			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			GGGTGAGCAGGAAGCCACTGG	0.617																																																	1	Substitution - coding silent(1)	kidney(1)											27.0	28.0	28.0					9																	35095479		2203	4300	6503	SO:0001819	synonymous_variant	84720			AB083625	CCDS6575.1, CCDS6576.1	9p13.2	2013-02-26	2006-06-28		ENSG00000165282	ENSG00000165282		"""Phosphatidylinositol glycan anchor biosynthesis"""	23215	protein-coding gene	gene with protein product		614730	"""phosphatidylinositol glycan, class O"""			10781593	Standard	NM_032634		Approved	DKFZp434M222, FLJ00135	uc003zwd.3	Q8TEQ8	OTTHUMG00000019854	ENST00000378617.3:c.84C>T	9.37:g.35095479G>A			B1AML3|Q6P154|Q6UX80|Q8TDS8|Q96CS9|Q9BVN9|Q9Y4B0	Silent	SNP	ENST00000378617.3	37	CCDS6575.1																																																																																				0.617	PIGO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052284.1		NM_032634	
POM121L9P	29774	broad.mit.edu	37	22	24659591	24659591	+	RNA	SNP	A	A	G			TCGA-B2-4099-01A-02D-1458-08	TCGA-B2-4099-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01c54f7c-84b9-4f5b-ae44-2ac1f661fd29	54cf60f2-947e-4eb0-b5a7-1e644ca10dba	g.chr22:24659591A>G	ENST00000414583.2	+	0	3116					NR_003714.1				POM121 transmembrane nucleoporin-like 9, pseudogene																		ACTCACTGACATCGAAGGCTG	0.632																																																	0																																												29774			AL040062, AL117401		22q11.22	2012-03-13	2012-03-13		ENSG00000128262	ENSG00000128262			30080	pseudogene	pseudogene			"""POM121 membrane glycoprotein-like 9, pseudogene"""				Standard	NR_003714		Approved				OTTHUMG00000150763		22.37:g.24659591A>G				RNA	SNP	ENST00000414583.2	37																																																																																					0.632	POM121L9P-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000319991.1		NM_014549	
POM121L9P	29774	broad.mit.edu	37	22	24659593	24659593	+	RNA	SNP	C	C	T			TCGA-B2-4099-01A-02D-1458-08	TCGA-B2-4099-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01c54f7c-84b9-4f5b-ae44-2ac1f661fd29	54cf60f2-947e-4eb0-b5a7-1e644ca10dba	g.chr22:24659593C>T	ENST00000414583.2	+	0	3118					NR_003714.1				POM121 transmembrane nucleoporin-like 9, pseudogene																		TCACTGACATCGAAGGCTGCC	0.632																																																	0																																												29774			AL040062, AL117401		22q11.22	2012-03-13	2012-03-13		ENSG00000128262	ENSG00000128262			30080	pseudogene	pseudogene			"""POM121 membrane glycoprotein-like 9, pseudogene"""				Standard	NR_003714		Approved				OTTHUMG00000150763		22.37:g.24659593C>T				RNA	SNP	ENST00000414583.2	37																																																																																					0.632	POM121L9P-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000319991.1		NM_014549	
PTPN13	5783	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	87696460	87696460	+	Missense_Mutation	SNP	C	C	T			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr4:87696460C>T	ENST00000411767.2	+	34	5708	c.5645C>T	c.(5644-5646)cCg>cTg	p.P1882L	PTPN13_ENST00000427191.2_Missense_Mutation_p.P1863L|PTPN13_ENST00000316707.6_Missense_Mutation_p.P1691L|PTPN13_ENST00000436978.1_Missense_Mutation_p.P1887L|PTPN13_ENST00000511467.1_Missense_Mutation_p.P1887L			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	1882	PDZ 5. {ECO:0000255|PROSITE- ProRule:PRU00143}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)	p.P1887L(2)		NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		CATTTGCTACCGGACATAACA	0.383																																																	2	Substitution - Missense(2)	kidney(2)											83.0	76.0	79.0					4																	87696460		1865	4114	5979	SO:0001583	missense	5783				CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.5645C>T	4.37:g.87696460C>T	ENSP00000407249:p.Pro1882Leu		B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Missense_Mutation	SNP	ENST00000411767.2	37	CCDS47094.1	.	.	.	.	.	.	.	.	.	.	C	13.89	2.373313	0.42105	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000316707;ENST00000411767;ENST00000511467;ENST00000357349	T;T;T;T;T	0.26810	1.71;1.71;1.71;1.71;1.71	5.15	4.31	0.51392	PDZ/DHR/GLGF (1);	0.000000	0.48767	D	0.000176	T	0.49457	0.1558	M	0.72479	2.2	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.999;1.0	T	0.52132	-0.8616	10	0.56958	D	0.05	.	13.9344	0.64017	0.0:0.9261:0.0:0.0739	.	1691;1863;1882;1887	Q12923-2;Q12923-3;Q12923;Q12923-4	.;.;PTN13_HUMAN;.	L	1863;1887;1691;1882;1887;1831	ENSP00000408368:P1863L;ENSP00000394794:P1887L;ENSP00000322675:P1691L;ENSP00000407249:P1882L;ENSP00000426626:P1887L	ENSP00000322675:P1691L	P	+	2	0	PTPN13	87915484	1.000000	0.71417	0.967000	0.41034	0.020000	0.10135	7.021000	0.76425	1.302000	0.44855	-0.384000	0.06662	CCG		0.383	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363191.1			
PTPN18	26469	broad.mit.edu	37	2	131129929	131129934	+	In_Frame_Del	DEL	GACGGG	GACGGG	-	rs112040677	byFrequency	TCGA-B2-4099-01A-02D-1458-08	TCGA-B2-4099-10A-01D-1458-08	GACGGG	GACGGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01c54f7c-84b9-4f5b-ae44-2ac1f661fd29	54cf60f2-947e-4eb0-b5a7-1e644ca10dba	g.chr2:131129929_131129934delGACGGG	ENST00000175756.5	+	13	1214_1219	c.1113_1118delGACGGG	c.(1111-1119)cagacgggg>cag	p.TG378del	PTPN18_ENST00000347849.3_In_Frame_Del_p.TG271del	NM_014369.3	NP_055184.2	Q99952	PTN18_HUMAN	protein tyrosine phosphatase, non-receptor type 18 (brain-derived)	378				Missing (in Ref. 1; CAA56105). {ECO:0000305}.	peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)	p.T378_G379delTG(1)		endometrium(1)|kidney(3)|large_intestine(2)|lung(5)|ovary(3)|prostate(1)	15	Colorectal(110;0.1)					gtgggacgcagacggggacggggacg	0.777														1724	0.344249	0.6324	0.2349	5008	,	,		12983	0.3214		0.2008	False		,,,				2504	0.2035																1	Deletion - In frame(1)	prostate(1)							,	1068,966		446,176,395					,	-3.8	0.0		dbSNP_132	3	951,4205		280,391,1907	no	coding,coding	PTPN18	NM_014369.3,NM_001142370.1	,	726,567,2302	A1A1,A1R,RR		18.4445,47.4926,28.0807	,	,		2019,5171				SO:0001651	inframe_deletion	26469			X79568	CCDS2161.1, CCDS46410.1	2q21	2011-06-09			ENSG00000072135	ENSG00000072135		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9649	protein-coding gene	gene with protein product		606587				8950995	Standard	NM_014369		Approved	BDP1	uc002trc.3	Q99952	OTTHUMG00000131630	ENST00000175756.5:c.1113_1118delGACGGG	2.37:g.131129935_131129940delGACGGG	ENSP00000175756:p.Thr378_Gly379del		B4E1E6|Q53P42	In_Frame_Del	DEL	ENST00000175756.5	37	CCDS2161.1																																																																																				0.777	PTPN18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254523.2			
PTPN21	11099	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	88983531	88983531	+	Silent	SNP	C	C	T			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr14:88983531C>T	ENST00000556564.1	-	3	539	c.255G>A	c.(253-255)aaG>aaA	p.K85K	PTPN21_ENST00000554628.1_5'UTR|PTPN21_ENST00000328736.3_Silent_p.K85K|RP11-507K2.2_ENST00000555444.1_RNA	NM_007039.3	NP_008970.2	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type 21	85	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein tyrosine phosphatase activity (GO:0004725)	p.K85K(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|liver(1)|lung(7)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						CCAGCTGCTTCTTCAAAGGTT	0.453																																																	2	Substitution - coding silent(2)	kidney(2)											122.0	114.0	117.0					14																	88983531		2203	4300	6503	SO:0001819	synonymous_variant	11099			X79510	CCDS9884.1	14q31	2011-06-09				ENSG00000070778		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9651	protein-coding gene	gene with protein product		603271				7519780	Standard	NM_007039		Approved	PTPD1, PTPRL10	uc001xwv.4	Q16825		ENST00000556564.1:c.255G>A	14.37:g.88983531C>T				Silent	SNP	ENST00000556564.1	37	CCDS9884.1																																																																																				0.453	PTPN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410303.1			
PYCR1	5831	broad.mit.edu	37	17	79894640	79894640	+	Missense_Mutation	SNP	C	C	G			TCGA-B2-4099-01A-02D-1458-08	TCGA-B2-4099-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	01c54f7c-84b9-4f5b-ae44-2ac1f661fd29	54cf60f2-947e-4eb0-b5a7-1e644ca10dba	g.chr17:79894640C>G	ENST00000329875.8	-	1	115	c.51G>C	c.(49-51)aaG>aaC	p.K17N	PYCR1_ENST00000403172.4_Missense_Mutation_p.K17N|PYCR1_ENST00000402252.2_Missense_Mutation_p.K44N|PYCR1_ENST00000577756.1_Missense_Mutation_p.K17N|PYCR1_ENST00000337943.5_Missense_Mutation_p.K17N	NM_001282280.1|NM_001282281.1|NM_006907.2	NP_001269209.1|NP_001269210.1|NP_008838.2	P32322	P5CR1_HUMAN	pyrroline-5-carboxylate reductase 1	17					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to oxidative stress (GO:0034599)|L-proline biosynthetic process (GO:0055129)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|proline biosynthetic process (GO:0006561)|regulation of mitochondrial membrane potential (GO:0051881)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	identical protein binding (GO:0042802)|pyrroline-5-carboxylate reductase activity (GO:0004735)	p.K17N(2)		endometrium(2)|kidney(1)|lung(1)|prostate(1)	5	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.0165)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)		L-Proline(DB00172)	CTGTGAAGCCCTTGGCCAGGG	0.672																																																	2	Substitution - Missense(2)	kidney(2)											24.0	28.0	27.0					17																	79894640		2199	4292	6491	SO:0001583	missense	5831				CCDS11794.1, CCDS11795.1, CCDS62365.1, CCDS62366.1	17q25.3	2013-09-23			ENSG00000183010	ENSG00000183010	1.5.1.2		9721	protein-coding gene	gene with protein product		179035				1730675	Standard	XM_005256381		Approved	P5C	uc002kcr.1	P32322	OTTHUMG00000178436	ENST00000329875.8:c.51G>C	17.37:g.79894640C>G	ENSP00000328858:p.Lys17Asn		A6NFM2|B4DMU0|Q6FHI4|Q96DI6|Q9HBQ4	Missense_Mutation	SNP	ENST00000329875.8	37	CCDS11795.1	.	.	.	.	.	.	.	.	.	.	C	11.63	1.696832	0.30142	.	.	ENSG00000183010	ENST00000337943;ENST00000329875;ENST00000403172;ENST00000402252;ENST00000405481	T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88	4.42	3.43	0.39272	NAD(P)-binding domain (1);	0.223955	0.43747	D	0.000537	T	0.50650	0.1628	L	0.50993	1.605	0.58432	D	0.999997	D;D;D;D;B;D	0.69078	0.972;0.966;0.997;0.966;0.274;0.992	P;P;D;P;B;D	0.65773	0.899;0.818;0.938;0.818;0.202;0.934	T	0.48080	-0.9066	10	0.46703	T	0.11	.	7.4882	0.27445	0.0:0.7059:0.1387:0.1554	.	44;17;17;17;17;17	B4DMU0;E7D7X9;Q9HBQ4;P32322;E7D7Y0;A6NFM2	.;.;.;P5CR1_HUMAN;.;.	N	17;17;17;44;17	ENSP00000336579:K17N;ENSP00000328858:K17N;ENSP00000385483:K17N;ENSP00000384949:K44N;ENSP00000386002:K17N	ENSP00000328858:K17N	K	-	3	2	PYCR1	77487931	0.906000	0.30813	1.000000	0.80357	0.929000	0.56500	0.557000	0.23454	2.009000	0.58944	0.561000	0.74099	AAG		0.672	PYCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441953.1			
RAB11FIP2	22841	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	119805451	119805451	+	Missense_Mutation	SNP	C	C	T			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr10:119805451C>T	ENST00000355624.3	-	1	663	c.224G>A	c.(223-225)gGa>gAa	p.G75E	RAB11FIP2_ENST00000369199.3_Missense_Mutation_p.G75E|RP11-354M20.3_ENST00000451610.2_RNA|RP11-354M20.3_ENST00000417968.4_RNA|CASC2_ENST00000454857.1_RNA|CASC2_ENST00000414722.1_RNA|CASC2_ENST00000426021.1_RNA|CASC2_ENST00000435944.1_RNA|CASC2_ENST00000454781.1_RNA	NM_014904.2	NP_055719.1	Q7L804	RFIP2_HUMAN	RAB11 family interacting protein 2 (class I)	75	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.|Necessary for its cellular translocation to the plasma membrane.				establishment of cell polarity (GO:0030010)|insulin secretion involved in cellular response to glucose stimulus (GO:0035773)|protein transport (GO:0015031)|regulated secretory pathway (GO:0045055)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasmic vesicle membrane (GO:0030659)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)	p.G75E(2)		cervix(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(8)	19		Colorectal(252;0.235)		all cancers(201;0.0238)		CTCTGGACTTCCCTGAATTAG	0.463																																																	2	Substitution - Missense(2)	kidney(2)											116.0	111.0	113.0					10																	119805451		2203	4300	6503	SO:0001583	missense	22841			AY037299	CCDS7602.1	10q26.12	2004-07-22			ENSG00000107560	ENSG00000107560			29152	protein-coding gene	gene with protein product		608599				11994279, 10231032	Standard	NM_014904		Approved	KIAA0941, nRip11, Rab11-FIP2	uc001ldj.2	Q7L804	OTTHUMG00000019128	ENST00000355624.3:c.224G>A	10.37:g.119805451C>T	ENSP00000347839:p.Gly75Glu		A6NEI4|Q3I768|Q9Y2F0	Missense_Mutation	SNP	ENST00000355624.3	37	CCDS7602.1	.	.	.	.	.	.	.	.	.	.	C	9.214	1.031720	0.19590	.	.	ENSG00000107560	ENST00000355624;ENST00000369199	T;T	0.67698	-0.28;-0.28	5.0	5.0	0.66597	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.104089	0.64402	D	0.000003	T	0.49372	0.1553	N	0.13003	0.285	0.47862	D	0.999539	B;B	0.18013	0.02;0.025	B;B	0.29077	0.049;0.098	T	0.46498	-0.9187	10	0.37606	T	0.19	-13.8547	9.2394	0.37486	0.0:0.8317:0.0:0.1683	.	75;75	Q3I768;Q7L804	.;RFIP2_HUMAN	E	75	ENSP00000347839:G75E;ENSP00000358200:G75E	ENSP00000347839:G75E	G	-	2	0	RAB11FIP2	119795441	0.996000	0.38824	0.999000	0.59377	0.942000	0.58702	4.760000	0.62235	2.498000	0.84270	0.555000	0.69702	GGA		0.463	RAB11FIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050583.1		NM_014904	
REM1	28954	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	30064350	30064350	+	Missense_Mutation	SNP	C	C	G			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr20:30064350C>G	ENST00000201979.2	+	2	395	c.102C>G	c.(100-102)agC>agG	p.S34R	DEFB124_ENST00000481595.1_Intron	NM_014012.4	NP_054731.2	O75628	REM1_HUMAN	RAS (RAD and GEM)-like GTP-binding 1	34					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)	p.S34R(2)		kidney(3)|large_intestine(3)|lung(14)|pancreas(2)|upper_aerodigestive_tract(1)	23	all_cancers(5;0.000119)|Lung NSC(7;1.32e-05)|all_lung(7;2.14e-05)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			GCCGCCTGAGCACAGTGCCTT	0.642																																																	2	Substitution - Missense(2)	kidney(2)											79.0	87.0	84.0					20																	30064350		2203	4300	6503	SO:0001583	missense	28954			AF152863	CCDS13181.1	20q11.21	2014-05-09	2004-04-14	2004-04-16	ENSG00000088320	ENSG00000088320			15922	protein-coding gene	gene with protein product	"""GTPase GES"""	610388	"""RAS (RAD and GEM)-like GTP-binding"""	REM		10831614, 14623965	Standard	NM_014012		Approved	GES	uc002wwa.3	O75628	OTTHUMG00000032168	ENST00000201979.2:c.102C>G	20.37:g.30064350C>G	ENSP00000201979:p.Ser34Arg		E1P5L1|Q5TZR7|Q5TZR8|Q9NP57	Missense_Mutation	SNP	ENST00000201979.2	37	CCDS13181.1	.	.	.	.	.	.	.	.	.	.	C	7.115	0.576816	0.13686	.	.	ENSG00000088320	ENST00000201979	T	0.65549	-0.16	4.55	1.49	0.22878	.	0.485483	0.18972	N	0.126101	T	0.32526	0.0832	N	0.08118	0	0.21861	N	0.999508	B	0.02656	0.0	B	0.04013	0.001	T	0.13522	-1.0506	10	0.15066	T	0.55	.	4.4206	0.11479	0.0:0.6092:0.1863:0.2046	.	34	O75628	REM1_HUMAN	R	34	ENSP00000201979:S34R	ENSP00000201979:S34R	S	+	3	2	REM1	29528011	0.086000	0.21541	0.700000	0.30305	0.923000	0.55619	0.200000	0.17257	0.159000	0.19401	0.655000	0.94253	AGC		0.642	REM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078508.2		NM_014012	
RFPL2	10739	broad.mit.edu;hgsc.bcm.edu	37	22	32587083	32587083	+	Silent	SNP	G	G	C			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr22:32587083G>C	ENST00000400237.1	-	5	1748	c.813C>G	c.(811-813)acC>acG	p.T271T	RFPL2_ENST00000400236.3_Silent_p.T181T|RFPL2_ENST00000489846.1_5'UTR|RFPL2_ENST00000248983.4_Silent_p.T181T|RFPL2_ENST00000248980.4_Silent_p.T210T			O75678	RFPL2_HUMAN	ret finger protein-like 2	271	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.						zinc ion binding (GO:0008270)	p.T210T(2)|p.T181T(2)|p.T271T(2)		endometrium(2)|kidney(4)|large_intestine(3)|lung(9)|ovary(1)|skin(2)	21						CAAGCTCTGTGGTCAGCTGGA	0.587																																																	6	Substitution - coding silent(6)	kidney(6)											105.0	105.0	105.0					22																	32587083		2203	4300	6503	SO:0001819	synonymous_variant	10739			AJ010231	CCDS43009.1, CCDS46694.1, CCDS43009.2	22q12.3	2008-06-12				ENSG00000128253		"""RING-type (C3HC4) zinc fingers"""	9979	protein-coding gene	gene with protein product		605969				10508838	Standard	NM_001098527		Approved	RNF79	uc003amg.3	O75678		ENST00000400237.1:c.813C>G	22.37:g.32587083G>C				Silent	SNP	ENST00000400237.1	37	CCDS43009.2																																																																																				0.587	RFPL2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000075262.2		NM_006605	
RNPC3	55599	hgsc.bcm.edu	37	1	104076467	104076467	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr1:104076467delA	ENST00000533099.1	+	4	583	c.347delA	c.(346-348)gaafs	p.E116fs	RNPC3_ENST00000524631.1_Frame_Shift_Del_p.E116fs|RNPC3_ENST00000423855.2_Frame_Shift_Del_p.E116fs			Q96LT9	RBM40_HUMAN	RNA-binding region (RNP1, RRM) containing 3	116	Necessary for interaction with PDCD7.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Lung(183;0.111)|Epithelial(280;0.122)|all cancers(265;0.125)|Colorectal(144;0.163)		TCAGGCTCTGAAAAAAAAAAA	0.318																																																	0										85,435,1262		6,1,72,18,398,396	50.0	39.0	43.0			4.6	0.6	1		49	197,914,2651		20,3,154,16,879,809	no	codingComplex	RNPC3	NM_017619.3		26,4,226,34,1277,1205	A1A1,A1A2,A1R,A2A2,A2R,RR		29.5322,29.1807,29.4192			104076467	282,1349,3913	692	1590	2282	SO:0001589	frameshift_variant	55599			AB058742, AY099329	CCDS781.1	1p21.1	2013-07-16			ENSG00000185946	ENSG00000185946		"""RNA binding motif (RRM) containing"""	18666	protein-coding gene	gene with protein product	"""U11/U12 snRNP 65K"""					14974681, 15146077	Standard	NM_017619		Approved	KIAA1839, FLJ20008, RBM40, SNRNP65	uc010oun.2	Q96LT9	OTTHUMG00000166613	ENST00000533099.1:c.347delA	1.37:g.104076467delA	ENSP00000432886:p.Glu116fs		A8K1C9|D3DT74|Q5TZ87|Q96FK7|Q96JI8|Q9NSU7|Q9NXX2	Frame_Shift_Del	DEL	ENST00000533099.1	37	CCDS781.1																																																																																				0.318	RNPC3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390812.1		NM_017619	
RUFY3	22902	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	71648807	71648807	+	Splice_Site	SNP	G	G	T			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr4:71648807G>T	ENST00000226328.4	+	9	1457		c.e9-1		RUFY3_ENST00000381006.3_Splice_Site|RUFY3_ENST00000536664.1_Splice_Site|RUFY3_ENST00000417478.2_Splice_Site|RUFY3_ENST00000502653.1_Splice_Site	NM_014961.3	NP_055776.1	Q7L099	RUFY3_HUMAN	RUN and FYVE domain containing 3						negative regulation of axonogenesis (GO:0050771)	filopodium (GO:0030175)|growth cone (GO:0030426)		p.?(4)		endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	16		all_hematologic(202;0.248)	Lung(101;0.235)			tttatCCACAGCTTGCAGTTG	0.318																																																	4	Unknown(4)	kidney(4)											52.0	49.0	50.0					4																	71648807		2203	4300	6503	SO:0001630	splice_region_variant	22902			AF112221	CCDS3547.1, CCDS34001.1, CCDS47068.1, CCDS75138.1	4q13.3	2009-05-29			ENSG00000018189	ENSG00000018189		"""Zinc fingers, FYVE domain containing"""	30285	protein-coding gene	gene with protein product	"""single axon-related 1"""	611194				17439943	Standard	NM_001130709		Approved	RIPx, KIAA0871, Singar1	uc003hfr.3	Q7L099	OTTHUMG00000129910	ENST00000226328.4:c.895-1G>T	4.37:g.71648807G>T			B3KM25|B4DYW7|D9N163|O94948|Q9UI00	Splice_Site	SNP	ENST00000226328.4	37	CCDS3547.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.496650	0.85069	.	.	ENSG00000018189	ENST00000417478;ENST00000381006;ENST00000226328;ENST00000536664;ENST00000502653	.	.	.	5.12	5.12	0.69794	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.7083	0.91646	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RUFY3	71867671	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.466000	0.97665	2.823000	0.97156	0.643000	0.83706	.		0.318	RUFY3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252161.2		NM_014961	Intron
RYR2	6262	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	237895427	237895427	+	Silent	SNP	C	C	A			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr1:237895427C>A	ENST00000366574.2	+	78	11334	c.11017C>A	c.(11017-11019)Cgg>Agg	p.R3673R	RYR2_ENST00000360064.6_Silent_p.R3671R|RYR2_ENST00000542537.1_Silent_p.R3657R|RYR2_ENST00000609119.1_3'UTR	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3673					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.R3671R(2)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TCTGTTTAGTCGGACAGCTTT	0.443																																																	2	Substitution - coding silent(2)	kidney(2)											96.0	96.0	96.0					1																	237895427		1854	4091	5945	SO:0001819	synonymous_variant	6262			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.11017C>A	1.37:g.237895427C>A			Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	37	CCDS55691.1																																																																																				0.443	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2		NM_001035	
SBNO2	22904	broad.mit.edu;hgsc.bcm.edu	37	19	1112193	1112193	+	Missense_Mutation	SNP	T	T	C			TCGA-B2-4099-01A-02D-1458-08	TCGA-B2-4099-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01c54f7c-84b9-4f5b-ae44-2ac1f661fd29	54cf60f2-947e-4eb0-b5a7-1e644ca10dba	g.chr19:1112193T>C	ENST00000361757.3	-	22	2860	c.2623A>G	c.(2623-2625)Agt>Ggt	p.S875G	SBNO2_ENST00000438103.2_Missense_Mutation_p.S818G|SBNO2_ENST00000587024.1_Missense_Mutation_p.S865G	NM_014963.2	NP_055778.2	Q9Y2G9	SBNO2_HUMAN	strawberry notch homolog 2 (Drosophila)	875					bone mineralization (GO:0030282)|bone trabecula morphogenesis (GO:0061430)|macrophage activation involved in immune response (GO:0002281)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoclast fusion (GO:0072675)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of inflammatory response (GO:0050727)|transcription, DNA-templated (GO:0006351)			p.S882G(2)|p.S875G(2)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTCACCAGACTCTCCAGGCGC	0.657																																																	4	Substitution - Missense(4)	kidney(4)											13.0	16.0	15.0					19																	1112193		1935	4127	6062	SO:0001583	missense	22904			AK074102	CCDS45894.1, CCDS45895.1	19p13.3	2008-02-05	2006-10-06	2006-10-06		ENSG00000064932			29158	protein-coding gene	gene with protein product		615729	"""KIAA0963"""	KIAA0963		10231032	Standard	NM_014963		Approved	FLJ00173, Stno, Sno	uc002lrk.4	Q9Y2G9		ENST00000361757.3:c.2623A>G	19.37:g.1112193T>C	ENSP00000354733:p.Ser875Gly		A8K8P2|B3KWJ1|O75257|Q3KQX0|Q8TEM0	Missense_Mutation	SNP	ENST00000361757.3	37	CCDS45894.1	.	.	.	.	.	.	.	.	.	.	T	26.6	4.756695	0.89843	.	.	ENSG00000064932	ENST00000361757;ENST00000438103;ENST00000250872	T;T	0.75477	-0.94;-0.94	4.7	4.7	0.59300	.	0.041945	0.85682	D	0.000000	D	0.88695	0.6506	M	0.93062	3.375	0.45733	D	0.998632	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.994	D	0.91337	0.5094	10	0.87932	D	0	-25.4377	13.6202	0.62132	0.0:0.0:0.0:1.0	.	875;818	Q9Y2G9;Q9Y2G9-3	SBNO2_HUMAN;.	G	875;818;882	ENSP00000354733:S875G;ENSP00000400762:S818G	ENSP00000250872:S882G	S	-	1	0	SBNO2	1063193	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	7.778000	0.85637	1.882000	0.54519	0.368000	0.22195	AGT		0.657	SBNO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458065.2		NM_014963	
SEMA3F	6405	broad.mit.edu	37	3	50225421	50225421	+	Missense_Mutation	SNP	A	A	T			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr3:50225421A>T	ENST00000002829.3	+	19	2715	c.2231A>T	c.(2230-2232)cAg>cTg	p.Q744L	SEMA3F_ENST00000413852.1_Missense_Mutation_p.Q645L|SEMA3F_ENST00000434342.1_Missense_Mutation_p.Q713L	NM_004186.3	NP_004177.3	Q13275	SEM3F_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F	744					axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|negative regulation of axon extension involved in axon guidance (GO:0048843)|nerve development (GO:0021675)|neural crest cell migration (GO:0001755)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sympathetic ganglion development (GO:0061549)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	extracellular space (GO:0005615)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|receptor activity (GO:0004872)	p.Q744L(1)		central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(2)	17				BRCA - Breast invasive adenocarcinoma(193;0.00013)|KIRC - Kidney renal clear cell carcinoma(197;0.00599)|Kidney(197;0.00688)		CTCATCCACCAGTACTGCCAG	0.692																																																	1	Substitution - Missense(1)	kidney(1)											8.0	9.0	9.0					3																	50225421		2168	4237	6405	SO:0001583	missense	6405			U33920	CCDS2811.1	3p21.3	2013-01-11			ENSG00000001617	ENSG00000001617		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10728	protein-coding gene	gene with protein product	"""sema IV"""	601124				8786119, 8649831	Standard	NM_004186		Approved	SEMAK, Sema4	uc003cyj.3	Q13275	OTTHUMG00000156806	ENST00000002829.3:c.2231A>T	3.37:g.50225421A>T	ENSP00000002829:p.Gln744Leu		C9JQ85|Q13274|Q13372|Q15704|Q6GTR4	Missense_Mutation	SNP	ENST00000002829.3	37	CCDS2811.1	.	.	.	.	.	.	.	.	.	.	A	26.0	4.691128	0.88735	.	.	ENSG00000001617	ENST00000413852;ENST00000002829;ENST00000434342	T;T;T	0.55760	0.59;0.5;0.58	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.69878	0.3160	M	0.64997	1.995	0.58432	D	0.99999	D;D	0.89917	0.999;1.0	D;D	0.87578	0.998;0.996	T	0.73161	-0.4070	10	0.87932	D	0	.	14.6966	0.69126	1.0:0.0:0.0:0.0	.	713;744	C9JQ85;Q13275	.;SEM3F_HUMAN	L	645;744;713	ENSP00000388931:Q645L;ENSP00000002829:Q744L;ENSP00000409859:Q713L	ENSP00000002829:Q744L	Q	+	2	0	SEMA3F	50200425	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.974000	0.70465	2.111000	0.64477	0.379000	0.24179	CAG		0.692	SEMA3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345929.1		NM_004186	
SHISA9	729993	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	13329151	13329151	+	Missense_Mutation	SNP	G	G	A			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr16:13329151G>A	ENST00000424107.3	+	5	1605	c.1160G>A	c.(1159-1161)gGc>gAc	p.G387D	SHISA9_ENST00000558583.1_Missense_Mutation_p.G428D			B4DS77	SHSA9_HUMAN	shisa family member 9	387					regulation of short-term neuronal synaptic plasticity (GO:0048172)	cell junction (GO:0030054)|dendritic spine membrane (GO:0032591)|ionotropic glutamate receptor complex (GO:0008328)|synapse (GO:0045202)		p.G428D(1)		breast(1)|endometrium(2)|kidney(1)|lung(2)|prostate(1)|skin(2)	9						AGCAACAAGGGCAAGCTTGGC	0.612																																																	1	Substitution - Missense(1)	kidney(1)											108.0	133.0	126.0					16																	13329151		692	1591	2283	SO:0001583	missense	729993				CCDS45417.1, CCDS45418.1, CCDS45417.2, CCDS45418.2	16p13.12	2013-07-31	2013-07-31		ENSG00000237515	ENSG00000237515		"""Shisa homologs"""	37231	protein-coding gene	gene with protein product		613346	"""shisa homolog 9 (Xenopus laevis)"""				Standard	NM_001145205		Approved		uc010uyy.2	B4DS77	OTTHUMG00000154258	ENST00000424107.3:c.1160G>A	16.37:g.13329151G>A	ENSP00000407958:p.Gly387Asp		C9J314|C9JCE9	Missense_Mutation	SNP	ENST00000424107.3	37	CCDS45417.2	.	.	.	.	.	.	.	.	.	.	G	19.83	3.899962	0.72754	.	.	ENSG00000237515	ENST00000424107	.	.	.	5.12	4.13	0.48395	.	.	.	.	.	T	0.40815	0.1132	L	0.36672	1.1	0.80722	D	1	P	0.43477	0.808	B	0.36504	0.226	T	0.37430	-0.9706	8	0.56958	D	0.05	.	12.3294	0.55031	0.0:0.1707:0.8293:0.0	.	387	B4DS77	SHSA9_HUMAN	D	428	.	ENSP00000407958:G428D	G	+	2	0	SHISA9	13236652	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	3.362000	0.52314	1.095000	0.41419	0.650000	0.86243	GGC		0.612	SHISA9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334564.5		NM_001145204	
SLC16A9	220963	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	61414026	61414026	+	Missense_Mutation	SNP	A	A	T			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr10:61414026A>T	ENST00000395348.3	-	5	1394	c.758T>A	c.(757-759)cTt>cAt	p.L253H	SLC16A9_ENST00000395347.1_Missense_Mutation_p.L253H	NM_194298.2	NP_919274.1	Q7RTY1	MOT9_HUMAN	solute carrier family 16, member 9	253					urate metabolic process (GO:0046415)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)	p.L253H(2)		kidney(3)|large_intestine(5)|lung(5)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	23						GTTTTTATGAAGTAGGCTGTC	0.403																																																	2	Substitution - Missense(2)	kidney(2)											248.0	232.0	237.0					10																	61414026		2203	4300	6503	SO:0001583	missense	220963			AK125791	CCDS7256.1	10q21.3	2013-07-18	2013-07-18	2004-01-21	ENSG00000165449	ENSG00000165449		"""Solute carriers"""	23520	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 9"""	614242	"""chromosome 10 open reading frame 36"", ""solute carrier family 16 (monocarboxylic acid transporters), member 9"", ""solute carrier family 16, member 9 (monocarboxylic acid transporter 9)"""	C10orf36			Standard	NM_194298		Approved	FLJ43803, MCT9	uc010qig.1	Q7RTY1	OTTHUMG00000018283	ENST00000395348.3:c.758T>A	10.37:g.61414026A>T	ENSP00000378757:p.Leu253His		Q6ZMI2|Q9UFH8	Missense_Mutation	SNP	ENST00000395348.3	37	CCDS7256.1	.	.	.	.	.	.	.	.	.	.	A	0.017	-1.505394	0.00992	.	.	ENSG00000165449	ENST00000395348;ENST00000395347	T;T	0.04758	3.56;3.56	4.74	0.706	0.18133	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	1.974010	0.02169	N	0.059493	T	0.05090	0.0136	L	0.46157	1.445	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.42310	-0.9459	10	0.16896	T	0.51	.	1.3395	0.02151	0.5442:0.1508:0.1601:0.1449	.	253	Q7RTY1	MOT9_HUMAN	H	253	ENSP00000378757:L253H;ENSP00000378756:L253H	ENSP00000378756:L253H	L	-	2	0	SLC16A9	61084032	0.141000	0.22595	0.014000	0.15608	0.045000	0.14185	1.813000	0.38962	0.170000	0.19704	0.482000	0.46254	CTT		0.403	SLC16A9-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048174.2		NM_194298	
SLC35A2	7355	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	48762340	48762340	+	Silent	SNP	C	C	T			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chrX:48762340C>T	ENST00000247138.5	-	4	849	c.846G>A	c.(844-846)ggG>ggA	p.G282G	SLC35A2_ENST00000376529.3_Intron|SLC35A2_ENST00000452555.2_Silent_p.G310G|SLC35A2_ENST00000413561.2_Silent_p.G221G|SLC35A2_ENST00000376515.3_Intron|SLC35A2_ENST00000376521.1_Silent_p.G282G|SLC35A2_ENST00000445167.2_Intron	NM_005660.1	NP_005651.1	P78381	S35A2_HUMAN	solute carrier family 35 (UDP-galactose transporter), member A2	282					galactose metabolic process (GO:0006012)|transmembrane transport (GO:0055085)|UDP-galactose transport (GO:0015785)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	sugar:proton symporter activity (GO:0005351)|UDP-galactose transmembrane transporter activity (GO:0005459)	p.G282G(2)		breast(1)|endometrium(4)|kidney(2)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(2)	15						CCACCAGTAGCCCGCCGAAGG	0.597																																																	2	Substitution - coding silent(2)	kidney(2)											43.0	33.0	36.0					X																	48762340		2203	4300	6503	SO:0001819	synonymous_variant	7355			D88146	CCDS14311.1, CCDS35247.1, CCDS43937.1, CCDS65253.1, CCDS65254.1, CCDS75973.1, CCDS75974.1, CCDS75975.1	Xp11.23-p11.22	2013-05-22			ENSG00000102100	ENSG00000102100		"""Solute carriers"""	11022	protein-coding gene	gene with protein product		314375	"""solute carrier family 35 (UDP-galactose transporter), member 2"""	UGALT		8128316	Standard	NM_001042498		Approved	UGAT, UGT, UGT1, UGT2, UGTL	uc004dlo.1	P78381	OTTHUMG00000024129	ENST00000247138.5:c.846G>A	X.37:g.48762340C>T			A8K2L9|A8K9V1|B4DE11|B4DPT2|E7EW45|Q8IV21|Q92553	Silent	SNP	ENST00000247138.5	37	CCDS14311.1																																																																																				0.597	SLC35A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060790.1		NM_005660	
SLC4A7	9497	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	27451006	27451006	+	Silent	SNP	C	C	T			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr3:27451006C>T	ENST00000295736.5	-	13	1825	c.1755G>A	c.(1753-1755)ttG>ttA	p.L585L	SLC4A7_ENST00000445684.1_Silent_p.L581L|SLC4A7_ENST00000440156.1_Silent_p.L581L|SLC4A7_ENST00000435667.2_Silent_p.L470L|SLC4A7_ENST00000455077.1_Silent_p.L466L|SLC4A7_ENST00000446700.1_Silent_p.L577L|SLC4A7_ENST00000388777.4_Silent_p.L135L|SLC4A7_ENST00000425128.2_Intron|SLC4A7_ENST00000437179.1_Silent_p.L466L|SLC4A7_ENST00000454389.1_Silent_p.L594L|SLC4A7_ENST00000428386.1_Silent_p.L461L	NM_003615.4	NP_003606.3	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 7	585					auditory receptor cell development (GO:0060117)|bicarbonate transport (GO:0015701)|cochlear nucleus development (GO:0021747)|ion transport (GO:0006811)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal cell programmed cell death (GO:0046666)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)	p.L585L(2)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(9)|ovary(4)|skin(1)	38					Sodium bicarbonate(DB01390)	TGTCAAGTATCAAACCACCAA	0.408																																																	2	Substitution - coding silent(2)	kidney(2)											81.0	81.0	81.0					3																	27451006		2203	4300	6503	SO:0001819	synonymous_variant	9497			AB012130	CCDS33721.1, CCDS58819.1, CCDS58820.1	3p24.1	2013-05-22			ENSG00000033867	ENSG00000033867		"""Solute carriers"""	11033	protein-coding gene	gene with protein product		603353		SLC4A6		10198178, 9610397	Standard	NM_003615		Approved	NBC3, SBC2	uc003cdv.4	Q9Y6M7	OTTHUMG00000155679	ENST00000295736.5:c.1755G>A	3.37:g.27451006C>T			A6NIA8|B2CI53|B5M449|B5M451|B5M452|B5M453|B6DY52|B6DY53|C9JST9|D3K174|D3K175|O60350|Q6AHZ9|Q9HC88|Q9UIB9	Silent	SNP	ENST00000295736.5	37	CCDS33721.1																																																																																				0.408	SLC4A7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000341230.2		NM_003615	
SLK	9748	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	105752775	105752775	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr10:105752775delA	ENST00000369755.3	+	4	943	c.398delA	c.(397-399)caafs	p.Q133fs	SLK_ENST00000335753.4_Frame_Shift_Del_p.Q133fs	NM_014720.2	NP_055535.2	Q9H2G2	SLK_HUMAN	STE20-like kinase	133	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)			kidney(1)|lung(1)|ovary(2)|skin(2)|stomach(2)	8		Colorectal(252;0.178)		Epithelial(162;5.81e-10)|all cancers(201;2.35e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		TCCCAAATACAAGTAGTTTGC	0.333																																					NSCLC(111;540 1651 1927 4474 17706)												0													88.0	91.0	90.0					10																	105752775		2203	4299	6502	SO:0001589	frameshift_variant	9748				CCDS7553.1	10q25.1	2010-06-25	2010-06-25		ENSG00000065613	ENSG00000065613			11088	protein-coding gene	gene with protein product			"""SNF1 (sucrose nonfermenting, yeast, homolog)-like kinase, SNF1 sucrose nonfermenting like kinase (yeast)"", ""STE20-like kinase (yeast)"""			3526554	Standard	NM_014720		Approved	STK2, se20-9, KIAA0204	uc001kxo.1	Q9H2G2	OTTHUMG00000018999	ENST00000369755.3:c.398delA	10.37:g.105752775delA	ENSP00000358770:p.Gln133fs		D3DRA0|D3DRA1|O00211|Q6P1Z4|Q86WU7|Q86WW1|Q92603|Q9NQL0|Q9NQL1	Frame_Shift_Del	DEL	ENST00000369755.3	37	CCDS7553.1																																																																																				0.333	SLK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050188.1		NM_014720	
SMYD4	114826	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	1703754	1703754	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr17:1703754delA	ENST00000305513.7	-	5	1101	c.934delT	c.(934-936)tgcfs	p.C312fs		NM_052928.2	NP_443160.2	Q8IYR2	SMYD4_HUMAN	SET and MYND domain containing 4	312	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.						metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(5)|stomach(1)	21						GCATAACTGCATCCGTCACAC	0.547																																																	0													137.0	125.0	129.0					17																	1703754		2203	4300	6503	SO:0001589	frameshift_variant	114826			AB067523	CCDS11013.1	17p13.3	2004-04-21			ENSG00000186532	ENSG00000186532		"""Zinc fingers, MYND-type"""	21067	protein-coding gene	gene with protein product						11572484	Standard	NM_052928		Approved	KIAA1936, ZMYND21	uc002ftm.4	Q8IYR2	OTTHUMG00000090570	ENST00000305513.7:c.934delT	17.37:g.1703754delA	ENSP00000304360:p.Cys312fs		Q8N1P2|Q8NAT0|Q96LV4|Q96PV2	Frame_Shift_Del	DEL	ENST00000305513.7	37	CCDS11013.1																																																																																				0.547	SMYD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207108.4		XM_056082	
SPAG1	6674	hgsc.bcm.edu	37	8	101206459	101206460	+	In_Frame_Ins	INS	-	-	GAC	rs72062044|rs56246127	byFrequency	TCGA-B2-4099-01A-02D-1458-08	TCGA-B2-4099-10A-01D-1458-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01c54f7c-84b9-4f5b-ae44-2ac1f661fd29	54cf60f2-947e-4eb0-b5a7-1e644ca10dba	g.chr8:101206459_101206460insGAC	ENST00000388798.2	+	10	1250_1251	c.1059_1060insGAC	c.(1060-1062)agc>GACagc	p.353_354insD	SPAG1_ENST00000520643.1_In_Frame_Ins_p.353_354insD|SPAG1_ENST00000520508.1_In_Frame_Ins_p.353_354insD|SPAG1_ENST00000251809.3_In_Frame_Ins_p.353_354insD	NM_003114.4	NP_003105.2	Q07617	SPAG1_HUMAN	sperm associated antigen 1	353					axonemal dynein complex assembly (GO:0070286)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	GTP binding (GO:0005525)|hydrolase activity (GO:0016787)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	30	all_cancers(14;2.35e-05)|all_epithelial(15;5.2e-08)|Lung NSC(17;0.000283)|all_lung(17;0.000823)	Breast(495;0.195)	Epithelial(11;1.12e-09)|all cancers(13;1.26e-07)|OV - Ovarian serous cystadenocarcinoma(57;4.37e-05)|STAD - Stomach adenocarcinoma(118;0.0525)	KIRC - Kidney renal clear cell carcinoma(542;0.00178)|READ - Rectum adenocarcinoma(644;0.236)		AAGAAGGAAAAAGCGGAAGAAA	0.356														753	0.150359	0.0537	0.2392	5008	,	,		16467	0.0734		0.2117	False		,,,				2504	0.2342																0									,	320,3944		14,292,1826					,	0.9	0.0		dbSNP_130	64	1643,6611		162,1319,2646	no	coding,coding	SPAG1	NM_172218.2,NM_003114.4	,	176,1611,4472	A1A1,A1R,RR		19.9055,7.5047,15.6814	,	,		1963,10555				SO:0001652	inframe_insertion	6674			AF311312	CCDS34930.1	8q22	2014-01-21			ENSG00000104450	ENSG00000104450		"""Tetratricopeptide (TTC) repeat domain containing"""	11212	protein-coding gene	gene with protein product		603395				16368546	Standard	NM_172218		Approved	SP75, FLJ32920, HSD-3.8, TPIS, CT140	uc003yjh.2	Q07617	OTTHUMG00000164706	Exception_encountered	8.37:g.101206459_101206460insGAC	ENSP00000373450:p.Lys353_Ser354insAsp		A6NP70|B3KQ58|G3XAM3|Q7Z5G1	In_Frame_Ins	INS	ENST00000388798.2	37	CCDS34930.1																																																																																				0.356	SPAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379853.2		NM_172218	
STAB2	55576	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	104107496	104107496	+	Missense_Mutation	SNP	G	G	A	rs141685549	byFrequency	TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr12:104107496G>A	ENST00000388887.2	+	42	4691	c.4487G>A	c.(4486-4488)cGa>cAa	p.R1496Q		NM_017564.9	NP_060034.9			stabilin 2									p.R1496Q(2)		NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						CCAGGAAGGCGAGTGTGCACG	0.522													G|||	2	0.000399361	0.0	0.0	5008	,	,		21099	0.001		0.001	False		,,,				2504	0.0																2	Substitution - Missense(2)	kidney(2)						G	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	292.0	264.0	274.0		4487	5.2	0.6	12	dbSNP_134	274	0,8600		0,0,4300	no	missense	STAB2	NM_017564.9	43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	1496/2552	104107496	1,13005	2203	4300	6503	SO:0001583	missense	55576			AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.4487G>A	12.37:g.104107496G>A	ENSP00000373539:p.Arg1496Gln			Missense_Mutation	SNP	ENST00000388887.2	37	CCDS31888.1	2	9.157509157509158E-4	0	0.0	0	0.0	1	0.0017482517482517483	1	0.0013192612137203166	G	20.5	3.994734	0.74703	2.27E-4	0.0	ENSG00000136011	ENST00000388887;ENST00000258495	D	0.87256	-2.23	5.18	5.18	0.71444	EGF domain, merozoite surface protein 1-like (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.182769	0.45606	D	0.000355	D	0.94922	0.8358	M	0.92555	3.32	0.50632	D	0.999886	D	0.89917	1.0	D	0.91635	0.999	D	0.94139	0.7395	10	0.28530	T	0.3	.	18.7123	0.91662	0.0:0.0:1.0:0.0	.	1496	Q8WWQ8	STAB2_HUMAN	Q	1496;183	ENSP00000373539:R1496Q	ENSP00000258495:R183Q	R	+	2	0	STAB2	102631626	1.000000	0.71417	0.628000	0.29241	0.116000	0.19942	8.678000	0.91211	2.411000	0.81874	0.555000	0.69702	CGA		0.522	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1			
SYNE2	23224	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	64683102	64683102	+	Silent	SNP	C	C	G			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr14:64683102C>G	ENST00000344113.4	+	107	19682	c.19470C>G	c.(19468-19470)ccC>ccG	p.P6490P	SYNE2_ENST00000555002.1_Silent_p.P3147P|SYNE2_ENST00000357395.3_Silent_p.P2875P|SYNE2_ENST00000358025.3_Silent_p.P6513P|SYNE2_ENST00000394768.2_Silent_p.P2875P|SYNE2_ENST00000554805.1_Silent_p.P273P|SYNE2_ENST00000555022.1_Silent_p.P368P|SYNE2_ENST00000441438.2_Silent_p.P21P|SYNE2_ENST00000458046.2_Silent_p.P147P|SYNE2_ENST00000554584.1_Silent_p.P6432P|ESR2_ENST00000542956.1_Intron	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	6490					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)	p.P6513P(2)		NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		ATAAACCACCCTATGTAAGTC	0.473																																																	2	Substitution - coding silent(2)	kidney(2)											112.0	104.0	107.0					14																	64683102		2203	4300	6503	SO:0001819	synonymous_variant	23224			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.19470C>G	14.37:g.64683102C>G			Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Silent	SNP	ENST00000344113.4	37	CCDS41963.1																																																																																				0.473	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2		NM_182914	
SYNJ2BP	55333	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	70839819	70839819	+	Missense_Mutation	SNP	A	A	T			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr14:70839819A>T	ENST00000256366.4	-	4	408	c.327T>A	c.(325-327)caT>caA	p.H109Q	SYNJ2BP_ENST00000554216.1_5'UTR|SYNJ2BP-COX16_ENST00000555276.1_RNA	NM_018373.2	NP_060843.2	P57105	SYJ2B_HUMAN	synaptojanin 2 binding protein	109					intracellular distribution of mitochondria (GO:0048312)|negative regulation of activin receptor signaling pathway (GO:0032926)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of protein localization to cell surface (GO:2000010)|positive regulation of receptor internalization (GO:0002092)	cell surface (GO:0009986)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrion (GO:0005739)		p.H109Q(2)		central_nervous_system(1)|kidney(2)|large_intestine(1)|upper_aerodigestive_tract(1)	5				all cancers(60;0.00367)|BRCA - Breast invasive adenocarcinoma(234;0.00716)|OV - Ovarian serous cystadenocarcinoma(108;0.0377)		CTTCACCTCGATGTCCTATAG	0.483																																																	2	Substitution - Missense(2)	kidney(2)											134.0	110.0	118.0					14																	70839819		2203	4300	6503	SO:0001583	missense	55333			AK002133	CCDS9803.1	14q24.2	2013-05-10			ENSG00000213463	ENSG00000213463			18955	protein-coding gene	gene with protein product	"""activin receptor interacting protein 5"""	609411				11882656	Standard	NM_018373		Approved	Arip2		P57105	OTTHUMG00000171240	ENST00000256366.4:c.327T>A	14.37:g.70839819A>T	ENSP00000256366:p.His109Gln		Q49SH3|Q96IA4	Missense_Mutation	SNP	ENST00000256366.4	37	CCDS9803.1	.	.	.	.	.	.	.	.	.	.	A	12.08	1.830210	0.32329	.	.	ENSG00000213463	ENST00000256366	T	0.18657	2.2	5.45	1.88	0.25563	PDZ/DHR/GLGF (1);	0.550372	0.17575	N	0.169334	T	0.14141	0.0342	L	0.57536	1.79	0.29231	N	0.873275	P	0.39665	0.682	B	0.35240	0.198	T	0.14008	-1.0488	10	0.11182	T	0.66	-2.9432	3.3825	0.07260	0.4013:0.2223:0.3764:0.0	.	109	P57105	SYJ2B_HUMAN	Q	109	ENSP00000256366:H109Q	ENSP00000256366:H109Q	H	-	3	2	SYNJ2BP	69909572	1.000000	0.71417	0.632000	0.29296	0.998000	0.95712	0.578000	0.23773	0.209000	0.20645	0.533000	0.62120	CAT		0.483	SYNJ2BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412472.1		NM_018373	
TGFBI	7045	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	135379760	135379760	+	Missense_Mutation	SNP	G	G	A			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr5:135379760G>A	ENST00000442011.2	+	3	408	c.247G>A	c.(247-249)Gag>Aag	p.E83K	TGFBI_ENST00000504185.1_3'UTR|TGFBI_ENST00000305126.8_Missense_Mutation_p.E83K	NM_000358.2	NP_000349.1	Q15582	BGH3_HUMAN	transforming growth factor, beta-induced, 68kDa	83	EMI. {ECO:0000255|PROSITE- ProRule:PRU00384}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|chondrocyte differentiation (GO:0002062)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	collagen binding (GO:0005518)|extracellular matrix binding (GO:0050840)|integrin binding (GO:0005178)	p.E83K(2)		breast(6)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CATCAGCTACGAGTGCTGTCC	0.537																																																	2	Substitution - Missense(2)	kidney(2)											187.0	189.0	188.0					5																	135379760		2029	4195	6224	SO:0001583	missense	7045			M77349	CCDS47266.1	5q31	2008-02-05	2002-08-29		ENSG00000120708	ENSG00000120708			11771	protein-coding gene	gene with protein product		601692	"""transforming growth factor, beta-induced, 68kD"""	CSD3, LCD1, CSD1, CSD2		9463327	Standard	NM_000358		Approved	BIGH3, CDB1, CDGG1	uc003lbf.4	Q15582	OTTHUMG00000163213	ENST00000442011.2:c.247G>A	5.37:g.135379760G>A	ENSP00000416330:p.Glu83Lys		D3DQB1|O14471|O14472|O14476|O43216|O43217|O43218|O43219|Q53XM1	Missense_Mutation	SNP	ENST00000442011.2	37	CCDS47266.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.433930	0.83776	.	.	ENSG00000120708	ENST00000442011;ENST00000305126	D;D	0.91792	-2.91;-2.91	5.64	5.64	0.86602	EMI domain (1);FAS1 domain (2);	0.045917	0.85682	D	0.000000	D	0.92325	0.7565	M	0.74647	2.275	0.80722	D	1	B	0.20550	0.046	B	0.17433	0.018	D	0.89343	0.3655	10	0.87932	D	0	-1.4839	19.6813	0.95964	0.0:0.0:1.0:0.0	.	83	Q15582	BGH3_HUMAN	K	83	ENSP00000416330:E83K;ENSP00000306306:E83K	ENSP00000306306:E83K	E	+	1	0	TGFBI	135407659	1.000000	0.71417	0.969000	0.41365	0.903000	0.53119	9.578000	0.98200	2.653000	0.90120	0.655000	0.94253	GAG		0.537	TGFBI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372108.1			
TPTE2P2	644623	broad.mit.edu	37	13	52857470	52857470	+	RNA	SNP	A	A	G			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr13:52857470A>G	ENST00000451298.1	-	0	235																											ATGTTAAGTAAATCAGAAAAA	0.318																																																	0																																												374500																															13.37:g.52857470A>G				RNA	SNP	ENST00000451298.1	37																																																																																					0.318	RP11-248G5.8-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript	OTTHUMT00000471093.1			
TMEM184C	55751	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	148545115	148545115	+	Splice_Site	SNP	G	G	C			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr4:148545115G>C	ENST00000296582.3	+	2	828	c.254G>C	c.(253-255)aGg>aCg	p.R85T	TMEM184C_ENST00000508208.1_Splice_Site_p.R85T	NM_018241.2	NP_060711.2	Q9NVA4	T184C_HUMAN	transmembrane protein 184C	85						integral component of membrane (GO:0016021)		p.R85T(2)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(2)|prostate(1)	16						CCAATAATAAGGTATGTCTTA	0.308																																																	2	Substitution - Missense(2)	kidney(2)											114.0	115.0	115.0					4																	148545115		2203	4300	6503	SO:0001630	splice_region_variant	55751			AF305823	CCDS3770.1	4q31.22	2008-06-05	2008-06-05	2008-06-05		ENSG00000164168			25587	protein-coding gene	gene with protein product		613937	"""transmembrane protein 34"""	TMEM34			Standard	NM_018241		Approved	FLJ10846	uc003ila.4	Q9NVA4		ENST00000296582.3:c.254+1G>C	4.37:g.148545115G>C			D3DP04|Q86X84|Q969I7|Q9NXM2	Missense_Mutation	SNP	ENST00000296582.3	37	CCDS3770.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.148181	0.78001	.	.	ENSG00000164168	ENST00000296582;ENST00000508208	T;T	0.54071	0.59;0.59	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.81931	0.4927	H	0.95574	3.69	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86897	0.2052	10	0.72032	D	0.01	-21.5	19.5645	0.95388	0.0:0.0:1.0:0.0	.	85	Q9NVA4	T184C_HUMAN	T	85	ENSP00000296582:R85T;ENSP00000425940:R85T	ENSP00000296582:R85T	R	+	2	0	TMEM184C	148764565	1.000000	0.71417	1.000000	0.80357	0.571000	0.35966	9.813000	0.99286	2.695000	0.91970	0.557000	0.71058	AGG		0.308	TMEM184C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364644.1		NM_018241	Missense_Mutation
TMEM69	51249	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	46156752	46156752	+	Silent	SNP	C	C	T			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr1:46156752C>T	ENST00000372025.4	+	2	1169	c.12C>T	c.(10-12)ttC>ttT	p.F4F	TMEM69_ENST00000496366.1_Intron	NM_016486.3	NP_057570.2	Q5SWH9	TMM69_HUMAN	transmembrane protein 69	4						integral component of membrane (GO:0016021)		p.F4F(2)		kidney(3)|lung(4)|ovary(1)	8	Acute lymphoblastic leukemia(166;0.155)					TGCTTCGCTTCATCCAGAAGT	0.438																																																	2	Substitution - coding silent(2)	kidney(2)											110.0	100.0	103.0					1																	46156752		1910	4128	6038	SO:0001819	synonymous_variant	51249			BC040289, BC013608	CCDS41325.1	1p34.1	2008-02-05	2005-08-17	2005-08-17	ENSG00000159596	ENSG00000159596			28035	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 154"""	C1orf154			Standard	NM_016486		Approved	FLJ21029	uc001cor.1	Q5SWH9	OTTHUMG00000040993	ENST00000372025.4:c.12C>T	1.37:g.46156752C>T			Q3SWW5|Q7Z2G0|Q9P0P9	Silent	SNP	ENST00000372025.4	37	CCDS41325.1																																																																																				0.438	TMEM69-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098390.1		NM_016486	
C5orf17	439936	broad.mit.edu	37	5	23980775	23980775	+	IGR	SNP	G	G	A			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr5:23980775G>A	ENST00000507936.1	+	0	477							Q8NAS9	CE017_HUMAN	chromosome 5 open reading frame 17																		AGGAGATAGAGGTGGCACCCC	0.512																																																	0																																										SO:0001628	intergenic_variant	0			AK092155		5p14.2	2011-11-24			ENSG00000248874	ENSG00000248874			26630	protein-coding gene	gene with protein product							Standard			Approved	FLJ34836		Q8NAS9	OTTHUMG00000161911		5.37:g.23980775G>A			Q2I376	RNA	SNP	ENST00000507936.1	37																																																																																					0.512	C5orf17-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000366366.1		NM_173668	
VSIG4	11326	broad.mit.edu;ucsc.edu	37	X	65252420	65252420	+	Missense_Mutation	SNP	G	G	A	rs139911916		TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chrX:65252420G>A	ENST00000374737.4	-	3	692	c.584C>T	c.(583-585)aCc>aTc	p.T195I	VSIG4_ENST00000455586.2_Missense_Mutation_p.T195I|VSIG4_ENST00000412866.2_Intron	NM_001257403.1|NM_007268.2	NP_001244332.1|NP_009199.1	Q9Y279	VSIG4_HUMAN	V-set and immunoglobulin domain containing 4	195	Ig-like 2.				complement activation, alternative pathway (GO:0006957)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of T cell proliferation (GO:0042130)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.T195I(2)		breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GAAGAGTAAGGTACTTAGGGT	0.498																																																	2	Substitution - Missense(2)	kidney(2)											194.0	162.0	173.0					X																	65252420		2203	4300	6503	SO:0001583	missense	11326			AJ132502	CCDS14383.1, CCDS48132.1, CCDS55435.1	Xq12-q13.3	2013-01-29			ENSG00000155659	ENSG00000155659		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17032	protein-coding gene	gene with protein product		300353				10899594, 11004523, 17016555, 17016562	Standard	NM_007268		Approved	Z39IG	uc004dwh.2	Q9Y279	OTTHUMG00000021727	ENST00000374737.4:c.584C>T	X.37:g.65252420G>A	ENSP00000363869:p.Thr195Ile		Q6UXI4	Missense_Mutation	SNP	ENST00000374737.4	37	CCDS14383.1	.	.	.	.	.	.	.	.	.	.	G	7.342	0.621183	0.14193	.	.	ENSG00000155659	ENST00000374737;ENST00000455586;ENST00000423830	T;T;T	0.03717	3.83;3.83;3.83	4.04	-1.63	0.08345	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.727143	0.12251	N	0.485577	T	0.08403	0.0209	L	0.58810	1.83	0.09310	N	1	P;P;D;D	0.61080	0.784;0.901;0.985;0.989	P;P;D;P	0.67382	0.496;0.702;0.951;0.878	T	0.23976	-1.0173	10	0.44086	T	0.13	-0.7344	0.43	0.00469	0.2162:0.1612:0.2908:0.3319	.	195;118;185;195	Q9Y279-2;C9JTJ4;C9JH67;Q9Y279	.;.;.;VSIG4_HUMAN	I	195;195;118	ENSP00000363869:T195I;ENSP00000411581:T195I;ENSP00000414594:T118I	ENSP00000363869:T195I	T	-	2	0	VSIG4	65169145	0.049000	0.20398	0.001000	0.08648	0.014000	0.08584	0.450000	0.21762	-0.544000	0.06232	-1.006000	0.02489	ACC		0.498	VSIG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056986.1		NM_007268	
VWA5B1	127731	broad.mit.edu;ucsc.edu	37	1	20657460	20657460	+	Missense_Mutation	SNP	A	A	G			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr1:20657460A>G	ENST00000375079.2	+	11	1752	c.1556A>G	c.(1555-1557)gAg>gGg	p.E519G	VWA5B1_ENST00000375083.4_Missense_Mutation_p.E519G|VWA5B1_ENST00000289815.8_Missense_Mutation_p.E519G|VWA5B1_ENST00000289825.4_Missense_Mutation_p.E236G	NM_001039500.2	NP_001034589.2	Q5TIE3	VW5B1_HUMAN	von Willebrand factor A domain containing 5B1	519	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.					extracellular region (GO:0005576)		p.E519G(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|prostate(1)|skin(1)	7						ATGGAGGGGGAGCGGCTGCAA	0.587																																																	1	Substitution - Missense(1)	kidney(1)											67.0	65.0	66.0					1																	20657460		692	1591	2283	SO:0001583	missense	127731			AK125833, AK057346		1p36.12	2014-02-12			ENSG00000158816	ENSG00000158816			26538	protein-coding gene	gene with protein product							Standard	NM_001039500		Approved	FLJ32784	uc009vps.2	Q5TIE3	OTTHUMG00000002835	ENST00000375079.2:c.1556A>G	1.37:g.20657460A>G	ENSP00000364220:p.Glu519Gly		A4IF35|A4IF36|Q3ZCM4|Q6ZUB4|Q96M71	Missense_Mutation	SNP	ENST00000375079.2	37		.	.	.	.	.	.	.	.	.	.	A	22.9	4.351740	0.82132	.	.	ENSG00000158816	ENST00000375089;ENST00000289815;ENST00000375083;ENST00000289825;ENST00000375079	T;T;T;T	0.13901	2.55;2.55;2.55;2.55	5.38	5.38	0.77491	von Willebrand factor, type A (2);	0.105694	0.64402	D	0.000006	T	0.44603	0.1301	M	0.89785	3.06	0.58432	D	0.999999	P;D;D	0.76494	0.624;0.999;0.999	B;D;D	0.72982	0.406;0.979;0.977	T	0.55055	-0.8200	10	0.87932	D	0	-15.8698	14.2189	0.65812	1.0:0.0:0.0:0.0	.	519;519;236	Q5TIE3;Q5TIE3-2;Q5TIE3-3	VW5B1_HUMAN;.;.	G	519;519;519;236;519	ENSP00000289815:E519G;ENSP00000364224:E519G;ENSP00000289825:E236G;ENSP00000364220:E519G	ENSP00000289815:E519G	E	+	2	0	VWA5B1	20530047	1.000000	0.71417	0.991000	0.47740	0.791000	0.44710	8.410000	0.90225	2.049000	0.60858	0.523000	0.50628	GAG		0.587	VWA5B1-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000007945.4		XM_001722222	
WBSCR28	135886	broad.mit.edu	37	7	73280191	73280191	+	Silent	SNP	T	T	C			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr7:73280191T>C	ENST00000320531.2	+	3	822	c.786T>C	c.(784-786)acT>acC	p.T262T		NM_182504.3	NP_872310.2	Q6UE05	WBS28_HUMAN	Williams-Beuren syndrome chromosome region 28	262						integral component of membrane (GO:0016021)		p.T262T(1)		breast(2)|kidney(2)|lung(6)|skin(1)	11		Lung NSC(55;0.159)				AGCAAGAAACTCCCAGAGAAT	0.542																																																	1	Substitution - coding silent(1)	kidney(1)											85.0	95.0	91.0					7																	73280191		2000	4171	6171	SO:0001819	synonymous_variant	135886			BC030643	CCDS43597.1	7q11.23	2006-07-04			ENSG00000175877	ENSG00000175877			23018	protein-coding gene	gene with protein product		612547				8812460	Standard	NM_182504		Approved	MGC26719	uc003tzk.2	Q6UE05	OTTHUMG00000157243	ENST00000320531.2:c.786T>C	7.37:g.73280191T>C			Q6UE04|Q8NHP4	Silent	SNP	ENST00000320531.2	37	CCDS43597.1																																																																																				0.542	WBSCR28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348130.1		NM_182504	
WDR62	284403	hgsc.bcm.edu;ucsc.edu	37	19	36593730	36593730	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr19:36593730delC	ENST00000270301.7	+	27	3297	c.3297delC	c.(3295-3297)ctcfs	p.L1099fs	WDR62_ENST00000401500.2_Frame_Shift_Del_p.L1104fs			O43379	WDR62_HUMAN	WD repeat domain 62	1099					cerebral cortex development (GO:0021987)|neurogenesis (GO:0022008)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle pole (GO:0000922)				cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(15)|prostate(4)|stomach(2)|urinary_tract(3)	43	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			CGCAGTTCCTCTCAAGCCTCC	0.592																																																	0													94.0	74.0	81.0					19																	36593730		2203	4300	6503	SO:0001589	frameshift_variant	284403			BX647726	CCDS33001.1, CCDS46059.1	19q13.12	2013-01-09	2005-05-09	2005-05-09	ENSG00000075702	ENSG00000075702		"""WD repeat domain containing"""	24502	protein-coding gene	gene with protein product		613583	"""chromosome 19 open reading frame 14"", ""microcephaly, primary autosomal recessive 2"""	C19orf14, MCPH2		19910486, 20729831, 20890278, 21496009	Standard	NM_001083961		Approved	DKFZP434J046, FLJ33298	uc002odd.2	O43379	OTTHUMG00000048139	ENST00000270301.7:c.3297delC	19.37:g.36593730delC	ENSP00000270301:p.Leu1099fs		Q63HP9|Q659D7|Q8NBF7|Q96AD9	Frame_Shift_Del	DEL	ENST00000270301.7	37	CCDS33001.1																																																																																				0.592	WDR62-006	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457436.1		NM_015671	
WDR62	284403	hgsc.bcm.edu;ucsc.edu	37	19	36593732	36593733	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	CA	CA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr19:36593732_36593733delCA	ENST00000270301.7	+	27	3299_3300	c.3299_3300delCA	c.(3298-3300)tcafs	p.S1101fs	WDR62_ENST00000401500.2_Frame_Shift_Del_p.S1106fs			O43379	WDR62_HUMAN	WD repeat domain 62	1101					cerebral cortex development (GO:0021987)|neurogenesis (GO:0022008)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle pole (GO:0000922)				cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(15)|prostate(4)|stomach(2)|urinary_tract(3)	43	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			CAGTTCCTCTCAAGCCTCCAGA	0.599																																																	0																																										SO:0001589	frameshift_variant	284403			BX647726	CCDS33001.1, CCDS46059.1	19q13.12	2013-01-09	2005-05-09	2005-05-09	ENSG00000075702	ENSG00000075702		"""WD repeat domain containing"""	24502	protein-coding gene	gene with protein product		613583	"""chromosome 19 open reading frame 14"", ""microcephaly, primary autosomal recessive 2"""	C19orf14, MCPH2		19910486, 20729831, 20890278, 21496009	Standard	NM_001083961		Approved	DKFZP434J046, FLJ33298	uc002odd.2	O43379	OTTHUMG00000048139	ENST00000270301.7:c.3299_3300delCA	19.37:g.36593732_36593733delCA	ENSP00000270301:p.Ser1101fs		Q63HP9|Q659D7|Q8NBF7|Q96AD9	Frame_Shift_Del	DEL	ENST00000270301.7	37	CCDS33001.1																																																																																				0.599	WDR62-006	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457436.1		NM_015671	
ZNF227	7770	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	44740521	44740521	+	Silent	SNP	T	T	C			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr19:44740521T>C	ENST00000313040.7	+	6	2143	c.1938T>C	c.(1936-1938)ggT>ggC	p.G646G	ZNF227_ENST00000589005.1_Silent_p.G595G|ZNF227_ENST00000391961.2_Silent_p.G595G|ZNF235_ENST00000589799.1_3'UTR	NM_182490.1	NP_872296.1	Q86WZ6	ZN227_HUMAN	zinc finger protein 227	646					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G646G(2)		central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(2)|stomach(1)|urinary_tract(1)	24		Prostate(69;0.0435)				AGTCCTCTGGTCTTCAATCCC	0.463																																																	2	Substitution - coding silent(2)	kidney(2)											64.0	65.0	65.0					19																	44740521		2203	4300	6503	SO:0001819	synonymous_variant	7770			AK092253	CCDS12636.1, CCDS74388.1	19q13.32	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	13020	protein-coding gene	gene with protein product							Standard	XM_005259232		Approved		uc002oyu.3	Q86WZ6		ENST00000313040.7:c.1938T>C	19.37:g.44740521T>C			B3KRU7|B7Z5P9	Silent	SNP	ENST00000313040.7	37	CCDS12636.1																																																																																				0.463	ZNF227-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460720.1		NM_182490	
ZBTB18	10472	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	244218338	244218338	+	Missense_Mutation	SNP	G	G	T			TCGA-B2-4099-01A-02D-1458-08	TCGA-B2-4099-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01c54f7c-84b9-4f5b-ae44-2ac1f661fd29	54cf60f2-947e-4eb0-b5a7-1e644ca10dba	g.chr1:244218338G>T	ENST00000358704.4	+	2	1411	c.1262G>T	c.(1261-1263)tGc>tTc	p.C421F		NM_001278196.1|NM_006352.4|NM_205768.2	NP_001265125.1|NP_006343.2|NP_991331.1	Q99592	ZBT18_HUMAN	zinc finger and BTB domain containing 18	412	Interaction with DNMT3A.				cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron development (GO:0048666)|regulation of cell division (GO:0051302)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.C412F(2)									GTGCCCACGTGCTCGCTGTGT	0.632																																																	2	Substitution - Missense(2)	kidney(2)											61.0	62.0	62.0					1																	244218338		2203	4300	6503	SO:0001583	missense	0			U38896	CCDS1622.1	1q44	2013-09-19	2013-01-09	2013-01-09	ENSG00000179456	ENSG00000179456		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13030	protein-coding gene	gene with protein product		608433	"""zinc finger protein 238"""	ZNF238		9568537, 9013868	Standard	NM_205768		Approved	C2H2-171, TAZ-1, RP58	uc031psv.1	Q99592	OTTHUMG00000040013	ENST00000358704.4:c.1262G>T	1.37:g.244218338G>T	ENSP00000351539:p.Cys421Phe		A8K5U3|Q13397|Q5VU40|Q8N463|Q9UD99	Missense_Mutation	SNP	ENST00000358704.4	37	CCDS1622.1	.	.	.	.	.	.	.	.	.	.	G	17.48	3.399627	0.62177	.	.	ENSG00000179456	ENST00000366538;ENST00000358704	D	0.85411	-1.98	5.84	5.84	0.93424	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.89417	0.6709	L	0.34521	1.04	0.80722	D	1	D;D	0.69078	0.995;0.997	D;D	0.78314	0.979;0.991	D	0.89992	0.4108	10	0.87932	D	0	.	20.1379	0.98040	0.0:0.0:1.0:0.0	.	412;421	Q99592;Q99592-2	ZN238_HUMAN;.	F	421	ENSP00000351539:C421F	ENSP00000351539:C421F	C	+	2	0	ZNF238	242284961	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.779000	0.95612	0.655000	0.94253	TGC		0.632	ZBTB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096513.2		NM_205768	
ZNF564	163050	hgsc.bcm.edu	37	19	12637738	12637739	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr19:12637738_12637739insAA	ENST00000339282.7	-	4	1379_1380	c.1183_1184insTT	c.(1183-1185)tgtfs	p.C395fs	CTD-2192J16.21_ENST00000601420.1_RNA|CTD-2192J16.20_ENST00000593682.1_3'UTR|ZNF709_ENST00000428311.1_Intron	NM_144976.3	NP_659413.1	Q8TBZ8	ZN564_HUMAN	zinc finger protein 564	395					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18						ACATACCTGACATTTATAAGGT	0.436																																																	0																																										SO:0001589	frameshift_variant	163050			BC028367	CCDS42505.1	19p13.2	2013-09-19			ENSG00000249709	ENSG00000249709		"""Zinc fingers, C2H2-type"", ""-"""	31106	protein-coding gene	gene with protein product							Standard	NM_144976		Approved	MGC26914		Q8TBZ8	OTTHUMG00000156418	ENST00000339282.7:c.1183_1184insTT	19.37:g.12637738_12637739insAA	ENSP00000340004:p.Cys395fs		B9EGT4|Q6P1K6	Frame_Shift_Ins	INS	ENST00000339282.7	37	CCDS42505.1																																																																																				0.436	ZNF564-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344120.2		NM_144976	
ZNF595	152687	hgsc.bcm.edu	37	4	85995	85996	+	3'UTR	INS	-	-	A	rs61336127|rs397762835		TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr4:85995_85996insA	ENST00000339368.6	+	0	804_805							Q8IYB9	ZN595_HUMAN	zinc finger protein 595						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)	20		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		AGAAACCCTACAATGTGAAAAA	0.401													AAA|AA|AAA|deletion	5008	1.0	1.0	1.0	5008	,	,		15241	1.0		1.0	False		,,,				2504	1.0																0										3875,15		1931,13,1						0.1	0.1		dbSNP_134	13	7943,47		3955,33,7	no	frameshift	ZNF595	NM_182524.2		5886,46,8	A1A1,A1R,RR		0.5882,0.3856,0.5219				11818,62				SO:0001624	3_prime_UTR_variant	152687			BX537887	CCDS75075.1, CCDS75076.1, CCDS75077.1	4p16.3	2013-01-08				ENSG00000272602		"""Zinc fingers, C2H2-type"", ""-"""	27196	protein-coding gene	gene with protein product						12477932	Standard	NM_182524		Approved	FLJ31740		Q8IYB9		ENST00000339368.6:c.*802->A	4.37:g.85997_85997dupA				Frame_Shift_Ins	INS	ENST00000339368.6	37																																																																																					0.401	ZNF595-001	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000357814.2		NM_182524	
ZUFSP	221302	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	116977892	116977892	+	Missense_Mutation	SNP	C	C	T			TCGA-B2-4099-01A-02D-1251-10	TCGA-B2-4099-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ce82bf89-dc70-44a3-b708-8baf21fbcc47	ef7262e7-c3e5-4d51-b410-aafd62940610	g.chr6:116977892C>T	ENST00000368576.3	-	5	1159	c.916G>A	c.(916-918)Gaa>Aaa	p.E306K	ZUFSP_ENST00000471919.1_5'UTR|ZUFSP_ENST00000368573.1_Intron	NM_145062.2	NP_659499.2	Q96AP4	ZUFSP_HUMAN	zinc finger with UFM1-specific peptidase domain	306							metal ion binding (GO:0046872)	p.E306K(2)		NS(1)|endometrium(2)|kidney(6)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	21				GBM - Glioblastoma multiforme(226;0.0258)|all cancers(137;0.0368)|OV - Ovarian serous cystadenocarcinoma(136;0.0464)|Epithelial(106;0.186)		GCTAATGATTCCATCATATCA	0.348																																																	2	Substitution - Missense(2)	kidney(2)											112.0	103.0	106.0					6																	116977892		2203	4299	6502	SO:0001583	missense	221302			AK054582	CCDS5110.1	6q22.31	2013-01-28	2008-03-25	2008-03-25	ENSG00000153975	ENSG00000153975		"""Zinc fingers, C2H2-type"""	21224	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 113"""	C6orf113			Standard	NM_145062		Approved	dJ412I7.3	uc003pxf.2	Q96AP4	OTTHUMG00000015445	ENST00000368576.3:c.916G>A	6.37:g.116977892C>T	ENSP00000357565:p.Glu306Lys		Q5TD92|Q6PJH7|Q96NV6	Missense_Mutation	SNP	ENST00000368576.3	37	CCDS5110.1	.	.	.	.	.	.	.	.	.	.	C	34	5.336175	0.95758	.	.	ENSG00000153975	ENST00000368576	T	0.44881	0.91	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.54334	0.1852	L	0.58669	1.825	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.36817	-0.9732	10	0.28530	T	0.3	-23.3391	20.0079	0.97439	0.0:1.0:0.0:0.0	.	306	Q96AP4	ZUFSP_HUMAN	K	306	ENSP00000357565:E306K	ENSP00000357565:E306K	E	-	1	0	ZUFSP	117084585	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.089000	0.76909	2.726000	0.93360	0.561000	0.74099	GAA		0.348	ZUFSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041961.1		NM_145062	
LRRC7	57554	broad.mit.edu	37	1	70502282	70502282	+	Missense_Mutation	SNP	G	G	C			TCGA-B2-4099-01A-02D-1458-08	TCGA-B2-4099-10A-01D-1458-08	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454	.		Illumina GAIIx	01c54f7c-84b9-4f5b-ae44-2ac1f661fd29	54cf60f2-947e-4eb0-b5a7-1e644ca10dba	g.chr1:70502282G>C	ENST00000035383.5	+	18	2179	c.2149G>C	c.(2149-2151)Gta>Cta	p.V717L	LRRC7_ENST00000415775.2_Intron|LRRC7_ENST00000310961.5_Missense_Mutation_p.V722L	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	717						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)		p.V717L(2)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						TAAAGATGCAGTACATAATTC	0.423																																						.											2	Substitution - Missense(2)	kidney(2)											141.0	153.0	149.0					1																	70502282		2203	4300	6503	SO:0001583	missense	57554				CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.2149G>C	1.37:g.70502282G>C	ENSP00000035383:p.Val717Leu		Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	ENST00000035383.5	37	CCDS645.1	.	.	.	.	.	.	.	.	.	.	G	15.05	2.718215	0.48622	.	.	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000370957	T;T	0.36699	1.24;1.31	5.77	5.77	0.91146	.	0.457883	0.21756	N	0.069590	T	0.22820	0.0551	L	0.44542	1.39	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.01500	-1.1339	10	0.38643	T	0.18	.	19.335	0.94312	0.0:0.0:1.0:0.0	.	717	Q96NW7	LRRC7_HUMAN	L	722;717;540	ENSP00000309245:V722L;ENSP00000035383:V717L	ENSP00000035383:V717L	V	+	1	0	LRRC7	70274870	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.680000	0.61656	2.890000	0.99128	0.650000	0.86243	GTA		0.423	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1		NM_020794	
