#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ATP5F1	515	hgsc.bcm.edu	37	1	112002161	112002161	+	Missense_Mutation	SNP	A	A	G	rs201457142		TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr1:112002161A>G	ENST00000369722.3	+	6	1202	c.596A>G	c.(595-597)tAt>tGt	p.Y199C	ATP5F1_ENST00000483994.1_Missense_Mutation_p.Y138C|ATP5F1_ENST00000369721.4_3'UTR	NM_001688.4	NP_001679.2	P24539	AT5F1_HUMAN	ATP synthase, H+ transporting, mitochondrial Fo complex, subunit B1	199					ATP catabolic process (GO:0006200)|ATP synthesis coupled proton transport (GO:0015986)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase complex, coupling factor F(o) (GO:0000276)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)			breast(1)|cervix(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	8		all_cancers(81;8.16e-06)|all_epithelial(167;5.63e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0238)|Colorectal(144;0.0296)|all cancers(265;0.0488)|Epithelial(280;0.0732)|COAD - Colon adenocarcinoma(174;0.114)|LUSC - Lung squamous cell carcinoma(189;0.135)		CGCCTGGACTATCATATATCT	0.418													A|||	1	0.000199681	0.0008	0.0	5008	,	,		19484	0.0		0.0	False		,,,				2504	0.0				p.Y199C		Atlas-SNP	.											.	ATP5F1	20	.	0			c.A596G						PASS	.	A	CYS/TYR	1,4405	2.1+/-5.4	0,1,2202	79.0	85.0	83.0		596	4.8	1.0	1		83	1,8599		0,1,4299	no	missense	ATP5F1	NM_001688.4	194	0,2,6501	GG,GA,AA		0.0116,0.0227,0.0154	probably-damaging	199/257	112002161	2,13004	2203	4300	6503	SO:0001583	missense	515	exon6			TGGACTATCATAT	X60221	CCDS836.1	1p13.2	2012-10-12	2010-06-11		ENSG00000116459	ENSG00000116459		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	840	protein-coding gene	gene with protein product		603270	"""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit b, isoform 1"", ""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit B1"""			1831354	Standard	XM_005270929		Approved		uc001ebc.3	P24539	OTTHUMG00000011745	ENST00000369722.3:c.596A>G	chr1.hg19:g.112002161A>G	ENSP00000358737:p.Tyr199Cys	73.0	0.0	.		50.0	7.0	.	NM_001688	Q9BQ68|Q9BRU8	Missense_Mutation	SNP	ENST00000369722.3	hg19	CCDS836.1	.	.	.	.	.	.	.	.	.	.	A	16.68	3.189998	0.58017	2.27E-4	1.16E-4	ENSG00000116459	ENST00000369722;ENST00000483994	T;T	0.38887	1.11;1.11	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.62950	0.2470	M	0.89095	3.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.71178	-0.4669	10	0.59425	D	0.04	.	14.394	0.66999	1.0:0.0:0.0:0.0	.	199;199	Q08ET0;P24539	.;AT5F1_HUMAN	C	199;138	ENSP00000358737:Y199C;ENSP00000420366:Y138C	ENSP00000358737:Y199C	Y	+	2	0	ATP5F1	111803684	1.000000	0.71417	0.998000	0.56505	0.208000	0.24298	8.489000	0.90461	1.956000	0.56807	0.383000	0.25322	TAT	.	A|0.999;G|0.001	0.001	weak		0.418	ATP5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032455.1	NM_001688	
SLC16A1	6566	hgsc.bcm.edu	37	1	113460277	113460277	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr1:113460277G>A	ENST00000538576.1	-	4	1582	c.751C>T	c.(751-753)Cag>Tag	p.Q251*	SLC16A1_ENST00000369626.3_Nonsense_Mutation_p.Q251*|SLC16A1_ENST00000433570.4_Nonsense_Mutation_p.Q251*	NM_001166496.1	NP_001159968.1	P53985	MOT1_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 1	251					behavioral response to nutrient (GO:0051780)|blood coagulation (GO:0007596)|cellular metabolic process (GO:0044237)|cellular response to organic cyclic compound (GO:0071407)|centrosome organization (GO:0051297)|glucose homeostasis (GO:0042593)|leukocyte migration (GO:0050900)|lipid metabolic process (GO:0006629)|mevalonate transport (GO:0015728)|monocarboxylic acid transport (GO:0015718)|plasma membrane lactate transport (GO:0035879)|pyruvate metabolic process (GO:0006090)|regulation of insulin secretion (GO:0050796)|response to food (GO:0032094)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	mevalonate transmembrane transporter activity (GO:0015130)|monocarboxylic acid transmembrane transporter activity (GO:0008028)|organic cyclic compound binding (GO:0097159)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(8)|skin(1)|urinary_tract(1)	20	Lung SC(450;0.246)	all_cancers(81;7.6e-08)|all_epithelial(167;3.82e-07)|all_lung(203;3.07e-05)|Lung NSC(69;5.51e-05)|Prostate(1639;0.00232)		Epithelial(280;7.31e-13)|all cancers(265;5.1e-10)|Kidney(133;5.29e-07)|KIRC - Kidney renal clear cell carcinoma(1967;8.63e-06)|OV - Ovarian serous cystadenocarcinoma(397;1.48e-05)|BRCA - Breast invasive adenocarcinoma(282;0.003)|LUSC - Lung squamous cell carcinoma(189;0.008)|Lung(183;0.00948)|Colorectal(144;0.0325)|COAD - Colon adenocarcinoma(174;0.0643)	Acetic acid(DB03166)|Aminohippurate(DB00345)|Ampicillin(DB00415)|Foscarnet(DB00529)|Gamma Hydroxybutyric Acid(DB01440)|Methotrexate(DB00563)|Nateglinide(DB00731)|Niacin(DB00627)|Niflumic Acid(DB04552)|Pravastatin(DB00175)|Probenecid(DB01032)|Pyruvic acid(DB00119)|Salicylic acid(DB00936)|Valproic Acid(DB00313)	TCCAGGAACTGATTAATTGTT	0.388																																					p.Q251X		Atlas-SNP	.											.	SLC16A1	61	.	0			c.C751T						PASS	.						101.0	103.0	103.0					1																	113460277		2203	4300	6503	SO:0001587	stop_gained	6566	exon4			GGAACTGATTAAT	BC026317	CCDS858.1	1p12	2013-07-18	2013-07-18		ENSG00000155380	ENSG00000155380		"""Solute carriers"""	10922	protein-coding gene	gene with protein product		600682	"""solute carrier family 16 (monocarboxylic acid transporters), member 1"", ""solute carrier family 16, member 1 (monocarboxylic acid transporter 1)"""			8124722, 7835905	Standard	NM_003051		Approved	MCT, MCT1	uc001ecy.3	P53985	OTTHUMG00000012129	ENST00000538576.1:c.751C>T	chr1.hg19:g.113460277G>A	ENSP00000441065:p.Gln251*	156.0	0.0	.		86.0	17.0	.	NM_001166496	Q49A45|Q5T8R6|Q9NSJ9	Nonsense_Mutation	SNP	ENST00000538576.1	hg19	CCDS858.1	.	.	.	.	.	.	.	.	.	.	G	18.51	3.639199	0.67244	.	.	ENSG00000155380	ENST00000369626;ENST00000538576;ENST00000458229;ENST00000433570;ENST00000443580	.	.	.	5.74	-3.2	0.05156	.	0.477590	0.27223	N	0.020353	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.6817	0.91548	0.0:0.0:0.6596:0.3404	.	.	.	.	X	251	.	ENSP00000358640:Q251X	Q	-	1	0	SLC16A1	113261800	0.997000	0.39634	0.183000	0.23137	0.253000	0.25986	1.851000	0.39338	-0.739000	0.04809	-0.457000	0.05445	CAG	.	.	.	none		0.388	SLC16A1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033539.1	NM_003051	
SNAPIN	23557	hgsc.bcm.edu	37	1	153631989	153631989	+	Missense_Mutation	SNP	C	C	G			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr1:153631989C>G	ENST00000368685.5	+	3	346	c.256C>G	c.(256-258)Ctt>Gtt	p.L86V	SNAPIN_ENST00000478558.1_3'UTR|ILF2_ENST00000480213.1_5'Flank	NM_012437.5	NP_036569.1	O95295	SNAPN_HUMAN	SNAP-associated protein	86	Interaction with TOR1A.				anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|endosome to lysosome transport (GO:0008333)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|negative regulation of neuron projection development (GO:0010977)|neuron projection development (GO:0031175)|neurotransmitter secretion (GO:0007269)|positive regulation of late endosome to lysosome transport (GO:1902824)|regulation of protein binding (GO:0043393)|synaptic vesicle exocytosis (GO:0016079)|synaptic vesicle fusion to presynaptic membrane (GO:0031629)|synaptic vesicle maturation (GO:0016188)|synaptic vesicle transport (GO:0048489)|terminal button organization (GO:0072553)|viral process (GO:0016032)	BLOC-1 complex (GO:0031083)|cell junction (GO:0030054)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleolus (GO:0005730)|perinuclear region of cytoplasm (GO:0048471)|secretory granule (GO:0030141)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	SNARE binding (GO:0000149)			lung(3)	3	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			TAAGAAGCTACTTAATGCCCG	0.443																																					p.L86V		Atlas-SNP	.											.	SNAPIN	6	.	0			c.C256G						PASS	.						147.0	146.0	146.0					1																	153631989		2203	4300	6503	SO:0001583	missense	23557	exon3			AAGCTACTTAATG	AF086837	CCDS1049.1	1q22	2013-09-27		2007-11-14	ENSG00000143553	ENSG00000143553		"""Biogenesis of lysosomal organelles complex-1 subunits"""	17145	protein-coding gene	gene with protein product	"""snapin"", ""SNAP-25-binding protein"", ""biogenesis of lysosomal organelles complex-1, subunit 7"""	607007		SNAPAP		10195194, 12659861	Standard	NM_012437		Approved	BLOC1S7	uc001fcq.4	O95295	OTTHUMG00000037086	ENST00000368685.5:c.256C>G	chr1.hg19:g.153631989C>G	ENSP00000357674:p.Leu86Val	148.0	0.0	.		95.0	14.0	.	NM_012437	D3DV56|Q5SXU8	Missense_Mutation	SNP	ENST00000368685.5	hg19	CCDS1049.1	.	.	.	.	.	.	.	.	.	.	C	15.11	2.734669	0.48939	.	.	ENSG00000143553	ENST00000368685	T	0.46451	0.87	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.19685	0.0473	L	0.39245	1.2	0.49582	D	0.999803	B	0.28998	0.23	B	0.20955	0.032	T	0.03364	-1.1044	10	0.15066	T	0.55	-16.4091	17.2626	0.87075	0.0:1.0:0.0:0.0	.	86	O95295	SNAPN_HUMAN	V	86	ENSP00000357674:L86V	ENSP00000357674:L86V	L	+	1	0	SNAPIN	151898613	0.999000	0.42202	0.961000	0.40146	0.986000	0.74619	4.168000	0.58216	2.941000	0.99782	0.655000	0.94253	CTT	.	.	.	none		0.443	SNAPIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090036.1	NM_012437	
NLRC4	58484	hgsc.bcm.edu	37	2	32475306	32475307	+	Missense_Mutation	DNP	GC	GC	CT			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr2:32475306_32475307GC>CT	ENST00000404025.2	-	5	2114_2115	c.1626_1627GC>AG	c.(1624-1629)gaGCaa>gaAGaa	p.Q543E	NLRC4_ENST00000342905.6_Intron|NLRC4_ENST00000360906.5_Missense_Mutation_p.Q543E|NLRC4_ENST00000402280.1_Missense_Mutation_p.Q543E			Q9NPP4	NLRC4_HUMAN	NLR family, CARD domain containing 4	543					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of innate immune response (GO:0002218)|defense response to bacterium (GO:0042742)|detection of bacterium (GO:0016045)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of apoptotic process (GO:0043065)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein homooligomerization (GO:0051260)|pyroptosis (GO:0070269)	cytosol (GO:0005829)|intracellular (GO:0005622)|IPAF inflammasome complex (GO:0072557)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(1)|ovary(3)|skin(2)|stomach(2)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					AGAATTTCTTGCTCAGTGGTGT	0.446																																					p.Q543E|p.E542E		Atlas-SNP	.											.	NLRC4	165	.	0			c.C1627G|c.G1626A						PASS	.																																			SO:0001583	missense	58484	exon4			TTTCTTGCTCAGT|TTCTTGCTCAGTG	AF376061	CCDS33174.1	2p22-p21	2008-08-27	2006-12-08	2006-12-08	ENSG00000091106	ENSG00000091106		"""Nucleotide-binding domain and leucine rich repeat containing"""	16412	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 4"", ""NOD-like receptor C4"""	606831	"""caspase recruitment domain family, member 12"""	CARD12		11374873	Standard	NM_021209		Approved	CLAN1, ipaf, CLANA, CLANB, CLANC, CLAND, CLR2.1, CLAN	uc021vfq.1	Q9NPP4	OTTHUMG00000152107	ENST00000404025.2:c.1626_1627delinsCT	chr2.hg19:g.32475306_32475307delinsCT	ENSP00000385090:p.Gln543Glu	164.0|163.0	0.0	.		105.0|106.0	21.0	.	NM_001199138	A8K9F8|B2RBQ3|B3KTF0|D6W580|Q96J81|Q96J82|Q96J83	Missense_Mutation|Silent	SNP	ENST00000404025.2	hg19	CCDS33174.1																																																																																			.	.	.	none		0.446	NLRC4-001	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325222.2	NM_021209	
HAT1	8520	hgsc.bcm.edu	37	2	172848182	172848182	+	Missense_Mutation	SNP	C	C	A			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr2:172848182C>A	ENST00000264108.4	+	11	1212	c.1176C>A	c.(1174-1176)agC>agA	p.S392R	SLC25A12_ENST00000472748.1_Intron|HAT1_ENST00000392584.1_Missense_Mutation_p.S307R	NM_003642.3	NP_003633.1	O14929	HAT1_HUMAN	histone acetyltransferase 1	392					chromatin organization (GO:0006325)|chromatin silencing at telomere (GO:0006348)|DNA packaging (GO:0006323)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4 acetylation (GO:0043967)|internal protein amino acid acetylation (GO:0006475)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	H4 histone acetyltransferase activity (GO:0010485)|histone acetyltransferase activity (GO:0004402)			breast(1)|kidney(1)|large_intestine(5)|liver(2)|lung(8)|ovary(1)|prostate(1)	19			OV - Ovarian serous cystadenocarcinoma(117;0.216)			TAGAAATAAGCATGCAACATG	0.388																																					p.S392R		Atlas-SNP	.											HAT1,NS,carcinoma,0,1	HAT1	40	.	0			c.C1176A						PASS	.						112.0	112.0	112.0					2																	172848182		2203	4300	6503	SO:0001583	missense	8520	exon11			AATAAGCATGCAA	AF030424	CCDS2245.1	2q31.2-q33.1	2011-07-01			ENSG00000128708	ENSG00000128708	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"""	4821	protein-coding gene	gene with protein product		603053				9427644	Standard	NM_003642		Approved	KAT1	uc002uhi.3	O14929	OTTHUMG00000132282	ENST00000264108.4:c.1176C>A	chr2.hg19:g.172848182C>A	ENSP00000264108:p.Ser392Arg	77.0	0.0	.		55.0	3.0	.	NM_003642	Q49A44|Q53QF0|Q53SU4|Q6P594|Q8WWB9	Missense_Mutation	SNP	ENST00000264108.4	hg19	CCDS2245.1	.	.	.	.	.	.	.	.	.	.	C	3.309	-0.141123	0.06669	.	.	ENSG00000128708	ENST00000392584;ENST00000264108	.	.	.	5.94	3.11	0.35812	.	0.224777	0.53938	D	0.000049	T	0.40423	0.1116	L	0.38175	1.15	0.32521	N	0.536232	B	0.02656	0.0	B	0.04013	0.001	T	0.45220	-0.9276	9	0.87932	D	0	-6.6111	8.5772	0.33605	0.0:0.7345:0.127:0.1386	.	392	O14929	HAT1_HUMAN	R	307;392	.	ENSP00000264108:S392R	S	+	3	2	HAT1	172556428	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.923000	0.28757	0.370000	0.24538	0.591000	0.81541	AGC	.	.	.	none		0.388	HAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255377.1	NM_003642	
ZNF142	7701	hgsc.bcm.edu	37	2	219510938	219510938	+	Missense_Mutation	SNP	C	C	A			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr2:219510938C>A	ENST00000449707.1	-	7	1828	c.1407G>T	c.(1405-1407)aaG>aaT	p.K469N	ZNF142_ENST00000411696.2_Missense_Mutation_p.K469N	NM_001105537.1	NP_001099007.1	P52746	ZN142_HUMAN	zinc finger protein 142	469					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(7)|endometrium(7)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38		Renal(207;0.0474)		Epithelial(149;5.21e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		GGAGGTAGTGCTTCCACTTGG	0.517																																					p.K469N	Colon(170;867 1942 8995 15834 18053)	Atlas-SNP	.											.	ZNF142	190	.	0			c.G1407T						PASS	.						226.0	220.0	222.0					2																	219510938		2153	4245	6398	SO:0001583	missense	7701	exon7			GTAGTGCTTCCAC	U09849	CCDS42817.1	2q35	2013-01-08	2006-06-13		ENSG00000115568	ENSG00000115568		"""Zinc fingers, C2H2-type"""	12927	protein-coding gene	gene with protein product		604083	"""zinc finger protein 142 (clone pHZ-49)"""				Standard	NM_001105537		Approved	KIAA0236, pHZ-49	uc002vin.4	P52746	OTTHUMG00000154736	ENST00000449707.1:c.1407G>T	chr2.hg19:g.219510938C>A	ENSP00000408643:p.Lys469Asn	134.0	0.0	.		139.0	32.0	.	NM_001105537	Q92510	Missense_Mutation	SNP	ENST00000449707.1	hg19	CCDS42817.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.188772	0.78789	.	.	ENSG00000115568	ENST00000449707;ENST00000411696	T;T	0.54071	0.59;0.59	5.19	5.19	0.71726	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.62684	0.2448	L	0.41906	1.305	0.42919	D	0.994282	D;D	0.89917	1.0;0.999	D;D	0.85130	0.996;0.997	T	0.62978	-0.6739	10	0.54805	T	0.06	-14.9575	12.26	0.54645	0.0:0.9228:0.0:0.0772	.	469;306	P52746;A8MWU9	ZN142_HUMAN;.	N	469	ENSP00000408643:K469N;ENSP00000398798:K469N	ENSP00000398798:K469N	K	-	3	2	ZNF142	219219182	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.173000	0.50839	2.709000	0.92574	0.561000	0.74099	AAG	.	.	.	none		0.517	ZNF142-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336833.1	NM_005081	
ADAMTS16	170690	hgsc.bcm.edu	37	5	5235247	5235247	+	Missense_Mutation	SNP	C	C	G			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr5:5235247C>G	ENST00000274181.7	+	13	2109	c.1971C>G	c.(1969-1971)agC>agG	p.S657R	ADAMTS16_ENST00000513709.1_3'UTR	NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	657	Cys-rich.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						AGCACAACAGCAGACGATTCA	0.512																																					p.S657R		Atlas-SNP	.											.	ADAMTS16	543	.	0			c.C1971G						PASS	.						76.0	80.0	79.0					5																	5235247		1950	4152	6102	SO:0001583	missense	170690	exon13			CAACAGCAGACGA	AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.1971C>G	chr5.hg19:g.5235247C>G	ENSP00000274181:p.Ser657Arg	97.0	0.0	.		124.0	16.0	.	NM_139056	C6G490|Q8IVE2	Missense_Mutation	SNP	ENST00000274181.7	hg19	CCDS43299.1	.	.	.	.	.	.	.	.	.	.	C	10.26	1.302320	0.23736	.	.	ENSG00000145536	ENST00000274181;ENST00000536857	T	0.63580	-0.05	4.57	3.68	0.42216	.	0.198340	0.50627	D	0.000116	T	0.56702	0.2003	M	0.62016	1.91	0.80722	D	1	P;B	0.50710	0.938;0.296	B;B	0.41860	0.368;0.292	T	0.58825	-0.7568	10	0.33940	T	0.23	.	11.2853	0.49218	0.0:0.908:0.0:0.092	.	657;657	Q8TE57;Q8TE57-2	ATS16_HUMAN;.	R	657	ENSP00000274181:S657R	ENSP00000274181:S657R	S	+	3	2	ADAMTS16	5288247	1.000000	0.71417	0.100000	0.21137	0.015000	0.08874	2.587000	0.46128	2.270000	0.75569	0.655000	0.94253	AGC	.	.	.	none		0.512	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056	
VCAN	1462	hgsc.bcm.edu	37	5	82850838	82850838	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr5:82850838G>A	ENST00000265077.3	+	12	10281	c.9716G>A	c.(9715-9717)tGg>tAg	p.W3239*	VCAN_ENST00000502527.2_Nonsense_Mutation_p.W498*|VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000342785.4_Nonsense_Mutation_p.W1485*|VCAN_ENST00000512590.2_Nonsense_Mutation_p.W1437*|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000343200.5_Nonsense_Mutation_p.W2252*	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	3239	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)	p.W3239S(1)		NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	GACTTCCGTTGGACTGATGGC	0.443																																					p.W3239X		Atlas-SNP	.											VCAN,NS,carcinoma,0,1	VCAN	498	.	1	Substitution - Missense(1)	lung(1)	c.G9716A						PASS	.						236.0	192.0	207.0					5																	82850838		2203	4300	6503	SO:0001587	stop_gained	1462	exon12			TCCGTTGGACTGA	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.9716G>A	chr5.hg19:g.82850838G>A	ENSP00000265077:p.Trp3239*	89.0	0.0	.		79.0	13.0	.	NM_004385	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Nonsense_Mutation	SNP	ENST00000265077.3	hg19	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	G	48	13.927085	0.99770	.	.	ENSG00000038427	ENST00000265077;ENST00000343200;ENST00000342785;ENST00000512590;ENST00000502527	.	.	.	5.81	5.81	0.92471	.	0.000000	0.56097	D	0.000028	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.089	0.97809	0.0:0.0:1.0:0.0	.	.	.	.	X	3239;2252;1485;1437;498	.	ENSP00000265077:W3239X	W	+	2	0	VCAN	82886594	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	9.756000	0.98918	2.752000	0.94435	0.557000	0.71058	TGG	.	.	.	none		0.443	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
HIST1H4B	8366	hgsc.bcm.edu	37	6	26027471	26027471	+	Missense_Mutation	SNP	G	G	C			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr6:26027471G>C	ENST00000377364.3	-	1	9	c.10C>G	c.(10-12)Cgc>Ggc	p.R4G		NM_003544.2	NP_003535.1	P62805	H4_HUMAN	histone cluster 1, H4b	4					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			large_intestine(4)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)	13						CCTTTGCCGCGACCAGACATG	0.512																																					p.R4G		Atlas-SNP	.											HIST1H4B,NS,carcinoma,0,1	HIST1H4B	27	.	0			c.C10G						PASS	.						49.0	47.0	47.0					6																	26027471		2203	4300	6503	SO:0001583	missense	8366	exon1			TGCCGCGACCAGA	X67081	CCDS4572.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000124529	ENSG00000278705		"""Histones / Replication-dependent"""	4789	protein-coding gene	gene with protein product		602829	"""H4 histone family, member I"", ""histone 1, H4b"""	H4FI		9119399, 12408966	Standard	NM_003544		Approved	H4/I	uc003nfr.3	P62805	OTTHUMG00000014417	ENST00000377364.3:c.10C>G	chr6.hg19:g.26027471G>C	ENSP00000366581:p.Arg4Gly	95.0	0.0	.		104.0	16.0	.	NM_003544	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	ENST00000377364.3	hg19	CCDS4572.1	.	.	.	.	.	.	.	.	.	.	g	12.98	2.099423	0.37048	.	.	ENSG00000124529	ENST00000377364	.	.	.	4.56	3.6	0.41247	.	0.000000	0.47852	U	0.000206	T	0.42988	0.1227	.	.	.	0.29320	N	0.867408	.	.	.	.	.	.	T	0.30592	-0.9973	6	0.72032	D	0.01	.	13.1415	0.59438	0.0:0.0:0.7636:0.2364	.	.	.	.	G	4	.	ENSP00000366581:R4G	R	-	1	0	HIST1H4B	26135450	0.573000	0.26676	0.167000	0.22817	0.033000	0.12548	0.731000	0.26058	2.454000	0.82982	0.563000	0.77884	CGC	.	.	.	none		0.512	HIST1H4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040079.2	NM_003544	
PKHD1	5314	hgsc.bcm.edu	37	6	51924820	51924820	+	Missense_Mutation	SNP	A	A	C	rs143341567		TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr6:51924820A>C	ENST00000371117.3	-	15	1414	c.1139T>G	c.(1138-1140)tTt>tGt	p.F380C	AL590391.1_ENST00000408630.2_RNA|PKHD1_ENST00000340994.4_Missense_Mutation_p.F380C	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	380					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					TGGAGCCACAAAGAACCCACT	0.443																																					p.F380C		Atlas-SNP	.											.	PKHD1	927	.	0			c.T1139G						PASS	.						85.0	77.0	80.0					6																	51924820		2203	4300	6503	SO:0001583	missense	5314	exon15			GCCACAAAGAACC	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.1139T>G	chr6.hg19:g.51924820A>C	ENSP00000360158:p.Phe380Cys	121.0	0.0	.		67.0	18.0	.	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	hg19	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.110642	0.77210	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	T;T	0.76968	-1.06;-1.06	5.46	5.46	0.80206	.	0.000000	0.64402	D	0.000001	D	0.85617	0.5738	M	0.78049	2.395	0.38168	D	0.939231	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.88299	0.2948	10	0.87932	D	0	.	15.0065	0.71516	1.0:0.0:0.0:0.0	.	380;380	P08F94-2;P08F94	.;PKHD1_HUMAN	C	380	ENSP00000360158:F380C;ENSP00000341097:F380C	ENSP00000341097:F380C	F	-	2	0	PKHD1	52032779	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.103000	0.71492	2.195000	0.70347	0.528000	0.53228	TTT	.	A|1.000;G|0.000	.	alt		0.443	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
KCNQ5	56479	hgsc.bcm.edu	37	6	73905126	73905126	+	Missense_Mutation	SNP	A	A	G			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr6:73905126A>G	ENST00000370398.1	+	14	2897	c.2788A>G	c.(2788-2790)Aaa>Gaa	p.K930E	KCNQ5_ENST00000355635.3_Missense_Mutation_p.K931E|KCNQ5_ENST00000355194.4_Missense_Mutation_p.K930E|KCNQ5_ENST00000414165.2_Missense_Mutation_p.K820E|KCNQ5_ENST00000342056.2_Missense_Mutation_p.K949E|KCNQ5_ENST00000403813.2_Missense_Mutation_p.K921E|KCNQ5_ENST00000402622.2_Missense_Mutation_p.K940E	NM_019842.3	NP_062816.2	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 5	930					protein complex assembly (GO:0006461)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|cervix(1)|endometrium(6)|kidney(7)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	57		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)	Ezogabine(DB04953)	GCCTCATGTCAAACTGAAATA	0.408																																					p.K949E	GBM(142;1375 1859 14391 23261 44706)	Atlas-SNP	.											.	KCNQ5	153	.	0			c.A2845G						PASS	.						64.0	65.0	65.0					6																	73905126		2203	4300	6503	SO:0001583	missense	56479	exon15			CATGTCAAACTGA	AF202977	CCDS4976.1, CCDS55034.1	6q14	2012-07-05			ENSG00000185760	ENSG00000185760		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6299	protein-coding gene	gene with protein product		607357				10787416, 10816588, 16382104	Standard	NM_019842		Approved	Kv7.5	uc011dyh.2	Q9NR82	OTTHUMG00000015020	ENST00000370398.1:c.2788A>G	chr6.hg19:g.73905126A>G	ENSP00000359425:p.Lys930Glu	122.0	0.0	.		112.0	17.0	.	NM_001160133	A6NKT6|A6PVT6|A8MSQ5|B4DS33|B5MC83|B7ZL37|F5GZV0|Q17RE1|Q5VVP3|Q86W40|Q9NRN0|Q9NYA6	Missense_Mutation	SNP	ENST00000370398.1	hg19	CCDS4976.1	.	.	.	.	.	.	.	.	.	.	A	14.61	2.587561	0.46110	.	.	ENSG00000185760	ENST00000342056;ENST00000451840;ENST00000355194;ENST00000370398;ENST00000402622;ENST00000355635;ENST00000403813;ENST00000414165	D;D;D;D;D;D;D	0.99429	-5.66;-5.66;-5.66;-5.66;-5.67;-5.7;-5.89	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	D	0.98698	0.9563	N	0.24115	0.695	0.24539	N	0.994073	D;P;B;P;B	0.61697	0.99;0.792;0.017;0.525;0.435	D;B;B;B;B	0.72982	0.979;0.254;0.021;0.117;0.078	D	0.96550	0.9407	10	0.62326	D	0.03	.	16.4622	0.84064	1.0:0.0:0.0:0.0	.	820;940;949;921;930	F5GZV0;Q9NR82-3;A6PVT6;Q9NR82-2;Q9NR82	.;.;.;.;KCNQ5_HUMAN	E	949;949;930;930;940;931;921;820	ENSP00000345055:K949E;ENSP00000347326:K930E;ENSP00000359425:K930E;ENSP00000385501:K940E;ENSP00000347853:K931E;ENSP00000384453:K921E;ENSP00000409861:K820E	ENSP00000345055:K949E	K	+	1	0	KCNQ5	73961847	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.654000	0.67974	2.289000	0.77006	0.533000	0.62120	AAA	.	.	.	none		0.408	KCNQ5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041198.3	NM_019842	
RARS2	57038	hgsc.bcm.edu	37	6	88231239	88231239	+	Missense_Mutation	SNP	A	A	T			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr6:88231239A>T	ENST00000369536.5	-	12	1023	c.978T>A	c.(976-978)gaT>gaA	p.D326E	RARS2_ENST00000497828.1_5'Flank	NM_020320.3	NP_064716.2	Q5T160	SYRM_HUMAN	arginyl-tRNA synthetase 2, mitochondrial	326					arginyl-tRNA aminoacylation (GO:0006420)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	22		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0456)		CAGCTGCAAGATCTCTGAAAC	0.323																																					p.D326E		Atlas-SNP	.											.	RARS2	61	.	0			c.T978A						PASS	.						83.0	83.0	83.0					6																	88231239		2203	4300	6503	SO:0001583	missense	57038	exon12			TGCAAGATCTCTG	AK093934	CCDS5011.1	6q16.1	2011-07-01	2007-09-27	2007-02-23	ENSG00000146282	ENSG00000146282	6.1.1.19	"""Aminoacyl tRNA synthetases / Class I"""	21406	protein-coding gene	gene with protein product	"""arginine tRNA ligase 2, mitochondrial (putative)"""	611524	"""arginyl-tRNA synthetase-like"""	RARSL		17847012	Standard	NM_020320		Approved	MGC14993, MGC23778, PRO1992, dJ382I10.6, DALRD2	uc003pme.3	Q5T160	OTTHUMG00000015178	ENST00000369536.5:c.978T>A	chr6.hg19:g.88231239A>T	ENSP00000358549:p.Asp326Glu	64.0	0.0	.		33.0	8.0	.	NM_020320	B2RDT7|Q96FU5|Q9H8K8	Missense_Mutation	SNP	ENST00000369536.5	hg19	CCDS5011.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.219539	0.79464	.	.	ENSG00000146282	ENST00000369536	D	0.82081	-1.57	5.83	-1.0	0.10196	Arginyl-tRNA synthetase, class Ia, core (2);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	D	0.90335	0.6976	H	0.95712	3.71	0.58432	D	0.999996	D	0.71674	0.998	D	0.80764	0.994	D	0.90743	0.4651	10	0.87932	D	0	.	11.7636	0.51918	0.557:0.0:0.443:0.0	.	326	Q5T160	SYRM_HUMAN	E	326	ENSP00000358549:D326E	ENSP00000358549:D326E	D	-	3	2	RARS2	88287958	0.984000	0.35163	0.987000	0.45799	0.993000	0.82548	0.740000	0.26188	-0.395000	0.07715	0.533000	0.62120	GAT	.	.	.	none		0.323	RARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041448.1	NM_020320	
CAPRIN2	65981	hgsc.bcm.edu	37	12	30888129	30888129	+	Silent	SNP	C	C	T	rs145888176		TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr12:30888129C>T	ENST00000395805.2	-	4	1129	c.582G>A	c.(580-582)gcG>gcA	p.A194A	CAPRIN2_ENST00000417045.1_Silent_p.A194A|CAPRIN2_ENST00000538387.1_5'Flank|CAPRIN2_ENST00000298892.5_Silent_p.A194A|CAPRIN2_ENST00000308433.5_5'UTR|CAPRIN2_ENST00000251071.5_Silent_p.A194A	NM_001206856.1	NP_001193785.1			caprin family member 2									p.A194A(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(4)|large_intestine(13)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	48	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					CCTTCTTTTGCGCTTTTAGTA	0.378																																					p.A194A		Atlas-SNP	.											CAPRIN2,NS,carcinoma,0,1	CAPRIN2	109	.	1	Substitution - coding silent(1)	lung(1)	c.G582A						PASS	.	C	,,,	0,4406		0,0,2203	127.0	123.0	125.0		582,582,582,582	-5.3	1.0	12	dbSNP_134	125	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	CAPRIN2	NM_001002259.1,NM_001206856.1,NM_023925.3,NM_032156.3	,,,	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	,,,	194/1128,194/906,194/1078,194/961	30888129	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	65981	exon4			CTTTTGCGCTTTT	AY074491	CCDS8720.1, CCDS41766.1, CCDS41766.2, CCDS55816.1	12p11	2010-08-03	2007-03-27	2007-03-27	ENSG00000110888	ENSG00000110888			21259	protein-coding gene	gene with protein product		610375	"""C1q domain containing 1"""	C1QDC1		11347906, 14764709	Standard	NM_001002259		Approved	EEG1, FLJ22569, FLJ11391, caprin-2, RNG140	uc001rji.1	Q6IMN6	OTTHUMG00000169185	ENST00000395805.2:c.582G>A	chr12.hg19:g.30888129C>T		171.0	0.0	.		91.0	5.0	.	NM_023925		Silent	SNP	ENST00000395805.2	hg19	CCDS55816.1																																																																																			.	C|1.000;T|0.000	0.000	weak		0.378	CAPRIN2-004	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000403322.2	NM_023925	
RAN	5901	hgsc.bcm.edu	37	12	131359114	131359114	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr12:131359114G>A	ENST00000543796.1	+	5	529	c.271G>A	c.(271-273)Gat>Aat	p.D91N	RAN_ENST00000254675.3_Missense_Mutation_p.D3N|RAN_ENST00000392367.3_Missense_Mutation_p.D108N|RAN_ENST00000392369.2_Missense_Mutation_p.D91N|RAN_ENST00000541630.1_Missense_Mutation_p.D3N			P62826	RAN_HUMAN	RAN, member RAS oncogene family	91					actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|cellular protein complex localization (GO:0034629)|DNA metabolic process (GO:0006259)|gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription, DNA-templated (GO:0045893)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(2)	9	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	Lung NSC(355;7.46e-07)|all_epithelial(31;7.36e-06)		OV - Ovarian serous cystadenocarcinoma(86;9.18e-49)|Epithelial(86;1.42e-45)|all cancers(50;6.28e-40)		CATAATGTTTGATGTAACATC	0.413																																					p.D91N		Atlas-SNP	.											.	RAN	18	.	0			c.G271A						PASS	.						122.0	103.0	109.0					12																	131359114		2203	4300	6503	SO:0001583	missense	5901	exon5			ATGTTTGATGTAA	M31469	CCDS9271.1, CCDS73546.1	12q24.33	2014-05-09			ENSG00000132341	ENSG00000132341			9846	protein-coding gene	gene with protein product		601179				8421051	Standard	XM_005253592		Approved	ARA24, TC4, Gsp1	uc001uir.3	P62826	OTTHUMG00000134328	ENST00000543796.1:c.271G>A	chr12.hg19:g.131359114G>A	ENSP00000446215:p.Asp91Asn	95.0	0.0	.		50.0	9.0	.	NM_006325	A8K3Z8|P17080|P28746|P28747|Q6IPB2|Q86V08|Q8NI90|Q9CSP3|Q9CWI7|Q9CZA2|Q9UDJ5|Q9UEU9	Missense_Mutation	SNP	ENST00000543796.1	hg19	CCDS9271.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.769269	0.90020	.	.	ENSG00000132341	ENST00000543796;ENST00000448750;ENST00000541630;ENST00000392369;ENST00000254675;ENST00000535090;ENST00000392367	D;D;D;D;D;D;D	0.86694	-2.16;-2.16;-2.16;-2.16;-2.16;-2.16;-2.16	3.93	3.93	0.45458	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.95465	0.8527	H	0.96720	3.87	0.80722	D	1	D;D	0.55800	0.973;0.973	D;D	0.68192	0.956;0.956	D	0.97181	0.9851	10	0.87932	D	0	-17.8637	15.3182	0.74099	0.0:0.0:1.0:0.0	.	91;91	A8K3Z8;P62826	.;RAN_HUMAN	N	91;109;3;91;3;87;108	ENSP00000446215:D91N;ENSP00000396127:D109N;ENSP00000441210:D3N;ENSP00000376176:D91N;ENSP00000254675:D3N;ENSP00000444042:D87N;ENSP00000376174:D108N	ENSP00000254675:D3N	D	+	1	0	RAN	129925067	1.000000	0.71417	0.974000	0.42286	0.827000	0.46813	9.335000	0.96500	1.906000	0.55180	0.561000	0.74099	GAT	.	.	.	none		0.413	RAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259441.2	NM_006325	
TJP1	7082	hgsc.bcm.edu	37	15	30008820	30008820	+	Silent	SNP	A	A	G			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr15:30008820A>G	ENST00000346128.6	-	23	4671	c.4197T>C	c.(4195-4197)tcT>tcC	p.S1399S	TJP1_ENST00000400011.2_Silent_p.S1323S|TJP1_ENST00000356107.6_Silent_p.S1399S|TJP1_ENST00000545208.2_Silent_p.S1319S	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	1399					apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		CTTACTTTGAAGAATAACTAG	0.368																																					p.S1399S	Melanoma(77;681 1843 6309 6570)	Atlas-SNP	.											.	TJP1	140	.	0			c.T4197C						PASS	.						60.0	61.0	61.0					15																	30008820		1812	4085	5897	SO:0001819	synonymous_variant	7082	exon23			CTTTGAAGAATAA		CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.4197T>C	chr15.hg19:g.30008820A>G		81.0	0.0	.		54.0	7.0	.	NM_003257	B4E3K1|Q2NKP3|Q4ZGJ6	Silent	SNP	ENST00000346128.6	hg19	CCDS42007.1																																																																																			.	.	.	none		0.368	TJP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268237.3	NM_003257	
TJP1	7082	hgsc.bcm.edu	37	15	30065529	30065529	+	Missense_Mutation	SNP	G	G	T			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr15:30065529G>T	ENST00000346128.6	-	3	590	c.116C>A	c.(115-117)tCt>tAt	p.S39Y	TJP1_ENST00000400011.2_Missense_Mutation_p.S43Y|TJP1_ENST00000495972.2_Missense_Mutation_p.S39Y|TJP1_ENST00000356107.6_Missense_Mutation_p.S39Y|TJP1_ENST00000545208.2_Missense_Mutation_p.S39Y	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	39	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		TCGTCCACCAGATATTGCAAT	0.363																																					p.S39Y	Melanoma(77;681 1843 6309 6570)	Atlas-SNP	.											.	TJP1	140	.	0			c.C116A						PASS	.						136.0	121.0	126.0					15																	30065529		1874	4102	5976	SO:0001583	missense	7082	exon3			CCACCAGATATTG		CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.116C>A	chr15.hg19:g.30065529G>T	ENSP00000281537:p.Ser39Tyr	148.0	0.0	.		108.0	19.0	.	NM_175610	B4E3K1|Q2NKP3|Q4ZGJ6	Missense_Mutation	SNP	ENST00000346128.6	hg19	CCDS42007.1	.	.	.	.	.	.	.	.	.	.	G	19.61	3.859179	0.71834	.	.	ENSG00000104067	ENST00000346128;ENST00000400011;ENST00000545208;ENST00000400007;ENST00000356107	T;T;T;T	0.29655	1.56;1.56;1.56;1.56	5.5	5.5	0.81552	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.66509	0.2796	M	0.92026	3.265	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.998	T	0.73291	-0.4029	9	.	.	.	.	19.7625	0.96325	0.0:0.0:1.0:0.0	.	32;39;39;43	A9CQZ8;Q07157-2;Q07157;G5E9E7	.;.;ZO1_HUMAN;.	Y	39;43;39;39;39	ENSP00000281537:S39Y;ENSP00000382890:S43Y;ENSP00000441202:S39Y;ENSP00000348416:S39Y	.	S	-	2	0	TJP1	27852821	1.000000	0.71417	0.999000	0.59377	0.256000	0.26092	9.715000	0.98748	2.749000	0.94314	0.585000	0.79938	TCT	.	.	.	none		0.363	TJP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268237.3	NM_003257	
EFCAB3	146779	hgsc.bcm.edu	37	17	60484528	60484528	+	Silent	SNP	T	T	C			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr17:60484528T>C	ENST00000305286.3	+	8	900	c.822T>C	c.(820-822)caT>caC	p.H274H	EFCAB3_ENST00000450662.2_Silent_p.H326H	NM_173503.3	NP_775774.1	Q8N7B9	EFCB3_HUMAN	EF-hand calcium binding domain 3	274							calcium ion binding (GO:0005509)			cervix(1)|endometrium(2)|large_intestine(5)|lung(6)|skin(3)	17			BRCA - Breast invasive adenocarcinoma(2;2.27e-11)			AGCCTTTGCATTTCTTTGAGG	0.358																																					p.H326H		Atlas-SNP	.											.	EFCAB3	71	.	0			c.T978C						PASS	.						80.0	82.0	81.0					17																	60484528		2203	4300	6503	SO:0001819	synonymous_variant	146779	exon10			TTTGCATTTCTTT	AK098684	CCDS11632.1, CCDS45751.1	17q23.3	2013-01-10			ENSG00000172421	ENSG00000172421		"""EF-hand domain containing"""	26379	protein-coding gene	gene with protein product						12477932	Standard	NM_173503		Approved	FLJ25818	uc010wpc.2	Q8N7B9	OTTHUMG00000179175	ENST00000305286.3:c.822T>C	chr17.hg19:g.60484528T>C		92.0	0.0	.		74.0	7.0	.	NM_001144933	J3KQM8	Silent	SNP	ENST00000305286.3	hg19	CCDS11632.1																																																																																			.	.	.	none		0.358	EFCAB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379114.1	NM_173503	
KLHL14	57565	hgsc.bcm.edu	37	18	30350134	30350134	+	Missense_Mutation	SNP	A	A	C			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr18:30350134A>C	ENST00000359358.4	-	2	859	c.421T>G	c.(421-423)Tac>Gac	p.Y141D	AC012123.1_ENST00000426194.1_Intron|KLHL14_ENST00000358095.4_Missense_Mutation_p.Y141D	NM_020805.1	NP_065856.1	Q9P2G3	KLH14_HUMAN	kelch-like family member 14	141	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.					endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(20)|ovary(2)	31						GTGTAGAGGTACTCGAGCACC	0.642																																					p.Y141D		Atlas-SNP	.											.	KLHL14	92	.	0			c.T421G						PASS	.						99.0	99.0	99.0					18																	30350134		2203	4300	6503	SO:0001583	missense	57565	exon2			AGAGGTACTCGAG	AB037805	CCDS32813.1	18q12.1	2013-10-15	2013-01-30		ENSG00000197705	ENSG00000197705		"""Kelch-like"", ""BTB/POZ domain containing"""	29266	protein-coding gene	gene with protein product	"""printor"""	613772	"""kelch-like 14 (Drosophila)"""			10718198, 19535332	Standard	NM_020805		Approved	KIAA1384	uc002kxm.1	Q9P2G3	OTTHUMG00000179819	ENST00000359358.4:c.421T>G	chr18.hg19:g.30350134A>C	ENSP00000352314:p.Tyr141Asp	216.0	0.0	.		268.0	50.0	.	NM_020805	A6NNW1|B4DHA0|Q8WU41	Missense_Mutation	SNP	ENST00000359358.4	hg19	CCDS32813.1	.	.	.	.	.	.	.	.	.	.	A	9.978	1.227338	0.22542	.	.	ENSG00000197705	ENST00000359358;ENST00000358095	T;T	0.71222	-0.55;-0.55	4.34	4.34	0.51931	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.134366	0.51477	D	0.000081	T	0.78660	0.4318	L	0.48362	1.52	0.80722	D	1	D	0.63880	0.993	D	0.81914	0.995	T	0.80876	-0.1186	10	0.87932	D	0	.	13.0081	0.58717	1.0:0.0:0.0:0.0	.	141	Q9P2G3	KLH14_HUMAN	D	141	ENSP00000352314:Y141D;ENSP00000350808:Y141D	ENSP00000350808:Y141D	Y	-	1	0	KLHL14	28604132	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.006000	0.70724	1.738000	0.51689	0.377000	0.23210	TAC	.	.	.	none		0.642	KLHL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448376.1		
ATP5A1	498	hgsc.bcm.edu	37	18	43671697	43671697	+	Missense_Mutation	SNP	A	A	G			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr18:43671697A>G	ENST00000398752.6	-	3	381	c.260T>C	c.(259-261)cTg>cCg	p.L87P	ATP5A1_ENST00000593152.2_Missense_Mutation_p.L37P|ATP5A1_ENST00000591267.1_5'Flank|ATP5A1_ENST00000282050.2_Missense_Mutation_p.L87P|ATP5A1_ENST00000590665.1_Missense_Mutation_p.L87P	NM_001001935.2|NM_004046.5	NP_001001935.1|NP_004037.1	P25705	ATPA_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle	87					ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular metabolic process (GO:0044237)|embryo development (GO:0009790)|lipid metabolic process (GO:0006629)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|negative regulation of endothelial cell proliferation (GO:0001937)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|proton-transporting ATP synthase complex, catalytic core F(1) (GO:0045261)	ATP binding (GO:0005524)|MHC class I protein binding (GO:0042288)|poly(A) RNA binding (GO:0044822)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)			breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(8)|skin(1)|urinary_tract(1)	22						AACATTCCTCAGCCCATGTAC	0.388																																					p.L87P		Atlas-SNP	.											.	ATP5A1	52	.	0			c.T260C						PASS	.						100.0	98.0	98.0					18																	43671697		2203	4300	6503	SO:0001583	missense	498	exon3			TTCCTCAGCCCAT	D14710	CCDS11927.1, CCDS58620.1, CCDS59315.1	18q21	2012-10-12	2006-01-13		ENSG00000152234	ENSG00000152234	3.6.1.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	823	protein-coding gene	gene with protein product		164360	"""ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform 2, non-cardiac muscle-like 2"", ""ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform 1, cardiac muscle"""	ATP5AL2, ATPM		1830491	Standard	NM_001257334		Approved	ATP5A, hATP1, OMR, ORM	uc002lbr.2	P25705	OTTHUMG00000132637	ENST00000398752.6:c.260T>C	chr18.hg19:g.43671697A>G	ENSP00000381736:p.Leu87Pro	134.0	0.0	.		103.0	25.0	.	NM_004046	A8K092|B4DY56|K7ENP3|Q53XX6|Q8IXV2|Q96FB4|Q96HW2|Q96IR6|Q9BTV8	Missense_Mutation	SNP	ENST00000398752.6	hg19	CCDS11927.1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.527021	0.85706	.	.	ENSG00000152234	ENST00000282050;ENST00000398752;ENST00000542290	D;D	0.88354	-2.37;-2.37	5.24	5.24	0.73138	ATPase, F1/A1 complex, alpha subunit, N-terminal (1);ATPase, F1/V1/A1 complex, alpha/beta subunit, N-terminal (1);ATPase, F1/A1 complex, alpha/beta subunit, N-terminal (1);	0.147149	0.47852	D	0.000217	D	0.96873	0.8979	H	0.98996	4.395	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.98545	1.0634	10	0.87932	D	0	-17.4309	15.1468	0.72662	1.0:0.0:0.0:0.0	.	87	P25705	ATPA_HUMAN	P	87;87;37	ENSP00000282050:L87P;ENSP00000381736:L87P	ENSP00000282050:L87P	L	-	2	0	ATP5A1	41925695	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	9.176000	0.94839	1.975000	0.57531	0.533000	0.62120	CTG	.	.	.	none		0.388	ATP5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255884.1	NM_004046	
ANKRD27	84079	hgsc.bcm.edu	37	19	33132944	33132944	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr19:33132944G>A	ENST00000306065.4	-	10	1048	c.890C>T	c.(889-891)tCt>tTt	p.S297F	ANKRD27_ENST00000587352.1_Missense_Mutation_p.S297F	NM_032139.2	NP_115515.2	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	297	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.				early endosome to late endosome transport (GO:0045022)|positive regulation of GTPase activity (GO:0043547)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|lysosome (GO:0005764)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			breast(3)|endometrium(7)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	42	Esophageal squamous(110;0.137)					CTGGCTTGGAGACTGTGTAAT	0.493																																					p.S297F		Atlas-SNP	.											.	ANKRD27	86	.	0			c.C890T						PASS	.						149.0	138.0	142.0					19																	33132944		2203	4300	6503	SO:0001583	missense	84079	exon10			CTTGGAGACTGTG	AK054561	CCDS32986.1	19q13.12	2013-01-10				ENSG00000105186		"""Ankyrin repeat domain containing"""	25310	protein-coding gene	gene with protein product	"""Vps9 domain and ankyrin-repeat-containing protein"""					11230166, 16525121	Standard	NM_032139		Approved	FLJ00040, DKFZp434L0718, VARP	uc002ntn.1	Q96NW4		ENST00000306065.4:c.890C>T	chr19.hg19:g.33132944G>A	ENSP00000304292:p.Ser297Phe	214.0	0.0	.		199.0	53.0	.	NM_032139	Q71MF5|Q86UC3|Q8ND80|Q9H0I4	Missense_Mutation	SNP	ENST00000306065.4	hg19	CCDS32986.1	.	.	.	.	.	.	.	.	.	.	G	9.152	1.016485	0.19355	.	.	ENSG00000105186	ENST00000306065	T	0.31247	1.5	5.43	5.43	0.79202	Vacuolar sorting protein 9, subgroup (1);Vacuolar sorting protein 9 (2);	0.000000	0.64402	D	0.000017	T	0.40222	0.1108	M	0.72118	2.19	0.53005	D	0.999961	B	0.23058	0.079	B	0.28638	0.092	T	0.23904	-1.0175	10	0.44086	T	0.13	-22.3055	19.253	0.93933	0.0:0.0:1.0:0.0	.	297	Q96NW4	ANR27_HUMAN	F	297	ENSP00000304292:S297F	ENSP00000304292:S297F	S	-	2	0	ANKRD27	37824784	1.000000	0.71417	1.000000	0.80357	0.678000	0.39670	5.388000	0.66249	2.551000	0.86045	0.563000	0.77884	TCT	.	.	.	none		0.493	ANKRD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450329.1	NM_032139	
LILRA5	353514	hgsc.bcm.edu	37	19	54819027	54819027	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr19:54819027G>A	ENST00000301219.3	-	6	838	c.719C>T	c.(718-720)gCt>gTt	p.A240V	AC008984.2_ENST00000507363.1_RNA|LILRA5_ENST00000346508.3_Missense_Mutation_p.A228V	NM_021250.2	NP_067073.1	A6NI73	LIRA5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5	240					innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	20	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GAGGTTATCAGCTGCTCCTGA	0.517																																					p.A240V		Atlas-SNP	.											.	LILRA5	49	.	0			c.C719T						PASS	.						83.0	76.0	78.0					19																	54819027		2203	4300	6503	SO:0001583	missense	353514	exon6			TTATCAGCTGCTC	AF212842	CCDS12888.1, CCDS12889.1	19q13.4	2013-01-11	2005-05-13	2005-05-13	ENSG00000187116	ENSG00000187116		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16309	protein-coding gene	gene with protein product		606047		LILRB7		10941842	Standard	NM_181986		Approved	ILT11, LIR9, CD85, CD85f	uc002qfe.3	A6NI73	OTTHUMG00000065357	ENST00000301219.3:c.719C>T	chr19.hg19:g.54819027G>A	ENSP00000301219:p.Ala240Val	69.0	0.0	.		66.0	13.0	.	NM_021250	A6NHI3	Missense_Mutation	SNP	ENST00000301219.3	hg19	CCDS12888.1	.	.	.	.	.	.	.	.	.	.	G	10.56	1.383828	0.25031	.	.	ENSG00000187116	ENST00000301219;ENST00000346508	T;T	0.00502	7.02;6.95	2.31	2.31	0.28768	.	.	.	.	.	T	0.00608	0.0020	M	0.62154	1.92	0.21386	N	0.999702	B;B	0.25048	0.117;0.014	B;B	0.31946	0.138;0.01	T	0.37103	-0.9720	9	0.38643	T	0.18	.	8.1667	0.31230	0.0:0.0:1.0:0.0	.	228;240	A6NI73-2;A6NI73	.;LIRA5_HUMAN	V	240;228	ENSP00000301219:A240V;ENSP00000302948:A228V	ENSP00000301219:A240V	A	-	2	0	LILRA5	59510839	0.000000	0.05858	0.004000	0.12327	0.073000	0.16967	0.233000	0.17911	1.603000	0.50134	0.536000	0.68110	GCT	.	.	.	none		0.517	LILRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140231.1	NM_181985	
HUWE1	10075	hgsc.bcm.edu	37	X	53589174	53589174	+	Silent	SNP	C	C	T			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chrX:53589174C>T	ENST00000342160.3	-	53	7693	c.7236G>A	c.(7234-7236)gaG>gaA	p.E2412E	HUWE1_ENST00000262854.6_Silent_p.E2412E			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	2412	Glu-rich.				base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.E2275D(1)		NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						TGTGCTCCTCCTCATCCTCAG	0.498																																					p.E2412E		Atlas-SNP	.											.	HUWE1	724	.	1	Substitution - Missense(1)	breast(1)	c.G7236A						PASS	.						138.0	86.0	104.0					X																	53589174		2203	4300	6503	SO:0001819	synonymous_variant	10075	exon54			CTCCTCCTCATCC	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.7236G>A	chrX.hg19:g.53589174C>T		59.0	0.0	.		57.0	16.0	.	NM_031407	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Silent	SNP	ENST00000342160.3	hg19	CCDS35301.1	.	.	.	.	.	.	.	.	.	.	C	2.473	-0.321458	0.05386	.	.	ENSG00000086758	ENST00000427052	.	.	.	4.93	4.05	0.47172	.	.	.	.	.	T	0.57592	0.2064	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55082	-0.8196	4	.	.	.	.	8.1437	0.31100	0.0:0.8128:0.0:0.1872	.	.	.	.	R	1446	.	.	G	-	1	0	HUWE1	53605899	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.451000	0.35145	2.164000	0.68074	0.513000	0.50165	GGA	.	.	.	none		0.498	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	
IGFBP1	3484	hgsc.bcm.edu	37	7	45932569	45932569	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr7:45932569delC	ENST00000275525.3	+	4	955	c.659delC	c.(658-660)tccfs	p.S220fs	IGFBP1_ENST00000457280.1_Frame_Shift_Del_p.S218fs|IGFBP1_ENST00000468955.1_Frame_Shift_Del_p.S177fs	NM_000596.2	NP_000587.1	P08833	IBP1_HUMAN	insulin-like growth factor binding protein 1	220	Thyroglobulin type-1. {ECO:0000255|PROSITE-ProRule:PRU00500}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|insulin receptor signaling pathway (GO:0008286)|positive regulation of cell growth (GO:0030307)|signal transduction (GO:0007165)|tissue regeneration (GO:0042246)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	insulin-like growth factor binding (GO:0005520)			large_intestine(2)|lung(4)	6						TGTGAGACATCCATGGATGGA	0.547																																					p.S220fs		Atlas-INDEL	.											.	IGFBP1	19	.	0			c.658delT						PASS	.						84.0	79.0	81.0					7																	45932569		2203	4300	6503	SO:0001589	frameshift_variant	3484	exon4			.		CCDS5504.1	7p12.3	2014-09-16			ENSG00000146678	ENSG00000146678			5469	protein-coding gene	gene with protein product	"""placental protein 12"", ""amniotic fluid binding protein"", ""alpha-pregnancy-associated endometrial globulin"", ""growth hormone independent-binding protein"", ""binding protein-28"", ""binding protein-26"", ""binding protein-25"", ""IGF-binding protein 1"""	146730		IBP1		2461294	Standard	NM_000596		Approved	IGF-BP25, AFBP, hIGFBP-1, PP12	uc003tnp.3	P08833	OTTHUMG00000152343	ENST00000275525.3:c.659delC	chr7.hg19:g.45932569delC	ENSP00000275525:p.Ser220fs	101.0	0.0	0		119.0	11.0	0.092437	NM_000596	A4D2F4|D3DVL9|Q8IYP5	Frame_Shift_Del	DEL	ENST00000275525.3	hg19	CCDS5504.1																																																																																			.	.	.	none		0.547	IGFBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251355.2	NM_000596	
GIT2	9815	hgsc.bcm.edu	37	12	110385121	110385127	+	Frame_Shift_Del	DEL	TGGGAGA	TGGGAGA	-	rs185965842	byFrequency	TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	TGGGAGA	TGGGAGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr12:110385121_110385127delTGGGAGA	ENST00000355312.3	-	15	1574_1580	c.1575_1581delTCTCCCA	c.(1573-1581)tatctcccafs	p.YLP525fs	GIT2_ENST00000338373.5_Intron|GIT2_ENST00000551209.1_Frame_Shift_Del_p.YLP474fs|GIT2_ENST00000361006.5_Frame_Shift_Del_p.YLP525fs|GIT2_ENST00000553118.1_Intron|GIT2_ENST00000356259.4_Intron|GIT2_ENST00000354574.4_Frame_Shift_Del_p.YLP477fs|GIT2_ENST00000547815.1_3'UTR|GIT2_ENST00000457474.2_Frame_Shift_Del_p.YLP477fs|GIT2_ENST00000343646.5_Frame_Shift_Del_p.YLP445fs|TCHP_ENST00000550780.1_Intron|GIT2_ENST00000360185.4_Frame_Shift_Del_p.YLP475fs	NM_057169.3	NP_476510.1	Q14161	GIT2_HUMAN	G protein-coupled receptor kinase interacting ArfGAP 2	525					behavioral response to pain (GO:0048266)|regulation of ARF GTPase activity (GO:0032312)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.L526I(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(8)|skin(4)	27						CTTCTCCCATTGGGAGATATGGTTTCT	0.57																																					p.526_528del		Atlas-INDEL	.											.	GIT2	81	.	1	Substitution - Missense(1)	large_intestine(1)	c.1576_1582del						PASS	.																																			SO:0001589	frameshift_variant	9815	exon15			.	AF124491	CCDS9138.1, CCDS9139.1, CCDS44968.1, CCDS44969.1, CCDS55884.1	12q24.1	2013-01-10	2008-09-05			ENSG00000139436		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	4273	protein-coding gene	gene with protein product		608564	"""G protein-coupled receptor kinase interactor 2"""			9826657, 10896954	Standard	NM_139201		Approved	KIAA0148	uc001tps.2	Q14161	OTTHUMG00000169313	ENST00000355312.3:c.1575_1581delTCTCCCA	chr12.hg19:g.110385121_110385127delTGGGAGA	ENSP00000347464:p.Tyr525fs	92.0	0.0	0		110.0	15.0	0.136364	NM_001135214	Q86U59|Q96CI2|Q9BV91|Q9Y5V2	Frame_Shift_Del	DEL	ENST00000355312.3	hg19	CCDS9138.1																																																																																			.	.	.	none		0.570	GIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403407.1	NM_057169	
ZNF341	84905	hgsc.bcm.edu	37	20	32345059	32345060	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr20:32345059_32345060insC	ENST00000375200.1	+	6	1212_1213	c.847_848insC	c.(847-849)accfs	p.T283fs	ZNF341_ENST00000342427.2_Frame_Shift_Ins_p.T283fs	NM_001282933.1	NP_001269862.1	Q9BYN7	ZN341_HUMAN	zinc finger protein 341	283					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	31						CGCCCCCATGACCAGCGCCACC	0.629																																					p.T283fs		Atlas-INDEL	.											.	ZNF341	73	.	0			c.847_848insC						PASS	.																																			SO:0001589	frameshift_variant	84905	exon6			.	AK027550	CCDS13227.1, CCDS74719.1	20q11.22	2013-01-08			ENSG00000131061	ENSG00000131061		"""Zinc fingers, C2H2-type"""	15992	protein-coding gene	gene with protein product							Standard	NM_001282933		Approved	dJ553F4.3	uc002wzx.3	Q9BYN7	OTTHUMG00000032275	ENST00000375200.1:c.849dupC	chr20.hg19:g.32345061_32345061dupC	ENSP00000364346:p.Thr283fs	318.0	0.0	0		414.0	128.0	0.309179	NM_032819	A2RUF4|B2RXE5|B7ZM09|Q5JXM8|Q96ST5	Frame_Shift_Ins	INS	ENST00000375200.1	hg19																																																																																				.	.	.	none		0.629	ZNF341-201	KNOWN	basic	protein_coding	protein_coding			
TRIP6	7205	hgsc.bcm.edu	37	7	100465513	100465514	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr7:100465513_100465514insC	ENST00000200457.4	+	2	500_501	c.140_141insC	c.(139-144)tgccccfs	p.CP47fs		NM_003302.2	NP_003293.2	Q15654	TRIP6_HUMAN	thyroid hormone receptor interactor 6	47					focal adhesion assembly (GO:0048041)|positive regulation of cell migration (GO:0030335)|regulation of transcription, DNA-templated (GO:0006355)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|kinase binding (GO:0019900)|poly(A) RNA binding (GO:0044822)|thyroid hormone receptor binding (GO:0046966)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|liver(1)|lung(5)	14	Lung NSC(181;0.041)|all_lung(186;0.0581)					GTCAATTTTTGCCCCCTTCCAT	0.624																																					p.C47fs		Atlas-INDEL	.											.	TRIP6	45	.	0			c.140_141insC						PASS	.																																			SO:0001589	frameshift_variant	7205	exon2			.	L40374, AF000974	CCDS5708.1	7q22	2006-09-05			ENSG00000087077	ENSG00000087077			12311	protein-coding gene	gene with protein product		602933				9598321, 7776974	Standard	NM_003302		Approved	ZRP-1, OIP1, MGC10556, MGC10558, MGC29959, MGC3837, MGC4423	uc003uww.3	Q15654	OTTHUMG00000157029	ENST00000200457.4:c.145dupC	chr7.hg19:g.100465518_100465518dupC	ENSP00000200457:p.Cys47fs	265.0	0.0	0		335.0	81.0	0.241791	NM_003302	A4D2E7|F2ZC07|F2ZC08|O15170|O15275|Q9BTB2|Q9BUE5|Q9BXP3|Q9UNT4	Frame_Shift_Ins	INS	ENST00000200457.4	hg19	CCDS5708.1																																																																																			.	.	.	none		0.624	TRIP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347151.2	NM_003302	
NUP50	10762	hgsc.bcm.edu	37	22	45574449	45574449	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr22:45574449delT	ENST00000347635.4	+	5	1137	c.671delT	c.(670-672)cttfs	p.L224fs	NUP50_ENST00000396096.2_Frame_Shift_Del_p.L196fs|NUP50_ENST00000425733.2_5'UTR|NUP50_ENST00000407019.2_Frame_Shift_Del_p.L196fs|CTA-268H5.12_ENST00000610217.1_RNA	NM_007172.3	NP_009103.2	Q9UKX7	NUP50_HUMAN	nucleoporin 50kDa	224	5 X 2 AA repeats of F-G.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|intracellular transport (GO:0046907)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	9		Ovarian(80;0.00965)|all_neural(38;0.0244)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		TCTCCTTCCCTTTTTGGCTCA	0.408																																					p.L224fs		Atlas-INDEL	.											.	NUP50	24	.	0			c.670delC						PASS	.						40.0	41.0	40.0					22																	45574449		2203	4300	6503	SO:0001589	frameshift_variant	10762	exon5			.	AF107840	CCDS14062.1, CCDS14063.1	22q13.3	2007-01-22	2002-08-29		ENSG00000093000	ENSG00000093000			8065	protein-coding gene	gene with protein product		604646	"""nucleoporin 50kD"""	NPAP60L		10449902	Standard	XM_005261312		Approved		uc003bfr.3	Q9UKX7	OTTHUMG00000151265	ENST00000347635.4:c.671delT	chr22.hg19:g.45574449delT	ENSP00000345895:p.Leu224fs	106.0	0.0	0		83.0	11.0	0.13253	NM_007172	B1AHA4|B2RB15|O75644|Q8N6V5|Q9NPM9|Q9NPR6|Q9P1K5	Frame_Shift_Del	DEL	ENST00000347635.4	hg19	CCDS14062.1																																																																																			.	.	.	none		0.408	NUP50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321993.2		
S100PBP	64766	hgsc.bcm.edu	37	1	33292114	33292114	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B3-8121-01A-21D-2396-08	TCGA-B3-8121-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef96a344-c871-4819-aada-dd93a5c7ca7d	5e9a09f1-d8de-4b72-99a8-ec2dad680376	g.chr1:33292114delA	ENST00000373475.5	+	3	668	c.414delA	c.(412-414)gtafs	p.V138fs	S100PBP_ENST00000398243.3_Frame_Shift_Del_p.V138fs|S100PBP_ENST00000356689.3_3'UTR|S100PBP_ENST00000373476.1_Frame_Shift_Del_p.V138fs	NM_022753.3	NP_073590.2			S100P binding protein											endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|stomach(1)	16		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)				GACGCTCTGTACTAGAAAAGA	0.413																																					p.V138fs		Atlas-INDEL	.											S100PBP,colon,carcinoma,0,1	S100PBP	31	.	0			c.413delT						PASS	.						55.0	56.0	56.0					1																	33292114		2203	4300	6503	SO:0001589	frameshift_variant	64766	exon3			.	BX647916	CCDS30666.1	1p35.1	2008-02-05			ENSG00000116497	ENSG00000116497			25768	protein-coding gene	gene with protein product	"""S100P binding protein 1"""	611889				12477932	Standard	NM_022753		Approved	FLJ12903, S100PBPR	uc001bwc.4	Q96BU1	OTTHUMG00000003955	ENST00000373475.5:c.414delA	chr1.hg19:g.33292114delA	ENSP00000362574:p.Val138fs	100.0	0.0	0		70.0	16.0	0.228571	NM_001256121		Frame_Shift_Del	DEL	ENST00000373475.5	hg19	CCDS30666.1																																																																																			.	.	.	none		0.413	S100PBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011266.1	NM_022753	
