#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ATP1A1	476	hgsc.bcm.edu	37	1	116941400	116941400	+	Missense_Mutation	SNP	G	G	C	rs11540954		TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr1:116941400G>C	ENST00000295598.5	+	16	2534	c.2282G>C	c.(2281-2283)gGa>gCa	p.G761A	ATP1A1_ENST00000369496.4_Missense_Mutation_p.G730A|ATP1A1_ENST00000537345.1_Missense_Mutation_p.G761A	NM_000701.7	NP_000692.2	P05023	AT1A1_HUMAN	ATPase, Na+/K+ transporting, alpha 1 polypeptide	761					ATP biosynthetic process (GO:0006754)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|membrane hyperpolarization (GO:0060081)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of glucocorticoid biosynthetic process (GO:0031947)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart contraction (GO:0045823)|positive regulation of striated muscle contraction (GO:0045989)|potassium ion import (GO:0010107)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of sodium ion transport (GO:0002028)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|chaperone binding (GO:0051087)|phosphatase activity (GO:0016791)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(2)|breast(2)|cervix(3)|endometrium(2)|kidney(5)|large_intestine(9)|lung(17)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Ciclopirox(DB01188)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Ethacrynic acid(DB00903)|Hydroflumethiazide(DB00774)|Ouabain(DB01092)|Trichlormethiazide(DB01021)	ATTGTGACTGGAGTAGAGGAA	0.438																																					p.G761A		Atlas-SNP	.											.	ATP1A1	87	.	0			c.G2282C						PASS	.						138.0	136.0	136.0					1																	116941400		2203	4300	6503	SO:0001583	missense	476	exon16			TGACTGGAGTAGA	D00099	CCDS887.1, CCDS53351.1, CCDS53352.1	1p13	2012-10-22			ENSG00000163399	ENSG00000163399	3.6.3.9	"""ATPases / P-type"""	799	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-1"", ""sodium pump subunit alpha-1"", ""sodium-potassium ATPase catalytic subunit alpha-1"""	182310					Standard	NM_000701		Approved		uc001ege.3	P05023	OTTHUMG00000012109	ENST00000295598.5:c.2282G>C	chr1.hg19:g.116941400G>C	ENSP00000295598:p.Gly761Ala	180.0	0.0	.		178.0	56.0	.	NM_000701	B2RBR6|B7Z2T5|B7Z3U6|F5H3A1|Q16689|Q6LDM4|Q9UCN1|Q9UJ20|Q9UJ21	Missense_Mutation	SNP	ENST00000295598.5	hg19	CCDS887.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.988230	0.93106	.	.	ENSG00000163399	ENST00000295598;ENST00000537345;ENST00000369496	D;D;D	0.91577	-2.87;-2.87;-2.86	5.23	5.23	0.72850	HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.88937	0.6573	N	0.11106	0.095	0.80722	D	1	D;D	0.65815	0.995;0.992	D;D	0.70227	0.968;0.929	D	0.91640	0.5326	10	0.66056	D	0.02	.	19.0012	0.92834	0.0:0.0:1.0:0.0	rs11540954	761;761	F5H3A1;P05023	.;AT1A1_HUMAN	A	761;761;730	ENSP00000295598:G761A;ENSP00000445306:G761A;ENSP00000358508:G730A	ENSP00000295598:G761A	G	+	2	0	ATP1A1	116742923	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.657000	0.98554	2.718000	0.92993	0.655000	0.94253	GGA	.	.	.	weak		0.438	ATP1A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000033481.5	NM_001160233	
ATP1B1	481	hgsc.bcm.edu	37	1	169096584	169096584	+	Missense_Mutation	SNP	T	T	C			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr1:169096584T>C	ENST00000367816.1	+	5	1034	c.505T>C	c.(505-507)Tac>Cac	p.Y169H	ATP1B1_ENST00000367815.4_Missense_Mutation_p.Y169H|ATP1B1_ENST00000367813.3_Missense_Mutation_p.Y161H|ATP1B1_ENST00000499679.3_Missense_Mutation_p.Y113H			P05026	AT1B1_HUMAN	ATPase, Na+/K+ transporting, beta 1 polypeptide	169					blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular potassium ion homeostasis (GO:0030007)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|leukocyte migration (GO:0050900)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|positive regulation of ATP catabolic process (GO:1903291)|positive regulation of ATPase activity (GO:0032781)|positive regulation of calcium:sodium antiporter activity (GO:1903281)|positive regulation of potassium ion import (GO:1903288)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of sodium ion export from cell (GO:1903278)|potassium ion import (GO:0010107)|protein localization to plasma membrane (GO:0072659)|protein stabilization (GO:0050821)|protein transport into plasma membrane raft (GO:0044861)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression (GO:0010468)|relaxation of cardiac muscle (GO:0055119)|response to hypoxia (GO:0001666)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|vesicle (GO:0031982)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|MHC class II protein complex binding (GO:0023026)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	14	all_hematologic(923;0.208)					AACTTATGGCTACAAAGAGGG	0.388																																					p.Y169H		Atlas-SNP	.											.	ATP1B1	29	.	0			c.T505C						PASS	.						104.0	101.0	102.0					1																	169096584		2203	4300	6503	SO:0001583	missense	481	exon4			TATGGCTACAAAG	U16799	CCDS1276.1	1q24.2	2012-10-22			ENSG00000143153	ENSG00000143153		"""ATPases / P-type"""	804	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit beta-1"", ""sodium pump subunit beta-1"", ""sodium-potassium ATPase subunit beta 1 (non-catalytic)"""	182330		ATP1B			Standard	NM_001677		Approved		uc001gfr.1	P05026	OTTHUMG00000034590	ENST00000367816.1:c.505T>C	chr1.hg19:g.169096584T>C	ENSP00000356790:p.Tyr169His	167.0	0.0	.		188.0	58.0	.	NM_001677	Q5TGZ3	Missense_Mutation	SNP	ENST00000367816.1	hg19	CCDS1276.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.574319	0.86542	.	.	ENSG00000143153	ENST00000367816;ENST00000367815;ENST00000499679;ENST00000367813	T;T;T;T	0.48201	0.82;0.82;0.82;0.82	6.02	6.02	0.97574	.	0.049448	0.85682	D	0.000000	T	0.72087	0.3417	M	0.92738	3.34	0.42584	D	0.993227	D	0.76494	0.999	D	0.76071	0.987	T	0.80130	-0.1511	9	0.87932	D	0	-19.3541	16.5446	0.84426	0.0:0.0:0.0:1.0	.	169	P05026	AT1B1_HUMAN	H	169;169;113;161	ENSP00000356790:Y169H;ENSP00000356789:Y169H;ENSP00000423450:Y113H;ENSP00000356787:Y161H	ENSP00000356787:Y161H	Y	+	1	0	ATP1B1	167363208	1.000000	0.71417	1.000000	0.80357	0.643000	0.38383	7.388000	0.79795	2.311000	0.77944	0.533000	0.62120	TAC	.	.	.	none		0.388	ATP1B1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083696.1		
GOLT1A	127845	hgsc.bcm.edu	37	1	204183026	204183026	+	Silent	SNP	G	G	T			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr1:204183026G>T	ENST00000308302.3	-	1	194	c.9C>A	c.(7-9)tcC>tcA	p.S3S		NM_198447.1	NP_940849.1			golgi transport 1A											kidney(1)|lung(2)|urinary_tract(1)	4	all_cancers(21;0.0165)|Breast(84;0.179)|all_epithelial(62;0.242)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.244)			ATTCGGTGATGGAGATCATGC	0.642																																					p.S3S		Atlas-SNP	.											.	GOLT1A	15	.	0			c.C9A						PASS	.						68.0	53.0	58.0					1																	204183026		2203	4300	6503	SO:0001819	synonymous_variant	127845	exon1			GGTGATGGAGATC	BC058832	CCDS1443.1	1q32.1	2010-06-24	2010-06-24		ENSG00000174567	ENSG00000174567			24766	protein-coding gene	gene with protein product			"""golgi transport 1 homolog A (S. cerevisiae)"""			12477932	Standard	NM_198447		Approved	FLJ42654, CGI-141, YMR292W, GOT1, MGC62027	uc001has.1	Q6ZVE7	OTTHUMG00000036056	ENST00000308302.3:c.9C>A	chr1.hg19:g.204183026G>T		42.0	0.0	.		50.0	11.0	.	NM_198447		Silent	SNP	ENST00000308302.3	hg19	CCDS1443.1																																																																																			.	.	.	none		0.642	GOLT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087887.1	NM_198447	
GRHL1	29841	hgsc.bcm.edu	37	2	10101557	10101557	+	Missense_Mutation	SNP	G	G	A	rs140278187		TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr2:10101557G>A	ENST00000324907.9	+	4	797	c.661G>A	c.(661-663)Gtt>Att	p.V221I	GRHL1_ENST00000405379.2_Missense_Mutation_p.V221I|GRHL1_ENST00000324883.5_Silent_p.A57A	NM_198182.2	NP_937825.2	Q9NZI5	GRHL1_HUMAN	grainyhead-like 1 (Drosophila)	221					cellular lipid metabolic process (GO:0044255)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	17	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.246)		CAAGGAAGGCGTTCAGGAGGT	0.463													G|||	1	0.000199681	0.0	0.0	5008	,	,		19940	0.0		0.001	False		,,,				2504	0.0				p.V221I		Atlas-SNP	.											.	GRHL1	95	.	0			c.G661A						PASS	.	G	ILE/VAL	0,4406		0,0,2203	77.0	76.0	76.0		661	4.6	1.0	2	dbSNP_134	76	6,8594	5.0+/-18.6	0,6,4294	yes	missense	GRHL1	NM_198182.2	29	0,6,6497	AA,AG,GG		0.0698,0.0,0.0461	benign	221/619	10101557	6,13000	2203	4300	6503	SO:0001583	missense	29841	exon4			GAAGGCGTTCAGG	AF198489	CCDS33144.1, CCDS33144.2	2p25.2	2008-02-05	2005-07-11	2005-07-11	ENSG00000134317	ENSG00000134317			17923	protein-coding gene	gene with protein product		609786	"""transcription factor CP2-like 2"""	TFCP2L2		10644752, 12393799	Standard	NM_198182		Approved	LBP-32, MGR	uc002raa.3	Q9NZI5	OTTHUMG00000151704	ENST00000324907.9:c.661G>A	chr2.hg19:g.10101557G>A	ENSP00000324693:p.Val221Ile	154.0	0.0	.		170.0	54.0	.	NM_198182	A6NLA4|B2R7E4|B5MEC2|Q53T93|Q6NWN7|Q6NWN8|Q6NWN9|Q8NI33	Missense_Mutation	SNP	ENST00000324907.9	hg19	CCDS33144.2	.	.	.	.	.	.	.	.	.	.	G	13.48	2.248540	0.39797	0.0	6.98E-4	ENSG00000134317	ENST00000405379;ENST00000324907	T;T	0.11604	2.76;2.76	5.5	4.63	0.57726	.	0.205183	0.45361	D	0.000378	T	0.07369	0.0186	N	0.08118	0	0.80722	D	1	P	0.39520	0.676	B	0.41666	0.363	T	0.47394	-0.9121	10	0.23302	T	0.38	.	14.5094	0.67774	0.0707:0.0:0.9293:0.0	.	221	Q9NZI5	GRHL1_HUMAN	I	221	ENSP00000384209:V221I;ENSP00000324693:V221I	ENSP00000324693:V221I	V	+	1	0	GRHL1	10019008	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.852000	0.55934	1.337000	0.45525	-0.244000	0.11960	GTT	.	G|1.000;A|0.000	0.000	weak		0.463	GRHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323543.2	NM_014552	
SCTR	6344	hgsc.bcm.edu	37	2	120194829	120194829	+	IGR	SNP	T	T	C			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr2:120194829T>C	ENST00000019103.5	-	0	1865				TMEM37_ENST00000409826.1_Missense_Mutation_p.I141T|TMEM37_ENST00000465296.1_3'UTR|TMEM37_ENST00000306406.4_Missense_Mutation_p.I129T	NM_002980.2	NP_002971.2	P47872	SCTR_HUMAN	secretin receptor						digestion (GO:0007586)|excretion (GO:0007588)|G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasmic microtubule (GO:0005881)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	secretin receptor activity (GO:0015055)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)	19					Secretin(DB00021)	ATGGGTTCCATCCTCCTCCTG	0.567																																					p.I129T		Atlas-SNP	.											.	TMEM37	40	.	0			c.T386C						PASS	.						178.0	170.0	172.0					2																	120194829		2203	4300	6503	SO:0001628	intergenic_variant	140738	exon2			GTTCCATCCTCCT		CCDS2127.1	2q14.1	2012-08-10			ENSG00000080293	ENSG00000080293		"""GPCR / Class B : Glucagon receptors"""	10608	protein-coding gene	gene with protein product		182098				1646711	Standard	NM_002980		Approved		uc002tma.3	P47872	OTTHUMG00000131407		chr2.hg19:g.120194829T>C		464.0	0.0	.		471.0	126.0	.	NM_183240	Q12961|Q13213|Q53T00	Missense_Mutation	SNP	ENST00000019103.5	hg19	CCDS2127.1	.	.	.	.	.	.	.	.	.	.	T	0.231	-1.020958	0.02061	.	.	ENSG00000171227	ENST00000409826;ENST00000306406	.	.	.	4.97	-0.356	0.12583	.	1.570890	0.03832	N	0.269166	T	0.20129	0.0484	N	0.16478	0.41	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.11542	-1.0583	9	0.28530	T	0.3	-15.3671	1.4103	0.02290	0.1454:0.1645:0.1419:0.5481	.	129	Q8WXS4	CCGL_HUMAN	T	141;129	.	ENSP00000303148:I129T	I	+	2	0	TMEM37	119911299	0.156000	0.22821	0.071000	0.20095	0.017000	0.09413	0.523000	0.22925	-0.194000	0.10399	0.533000	0.62120	ATC	.	.	.	none		0.567	SCTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254198.2		
KCNH7	90134	hgsc.bcm.edu	37	2	163241347	163241347	+	Missense_Mutation	SNP	A	A	G			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr2:163241347A>G	ENST00000332142.5	-	13	2912	c.2813T>C	c.(2812-2814)aTc>aCc	p.I938T		NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	938					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	AATGGAGGAGATGAAAGATGA	0.408																																					p.I938T	GBM(196;1492 2208 17507 24132 45496)	Atlas-SNP	.											.	KCNH7	378	.	0			c.T2813C						PASS	.						242.0	233.0	236.0					2																	163241347		2203	4300	6503	SO:0001583	missense	90134	exon13			GAGGAGATGAAAG	AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.2813T>C	chr2.hg19:g.163241347A>G	ENSP00000331727:p.Ile938Thr	459.0	1.0	.		437.0	141.0	.	NM_033272	Q53QU4|Q53TB7|Q53TP9|Q8IV15	Missense_Mutation	SNP	ENST00000332142.5	hg19	CCDS2219.1	.	.	.	.	.	.	.	.	.	.	A	8.070	0.770061	0.15983	.	.	ENSG00000184611	ENST00000332142	D	0.98474	-4.95	5.6	4.45	0.53987	.	0.526834	0.21408	N	0.075025	D	0.92446	0.7602	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	D	0.88732	0.3237	10	0.10636	T	0.68	.	9.6489	0.39886	0.9219:0.0:0.0781:0.0	.	938	Q9NS40	KCNH7_HUMAN	T	938	ENSP00000331727:I938T	ENSP00000331727:I938T	I	-	2	0	KCNH7	162949593	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.587000	0.53957	2.141000	0.66446	0.533000	0.62120	ATC	.	.	.	none		0.408	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255093.1	NM_033272	
ITGB5	3693	hgsc.bcm.edu	37	3	124515613	124515614	+	Nonsense_Mutation	DNP	CC	CC	AT			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr3:124515613_124515614CC>AT	ENST00000296181.4	-	10	1610_1611	c.1314_1315GG>AT	c.(1312-1317)acGGag>acATag	p.E439*		NM_002213.3	NP_002204.2	P18084	ITB5_HUMAN	integrin, beta 5	439					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|epithelial cell-cell adhesion (GO:0090136)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|stress fiber assembly (GO:0043149)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alphav-beta5 complex (GO:0034684)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	30				GBM - Glioblastoma multiforme(114;0.163)		AACACATGCTCCGTGTGTCTGC	0.609																																					p.E439X|p.T438T		Atlas-SNP	.											.	ITGB5	66	.	0			c.G1315T|c.G1314A						PASS	.																																			SO:0001587	stop_gained	3693	exon10			CATGCTCCGTGTG|ATGCTCCGTGTGT	J05633	CCDS3030.1	3q21.2	2010-03-23			ENSG00000082781	ENSG00000082781		"""Integrins"""	6160	protein-coding gene	gene with protein product		147561				2211615	Standard	NM_002213		Approved		uc003eho.3	P18084	OTTHUMG00000159432	ENST00000296181.4:c.1314_1315delinsAT	chr3.hg19:g.124515613_124515614delinsAT	ENSP00000296181:p.Glu439*	73.0	0.0	.		89.0|91.0	22.0|24.0	.	NM_002213	B0LPF8|B2RD70	Nonsense_Mutation|Silent	SNP	ENST00000296181.4	hg19	CCDS3030.1																																																																																			.	.	.	none		0.609	ITGB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355286.3	NM_002213	
PCYT1A	5130	hgsc.bcm.edu	37	3	195974373	195974373	+	Silent	SNP	G	G	A			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr3:195974373G>A	ENST00000292823.2	-	6	523	c.351C>T	c.(349-351)ctC>ctT	p.L117L	PCYT1A_ENST00000431016.1_Silent_p.L117L|PCYT1A_ENST00000491544.1_5'UTR|PCYT1A_ENST00000419333.1_Silent_p.L117L	NM_005017.2	NP_005008.2	P49585	PCY1A_HUMAN	phosphate cytidylyltransferase 1, choline, alpha	117					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|glycogen granule (GO:0042587)	choline-phosphate cytidylyltransferase activity (GO:0004105)|lipid binding (GO:0008289)			cervix(1)|endometrium(3)|large_intestine(8)|lung(5)|ovary(1)	18	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.28e-24)|all cancers(36;1.01e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00259)	Choline(DB00122)|Lamivudine(DB00709)	AGTTGTGTGTGAGCTCATCAC	0.527																																					p.L117L		Atlas-SNP	.											.	PCYT1A	34	.	0			c.C351T						PASS	.						171.0	138.0	149.0					3																	195974373		2203	4300	6503	SO:0001819	synonymous_variant	5130	exon6			GTGTGTGAGCTCA	L28957	CCDS3315.1	3q29	2010-07-19	2005-09-05		ENSG00000161217	ENSG00000161217	2.7.7.15		8754	protein-coding gene	gene with protein product	"""phosphate cytidylyltransferase 1, choline, alpha isoform"""	123695	"""phosphate cytidylyltransferase 1, choline, alpha isoform"""	PCYT1		7918629	Standard	NM_005017		Approved	CT, CTPCT	uc003fwg.3	P49585	OTTHUMG00000155670	ENST00000292823.2:c.351C>T	chr3.hg19:g.195974373G>A		170.0	0.0	.		245.0	63.0	.	NM_005017	A9LYK9|D3DXB1|Q86Y88	Silent	SNP	ENST00000292823.2	hg19	CCDS3315.1																																																																																			.	.	.	none		0.527	PCYT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341147.1	NM_005017	
NRROS	375387	hgsc.bcm.edu	37	3	196387840	196387840	+	Silent	SNP	C	C	T			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr3:196387840C>T	ENST00000328557.4	+	3	1529	c.1326C>T	c.(1324-1326)ccC>ccT	p.P442P		NM_198565.1	NP_940967.1	Q86YC3	NRROS_HUMAN	negative regulator of reactive oxygen species	442					immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|superoxide metabolic process (GO:0006801)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											CACTTTGTCCCCTGCCAGCTG	0.592																																					p.P442P		Atlas-SNP	.											.	LRRC33	91	.	0			c.C1326T						PASS	.						144.0	148.0	147.0					3																	196387840		2203	4300	6503	SO:0001819	synonymous_variant	375387	exon3			TTGTCCCCTGCCA	AY358322	CCDS3319.1	3q29	2013-07-02	2013-07-02	2013-07-02	ENSG00000174004	ENSG00000174004			24613	protein-coding gene	gene with protein product		615322	"""leucine rich repeat containing 33"""	LRRC33		12975309	Standard	NM_198565		Approved	UNQ3030, ELLP3030, MGC50789, GARPL1	uc003fwv.3	Q86YC3	OTTHUMG00000155569	ENST00000328557.4:c.1326C>T	chr3.hg19:g.196387840C>T		439.0	1.0	.		489.0	202.0	.	NM_198565		Silent	SNP	ENST00000328557.4	hg19	CCDS3319.1																																																																																			.	.	.	none		0.592	NRROS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340676.1	NM_198565	
CLOCK	9575	hgsc.bcm.edu	37	4	56301654	56301654	+	Silent	SNP	A	A	T			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr4:56301654A>T	ENST00000309964.4	-	22	2719	c.2469T>A	c.(2467-2469)tcT>tcA	p.S823S	CLOCK_ENST00000513440.1_Silent_p.S823S|CLOCK_ENST00000381322.1_Silent_p.S823S	NM_004898.3	NP_004889.1	O15516	CLOCK_HUMAN	clock circadian regulator	823	Interaction with NR3C1. {ECO:0000250|UniProtKB:O08785}.|Poly-Gln.				cellular response to ionizing radiation (GO:0071479)|chromatin organization (GO:0006325)|circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|DNA damage checkpoint (GO:0000077)|histone acetylation (GO:0016573)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of transcription, DNA-templated (GO:0045892)|photoperiodism (GO:0009648)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of hair cycle (GO:0042634)|regulation of insulin secretion (GO:0050796)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of type B pancreatic cell development (GO:2000074)|response to redox state (GO:0051775)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|chromosome (GO:0005694)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|histone acetyltransferase activity (GO:0004402)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(8)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)			GCTGTTGCTGAGACTGATGTT	0.527																																					p.S823S		Atlas-SNP	.											.	CLOCK	81	.	0			c.T2469A						PASS	.						273.0	230.0	244.0					4																	56301654		2203	4300	6503	SO:0001819	synonymous_variant	9575	exon23			TTGCTGAGACTGA	AF011568	CCDS3500.1	4q12	2012-12-07	2012-12-07		ENSG00000134852	ENSG00000134852		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	2082	protein-coding gene	gene with protein product		601851	"""clock (mouse) homolog"", ""clock homolog (mouse)"""			10198158	Standard	NM_001267843		Approved	KIAA0334, KAT13D, bHLHe8	uc003hba.2	O15516	OTTHUMG00000102141	ENST00000309964.4:c.2469T>A	chr4.hg19:g.56301654A>T		205.0	0.0	.		195.0	62.0	.	NM_004898	A0AV01|A2I2N9|O14516|Q9UIT8	Silent	SNP	ENST00000309964.4	hg19	CCDS3500.1																																																																																			.	.	.	none		0.527	CLOCK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361993.2	NM_004898	
UGT2B7	7364	hgsc.bcm.edu	37	4	69978199	69978199	+	Silent	SNP	A	A	G			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr4:69978199A>G	ENST00000305231.7	+	6	1381	c.1335A>G	c.(1333-1335)ttA>ttG	p.L445L	UGT2B7_ENST00000508661.1_3'UTR|UGT2B7_ENST00000509763.1_3'UTR	NM_001074.2	NP_001065.2	P16662	UD2B7_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B7	445					androgen metabolic process (GO:0008209)|cellular glucuronidation (GO:0052695)|lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyltransferase activity (GO:0015020)			autonomic_ganglia(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38					Atorvastatin(DB01076)|Carbamazepine(DB00564)|Chenodeoxycholic acid(DB06777)|Codeine(DB00318)|Dabigatran etexilate(DB06695)|Dapagliflozin(DB06292)|Diclofenac(DB00586)|Epirubicin(DB00445)|Etodolac(DB00749)|Ezetimibe(DB00973)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Losartan(DB00678)|Lovastatin(DB00227)|Mitiglinide(DB01252)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Naproxen(DB00788)|Oxazepam(DB00842)|Pitavastatin(DB08860)|Silodosin(DB06207)|Simvastatin(DB00641)|Suprofen(DB00870)|Tapentadol(DB06204)|Valproic Acid(DB00313)|Zidovudine(DB00495)	TTATGAAATTATCAAGAATTC	0.393																																					p.L445L		Atlas-SNP	.											.	UGT2B7	79	.	0			c.A1335G						PASS	.						66.0	70.0	69.0					4																	69978199		2203	4300	6503	SO:0001819	synonymous_variant	7364	exon6			GAAATTATCAAGA	BC030974	CCDS3526.1	4q13	2008-02-05	2005-07-20		ENSG00000171234	ENSG00000171234		"""UDP glucuronosyltransferases"""	12554	protein-coding gene	gene with protein product		600068	"""UDP glycosyltransferase 2 family, polypeptide B7"""			2159463, 7835904	Standard	NM_001074		Approved	UGT2B9	uc003heg.4	P16662	OTTHUMG00000129404	ENST00000305231.7:c.1335A>G	chr4.hg19:g.69978199A>G		203.0	0.0	.		252.0	66.0	.	NM_001074	B2R810|Q6GTW0	Silent	SNP	ENST00000305231.7	hg19	CCDS3526.1																																																																																			.	.	.	none		0.393	UGT2B7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251560.1	NM_001074	
ARHGAP24	83478	hgsc.bcm.edu	37	4	86921691	86921691	+	Missense_Mutation	SNP	A	A	G			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr4:86921691A>G	ENST00000395184.1	+	10	2529	c.2063A>G	c.(2062-2064)gAt>gGt	p.D688G	RP13-514E23.2_ENST00000610225.1_RNA|ARHGAP24_ENST00000395183.2_Missense_Mutation_p.D593G|ARHGAP24_ENST00000264343.4_Missense_Mutation_p.D595G	NM_001025616.2	NP_001020787.2	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24	688					activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of ruffle assembly (GO:1900028)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|wound healing, spreading of epidermal cells (GO:0035313)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)	Rac GTPase activator activity (GO:0030675)			breast(3)|cervix(1)|endometrium(3)|large_intestine(4)|lung(10)|skin(1)|stomach(1)|urinary_tract(1)	24		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)		GATGAACTGGATCAGGAGAGG	0.448																																					p.D688G		Atlas-SNP	.											.	ARHGAP24	116	.	0			c.A2063G						PASS	.						71.0	73.0	72.0					4																	86921691		2203	4300	6503	SO:0001583	missense	83478	exon10			AACTGGATCAGGA	AK091196	CCDS3611.1, CCDS34025.1, CCDS43246.1	4q22.1	2013-01-10			ENSG00000138639	ENSG00000138639		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	25361	protein-coding gene	gene with protein product		610586				11230166, 15254788	Standard	NM_001042669		Approved	DKFZP564B1162, FLJ33877, FilGAP	uc003hpk.3	Q8N264	OTTHUMG00000130427	ENST00000395184.1:c.2063A>G	chr4.hg19:g.86921691A>G	ENSP00000378611:p.Asp688Gly	151.0	0.0	.		129.0	53.0	.	NM_001025616	Q4KMG1|Q6ZNV3|Q86TI5|Q86WE4|Q9H0T6	Missense_Mutation	SNP	ENST00000395184.1	hg19	CCDS34025.1	.	.	.	.	.	.	.	.	.	.	A	27.8	4.865537	0.91511	.	.	ENSG00000138639	ENST00000395184;ENST00000395183;ENST00000514229;ENST00000264343	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.57095	0.2030	L	0.54323	1.7	0.80722	D	1	D;D;P	0.69078	0.959;0.997;0.877	P;P;B	0.60117	0.637;0.869;0.339	T	0.60439	-0.7263	10	0.87932	D	0	.	16.002	0.80301	1.0:0.0:0.0:0.0	.	593;595;688	Q8N264-3;Q8N264-2;Q8N264	.;.;RHG24_HUMAN	G	688;593;603;595	ENSP00000378611:D688G;ENSP00000378610:D593G;ENSP00000425589:D603G;ENSP00000264343:D595G	ENSP00000264343:D595G	D	+	2	0	ARHGAP24	87140715	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.248000	0.95456	2.241000	0.73720	0.533000	0.62120	GAT	.	.	.	none		0.448	ARHGAP24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252815.2	NM_031305	
SEMA5A	9037	hgsc.bcm.edu	37	5	9226981	9226981	+	Splice_Site	SNP	C	C	T	rs141767878		TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr5:9226981C>T	ENST00000382496.5	-	7	1097	c.432G>A	c.(430-432)tcG>tcA	p.S144S		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	144	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)			biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						GAAGCCATACCGAGCGGTTGG	0.438																																					p.S144S		Atlas-SNP	.											.	SEMA5A	236	.	0			c.G432A						PASS	.	C		0,4406		0,0,2203	56.0	60.0	58.0		432	4.1	1.0	5	dbSNP_134	58	1,8599	1.2+/-3.3	0,1,4299	yes	coding-synonymous-near-splice	SEMA5A	NM_003966.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		144/1075	9226981	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	9037	exon7			CCATACCGAGCGG	U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.432+1G>A	chr5.hg19:g.9226981C>T		161.0	0.0	.		117.0	6.0	.	NM_003966	D3DTC6|O60408|Q1RLL9	Silent	SNP	ENST00000382496.5	hg19	CCDS3875.1	.	.	.	.	.	.	.	.	.	.	C	13.82	2.352056	0.41700	0.0	1.16E-4	ENSG00000112902	ENST00000514923	.	.	.	4.93	4.05	0.47172	.	.	.	.	.	T	0.62708	0.2450	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60826	-0.7186	4	.	.	.	.	11.7678	0.51941	0.0:0.823:0.177:0.0	.	.	.	.	I	92	.	.	V	-	1	0	SEMA5A	9279981	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	3.490000	0.53245	1.185000	0.42971	0.655000	0.94253	GTT	.	C|1.000;T|0.000	0.000	weak		0.438	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206989.2		Silent
ADAMTS19	171019	hgsc.bcm.edu	37	5	128956361	128956361	+	Missense_Mutation	SNP	A	A	G			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr5:128956361A>G	ENST00000274487.4	+	9	1656	c.1511A>G	c.(1510-1512)cAt>cGt	p.H504R	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	504	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		GATGGTCTTCATATCATGTCT	0.373																																					p.H504R		Atlas-SNP	.											ADAMTS19,caecum,carcinoma,0,1	ADAMTS19	216	.	0			c.A1511G						PASS	.						167.0	153.0	157.0					5																	128956361		2203	4300	6503	SO:0001583	missense	171019	exon9			GTCTTCATATCAT	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.1511A>G	chr5.hg19:g.128956361A>G	ENSP00000274487:p.His504Arg	229.0	0.0	.		282.0	12.0	.	NM_133638		Missense_Mutation	SNP	ENST00000274487.4	hg19	CCDS4146.1	.	.	.	.	.	.	.	.	.	.	A	19.79	3.893486	0.72639	.	.	ENSG00000145808	ENST00000274487	T	0.62639	0.01	4.51	4.51	0.55191	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.64402	D	0.000001	T	0.73140	0.3549	L	0.49126	1.545	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	T	0.72459	-0.4287	9	.	.	.	.	14.8814	0.70537	1.0:0.0:0.0:0.0	.	504	Q8TE59	ATS19_HUMAN	R	504	ENSP00000274487:H504R	.	H	+	2	0	ADAMTS19	128984260	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.916000	0.87491	2.246000	0.74042	0.533000	0.62120	CAT	.	.	.	none		0.373	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638	
GABRG2	2566	hgsc.bcm.edu	37	5	161576298	161576298	+	Missense_Mutation	SNP	A	A	T			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr5:161576298A>T	ENST00000361925.4	+	8	1327	c.1107A>T	c.(1105-1107)aaA>aaT	p.K369N	GABRG2_ENST00000393933.4_Missense_Mutation_p.K274N|GABRG2_ENST00000356592.3_Missense_Mutation_p.K369N|GABRG2_ENST00000414552.2_Missense_Mutation_p.K409N			P18507	GBRG2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 2	369					adult behavior (GO:0030534)|cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|post-embryonic development (GO:0009791)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|GABA-A receptor complex (GO:1902711)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(15)|lung(24)|ovary(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	62	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GCAAGGACAAAGATAAAAAGA	0.373																																					p.K409N		Atlas-SNP	.											.	GABRG2	142	.	0			c.A1227T						PASS	.						118.0	102.0	107.0					5																	161576298		2203	4300	6503	SO:0001583	missense	2566	exon9			GGACAAAGATAAA		CCDS4358.1, CCDS4359.1, CCDS47333.1	5q34	2012-06-22			ENSG00000113327	ENSG00000113327		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4087	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma 2"""	137164					Standard	NM_198904		Approved		uc010jjc.3	P18507	OTTHUMG00000130350	ENST00000361925.4:c.1107A>T	chr5.hg19:g.161576298A>T	ENSP00000354651:p.Lys369Asn	158.0	0.0	.		178.0	57.0	.	NM_198903	F5HB82|Q6GRL6|Q6PCC3|Q9UDB3|Q9UN15	Missense_Mutation	SNP	ENST00000361925.4	hg19	CCDS4358.1	.	.	.	.	.	.	.	.	.	.	A	14.77	2.633505	0.47049	.	.	ENSG00000113327	ENST00000356592;ENST00000414552;ENST00000361925;ENST00000393933	D;D;D;D	0.86865	-2.18;-2.18;-2.15;-2.15	5.61	0.527	0.17084	Neurotransmitter-gated ion-channel transmembrane domain (2);	1.305790	0.04797	N	0.432698	D	0.85535	0.5719	M	0.68317	2.08	0.48511	D	0.999667	B;B;B	0.14438	0.01;0.007;0.01	B;B;B	0.23852	0.02;0.049;0.049	T	0.70916	-0.4742	10	0.56958	D	0.05	.	5.4602	0.16612	0.5861:0.1356:0.2784:0.0	.	409;369;369	F5HB82;P18507;P18507-2	.;GBRG2_HUMAN;.	N	369;409;369;274	ENSP00000349000:K369N;ENSP00000410732:K409N;ENSP00000354651:K369N;ENSP00000377510:K274N	ENSP00000349000:K369N	K	+	3	2	GABRG2	161508876	1.000000	0.71417	0.996000	0.52242	0.970000	0.65996	3.143000	0.50608	-0.128000	0.11641	-0.263000	0.10527	AAA	.	.	.	none		0.373	GABRG2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252706.1		
FAM135A	57579	hgsc.bcm.edu	37	6	71234676	71234676	+	Missense_Mutation	SNP	T	T	A			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr6:71234676T>A	ENST00000418814.2	+	15	2503	c.1889T>A	c.(1888-1890)aTg>aAg	p.M630K	FAM135A_ENST00000457062.2_Missense_Mutation_p.M417K|FAM135A_ENST00000505868.1_Missense_Mutation_p.M630K|FAM135A_ENST00000505769.1_Missense_Mutation_p.M434K|FAM135A_ENST00000370479.3_Missense_Mutation_p.M417K|FAM135A_ENST00000361499.3_Missense_Mutation_p.M434K	NM_001105531.2|NM_001162529.1	NP_001099001.1|NP_001156001.1	Q9P2D6	F135A_HUMAN	family with sequence similarity 135, member A	630										breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38						ATTACACAAATGGAACACAAT	0.393																																					p.M630K		Atlas-SNP	.											.	FAM135A	181	.	0			c.T1889A						PASS	.						70.0	64.0	66.0					6																	71234676		2203	4299	6502	SO:0001583	missense	57579	exon13			CACAAATGGAACA	AK000183	CCDS34481.1, CCDS47448.1, CCDS55028.1	6q13	2008-10-30	2007-05-11	2007-05-11	ENSG00000082269	ENSG00000082269			21084	protein-coding gene	gene with protein product			"""KIAA1411"""	KIAA1411		10718198	Standard	NM_001105531		Approved	FLJ20176	uc003pfj.3	Q9P2D6	OTTHUMG00000014991	ENST00000418814.2:c.1889T>A	chr6.hg19:g.71234676T>A	ENSP00000410768:p.Met630Lys	143.0	0.0	.		127.0	52.0	.	NM_001162529	A2RRQ5|Q3C0H3|Q5JXK0|Q5JXK1|Q68DW0|Q6P081|Q9H0F2|Q9NU48|Q9NUQ5|Q9NXL5	Missense_Mutation	SNP	ENST00000418814.2	hg19	CCDS55028.1	.	.	.	.	.	.	.	.	.	.	T	10.84	1.464055	0.26335	.	.	ENSG00000082269	ENST00000418814;ENST00000370479;ENST00000505769;ENST00000457062;ENST00000361499;ENST00000505868	T;T;T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16;-1.16;-1.16	5.87	3.5	0.40072	.	0.419502	0.28453	N	0.015293	T	0.28928	0.0718	N	0.08118	0	0.27751	N	0.944159	B;B;B;B	0.15473	0.013;0.008;0.011;0.013	B;B;B;B	0.20577	0.03;0.008;0.019;0.03	T	0.27571	-1.0070	10	0.06494	T	0.89	.	8.0899	0.30795	0.0:0.2862:0.0:0.7138	.	630;630;434;417	Q9P2D6-4;Q9P2D6;Q9P2D6-2;Q9P2D6-3	.;F135A_HUMAN;.;.	K	630;417;434;417;434;630	ENSP00000410768:M630K;ENSP00000359510:M417K;ENSP00000423785:M434K;ENSP00000409201:M417K;ENSP00000354913:M434K;ENSP00000423307:M630K	ENSP00000354913:M434K	M	+	2	0	FAM135A	71291397	0.983000	0.35010	0.999000	0.59377	0.962000	0.63368	0.518000	0.22847	0.576000	0.29452	0.533000	0.62120	ATG	.	.	.	none		0.393	FAM135A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041137.2	NM_020819	
CTTNBP2	83992	hgsc.bcm.edu	37	7	117364734	117364734	+	Silent	SNP	T	T	A			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr7:117364734T>A	ENST00000160373.3	-	19	4405	c.4314A>T	c.(4312-4314)atA>atT	p.I1438I		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	1438					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		AACTGGAAACTATGGATAAAG	0.438																																					p.I1438I		Atlas-SNP	.											.	CTTNBP2	200	.	0			c.A4314T						PASS	.						106.0	96.0	100.0					7																	117364734		2203	4300	6503	SO:0001819	synonymous_variant	83992	exon19			GGAAACTATGGAT		CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.4314A>T	chr7.hg19:g.117364734T>A		147.0	0.0	.		187.0	53.0	.	NM_033427	O43389|Q7LG11|Q9C0A5	Silent	SNP	ENST00000160373.3	hg19	CCDS5774.1	.	.	.	.	.	.	.	.	.	.	T	2.995	-0.207314	0.06180	.	.	ENSG00000077063	ENST00000446636	.	.	.	5.45	-4.08	0.03963	.	.	.	.	.	T	0.38532	0.1044	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.37934	-0.9684	4	.	.	.	-1.618	1.9951	0.03455	0.2862:0.4031:0.1445:0.1662	.	.	.	.	C	926	.	.	S	-	1	0	CTTNBP2	117151970	0.378000	0.25114	0.285000	0.24819	0.253000	0.25986	-0.307000	0.08167	-0.488000	0.06726	-0.408000	0.06270	AGT	.	.	.	none		0.438	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427	
ARF5	381	hgsc.bcm.edu	37	7	127229193	127229193	+	Missense_Mutation	SNP	A	A	G			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr7:127229193A>G	ENST00000000233.5	+	2	278	c.124A>G	c.(124-126)Att>Gtt	p.I42V	ARF5_ENST00000467281.1_3'UTR|GCC1_ENST00000497650.1_Intron	NM_001662.3	NP_001653.1	P84085	ARF5_HUMAN	ADP-ribosylation factor 5	42					GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			cervix(2)|kidney(1)|lung(10)|ovary(1)	14						GTTGGGGGAGATTGTCACCAC	0.632											OREG0018287	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I42V		Atlas-SNP	.											.	ARF5	20	.	0			c.A124G						PASS	.						84.0	77.0	79.0					7																	127229193		2203	4300	6503	SO:0001583	missense	381	exon2			GGGGAGATTGTCA		CCDS34745.1	7q31.3	2008-07-18			ENSG00000004059	ENSG00000004059		"""ADP-ribosylation factors"""	658	protein-coding gene	gene with protein product		103188				1993656	Standard	NM_001662		Approved		uc003vmb.2	P84085	OTTHUMG00000023246	ENST00000000233.5:c.124A>G	chr7.hg19:g.127229193A>G	ENSP00000000233:p.Ile42Val	99.0	0.0	.	1555	117.0	46.0	.	NM_001662	P26437	Missense_Mutation	SNP	ENST00000000233.5	hg19	CCDS34745.1	.	.	.	.	.	.	.	.	.	.	a	17.35	3.367076	0.61513	.	.	ENSG00000004059	ENST00000000233;ENST00000415666	D;D	0.81821	-1.54;-1.54	5.19	3.96	0.45880	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.56572	0.1994	N	0.03050	-0.425	0.44635	D	0.997619	B;B	0.10296	0.003;0.003	B;B	0.16289	0.015;0.015	T	0.53746	-0.8395	10	0.29301	T	0.29	-8.2547	9.1237	0.36801	0.8363:0.0:0.0:0.1636	.	42;42	A4D0Z3;P84085	.;ARF5_HUMAN	V	42	ENSP00000000233:I42V;ENSP00000412701:I42V	ENSP00000000233:I42V	I	+	1	0	ARF5	127016429	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.106000	0.77039	1.962000	0.57031	0.444000	0.29173	ATT	.	.	.	none		0.632	ARF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059567.2	NM_001662	
ABRA	137735	hgsc.bcm.edu	37	8	107782408	107782408	+	Missense_Mutation	SNP	C	C	A			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr8:107782408C>A	ENST00000311955.3	-	1	65	c.11G>T	c.(10-12)gGc>gTc	p.G4V		NM_139166.4	NP_631905.1			actin-binding Rho activating protein											breast(1)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)	27			OV - Ovarian serous cystadenocarcinoma(57;3.83e-09)			TTCCTTTTCGCCCGGAGCCAT	0.597																																					p.G4V		Atlas-SNP	.											.	ABRA	57	.	0			c.G11T						PASS	.						33.0	37.0	35.0					8																	107782408		2202	4295	6497	SO:0001583	missense	137735	exon1			TTTTCGCCCGGAG	AF503617	CCDS6305.1	8q23.1	2012-02-06			ENSG00000174429	ENSG00000174429			30655	protein-coding gene	gene with protein product	"""striated muscle activator of Rho-dependent signaling"""	609747				11983702	Standard	NM_139166		Approved	STARS	uc003ymm.4	Q8N0Z2	OTTHUMG00000164809	ENST00000311955.3:c.11G>T	chr8.hg19:g.107782408C>A	ENSP00000311436:p.Gly4Val	110.0	0.0	.		125.0	27.0	.	NM_139166		Missense_Mutation	SNP	ENST00000311955.3	hg19	CCDS6305.1	.	.	.	.	.	.	.	.	.	.	C	13.23	2.174542	0.38413	.	.	ENSG00000174429	ENST00000311955	.	.	.	5.66	3.63	0.41609	.	0.510379	0.22113	N	0.064446	T	0.45796	0.1360	L	0.44542	1.39	0.53005	D	0.999964	P	0.42203	0.773	P	0.45712	0.491	T	0.45948	-0.9226	9	0.59425	D	0.04	-3.5289	4.2762	0.10809	0.0:0.5455:0.0:0.4545	.	4	Q8N0Z2	ABRA_HUMAN	V	4	.	ENSP00000311436:G4V	G	-	2	0	ABRA	107851584	1.000000	0.71417	0.870000	0.34147	0.314000	0.28054	1.867000	0.39499	1.377000	0.46286	0.655000	0.94253	GGC	.	.	.	none		0.597	ABRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380416.1	NM_139166	
MRPL13	28998	hgsc.bcm.edu	37	8	121455496	121455496	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr8:121455496G>A	ENST00000306185.3	-	2	371	c.80C>T	c.(79-81)cCa>cTa	p.P27L	MTBP_ENST00000305949.1_5'Flank	NM_014078.5	NP_054797.2	Q9BYD1	RM13_HUMAN	mitochondrial ribosomal protein L13	27					translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)|mitochondrial ribosome (GO:0005761)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(1)|ovary(1)	6	Lung NSC(37;1.69e-07)|Ovarian(258;0.00769)|all_neural(195;0.0804)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00503)			TTTGCCAGGTGGCTGCATTTT	0.373																																					p.P27L		Atlas-SNP	.											.	MRPL13	18	.	0			c.C80T						PASS	.						123.0	118.0	120.0					8																	121455496		2203	4300	6503	SO:0001583	missense	28998	exon2			CCAGGTGGCTGCA	AB049640	CCDS6332.1	8q22.1-q22.3	2012-09-13			ENSG00000172172	ENSG00000172172		"""Mitochondrial ribosomal proteins / large subunits"""	14278	protein-coding gene	gene with protein product		610200				11543634	Standard	NM_014078		Approved	L13, RPL13, L13mt, RPML13, L13A	uc003ypa.3	Q9BYD1	OTTHUMG00000165039	ENST00000306185.3:c.80C>T	chr8.hg19:g.121455496G>A	ENSP00000306548:p.Pro27Leu	178.0	0.0	.		194.0	62.0	.	NM_014078	B2R4R8|Q9UI04	Missense_Mutation	SNP	ENST00000306185.3	hg19	CCDS6332.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.607489	0.87157	.	.	ENSG00000172172	ENST00000306185;ENST00000518918	.	.	.	5.65	5.65	0.86999	Ribosomal protein L13 domain (2);	0.000000	0.85682	D	0.000000	D	0.83280	0.5220	M	0.80508	2.5	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82942	-0.0207	9	0.45353	T	0.12	-0.4573	19.3324	0.94297	0.0:0.0:1.0:0.0	.	27	Q9BYD1	RM13_HUMAN	L	27;3	.	ENSP00000306548:P27L	P	-	2	0	MRPL13	121524677	1.000000	0.71417	0.998000	0.56505	0.884000	0.51177	9.102000	0.94226	2.663000	0.90544	0.542000	0.68232	CCA	.	.	.	none		0.373	MRPL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381523.1	NM_014078	
CYHR1	50626	hgsc.bcm.edu	37	8	145690192	145690192	+	Splice_Site	SNP	C	C	G			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr8:145690192C>G	ENST00000438911.2	-	1	226	c.93G>C	c.(91-93)gaG>gaC	p.E31D	CYHR1_ENST00000424149.2_Splice_Site_p.E31D|KIFC2_ENST00000301331.5_5'Flank|CYHR1_ENST00000306145.5_Splice_Site_p.E31D|CYHR1_ENST00000530374.1_5'Flank|KIFC2_ENST00000301332.2_5'Flank|CTD-2517M22.16_ENST00000525461.1_RNA|CYHR1_ENST00000403000.2_Splice_Site_p.E31D	NM_138496.1	NP_612505.1	Q6ZMK1	CYHR1_HUMAN	cysteine/histidine-rich 1	31						cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)	zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|lung(3)|ovary(2)	7	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			GTGTACTCACCTCGGCTGTGC	0.627																																					p.E31D		Atlas-SNP	.											.	CYHR1	39	.	0			c.G93C						PASS	.						37.0	38.0	38.0					8																	145690192		2197	4298	6495	SO:0001630	splice_region_variant	50626	exon2			ACTCACCTCGGCT	AB007965	CCDS6426.1, CCDS47943.1	8q24	2004-12-07	2005-07-24		ENSG00000187954	ENSG00000187954			17806	protein-coding gene	gene with protein product			"""cysteine and histidine rich 1"""			10745073	Standard	NM_138496		Approved	CHRP, KIAA0496, MGC13010	uc003zcv.2	Q6ZMK1	OTTHUMG00000165171	ENST00000438911.2:c.93+1G>C	chr8.hg19:g.145690192C>G		38.0	0.0	.		51.0	18.0	.	NM_032687	B3KSX0|D3DWM3|Q9BSF6|Q9BSU6	Missense_Mutation	SNP	ENST00000438911.2	hg19	CCDS47943.1	.	.	.	.	.	.	.	.	.	.	c	17.42	3.385251	0.61956	.	.	ENSG00000187954	ENST00000438911;ENST00000526887;ENST00000403000;ENST00000424149;ENST00000306145;ENST00000533764;ENST00000530637	T;T;T;T;T;T;T	0.43688	0.94;1.65;0.94;0.94;0.94;0.94;0.94	4.22	4.22	0.49857	.	0.251507	0.25386	U	0.031059	T	0.24736	0.0600	N	0.08118	0	0.09310	N	0.999991	B;B	0.21606	0.058;0.0	B;B	0.19391	0.025;0.001	T	0.27297	-1.0078	10	0.72032	D	0.01	.	12.4423	0.55631	0.0:1.0:0.0:0.0	.	31;31	Q6ZMK1-3;Q6ZMK1	.;CYHR1_HUMAN	D	31	ENSP00000387426:E31D;ENSP00000434470:E31D;ENSP00000385962:E31D;ENSP00000414647:E31D;ENSP00000304826:E31D;ENSP00000432902:E31D;ENSP00000434642:E31D	ENSP00000304826:E31D	E	-	3	2	CYHR1	145661000	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	2.359000	0.44142	2.074000	0.62210	0.556000	0.70494	GAG	.	.	.	none		0.627	CYHR1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000382438.1	NM_032687	Missense_Mutation
TNFSF8	944	hgsc.bcm.edu	37	9	117666220	117666220	+	Missense_Mutation	SNP	A	A	C			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr9:117666220A>C	ENST00000223795.2	-	4	809	c.696T>G	c.(694-696)aaT>aaG	p.N232K	TNFSF8_ENST00000474301.1_Intron	NM_001244.3	NP_001235.1	P32971	TNFL8_HUMAN	tumor necrosis factor (ligand) superfamily, member 8	232					apoptotic process (GO:0006915)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	receptor binding (GO:0005102)			endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|skin(3)|urinary_tract(1)	12						TTCAGTCTGAATTACTGTATA	0.408																																					p.N232K		Atlas-SNP	.											.	TNFSF8	34	.	0			c.T696G						PASS	.						165.0	157.0	159.0					9																	117666220		2203	4300	6503	SO:0001583	missense	944	exon4			GTCTGAATTACTG	L09753	CCDS6810.1, CCDS75884.1	9q33	2008-02-05			ENSG00000106952	ENSG00000106952		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11938	protein-coding gene	gene with protein product		603875		CD30LG		8391931, 9349718	Standard	NM_001244		Approved	CD153	uc004bji.2	P32971	OTTHUMG00000021025	ENST00000223795.2:c.696T>G	chr9.hg19:g.117666220A>C	ENSP00000223795:p.Asn232Lys	266.0	0.0	.		273.0	82.0	.	NM_001244	O43404	Missense_Mutation	SNP	ENST00000223795.2	hg19	CCDS6810.1	.	.	.	.	.	.	.	.	.	.	A	10.09	1.255547	0.22965	.	.	ENSG00000106952	ENST00000223795	.	.	.	5.78	2.21	0.28008	.	0.916415	0.09426	N	0.803692	T	0.18130	0.0435	N	0.08118	0	0.09310	N	1	B	0.12013	0.005	B	0.09377	0.004	T	0.23048	-1.0199	9	0.48119	T	0.1	-0.0101	4.7061	0.12849	0.6059:0.1526:0.2415:0.0	.	232	P32971	TNFL8_HUMAN	K	232	.	ENSP00000223795:N232K	N	-	3	2	TNFSF8	116706041	0.167000	0.22975	0.531000	0.27976	0.664000	0.39144	0.394000	0.20834	0.135000	0.18707	-0.256000	0.11100	AAT	.	.	.	none		0.408	TNFSF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055464.1		
TNKS2	80351	hgsc.bcm.edu	37	10	93593686	93593686	+	Missense_Mutation	SNP	T	T	C			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr10:93593686T>C	ENST00000371627.4	+	12	1731	c.1352T>C	c.(1351-1353)cTa>cCa	p.L451P		NM_025235.3	NP_079511.1	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2	451					multicellular organism growth (GO:0035264)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein polyubiquitination (GO:0000209)|regulation of multicellular organism growth (GO:0040014)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			biliary_tract(1)|breast(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	48		Colorectal(252;0.162)				ACCTGCCGCCTACTCCTGAGC	0.413																																					p.L451P		Atlas-SNP	.											.	TNKS2	103	.	0			c.T1352C						PASS	.						148.0	131.0	137.0					10																	93593686		2203	4300	6503	SO:0001583	missense	80351	exon12			GCCGCCTACTCCT	AF342982	CCDS7417.1	10q23.3	2013-01-10			ENSG00000107854	ENSG00000107854		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15677	protein-coding gene	gene with protein product		607128					Standard	NM_025235		Approved	TNKL, TANK2, PARP-5b, PARP-5c, PARP5B, PARP5C, pART6	uc001khp.3	Q9H2K2	OTTHUMG00000018747	ENST00000371627.4:c.1352T>C	chr10.hg19:g.93593686T>C	ENSP00000360689:p.Leu451Pro	225.0	0.0	.		240.0	79.0	.	NM_025235	B2RBD3|Q9H8F2|Q9HAS4	Missense_Mutation	SNP	ENST00000371627.4	hg19	CCDS7417.1	.	.	.	.	.	.	.	.	.	.	T	26.2	4.715685	0.89112	.	.	ENSG00000107854	ENST00000371627	T	0.70164	-0.46	5.83	5.83	0.93111	Ankyrin repeat-containing domain (3);	0.000000	0.47093	D	0.000247	D	0.86489	0.5945	M	0.94142	3.5	0.80722	D	1	D	0.69078	0.997	D	0.70227	0.968	D	0.89940	0.4072	10	0.62326	D	0.03	.	16.1968	0.82036	0.0:0.0:0.0:1.0	.	451	Q9H2K2	TNKS2_HUMAN	P	451	ENSP00000360689:L451P	ENSP00000360689:L451P	L	+	2	0	TNKS2	93583666	1.000000	0.71417	0.975000	0.42487	0.983000	0.72400	8.040000	0.89188	2.225000	0.72522	0.533000	0.62120	CTA	.	.	.	none		0.413	TNKS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049374.1	NM_025235	
ITPRIP	85450	hgsc.bcm.edu	37	10	106075425	106075425	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr10:106075425C>T	ENST00000337478.1	-	2	556	c.385G>A	c.(385-387)Gcc>Acc	p.A129T	ITPRIP_ENST00000278071.2_Missense_Mutation_p.A129T|ITPRIP_ENST00000358187.2_Missense_Mutation_p.A129T|RP11-127L20.5_ENST00000472915.2_RNA	NM_001272013.1	NP_001258942.1	Q8IWB1	IPRI_HUMAN	inositol 1,4,5-trisphosphate receptor interacting protein	129						membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|large_intestine(5)|liver(1)|lung(9)|upper_aerodigestive_tract(1)	20						TGCAAGGGGGCGCCCCCCAGC	0.692																																					p.A129T		Atlas-SNP	.											.	ITPRIP	44	.	0			c.G385A						PASS	.						35.0	41.0	39.0					10																	106075425		2203	4298	6501	SO:0001583	missense	85450	exon2			AGGGGGCGCCCCC	AB051541	CCDS7557.1	10q25.1	2011-04-28	2011-04-28	2008-08-11	ENSG00000148841	ENSG00000148841			29370	protein-coding gene	gene with protein product			"""KIAA1754"", ""inositol 1,4,5-triphosphate receptor interacting protein"""	KIAA1754		11214970, 16990268	Standard	NM_001272012		Approved	bA127L20.2, DANGER	uc001kye.4	Q8IWB1	OTTHUMG00000019003	ENST00000337478.1:c.385G>A	chr10.hg19:g.106075425C>T	ENSP00000337178:p.Ala129Thr	167.0	0.0	.		179.0	76.0	.	NM_001272013	D3DRA5|Q5JU17|Q96MS8|Q9C0A9	Missense_Mutation	SNP	ENST00000337478.1	hg19	CCDS7557.1	.	.	.	.	.	.	.	.	.	.	C	0.011	-1.730767	0.00687	.	.	ENSG00000148841	ENST00000337478;ENST00000278071;ENST00000358187	T;T;T	0.22134	1.97;1.97;1.97	5.68	-5.02	0.02982	.	1.189030	0.05773	N	0.607175	T	0.10551	0.0258	N	0.13043	0.29	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.39563	-0.9608	10	0.12430	T	0.62	-5.7595	10.1192	0.42609	0.0857:0.426:0.0:0.4883	.	129	Q8IWB1	IPRI_HUMAN	T	129	ENSP00000337178:A129T;ENSP00000278071:A129T;ENSP00000350915:A129T	ENSP00000278071:A129T	A	-	1	0	ITPRIP	106065415	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-0.312000	0.08113	-1.181000	0.02730	-1.119000	0.02030	GCC	.	.	.	none		0.692	ITPRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050204.1	NM_033397	
MRGPRX1	259249	hgsc.bcm.edu	37	11	18955994	18955994	+	Missense_Mutation	SNP	A	A	T			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr11:18955994A>T	ENST00000302797.3	-	1	562	c.338T>A	c.(337-339)cTg>cAg	p.L113Q	MRGPRX1_ENST00000526914.1_5'UTR|RP11-583F24.8_ENST00000528646.1_RNA	NM_147199.3	NP_671732.3	Q96LB2	MRGX1_HUMAN	MAS-related GPR, member X1	113					acute-phase response (GO:0006953)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|pancreas(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						CACGGCACTCAGAAAGCTCAG	0.542																																					p.L113Q		Atlas-SNP	.											.	MRGPRX1	84	.	0			c.T338A						PASS	.						100.0	96.0	98.0					11																	18955994		2194	4286	6480	SO:0001583	missense	259249	exon1			GCACTCAGAAAGC		CCDS7846.1	11p15.1	2013-10-10			ENSG00000170255	ENSG00000170255		"""GPCR / Class A : Orphans"""	17962	protein-coding gene	gene with protein product		607227				11551509	Standard	NM_147199		Approved	MRGX1	uc001mpg.3	Q96LB2	OTTHUMG00000162655	ENST00000302797.3:c.338T>A	chr11.hg19:g.18955994A>T	ENSP00000305766:p.Leu113Gln	157.0	0.0	.		153.0	7.0	.	NM_147199	Q4V9L2|Q8TDD8|Q8TDD9	Missense_Mutation	SNP	ENST00000302797.3	hg19	CCDS7846.1	.	.	.	.	.	.	.	.	.	.	.	16.41	3.114997	0.56505	.	.	ENSG00000170255	ENST00000302797	D	0.81579	-1.51	2.28	2.28	0.28536	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000078	D	0.91199	0.7227	H	0.95982	3.75	0.29298	N	0.868908	D	0.89917	1.0	D	0.91635	0.999	D	0.85057	0.0932	10	0.87932	D	0	.	8.4333	0.32771	1.0:0.0:0.0:0.0	.	113	Q96LB2	MRGX1_HUMAN	Q	113	ENSP00000305766:L113Q	ENSP00000305766:L113Q	L	-	2	0	MRGPRX1	18912570	0.996000	0.38824	0.008000	0.14137	0.026000	0.11368	7.327000	0.79147	1.292000	0.44672	0.402000	0.26972	CTG	.	.	.	none		0.542	MRGPRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369913.1	NM_147199	
ABCG4	64137	hgsc.bcm.edu	37	11	119027678	119027678	+	Missense_Mutation	SNP	G	G	T			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr11:119027678G>T	ENST00000449422.2	+	9	1210	c.1022G>T	c.(1021-1023)aGc>aTc	p.S341I	ABCG4_ENST00000531739.1_Missense_Mutation_p.S341I|AP002956.1_ENST00000599663.1_Intron|ABCG4_ENST00000307417.3_Missense_Mutation_p.S341I	NM_001142505.1	NP_001135977.1	Q9H172	ABCG4_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 4	341					cholesterol efflux (GO:0033344)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(28)|ovary(2)|prostate(1)|skin(1)	44	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		AAGAAGAGCAGCCCTGAGAAG	0.607																																					p.S341I		Atlas-SNP	.											.	ABCG4	77	.	0			c.G1022T						PASS	.						180.0	164.0	170.0					11																	119027678		2200	4295	6495	SO:0001583	missense	64137	exon9			AGAGCAGCCCTGA	AJ300465	CCDS8415.1	11q23	2012-03-14			ENSG00000172350	ENSG00000172350		"""ATP binding cassette transporters / subfamily G"""	13884	protein-coding gene	gene with protein product	"""putative ABC transporter"", ""ATP-binding cassette, subfamily G, member 4"""	607784				11435397	Standard	NM_022169		Approved	WHITE2	uc001pvs.3	Q9H172	OTTHUMG00000166169	ENST00000449422.2:c.1022G>T	chr11.hg19:g.119027678G>T	ENSP00000406874:p.Ser341Ile	253.0	0.0	.		220.0	75.0	.	NM_022169	A8K1B5|Q8WWH0|Q8WWH1|Q8WWH2	Missense_Mutation	SNP	ENST00000449422.2	hg19	CCDS8415.1	.	.	.	.	.	.	.	.	.	.	G	16.00	2.998773	0.54147	.	.	ENSG00000172350	ENST00000307417;ENST00000449422;ENST00000531739;ENST00000534402	D;D;D;T	0.87412	-2.25;-2.25;-2.25;0.85	5.65	3.69	0.42338	.	0.573919	0.21547	N	0.072794	T	0.78660	0.4318	L	0.35854	1.095	0.36220	D	0.851913	B	0.13594	0.008	B	0.13407	0.009	T	0.75360	-0.3345	10	0.38643	T	0.18	-8.3485	6.2254	0.20706	0.071:0.1345:0.6546:0.1398	.	341	Q9H172	ABCG4_HUMAN	I	341;341;341;19	ENSP00000304111:S341I;ENSP00000406874:S341I;ENSP00000434318:S341I;ENSP00000434571:S19I	ENSP00000304111:S341I	S	+	2	0	ABCG4	118532888	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.327000	0.43858	1.359000	0.45940	0.655000	0.94253	AGC	.	.	.	none		0.607	ABCG4-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388215.1	NM_022169	
WDR66	144406	hgsc.bcm.edu	37	12	122413567	122413567	+	Silent	SNP	T	T	C			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr12:122413567T>C	ENST00000288912.4	+	19	3836	c.2982T>C	c.(2980-2982)atT>atC	p.I994I		NM_144668.5	NP_653269.3	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	994							calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(13)|ovary(2)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		TGAGAGCAATTGGCTTTTACC	0.438																																					p.I994I	Esophageal Squamous(85;849 1794 49757 52143)	Atlas-SNP	.											.	WDR66	143	.	0			c.T2982C						PASS	.						119.0	111.0	113.0					12																	122413567		1915	4145	6060	SO:0001819	synonymous_variant	144406	exon19			AGCAATTGGCTTT	AL833930	CCDS41853.1, CCDS53840.1	12q24.31	2014-07-31			ENSG00000158023	ENSG00000158023		"""WD repeat domain containing"""	28506	protein-coding gene	gene with protein product						17967944	Standard	NM_001178003		Approved	MGC33630, CaM-IP4	uc009zxk.3	Q8TBY9	OTTHUMG00000168948	ENST00000288912.4:c.2982T>C	chr12.hg19:g.122413567T>C		184.0	0.0	.		141.0	49.0	.	NM_144668	C9J1W2|Q8IYA3|Q8N898|Q8NDE7	Silent	SNP	ENST00000288912.4	hg19	CCDS41853.1																																																																																			.	.	.	none		0.438	WDR66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401700.1	NM_144668	
FRMD6	122786	hgsc.bcm.edu	37	14	52182105	52182105	+	Silent	SNP	G	G	T			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr14:52182105G>T	ENST00000344768.5	+	10	1108	c.912G>T	c.(910-912)acG>acT	p.T304T	FRMD6_ENST00000395718.2_Silent_p.T296T|FRMD6_ENST00000553556.1_5'Flank|FRMD6_ENST00000554167.1_Silent_p.T227T|FRMD6_ENST00000356218.4_Silent_p.T296T			Q96NE9	FRMD6_HUMAN	FERM domain containing 6	304	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				apical constriction (GO:0003383)|cellular protein localization (GO:0034613)|regulation of actin filament-based process (GO:0032970)	apical junction complex (GO:0043296)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_epithelial(31;0.0163)|Breast(41;0.089)					TATACTACACGGGGTGCCCCA	0.507																																					p.T304T		Atlas-SNP	.											.	FRMD6	100	.	0			c.G912T						PASS	.						62.0	65.0	64.0					14																	52182105		2203	4300	6503	SO:0001819	synonymous_variant	122786	exon10			CTACACGGGGTGC	BI465118	CCDS9704.1, CCDS58318.1, CCDS58319.1	14q22.1	2011-06-22	2005-07-20	2005-07-20	ENSG00000139926	ENSG00000139926			19839	protein-coding gene	gene with protein product	"""expanded homolog"""	614555	"""chromosome 14 open reading frame 31"""	C14orf31			Standard	NM_152330		Approved	MGC17921, willin, EX1	uc001wzd.3	Q96NE9	OTTHUMG00000140294	ENST00000344768.5:c.912G>T	chr14.hg19:g.52182105G>T		153.0	0.0	.		156.0	13.0	.	NM_001267046	D3DSB9|Q5HYF2|Q8N2X1|Q8WUH7	Silent	SNP	ENST00000344768.5	hg19	CCDS58318.1																																																																																			.	.	.	none		0.507	FRMD6-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276881.1	NM_152330	
TMC3	342125	hgsc.bcm.edu	37	15	81648105	81648105	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr15:81648105G>A	ENST00000359440.5	-	9	1031	c.896C>T	c.(895-897)gCt>gTt	p.A299V	RP11-761I4.3_ENST00000560851.1_RNA|RP11-761I4.3_ENST00000559781.1_RNA|TMC3_ENST00000558726.1_Missense_Mutation_p.A299V	NM_001080532.1	NP_001074001.1			transmembrane channel-like 3											autonomic_ganglia(2)|breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	34						TTCCAATATAGCTTCCTTTAA	0.284																																					p.A299V		Atlas-SNP	.											.	TMC3	112	.	0			c.C896T						PASS	.						120.0	114.0	116.0					15																	81648105		1789	4056	5845	SO:0001583	missense	342125	exon9			AATATAGCTTCCT	AY263163	CCDS45324.1	15q24.3	2006-11-24				ENSG00000188869			22995	protein-coding gene	gene with protein product						12906855, 12812529	Standard	NM_001080532		Approved		uc021ssk.1	Q7Z5M5		ENST00000359440.5:c.896C>T	chr15.hg19:g.81648105G>A	ENSP00000352413:p.Ala299Val	89.0	0.0	.		112.0	35.0	.	NM_001080532		Missense_Mutation	SNP	ENST00000359440.5	hg19	CCDS45324.1	.	.	.	.	.	.	.	.	.	.	G	15.67	2.901887	0.52227	.	.	ENSG00000188869	ENST00000359440	T	0.21191	2.02	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	T	0.37183	0.0994	L	0.54965	1.715	0.58432	D	0.999997	D;D	0.58970	0.984;0.973	P;P	0.56514	0.785;0.8	T	0.15037	-1.0451	10	0.72032	D	0.01	-13.4261	16.9402	0.86216	0.0:0.0:1.0:0.0	.	299;299	Q7Z5M5-2;Q7Z5M5	.;TMC3_HUMAN	V	299	ENSP00000352413:A299V	ENSP00000352413:A299V	A	-	2	0	TMC3	79435160	1.000000	0.71417	0.925000	0.36789	0.111000	0.19643	6.165000	0.71891	2.408000	0.81797	0.555000	0.69702	GCT	.	.	.	none		0.284	TMC3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417795.3	NM_181841	
ADAMTS17	170691	hgsc.bcm.edu	37	15	100657190	100657190	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr15:100657190C>T	ENST00000268070.4	-	13	1855	c.1750G>A	c.(1750-1752)Ggt>Agt	p.G584S		NM_139057.2	NP_620688.2	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 17	584	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)	50	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		ACACTGGCACCCGGGCAGTGT	0.632																																					p.G584S		Atlas-SNP	.											.	ADAMTS17	127	.	0			c.G1750A						PASS	.						39.0	33.0	35.0					15																	100657190		2203	4300	6503	SO:0001583	missense	170691	exon13			TGGCACCCGGGCA	AJ315735	CCDS10383.1	15q24	2014-01-28	2005-08-19		ENSG00000140470	ENSG00000140470		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17109	protein-coding gene	gene with protein product		607511	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 17"""			11867212	Standard	NM_139057		Approved	FLJ32769, FLJ16363	uc002bvv.1	Q8TE56	OTTHUMG00000149867	ENST00000268070.4:c.1750G>A	chr15.hg19:g.100657190C>T	ENSP00000268070:p.Gly584Ser	65.0	0.0	.		50.0	20.0	.	NM_139057	Q2I7G4|Q6ZN75	Missense_Mutation	SNP	ENST00000268070.4	hg19	CCDS10383.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.259132	0.80246	.	.	ENSG00000140470	ENST00000268070;ENST00000378898	T	0.60672	0.17	5.18	5.18	0.71444	.	0.141210	0.47852	D	0.000203	T	0.69459	0.3113	M	0.88450	2.955	0.54753	D	0.999987	P;B	0.38473	0.633;0.251	B;B	0.40375	0.327;0.108	T	0.77120	-0.2705	10	0.87932	D	0	.	18.7048	0.91633	0.0:1.0:0.0:0.0	.	341;584	Q8TE56-2;Q8TE56	.;ATS17_HUMAN	S	584;341	ENSP00000268070:G584S	ENSP00000268070:G584S	G	-	1	0	ADAMTS17	98474713	0.870000	0.30015	0.451000	0.26982	0.858000	0.48976	2.708000	0.47152	2.419000	0.82065	0.655000	0.94253	GGT	.	.	.	none		0.632	ADAMTS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313595.1	NM_139057	
IFT140	9742	hgsc.bcm.edu	37	16	1608090	1608090	+	Missense_Mutation	SNP	G	G	T			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr16:1608090G>T	ENST00000426508.2	-	19	2608	c.2245C>A	c.(2245-2247)Cac>Aac	p.H749N	IFT140_ENST00000439987.2_5'UTR	NM_014714.3	NP_055529.2	Q96RY7	IF140_HUMAN	intraflagellar transport 140	749					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)|protein localization to cilium (GO:0061512)|regulation of cilium assembly (GO:1902017)|renal system development (GO:0072001)|retina development in camera-type eye (GO:0060041)|skeletal system morphogenesis (GO:0048705)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)|photoreceptor connecting cilium (GO:0032391)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(12)|lung(10)|ovary(5)|pancreas(1)|prostate(4)|skin(4)|stomach(2)|urinary_tract(1)	53		Hepatocellular(780;0.219)				TGAGGGATGTGGTGGCACCCA	0.552																																					p.H749N		Atlas-SNP	.											.	IFT140	128	.	0			c.C2245A						PASS	.						149.0	145.0	146.0					16																	1608090		2199	4300	6499	SO:0001583	missense	9742	exon19			GGATGTGGTGGCA	AB011162	CCDS10439.1	16p13.3	2014-07-03	2014-07-03	2005-11-02	ENSG00000187535	ENSG00000187535		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29077	protein-coding gene	gene with protein product		614620	"""WD and tetratricopeptide repeats 2"", ""intraflagellar transport 140 homolog (Chlamydomonas)"""	WDTC2		9628581	Standard	NM_014714		Approved	gs114, KIAA0590	uc002cmb.3	Q96RY7	OTTHUMG00000128585	ENST00000426508.2:c.2245C>A	chr16.hg19:g.1608090G>T	ENSP00000406012:p.His749Asn	421.0	1.0	.		568.0	163.0	.	NM_014714	A2A2A8|D3DU75|O60332|Q9UG52	Missense_Mutation	SNP	ENST00000426508.2	hg19	CCDS10439.1	.	.	.	.	.	.	.	.	.	.	G	9.526	1.109524	0.20714	.	.	ENSG00000187535	ENST00000397417;ENST00000426508;ENST00000439987	T	0.41400	1.0	5.0	-3.73	0.04398	.	0.869820	0.10298	N	0.691510	T	0.15912	0.0383	N	0.08118	0	0.09310	N	1	B;B	0.23735	0.017;0.09	B;B	0.26416	0.021;0.069	T	0.23048	-1.0199	10	0.17832	T	0.49	.	1.4862	0.02447	0.393:0.097:0.2946:0.2155	.	749;474	Q96RY7;B4DR58	IF140_HUMAN;.	N	749	ENSP00000406012:H749N	ENSP00000380562:H749N	H	-	1	0	IFT140	1548091	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.055000	0.11807	-1.123000	0.02940	0.563000	0.77884	CAC	.	.	.	none		0.552	IFT140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250438.2	NM_014714	
ASGR1	432	hgsc.bcm.edu	37	17	7081872	7081872	+	Missense_Mutation	SNP	T	T	G			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr17:7081872T>G	ENST00000269299.3	-	2	410	c.11A>C	c.(10-12)gAg>gCg	p.E4A	ASGR1_ENST00000380920.4_5'Flank|ASGR1_ENST00000572879.1_5'Flank|ASGR1_ENST00000574388.1_Missense_Mutation_p.E4A	NM_001197216.2|NM_001671.4	NP_001184145.1|NP_001662.1	P07306	ASGR1_HUMAN	asialoglycoprotein receptor 1	4					cellular response to extracellular stimulus (GO:0031668)|receptor-mediated endocytosis (GO:0006898)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	asialoglycoprotein receptor activity (GO:0004873)|carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|skin(1)|urinary_tract(1)	10						GTCTTGATACTCCTTGGTCAT	0.577																																					p.E4A		Atlas-SNP	.											.	ASGR1	20	.	0			c.A11C						PASS	.						129.0	90.0	103.0					17																	7081872		2203	4300	6503	SO:0001583	missense	432	exon2			TGATACTCCTTGG		CCDS11089.1, CCDS56017.1	17p13-p11	2011-08-30			ENSG00000141505	ENSG00000141505		"""C-type lectin domain containing"""	742	protein-coding gene	gene with protein product		108360					Standard	NM_001671		Approved	CLEC4H1	uc002ges.4	P07306	OTTHUMG00000102159	ENST00000269299.3:c.11A>C	chr17.hg19:g.7081872T>G	ENSP00000269299:p.Glu4Ala	92.0	0.0	.		124.0	60.0	.	NM_001671	I3L1X1	Missense_Mutation	SNP	ENST00000269299.3	hg19	CCDS11089.1	.	.	.	.	.	.	.	.	.	.	T	14.43	2.533519	0.45073	.	.	ENSG00000141505	ENST00000269299;ENST00000380920	T	0.01015	5.44	4.43	4.43	0.53597	.	0.332135	0.21660	N	0.071026	T	0.00724	0.0024	N	0.14661	0.345	0.80722	D	1	B	0.30741	0.293	B	0.22386	0.039	T	0.73212	-0.4054	10	0.32370	T	0.25	.	10.0445	0.42177	0.0:0.0:0.0:1.0	.	4	P07306	ASGR1_HUMAN	A	4	ENSP00000269299:E4A	ENSP00000269299:E4A	E	-	2	0	ASGR1	7022596	0.996000	0.38824	0.991000	0.47740	0.852000	0.48524	3.429000	0.52800	1.875000	0.54330	0.449000	0.29647	GAG	.	.	.	none		0.577	ASGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220004.3	NM_001671	
PFAS	5198	hgsc.bcm.edu	37	17	8170542	8170542	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr17:8170542C>T	ENST00000314666.6	+	24	3297	c.3164C>T	c.(3163-3165)cCc>cTc	p.P1055L	PFAS_ENST00000545834.1_Missense_Mutation_p.P631L	NM_012393.2	NP_036525.1	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase	1055					'de novo' IMP biosynthetic process (GO:0006189)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|phosphoribosylformylglycinamidine synthase activity (GO:0004642)			central_nervous_system(3)|endometrium(8)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	35					L-Glutamine(DB00130)	GCCTCCGTGCCCCGTGAGCCT	0.677																																					p.P1055L		Atlas-SNP	.											.	PFAS	91	.	0			c.C3164T						PASS	.						18.0	17.0	17.0					17																	8170542		2201	4299	6500	SO:0001583	missense	5198	exon24			CCGTGCCCCGTGA	AB002359	CCDS11136.1	17p13.1	2008-07-31	2008-07-31		ENSG00000178921	ENSG00000178921	6.3.5.3		8863	protein-coding gene	gene with protein product	"""FGAR amidotransferase"""	602133				8110788	Standard	NM_012393		Approved	PURL, FGARAT, KIAA0361	uc002gkr.3	O15067	OTTHUMG00000108188	ENST00000314666.6:c.3164C>T	chr17.hg19:g.8170542C>T	ENSP00000313490:p.Pro1055Leu	21.0	0.0	.		44.0	13.0	.	NM_012393	A6H8V8	Missense_Mutation	SNP	ENST00000314666.6	hg19	CCDS11136.1	.	.	.	.	.	.	.	.	.	.	C	6.971	0.549059	0.13312	.	.	ENSG00000178921	ENST00000545834;ENST00000314666;ENST00000546020	T;T	0.33216	1.42;2.17	5.57	4.6	0.57074	AIR synthase-related protein, C-terminal (1);	0.289920	0.33959	N	0.004381	T	0.20495	0.0493	N	0.22421	0.69	0.48452	D	0.999654	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.04509	-1.0946	10	0.87932	D	0	-5.7605	8.6639	0.34110	0.0:0.8278:0.0:0.1722	.	1055;1055	A8K8N7;O15067	.;PUR4_HUMAN	L	631;1055;464	ENSP00000441706:P631L;ENSP00000313490:P1055L	ENSP00000313490:P1055L	P	+	2	0	PFAS	8111267	0.561000	0.26578	0.827000	0.32855	0.173000	0.22820	1.670000	0.37502	1.368000	0.46115	0.655000	0.94253	CCC	.	.	.	none		0.677	PFAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226994.2		
ACE	1636	hgsc.bcm.edu	37	17	61562641	61562641	+	Missense_Mutation	SNP	T	T	C			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr17:61562641T>C	ENST00000290866.4	+	13	1990	c.1966T>C	c.(1966-1968)Tat>Cat	p.Y656H	ACE_ENST00000577647.1_Missense_Mutation_p.Y82H|ACE_ENST00000428043.1_Missense_Mutation_p.Y656H|ACE_ENST00000490216.2_Missense_Mutation_p.Y82H|ACE_ENST00000421982.2_5'UTR|ACE_ENST00000290863.6_Missense_Mutation_p.Y82H|ACE_ENST00000413513.3_Missense_Mutation_p.Y82H	NM_000789.3	NP_000780.1	P12821	ACE_HUMAN	angiotensin I converting enzyme	656	Peptidase M2 2.				angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|arachidonic acid secretion (GO:0050482)|blood vessel remodeling (GO:0001974)|cellular protein metabolic process (GO:0044267)|hematopoietic stem cell differentiation (GO:0060218)|hormone catabolic process (GO:0042447)|kidney development (GO:0001822)|mononuclear cell proliferation (GO:0032943)|peptide catabolic process (GO:0043171)|regulation of blood pressure (GO:0008217)|regulation of renal output by angiotensin (GO:0002019)|regulation of smooth muscle cell migration (GO:0014910)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|bradykinin receptor binding (GO:0031711)|carboxypeptidase activity (GO:0004180)|chloride ion binding (GO:0031404)|drug binding (GO:0008144)|endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|peptidyl-dipeptidase activity (GO:0008241)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(3)|lung(22)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	51					Benazepril(DB00542)|Candoxatril(DB00616)|Captopril(DB01197)|Cilazapril(DB01340)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	TGTGGAGGAATATGACCGGAC	0.552																																					p.Y656H		Atlas-SNP	.											.	ACE	187	.	0			c.T1966C						PASS	.						165.0	123.0	137.0					17																	61562641		2203	4300	6503	SO:0001583	missense	1636	exon13			GAGGAATATGACC	J04144	CCDS11637.1, CCDS45755.1, CCDS54155.1	17q23.3	2013-06-12	2013-06-12		ENSG00000159640	ENSG00000159640	3.4.15.1	"""CD molecules"""	2707	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	106180	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 1"""	DCP1		2554286, 10319862	Standard	NM_001178057		Approved	ACE1, CD143	uc002jau.2	P12821	OTTHUMG00000154927	ENST00000290866.4:c.1966T>C	chr17.hg19:g.61562641T>C	ENSP00000290866:p.Tyr656His	91.0	0.0	.		111.0	52.0	.	NM_000789	B0LPF0|B4DXI3|E7EU16|P22966|Q53YX9|Q59GY8|Q7M4L4	Missense_Mutation	SNP	ENST00000290866.4	hg19	CCDS11637.1	.	.	.	.	.	.	.	.	.	.	T	14.19	2.460662	0.43736	.	.	ENSG00000159640	ENST00000290866;ENST00000428043;ENST00000290863;ENST00000413513	T;T;T;T	0.48836	0.8;0.8;0.8;0.8	5.09	5.09	0.68999	.	0.060975	0.64402	D	0.000002	T	0.71031	0.3292	M	0.86864	2.845	0.80722	D	1	D;D;P;D	0.76494	0.971;0.998;0.881;0.999	P;D;P;D	0.85130	0.887;0.997;0.843;0.994	T	0.75584	-0.3267	10	0.54805	T	0.06	-20.9481	12.3936	0.55373	0.0:0.0:0.0:1.0	.	82;656;82;656	B4DXI3;P12821-2;P12821-3;P12821	.;.;.;ACE_HUMAN	H	656;656;82;82	ENSP00000290866:Y656H;ENSP00000397593:Y656H;ENSP00000290863:Y82H;ENSP00000392247:Y82H	ENSP00000290863:Y82H	Y	+	1	0	ACE	58916373	1.000000	0.71417	1.000000	0.80357	0.861000	0.49209	4.885000	0.63142	1.919000	0.55581	0.379000	0.24179	TAT	.	.	.	none		0.552	ACE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337675.2		
DAZAP1	26528	hgsc.bcm.edu	37	19	1428875	1428875	+	Missense_Mutation	SNP	A	A	G			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr19:1428875A>G	ENST00000233078.4	+	8	742	c.581A>G	c.(580-582)aAg>aGg	p.K194R	DAZAP1_ENST00000586579.1_3'UTR|DAZAP1_ENST00000336761.6_Missense_Mutation_p.K194R	NM_018959.2	NP_061832.2	Q96EP5	DAZP1_HUMAN	DAZ associated protein 1	194					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|maternal placenta development (GO:0001893)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	9		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGGGACAGCAAGAGCCAAGCG	0.657																																					p.K194R		Atlas-SNP	.											.	DAZAP1	52	.	0			c.A581G						PASS	.						37.0	46.0	43.0					19																	1428875		2203	4300	6503	SO:0001583	missense	26528	exon8			ACAGCAAGAGCCA		CCDS12065.1, CCDS12066.1	19p13.3	2013-07-16			ENSG00000071626	ENSG00000071626		"""RNA binding motif (RRM) containing"""	2683	protein-coding gene	gene with protein product	"""deleted in azoospermia associated protein 1"""	607430				10857750, 23658607	Standard	XM_005259530		Approved	MGC19907	uc002lsn.3	Q96EP5		ENST00000233078.4:c.581A>G	chr19.hg19:g.1428875A>G	ENSP00000233078:p.Lys194Arg	80.0	0.0	.		87.0	26.0	.	NM_018959	Q96MJ3|Q9NRR9	Missense_Mutation	SNP	ENST00000233078.4	hg19	CCDS12065.1	.	.	.	.	.	.	.	.	.	.	A	15.03	2.711305	0.48517	.	.	ENSG00000071626	ENST00000233078;ENST00000336761	T;T	0.73363	-0.74;-0.74	5.03	5.03	0.67393	Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	D	0.000000	T	0.74891	0.3776	N	0.24115	0.695	0.80722	D	1	P;B;B	0.46578	0.88;0.073;0.119	P;B;B	0.62184	0.899;0.014;0.031	T	0.71573	-0.4552	10	0.22109	T	0.4	.	13.948	0.64099	1.0:0.0:0.0:0.0	.	261;194;194	Q5IRN4;Q96EP5;Q96EP5-2	.;DAZP1_HUMAN;.	R	194	ENSP00000233078:K194R;ENSP00000337132:K194R	ENSP00000233078:K194R	K	+	2	0	DAZAP1	1379875	1.000000	0.71417	0.983000	0.44433	0.941000	0.58515	6.547000	0.73892	1.906000	0.55180	0.459000	0.35465	AAG	.	.	.	none		0.657	DAZAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449522.3	NM_170711	
EEF2	1938	hgsc.bcm.edu	37	19	3979985	3979985	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr19:3979985C>T	ENST00000309311.6	-	10	1514	c.1426G>A	c.(1426-1428)Gac>Aac	p.D476N	SNORD37_ENST00000384048.1_RNA	NM_001961.3	NP_001952.1	P13639	EF2_HUMAN	eukaryotic translation elongation factor 2	476					cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|hematopoietic progenitor cell differentiation (GO:0002244)|positive regulation of gene expression (GO:0010628)|positive regulation of translation (GO:0045727)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation activator activity (GO:0008494)|translation elongation factor activity (GO:0003746)			endometrium(4)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|GBM - Glioblastoma multiforme(1328;0.0223)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGAACTGGTCCACGCCCACG	0.592																																					p.D476N	Colon(165;1804 1908 4071 6587 18799)	Atlas-SNP	.											.	EEF2	57	.	0			c.G1426A						PASS	.						69.0	57.0	61.0					19																	3979985		2203	4300	6503	SO:0001583	missense	1938	exon10			ACTGGTCCACGCC	Z11692	CCDS12117.1	19p13.3	2012-09-20			ENSG00000167658	ENSG00000167658			3214	protein-coding gene	gene with protein product	"""polypeptidyl-tRNA translocase"""	130610		EF2		2610926, 6427766	Standard	NM_001961		Approved	EEF-2	uc002lze.3	P13639		ENST00000309311.6:c.1426G>A	chr19.hg19:g.3979985C>T	ENSP00000307940:p.Asp476Asn	85.0	0.0	.		76.0	23.0	.	NM_001961	B2RMP5|D6W618|Q58J86	Missense_Mutation	SNP	ENST00000309311.6	hg19	CCDS12117.1	.	.	.	.	.	.	.	.	.	.	C	35	5.492373	0.96339	.	.	ENSG00000167658	ENST00000543343;ENST00000309311	D	0.82255	-1.59	5.45	5.45	0.79879	Translation elongation factor EFTu/EF1A, domain 2 (1);Translation elongation/initiation factor/Ribosomal, beta-barrel (1);	0.000000	0.85682	D	0.000000	D	0.95239	0.8456	H	0.98965	4.385	0.80722	D	1	D	0.69078	0.997	D	0.83275	0.996	D	0.97201	0.9864	10	0.87932	D	0	-55.7781	18.2479	0.89993	0.0:1.0:0.0:0.0	.	476	P13639	EF2_HUMAN	N	476	ENSP00000307940:D476N	ENSP00000307940:D476N	D	-	1	0	EEF2	3930985	1.000000	0.71417	0.999000	0.59377	0.932000	0.56968	7.773000	0.85462	2.555000	0.86185	0.561000	0.74099	GAC	.	.	.	none		0.592	EEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457615.2	NM_001961	
EIF3G	8666	hgsc.bcm.edu	37	19	10230530	10230530	+	Silent	SNP	A	A	G			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr19:10230530A>G	ENST00000253108.4	-	1	48	c.6T>C	c.(4-6)ccT>ccC	p.P2P	EIF3G_ENST00000587168.1_5'Flank	NM_003755.3	NP_003746.2			eukaryotic translation initiation factor 3, subunit G											central_nervous_system(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(20;3.53e-09)|Epithelial(33;4.91e-06)|all cancers(31;1.1e-05)			AGTCTCCAGTAGGCATCGCAA	0.642											OREG0025231	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P2P	Colon(124;1100 1638 3822 4510 4876)	Atlas-SNP	.											.	EIF3G	16	.	0			c.T6C						PASS	.						57.0	60.0	59.0					19																	10230530		2203	4300	6503	SO:0001819	synonymous_variant	8666	exon1			TCCAGTAGGCATC	U96074	CCDS12227.1	19p13.2	2013-02-12	2007-07-27	2007-07-27		ENSG00000130811		"""RNA binding motif (RRM) containing"""	3274	protein-coding gene	gene with protein product		603913	"""eukaryotic translation initiation factor 3, subunit 4 delta, 44kDa"""	EIF3S4		9822659	Standard	NM_003755		Approved	eIF3-delta, eIF3-p44, eIF3g	uc002mnd.3	O75821		ENST00000253108.4:c.6T>C	chr19.hg19:g.10230530A>G		120.0	0.0	.	663	114.0	27.0	.	NM_003755		Silent	SNP	ENST00000253108.4	hg19	CCDS12227.1																																																																																			.	.	.	none		0.642	EIF3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451144.1		
ZNF627	199692	hgsc.bcm.edu	37	19	11728624	11728624	+	Missense_Mutation	SNP	G	G	T			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr19:11728624G>T	ENST00000361113.5	+	4	1514	c.1306G>T	c.(1306-1308)Gta>Tta	p.V436L	ZNF627_ENST00000588174.1_3'UTR	NM_145295.3	NP_660338.1	Q7L945	ZN627_HUMAN	zinc finger protein 627	436					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14						TTACTTTCGAGTACATGAAAA	0.423																																					p.V436L	Melanoma(112;173 1614 10731 17751 23322)	Atlas-SNP	.											.	ZNF627	43	.	0			c.G1306T						PASS	.						55.0	59.0	57.0					19																	11728624		2198	4297	6495	SO:0001583	missense	199692	exon4			TTTCGAGTACATG	AK074846	CCDS42502.1	19p13.2	2013-01-08				ENSG00000198551		"""Zinc fingers, C2H2-type"", ""-"""	30570	protein-coding gene	gene with protein product		612248				12477932	Standard	NM_145295		Approved	FLJ90365	uc002msk.2	Q7L945		ENST00000361113.5:c.1306G>T	chr19.hg19:g.11728624G>T	ENSP00000354414:p.Val436Leu	186.0	0.0	.		149.0	38.0	.	NM_145295	O14846|Q4KMP9|Q6NT81|Q9BRG4	Missense_Mutation	SNP	ENST00000361113.5	hg19	CCDS42502.1	.	.	.	.	.	.	.	.	.	.	g	3.954	-0.011756	0.07727	.	.	ENSG00000198551	ENST00000361113	T	0.07908	3.15	1.43	-2.1	0.07210	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04588	0.0125	N	0.25825	0.765	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44345	-0.9334	9	0.23302	T	0.38	.	3.0288	0.06099	0.5661:0.2481:0.1857:0.0	.	436	Q7L945	ZN627_HUMAN	L	436	ENSP00000354414:V436L	ENSP00000354414:V436L	V	+	1	0	ZNF627	11589624	0.000000	0.05858	0.000000	0.03702	0.781000	0.44180	-2.946000	0.00680	-0.450000	0.07107	-0.670000	0.03821	GTA	.	.	.	none		0.423	ZNF627-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458875.1	NM_145295	
SLC5A3	6526	hgsc.bcm.edu	37	21	35467607	35467607	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr21:35467607G>A	ENST00000381151.3	+	2	622	c.110G>A	c.(109-111)aGt>aAt	p.S37N	AP000320.7_ENST00000362077.4_RNA|MRPS6_ENST00000399312.2_Intron|SLC5A3_ENST00000608209.1_Missense_Mutation_p.S37N			P53794	SC5A3_HUMAN	solute carrier family 5 (sodium/myo-inositol cotransporter), member 3	37					inositol metabolic process (GO:0006020)|peripheral nervous system development (GO:0007422)|regulation of respiratory gaseous exchange (GO:0043576)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	myo-inositol:sodium symporter activity (GO:0005367)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	20						AGCACCGTGAGTGGATACTTC	0.488																																					p.S37N		Atlas-SNP	.											.	SLC5A3	52	.	0			c.G110A						PASS	.						169.0	168.0	169.0					21																	35467607		2203	4300	6503	SO:0001583	missense	6526	exon2			CCGTGAGTGGATA		CCDS33549.1	21q22.11	2013-05-22	2008-09-02		ENSG00000198743	ENSG00000198743		"""Solute carriers"""	11038	protein-coding gene	gene with protein product		600444	"""solute carrier family 5 (inositol transporter), member 3"""			7789985	Standard	NM_006933		Approved	SMIT, SMIT1	uc002yto.3	P53794	OTTHUMG00000065821	ENST00000381151.3:c.110G>A	chr21.hg19:g.35467607G>A	ENSP00000370543:p.Ser37Asn	265.0	0.0	.		308.0	107.0	.	NM_006933	O43489	Missense_Mutation	SNP	ENST00000381151.3	hg19	CCDS33549.1	.	.	.	.	.	.	.	.	.	.	G	14.33	2.502590	0.44455	.	.	ENSG00000198743	ENST00000381151	D	0.86497	-2.13	6.09	6.09	0.99107	.	0.000000	0.85682	D	0.000000	D	0.84252	0.5431	L	0.42487	1.325	0.52099	D	0.999947	B	0.27286	0.174	B	0.20767	0.031	T	0.80355	-0.1417	10	0.56958	D	0.05	.	19.2541	0.93938	0.0:0.0:1.0:0.0	.	37	P53794	SC5A3_HUMAN	N	37	ENSP00000370543:S37N	ENSP00000370543:S37N	S	+	2	0	SLC5A3	34389477	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.594000	0.98254	2.898000	0.99336	0.596000	0.82720	AGT	.	.	.	none		0.488	SLC5A3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000141037.1		
SUSD2	56241	hgsc.bcm.edu	37	22	24581140	24581140	+	Silent	SNP	C	C	A			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr22:24581140C>A	ENST00000358321.3	+	6	1122	c.861C>A	c.(859-861)gcC>gcA	p.A287A		NM_019601.3	NP_062547.1	Q9UGT4	SUSD2_HUMAN	sushi domain containing 2	287	AMOP. {ECO:0000255|PROSITE- ProRule:PRU00347}.				immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	26						ACCCTGTGGCCTGGGCACGAA	0.662																																					p.A287A		Atlas-SNP	.											.	SUSD2	68	.	0			c.C861A						PASS	.						29.0	30.0	30.0					22																	24581140		2203	4299	6502	SO:0001819	synonymous_variant	56241	exon6			TGTGGCCTGGGCA	AK026431	CCDS13824.1	22q11-q12	2005-08-16			ENSG00000099994	ENSG00000099994			30667	protein-coding gene	gene with protein product		615825				12477932	Standard	NM_019601		Approved	BK65A6.2, FLJ22778	uc002zzn.1	Q9UGT4	OTTHUMG00000150792	ENST00000358321.3:c.861C>A	chr22.hg19:g.24581140C>A		79.0	0.0	.		69.0	21.0	.	NM_019601	Q9H5Y6	Silent	SNP	ENST00000358321.3	hg19	CCDS13824.1																																																																																			.	.	.	none		0.662	SUSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320088.1	NM_019601	
TTLL1	25809	hgsc.bcm.edu	37	22	43442517	43442517	+	Silent	SNP	C	C	G			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr22:43442517C>G	ENST00000266254.7	-	10	1281	c.1041G>C	c.(1039-1041)ctG>ctC	p.L347L	TTLL1_ENST00000331018.7_Silent_p.L318L|AL022476.2_ENST00000443063.1_RNA	NM_012263.4	NP_036395.1	O95922	TTLL1_HUMAN	tubulin tyrosine ligase-like family, member 1	347	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				axoneme assembly (GO:0035082)|epithelial cilium movement (GO:0003351)|protein polyglutamylation (GO:0018095)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	tubulin-glutamic acid ligase activity (GO:0070740)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|skin(2)|stomach(1)	23		Ovarian(80;0.0694)		BRCA - Breast invasive adenocarcinoma(115;0.00461)		TGTCATTAATCAGGTTGTACT	0.512																																					p.L347L		Atlas-SNP	.											.	TTLL1	41	.	0			c.G1041C						PASS	.						365.0	313.0	331.0					22																	43442517		2203	4300	6503	SO:0001819	synonymous_variant	25809	exon10			ATTAATCAGGTTG	AL096886	CCDS14043.1	22q13.1	2013-02-14			ENSG00000100271	ENSG00000100271		"""Tubulin tyrosine ligase-like family"""	1312	protein-coding gene	gene with protein product		608955	"""tubulin tyrosine ligase-like 1"""	C22orf7		10591208, 11054573	Standard	NM_012263		Approved		uc003bdi.3	O95922	OTTHUMG00000150699	ENST00000266254.7:c.1041G>C	chr22.hg19:g.43442517C>G		317.0	0.0	.		301.0	13.0	.	NM_012263	B2RDS7|Q9BR27|Q9NRS9|Q9UMU0	Silent	SNP	ENST00000266254.7	hg19	CCDS14043.1	.	.	.	.	.	.	.	.	.	.	C	3.860	-0.030135	0.07543	.	.	ENSG00000100271	ENST00000495814	.	.	.	5.41	0.463	0.16700	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.2216	0.15371	0.1717:0.307:0.4416:0.0796	.	.	.	.	S	273	.	.	X	-	2	2	TTLL1	41772461	0.997000	0.39634	0.466000	0.27168	0.403000	0.30841	0.331000	0.19733	0.219000	0.20840	0.555000	0.69702	TGA	.	.	.	none		0.512	TTLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319659.1	NM_012263	
MT-CO2	4513	hgsc.bcm.edu	37	M	8060	8060	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chrM:8060G>A	ENST00000361739.1	+	1	475	c.475G>A	c.(475-477)Gtc>Atc	p.V159I	MT-ND3_ENST00000361227.2_5'Flank|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TC_ENST00000387405.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TR_ENST00000387439.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-ND4L_ENST00000361335.1_5'Flank			P00403	COX2_HUMAN	mitochondrially encoded cytochrome c oxidase II	159					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|respiratory chain complex IV (GO:0045277)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)			endometrium(5)|kidney(8)|lung(2)|pancreas(3)|prostate(1)	19						CATCACAAGACGTCTTGCACT	0.478																																					p.V159I		Atlas-SNP	.											.	.	.	.	0			c.G475A						PASS	.																																			SO:0001583	missense	5743	exon1			CAAGACGTCTTGC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198712	ENSG00000198712		"""Mitochondrial respiratory chain complex / Complex IV"""	7421	protein-coding gene	gene with protein product		516040	"""cytochrome c oxidase II"""	MTCO2		1712754, 1989603	Standard			Approved	COX2, CO2		P00403		ENST00000361739.1:c.475G>A	chrM.hg19:g.8060G>A	ENSP00000354876:p.Val159Ile	60.0	0.0	.		75.0	7.0	.	ENST00000361739	Q37526	Missense_Mutation	SNP	ENST00000361739.1	hg19																																																																																				.	T|1.000;|0.000	.	alt		0.478	MT-CO2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024029	
SELE	6401	hgsc.bcm.edu	37	1	169698749	169698749	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr1:169698749delT	ENST00000333360.7	-	6	920	c.781delA	c.(781-783)agcfs	p.S261fs	C1orf112_ENST00000498289.1_Intron|SELE_ENST00000367775.1_Frame_Shift_Del_p.S199fs|SELE_ENST00000367779.4_Frame_Shift_Del_p.S261fs|SELE_ENST00000367780.4_Frame_Shift_Del_p.S199fs|SELE_ENST00000367782.4_Frame_Shift_Del_p.S261fs|SELE_ENST00000367774.1_Frame_Shift_Del_p.S261fs|SELE_ENST00000367777.1_Frame_Shift_Del_p.S261fs|SELE_ENST00000367776.1_Frame_Shift_Del_p.S261fs|SELE_ENST00000367781.4_Frame_Shift_Del_p.S261fs	NM_000450.2	NP_000441.2	P16581	LYAM2_HUMAN	selectin E	261	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				actin filament-based process (GO:0030029)|activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|leukocyte tethering or rolling (GO:0050901)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of receptor internalization (GO:0002092)|regulation of inflammatory response (GO:0050727)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)	caveola (GO:0005901)|coated pit (GO:0005905)|cortical cytoskeleton (GO:0030863)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	oligosaccharide binding (GO:0070492)|phospholipase binding (GO:0043274)|sialic acid binding (GO:0033691)|transmembrane signaling receptor activity (GO:0004888)	p.S261G(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(3)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	all_hematologic(923;0.208)				Carvedilol(DB01136)	CATGGGAAGCTTCCAGGGTTT	0.448																																					p.S261fs		Atlas-INDEL	.											.	SELE	84	.	1	Substitution - Missense(1)	lung(1)	c.782delG						PASS	.						137.0	130.0	132.0					1																	169698749		2203	4300	6503	SO:0001589	frameshift_variant	6401	exon6			.	M30640	CCDS1283.1	1q22-q25	2008-07-31	2008-07-31		ENSG00000007908	ENSG00000007908		"""CD molecules"""	10718	protein-coding gene	gene with protein product		131210	"""endothelial adhesion molecule 1"""	ELAM1, ELAM		1375831	Standard	NM_000450		Approved	ESEL, CD62E	uc001ggm.4	P16581	OTTHUMG00000034851	ENST00000333360.7:c.781delA	chr1.hg19:g.169698749delT	ENSP00000331736:p.Ser261fs	235.0	0.0	0		250.0	97.0	0.388	NM_000450	A2RRD6|P16111	Frame_Shift_Del	DEL	ENST00000333360.7	hg19	CCDS1283.1																																																																																			.	.	.	none		0.448	SELE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084333.1	NM_000450	
ANGEL1	23357	hgsc.bcm.edu	37	14	77274402	77274411	+	Frame_Shift_Del	DEL	GAGTGAACTG	GAGTGAACTG	-	rs138394702	byFrequency	TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	GAGTGAACTG	GAGTGAACTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr14:77274402_77274411delGAGTGAACTG	ENST00000251089.2	-	3	842_851	c.730_739delCAGTTCACTC	c.(730-741)cagttcactctgfs	p.QFTL244fs	ANGEL1_ENST00000554941.1_5'Flank	NM_015305.3	NP_056120.2	Q9UNK9	ANGE1_HUMAN	angel homolog 1 (Drosophila)	244										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(2)|lung(9)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	22			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0285)		TAAGACATCAGAGTGAACTGGAACTGAGGG	0.505																																					p.244_247del		Atlas-INDEL	.											.	ANGEL1	63	.	0			c.731_740del						PASS	.																																			SO:0001589	frameshift_variant	23357	exon3			.	AF111169	CCDS9852.1	14q24.3	2014-06-17		2005-08-04	ENSG00000013523	ENSG00000013523			19961	protein-coding gene	gene with protein product				KIAA0759		11943475	Standard	NM_015305		Approved	Ccr4e	uc001xsv.3	Q9UNK9	OTTHUMG00000171494	ENST00000251089.2:c.730_739delCAGTTCACTC	chr14.hg19:g.77274402_77274411delGAGTGAACTG	ENSP00000251089:p.Gln244fs	121.0	0.0	0		121.0	26.0	0.214876	NM_015305	B4DWL7|O94859|Q8NCS9	Frame_Shift_Del	DEL	ENST00000251089.2	hg19	CCDS9852.1																																																																																			.	.	.	none		0.505	ANGEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413712.2	NM_015305	
PIPOX	51268	hgsc.bcm.edu	37	17	27370356	27370357	+	Splice_Site	INS	-	-	G			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr17:27370356_27370357insG	ENST00000323372.4	+	1	439_440	c.113_114insG	c.(112-117)cagttc>caGgttc	p.F39fs	PIPOX_ENST00000583215.1_Intron	NM_016518.2	NP_057602.2	Q9P0Z9	SOX_HUMAN	pipecolic acid oxidase	39					L-lysine catabolic process to acetyl-CoA via L-pipecolate (GO:0033514)|oxidation-reduction process (GO:0055114)|tetrahydrofolate metabolic process (GO:0046653)	peroxisome (GO:0005777)	L-pipecolate oxidase activity (GO:0050031)|receptor binding (GO:0005102)|sarcosine oxidase activity (GO:0008115)			endometrium(2)|large_intestine(4)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	10	Lung NSC(42;0.015)		Epithelial(11;9.87e-06)|BRCA - Breast invasive adenocarcinoma(11;3.92e-05)|all cancers(11;5.59e-05)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)		Glycine(DB00145)	CTGCTGGAGCAGGTACTGTGTC	0.584																																					p.Q38fs		Atlas-INDEL	.											.	PIPOX	42	.	0			c.113_114insG						PASS	.																																			SO:0001630	splice_region_variant	51268	exon1			.	AF134593	CCDS11248.1	17p13.2	2008-07-18			ENSG00000179761	ENSG00000179761			17804	protein-coding gene	gene with protein product	"""L-pipecolic acid oxidase"""					10772957, 10642506	Standard	NM_016518		Approved	LPIPOX	uc002hdr.1	Q9P0Z9	OTTHUMG00000132679	ENST00000323372.4:c.114+1->G	chr17.hg19:g.27370358_27370358dupG		91.0	0.0	0		156.0	78.0	0.5	NM_016518	B3KNH0|Q96H28|Q9C070	Frame_Shift_Ins	INS	ENST00000323372.4	hg19	CCDS11248.1																																																																																			.	.	.	none		0.584	PIPOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255954.1	NM_016518	Frame_Shift_Ins
FBN3	84467	hgsc.bcm.edu	37	19	8182139	8182139	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr19:8182139delT	ENST00000600128.1	-	28	3914	c.3500delA	c.(3499-3501)gacfs	p.D1167fs	FBN3_ENST00000601739.1_Frame_Shift_Del_p.D1167fs|FBN3_ENST00000270509.2_Frame_Shift_Del_p.D1167fs			Q75N90	FBN3_HUMAN	fibrillin 3	1167	EGF-like 16; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						ACAGTGCACGTCACACCCACC	0.637																																					p.D1167fs		Atlas-INDEL	.											.	FBN3	300	.	0			c.3501delC						PASS	.						82.0	67.0	72.0					19																	8182139		2203	4300	6503	SO:0001589	frameshift_variant	84467	exon27			.		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.3500delA	chr19.hg19:g.8182139delT	ENSP00000470498:p.Asp1167fs	86.0	0.0	0		62.0	14.0	0.225806	NM_032447	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Frame_Shift_Del	DEL	ENST00000600128.1	hg19	CCDS12196.1																																																																																			.	.	.	none		0.637	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2	NM_032447	
EP300	2033	hgsc.bcm.edu	37	22	41574679	41574681	+	In_Frame_Del	DEL	CCC	CCC	-			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	CCC	CCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr22:41574679_41574681delCCC	ENST00000263253.7	+	31	8183_8185	c.6964_6966delCCC	c.(6964-6966)cccdel	p.P2323del	RP1-85F18.6_ENST00000415054.1_RNA|RP1-85F18.5_ENST00000420537.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	2323					apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						ACAGTCCCAGCCCCCCCACTCCA	0.616			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																												p.2321_2322del		Atlas-INDEL	.		Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	.	EP300	367	.	0			c.6963_6965del						PASS	.																																			SO:0001651	inframe_deletion	2033	exon31	Familial Cancer Database	Broad Thumb-Hallux syndrome	.	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.6964_6966delCCC	chr22.hg19:g.41574682_41574684delCCC	ENSP00000263253:p.Pro2323del	135.0	0.0	0		146.0	38.0	0.260274	NM_001429	B1AKC2	In_Frame_Del	DEL	ENST00000263253.7	hg19	CCDS14010.1																																																																																			.	.	.	none		0.616	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1	NM_001429	
CEP350	9857	hgsc.bcm.edu	37	1	179965912	179965912	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B3-4103-01A-01D-1458-08	TCGA-B3-4103-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	62fba643-8f61-4d98-afe1-fbfeca74cdfa	3fbd8531-47c5-4f07-9928-0b4e7cd5aad5	g.chr1:179965912delA	ENST00000367607.3	+	6	1038	c.620delA	c.(619-621)caafs	p.Q207fs		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	207					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						GATGCATTGCAAAATTCTGAA	0.378																																					p.Q207fs		Atlas-INDEL	.											.	CEP350	418	.	0			c.619delC						PASS	.						78.0	73.0	75.0					1																	179965912		2203	4300	6503	SO:0001589	frameshift_variant	9857	exon6			.	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.620delA	chr1.hg19:g.179965912delA	ENSP00000356579:p.Gln207fs	44.0	0.0	0		55.0	12.0	0.218182	NM_014810	O75068|Q8TDK3|Q8WY20	Frame_Shift_Del	DEL	ENST00000367607.3	hg19	CCDS1336.1																																																																																			.	.	.	none		0.378	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810	
