#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ALK	238	hgsc.bcm.edu	37	2	29432730	29432730	+	Missense_Mutation	SNP	C	C	G			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr2:29432730C>G	ENST00000389048.3	-	25	4664	c.3758G>C	c.(3757-3759)aGa>aCa	p.R1253T	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	1253	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	GAGGCAGTTTCTGGCAGCAAT	0.493			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																												p.R1253T		Atlas-SNP	.	yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	.	ALK	533	.	0			c.G3758C						PASS	.						105.0	107.0	106.0					2																	29432730		2203	4300	6503	SO:0001583	missense	238	exon25	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	CAGTTTCTGGCAG	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.3758G>C	chr2.hg19:g.29432730C>G	ENSP00000373700:p.Arg1253Thr	98.0	0.0	.		105.0	16.0	.	NM_004304	Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Missense_Mutation	SNP	ENST00000389048.3	hg19	CCDS33172.1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.983743	0.93044	.	.	ENSG00000171094	ENST00000389048	D	0.87571	-2.27	5.2	5.2	0.72013	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.53938	D	0.000057	D	0.95468	0.8528	H	0.94385	3.53	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96698	0.9516	9	.	.	.	.	17.5154	0.87771	0.0:1.0:0.0:0.0	.	1253	Q9UM73	ALK_HUMAN	T	1253	ENSP00000373700:R1253T	.	R	-	2	0	ALK	29286234	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	7.462000	0.80851	2.418000	0.82041	0.655000	0.94253	AGA	.	.	.	none		0.493	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324994.1	NM_004304	
PLXND1	23129	hgsc.bcm.edu	37	3	129284750	129284750	+	Missense_Mutation	SNP	C	C	A			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr3:129284750C>A	ENST00000324093.4	-	24	4480	c.4302G>T	c.(4300-4302)aaG>aaT	p.K1434N	PLXND1_ENST00000393239.1_Missense_Mutation_p.K1434N	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	1434					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)		PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						CCGCAAAGTCCTTCTGCTGCT	0.587																																					p.K1434N	Ovarian(97;366 1484 3738 22084 39045)	Atlas-SNP	.											.	PLXND1	149	.	0			c.G4302T						PASS	.						107.0	90.0	96.0					3																	129284750		2203	4300	6503	SO:0001583	missense	23129	exon24			AAAGTCCTTCTGC	AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.4302G>T	chr3.hg19:g.129284750C>A	ENSP00000317128:p.Lys1434Asn	69.0	0.0	.		117.0	15.0	.	NM_015103	A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Missense_Mutation	SNP	ENST00000324093.4	hg19	CCDS33854.1	.	.	.	.	.	.	.	.	.	.	C	16.25	3.069256	0.55539	.	.	ENSG00000004399	ENST00000324093;ENST00000393239	T;T	0.12879	2.64;2.64	4.86	2.99	0.34606	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.106561	0.64402	D	0.000006	T	0.28400	0.0702	L	0.59436	1.845	0.53005	D	0.999968	P;D	0.76494	0.643;0.999	B;D	0.71184	0.315;0.972	T	0.01448	-1.1352	10	0.87932	D	0	.	8.6019	0.33749	0.0:0.7443:0.0:0.2557	.	29;1434	B4DRU3;Q9Y4D7	.;PLXD1_HUMAN	N	1434	ENSP00000317128:K1434N;ENSP00000376931:K1434N	ENSP00000317128:K1434N	K	-	3	2	PLXND1	130767440	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	0.849000	0.27723	0.973000	0.38340	0.563000	0.77884	AAG	.	.	.	none		0.587	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356132.4	NM_015103	
RBAK	57786	hgsc.bcm.edu	37	7	5105227	5105227	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr7:5105227C>T	ENST00000353796.3	+	6	2464	c.2140C>T	c.(2140-2142)Ctc>Ttc	p.L714F	RBAK_ENST00000396912.1_Missense_Mutation_p.L714F|RBAK-RBAKDN_ENST00000396904.2_Intron|RBAK-RBAKDN_ENST00000407184.1_Intron	NM_001204456.1	NP_001191385.1	Q9NYW8	RBAK_HUMAN	RB-associated KRAB zinc finger	714	Interaction with AR.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.L714I(1)		NS(1)|kidney(1)|large_intestine(2)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	10		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)		TGTGGAAAATCTCTGAAGTCA	0.373																																					p.L714F		Atlas-SNP	.											RBAK_ENST00000396912,colon,carcinoma,0,1	RBAK	82	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2140T						PASS	.						38.0	41.0	40.0					7																	5105227		2116	4249	6365	SO:0001583	missense	57786	exon6			GAAAATCTCTGAA	AF226869	CCDS5337.1	7p22.1	2013-01-08			ENSG00000146587	ENSG00000146587		"""Zinc fingers, C2H2-type"", ""-"""	17680	protein-coding gene	gene with protein product		608191					Standard	NM_021163		Approved	ZNF769	uc003sns.1	Q9NYW8	OTTHUMG00000121155	ENST00000353796.3:c.2140C>T	chr7.hg19:g.5105227C>T	ENSP00000275423:p.Leu714Phe	89.0	0.0	.		56.0	15.0	.	NM_001204456	A6NDF2|A8KAK4|B2RN44|B9EGS1|F8W6M7	Missense_Mutation	SNP	ENST00000353796.3	hg19	CCDS5337.1	.	.	.	.	.	.	.	.	.	.	C	10.71	1.428124	0.25726	.	.	ENSG00000146587	ENST00000353796;ENST00000396912	T;T	0.07688	3.17;3.17	3.63	2.74	0.32292	.	0.328508	0.22348	N	0.061256	T	0.06188	0.0160	N	0.08118	0	0.30907	N	0.729093	P	0.51240	0.943	P	0.49799	0.622	T	0.35076	-0.9803	8	.	.	.	.	9.2279	0.37418	0.0:0.8873:0.0:0.1127	.	714	Q9NYW8	RBAK_HUMAN	F	714	ENSP00000275423:L714F;ENSP00000380120:L714F	.	L	+	1	0	RBAK	5071753	0.000000	0.05858	0.637000	0.29366	0.480000	0.33159	0.225000	0.17757	1.089000	0.41292	0.455000	0.32223	CTC	.	.	.	none		0.373	RBAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241640.2	NM_021163	
EPDR1	54749	hgsc.bcm.edu	37	7	37960767	37960767	+	Missense_Mutation	SNP	G	G	T			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr7:37960767G>T	ENST00000199448.4	+	1	605	c.226G>T	c.(226-228)Gtg>Ttg	p.V76L	EPDR1_ENST00000559325.1_Missense_Mutation_p.V196L|EPDR1_ENST00000425345.1_5'Flank|EPDR1_ENST00000476620.1_Intron|EPDR1_ENST00000423717.1_Missense_Mutation_p.V76L	NM_017549.4	NP_060019.2	Q9UM22	EPDR1_HUMAN	ependymin related 1	76					cell-matrix adhesion (GO:0007160)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	calcium ion binding (GO:0005509)			breast(1)|endometrium(1)|large_intestine(2)|lung(9)|ovary(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	22						CAACCAGCGCGTGCGGGTGCT	0.706																																					p.V76L		Atlas-SNP	.											.	EPDR1	48	.	0			c.G226T						PASS	.						15.0	16.0	16.0					7																	37960767		2107	4126	6233	SO:0001583	missense	54749	exon1			CAGCGCGTGCGGG	BC018299	CCDS5454.1, CCDS5454.2, CCDS59051.1, CCDS59052.1	7p14.1	2013-07-31	2013-07-31		ENSG00000086289	ENSG00000086289			17572	protein-coding gene	gene with protein product			"""ependymin related protein 1 (zebrafish)"""			11749721, 11248421	Standard	NM_001242946		Approved	MERP-1, MERP1, UCC1, EPDR	uc003tfp.4	Q9UM22	OTTHUMG00000102187	ENST00000199448.4:c.226G>T	chr7.hg19:g.37960767G>T	ENSP00000199448:p.Val76Leu	83.0	0.0	.		135.0	18.0	.	NM_001242946	A8K4C0|C9JYS3|Q06BL0|Q99M77	Missense_Mutation	SNP	ENST00000199448.4	hg19	CCDS5454.2	.	.	.	.	.	.	.	.	.	.	G	11.76	1.733873	0.30684	.	.	ENSG00000086289	ENST00000199448;ENST00000423717	.	.	.	4.04	1.93	0.25924	.	0.478080	0.21214	N	0.078255	T	0.40473	0.1118	L	0.42686	1.345	0.80722	D	1	B	0.16603	0.018	B	0.09377	0.004	T	0.14392	-1.0474	9	0.21014	T	0.42	-17.3655	3.9195	0.09237	0.2427:0.1958:0.5615:0.0	.	196	A4D1W8	.	L	196;170	.	ENSP00000199448:V196L	V	+	1	0	EPDR1	37927292	0.988000	0.35896	1.000000	0.80357	0.959000	0.62525	0.596000	0.24044	0.866000	0.35629	0.313000	0.20887	GTG	.	.	.	none		0.706	EPDR1-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220037.3	NM_017549	
MRC2	9902	hgsc.bcm.edu	37	17	60766323	60766323	+	Splice_Site	SNP	T	T	C			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr17:60766323T>C	ENST00000303375.5	+	23	3736		c.e23+2		MRC2_ENST00000580916.1_Splice_Site|MRC2_ENST00000446119.2_Splice_Site	NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2						collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						AGGGCACGGGTATGTGTCACC	0.642																																					.		Atlas-SNP	.											.	MRC2	126	.	0			c.3334+2T>C						PASS	.						42.0	35.0	37.0					17																	60766323		2203	4300	6503	SO:0001630	splice_region_variant	9902	exon23			CACGGGTATGTGT	AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.3334+2T>C	chr17.hg19:g.60766323T>C		54.0	0.0	.		81.0	14.0	.	NM_006039	A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Splice_Site	SNP	ENST00000303375.5	hg19	CCDS11634.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.155893	0.78114	.	.	ENSG00000011028	ENST00000303375;ENST00000446119	.	.	.	4.73	4.73	0.59995	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3771	0.66886	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	MRC2	58120055	1.000000	0.71417	0.863000	0.33907	0.565000	0.35776	5.032000	0.64140	1.978000	0.57642	0.459000	0.35465	.	.	.	.	none		0.642	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445152.1		Intron
ACSBG2	81616	hgsc.bcm.edu	37	19	6177251	6177251	+	Missense_Mutation	SNP	T	T	G			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr19:6177251T>G	ENST00000586696.1	+	8	1026	c.750T>G	c.(748-750)atT>atG	p.I250M	ACSBG2_ENST00000591403.1_Missense_Mutation_p.I250M|ACSBG2_ENST00000252669.5_Missense_Mutation_p.I250M|ACSBG2_ENST00000588485.1_Missense_Mutation_p.I63M|ACSBG2_ENST00000591741.1_3'UTR|ACSBG2_ENST00000588304.1_Missense_Mutation_p.I200M			Q5FVE4	ACBG2_HUMAN	acyl-CoA synthetase bubblegum family member 2	250					cell differentiation (GO:0030154)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid metabolic process (GO:0001676)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acyl-CoA hydrolase activity (GO:0047617)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)	p.I250M(3)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(3)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TCACGTGGATTGCAGGAGCAG	0.433																																					p.I250M		Atlas-SNP	.											ACSBG2,NS,carcinoma,0,4	ACSBG2	83	.	3	Substitution - Missense(3)	endometrium(2)|kidney(1)	c.T750G						PASS	.						97.0	69.0	78.0					19																	6177251		2203	4300	6503	SO:0001583	missense	81616	exon8			GTGGATTGCAGGA		CCDS12159.1, CCDS74269.1	19p13.3	2012-10-02			ENSG00000130377	ENSG00000130377		"""Acyl-CoA synthetase family"""	24174	protein-coding gene	gene with protein product	"""bubblegum related protein"""	614363				11230166	Standard	XM_005259653		Approved	BGR, PRTD-NY3, DKFZp434K1635	uc002meh.1	Q5FVE4	OTTHUMG00000180754	ENST00000586696.1:c.750T>G	chr19.hg19:g.6177251T>G	ENSP00000465589:p.Ile250Met	86.0	0.0	.		64.0	4.0	.	NM_030924	B3KSF2|Q6UWJ3|Q7Z5A0|Q8WW03|Q96M36|Q9BYZ3|Q9H0C4	Missense_Mutation	SNP	ENST00000586696.1	hg19	CCDS12159.1	.	.	.	.	.	.	.	.	.	.	T	8.593	0.885063	0.17540	.	.	ENSG00000130377	ENST00000252669	T	0.10477	2.87	4.48	-8.78	0.00824	AMP-dependent synthetase/ligase (1);	1.500690	0.04439	N	0.370611	T	0.03564	0.0102	N	0.03154	-0.405	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.16722	0.016;0.007	T	0.41124	-0.9526	10	0.49607	T	0.09	-6.8573	2.6506	0.04998	0.499:0.0951:0.1226:0.2833	.	250;250	B4DYU1;Q5FVE4	.;ACBG2_HUMAN	M	250	ENSP00000252669:I250M	ENSP00000252669:I250M	I	+	3	3	ACSBG2	6128251	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-3.884000	0.00342	-1.157000	0.02815	-0.778000	0.03378	ATT	.	.	.	none		0.433	ACSBG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452898.1	NM_030924	
ACSBG2	81616	hgsc.bcm.edu	37	19	6177264	6177264	+	Missense_Mutation	SNP	A	A	G			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr19:6177264A>G	ENST00000586696.1	+	8	1039	c.763A>G	c.(763-765)Aca>Gca	p.T255A	ACSBG2_ENST00000591403.1_Missense_Mutation_p.T255A|ACSBG2_ENST00000252669.5_Missense_Mutation_p.T255A|ACSBG2_ENST00000588485.1_Missense_Mutation_p.T68A|ACSBG2_ENST00000591741.1_3'UTR|ACSBG2_ENST00000588304.1_Missense_Mutation_p.T205A			Q5FVE4	ACBG2_HUMAN	acyl-CoA synthetase bubblegum family member 2	255					cell differentiation (GO:0030154)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid metabolic process (GO:0001676)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acyl-CoA hydrolase activity (GO:0047617)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)	p.T255A(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(3)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						AGGAGCAGTGACAAAGGACTT	0.423																																					p.T255A		Atlas-SNP	.											ACSBG2,NS,carcinoma,0,1	ACSBG2	83	.	1	Substitution - Missense(1)	endometrium(1)	c.A763G						PASS	.						100.0	71.0	81.0					19																	6177264		2203	4300	6503	SO:0001583	missense	81616	exon8			GCAGTGACAAAGG		CCDS12159.1, CCDS74269.1	19p13.3	2012-10-02			ENSG00000130377	ENSG00000130377		"""Acyl-CoA synthetase family"""	24174	protein-coding gene	gene with protein product	"""bubblegum related protein"""	614363				11230166	Standard	XM_005259653		Approved	BGR, PRTD-NY3, DKFZp434K1635	uc002meh.1	Q5FVE4	OTTHUMG00000180754	ENST00000586696.1:c.763A>G	chr19.hg19:g.6177264A>G	ENSP00000465589:p.Thr255Ala	84.0	0.0	.		67.0	3.0	.	NM_030924	B3KSF2|Q6UWJ3|Q7Z5A0|Q8WW03|Q96M36|Q9BYZ3|Q9H0C4	Missense_Mutation	SNP	ENST00000586696.1	hg19	CCDS12159.1	.	.	.	.	.	.	.	.	.	.	A	0.181	-1.062649	0.01950	.	.	ENSG00000130377	ENST00000252669	T	0.39997	1.05	4.48	-5.64	0.02466	AMP-dependent synthetase/ligase (1);	1.364350	0.05348	N	0.531310	T	0.10937	0.0267	N	0.01640	-0.785	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.25328	-1.0135	10	0.05351	T	0.99	-3.1473	3.0878	0.06284	0.1441:0.0988:0.3567:0.4004	.	255;255	B4DYU1;Q5FVE4	.;ACBG2_HUMAN	A	255	ENSP00000252669:T255A	ENSP00000252669:T255A	T	+	1	0	ACSBG2	6128264	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	0.149000	0.16243	-0.740000	0.04803	-0.902000	0.02854	ACA	.	.	.	none		0.423	ACSBG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452898.1	NM_030924	
UBA52	7311	hgsc.bcm.edu	37	19	18685757	18685757	+	Missense_Mutation	SNP	A	A	T			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr19:18685757A>T	ENST00000442744.2	+	4	326	c.268A>T	c.(268-270)Aac>Tac	p.N90Y	UBA52_ENST00000598780.1_Missense_Mutation_p.N90Y|UBA52_ENST00000595683.1_Missense_Mutation_p.N90Y|UBA52_ENST00000599595.1_Missense_Mutation_p.N90Y|UBA52_ENST00000596304.1_Missense_Mutation_p.N90Y|UBA52_ENST00000430157.2_Missense_Mutation_p.N90Y|CRLF1_ENST00000594325.1_Intron|UBA52_ENST00000595158.1_Missense_Mutation_p.N90Y|UBA52_ENST00000596273.1_Missense_Mutation_p.N90Y|UBA52_ENST00000599551.1_Missense_Mutation_p.N90Y|UBA52_ENST00000597451.1_Missense_Mutation_p.N90Y	NM_001033930.1	NP_001029102.1	P62987	RL40_HUMAN	ubiquitin A-52 residue ribosomal protein fusion product 1	90					activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|viral transcription (GO:0019083)|virion assembly (GO:0019068)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|ribosome (GO:0005840)	structural constituent of ribosome (GO:0003735)			endometrium(1)|large_intestine(2)	3						CCAGAAATACAACTGCGACAA	0.612																																					p.N90Y		Atlas-SNP	.											.	UBA52	6	.	0			c.A268T						PASS	.						46.0	42.0	43.0					19																	18685757		2203	4300	6503	SO:0001583	missense	7311	exon4			AAATACAACTGCG		CCDS12382.1	19p13.1-p12	2011-04-06			ENSG00000221983	ENSG00000221983		"""L ribosomal proteins"""	12458	protein-coding gene	gene with protein product	"""ribosomal protein L40"", ""ubiquitin-52 amino acid fusion protein"", ""ubiquitin carboxyl extension protein 52"", ""60S ribosomal protein L40"", ""ubiquitin-CEP52"""	191321				8188300	Standard	XM_005260051		Approved	RPL40, CEP52, HUBCEP52, MGC57125, MGC126879, MGC126881, L40	uc002njs.3	P62987		ENST00000442744.2:c.268A>T	chr19.hg19:g.18685757A>T	ENSP00000388107:p.Asn90Tyr	77.0	0.0	.		128.0	13.0	.	NM_001033930	P02248|P02249|P02250|P14793|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Missense_Mutation	SNP	ENST00000442744.2	hg19	CCDS12382.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.273436	0.80580	.	.	ENSG00000221983	ENST00000442744;ENST00000430157	T;T	0.45668	0.89;0.89	4.52	4.52	0.55395	.	0.000000	0.85682	D	0.000000	T	0.67822	0.2934	M	0.93197	3.39	0.58432	D	0.99999	D	0.59767	0.986	P	0.59424	0.857	T	0.76822	-0.2817	10	0.87932	D	0	-2.438	11.7658	0.51930	1.0:0.0:0.0:0.0	.	90	P62987	RL40_HUMAN	Y	90	ENSP00000388107:N90Y;ENSP00000396910:N90Y	ENSP00000396910:N90Y	N	+	1	0	UBA52	18546757	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.564000	0.60830	1.667000	0.50832	0.379000	0.24179	AAC	.	.	.	none		0.612	UBA52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465117.2	NM_003333	
ZNF99	7652	hgsc.bcm.edu	37	19	22940373	22940373	+	Missense_Mutation	SNP	T	T	C			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr19:22940373T>C	ENST00000596209.1	-	4	2428	c.2338A>G	c.(2338-2340)Aag>Gag	p.K780E	CTC-451A6.4_ENST00000442497.2_lincRNA|ZNF99_ENST00000397104.3_Missense_Mutation_p.K689E	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	780					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K689E(3)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				TGAATTATCTTATGTTTTCTA	0.343																																					p.K780E		Atlas-SNP	.											ZNF99,NS,carcinoma,0,4	ZNF99	273	.	3	Substitution - Missense(3)	prostate(1)|lung(1)|kidney(1)	c.A2338G						PASS	.						32.0	34.0	34.0					19																	22940373		1947	4138	6085	SO:0001583	missense	7652	exon4			TTATCTTATGTTT	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.2338A>G	chr19.hg19:g.22940373T>C	ENSP00000472969:p.Lys780Glu	90.0	0.0	.		97.0	4.0	.	NM_001080409	M0R335	Missense_Mutation	SNP	ENST00000596209.1	hg19	CCDS59369.1	.	.	.	.	.	.	.	.	.	.	t	9.727	1.161345	0.21538	.	.	ENSG00000213973	ENST00000397104	T	0.18016	2.24	1.26	-2.52	0.06346	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.20495	0.0493	L	0.28400	0.85	0.09310	N	1	D	0.65815	0.995	D	0.65233	0.933	T	0.12837	-1.0532	9	0.54805	T	0.06	.	4.187	0.10402	0.1821:0.0:0.5141:0.3038	.	689	A8MXY4	ZNF99_HUMAN	E	689	ENSP00000380293:K689E	ENSP00000380293:K689E	K	-	1	0	ZNF99	22732213	0.000000	0.05858	0.002000	0.10522	0.007000	0.05969	-0.737000	0.04877	-0.939000	0.03709	0.313000	0.20887	AAG	.	.	.	none		0.343	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124	
SAV1	60485	hgsc.bcm.edu	37	14	51132122	51132129	+	Frame_Shift_Del	DEL	CTAGACTT	CTAGACTT	-			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	CTAGACTT	CTAGACTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr14:51132122_51132129delCTAGACTT	ENST00000324679.4	-	2	666_673	c.303_310delAAGTCTAG	c.(301-312)agaagtctagcafs	p.RSLA101fs	RP11-248J18.2_ENST00000602954.1_RNA	NM_021818.3	NP_068590.1	Q9H4B6	SAV1_HUMAN	salvador family WW domain containing protein 1	101					hair follicle development (GO:0001942)|hippo signaling (GO:0035329)|intestinal epithelial cell differentiation (GO:0060575)|keratinocyte differentiation (GO:0030216)|lung epithelial cell differentiation (GO:0060487)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of epithelial cell proliferation (GO:0050680)|positive regulation of apoptotic process (GO:0043065)|regulation of stem cell maintenance (GO:2000036)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)				breast(1)|kidney(2)|lung(2)|prostate(1)	6	all_epithelial(31;0.000611)|Breast(41;0.0333)					GGGACATCTGCTAGACTTCTGGCAAGAT	0.385																																					p.102_104del		Atlas-INDEL	.											.	SAV1	18	.	0			c.304_311del						PASS	.																																			SO:0001589	frameshift_variant	60485	exon2			.	AK023071	CCDS9701.1	14q13-q23	2014-04-14	2014-04-14		ENSG00000151748	ENSG00000151748			17795	protein-coding gene	gene with protein product	"""WW domain-containing adaptor 45"""	607203	"""salvador homolog 1 (Drosophila)"""			12202036, 11027580	Standard	NM_021818		Approved	WW45, WWP4, salvador	uc001wyh.2	Q9H4B6	OTTHUMG00000140293	ENST00000324679.4:c.303_310delAAGTCTAG	chr14.hg19:g.51132122_51132129delCTAGACTT	ENSP00000324729:p.Arg101fs	59.0	0.0	0		50.0	13.0	0.26	NM_021818	A8K4B8|D3DSB6|Q6IA58|Q9H949|Q9HAK9	Frame_Shift_Del	DEL	ENST00000324679.4	hg19	CCDS9701.1																																																																																			.	.	.	none		0.385	SAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276879.1		
