#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
AMY2B	280	hgsc.bcm.edu	37	1	104122036	104122036	+	Missense_Mutation	SNP	G	G	A	rs143243690	byFrequency	TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr1:104122036G>A	ENST00000361355.4	+	12	2066	c.1450G>A	c.(1450-1452)Gtt>Att	p.V484I	AMY2B_ENST00000491397.1_3'UTR	NM_020978.3	NP_066188.1	P19961	AMY2B_HUMAN	amylase, alpha 2B (pancreatic)	484					carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|kidney(4)|large_intestine(1)|lung(30)|prostate(1)|skin(1)|urinary_tract(1)	46		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		TAAAATCTACGTTTCTGACGA	0.323													.|||	2	0.000399361	0.0	0.0	5008	,	,		17291	0.0		0.001	False		,,,				2504	0.001				p.V484I		Atlas-SNP	.											.	AMY2B	80	.	0			c.G1450A						PASS	.	G	ILE/VAL	0,4406		0,0,2203	227.0	235.0	232.0		1450	2.2	0.2	1	dbSNP_134	232	1,8599	1.2+/-3.3	0,1,4299	no	missense	AMY2B	NM_020978.3	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	484/512	104122036	1,13005	2203	4300	6503	SO:0001583	missense	280	exon12			ATCTACGTTTCTG	M24895	CCDS782.1	1p21	2010-08-02	2006-04-27		ENSG00000240038	ENSG00000240038	3.2.1.1		478	protein-coding gene	gene with protein product		104660	"""amylase, alpha 2B; pancreatic"""	AMY2		8268204	Standard	NM_020978		Approved		uc001duq.3	P19961	OTTHUMG00000011024	ENST00000361355.4:c.1450G>A	chr1.hg19:g.104122036G>A	ENSP00000354610:p.Val484Ile	735.0	1.0	.		1115.0	198.0	.	NM_020978	B3KTI1|B3KXB7|D3DT76|Q9UBH3	Missense_Mutation	SNP	ENST00000361355.4	hg19	CCDS782.1	.	.	.	.	.	.	.	.	.	.	G	8.662	0.900711	0.17686	0.0	1.16E-4	ENSG00000240038	ENST00000361355	T	0.78595	-1.19	4.14	2.25	0.28309	Alpha-amylase, C-terminal all beta (2);Glycosyl hydrolase, family 13, all-beta (1);	0.067775	0.64402	N	0.000017	T	0.74168	0.3681	H	0.95884	3.735	0.48040	D	0.999579	B	0.22346	0.068	B	0.20184	0.028	T	0.72577	-0.4251	10	0.56958	D	0.05	.	8.6944	0.34287	0.2605:0.0:0.7395:0.0	.	484	P19961	AMY2B_HUMAN	I	484	ENSP00000354610:V484I	ENSP00000354610:V484I	V	+	1	0	AMY2B	103923559	1.000000	0.71417	0.165000	0.22776	0.168000	0.22595	4.103000	0.57783	0.339000	0.23719	-0.224000	0.12420	GTT	.	G|1.000;A|0.000	0.000	weak		0.323	AMY2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030318.1	NM_020978	
LRIG2	9860	hgsc.bcm.edu	37	1	113616063	113616063	+	Missense_Mutation	SNP	A	A	T			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr1:113616063A>T	ENST00000361127.5	+	1	233	c.35A>T	c.(34-36)cAg>cTg	p.Q12L	RP11-31F15.2_ENST00000421157.1_lincRNA	NM_014813.1	NP_055628.1	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like domains 2	12					innervation (GO:0060384)|regulation of platelet-derived growth factor receptor signaling pathway (GO:0010640)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(10)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	31	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		CCGGAGGAGCAGTTGCTGGGG	0.642											OREG0013684	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q12L		Atlas-SNP	.											.	LRIG2	67	.	0			c.A35T						PASS	.						109.0	125.0	120.0					1																	113616063		2203	4300	6503	SO:0001583	missense	9860	exon1			AGGAGCAGTTGCT	AB018349	CCDS30808.1	1p13.1	2013-01-11			ENSG00000198799	ENSG00000198799		"""Immunoglobulin superfamily / I-set domain containing"""	20889	protein-coding gene	gene with protein product		608869					Standard	XM_005271369		Approved	KIAA0806	uc001edf.1	O94898	OTTHUMG00000012133	ENST00000361127.5:c.35A>T	chr1.hg19:g.113616063A>T	ENSP00000355396:p.Gln12Leu	320.0	0.0	.	1451	352.0	123.0	.	NM_014813	Q9NSN2	Missense_Mutation	SNP	ENST00000361127.5	hg19	CCDS30808.1	.	.	.	.	.	.	.	.	.	.	A	9.612	1.131598	0.21041	.	.	ENSG00000198799	ENST00000361127	T	0.60920	0.15	4.86	-2.01	0.07410	.	0.866104	0.09769	N	0.758205	T	0.10637	0.0260	N	0.08118	0	0.21220	N	0.99976	B	0.02656	0.0	B	0.01281	0.0	T	0.18335	-1.0340	10	0.35671	T	0.21	.	0.3463	0.00342	0.1887:0.2563:0.2382:0.3168	.	12	O94898	LRIG2_HUMAN	L	12	ENSP00000355396:Q12L	ENSP00000355396:Q12L	Q	+	2	0	LRIG2	113417586	0.910000	0.30920	0.987000	0.45799	0.031000	0.12232	-0.515000	0.06290	-0.294000	0.08973	-0.290000	0.09829	CAG	.	.	.	none		0.642	LRIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033549.2	NM_014813	
KIAA0907	22889	hgsc.bcm.edu	37	1	155899153	155899153	+	Missense_Mutation	SNP	C	C	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr1:155899153C>G	ENST00000368321.3	-	4	421	c.398G>C	c.(397-399)aGt>aCt	p.S133T	KIAA0907_ENST00000482337.1_5'UTR|KIAA0907_ENST00000368320.3_Missense_Mutation_p.S133T|KIAA0907_ENST00000368319.3_Missense_Mutation_p.S133T	NM_014949.2	NP_055764.2	Q7Z7F0	K0907_HUMAN	KIAA0907	133							RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|urinary_tract(1)	21	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;8.82e-06)			TGCAGCCCCACTAAGTCGGCT	0.408																																					p.S133T		Atlas-SNP	.											.	KIAA0907	58	.	0			c.G398C						PASS	.						126.0	119.0	122.0					1																	155899153		2203	4300	6503	SO:0001583	missense	22889	exon4			GCCCCACTAAGTC	BC062637	CCDS30885.1	1q22	2012-11-30			ENSG00000132680	ENSG00000132680			29145	protein-coding gene	gene with protein product						10048485	Standard	NM_014949		Approved	BLOM7	uc001fmi.1	Q7Z7F0	OTTHUMG00000014103	ENST00000368321.3:c.398G>C	chr1.hg19:g.155899153C>G	ENSP00000357304:p.Ser133Thr	88.0	0.0	.		139.0	52.0	.	NM_014949	O94981|Q7L7Q2|Q7Z7E9|Q8TBQ0	Missense_Mutation	SNP	ENST00000368321.3	hg19	CCDS30885.1	.	.	.	.	.	.	.	.	.	.	C	18.00	3.524402	0.64747	.	.	ENSG00000132680	ENST00000368321;ENST00000368320;ENST00000368319	T;T;T	0.34859	1.34;1.34;1.34	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.20129	0.0484	N	0.16790	0.44	0.80722	D	1	P;P;P;P;P;B	0.50819	0.873;0.939;0.873;0.884;0.682;0.336	P;P;B;P;B;B	0.52646	0.541;0.699;0.439;0.705;0.303;0.395	T	0.01720	-1.1288	10	0.08179	T	0.78	-11.4646	17.2104	0.86929	0.0:1.0:0.0:0.0	.	133;133;133;133;133;133	D3DVA4;Q7Z7F0-4;A8K1I7;Q7Z7F0-3;Q7Z7F0-2;Q7Z7F0	.;.;.;.;.;K0907_HUMAN	T	133	ENSP00000357304:S133T;ENSP00000357303:S133T;ENSP00000357302:S133T	ENSP00000357302:S133T	S	-	2	0	KIAA0907	154165777	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.105000	0.77031	2.831000	0.97527	0.650000	0.86243	AGT	.	.	.	none		0.408	KIAA0907-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039583.1	NM_014949	
USF1	7391	hgsc.bcm.edu	37	1	161011569	161011569	+	Missense_Mutation	SNP	T	T	C			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr1:161011569T>C	ENST00000368021.3	-	6	548	c.344A>G	c.(343-345)cAc>cGc	p.H115R	F11R_ENST00000289779.3_5'Flank|TSTD1_ENST00000423014.2_5'Flank|TSTD1_ENST00000368024.1_5'Flank|USF1_ENST00000368020.1_Missense_Mutation_p.H115R|USF1_ENST00000435396.1_Missense_Mutation_p.H56R|TSTD1_ENST00000368023.3_5'Flank|TSTD1_ENST00000318289.10_5'Flank|USF1_ENST00000368019.1_Missense_Mutation_p.H115R	NM_007122.3	NP_009053.1	P22415	USF1_HUMAN	upstream transcription factor 1	115					carbon catabolite regulation of transcription (GO:0045990)|cellular response to insulin stimulus (GO:0032869)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|late viral transcription (GO:0019086)|lipid homeostasis (GO:0055088)|negative regulation of fibrinolysis (GO:0051918)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by glucose (GO:0000432)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter by glucose (GO:0000430)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|large_intestine(3)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9	all_cancers(52;6.73e-18)|Breast(13;0.012)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			GTAAGTATAGTGCGTCTCAGC	0.572											OREG0013936	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.H115R		Atlas-SNP	.											.	USF1	29	.	0			c.A344G						PASS	.						95.0	87.0	90.0					1																	161011569		2203	4300	6503	SO:0001583	missense	7391	exon6			GTATAGTGCGTCT	BC035505	CCDS1214.1	1q22-q23	2013-05-21			ENSG00000158773	ENSG00000158773		"""Basic helix-loop-helix proteins"""	12593	protein-coding gene	gene with protein product		191523				8486371	Standard	NM_007122		Approved	UEF, MLTFI, bHLHb11	uc031pqv.1	P22415	OTTHUMG00000031472	ENST00000368021.3:c.344A>G	chr1.hg19:g.161011569T>C	ENSP00000357000:p.His115Arg	123.0	0.0	.	1813	141.0	13.0	.	NM_001276373	B2RBZ4|Q5SY46|Q7Z5Y1	Missense_Mutation	SNP	ENST00000368021.3	hg19	CCDS1214.1	.	.	.	.	.	.	.	.	.	.	T	5.051	0.195050	0.09599	.	.	ENSG00000158773	ENST00000368020;ENST00000368021;ENST00000435396;ENST00000368019;ENST00000534633	D;D;D;D	0.91740	-2.9;-2.9;-2.85;-2.89	5.23	5.23	0.72850	.	0.048337	0.85682	D	0.000000	T	0.72614	0.3482	N	0.19112	0.55	0.42447	D	0.992738	B	0.11235	0.004	B	0.09377	0.004	T	0.67480	-0.5660	10	0.02654	T	1	-18.6648	13.1223	0.59334	0.0:0.0:0.0:1.0	.	115	P22415	USF1_HUMAN	R	115;115;56;115;56	ENSP00000356999:H115R;ENSP00000357000:H115R;ENSP00000390109:H56R;ENSP00000356998:H115R	ENSP00000356998:H115R	H	-	2	0	USF1	159278193	0.992000	0.36948	0.993000	0.49108	0.996000	0.88848	1.041000	0.30291	2.194000	0.70268	0.533000	0.62120	CAC	.	.	.	none		0.572	USF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077050.1	NM_007122	
IMMT	10989	hgsc.bcm.edu	37	2	86371415	86371415	+	Silent	SNP	T	T	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr2:86371415T>G	ENST00000410111.3	-	15	2640	c.2253A>C	c.(2251-2253)ggA>ggC	p.G751G	IMMT_ENST00000442664.2_Silent_p.G750G|IMMT_ENST00000409051.2_Silent_p.G704G|IMMT_ENST00000449247.2_Silent_p.G740G|IMMT_ENST00000254636.5_Silent_p.G652G	NM_001100169.1|NM_001100170.1|NM_006839.2	NP_001093639.1|NP_001093640.1|NP_006830.2	Q16891	MIC60_HUMAN	inner membrane protein, mitochondrial	751					mitochondrial calcium ion homeostasis (GO:0051560)|response to cold (GO:0009409)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						CCTGAGTGGTTCCTATTCCTA	0.478																																					p.G751G		Atlas-SNP	.											.	IMMT	65	.	0			c.A2253C						PASS	.						68.0	66.0	67.0					2																	86371415		1922	4128	6050	SO:0001819	synonymous_variant	10989	exon15			AGTGGTTCCTATT	D21094	CCDS46355.1, CCDS46356.1, CCDS46357.1	2p11.2	2011-10-04	2010-04-29		ENSG00000132305	ENSG00000132305			6047	protein-coding gene	gene with protein product	"""mitofilin"", ""mitochondrial inner membrane organizing system 2"""	600378	"""inner membrane protein, mitochondrial (mitofilin)"""			9168817, 8039717	Standard	NM_001100169		Approved	P87, P89, HMP, MINOS2	uc002sqz.4	Q16891	OTTHUMG00000153170	ENST00000410111.3:c.2253A>C	chr2.hg19:g.86371415T>G		94.0	0.0	.		101.0	40.0	.	NM_006839	B1H0U5|B2R5N6|Q14539|Q15092|Q68D41|Q69HW5|Q6IBL0|Q7Z3X1|Q8TAJ5|Q9P0V2	Silent	SNP	ENST00000410111.3	hg19	CCDS46355.1	.	.	.	.	.	.	.	.	.	.	T	7.004	0.555382	0.13436	.	.	ENSG00000132305	ENST00000419070	.	.	.	5.3	-1.19	0.09585	.	.	.	.	.	T	0.52058	0.1711	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44329	-0.9335	4	.	.	.	-22.8427	7.6657	0.28430	0.0:0.4268:0.1243:0.4489	.	.	.	.	H	606	.	.	N	-	1	0	IMMT	86224926	0.864000	0.29904	0.998000	0.56505	0.905000	0.53344	-0.251000	0.08818	-0.076000	0.12775	-0.256000	0.11100	AAC	.	.	.	none		0.478	IMMT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000329909.2	NM_006839	
VWC2L	402117	hgsc.bcm.edu	37	2	215440518	215440518	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr2:215440518G>T	ENST00000312504.5	+	4	1445	c.643G>T	c.(643-645)Gaa>Taa	p.E215*	VWC2L_ENST00000427124.1_3'UTR|AC107218.3_ENST00000437883.1_RNA|AC107218.3_ENST00000412896.1_RNA	NM_001080500.2	NP_001073969.1	B2RUY7	VWC2L_HUMAN	von Willebrand factor C domain containing protein 2-like	215					negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of neuron differentiation (GO:0045666)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|synapse (GO:0045202)				breast(1)|endometrium(1)|large_intestine(3)|lung(10)|prostate(1)	16						TTCGAAACGTGAATGCCAAGG	0.458																																					p.E215X		Atlas-SNP	.											.	VWC2L	40	.	0			c.G643T						PASS	.						225.0	220.0	221.0					2																	215440518		2026	4199	6225	SO:0001587	stop_gained	402117	exon4			AAACGTGAATGCC	AB374231	CCDS46509.1	2q34-q35	2011-01-25	2011-01-25		ENSG00000174453	ENSG00000174453			37203	protein-coding gene	gene with protein product			"""von Willebrand factor C domain-containing protein 2-like"""				Standard	NM_001080500		Approved		uc002vet.2	B2RUY7	OTTHUMG00000154811	ENST00000312504.5:c.643G>T	chr2.hg19:g.215440518G>T	ENSP00000308976:p.Glu215*	211.0	0.0	.		305.0	93.0	.	NM_001080500	A6NC69|B2RUW7|B7X8X1	Nonsense_Mutation	SNP	ENST00000312504.5	hg19	CCDS46509.1	.	.	.	.	.	.	.	.	.	.	G	44	10.583132	0.99432	.	.	ENSG00000174453	ENST00000312504	.	.	.	5.58	5.58	0.84498	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	-3.3711	19.5796	0.95461	0.0:0.0:1.0:0.0	.	.	.	.	X	215	.	ENSP00000308976:E215X	E	+	1	0	VWC2L	215148763	1.000000	0.71417	0.997000	0.53966	0.999000	0.98932	9.476000	0.97823	2.624000	0.88883	0.655000	0.94253	GAA	.	.	.	none		0.458	VWC2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337175.1	NM_001080500	
OGG1	4968	hgsc.bcm.edu	37	3	9798228	9798228	+	Missense_Mutation	SNP	T	T	A			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr3:9798228T>A	ENST00000344629.7	+	5	1164	c.821T>A	c.(820-822)aTt>aAt	p.I274N	OGG1_ENST00000339511.5_Missense_Mutation_p.I274N|OGG1_ENST00000302036.7_Missense_Mutation_p.I274N|OGG1_ENST00000302008.8_Missense_Mutation_p.I274N|OGG1_ENST00000349503.5_Intron|OGG1_ENST00000449570.2_Missense_Mutation_p.I274N|OGG1_ENST00000302003.7_Missense_Mutation_p.I274N|OGG1_ENST00000383826.5_Intron			O15527	OGG1_HUMAN	8-oxoguanine DNA glycosylase	274					acute inflammatory response (GO:0002526)|base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|cellular response to cadmium ion (GO:0071276)|depurination (GO:0045007)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair (GO:0006289)|regulation of protein import into nucleus, translocation (GO:0033158)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|response to oxidative stress (GO:0006979)|response to radiation (GO:0009314)	mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	8-oxo-7,8-dihydroguanine DNA N-glycosylase activity (GO:0034039)|damaged DNA binding (GO:0003684)|endonuclease activity (GO:0004519)|oxidized purine nucleobase lesion DNA N-glycosylase activity (GO:0008534)			kidney(2)|large_intestine(2)|lung(2)|skin(1)|urinary_tract(1)	8	Medulloblastoma(99;0.227)					ATGTGGCACATTGCCCAACGT	0.602								Base excision repair (BER), DNA glycosylases																													p.I274N		Atlas-SNP	.											.	OGG1	57	.	0			c.T821A						PASS	.						81.0	78.0	79.0					3																	9798228		2203	4300	6503	SO:0001583	missense	4968	exon5			GGCACATTGCCCA	U96710	CCDS2576.1, CCDS2577.1, CCDS2578.1, CCDS2579.1, CCDS2580.1, CCDS2581.1, CCDS43046.1, CCDS46742.1	3p26	2010-11-23			ENSG00000114026	ENSG00000114026	3.2.2.-, 4.2.99.18		8125	protein-coding gene	gene with protein product	"""8-hydroxyguanine DNA glycosylase"", ""OGG1 type 1e"", ""OGG1 type 1d"", ""OGG1 type 1g"", ""OGG1 type 1h"""	601982				9207108, 10449904	Standard	NM_002542		Approved	HMMH, HOGG1, OGH1, MUTM	uc003bsj.3	O15527	OTTHUMG00000097091	ENST00000344629.7:c.821T>A	chr3.hg19:g.9798228T>A	ENSP00000342851:p.Ile274Asn	77.0	0.0	.		79.0	31.0	.	NM_016819	A8K1E3|O00390|O00670|O00705|O14876|O95488|P78554|Q9BW42|Q9UIK0|Q9UIK1|Q9UIK2|Q9UL34|Q9Y2C0|Q9Y2C1|Q9Y6C3|Q9Y6C4	Missense_Mutation	SNP	ENST00000344629.7	hg19	CCDS2581.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.74|17.74	3.464569|3.464569	0.63513|0.63513	.|.	.|.	ENSG00000114026|ENSG00000114026	ENST00000302003;ENST00000344629;ENST00000302036;ENST00000339511;ENST00000449570;ENST00000302008|ENST00000441094;ENST00000416333	D;D;D;D;D;D|.	0.88046|.	-2.33;-2.33;-2.33;-2.33;-2.33;-2.33|.	5.43|5.43	5.43|5.43	0.79202|0.79202	HhH-GPD domain (2);DNA glycosylase (1);Helix-turn-helix, base-excision DNA repair, C-terminal (1);|.	0.044994|.	0.85682|.	D|.	0.000000|.	D|D	0.87124|0.87124	0.6099|0.6099	H|H	0.95745|0.95745	3.715|3.715	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D;D;D|.	0.97110|.	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0|.	D|D	0.91042|0.91042	0.4872|0.4872	10|5	0.87932|.	D|.	0|.	-15.1918|-15.1918	15.7624|15.7624	0.78096|0.78096	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	274;274;274;274;274;274;274;274|.	E5KPN1;O15527-3;E5KPM5;E5KPM7;E5KPM9;E5KPN0;O15527;O15527-2|.	.;.;.;.;.;.;OGG1_HUMAN;.|.	N|M	274|172;41	ENSP00000305584:I274N;ENSP00000342851:I274N;ENSP00000306561:I274N;ENSP00000345520:I274N;ENSP00000403598:I274N;ENSP00000305527:I274N|.	ENSP00000305584:I274N|.	I|L	+|+	2|1	0|2	OGG1|OGG1	9773228|9773228	1.000000|1.000000	0.71417|0.71417	0.970000|0.970000	0.41538|0.41538	0.135000|0.135000	0.20990|0.20990	7.054000|7.054000	0.76649|0.76649	2.176000|2.176000	0.68965|0.68965	0.533000|0.533000	0.62120|0.62120	ATT|TTG	.	.	.	none		0.602	OGG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214223.2	NM_016821	
RAF1	5894	hgsc.bcm.edu	37	3	12633229	12633229	+	Missense_Mutation	SNP	T	T	A	rs368807126		TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr3:12633229T>A	ENST00000251849.4	-	11	1610	c.1171A>T	c.(1171-1173)Agg>Tgg	p.R391W	RAF1_ENST00000542177.1_Missense_Mutation_p.R310W|RAF1_ENST00000442415.2_Missense_Mutation_p.R411W|RAF1_ENST00000534997.1_Missense_Mutation_p.R176W	NM_002880.3	NP_002871.1	P04049	RAF1_HUMAN	Raf-1 proto-oncogene, serine/threonine kinase	391	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|death-inducing signaling complex assembly (GO:0071550)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intermediate filament cytoskeleton organization (GO:0045104)|ion transmembrane transport (GO:0034220)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of protein complex assembly (GO:0031333)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of cell differentiation (GO:0045595)|regulation of cell motility (GO:2000145)|regulation of Rho protein signal transduction (GO:0035023)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)		ESRP1/RAF1(4)|RAF1/DAZL(2)|SRGAP3/RAF1(6)	biliary_tract(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	32					Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)	ACCTCATTCCTGAAGGCCTGG	0.507			T	SRGAP3	pilocytic astrocytoma				Noonan syndrome																												p.R391W		Atlas-SNP	.		Dom	yes		3	3p25	5894	v-raf-1 murine leukemia viral oncogene homolog 1		M	.	RAF1	66	.	0			c.A1171T						PASS	.	T	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	110.0	99.0	103.0		1171	4.0	1.0	3		103	0,8600		0,0,4300	no	missense	RAF1	NM_002880.3	101	0,1,6502	AA,AT,TT		0.0,0.0227,0.0077	probably-damaging	391/649	12633229	1,13005	2203	4300	6503	SO:0001583	missense	5894	exon11	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	CATTCCTGAAGGC	X03484	CCDS2612.1	3p25	2014-09-17	2014-06-26		ENSG00000132155	ENSG00000132155			9829	protein-coding gene	gene with protein product	"""C-Raf proto-oncogene, serine/threonine kinase"""	164760	"""v-raf-1 murine leukemia viral oncogene homolog 1"""			1611909	Standard	NM_002880		Approved	Raf-1, c-Raf, CRAF	uc003bxf.4	P04049	OTTHUMG00000129789	ENST00000251849.4:c.1171A>T	chr3.hg19:g.12633229T>A	ENSP00000251849:p.Arg391Trp	77.0	0.0	.		102.0	31.0	.	NM_002880	B0LPH8|B2R5N3|Q15278|Q9UC20	Missense_Mutation	SNP	ENST00000251849.4	hg19	CCDS2612.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.216060	0.79352	2.27E-4	0.0	ENSG00000132155	ENST00000251849;ENST00000442415;ENST00000432427;ENST00000534997;ENST00000542177	D;D;D;D;D	0.82893	-1.66;-1.66;-1.66;-1.66;-1.66	5.15	3.96	0.45880	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.84419	0.5468	L	0.28192	0.835	0.80722	D	1	D;D;D	0.71674	0.994;0.994;0.998	D;D;D	0.77557	0.99;0.985;0.99	D	0.85467	0.1170	10	0.87932	D	0	.	11.796	0.52100	0.0:0.0:0.2774:0.7226	.	310;176;391	B4E0X2;B4E1N6;P04049	.;.;RAF1_HUMAN	W	391;411;270;176;310	ENSP00000251849:R391W;ENSP00000401888:R411W;ENSP00000398591:R270W;ENSP00000441186:R176W;ENSP00000443567:R310W	ENSP00000251849:R391W	R	-	1	2	RAF1	12608229	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.865000	0.56033	1.047000	0.40274	0.533000	0.62120	AGG	.	.	.	weak		0.507	RAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252015.2	NM_002880	
TOP2B	7155	hgsc.bcm.edu	37	3	25646332	25646332	+	Missense_Mutation	SNP	C	C	A			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr3:25646332C>A	ENST00000264331.4	-	33	4407	c.4408G>T	c.(4408-4410)Gat>Tat	p.D1470Y	TOP2B_ENST00000542520.1_Missense_Mutation_p.D322Y|TOP2B_ENST00000540199.1_Missense_Mutation_p.D322Y|TOP2B_ENST00000435706.2_Missense_Mutation_p.D1465Y	NM_001068.2	NP_001059.2	Q02880	TOP2B_HUMAN	topoisomerase (DNA) II beta 180kDa	1470					ATP catabolic process (GO:0006200)|axonogenesis (GO:0007409)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|forebrain development (GO:0030900)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|neuron migration (GO:0001764)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein kinase C binding (GO:0005080)	p.D1465Y(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|skin(2)|stomach(1)	36					Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Etoposide(DB00773)	GAAGCAGAATCTTCTTCATTA	0.313																																					p.D1465Y		Atlas-SNP	.											TOP2B,rectum,carcinoma,0,1	TOP2B	98	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4393T						PASS	.						118.0	110.0	112.0					3																	25646332		1811	4068	5879	SO:0001583	missense	7155	exon33			CAGAATCTTCTTC	X68060	CCDS46776.1	3p24.2	2012-08-30	2002-08-29		ENSG00000077097	ENSG00000077097	5.99.1.3		11990	protein-coding gene	gene with protein product		126431	"""topoisomerase (DNA) II beta (180kD)"""			1309226, 1333583	Standard	NM_001068		Approved		uc003cdj.3	Q02880	OTTHUMG00000155596	ENST00000264331.4:c.4408G>T	chr3.hg19:g.25646332C>A	ENSP00000264331:p.Asp1470Tyr	82.0	1.0	.		142.0	54.0	.	NM_001068	Q13600|Q9UMG8|Q9UQP8	Missense_Mutation	SNP	ENST00000264331.4	hg19		.	.	.	.	.	.	.	.	.	.	C	19.71	3.878740	0.72294	.	.	ENSG00000077097	ENST00000542520;ENST00000435706;ENST00000264331;ENST00000540199	T;T;T;T	0.49720	0.77;0.85;0.85;0.77	5.48	5.48	0.80851	.	0.262894	0.42964	D	0.000636	T	0.51261	0.1664	N	0.08118	0	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.83275	0.995;0.996	T	0.61744	-0.7000	10	0.66056	D	0.02	-20.2424	17.9046	0.88914	0.0:1.0:0.0:0.0	.	1470;1465	Q02880;Q02880-2	TOP2B_HUMAN;.	Y	322;1465;1470;322	ENSP00000446023:D322Y;ENSP00000396704:D1465Y;ENSP00000264331:D1470Y;ENSP00000437352:D322Y	ENSP00000264331:D1470Y	D	-	1	0	TOP2B	25621336	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.225000	0.65294	2.722000	0.93159	0.563000	0.77884	GAT	.	.	.	none		0.313	TOP2B-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			
SCN10A	6336	hgsc.bcm.edu	37	3	38835251	38835251	+	Missense_Mutation	SNP	G	G	A	rs140609990		TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr3:38835251G>A	ENST00000449082.2	-	1	250	c.251C>T	c.(250-252)cCg>cTg	p.P84L		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	84					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	GCTGTAGAACGGATCTAGATC	0.572													G|||	1	0.000199681	0.0008	0.0	5008	,	,		12896	0.0		0.0	False		,,,				2504	0.0				p.P84L		Atlas-SNP	.											.	SCN10A	359	.	0			c.C251T						PASS	.	G	LEU/PRO	6,4400	9.9+/-24.2	0,6,2197	154.0	158.0	157.0		251	5.2	1.0	3	dbSNP_134	157	0,8600		0,0,4300	yes	missense	SCN10A	NM_006514.2	98	0,6,6497	AA,AG,GG		0.0,0.1362,0.0461	possibly-damaging	84/1957	38835251	6,13000	2203	4300	6503	SO:0001583	missense	6336	exon1			TAGAACGGATCTA	AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.251C>T	chr3.hg19:g.38835251G>A	ENSP00000390600:p.Pro84Leu	212.0	0.0	.		316.0	94.0	.	NM_006514	A6NDQ1	Missense_Mutation	SNP	ENST00000449082.2	hg19	CCDS33736.1	.	.	.	.	.	.	.	.	.	.	G	14.95	2.689442	0.48097	0.001362	0.0	ENSG00000185313	ENST00000449082	D	0.96856	-4.15	5.19	5.19	0.71726	.	0.170309	0.52532	D	0.000066	D	0.96842	0.8969	M	0.91612	3.225	0.52501	D	0.999956	D	0.54601	0.967	B	0.41135	0.348	D	0.98036	1.0379	10	0.87932	D	0	.	18.9136	0.92496	0.0:0.0:1.0:0.0	.	84	Q9Y5Y9	SCNAA_HUMAN	L	84	ENSP00000390600:P84L	ENSP00000390600:P84L	P	-	2	0	SCN10A	38810255	1.000000	0.71417	0.997000	0.53966	0.163000	0.22366	9.575000	0.98187	2.704000	0.92352	0.563000	0.77884	CCG	.	G|1.000;A|0.000	0.000	weak		0.572	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514	
ATP6V1A	523	hgsc.bcm.edu	37	3	113503595	113503595	+	Missense_Mutation	SNP	C	C	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr3:113503595C>G	ENST00000273398.3	+	5	587	c.479C>G	c.(478-480)tCg>tGg	p.S160W	ATP6V1A_ENST00000538620.1_Missense_Mutation_p.S127W	NM_001690.3	NP_001681.2	P38606	VATA_HUMAN	ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A	160					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|microvillus (GO:0005902)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	ATP binding (GO:0005524)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34					Alendronate(DB00630)|Etidronic acid(DB01077)|Tiludronate(DB01133)	AGTGAGAACTCGCTTATCAAA	0.368																																					p.S160W		Atlas-SNP	.											.	ATP6V1A	71	.	0			c.C479G						PASS	.						121.0	116.0	118.0					3																	113503595		2203	4300	6503	SO:0001583	missense	523	exon5			AGAACTCGCTTAT	L09235	CCDS2976.1	3q13.31	2010-04-21	2002-08-29	2003-04-25	ENSG00000114573	ENSG00000114573	3.6.3.14	"""ATPases / V-type"""	851	protein-coding gene	gene with protein product		607027	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), alpha polypeptide, 70kD, isoform 1"""	VPP2, ATP6A1, ATP6V1A1		8463241	Standard	NM_001690		Approved	Vma1, VA68	uc003eao.3	P38606	OTTHUMG00000159295	ENST00000273398.3:c.479C>G	chr3.hg19:g.113503595C>G	ENSP00000273398:p.Ser160Trp	125.0	0.0	.		171.0	58.0	.	NM_001690	B2RBR8|B7Z1R5|D3DN75|Q53YD9|Q96DY6|Q9UHY3	Missense_Mutation	SNP	ENST00000273398.3	hg19	CCDS2976.1	.	.	.	.	.	.	.	.	.	.	C	18.49	3.634753	0.67130	.	.	ENSG00000114573	ENST00000273398;ENST00000538620;ENST00000496747;ENST00000475322	D;T	0.86956	-2.19;-1.41	6.07	5.2	0.72013	.	0.000000	0.85682	D	0.000000	D	0.92502	0.7619	M	0.78916	2.43	0.80722	D	1	D	0.64830	0.994	P	0.61397	0.888	D	0.93432	0.6786	10	0.87932	D	0	-10.5657	15.5979	0.76602	0.0:0.9341:0.0:0.0659	.	160	P38606	VATA_HUMAN	W	160;127;127;160	ENSP00000273398:S160W;ENSP00000439874:S127W	ENSP00000273398:S160W	S	+	2	0	ATP6V1A	114986285	1.000000	0.71417	0.905000	0.35620	0.616000	0.37450	7.253000	0.78320	1.578000	0.49821	0.655000	0.94253	TCG	.	.	.	none		0.368	ATP6V1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354457.1	NM_001690	
RUFY3	22902	hgsc.bcm.edu	37	4	71659564	71659564	+	IGR	SNP	A	A	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr4:71659564A>G	ENST00000226328.4	+	0	4233				RUFY3_ENST00000502653.1_Missense_Mutation_p.D414G|RUFY3_ENST00000381006.3_Missense_Mutation_p.D467G	NM_014961.3	NP_055776.1	Q7L099	RUFY3_HUMAN	RUN and FYVE domain containing 3						negative regulation of axonogenesis (GO:0050771)	filopodium (GO:0030175)|growth cone (GO:0030426)				endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	16		all_hematologic(202;0.248)	Lung(101;0.235)			TTCAAACAGGACTTTGGAGAC	0.527																																					p.D467G		Atlas-SNP	.											.	RUFY3	61	.	0			c.A1400G						PASS	.						52.0	48.0	50.0					4																	71659564		2203	4300	6503	SO:0001628	intergenic_variant	22902	exon13			AACAGGACTTTGG	AF112221	CCDS3547.1, CCDS34001.1, CCDS47068.1, CCDS75138.1	4q13.3	2009-05-29			ENSG00000018189	ENSG00000018189		"""Zinc fingers, FYVE domain containing"""	30285	protein-coding gene	gene with protein product	"""single axon-related 1"""	611194				17439943	Standard	NM_001130709		Approved	RIPx, KIAA0871, Singar1	uc003hfr.3	Q7L099	OTTHUMG00000129910		chr4.hg19:g.71659564A>G		83.0	0.0	.		99.0	34.0	.	NM_001037442	B3KM25|B4DYW7|D9N163|O94948|Q9UI00	Missense_Mutation	SNP	ENST00000226328.4	hg19	CCDS3547.1	.	.	.	.	.	.	.	.	.	.	A	18.32	3.597113	0.66332	.	.	ENSG00000018189	ENST00000381006;ENST00000502653	T;T	0.08720	3.06;3.06	5.87	5.87	0.94306	.	0.237818	0.42294	D	0.000726	T	0.10508	0.0257	.	.	.	0.80722	D	1	B	0.31548	0.328	B	0.31101	0.124	T	0.04900	-1.0919	9	0.51188	T	0.08	-8.0298	16.2631	0.82557	1.0:0.0:0.0:0.0	.	467	Q7L099-3	.	G	467;414	ENSP00000370394:D467G;ENSP00000425400:D414G	ENSP00000370394:D467G	D	+	2	0	RUFY3	71878428	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	8.930000	0.92872	2.239000	0.73571	0.528000	0.53228	GAC	.	.	.	none		0.527	RUFY3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252161.2	NM_014961	
TIGD2	166815	hgsc.bcm.edu	37	4	90035227	90035227	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr4:90035227G>T	ENST00000317005.2	+	1	1260	c.1102G>T	c.(1102-1104)Gaa>Taa	p.E368*	RP11-84C13.1_ENST00000603357.1_lincRNA|FAM13A_ENST00000502459.1_5'Flank	NM_145715.2	NP_663761.1	Q4W5G0	TIGD2_HUMAN	tigger transposable element derived 2	368	DDE.					nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	14		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;3.86e-05)		TGCAATTTATGAAGTGTCAAG	0.363																																					p.E368X		Atlas-SNP	.											.	TIGD2	36	.	0			c.G1102T						PASS	.						81.0	80.0	80.0					4																	90035227		2203	4300	6503	SO:0001587	stop_gained	166815	exon1			ATTTATGAAGTGT	AK027653	CCDS3633.1	4q21.3	2013-02-21			ENSG00000180346	ENSG00000180346			18333	protein-coding gene	gene with protein product		612973					Standard	NM_145715		Approved		uc003hsk.3	Q4W5G0	OTTHUMG00000130946	ENST00000317005.2:c.1102G>T	chr4.hg19:g.90035227G>T	ENSP00000317170:p.Glu368*	54.0	0.0	.		103.0	31.0	.	NM_145715		Nonsense_Mutation	SNP	ENST00000317005.2	hg19	CCDS3633.1	.	.	.	.	.	.	.	.	.	.	G	35	5.519555	0.96416	.	.	ENSG00000180346	ENST00000317005	.	.	.	4.36	3.47	0.39725	.	0.000000	0.43110	D	0.000607	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	-9.209	6.0713	0.19891	0.1044:0.193:0.7026:0.0	.	.	.	.	X	368	.	ENSP00000317170:E368X	E	+	1	0	TIGD2	90254250	1.000000	0.71417	0.996000	0.52242	0.956000	0.61745	2.543000	0.45752	2.264000	0.75181	0.460000	0.39030	GAA	.	.	.	none		0.363	TIGD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253545.2	NM_145715	
PCDH18	54510	hgsc.bcm.edu	37	4	138450855	138450855	+	Silent	SNP	G	G	A			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr4:138450855G>A	ENST00000344876.4	-	1	2774	c.2388C>T	c.(2386-2388)caC>caT	p.H796H	PCDH18_ENST00000507846.1_Silent_p.H576H|PCDH18_ENST00000510305.1_Silent_p.H7H|PCDH18_ENST00000511115.1_Intron|PCDH18_ENST00000412923.2_Silent_p.H796H	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	796					brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					GGTGACTGTTGTGACTCTGCC	0.498																																					p.H796H		Atlas-SNP	.											.	PCDH18	229	.	0			c.C2388T						PASS	.						125.0	109.0	114.0					4																	138450855		2203	4300	6503	SO:0001819	synonymous_variant	54510	exon1			ACTGTTGTGACTC	AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.2388C>T	chr4.hg19:g.138450855G>A		69.0	0.0	.		97.0	44.0	.	NM_019035	A8K7K3|B7ZKT1|Q52LS2	Silent	SNP	ENST00000344876.4	hg19	CCDS34064.1																																																																																			.	.	.	none		0.498	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364614.1	NM_019035	
ABCE1	6059	hgsc.bcm.edu	37	4	146041306	146041306	+	Splice_Site	SNP	G	G	A			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr4:146041306G>A	ENST00000296577.4	+	11	1659		c.e11+1		ABCE1_ENST00000502803.1_Splice_Site|OTUD4_ENST00000455611.2_Intron	NM_001040876.1|NM_002940.2	NP_001035809.1|NP_002931.2	P61221	ABCE1_HUMAN	ATP-binding cassette, sub-family E (OABP), member 1						negative regulation of catalytic activity (GO:0043086)|response to virus (GO:0009615)|RNA catabolic process (GO:0006401)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|iron-sulfur cluster binding (GO:0051536)|ribonuclease inhibitor activity (GO:0008428)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|lung(5)|prostate(2)|skin(3)	18	all_hematologic(180;0.151)					GGGGAAAATGGTAAGTTTTCT	0.313																																					.		Atlas-SNP	.											.	ABCE1	47	.	0			c.1144+1G>A						PASS	.						66.0	72.0	70.0					4																	146041306		2203	4296	6499	SO:0001630	splice_region_variant	6059	exon11			AAAATGGTAAGTT	X74987	CCDS34071.1	4q31	2012-03-14			ENSG00000164163	ENSG00000164163		"""ATP binding cassette transporters / subfamily E"""	69	protein-coding gene	gene with protein product		601213		RNASEL1, RNASELI, RNS4I		7539425	Standard	NM_002940		Approved	RLI, OABP	uc003ijy.3	P61221	OTTHUMG00000161478	ENST00000296577.4:c.1144+1G>A	chr4.hg19:g.146041306G>A		62.0	0.0	.		95.0	33.0	.	NM_002940	O88793|Q13181|Q13864|Q6NR76|Q96AL0|Q96B10|Q99K66	Splice_Site	SNP	ENST00000296577.4	hg19	CCDS34071.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.276838	0.80580	.	.	ENSG00000164163	ENST00000296577	.	.	.	5.31	5.31	0.75309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3284	0.94273	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ABCE1	146260756	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	9.869000	0.99810	2.623000	0.88846	0.555000	0.69702	.	.	.	.	none		0.313	ABCE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365104.1	NM_002940	Intron
DDR1	780	hgsc.bcm.edu	37	6	30857025	30857025	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr6:30857025G>A	ENST00000324771.8	+	6	783	c.235G>A	c.(235-237)Gtg>Atg	p.V79M	DDR1_ENST00000454612.2_Missense_Mutation_p.V79M|DDR1_ENST00000418800.2_Missense_Mutation_p.V79M|DDR1_ENST00000376568.3_Missense_Mutation_p.V79M|DDR1_ENST00000513240.1_Missense_Mutation_p.V79M|DDR1_ENST00000452441.1_Missense_Mutation_p.V79M|DDR1_ENST00000508312.1_Missense_Mutation_p.V97M|MIR4640_ENST00000581824.1_RNA|DDR1_ENST00000376575.3_Missense_Mutation_p.V79M|DDR1_ENST00000376567.2_Missense_Mutation_p.V79M|DDR1_ENST00000376570.4_Missense_Mutation_p.V79M|DDR1_ENST00000446312.1_Missense_Mutation_p.V79M|DDR1_ENST00000361741.4_5'Flank|DDR1_ENST00000376569.3_Missense_Mutation_p.V79M			Q08345	DDR1_HUMAN	discoidin domain receptor tyrosine kinase 1	79	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|ear development (GO:0043583)|embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine autophosphorylation (GO:0038083)|protein autophosphorylation (GO:0046777)|regulation of cell growth (GO:0001558)|regulation of cell-matrix adhesion (GO:0001952)|regulation of extracellular matrix disassembly (GO:0010715)|smooth muscle cell migration (GO:0014909)|smooth muscle cell-matrix adhesion (GO:0061302)|wound healing, spreading of cells (GO:0044319)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|metal ion binding (GO:0046872)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(1)|prostate(1)|skin(1)	29					Imatinib(DB00619)	CGCAGGGTCGGTGTTTCCCAA	0.647																																					p.V97M		Atlas-SNP	.											.	DDR1	213	.	0			c.G289A						PASS	.						174.0	186.0	181.0					6																	30857025		1511	2709	4220	SO:0001583	missense	780	exon4			GGGTCGGTGTTTC	X99031	CCDS4690.1, CCDS34385.1, CCDS47396.1, CCDS56411.1, CCDS75419.1	6p21.33	2010-02-17	2008-01-23		ENSG00000204580	ENSG00000204580	2.7.10.1	"""CD molecules"""	2730	protein-coding gene	gene with protein product		600408	"""discoidin domain receptor family, member 1"""	NTRK4, PTK3A, NEP, CAK, EDDR1		7789998	Standard	NM_001954		Approved	RTK6, CD167	uc003nrv.3	Q08345	OTTHUMG00000031236	ENST00000324771.8:c.235G>A	chr6.hg19:g.30857025G>A	ENSP00000318217:p.Val79Met	384.0	0.0	.		482.0	150.0	.	NM_001202523	B5A975|B5A976|B7Z2K0|Q14196|Q16562|Q2L6H3|Q4LE50|Q5ST11|Q5ST12|Q6NSK4|Q9UD35|Q9UD36|Q9UD37|Q9UD86|Q9UDL2	Missense_Mutation	SNP	ENST00000324771.8	hg19	CCDS34385.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.45|16.45	3.125934|3.125934	0.56721|0.56721	.|.	.|.	ENSG00000204580|ENSG00000204580	ENST00000424544|ENST00000505066;ENST00000460944;ENST00000324771;ENST00000505534;ENST00000508317;ENST00000418800;ENST00000509639;ENST00000454612;ENST00000437124;ENST00000396342;ENST00000512694;ENST00000515233;ENST00000515881;ENST00000376569;ENST00000511510;ENST00000376575;ENST00000376570;ENST00000446312;ENST00000504927;ENST00000428153;ENST00000376568;ENST00000452441;ENST00000508312;ENST00000512336;ENST00000421124;ENST00000512725;ENST00000504679;ENST00000503495;ENST00000376567;ENST00000513240	.|D;D;D;D;D;D;D;D;D;D;D;D;T;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	.|0.98987	.|-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;0.66;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3	4.84|4.84	4.84|4.84	0.62591|0.62591	.|Coagulation factor 5/8 C-terminal type domain (4);Galactose-binding domain-like (1);	.|0.156961	.|0.41396	.|D	.|0.000884	D|D	0.98729|0.98729	0.9573|0.9573	M|M	0.67517|0.67517	2.055|2.055	0.20563|0.20563	N|N	0.99989|0.99989	.|D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D	.|0.97110	.|0.973;0.984;0.998;0.976;1.0	D|D	0.95690|0.95690	0.8739|0.8739	5|10	.|0.87932	.|D	.|0	.|.	11.2046|11.2046	0.48762|0.48762	0.0:0.1855:0.8145:0.0|0.0:0.1855:0.8145:0.0	.|.	.|79;105;97;79;79	.|Q08345-4;B7Z3A2;B7Z2K0;Q08345-5;Q08345	.|.;.;.;.;DDR1_HUMAN	D|M	62|79;79;79;79;79;79;79;79;79;79;79;79;79;79;79;79;79;79;79;79;79;79;97;79;79;79;79;105;79;79	.|ENSP00000421189:V79M;ENSP00000426420:V79M;ENSP00000318217:V79M;ENSP00000420833:V79M;ENSP00000427369:V79M;ENSP00000407699:V79M;ENSP00000422331:V79M;ENSP00000406091:V79M;ENSP00000394273:V79M;ENSP00000379631:V79M;ENSP00000426229:V79M;ENSP00000422467:V79M;ENSP00000423492:V79M;ENSP00000365753:V79M;ENSP00000425113:V79M;ENSP00000365759:V79M;ENSP00000365754:V79M;ENSP00000405998:V79M;ENSP00000427597:V79M;ENSP00000390593:V79M;ENSP00000365752:V79M;ENSP00000405039:V79M;ENSP00000422442:V97M;ENSP00000421719:V79M;ENSP00000409682:V79M;ENSP00000422108:V79M;ENSP00000423906:V79M;ENSP00000423749:V105M;ENSP00000365751:V79M;ENSP00000427552:V79M	.|ENSP00000318217:V79M	G|V	+|+	2|1	0|0	DDR1|DDR1	30965004|30965004	1.000000|1.000000	0.71417|0.71417	0.415000|0.415000	0.26534|0.26534	0.938000|0.938000	0.57974|0.57974	4.107000|4.107000	0.57811|0.57811	2.509000|2.509000	0.84616|0.84616	0.305000|0.305000	0.20034|0.20034	GGT|GTG	.	.	.	none		0.647	DDR1-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076494.3	NM_013994	
PREP	5550	hgsc.bcm.edu	37	6	105825364	105825364	+	Missense_Mutation	SNP	C	C	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr6:105825364C>G	ENST00000369110.3	-	3	343	c.151G>C	c.(151-153)Gtg>Ctg	p.V51L		NM_002726.4	NP_002717.3	P48147	PPCE_HUMAN	prolyl endopeptidase	51					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)|serine-type peptidase activity (GO:0008236)	p.V51L(1)		breast(1)|endometrium(2)|large_intestine(7)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		all_cancers(87;0.000128)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0344)|Lung NSC(302;0.191)|Colorectal(196;0.202)			Oxytocin(DB00107)	AGAAATGGCACAGTAATCTTA	0.353																																					p.V51L		Atlas-SNP	.											PREP,NS,carcinoma,0,1	PREP	65	.	1	Substitution - Missense(1)	lung(1)	c.G151C						PASS	.						95.0	93.0	94.0					6																	105825364		2203	4300	6503	SO:0001583	missense	5550	exon3			ATGGCACAGTAAT		CCDS5053.1	6q22	2008-02-05			ENSG00000085377	ENSG00000085377	3.4.21.26		9358	protein-coding gene	gene with protein product		600400				7959018	Standard	NM_002726		Approved		uc003prc.3	P48147	OTTHUMG00000015297	ENST00000369110.3:c.151G>C	chr6.hg19:g.105825364C>G	ENSP00000358106:p.Val51Leu	100.0	0.0	.		173.0	62.0	.	NM_002726	Q8N6D4	Missense_Mutation	SNP	ENST00000369110.3	hg19	CCDS5053.1	.	.	.	.	.	.	.	.	.	.	C	12.02	1.812019	0.32053	.	.	ENSG00000085377	ENST00000369110	T	0.44881	0.91	5.76	4.89	0.63831	Peptidase S9A/B/C, oligopeptidase, N-terminal beta-propeller (2);	0.241940	0.41823	D	0.000804	T	0.07098	0.0180	N	0.01352	-0.895	0.39317	D	0.965174	B	0.02656	0.0	B	0.01281	0.0	T	0.15065	-1.0450	10	0.25751	T	0.34	-16.8555	10.4377	0.44445	0.0:0.8553:0.0:0.1447	.	51	P48147	PPCE_HUMAN	L	51	ENSP00000358106:V51L	ENSP00000358106:V51L	V	-	1	0	PREP	105932057	0.730000	0.28100	0.982000	0.44146	0.979000	0.70002	1.374000	0.34283	2.700000	0.92200	0.650000	0.86243	GTG	.	.	.	none		0.353	PREP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041658.1		
ROS1	6098	hgsc.bcm.edu	37	6	117622147	117622147	+	Missense_Mutation	SNP	T	T	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr6:117622147T>G	ENST00000368508.3	-	42	6921	c.6723A>C	c.(6721-6723)gaA>gaC	p.E2241D	RN7SKP18_ENST00000516005.1_RNA|RN7SKP51_ENST00000410781.1_RNA|ROS1_ENST00000368507.3_Missense_Mutation_p.E2235D	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	2241					cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		CTTCAAAGCTTTCATTTATGA	0.333			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																p.E2241D		Atlas-SNP	.		Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	.	ROS1	728	.	0			c.A6723C						PASS	.						77.0	74.0	75.0					6																	117622147		2203	4300	6503	SO:0001583	missense	6098	exon42			AAAGCTTTCATTT	M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.6723A>C	chr6.hg19:g.117622147T>G	ENSP00000357494:p.Glu2241Asp	76.0	0.0	.		109.0	38.0	.	NM_002944	Q15368|Q5TDB5	Missense_Mutation	SNP	ENST00000368508.3	hg19	CCDS5116.1	.	.	.	.	.	.	.	.	.	.	T	11.69	1.713310	0.30413	.	.	ENSG00000047936	ENST00000368508;ENST00000368507	T;T	0.71341	-0.56;-0.56	4.98	1.37	0.22104	.	0.267889	0.32190	N	0.006450	T	0.30823	0.0777	L	0.27053	0.805	0.23174	N	0.998172	B	0.24963	0.115	B	0.20577	0.03	T	0.18871	-1.0323	10	0.30854	T	0.27	.	7.4549	0.27261	0.0:0.2549:0.0:0.7451	.	2241	P08922	ROS1_HUMAN	D	2241;2235	ENSP00000357494:E2241D;ENSP00000357493:E2235D	ENSP00000357493:E2235D	E	-	3	2	ROS1	117728840	0.999000	0.42202	0.996000	0.52242	0.448000	0.32197	0.295000	0.19065	0.439000	0.26476	0.459000	0.35465	GAA	.	.	.	none		0.333	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043464.1		
POLM	27434	hgsc.bcm.edu	37	7	44121926	44121926	+	Missense_Mutation	SNP	G	G	T	rs375526665		TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr7:44121926G>T	ENST00000242248.5	-	1	213	c.112C>A	c.(112-114)Cgc>Agc	p.R38S	POLM_ENST00000335195.6_Missense_Mutation_p.R38S|POLM_ENST00000395831.3_Missense_Mutation_p.R38S	NM_013284.2	NP_037416.1	Q9NP87	DPOLM_HUMAN	polymerase (DNA directed), mu	38	BRCT. {ECO:0000255|PROSITE- ProRule:PRU00033}.				DNA recombination (GO:0006310)|DNA repair (GO:0006281)	nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(6)|ovary(3)|skin(2)	22						CGACCCATGCGAGGCTCGACC	0.751								DNA polymerases (catalytic subunits)																													p.R38S		Atlas-SNP	.											.	POLM	50	.	0			c.C112A						PASS	.	G	SER/ARG	1,4241		0,1,2120	6.0	8.0	7.0		112	4.4	0.8	7		7	0,8326		0,0,4163	no	missense	POLM	NM_013284.2	110	0,1,6283	TT,TG,GG		0.0,0.0236,0.0080	possibly-damaging	38/495	44121926	1,12567	2121	4163	6284	SO:0001583	missense	27434	exon1			CCATGCGAGGCTC	AF176097	CCDS34625.1, CCDS64635.1, CCDS64636.1	7p13	2012-05-18			ENSG00000122678	ENSG00000122678		"""DNA polymerases"""	9185	protein-coding gene	gene with protein product	"""Pol iota"""	606344				10982892	Standard	XM_005249708		Approved	Tdt-N	uc003tjt.3	Q9NP87	OTTHUMG00000155353	ENST00000242248.5:c.112C>A	chr7.hg19:g.44121926G>T	ENSP00000242248:p.Arg38Ser	14.0	0.0	.		22.0	7.0	.	NM_013284	D3DVK4|Q6P5X8|Q86WQ9	Missense_Mutation	SNP	ENST00000242248.5	hg19	CCDS34625.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.451233	0.84209	2.36E-4	0.0	ENSG00000122678	ENST00000335195;ENST00000242248;ENST00000395831;ENST00000414235;ENST00000452049	T;T;T;T;T	0.36699	2.24;2.54;1.55;1.24;1.24	5.31	4.41	0.53225	BRCT (3);	0.108961	0.64402	D	0.000019	T	0.51143	0.1657	M	0.61703	1.905	0.40282	D	0.978403	P;D;D;D;P;P	0.62365	0.638;0.959;0.991;0.976;0.894;0.819	B;P;P;P;P;B	0.59948	0.162;0.796;0.866;0.813;0.591;0.439	T	0.55515	-0.8129	10	0.72032	D	0.01	-27.4319	11.1603	0.48512	0.0:0.0:0.8158:0.1842	.	38;38;38;38;38;38	B4DG75;Q6PIY2;Q9H980;Q86WQ9;Q6P5X8;Q9NP87	.;.;.;.;.;DPOLM_HUMAN	S	38	ENSP00000335141:R38S;ENSP00000242248:R38S;ENSP00000379174:R38S;ENSP00000390899:R38S;ENSP00000399244:R38S	ENSP00000242248:R38S	R	-	1	0	POLM	44088451	0.981000	0.34729	0.836000	0.33094	0.795000	0.44927	1.385000	0.34408	1.202000	0.43218	0.561000	0.74099	CGC	.	.	.	weak		0.751	POLM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339594.1	NM_013284	
ASB15	142685	hgsc.bcm.edu	37	7	123264837	123264837	+	Missense_Mutation	SNP	C	C	A			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr7:123264837C>A	ENST00000451558.1	+	10	1187	c.666C>A	c.(664-666)caC>caA	p.H222Q	ASB15_ENST00000434204.1_Missense_Mutation_p.H222Q|ASB15_ENST00000451215.1_Missense_Mutation_p.H222Q|RP11-390E23.3_ENST00000451016.1_RNA|RP11-390E23.3_ENST00000429396.1_RNA|ASB15_ENST00000540573.1_Missense_Mutation_p.H222Q|RP11-390E23.3_ENST00000418409.1_RNA|ASB15_ENST00000275699.3_Missense_Mutation_p.H222Q|RP11-390E23.3_ENST00000440504.1_RNA|RP11-390E23.3_ENST00000422401.1_RNA			Q8WXK1	ASB15_HUMAN	ankyrin repeat and SOCS box containing 15	222					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					breast(1)|kidney(1)|large_intestine(1)|lung(6)|skin(3)	12						AGTATGGTCACTGTGACGTGT	0.468											OREG0018282	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.H222Q		Atlas-SNP	.											.	ASB15	94	.	0			c.C666A						PASS	.						132.0	95.0	107.0					7																	123264837		2203	4300	6503	SO:0001583	missense	142685	exon6			TGGTCACTGTGAC	AF403033	CCDS34742.1	7q31.31	2013-01-10	2011-01-25		ENSG00000146809	ENSG00000146809		"""Ankyrin repeat domain containing"""	19767	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 15"""			12076535	Standard	XM_005250149		Approved	FLJ43370	uc003vkw.1	Q8WXK1	OTTHUMG00000157114	ENST00000451558.1:c.666C>A	chr7.hg19:g.123264837C>A	ENSP00000397655:p.His222Gln	61.0	0.0	.	1525	83.0	35.0	.	NM_080928	Q3ZCP3|Q3ZCP5|Q68D37	Missense_Mutation	SNP	ENST00000451558.1	hg19	CCDS34742.1	.	.	.	.	.	.	.	.	.	.	C	12.02	1.811718	0.32053	.	.	ENSG00000146809	ENST00000451558;ENST00000434204;ENST00000451215;ENST00000540573;ENST00000542545;ENST00000447789;ENST00000275699	T;T;T;T;T;T	0.65549	-0.1;-0.1;-0.1;-0.1;-0.16;-0.1	5.36	5.36	0.76844	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.67154	0.2863	L	0.33792	1.035	0.58432	D	0.999999	D	0.54601	0.967	P	0.58391	0.838	T	0.60924	-0.7166	10	0.22706	T	0.39	-7.5108	19.4438	0.94838	0.0:1.0:0.0:0.0	.	222	Q8WXK1	ASB15_HUMAN	Q	222;222;222;222;11;222;222	ENSP00000397655:H222Q;ENSP00000390963:H222Q;ENSP00000416433:H222Q;ENSP00000438643:H222Q;ENSP00000401166:H222Q;ENSP00000275699:H222Q	ENSP00000275699:H222Q	H	+	3	2	ASB15	123052073	0.988000	0.35896	1.000000	0.80357	0.235000	0.25334	1.161000	0.31773	2.674000	0.91012	0.491000	0.48974	CAC	.	.	.	none		0.468	ASB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347493.1		
MGAM	8972	hgsc.bcm.edu	37	7	141800677	141800677	+	Missense_Mutation	SNP	T	T	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr7:141800677T>G	ENST00000549489.2	+	45	5357	c.5262T>G	c.(5260-5262)gaT>gaG	p.D1754E	MGAM_ENST00000475668.2_Missense_Mutation_p.D2650E	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1754	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TCTGGGATGATGGGCAAAGCA	0.502																																					p.D1754E		Atlas-SNP	.											.	MGAM	767	.	0			c.T5262G						PASS	.						86.0	86.0	86.0					7																	141800677		1981	4153	6134	SO:0001583	missense	8972	exon45			GGATGATGGGCAA	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.5262T>G	chr7.hg19:g.141800677T>G	ENSP00000447378:p.Asp1754Glu	32.0	0.0	.		52.0	26.0	.	NM_004668	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000549489.2	hg19	CCDS47727.1	.	.	.	.	.	.	.	.	.	.	T	18.11	3.550375	0.65311	.	.	ENSG00000257335	ENST00000549489;ENST00000475668	D	0.96265	-3.96	4.83	1.2	0.21068	.	.	.	.	.	D	0.97343	0.9131	M	0.89414	3.03	0.24431	N	0.994574	D	0.55172	0.97	P	0.56823	0.807	D	0.92205	0.5771	9	0.87932	D	0	.	7.7862	0.29093	0.0:0.3312:0.0:0.6688	.	1754	O43451	MGA_HUMAN	E	1754;2651	ENSP00000447378:D1754E	ENSP00000373973:D1754E	D	+	3	2	MGAM	141447146	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	0.614000	0.24314	0.058000	0.16222	-0.269000	0.10298	GAT	.	.	.	none		0.502	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3		
SNTB1	6641	hgsc.bcm.edu	37	8	121587444	121587444	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr8:121587444G>A	ENST00000395601.3	-	5	1432	c.1018C>T	c.(1018-1020)Cag>Tag	p.Q340*	SNTB1_ENST00000517992.1_Nonsense_Mutation_p.Q340*|SNTB1_ENST00000519177.1_5'UTR	NM_021021.3	NP_066301.1	Q13884	SNTB1_HUMAN	syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1)	340	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				muscle contraction (GO:0006936)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|protein complex (GO:0043234)|synapse (GO:0045202)				NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|prostate(2)|skin(6)	24	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)			GGTTTCCACTGTTTCTTGCTC	0.483																																					p.Q340X		Atlas-SNP	.											.	SNTB1	54	.	0			c.C1018T						PASS	.						149.0	139.0	142.0					8																	121587444		2203	4300	6503	SO:0001587	stop_gained	6641	exon4			TCCACTGTTTCTT	AF028828	CCDS6334.1	8q23-q24	2013-01-10	2002-08-29		ENSG00000172164	ENSG00000172164		"""Pleckstrin homology (PH) domain containing"""	11168	protein-coding gene	gene with protein product	"""tax interaction protein 43"""	600026	"""syntrophin, beta 1 (dystrophin-associated protein A1, 59kD, basic component 1)"""	SNT2B1		8183929, 9482110	Standard	NM_021021		Approved	59-DAP, A1B, BSYN2, TIP-43, SNT2	uc010mdg.3	Q13884	OTTHUMG00000165041	ENST00000395601.3:c.1018C>T	chr8.hg19:g.121587444G>A	ENSP00000378965:p.Gln340*	170.0	0.0	.		219.0	62.0	.	NM_021021	A8K9E0|O14912|Q4KMG8	Nonsense_Mutation	SNP	ENST00000395601.3	hg19	CCDS6334.1	.	.	.	.	.	.	.	.	.	.	G	40	8.420009	0.98803	.	.	ENSG00000172164	ENST00000395601;ENST00000517992	.	.	.	6.01	5.11	0.69529	.	0.476872	0.25380	N	0.031082	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.7345	0.85444	0.0:0.0:0.8703:0.1297	.	.	.	.	X	340	.	ENSP00000378965:Q340X	Q	-	1	0	SNTB1	121656625	1.000000	0.71417	0.999000	0.59377	0.901000	0.52897	6.995000	0.76257	2.861000	0.98227	0.650000	0.86243	CAG	.	.	.	none		0.483	SNTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381535.1	NM_021021	
COL17A1	1308	hgsc.bcm.edu	37	10	105793764	105793764	+	Silent	SNP	A	A	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr10:105793764A>G	ENST00000353479.5	-	52	4385	c.4095T>C	c.(4093-4095)gcT>gcC	p.A1365A	COL17A1_ENST00000369733.3_Silent_p.A1283A	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	1365	Triple-helical region.				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		CAGCAAAGTCAGCTCCCAATA	0.587																																					p.A1365A		Atlas-SNP	.											.	COL17A1	149	.	0			c.T4095C						PASS	.						109.0	106.0	107.0					10																	105793764		2203	4300	6503	SO:0001819	synonymous_variant	1308	exon52			AAAGTCAGCTCCC	M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.4095T>C	chr10.hg19:g.105793764A>G		122.0	0.0	.		140.0	42.0	.	NM_000494	Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Silent	SNP	ENST00000353479.5	hg19	CCDS7554.1																																																																																			.	.	.	none		0.587	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050181.1	NM_130778, NM_000494	
PTPRE	5791	hgsc.bcm.edu	37	10	129859261	129859261	+	Silent	SNP	C	C	A			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr10:129859261C>A	ENST00000254667.3	+	8	849	c.570C>A	c.(568-570)atC>atA	p.I190I	PTPRE_ENST00000419012.2_Silent_p.I190I|PTPRE_ENST00000430713.2_3'UTR|PTPRE_ENST00000306042.5_Silent_p.I132I	NM_006504.4	NP_006495.1	P23469	PTPRE_HUMAN	protein tyrosine phosphatase, receptor type, E	190	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				negative regulation of insulin receptor signaling pathway (GO:0046627)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of mast cell activation (GO:0033003)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	22		all_epithelial(44;1.66e-05)|all_lung(145;0.00456)|Lung NSC(174;0.0066)|all_neural(114;0.0936)|Colorectal(57;0.141)|Breast(234;0.166)|Melanoma(40;0.203)			Alendronate(DB00630)	CAGACTACATCAATGCTTCCT	0.483																																					p.I190I	Colon(52;977 1184 20575 41685)	Atlas-SNP	.											.	PTPRE	132	.	0			c.C570A						PASS	.						175.0	160.0	165.0					10																	129859261		2203	4300	6503	SO:0001819	synonymous_variant	5791	exon8			CTACATCAATGCT	AF406557	CCDS7657.1, CCDS7658.1	10q26	2011-06-09			ENSG00000132334	ENSG00000132334		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9669	protein-coding gene	gene with protein product		600926				8595895	Standard	NM_130435		Approved	PTPE	uc001lkb.3	P23469	OTTHUMG00000019254	ENST00000254667.3:c.570C>A	chr10.hg19:g.129859261C>A		87.0	0.0	.		109.0	38.0	.	NM_006504	Q13345|Q5VWH3|Q5VWH4|Q96KQ6	Silent	SNP	ENST00000254667.3	hg19	CCDS7657.1																																																																																			.	.	.	none		0.483	PTPRE-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050990.1		
PAOX	196743	hgsc.bcm.edu	37	10	135193909	135193909	+	Silent	SNP	C	C	T			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr10:135193909C>T	ENST00000278060.5	+	2	671	c.588C>T	c.(586-588)ggC>ggT	p.G196G	PAOX_ENST00000368539.4_Intron|PAOX_ENST00000368535.2_3'UTR|PAOX_ENST00000480071.2_Silent_p.G196G|PAOX_ENST00000357296.3_Silent_p.G196G|AL360181.1_ENST00000597657.1_5'Flank	NM_152911.2	NP_690875.1	Q6QHF9	PAOX_HUMAN	polyamine oxidase (exo-N4-amino)	334					cellular nitrogen compound metabolic process (GO:0034641)|oxidation-reduction process (GO:0055114)|polyamine biosynthetic process (GO:0006596)|polyamine catabolic process (GO:0006598)|polyamine metabolic process (GO:0006595)|positive regulation of spermidine biosynthetic process (GO:1901307)|putrescine biosynthetic process (GO:0009446)|putrescine catabolic process (GO:0009447)|small molecule metabolic process (GO:0044281)|spermidine catabolic process (GO:0046203)|spermine catabolic process (GO:0046208)|xenobiotic metabolic process (GO:0006805)	peroxisomal matrix (GO:0005782)	N(1),N(12)-diacetylspermine:oxygen oxidoreductase (3-acetamidopropanal-forming) activity (GO:0052899)|N1-acetylspermidine:oxygen oxidoreductase (3-acetamidopropanal-forming) activity (GO:0052904)|N1-acetylspermine:oxygen oxidoreductase (3-acetamidopropanal-forming) activity (GO:0052903)|polyamine oxidase activity (GO:0046592)|receptor binding (GO:0005102)|spermidine:oxygen oxidoreductase (3-aminopropanal-forming) activity (GO:0052902)|spermine:oxygen oxidoreductase (spermidine-forming) activity (GO:0052901)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(13)|ovary(1)|urinary_tract(2)	23		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;4.39e-07)|OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|Epithelial(32;1.94e-06)		GTGTGAGCGGCACCCACAGCA	0.622																																					p.G196G		Atlas-SNP	.											.	PAOX	82	.	0			c.C588T						PASS	.						33.0	36.0	35.0					10																	135193909		2202	4299	6501	SO:0001819	synonymous_variant	196743	exon2			GAGCGGCACCCAC	BC032778	CCDS7682.1, CCDS7683.1, CCDS7684.1	10q26.3	2003-11-13			ENSG00000148832	ENSG00000148832			20837	protein-coding gene	gene with protein product		615853				12660232	Standard	NM_207127		Approved	PAO	uc001lmv.3	Q6QHF9	OTTHUMG00000019318	ENST00000278060.5:c.588C>T	chr10.hg19:g.135193909C>T		73.0	0.0	.		83.0	7.0	.	NM_207128	D3DXI6|Q5VWY0|Q6QHF5|Q6QHF6|Q6QHF7|Q6QHF8|Q6QHG0|Q6QHG1|Q6QHG2|Q6QHG3|Q6QHG4|Q6QHG5|Q6QHG6|Q86WP9|Q8N555|Q8NCX3	Silent	SNP	ENST00000278060.5	hg19	CCDS7683.1																																																																																			.	.	.	none		0.622	PAOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051146.2	NM_152911	
GYS2	2998	hgsc.bcm.edu	37	12	21757442	21757442	+	Missense_Mutation	SNP	G	G	T			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr12:21757442G>T	ENST00000261195.2	-	1	339	c.85C>A	c.(85-87)Ctg>Atg	p.L29M		NM_021957.3	NP_068776.2	P54840	GYS2_HUMAN	glycogen synthase 2 (liver)	29					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|ectoplasm (GO:0043265)	glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein homodimerization activity (GO:0042803)			NS(1)|breast(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(14)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						TCAAAGAGCAGTAACTCCTCC	0.493																																					p.L29M	Colon(149;9 1820 3690 10544 50424)	Atlas-SNP	.											.	GYS2	110	.	0			c.C85A						PASS	.						117.0	114.0	115.0					12																	21757442		2203	4299	6502	SO:0001583	missense	2998	exon1			AGAGCAGTAACTC		CCDS8690.1	12p12.2-p11.2	2013-02-22			ENSG00000111713	ENSG00000111713	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4707	protein-coding gene	gene with protein product		138571					Standard	NM_021957		Approved		uc001rfb.3	P54840	OTTHUMG00000169135	ENST00000261195.2:c.85C>A	chr12.hg19:g.21757442G>T	ENSP00000261195:p.Leu29Met	207.0	0.0	.		346.0	175.0	.	NM_021957	A0AVD8	Missense_Mutation	SNP	ENST00000261195.2	hg19	CCDS8690.1	.	.	.	.	.	.	.	.	.	.	G	15.54	2.864428	0.51482	.	.	ENSG00000111713	ENST00000261195	T	0.66638	-0.22	5.28	2.44	0.29823	.	0.076400	0.53938	D	0.000050	T	0.52964	0.1767	N	0.19112	0.55	0.34049	D	0.655926	P	0.52577	0.954	P	0.48166	0.569	T	0.61584	-0.7033	10	0.46703	T	0.11	-15.2558	7.1986	0.25868	0.35:0.0:0.65:0.0	.	29	P54840	GYS2_HUMAN	M	29	ENSP00000261195:L29M	ENSP00000261195:L29M	L	-	1	2	GYS2	21648709	0.646000	0.27295	0.229000	0.23960	0.989000	0.77384	0.796000	0.26986	0.361000	0.24292	0.655000	0.94253	CTG	.	.	.	none		0.493	GYS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402396.1	NM_021957	
METTL21B	25895	hgsc.bcm.edu	37	12	58177005	58177005	+	IGR	SNP	C	C	T			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr12:58177005C>T	ENST00000300209.8	+	0	2563				TSFM_ENST00000454289.3_Missense_Mutation_p.T57I|RP11-571M6.15_ENST00000471530.1_Nonsense_Mutation_p.Q72*|TSFM_ENST00000350762.5_5'UTR|RP11-571M6.15_ENST00000553083.1_3'UTR|TSFM_ENST00000540550.1_Missense_Mutation_p.T57I|TSFM_ENST00000550559.1_Missense_Mutation_p.T57I|TSFM_ENST00000497617.1_3'UTR|TSFM_ENST00000548851.1_Missense_Mutation_p.T57I|TSFM_ENST00000543727.1_Missense_Mutation_p.T57I|TSFM_ENST00000323833.8_Missense_Mutation_p.T57I	NM_015433.2	NP_056248.2	Q96AZ1	MT21B_HUMAN	methyltransferase like 21B							cytoplasm (GO:0005737)|intracellular (GO:0005622)	methyltransferase activity (GO:0008168)			endometrium(1)|lung(1)	2						CGGCGGAAAACAGGCTACTCC	0.582											OREG0021954	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T57I		Atlas-SNP	.											.	TSFM	26	.	0			c.C170T						PASS	.						100.0	110.0	107.0					12																	58177005		2203	4300	6503	SO:0001628	intergenic_variant	10102	exon2			GGAAAACAGGCTA	AL050100, AF455816	CCDS8957.1, CCDS31848.1	12q14.1	2011-03-03	2011-03-03	2011-03-03	ENSG00000123427	ENSG00000123427			24936	protein-coding gene	gene with protein product		615258	"""family with sequence similarity 119, member B"""	FAM119B		12477932	Standard	NM_015433		Approved	DKFZP586D0919	uc001sqg.3	Q96AZ1	OTTHUMG00000170459		chr12.hg19:g.58177005C>T		215.0	0.0	.	1028	337.0	96.0	.	NM_005726	Q9H749|Q9Y3W2	Missense_Mutation	SNP	ENST00000300209.8	hg19	CCDS8957.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.599184	0.87055	.	.	ENSG00000123297	ENST00000454289;ENST00000543727;ENST00000540550;ENST00000323833;ENST00000550559;ENST00000548851;ENST00000434359;ENST00000457189	.	.	.	5.29	5.29	0.74685	Translation elongation factor Ts, conserved site (1);Ubiquitin-associated/translation elongation factor EF1B, N-terminal (1);UBA-like (1);	0.000000	0.85682	D	0.000000	D	0.89784	0.6815	H	0.97103	3.94	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.92805	0.6259	9	0.87932	D	0	.	17.8551	0.88760	0.0:1.0:0.0:0.0	.	57;57;57	B4E391;P43897;P43897-2	.;EFTS_HUMAN;.	I	57;57;57;57;57;57;7;7	.	ENSP00000313877:T57I	T	+	2	0	TSFM	56463272	1.000000	0.71417	0.991000	0.47740	0.509000	0.34042	6.612000	0.74187	2.753000	0.94483	0.462000	0.41574	ACA	.	.	.	none		0.582	METTL21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409268.1	NM_015433	
CCDC63	160762	hgsc.bcm.edu	37	12	111321841	111321841	+	Missense_Mutation	SNP	G	G	C			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr12:111321841G>C	ENST00000308208.5	+	8	1103	c.861G>C	c.(859-861)aaG>aaC	p.K287N	CCDC63_ENST00000545036.1_Missense_Mutation_p.K247N|CCDC63_ENST00000552694.1_Missense_Mutation_p.K208N	NM_152591.1	NP_689804.1	Q8NA47	CCD63_HUMAN	coiled-coil domain containing 63	287										NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(15)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(1)	39						TAGCTCTCAAGGCAAAGAAGC	0.502																																					p.K287N		Atlas-SNP	.											.	CCDC63	89	.	0			c.G861C						PASS	.						129.0	129.0	129.0					12																	111321841		2203	4300	6503	SO:0001583	missense	160762	exon8			TCTCAAGGCAAAG	AK093162	CCDS9151.1, CCDS66470.1, CCDS73528.1	12q24.11	2013-02-19				ENSG00000173093			26669	protein-coding gene	gene with protein product	"""outer row dynein assembly 5 homolog (Chlamydomonas)"""						Standard	NM_001286243		Approved	ODA5, FLJ35843	uc001trv.1	Q8NA47	OTTHUMG00000169534	ENST00000308208.5:c.861G>C	chr12.hg19:g.111321841G>C	ENSP00000312399:p.Lys287Asn	170.0	0.0	.		296.0	144.0	.	NM_152591	B4DY03|Q0P603|Q6P2E1	Missense_Mutation	SNP	ENST00000308208.5	hg19	CCDS9151.1	.	.	.	.	.	.	.	.	.	.	G	13.24	2.177145	0.38413	.	.	ENSG00000173093	ENST00000545036;ENST00000308208;ENST00000552694	T;T;T	0.21734	1.99;1.99;1.99	5.68	4.78	0.61160	.	0.332758	0.32357	N	0.006214	T	0.45836	0.1362	M	0.83012	2.62	0.33081	D	0.536687	D	0.71674	0.998	D	0.66351	0.943	T	0.64296	-0.6441	10	0.66056	D	0.02	.	10.8325	0.46669	0.089:0.0:0.911:0.0	.	287	Q8NA47	CCD63_HUMAN	N	247;287;208	ENSP00000445881:K247N;ENSP00000312399:K287N;ENSP00000450217:K208N	ENSP00000312399:K287N	K	+	3	2	CCDC63	109806224	0.905000	0.30787	0.841000	0.33234	0.034000	0.12701	1.260000	0.32968	1.383000	0.46405	0.655000	0.94253	AAG	.	.	.	none		0.502	CCDC63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404673.2	NM_152591	
PTPN11	5781	hgsc.bcm.edu	37	12	112892458	112892458	+	Silent	SNP	T	T	C	rs78376169		TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr12:112892458T>C	ENST00000351677.2	+	5	814	c.616T>C	c.(616-618)Ttg>Ctg	p.L206L	PTPN11_ENST00000392597.1_Silent_p.L206L	NM_002834.3	NP_002825.3	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type 11	206	SH2 2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				abortive mitotic cell cycle (GO:0033277)|activation of MAPK activity (GO:0000187)|atrioventricular canal development (GO:0036302)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage checkpoint (GO:0000077)|ephrin receptor signaling pathway (GO:0048013)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|genitalia development (GO:0048806)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|multicellular organismal reproductive process (GO:0048609)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cortisol secretion (GO:0051463)|negative regulation of growth hormone secretion (GO:0060125)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ growth (GO:0035265)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of hormone secretion (GO:0046887)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of multicellular organism growth (GO:0040014)|regulation of protein export from nucleus (GO:0046825)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	insulin receptor binding (GO:0005158)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|SH3/SH2 adaptor activity (GO:0005070)	p.L206L(1)		NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(406)|kidney(2)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(3)|stomach(3)	451						GGTGGAAACATTGGGTACAGT	0.373			Mis		"""JMML, AML, MDS"""		Noonan Syndrome		Noonan syndrome																												p.L206L		Atlas-SNP	.		Dom	yes		12	12q24.1	5781	"""protein tyrosine phosphatase, non-receptor type 11"""	yes	L	PTPN11,NS,carcinoma,0,2	PTPN11	623	.	1	Substitution - coding silent(1)	stomach(1)	c.T616C						PASS	.						87.0	82.0	84.0					12																	112892458		2203	4300	6503	SO:0001819	synonymous_variant	5781	exon5	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	GAAACATTGGGTA	D13540	CCDS9163.1, CCDS58280.1	12q24.1	2014-09-17	2008-07-31		ENSG00000179295	ENSG00000179295		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9644	protein-coding gene	gene with protein product		176876	"""Noonan syndrome 1"""	NS1		7894486, 1280823	Standard	NM_080601		Approved	BPTP3, SH-PTP2, SHP-2, PTP2C, SHP2	uc001ttx.3	Q06124	OTTHUMG00000134334	ENST00000351677.2:c.616T>C	chr12.hg19:g.112892458T>C		61.0	0.0	.		120.0	6.0	.	NM_080601	A8K1D9|Q96HD7	Silent	SNP	ENST00000351677.2	hg19	CCDS9163.1																																																																																			.	.	.	weak		0.373	PTPN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259496.2		
MYH7	4625	hgsc.bcm.edu	37	14	23886422	23886422	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr14:23886422C>T	ENST00000355349.3	-	32	4621	c.4459G>A	c.(4459-4461)Gcc>Acc	p.A1487T	CTD-2201G16.1_ENST00000557368.1_RNA|MIR208B_ENST00000401172.1_RNA	NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1487					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TCCTCATAGGCGTTCTTGAGT	0.597																																					p.A1487T		Atlas-SNP	.											.	MYH7	349	.	0			c.G4459A						PASS	.						118.0	124.0	122.0					14																	23886422		2203	4300	6503	SO:0001583	missense	4625	exon32			CATAGGCGTTCTT	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.4459G>A	chr14.hg19:g.23886422C>T	ENSP00000347507:p.Ala1487Thr	234.0	0.0	.		257.0	77.0	.	NM_000257	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	ENST00000355349.3	hg19	CCDS9601.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.374149	0.82573	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	T	0.78364	-1.17	5.27	5.27	0.74061	Myosin tail (1);	.	.	.	.	D	0.84000	0.5376	M	0.81942	2.565	0.39473	D	0.967754	P	0.43662	0.814	P	0.50440	0.641	D	0.86199	0.1617	9	0.59425	D	0.04	.	13.987	0.64341	0.1513:0.8487:0.0:0.0	.	1487	P12883	MYH7_HUMAN	T	1487;1492	ENSP00000347507:A1487T	ENSP00000347507:A1487T	A	-	1	0	MYH7	22956262	0.987000	0.35691	0.998000	0.56505	0.982000	0.71751	2.764000	0.47613	2.746000	0.94184	0.591000	0.81541	GCC	.	.	.	none		0.597	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257	
PLCB2	5330	hgsc.bcm.edu	37	15	40594160	40594160	+	Nonsense_Mutation	SNP	T	T	A			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr15:40594160T>A	ENST00000260402.3	-	7	829	c.580A>T	c.(580-582)Aaa>Taa	p.K194*	PLCB2_ENST00000456256.2_Nonsense_Mutation_p.K194*|PLCB2-AS1_ENST00000559520.1_RNA|PLCB2_ENST00000543785.2_Nonsense_Mutation_p.K194*|PLCB2_ENST00000557821.1_Nonsense_Mutation_p.K194*	NM_001284297.1|NM_004573.2	NP_001271226.1|NP_004564.2	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	194					activation of phospholipase C activity (GO:0007202)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|sensory perception of bitter taste (GO:0050913)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(3)	39		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		CCACTCACTTTGCCTTTGGGG	0.582																																					p.K194X		Atlas-SNP	.											.	PLCB2	177	.	0			c.A580T						PASS	.						43.0	46.0	45.0					15																	40594160		2018	4185	6203	SO:0001587	stop_gained	5330	exon7			TCACTTTGCCTTT		CCDS42020.1, CCDS61591.1, CCDS61592.1, CCDS73704.1	15q15.1	2012-01-23			ENSG00000137841	ENSG00000137841	3.1.4.11		9055	protein-coding gene	gene with protein product		604114				1644792, 9925923	Standard	XM_005254448		Approved	FLJ38135	uc001zld.3	Q00722	OTTHUMG00000172412	ENST00000260402.3:c.580A>T	chr15.hg19:g.40594160T>A	ENSP00000260402:p.Lys194*	99.0	0.0	.		72.0	21.0	.	NM_004573	A8K6J2|B9EGH5	Nonsense_Mutation	SNP	ENST00000260402.3	hg19	CCDS42020.1	.	.	.	.	.	.	.	.	.	.	T	37	6.183272	0.97357	.	.	ENSG00000137841	ENST00000260402;ENST00000456256;ENST00000543785	.	.	.	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.9216	0.70843	0.0:0.0:0.0:1.0	.	.	.	.	X	194	.	ENSP00000260402:K194X	K	-	1	0	PLCB2	38381452	1.000000	0.71417	1.000000	0.80357	0.792000	0.44763	4.795000	0.62489	2.185000	0.69588	0.454000	0.30748	AAA	.	.	.	none		0.582	PLCB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418430.1		
GLDN	342035	hgsc.bcm.edu	37	15	51693835	51693835	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr15:51693835G>A	ENST00000335449.6	+	9	1129	c.1073G>A	c.(1072-1074)gGc>gAc	p.G358D	GLDN_ENST00000396399.2_Missense_Mutation_p.G234D	NM_181789.2	NP_861454.2	Q6ZMI3	GLDN_HUMAN	gliomedin	358	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|microvillus organization (GO:0032528)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19				all cancers(107;0.00194)|GBM - Glioblastoma multiforme(94;0.00942)		CTTCTGAATGGCAGTTACACG	0.483											OREG0023125	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G358D		Atlas-SNP	.											.	GLDN	54	.	0			c.G1073A						PASS	.						267.0	204.0	226.0					15																	51693835		2196	4293	6489	SO:0001583	missense	342035	exon9			TGAATGGCAGTTA	AY358144	CCDS10140.2	15q15.3	2008-02-05	2005-10-06	2005-10-06	ENSG00000186417	ENSG00000186417			29514	protein-coding gene	gene with protein product		608603	"""collomin"""	COLM		16039564, 12642876	Standard	XM_005254338		Approved	CRG-L2, CLOM, colmedin, UNC-112	uc002aba.3	Q6ZMI3	OTTHUMG00000131746	ENST00000335449.6:c.1073G>A	chr15.hg19:g.51693835G>A	ENSP00000335196:p.Gly358Asp	176.0	0.0	.	979	197.0	76.0	.	NM_181789	Q6UXZ7|Q7Z359	Missense_Mutation	SNP	ENST00000335449.6	hg19	CCDS10140.2	.	.	.	.	.	.	.	.	.	.	G	4.101	0.016804	0.07959	.	.	ENSG00000186417	ENST00000335449;ENST00000396399;ENST00000537339	D;D	0.88431	-2.38;-2.38	5.71	3.4	0.38934	Olfactomedin-like (3);	0.890672	0.09441	N	0.801780	T	0.77274	0.4106	N	0.14661	0.345	0.20638	N	0.999872	B	0.13594	0.008	B	0.16289	0.015	T	0.61855	-0.6977	10	0.12103	T	0.63	.	7.3269	0.26560	0.359:0.0:0.641:0.0	.	358	Q6ZMI3	GLDN_HUMAN	D	358;234;234	ENSP00000335196:G358D;ENSP00000379681:G234D	ENSP00000335196:G358D	G	+	2	0	GLDN	49481127	0.992000	0.36948	0.561000	0.28357	0.921000	0.55340	1.691000	0.37721	1.316000	0.45131	0.655000	0.94253	GGC	.	.	.	none		0.483	GLDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254667.2	NM_181789	
VPS13C	54832	hgsc.bcm.edu	37	15	62221845	62221845	+	Missense_Mutation	SNP	C	C	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr15:62221845C>G	ENST00000261517.5	-	51	6214	c.6141G>C	c.(6139-6141)aaG>aaC	p.K2047N	VPS13C_ENST00000249837.3_Missense_Mutation_p.K2004N|VPS13C_ENST00000395896.4_Missense_Mutation_p.K2047N|VPS13C_ENST00000395898.3_Missense_Mutation_p.K2004N	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						ATACATACAGCTTGTCAAGAA	0.368																																					p.K2047N		Atlas-SNP	.											.	VPS13C	506	.	0			c.G6141C						PASS	.						192.0	162.0	172.0					15																	62221845		2203	4300	6503	SO:0001583	missense	54832	exon51			ATACAGCTTGTCA	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.6141G>C	chr15.hg19:g.62221845C>G	ENSP00000261517:p.Lys2047Asn	76.0	0.0	.		82.0	30.0	.	NM_020821		Missense_Mutation	SNP	ENST00000261517.5	hg19	CCDS32257.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.069131	0.76301	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T;T	0.46451	0.87;0.87;1.04;1.03	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.51449	0.1675	M	0.71581	2.175	0.80722	D	1	P;P;P;B	0.40794	0.544;0.729;0.544;0.409	B;B;B;B	0.44044	0.176;0.439;0.34;0.336	T	0.51601	-0.8685	10	0.37606	T	0.19	.	18.867	0.92296	0.0:1.0:0.0:0.0	.	2004;2047;2004;2047	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	N	2004;2047;2047;2047	ENSP00000249837:K2004N;ENSP00000261517:K2047N;ENSP00000379233:K2047N;ENSP00000379235:K2047N	ENSP00000249837:K2004N	K	-	3	2	VPS13C	60009137	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	2.197000	0.42696	2.442000	0.82660	0.655000	0.94253	AAG	.	.	.	none		0.368	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	NM_017684	
MYO9A	4649	hgsc.bcm.edu	37	15	72192125	72192125	+	Silent	SNP	T	T	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr15:72192125T>G	ENST00000356056.5	-	24	3845	c.3373A>C	c.(3373-3375)Aga>Cga	p.R1125R	MYO9A_ENST00000563542.1_5'UTR|MYO9A_ENST00000444904.1_Silent_p.R1106R|MYO9A_ENST00000566885.1_Silent_p.R745R|MYO9A_ENST00000564571.1_Silent_p.R1125R|MYO9A_ENST00000424560.1_Silent_p.R1125R	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	1125	IQ 4. {ECO:0000255|PROSITE- ProRule:PRU00116}.|Neck or regulatory domain.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						GCTTTCCATCTTGCTTGTATG	0.438																																					p.R1125R		Atlas-SNP	.											.	MYO9A	203	.	0			c.A3373C						PASS	.						85.0	81.0	82.0					15																	72192125		2199	4297	6496	SO:0001819	synonymous_variant	4649	exon24			TCCATCTTGCTTG	AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.3373A>C	chr15.hg19:g.72192125T>G		97.0	0.0	.		123.0	46.0	.	NM_006901	B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Silent	SNP	ENST00000356056.5	hg19	CCDS10239.1																																																																																			.	.	.	none		0.438	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257308.1	NM_006901	
SLX4	84464	hgsc.bcm.edu	37	16	3641173	3641173	+	Missense_Mutation	SNP	C	C	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr16:3641173C>G	ENST00000294008.3	-	12	3106	c.2466G>C	c.(2464-2466)atG>atC	p.M822I		NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	822	Glu-rich.|Interaction with PLK1 and TERF2-TERF2IP.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)			breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						CATCTGCCCACATTGACCTCA	0.468								Direct reversal of damage																													p.M822I		Atlas-SNP	.											.	SLX4	173	.	0			c.G2466C						PASS	.						165.0	176.0	172.0					16																	3641173		2197	4300	6497	SO:0001583	missense	84464	exon12			TGCCCACATTGAC	AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.2466G>C	chr16.hg19:g.3641173C>G	ENSP00000294008:p.Met822Ile	247.0	0.0	.		291.0	79.0	.	NM_032444	Q69YT8|Q8TF15|Q96JP1	Missense_Mutation	SNP	ENST00000294008.3	hg19	CCDS10506.2	.	.	.	.	.	.	.	.	.	.	C	18.93	3.727924	0.69074	.	.	ENSG00000188827	ENST00000294008	T	0.01347	4.99	5.57	5.57	0.84162	.	0.430257	0.24894	N	0.034741	T	0.02304	0.0071	L	0.47190	1.495	0.28137	N	0.92995	B	0.30406	0.278	B	0.24155	0.051	T	0.37267	-0.9713	10	0.45353	T	0.12	.	18.5351	0.91008	0.0:1.0:0.0:0.0	.	822	Q8IY92	SLX4_HUMAN	I	822	ENSP00000294008:M822I	ENSP00000294008:M822I	M	-	3	0	SLX4	3581174	1.000000	0.71417	0.995000	0.50966	0.993000	0.82548	3.184000	0.50926	2.619000	0.88677	0.561000	0.74099	ATG	.	.	.	none		0.468	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157301.3	NM_032444	
SRCAP	10847	hgsc.bcm.edu	37	16	30732089	30732089	+	Missense_Mutation	SNP	C	C	A			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr16:30732089C>A	ENST00000262518.4	+	20	3428	c.3043C>A	c.(3043-3045)Cca>Aca	p.P1015T	SRCAP_ENST00000395059.2_Missense_Mutation_p.P1015T|SRCAP_ENST00000344771.4_Missense_Mutation_p.P1015T	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	1015	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			GGTGAACAACCCACGGGCGCC	0.602																																					p.P1015T		Atlas-SNP	.											.	SRCAP	298	.	0			c.C3043A						PASS	.						65.0	74.0	71.0					16																	30732089		2197	4300	6497	SO:0001583	missense	10847	exon20			AACAACCCACGGG	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.3043C>A	chr16.hg19:g.30732089C>A	ENSP00000262518:p.Pro1015Thr	223.0	0.0	.		275.0	93.0	.	NM_006662	B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	ENST00000262518.4	hg19	CCDS10689.2	.	.	.	.	.	.	.	.	.	.	C	15.07	2.724931	0.48833	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	D;D;D	0.91631	-2.88;-2.81;-2.85	5.25	5.25	0.73442	.	0.000000	0.50627	D	0.000110	D	0.90219	0.6942	N	0.14661	0.345	0.41912	D	0.990471	D;D;D	0.76494	0.999;0.999;0.997	D;D;P	0.67382	0.934;0.951;0.895	D	0.87595	0.2493	10	0.25106	T	0.35	-10.7491	11.2203	0.48851	0.0:0.9156:0.0:0.0844	.	1015;1015;1015	Q6ZRS2-3;Q6ZRS2-2;Q6ZRS2	.;.;SRCAP_HUMAN	T	1015	ENSP00000262518:P1015T;ENSP00000378499:P1015T;ENSP00000343042:P1015T	ENSP00000262518:P1015T	P	+	1	0	SRCAP	30639590	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	4.640000	0.61368	2.729000	0.93468	0.557000	0.71058	CCA	.	.	.	none		0.602	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
ZZEF1	23140	hgsc.bcm.edu	37	17	3953114	3953114	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr17:3953114C>T	ENST00000381638.2	-	37	6027	c.5903G>A	c.(5902-5904)gGg>gAg	p.G1968E		NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	1968							calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						GCTCGAGTCCCCATCTGGCAA	0.498																																					p.G1968E		Atlas-SNP	.											.	ZZEF1	195	.	0			c.G5903A						PASS	.						97.0	92.0	94.0					17																	3953114		2203	4300	6503	SO:0001583	missense	23140	exon37			GAGTCCCCATCTG	BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.5903G>A	chr17.hg19:g.3953114C>T	ENSP00000371051:p.Gly1968Glu	111.0	0.0	.		170.0	54.0	.	NM_015113	A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Missense_Mutation	SNP	ENST00000381638.2	hg19	CCDS11043.1	.	.	.	.	.	.	.	.	.	.	C	16.80	3.222545	0.58668	.	.	ENSG00000074755	ENST00000381638	T	0.20881	2.04	5.33	4.35	0.52113	.	0.334072	0.36555	N	0.002540	T	0.21427	0.0516	N	0.19112	0.55	0.40921	D	0.984313	D;D	0.59767	0.962;0.986	P;P	0.54174	0.744;0.738	T	0.00888	-1.1526	10	0.49607	T	0.09	-17.7018	10.7443	0.46170	0.0:0.9108:0.0:0.0892	.	1968;1968	O43149-2;O43149	.;ZZEF1_HUMAN	E	1968	ENSP00000371051:G1968E	ENSP00000371051:G1968E	G	-	2	0	ZZEF1	3899863	0.864000	0.29904	0.970000	0.41538	0.425000	0.31504	1.732000	0.38146	2.672000	0.90937	0.508000	0.49915	GGG	.	.	.	none		0.498	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207480.1	NM_015113	
QRICH2	84074	hgsc.bcm.edu	37	17	74283337	74283337	+	Missense_Mutation	SNP	T	T	A			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr17:74283337T>A	ENST00000262765.5	-	7	3628	c.3449A>T	c.(3448-3450)cAa>cTa	p.Q1150L		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	1150										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						GCCCCTGTCTTGGCTCTCCCT	0.567																																					p.Q1150L		Atlas-SNP	.											.	QRICH2	143	.	0			c.A3449T						PASS	.						128.0	104.0	112.0					17																	74283337		2203	4300	6503	SO:0001583	missense	84074	exon7			CTGTCTTGGCTCT	AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.3449A>T	chr17.hg19:g.74283337T>A	ENSP00000262765:p.Gln1150Leu	74.0	0.0	.		118.0	31.0	.	NM_032134	A2RRE1|Q96LM3	Missense_Mutation	SNP	ENST00000262765.5	hg19	CCDS32741.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.420700	0.83559	.	.	ENSG00000129646	ENST00000262765;ENST00000447564;ENST00000301613	T;T	0.63580	1.79;-0.05	4.89	4.89	0.63831	.	.	.	.	.	T	0.67906	0.2943	L	0.34521	1.04	0.32374	N	0.555436	D;D	0.71674	0.998;0.998	D;D	0.66351	0.943;0.943	T	0.73704	-0.3899	9	0.52906	T	0.07	-7.7869	12.7966	0.57562	0.0:0.0:0.0:1.0	.	1150;1150	B5MD94;Q9H0J4	.;QRIC2_HUMAN	L	1150;158;1150	ENSP00000262765:Q1150L;ENSP00000394461:Q158L	ENSP00000262765:Q1150L	Q	-	2	0	QRICH2	71794932	1.000000	0.71417	0.985000	0.45067	0.931000	0.56810	4.519000	0.60517	1.836000	0.53414	0.454000	0.30748	CAA	.	.	.	none		0.567	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395140.1	NM_032134	
TBCD	6904	hgsc.bcm.edu	37	17	80888515	80888515	+	Missense_Mutation	SNP	G	G	C			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr17:80888515G>C	ENST00000355528.4	+	33	3239	c.3109G>C	c.(3109-3111)Gag>Cag	p.E1037Q	TBCD_ENST00000539345.2_Missense_Mutation_p.E1037Q	NM_005993.4	NP_005984.3	Q9BTW9	TBCD_HUMAN	tubulin folding cofactor D	1037					'de novo' posttranslational protein folding (GO:0051084)|adherens junction assembly (GO:0034333)|cellular protein metabolic process (GO:0044267)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of microtubule polymerization (GO:0031115)|positive regulation of GTPase activity (GO:0043547)|post-chaperonin tubulin folding pathway (GO:0007023)|protein folding (GO:0006457)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|tight junction (GO:0005923)	beta-tubulin binding (GO:0048487)|chaperone binding (GO:0051087)|GTPase activator activity (GO:0005096)					Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			CCTTCTGAATGAGAGGTGAGT	0.597																																					p.E1037Q		Atlas-SNP	.											.	TBCD	94	.	0			c.G3109C						PASS	.						92.0	89.0	90.0					17																	80888515		2024	4185	6209	SO:0001583	missense	6904	exon33			CTGAATGAGAGGT	BC003094	CCDS45818.1	17q25.3	2006-11-21	2006-11-21			ENSG00000141556			11581	protein-coding gene	gene with protein product		604649	"""tubulin-specific chaperone d"""				Standard	NM_005993		Approved		uc002kfz.3	Q9BTW9		ENST00000355528.4:c.3109G>C	chr17.hg19:g.80888515G>C	ENSP00000347719:p.Glu1037Gln	60.0	0.0	.		106.0	27.0	.	NM_005993	O95458|Q7L8K1|Q8IXP6|Q8NAX0|Q8WYH4|Q96E74|Q9UF82|Q9UG46|Q9Y2J3	Missense_Mutation	SNP	ENST00000355528.4	hg19	CCDS45818.1	.	.	.	.	.	.	.	.	.	.	G	11.82	1.751852	0.31046	.	.	ENSG00000141556	ENST00000355528;ENST00000334614;ENST00000539345	T	0.35236	1.32	4.63	2.48	0.30137	Armadillo-like helical (1);Armadillo-type fold (1);Tubulin-specific chaperone D, C-terminal (1);	0.128907	0.50627	D	0.000107	T	0.27731	0.0682	L	0.42245	1.32	0.80722	D	1	P;P;P	0.41313	0.745;0.601;0.709	B;B;B	0.41946	0.27;0.307;0.371	T	0.02632	-1.1131	9	.	.	.	.	5.3369	0.15963	0.113:0.2093:0.6777:0.0	.	814;1037;1037	F8WC00;Q9BTW9;Q9BTW9-4	.;TBCD_HUMAN;.	Q	1037;788;29	ENSP00000347719:E1037Q	.	E	+	1	0	TBCD	78481804	1.000000	0.71417	0.852000	0.33557	0.360000	0.29518	3.799000	0.55529	0.939000	0.37446	0.591000	0.81541	GAG	.	.	.	none		0.597	TBCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439415.1	NM_005993	
HDHD2	84064	hgsc.bcm.edu	37	18	44662721	44662721	+	Silent	SNP	T	T	C			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr18:44662721T>C	ENST00000300605.6	-	2	242	c.90A>G	c.(88-90)gaA>gaG	p.E30E	HDHD2_ENST00000587841.1_Intron|IER3IP1_ENST00000588705.1_3'UTR	NM_032124.4	NP_115500.1	Q9H0R4	HDHD2_HUMAN	haloacid dehalogenase-like hydrolase domain containing 2	30						extracellular vesicular exosome (GO:0070062)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)			kidney(2)|large_intestine(2)|lung(1)|skin(1)	6						TTTTAAGAGCTTCCTGTGCGC	0.463																																					p.E30E		Atlas-SNP	.											.	HDHD2	12	.	0			c.A90G						PASS	.						99.0	82.0	88.0					18																	44662721		2203	4300	6503	SO:0001819	synonymous_variant	84064	exon2			AAGAGCTTCCTGT	AL136681	CCDS32829.1	18q21.1	2008-02-05				ENSG00000167220			25364	protein-coding gene	gene with protein product						11230166	Standard	NM_032124		Approved	DKFZP564D1378	uc002lcs.3	Q9H0R4		ENST00000300605.6:c.90A>G	chr18.hg19:g.44662721T>C		159.0	0.0	.		221.0	83.0	.	NM_032124	A8K7T3|Q96NV4	Silent	SNP	ENST00000300605.6	hg19	CCDS32829.1																																																																																			.	.	.	none		0.463	HDHD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450668.2	NM_032124	
MYO5B	4645	hgsc.bcm.edu	37	18	47500737	47500737	+	Silent	SNP	C	C	T			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr18:47500737C>T	ENST00000285039.7	-	10	1604	c.1305G>A	c.(1303-1305)ggG>ggA	p.G435G		NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	435	Myosin motor.		G -> R (in DIAR2). {ECO:0000269|PubMed:20186687}.		endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		TGTCCAGGACCCCGATGAAGG	0.582																																					p.G435G		Atlas-SNP	.											.	MYO5B	178	.	0			c.G1305A						PASS	.						98.0	108.0	104.0					18																	47500737		2136	4239	6375	SO:0001819	synonymous_variant	4645	exon10			CAGGACCCCGATG	AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.1305G>A	chr18.hg19:g.47500737C>T		108.0	0.0	.		92.0	35.0	.	NM_001080467	B0I1R3|Q0P656|Q9H6Y6	Silent	SNP	ENST00000285039.7	hg19	CCDS42436.1																																																																																			.	.	.	none		0.582	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448515.2		
RFX2	5990	hgsc.bcm.edu	37	19	6013026	6013026	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr19:6013026C>T	ENST00000303657.5	-	8	1019	c.870G>A	c.(868-870)atG>atA	p.M290I	RFX2_ENST00000359161.3_Missense_Mutation_p.M290I|CTC-232P5.1_ENST00000587836.1_RNA|RFX2_ENST00000592546.1_Missense_Mutation_p.M265I	NM_000635.3	NP_000626.2	P48378	RFX2_HUMAN	regulatory factor X, 2 (influences HLA class II expression)	290					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(4)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21						GCTGCTGCCGCATGGCCATGT	0.617																																					p.M290I	Colon(38;171 817 19800 47433 48051)	Atlas-SNP	.											.	RFX2	60	.	0			c.G870A						PASS	.						104.0	104.0	104.0					19																	6013026		2203	4300	6503	SO:0001583	missense	5990	exon8			CTGCCGCATGGCC		CCDS12157.1, CCDS12158.1	19p13.3	2011-11-23			ENSG00000087903	ENSG00000087903			9983	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 2"", ""DNA binding protein RFX2"", ""HLA class II regulatory factor RFX2"""	142765				1505960	Standard	NM_000635		Approved	FLJ14226	uc002meb.3	P48378		ENST00000303657.5:c.870G>A	chr19.hg19:g.6013026C>T	ENSP00000306335:p.Met290Ile	279.0	0.0	.		320.0	119.0	.	NM_000635	A8K581|B3KNC4|Q6IQ44|Q8SNA2	Missense_Mutation	SNP	ENST00000303657.5	hg19	CCDS12157.1	.	.	.	.	.	.	.	.	.	.	C	17.54	3.414320	0.62511	.	.	ENSG00000087903	ENST00000303657;ENST00000359161;ENST00000537791	T	0.65364	-0.15	4.99	4.99	0.66335	.	0.038993	0.85682	D	0.000000	T	0.57359	0.2048	L	0.60845	1.875	0.80722	D	1	B;B	0.13594	0.008;0.005	B;B	0.17722	0.019;0.013	T	0.57341	-0.7828	10	0.51188	T	0.08	-34.5934	10.8416	0.46720	0.0:0.9125:0.0:0.0875	.	265;290	P48378-2;P48378	.;RFX2_HUMAN	I	290;265;77	ENSP00000306335:M290I	ENSP00000306335:M290I	M	-	3	0	RFX2	5964026	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.796000	0.62496	2.473000	0.83533	0.557000	0.71058	ATG	.	.	.	none		0.617	RFX2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452687.1	NM_000635	
ZNF99	7652	hgsc.bcm.edu	37	19	22940806	22940806	+	Silent	SNP	G	G	A			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr19:22940806G>A	ENST00000596209.1	-	4	1995	c.1905C>T	c.(1903-1905)acC>acT	p.T635T	ZNF99_ENST00000397104.3_Silent_p.T544T	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	635					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T544T(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				GTTTTCTAAGGGTTGAGGACT	0.378																																					p.T635T		Atlas-SNP	.											ZNF99,NS,carcinoma,0,1	ZNF99	273	.	1	Substitution - coding silent(1)	prostate(1)	c.C1905T						PASS	.						37.0	39.0	38.0					19																	22940806		1989	4186	6175	SO:0001819	synonymous_variant	7652	exon4			TCTAAGGGTTGAG	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.1905C>T	chr19.hg19:g.22940806G>A		95.0	1.0	.		118.0	6.0	.	NM_001080409	M0R335	Silent	SNP	ENST00000596209.1	hg19	CCDS59369.1																																																																																			.	.	.	none		0.378	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124	
GIPR	2696	hgsc.bcm.edu	37	19	46184876	46184876	+	Missense_Mutation	SNP	C	C	G	rs529800464		TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr19:46184876C>G	ENST00000590918.1	+	13	1266	c.1167C>G	c.(1165-1167)agC>agG	p.S389R	GIPR_ENST00000263281.3_Missense_Mutation_p.S389R|GIPR_ENST00000304207.8_Missense_Mutation_p.S353R	NM_000164.2	NP_000155.1	P48546	GIPR_HUMAN	gastric inhibitory polypeptide receptor	389					activation of adenylate cyclase activity (GO:0007190)|cell surface receptor signaling pathway (GO:0007166)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|endocrine pancreas development (GO:0031018)|generation of precursor metabolites and energy (GO:0006091)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of insulin secretion (GO:0032024)|response to axon injury (GO:0048678)|response to calcium ion (GO:0051592)|response to fatty acid (GO:0070542)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gastric inhibitory peptide receptor activity (GO:0016519)|peptide hormone binding (GO:0017046)|transmembrane signaling receptor activity (GO:0004888)			endometrium(1)|kidney(2)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	12		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0056)|GBM - Glioblastoma multiforme(486;0.0832)|Epithelial(262;0.199)		TCCTGGTCAGCGTCCTCTACT	0.677																																					p.S389R		Atlas-SNP	.											.	GIPR	36	.	0			c.C1167G						PASS	.						35.0	40.0	38.0					19																	46184876		2203	4300	6503	SO:0001583	missense	2696	exon13			GGTCAGCGTCCTC		CCDS12671.1	19q13.2-q13.3	2012-08-10				ENSG00000010310		"""GPCR / Class B : Glucagon receptors"""	4271	protein-coding gene	gene with protein product		137241				7490109	Standard	NM_000164		Approved		uc002pcu.1	P48546		ENST00000590918.1:c.1167C>G	chr19.hg19:g.46184876C>G	ENSP00000467494:p.Ser389Arg	96.0	0.0	.		99.0	30.0	.	NM_000164	B7WP14|B7ZKQ0|Q14401|Q16400|Q52M04|Q9UPI1	Missense_Mutation	SNP	ENST00000590918.1	hg19	CCDS12671.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.160957	0.78226	.	.	ENSG00000010310	ENST00000263281;ENST00000304207	T;T	0.58940	0.3;1.18	4.81	2.65	0.31530	GPCR, family 2-like (1);GPCR, family 2, secretin-like, conserved site (1);	0.209202	0.33959	N	0.004388	T	0.68842	0.3045	M	0.65677	2.01	0.35843	D	0.826177	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.73380	0.98;0.953;0.971	T	0.73898	-0.3837	10	0.87932	D	0	.	7.5841	0.27982	0.0:0.8105:0.0:0.1895	.	353;389;389	B7WP14;P48546;P48546-2	.;GIPR_HUMAN;.	R	389;353	ENSP00000263281:S389R;ENSP00000305321:S353R	ENSP00000263281:S389R	S	+	3	2	GIPR	50876716	0.911000	0.30947	0.991000	0.47740	0.988000	0.76386	0.947000	0.29082	0.609000	0.30018	0.561000	0.74099	AGC	.	.	.	none		0.677	GIPR-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000459640.1		
SIGLEC9	27180	hgsc.bcm.edu	37	19	51633170	51633170	+	Missense_Mutation	SNP	C	C	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr19:51633170C>G	ENST00000250360.3	+	7	1293	c.1226C>G	c.(1225-1227)gCa>gGa	p.A409G	SIGLEC9_ENST00000440804.3_Intron	NM_014441.2	NP_055256.1	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9	409					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(3)|lung(25)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	45		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		GAACCTTGGGCAGAAGACAGT	0.602																																					p.A409G		Atlas-SNP	.											.	SIGLEC9	85	.	0			c.C1226G						PASS	.						72.0	77.0	75.0					19																	51633170		2203	4300	6503	SO:0001583	missense	27180	exon7			CTTGGGCAGAAGA	AF135027	CCDS12825.1, CCDS56100.1	19q13.3-q13.4	2013-01-29			ENSG00000129450	ENSG00000129450		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10878	protein-coding gene	gene with protein product		605640				10903842	Standard	NM_014441		Approved	CD329	uc002pvu.3	Q9Y336		ENST00000250360.3:c.1226C>G	chr19.hg19:g.51633170C>G	ENSP00000250360:p.Ala409Gly	141.0	0.0	.		142.0	38.0	.	NM_014441	Q6GTU4|Q9BYI9	Missense_Mutation	SNP	ENST00000250360.3	hg19	CCDS12825.1	.	.	.	.	.	.	.	.	.	.	.	2.098	-0.406818	0.04832	.	.	ENSG00000129450	ENST00000250360	T	0.11277	2.79	1.96	-1.87	0.07737	.	.	.	.	.	T	0.08403	0.0209	M	0.63843	1.955	0.09310	N	1	P	0.35174	0.488	B	0.32211	0.142	T	0.31916	-0.9926	9	0.22109	T	0.4	.	2.1117	0.03704	0.2511:0.4132:0.0:0.3357	.	409	Q9Y336	SIGL9_HUMAN	G	409	ENSP00000250360:A409G	ENSP00000250360:A409G	A	+	2	0	SIGLEC9	56324982	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.824000	0.01708	-0.341000	0.08376	-0.346000	0.07831	GCA	.	.	.	none		0.602	SIGLEC9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464224.1	NM_014441	
CD40	958	hgsc.bcm.edu	37	20	44757638	44757638	+	Missense_Mutation	SNP	G	G	C			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr20:44757638G>C	ENST00000372285.3	+	9	865	c.793G>C	c.(793-795)Gat>Cat	p.D265H	CD40_ENST00000489304.1_3'UTR|CD40_ENST00000372276.3_3'UTR	NM_001250.4	NP_001241.1	P25942	TNR5_HUMAN	CD40 molecule, TNF receptor superfamily member 5	265					B cell proliferation (GO:0042100)|cellular calcium ion homeostasis (GO:0006874)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|inflammatory response (GO:0006954)|platelet activation (GO:0030168)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|protein complex assembly (GO:0006461)|regulation of immune response (GO:0050776)|regulation of immunoglobulin secretion (GO:0051023)	CD40 receptor complex (GO:0035631)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|enzyme binding (GO:0019899)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10		Myeloproliferative disorder(115;0.0122)				CACCCAGGAGGATGGCAAAGA	0.582									Immune Deficiency with Hyper-IgM																												p.D265H		Atlas-SNP	.											.	CD40	33	.	0			c.G793C						PASS	.						94.0	86.0	89.0					20																	44757638		2203	4300	6503	SO:0001583	missense	958	exon9	Familial Cancer Database	Hypogammaglobulinemia with Hyper-IgM, HIGM type I-V, XLHIGM	CAGGAGGATGGCA	X60592	CCDS13393.1, CCDS13394.1	20q12-q13.2	2014-09-17	2006-03-28	2005-01-14	ENSG00000101017	ENSG00000101017		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11919	protein-coding gene	gene with protein product		109535	"""tumor necrosis factor receptor superfamily, member 5"""	TNFRSF5		7687385, 2998589	Standard	XM_005260617		Approved	p50, Bp50	uc002xrg.1	P25942	OTTHUMG00000033053	ENST00000372285.3:c.793G>C	chr20.hg19:g.44757638G>C	ENSP00000361359:p.Asp265His	120.0	0.0	.		208.0	43.0	.	NM_001250	E1P5S9|Q53GN5|Q5JY15|Q5U007|Q7M4Q8|Q86YK5|Q9BYU0	Missense_Mutation	SNP	ENST00000372285.3	hg19	CCDS13393.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.14|19.14	3.769455|3.769455	0.69992|0.69992	.|.	.|.	ENSG00000101017|ENSG00000101017	ENST00000372285|ENST00000372278	T|.	0.75050|.	-0.9|.	4.61|4.61	4.61|4.61	0.57282|0.57282	.|.	2.083250|.	0.02069|.	N|.	0.051393|.	T|T	0.72078|0.72078	0.3416|0.3416	L|L	0.61218|0.61218	1.895|1.895	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	T|T	0.75792|0.75792	-0.3193|-0.3193	10|6	0.48119|0.87932	T|D	0.1|0	-17.99|-17.99	14.7536|14.7536	0.69546|0.69546	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	265|.	P25942|.	TNR5_HUMAN|.	H|S	265|214	ENSP00000361359:D265H|.	ENSP00000361359:D265H|ENSP00000361352:R214S	D|R	+|+	1|3	0|2	CD40|CD40	44191045|44191045	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.759000|0.759000	0.43091|0.43091	5.327000|5.327000	0.65881|0.65881	2.375000|2.375000	0.81037|0.81037	0.491000|0.491000	0.48974|0.48974	GAT|AGG	.	.	.	none		0.582	CD40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080376.1	NM_001250	
ZNFX1	57169	hgsc.bcm.edu	37	20	47887763	47887763	+	Missense_Mutation	SNP	T	T	C			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr20:47887763T>C	ENST00000396105.1	-	3	832	c.586A>G	c.(586-588)Agc>Ggc	p.S196G	ZNFX1_ENST00000371754.4_Missense_Mutation_p.S196G|ZNFX1_ENST00000371752.1_Missense_Mutation_p.S196G	NM_021035.2	NP_066363.1	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	196							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(8)|kidney(7)|large_intestine(15)|liver(1)|lung(17)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	60			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			ATTTTGGAGCTACAAGCCTTC	0.448																																					p.S196G		Atlas-SNP	.											.	ZNFX1	194	.	0			c.A586G						PASS	.						122.0	125.0	124.0					20																	47887763		2203	4300	6503	SO:0001583	missense	57169	exon3			TGGAGCTACAAGC	AK022641	CCDS13417.1	20q13.13	2014-02-12			ENSG00000124201	ENSG00000124201			29271	protein-coding gene	gene with protein product						10718198	Standard	NM_021035		Approved	KIAA1404, FLJ11277	uc002xui.3	Q9P2E3	OTTHUMG00000032696	ENST00000396105.1:c.586A>G	chr20.hg19:g.47887763T>C	ENSP00000379412:p.Ser196Gly	183.0	0.0	.		306.0	151.0	.	NM_021035	Q9BQM7|Q9BQM8|Q9H8C1|Q9H9S2|Q9NUM1|Q9NWW1	Missense_Mutation	SNP	ENST00000396105.1	hg19	CCDS13417.1	.	.	.	.	.	.	.	.	.	.	T	9.975	1.226419	0.22542	.	.	ENSG00000124201	ENST00000396106;ENST00000371754;ENST00000371752;ENST00000396105;ENST00000371744	D;D;D;T	0.86865	-1.89;-2.18;-2.18;-0.82	5.86	5.86	0.93980	.	0.260907	0.49916	D	0.000128	T	0.81564	0.4849	L	0.45581	1.43	0.25150	N	0.990437	B	0.13145	0.007	B	0.10450	0.005	T	0.66590	-0.5885	10	0.21540	T	0.41	-21.586	10.261	0.43427	0.0:0.0774:0.0:0.9226	.	196	Q9P2E3	ZNFX1_HUMAN	G	196	ENSP00000360819:S196G;ENSP00000360817:S196G;ENSP00000379412:S196G;ENSP00000360809:S196G	ENSP00000360809:S196G	S	-	1	0	ZNFX1	47321170	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	1.608000	0.36847	2.241000	0.73720	0.533000	0.62120	AGC	.	.	.	none		0.448	ZNFX1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079647.2	NM_021035	
GNAZ	2781	hgsc.bcm.edu	37	22	23438484	23438484	+	Missense_Mutation	SNP	A	A	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr22:23438484A>G	ENST00000248996.4	+	2	1268	c.602A>G	c.(601-603)gAc>gGc	p.D201G	RTDR1_ENST00000216036.4_Intron	NM_002073.2	NP_002064.1	P19086	GNAZ_HUMAN	guanine nucleotide binding protein (G protein), alpha z polypeptide	201					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|receptor signaling protein activity (GO:0005057)|signal transducer activity (GO:0004871)			endometrium(3)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(5)|urinary_tract(1)	19	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.166)		AAGATGGTGGACGTGGGGGGG	0.567																																					p.D201G		Atlas-SNP	.											GNAZ,NS,carcinoma,-1,1	GNAZ	45	.	0			c.A602G						PASS	.						131.0	136.0	135.0					22																	23438484		2203	4300	6503	SO:0001583	missense	2781	exon2			TGGTGGACGTGGG		CCDS13804.1	22q11.1-q11.2	2008-06-10			ENSG00000128266	ENSG00000128266			4395	protein-coding gene	gene with protein product		139160				2115889	Standard	NM_002073		Approved		uc002zwu.1	P19086	OTTHUMG00000150611	ENST00000248996.4:c.602A>G	chr22.hg19:g.23438484A>G	ENSP00000248996:p.Asp201Gly	247.0	1.0	.		228.0	69.0	.	NM_002073	B2R6C1|Q4QRJ6	Missense_Mutation	SNP	ENST00000248996.4	hg19	CCDS13804.1	.	.	.	.	.	.	.	.	.	.	A	13.88	2.367786	0.42003	.	.	ENSG00000128266	ENST00000248996;ENST00000456059	D	0.95656	-3.77	4.7	2.53	0.30540	.	0.000000	0.85682	D	0.000000	D	0.96386	0.8821	H	0.98577	4.27	0.80722	D	1	B	0.10296	0.003	B	0.08055	0.003	D	0.92468	0.5983	10	0.87932	D	0	.	6.794	0.23715	0.7665:0.1527:0.0808:0.0	.	201	P19086	GNAZ_HUMAN	G	201;149	ENSP00000248996:D201G	ENSP00000248996:D201G	D	+	2	0	GNAZ	21768484	1.000000	0.71417	0.650000	0.29550	0.158000	0.22134	9.084000	0.94076	0.268000	0.21939	-0.313000	0.08912	GAC	.	.	.	none		0.567	GNAZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319073.1	NM_002073	
CABIN1	23523	hgsc.bcm.edu	37	22	24447425	24447425	+	Silent	SNP	T	T	A			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr22:24447425T>A	ENST00000398319.2	+	8	1180	c.795T>A	c.(793-795)atT>atA	p.I265I	CABIN1_ENST00000263119.5_Silent_p.I265I|CABIN1_ENST00000405822.2_Intron	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	265					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						TGCAGCCCATTCCTTTCTTCA	0.577																																					p.I265I		Atlas-SNP	.											.	CABIN1	153	.	0			c.T795A						PASS	.						100.0	85.0	90.0					22																	24447425		2203	4300	6503	SO:0001819	synonymous_variant	23523	exon8			GCCCATTCCTTTC	AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.795T>A	chr22.hg19:g.24447425T>A		58.0	0.0	.		56.0	24.0	.	NM_001199281	G5E9F3|Q6PHY0|Q9Y460	Silent	SNP	ENST00000398319.2	hg19	CCDS13823.1																																																																																			.	.	.	none		0.577	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320161.2	NM_012295	
DEPDC5	9681	hgsc.bcm.edu	37	22	32193641	32193641	+	Nonsense_Mutation	SNP	A	A	T			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr22:32193641A>T	ENST00000382112.3	+	12	893	c.823A>T	c.(823-825)Aaa>Taa	p.K275*	DEPDC5_ENST00000400242.3_Nonsense_Mutation_p.K275*|DEPDC5_ENST00000535622.1_Nonsense_Mutation_p.K275*|DEPDC5_ENST00000382111.2_Nonsense_Mutation_p.K275*|DEPDC5_ENST00000400246.1_Nonsense_Mutation_p.K275*|DEPDC5_ENST00000536766.1_Nonsense_Mutation_p.K247*|DEPDC5_ENST00000400248.2_Nonsense_Mutation_p.K275*|DEPDC5_ENST00000382105.2_Nonsense_Mutation_p.K275*|DEPDC5_ENST00000266091.3_Nonsense_Mutation_p.K275*|DEPDC5_ENST00000400249.2_Nonsense_Mutation_p.K275*	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	275					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						CGTAACCATTAAAAAACTCTT	0.438																																					p.K275X		Atlas-SNP	.											.	DEPDC5	266	.	0			c.A823T						PASS	.						83.0	84.0	84.0					22																	32193641		1902	4127	6029	SO:0001587	stop_gained	9681	exon13			ACCATTAAAAAAC	AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.823A>T	chr22.hg19:g.32193641A>T	ENSP00000371546:p.Lys275*	58.0	0.0	.		69.0	28.0	.	NM_001242897	A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Nonsense_Mutation	SNP	ENST00000382112.3	hg19	CCDS46692.1	.	.	.	.	.	.	.	.	.	.	A	38	6.793795	0.97841	.	.	ENSG00000100150	ENST00000535622;ENST00000536766;ENST00000400242;ENST00000266091;ENST00000400249;ENST00000382109;ENST00000400246;ENST00000382105;ENST00000382112;ENST00000382111;ENST00000400248	.	.	.	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.9647	0.64202	1.0:0.0:0.0:0.0	.	.	.	.	X	275;247;275;275;275;275;275;275;275;275;275	.	ENSP00000266091:K275X	K	+	1	0	DEPDC5	30523641	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.097000	0.94193	1.921000	0.55644	0.443000	0.29094	AAA	.	.	.	none		0.438	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129087.1	NM_014662	
SOX10	6663	hgsc.bcm.edu	37	22	38374016	38374016	+	Silent	SNP	C	C	T			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr22:38374016C>T	ENST00000396884.2	-	3	837	c.555G>A	c.(553-555)caG>caA	p.Q185Q	SOX10_ENST00000470555.1_5'Flank|SOX10_ENST00000360880.2_Silent_p.Q185Q|POLR2F_ENST00000407936.1_Intron|POLR2F_ENST00000405557.1_Intron	NM_006941.3	NP_008872.1	P56693	SOX10_HUMAN	SRY (sex determining region Y)-box 10	185					anatomical structure morphogenesis (GO:0009653)|cell maturation (GO:0048469)|developmental growth (GO:0048589)|digestive tract morphogenesis (GO:0048546)|enteric nervous system development (GO:0048484)|in utero embryonic development (GO:0001701)|melanocyte differentiation (GO:0030318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system development (GO:0007422)|positive regulation of gliogenesis (GO:0014015)|positive regulation of neuroblast proliferation (GO:0002052)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	extrinsic component of mitochondrial outer membrane (GO:0031315)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|transcription coactivator activity (GO:0003713)			NS(6)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)|skin(2)	20	Melanoma(58;0.045)					CCGCCTCGCCCTGGGCGGCCT	0.682																																					p.Q185Q	Melanoma(39;342 1098 6220 32775 40068)|GBM(21;140 497 5227 16059 19275)	Atlas-SNP	.											.	SOX10	48	.	0			c.G555A						PASS	.						30.0	30.0	30.0					22																	38374016		2202	4300	6502	SO:0001819	synonymous_variant	6663	exon3			CTCGCCCTGGGCG		CCDS13964.1	22q13.1	2014-09-17			ENSG00000100146	ENSG00000100146		"""SRY (sex determining region Y)-boxes"""	11190	protein-coding gene	gene with protein product	"""dominant megacolon, mouse, human homolog of"""	602229				9462749, 10441344, 12944398	Standard	NM_006941		Approved	DOM, WS4, WS2E	uc003aun.1	P56693	OTTHUMG00000149913	ENST00000396884.2:c.555G>A	chr22.hg19:g.38374016C>T		65.0	0.0	.		67.0	19.0	.	NM_006941	B4DV62|Q6FHW7	Silent	SNP	ENST00000396884.2	hg19	CCDS13964.1	.	.	.	.	.	.	.	.	.	.	C	0.065	-1.215656	0.01542	.	.	ENSG00000100146	ENST00000446929	.	.	.	4.24	0.707	0.18139	.	.	.	.	.	T	0.50531	0.1621	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.34329	-0.9833	4	.	.	.	.	4.6565	0.12620	0.1228:0.6075:0.12:0.1497	.	.	.	.	K	62	.	.	R	-	2	0	SOX10	36703962	1.000000	0.71417	0.997000	0.53966	0.009000	0.06853	2.108000	0.41854	-0.014000	0.14175	-1.644000	0.00765	AGG	.	.	.	none		0.682	SOX10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313875.1	NM_006941	
MXRA5	25878	hgsc.bcm.edu	37	X	3238719	3238719	+	Silent	SNP	A	A	G			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chrX:3238719A>G	ENST00000217939.6	-	5	5161	c.5007T>C	c.(5005-5007)agT>agC	p.S1669S		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	1669						extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				GAATTGTTGTACTTGATAATC	0.438																																					p.S1669S		Atlas-SNP	.											.	MXRA5	815	.	0			c.T5007C						PASS	.						171.0	162.0	165.0					X																	3238719		2203	4300	6503	SO:0001819	synonymous_variant	25878	exon5			TGTTGTACTTGAT	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.5007T>C	chrX.hg19:g.3238719A>G		221.0	0.0	.		292.0	220.0	.	NM_015419	Q6P1M7|Q9Y3Y8	Silent	SNP	ENST00000217939.6	hg19	CCDS14124.1																																																																																			.	.	.	none		0.438	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419	
CTPS2	56474	hgsc.bcm.edu	37	X	16685795	16685795	+	Silent	SNP	A	A	C			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chrX:16685795A>C	ENST00000443824.1	-	12	1985	c.1242T>G	c.(1240-1242)ctT>ctG	p.L414L	CTPS2_ENST00000380241.3_Silent_p.L414L|CTPS2_ENST00000359276.4_Silent_p.L414L	NM_001144002.1	NP_001137474.1	Q9NRF8	PYRG2_HUMAN	CTP synthase 2	414	Glutamine amidotransferase type-1. {ECO:0000255|PROSITE-ProRule:PRU00605}.				'de novo' CTP biosynthetic process (GO:0044210)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP synthase activity (GO:0003883)			breast(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	Hepatocellular(33;0.0997)					CTTTCAAGTTAAGGCAGTTTC	0.323																																					p.L414L		Atlas-SNP	.											.	CTPS2	49	.	0			c.T1242G						PASS	.						104.0	95.0	98.0					X																	16685795		2203	4300	6503	SO:0001819	synonymous_variant	56474	exon12			CAAGTTAAGGCAG	AF086422	CCDS14175.1	Xp22	2012-05-02	2012-05-02		ENSG00000047230	ENSG00000047230	6.3.4.2		2520	protein-coding gene	gene with protein product		300380	"""CTP synthase II"""			10899599	Standard	NM_001144002		Approved		uc004cxm.3	Q9NRF8	OTTHUMG00000021193	ENST00000443824.1:c.1242T>G	chrX.hg19:g.16685795A>C		67.0	0.0	.		85.0	58.0	.	NM_001144002	B3KWM2|Q9BRI0|Q9H809|Q9H8K9	Silent	SNP	ENST00000443824.1	hg19	CCDS14175.1	.	.	.	.	.	.	.	.	.	.	A	8.285	0.816447	0.16607	.	.	ENSG00000047230	ENST00000455276	.	.	.	5.47	-4.64	0.03349	.	0.000000	0.64402	D	0.000015	.	.	.	.	.	.	0.44862	D	0.997874	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.4425	9.4054	0.38457	0.1945:0.5966:0.0:0.2089	.	.	.	.	X	36	.	ENSP00000400431:L36X	L	-	2	0	CTPS2	16595716	0.000000	0.05858	0.699000	0.30290	0.941000	0.58515	-1.673000	0.01951	-0.843000	0.04189	0.486000	0.48141	TTA	.	.	.	none		0.323	CTPS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055906.1	NM_019857	
C10orf12	26148	hgsc.bcm.edu	37	10	98741324	98741326	+	In_Frame_Del	DEL	TTT	TTT	-			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	TTT	TTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr10:98741324_98741326delTTT	ENST00000286067.2	+	1	284_286	c.177_179delTTT	c.(175-180)acttta>aca	p.L60del		NM_015652.2	NP_056467.2	Q8N655	CJ012_HUMAN	chromosome 10 open reading frame 12	60										NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(3)|prostate(2)|skin(2)|stomach(4)	45		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		AAGAGAATACTTTACAGTGTCCA	0.404																																					p.59_60del		Atlas-INDEL	.											.	C10orf12	94	.	0			c.176_178del						PASS	.																																			SO:0001651	inframe_deletion	26148	exon1			.	BC024315	CCDS7452.1	10q24.2	2014-03-11			ENSG00000155640	ENSG00000155640			23420	protein-coding gene	gene with protein product						24550272	Standard	NM_015652		Approved	DKFZP564P1916, FLJ13022	uc001kmv.3	Q8N655	OTTHUMG00000018840	ENST00000286067.2:c.177_179delTTT	chr10.hg19:g.98741324_98741326delTTT	ENSP00000286067:p.Leu60del	79.0	0.0	0		108.0	37.0	0.342593	NM_015652	Q9H945|Q9Y457	In_Frame_Del	DEL	ENST00000286067.2	hg19	CCDS7452.1																																																																																			.	.	.	none		0.404	C10orf12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049627.1	NM_015652	
OGG1	4968	hgsc.bcm.edu	37	3	9798226	9798227	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr3:9798226_9798227insAA	ENST00000344629.7	+	5	1162_1163	c.819_820insAA	c.(820-822)attfs	p.I274fs	OGG1_ENST00000339511.5_Frame_Shift_Ins_p.I274fs|OGG1_ENST00000302036.7_Frame_Shift_Ins_p.I274fs|OGG1_ENST00000302008.8_Frame_Shift_Ins_p.I274fs|OGG1_ENST00000349503.5_Intron|OGG1_ENST00000449570.2_Frame_Shift_Ins_p.I274fs|OGG1_ENST00000302003.7_Frame_Shift_Ins_p.I274fs|OGG1_ENST00000383826.5_Intron			O15527	OGG1_HUMAN	8-oxoguanine DNA glycosylase	274					acute inflammatory response (GO:0002526)|base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|cellular response to cadmium ion (GO:0071276)|depurination (GO:0045007)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair (GO:0006289)|regulation of protein import into nucleus, translocation (GO:0033158)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|response to oxidative stress (GO:0006979)|response to radiation (GO:0009314)	mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	8-oxo-7,8-dihydroguanine DNA N-glycosylase activity (GO:0034039)|damaged DNA binding (GO:0003684)|endonuclease activity (GO:0004519)|oxidized purine nucleobase lesion DNA N-glycosylase activity (GO:0008534)			kidney(2)|large_intestine(2)|lung(2)|skin(1)|urinary_tract(1)	8	Medulloblastoma(99;0.227)					ATATGTGGCACATTGCCCAACG	0.599								Base excision repair (BER), DNA glycosylases																													p.H273fs		Atlas-INDEL	.											.	OGG1	57	.	0			c.819_820insAA						PASS	.																																			SO:0001589	frameshift_variant	4968	exon5			.	U96710	CCDS2576.1, CCDS2577.1, CCDS2578.1, CCDS2579.1, CCDS2580.1, CCDS2581.1, CCDS43046.1, CCDS46742.1	3p26	2010-11-23			ENSG00000114026	ENSG00000114026	3.2.2.-, 4.2.99.18		8125	protein-coding gene	gene with protein product	"""8-hydroxyguanine DNA glycosylase"", ""OGG1 type 1e"", ""OGG1 type 1d"", ""OGG1 type 1g"", ""OGG1 type 1h"""	601982				9207108, 10449904	Standard	NM_002542		Approved	HMMH, HOGG1, OGH1, MUTM	uc003bsj.3	O15527	OTTHUMG00000097091	Exception_encountered	chr3.hg19:g.9798226_9798227insAA	ENSP00000342851:p.Ile274fs	80.0	0.0	0		86.0	28.0	0.325581	NM_016821	A8K1E3|O00390|O00670|O00705|O14876|O95488|P78554|Q9BW42|Q9UIK0|Q9UIK1|Q9UIK2|Q9UL34|Q9Y2C0|Q9Y2C1|Q9Y6C3|Q9Y6C4	Frame_Shift_Ins	INS	ENST00000344629.7	hg19	CCDS2581.1																																																																																			.	.	.	none		0.599	OGG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214223.2	NM_016821	
ANAPC5	51433	hgsc.bcm.edu	37	12	121746455	121746458	+	Frame_Shift_Del	DEL	TTCT	TTCT	-	rs146935401		TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	TTCT	TTCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr12:121746455_121746458delTTCT	ENST00000261819.3	-	17	2214_2217	c.2093_2096delAGAA	c.(2092-2097)aagaacfs	p.KN698fs	ANAPC5_ENST00000344395.4_Frame_Shift_Del_p.KN586fs|ANAPC5_ENST00000441917.2_Frame_Shift_Del_p.KN586fs|ANAPC5_ENST00000535482.1_Frame_Shift_Del_p.KN364fs|ANAPC5_ENST00000544314.1_5'UTR|ANAPC5_ENST00000541887.1_Frame_Shift_Del_p.KN685fs	NM_016237.4	NP_057321.2	Q9UJX4	APC5_HUMAN	anaphase promoting complex subunit 5	698					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)			breast(6)|endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|prostate(1)|skin(3)	31	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TGCAAAATAGTTCTTGGCTTCATT	0.49																																					p.698_699del		Atlas-INDEL	.											.	ANAPC5	60	.	0			c.2094_2097del						PASS	.																																			SO:0001589	frameshift_variant	51433	exon17			.	AF191339	CCDS9220.1, CCDS45000.1	12q24.31	2014-08-12			ENSG00000089053	ENSG00000089053		"""Anaphase promoting complex subunits"""	15713	protein-coding gene	gene with protein product		606948				9469815	Standard	NM_016237		Approved	APC5	uc001uag.3	Q9UJX4	OTTHUMG00000169157	ENST00000261819.3:c.2093_2096delAGAA	chr12.hg19:g.121746455_121746458delTTCT	ENSP00000261819:p.Lys698fs	220.0	0.0	0		299.0	132.0	0.441472	NM_016237	E9PFB2|Q8N4H7|Q9BQD4	Frame_Shift_Del	DEL	ENST00000261819.3	hg19	CCDS9220.1																																																																																			.	.	.	none		0.490	ANAPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402582.1		
GIGYF2	26058	hgsc.bcm.edu	37	2	233681733	233681734	+	Frame_Shift_Ins	INS	-	-	AGGAAAC			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr2:233681733_233681734insAGGAAAC	ENST00000409547.1	+	22	2672_2673	c.2361_2362insAGGAAAC	c.(2362-2364)aggfs	p.-790fs	GIGYF2_ENST00000409196.3_Frame_Shift_Ins_p.-784fs|GIGYF2_ENST00000452341.2_Frame_Shift_Ins_p.-621fs|GIGYF2_ENST00000373566.3_Frame_Shift_Ins_p.-812fs|GIGYF2_ENST00000409480.1_Frame_Shift_Ins_p.-812fs|GIGYF2_ENST00000373563.4_Frame_Shift_Ins_p.-790fs|GIGYF2_ENST00000409451.3_Frame_Shift_Ins_p.-811fs	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2						adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		AACTTGCCCGAAGGAAACAGGT	0.47																																					p.R808fs		Atlas-INDEL	.											.	GIGYF2	288	.	0			c.2424_2425insAGGAAAC						PASS	.																																			SO:0001589	frameshift_variant	26058	exon22			.	U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.2362_2368dupAGGAAAC	chr2.hg19:g.233681734_233681740dupAGGAAAC	ENSP00000386537:p.Gln790fs	261.0	0.0	0		323.0	45.0	0.139319	NM_001103147	A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Frame_Shift_Ins	INS	ENST00000409547.1	hg19	CCDS33401.1																																																																																			.	.	.	none		0.470	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000330316.2	NM_001103146	
RAB27B	5874	hgsc.bcm.edu	37	18	52555227	52555230	+	Splice_Site	DEL	CCAA	CCAA	-			TCGA-B3-3925-01A-01D-1458-08	TCGA-B3-3925-10A-01D-1458-08	CCAA	CCAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5bb6b194-3bad-4d65-8345-c5a0161b4a0f	acd62c81-b9cd-47ac-b708-52546a54aa37	g.chr18:52555227_52555230delCCAA	ENST00000262094.5	+	5	866_869	c.345_348delCCAA	c.(343-348)agccaa>ag	p.SQ115fs	RAB27B_ENST00000586594.1_3'UTR|RP11-839G9.1_ENST00000588466.1_RNA	NM_004163.4	NP_004154.2	O00194	RB27B_HUMAN	RAB27B, member RAS oncogene family	115					multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|multivesicular body membrane (GO:0032585)|trans-Golgi network transport vesicle (GO:0030140)|zymogen granule membrane (GO:0042589)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|protein domain specific binding (GO:0019904)			large_intestine(3)|lung(3)|skin(1)	7				Colorectal(16;0.0273)|READ - Rectum adenocarcinoma(59;0.219)		CTTTTCAAGGCCAACTGCAAGCAA	0.402																																					p.115_116del		Atlas-INDEL	.											.	RAB27B	24	.	0			c.344_347del						PASS	.																																			SO:0001630	splice_region_variant	5874	exon5			.	U57093	CCDS11958.1	18q21.2	2006-12-18			ENSG00000041353	ENSG00000041353		"""RAB, member RAS oncogene"""	9767	protein-coding gene	gene with protein product		603869				9066979	Standard	NM_004163		Approved		uc002lfr.3	O00194	OTTHUMG00000132710	ENST00000262094.5:c.344-1CCAA>-	chr18.hg19:g.52555227_52555230delCCAA		131.0	0.0	0		199.0	39.0	0.19598	NM_004163	B2RAB0|Q9BZB6	Frame_Shift_Del	DEL	ENST00000262094.5	hg19	CCDS11958.1																																																																																			.	.	.	none		0.402	RAB27B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256008.3	NM_004163	Frame_Shift_Del
