#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PHC2	1912	hgsc.bcm.edu	37	1	33790580	33790580	+	Missense_Mutation	SNP	G	G	C	rs370770593		TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr1:33790580G>C	ENST00000257118.5	-	14	2516	c.2463C>G	c.(2461-2463)atC>atG	p.I821M	PHC2_ENST00000485928.1_5'UTR|PHC2_ENST00000373422.3_Missense_Mutation_p.I427M|PHC2_ENST00000431992.1_Missense_Mutation_p.I792M|PHC2_ENST00000419414.2_Missense_Mutation_p.I822M|RP11-415J8.3_ENST00000588828.1_RNA|RP11-415J8.3_ENST00000587696.1_RNA|PHC2_ENST00000373418.3_Missense_Mutation_p.I286M|RP11-415J8.3_ENST00000457957.2_RNA	NM_198040.2	NP_932157.1	Q8IXK0	PHC2_HUMAN	polyhomeotic homolog 2 (Drosophila)	821	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				CTTGCCCGTCGATTTCCTGGG	0.602																																					p.I821M		Atlas-SNP	.											PHC2,NS,carcinoma,0,1	PHC2	78	.	0			c.C2463G						PASS	.						64.0	57.0	59.0					1																	33790580		2203	4300	6503	SO:0001583	missense	1912	exon14			CCCGTCGATTTCC	AJ419231	CCDS378.1, CCDS379.1	1p34.3	2013-01-10	2006-09-12	2002-11-15	ENSG00000134686	ENSG00000134686		"""Sterile alpha motif (SAM) domain containing"""	3183	protein-coding gene	gene with protein product		602979	"""early development regulator 2 (homolog of polyhomeotic 2)"", ""polyhomeotic-like 2 (Drosophila)"""	EDR2		9121482, 12384788	Standard	NM_198040		Approved	HPH2	uc001bxg.1	Q8IXK0	OTTHUMG00000004133	ENST00000257118.5:c.2463C>G	chr1.hg19:g.33790580G>C	ENSP00000257118:p.Ile821Met	52.0	0.0	.		44.0	17.0	.	NM_198040	A1L4Q1|A8KA40|D3DPR2|Q2TAL3|Q5T0C1|Q6NUJ6|Q6ZQR1|Q8N306|Q8TAG8|Q96BL4|Q9Y4Y7	Missense_Mutation	SNP	ENST00000257118.5	hg19	CCDS378.1	.	.	.	.	.	.	.	.	.	.	G	11.89	1.774537	0.31411	.	.	ENSG00000134686	ENST00000431992;ENST00000257118;ENST00000373422;ENST00000373418;ENST00000307890;ENST00000419414	T;T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01;-0.01	5.73	-2.29	0.06805	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.000000	0.85682	D	0.000000	T	0.79969	0.4538	M	0.93978	3.48	0.80722	D	1	D;D;D	0.63880	0.993;0.993;0.993	D;D;D	0.66351	0.943;0.909;0.943	T	0.81627	-0.0847	10	0.87932	D	0	-18.6041	12.5999	0.56491	0.6063:0.0:0.3937:0.0	.	822;793;821	A8KA40;B7ZLY0;Q8IXK0	.;.;PHC2_HUMAN	M	792;821;427;286;397;822	ENSP00000389436:I792M;ENSP00000257118:I821M;ENSP00000362521:I427M;ENSP00000362517:I286M;ENSP00000391440:I822M	ENSP00000257118:I821M	I	-	3	3	PHC2	33563167	0.002000	0.14202	0.497000	0.27552	0.479000	0.33129	-1.250000	0.02885	-0.720000	0.04935	-1.814000	0.00607	ATC	.	.	.	none		0.602	PHC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000011895.1	NM_198040	
ZNF691	51058	hgsc.bcm.edu	37	1	43316674	43316674	+	Missense_Mutation	SNP	G	G	T			TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr1:43316674G>T	ENST00000372506.1	+	4	385	c.45G>T	c.(43-45)gaG>gaT	p.E15D	ZNF691_ENST00000372502.1_Missense_Mutation_p.E37D|ZNF691_ENST00000372508.3_Missense_Mutation_p.E15D|ZNF691_ENST00000372504.1_Missense_Mutation_p.E37D|ZNF691_ENST00000397044.3_Missense_Mutation_p.E46D|ZNF691_ENST00000372507.1_Missense_Mutation_p.E15D	NM_001242739.1	NP_001229668.1	Q5VV52	ZN691_HUMAN	zinc finger protein 691	46						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(2)|lung(2)|ovary(2)|prostate(1)	7	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				ACCTGCCTGAGGAAGGGGAAG	0.547																																					p.E46D		Atlas-SNP	.											.	ZNF691	30	.	0			c.G138T						PASS	.						75.0	75.0	75.0					1																	43316674		2203	4300	6503	SO:0001583	missense	51058	exon4			GCCTGAGGAAGGG		CCDS476.1, CCDS55595.1	1p34.2	2013-01-08			ENSG00000164011	ENSG00000164011		"""Zinc fingers, C2H2-type"""	28028	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001242739		Approved	Zfp691	uc021omh.1	Q5VV52	OTTHUMG00000007623	ENST00000372506.1:c.45G>T	chr1.hg19:g.43316674G>T	ENSP00000361584:p.Glu15Asp	124.0	0.0	.		89.0	4.0	.	NM_001242739	A8MXP6|B4DJR7|O95878|Q9NWE8	Missense_Mutation	SNP	ENST00000372506.1	hg19	CCDS476.1	.	.	.	.	.	.	.	.	.	.	G	15.82	2.946137	0.53079	.	.	ENSG00000164011	ENST00000372508;ENST00000372507;ENST00000372506;ENST00000397044;ENST00000372504;ENST00000397034;ENST00000372503;ENST00000372502	T;T;T;T;T;T;T	0.09630	3.03;3.03;3.03;2.96;2.97;4.42;2.97	5.58	3.66	0.41972	.	0.220360	0.32593	N	0.005885	T	0.07954	0.0199	N	0.19112	0.55	0.35419	D	0.793114	B;B	0.16603	0.007;0.018	B;B	0.16722	0.016;0.016	T	0.11991	-1.0565	10	0.59425	D	0.04	-16.8708	10.9839	0.47510	0.0:0.1404:0.7137:0.1459	.	46;46	B4DJR7;Q5VV52	.;ZN691_HUMAN	D	15;15;15;46;37;46;46;37	ENSP00000361586:E15D;ENSP00000361585:E15D;ENSP00000361584:E15D;ENSP00000380237:E46D;ENSP00000361582:E37D;ENSP00000380228:E46D;ENSP00000361580:E37D	ENSP00000361580:E37D	E	+	3	2	ZNF691	43089261	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.991000	0.40727	0.789000	0.33779	0.655000	0.94253	GAG	.	.	.	none		0.547	ZNF691-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020192.1	NM_015911	
PTPRF	5792	hgsc.bcm.edu	37	1	44035436	44035436	+	Missense_Mutation	SNP	G	G	T			TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr1:44035436G>T	ENST00000359947.4	+	6	895	c.555G>T	c.(553-555)aaG>aaT	p.K185N	PTPRF_ENST00000438120.1_Missense_Mutation_p.K185N|PTPRF_ENST00000372413.3_Missense_Mutation_p.K185N|PTPRF_ENST00000372414.3_Missense_Mutation_p.K185N	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	185	Ig-like C2-type 2.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GCCGCATCAAGCAGCTGCGTT	0.587																																					p.K185N		Atlas-SNP	.											.	PTPRF	172	.	0			c.G555T						PASS	.						40.0	39.0	39.0					1																	44035436		2203	4300	6503	SO:0001583	missense	5792	exon6			CATCAAGCAGCTG	Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.555G>T	chr1.hg19:g.44035436G>T	ENSP00000353030:p.Lys185Asn	74.0	0.0	.		40.0	14.0	.	NM_002840	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Missense_Mutation	SNP	ENST00000359947.4	hg19	CCDS489.2	.	.	.	.	.	.	.	.	.	.	G	19.86	3.906136	0.72868	.	.	ENSG00000142949	ENST00000359947;ENST00000438120;ENST00000372414;ENST00000372413;ENST00000437607	T;T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29;-0.29	4.82	0.168	0.15012	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.35805	N	0.002976	T	0.64638	0.2616	N	0.20610	0.595	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.997	D;D;D;D	0.91635	0.997;0.995;0.999;0.94	T	0.59716	-0.7402	10	0.37606	T	0.19	.	9.6408	0.39837	0.3951:0.0:0.6049:0.0	.	185;185;185;185	Q5T020;P10586-2;P10586;Q5T019	.;.;PTPRF_HUMAN;.	N	185	ENSP00000353030:K185N;ENSP00000398822:K185N;ENSP00000361491:K185N;ENSP00000361490:K185N;ENSP00000413306:K185N	ENSP00000353030:K185N	K	+	3	2	PTPRF	43808023	0.982000	0.34865	1.000000	0.80357	0.993000	0.82548	0.295000	0.19065	0.060000	0.16281	0.561000	0.74099	AAG	.	.	.	none		0.587	PTPRF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000019710.1		
CELSR2	1952	hgsc.bcm.edu	37	1	109801145	109801145	+	Silent	SNP	G	G	A			TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr1:109801145G>A	ENST00000271332.3	+	2	3463	c.3402G>A	c.(3400-3402)gaG>gaA	p.E1134E		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	1134	Cadherin 9. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		TGCGCCTGGAGGACATGTCAC	0.647																																					p.E1134E	NSCLC(158;1285 2011 34800 34852 42084)	Atlas-SNP	.											.	CELSR2	228	.	0			c.G3402A						PASS	.						42.0	36.0	38.0					1																	109801145		2203	4300	6503	SO:0001819	synonymous_variant	1952	exon2			CCTGGAGGACATG	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.3402G>A	chr1.hg19:g.109801145G>A		128.0	0.0	.		130.0	43.0	.	NM_001408	Q5T2Y7|Q92566	Silent	SNP	ENST00000271332.3	hg19	CCDS796.1																																																																																			.	.	.	none		0.647	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408	
PTPN22	26191	hgsc.bcm.edu	37	1	114397574	114397574	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr1:114397574C>T	ENST00000359785.5	-	8	773	c.638G>A	c.(637-639)cGt>cAt	p.R213H	PTPN22_ENST00000538253.1_Intron|AP4B1-AS1_ENST00000419536.1_RNA|PTPN22_ENST00000525799.1_Intron|PTPN22_ENST00000528414.1_Missense_Mutation_p.R213H|PTPN22_ENST00000460620.1_Intron|PTPN22_ENST00000420377.2_Missense_Mutation_p.R213H|PTPN22_ENST00000534519.1_5'Flank	NM_001193431.1|NM_015967.5	NP_001180360.1|NP_057051	Q9Y2R2	PTN22_HUMAN	protein tyrosine phosphatase, non-receptor type 22 (lymphoid)	213	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				negative regulation of T cell activation (GO:0050868)|negative regulation of T cell receptor signaling pathway (GO:0050860)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphoanandamide dephosphorylation (GO:0035644)|protein dephosphorylation (GO:0006470)|regulation of B cell receptor signaling pathway (GO:0050855)|regulation of innate immune response (GO:0045088)|regulation of natural killer cell proliferation (GO:0032817)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	kinase binding (GO:0019900)|protein tyrosine phosphatase activity (GO:0004725)|SH3 domain binding (GO:0017124)			NS(1)|breast(1)|kidney(3)|large_intestine(4)|lung(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Lung SC(450;0.184)	all_cancers(81;1.93e-08)|all_epithelial(167;4.37e-08)|all_lung(203;5.22e-06)|Lung NSC(69;8.94e-06)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTGGTAACAACGTACATCCCA	0.408																																					p.R213H		Atlas-SNP	.											.	PTPN22	90	.	0			c.G638A						PASS	.						178.0	156.0	163.0					1																	114397574		2203	4300	6503	SO:0001583	missense	26191	exon8			TAACAACGTACAT	AF001846	CCDS863.1, CCDS864.1, CCDS864.2	1p13.2	2011-06-09	2005-02-02		ENSG00000134242	ENSG00000134242		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9652	protein-coding gene	gene with protein product		600716	"""protein tyrosine phosphatase, non-receptor type 8"""	PTPN8		10068674, 1373816	Standard	NM_015967		Approved	Lyp, Lyp1, Lyp2	uc001eds.3	Q9Y2R2	OTTHUMG00000011936	ENST00000359785.5:c.638G>A	chr1.hg19:g.114397574C>T	ENSP00000352833:p.Arg213His	80.0	0.0	.		84.0	43.0	.	NM_001193431	A0N0K6|B1ALC8|D4NZ71|E9PLD8|E9PPI1|O95063|O95064|Q6IPX8|Q8WVM1	Missense_Mutation	SNP	ENST00000359785.5	hg19	CCDS863.1	.	.	.	.	.	.	.	.	.	.	C	35	5.473320	0.96274	.	.	ENSG00000134242	ENST00000359785;ENST00000528414;ENST00000420377;ENST00000354605	D;D;D	0.84516	-1.86;-1.86;-1.86	6.16	6.16	0.99307	Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.85682	D	0.000000	D	0.91563	0.7335	M	0.72353	2.195	0.80722	D	1	D;D;D;D	0.89917	0.983;1.0;1.0;1.0	P;D;D;D	0.97110	0.835;1.0;0.994;0.994	D	0.91177	0.4973	10	0.87932	D	0	.	19.6313	0.95704	0.0:1.0:0.0:0.0	.	213;213;213;213	E9PMT0;E9PLD8;G5E984;Q9Y2R2	.;.;.;PTN22_HUMAN	H	213	ENSP00000352833:R213H;ENSP00000435176:R213H;ENSP00000388229:R213H	ENSP00000346621:R213H	R	-	2	0	PTPN22	114199097	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	4.496000	0.60360	2.937000	0.99478	0.650000	0.86243	CGT	.	.	.	none		0.408	PTPN22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033015.1	NM_015967	
SYCP1	6847	hgsc.bcm.edu	37	1	115453123	115453123	+	Splice_Site	SNP	G	G	A			TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr1:115453123G>A	ENST00000369522.3	+	17	1665		c.e17+1		SYCP1_ENST00000369518.1_Splice_Site	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1						chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)		RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGCCAGAGAGGTTTGTTTAAG	0.259																																					.		Atlas-SNP	.											.	SYCP1	149	.	0			c.1425+1G>A						PASS	.						40.0	46.0	44.0					1																	115453123		2199	4290	6489	SO:0001630	splice_region_variant	6847	exon17			AGAGAGGTTTGTT	D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.1425+1G>A	chr1.hg19:g.115453123G>A		337.0	1.0	.		262.0	87.0	.	NM_003176	O14963|Q5VXJ6	Splice_Site	SNP	ENST00000369522.3	hg19	CCDS879.1	.	.	.	.	.	.	.	.	.	.	G	17.09	3.300500	0.60195	.	.	ENSG00000198765	ENST00000369522;ENST00000536734;ENST00000455987;ENST00000369518	.	.	.	4.96	4.96	0.65561	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.0505	0.64732	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SYCP1	115254646	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	5.024000	0.64090	2.440000	0.82611	0.467000	0.42956	.	.	.	.	none		0.259	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033386.1	NM_003176	Intron
ADCY10	55811	hgsc.bcm.edu	37	1	167829047	167829047	+	Missense_Mutation	SNP	G	G	T			TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr1:167829047G>T	ENST00000367851.4	-	16	2078	c.1894C>A	c.(1894-1896)Ctg>Atg	p.L632M	ADCY10_ENST00000545172.1_Missense_Mutation_p.L479M|ADCY10_ENST00000367848.1_Missense_Mutation_p.L540M	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	632					cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						GCTCTTACCAGCTTCAAGATC	0.423																																					p.L632M		Atlas-SNP	.											.	ADCY10	175	.	0			c.C1894A						PASS	.						205.0	216.0	212.0					1																	167829047		2203	4300	6503	SO:0001583	missense	55811	exon16			TTACCAGCTTCAA	AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.1894C>A	chr1.hg19:g.167829047G>T	ENSP00000356825:p.Leu632Met	69.0	0.0	.		66.0	4.0	.	NM_018417	B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Missense_Mutation	SNP	ENST00000367851.4	hg19	CCDS1265.1	.	.	.	.	.	.	.	.	.	.	G	10.72	1.429730	0.25726	.	.	ENSG00000143199	ENST00000545172;ENST00000367851;ENST00000367848	T;T;T	0.66280	-0.2;-0.2;-0.2	5.4	2.21	0.28008	.	0.644144	0.15119	N	0.279490	T	0.20292	0.0488	N	0.08118	0	0.20307	N	0.999911	B;B;B	0.19583	0.037;0.037;0.022	B;B;B	0.14023	0.01;0.01;0.004	T	0.04041	-1.0982	9	0.48119	T	0.1	-6.5051	8.477	0.33018	0.0:0.1476:0.549:0.3034	.	479;540;632	F5GWS5;Q96PN6-2;Q96PN6	.;.;ADCYA_HUMAN	M	479;632;540	ENSP00000441992:L479M;ENSP00000356825:L632M;ENSP00000356822:L540M	ENSP00000356822:L540M	L	-	1	2	ADCY10	166095671	0.936000	0.31750	1.000000	0.80357	0.434000	0.31775	0.414000	0.21164	0.701000	0.31803	0.655000	0.94253	CTG	.	.	.	none		0.423	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083663.1	NM_018417	
RAB3GAP2	25782	hgsc.bcm.edu	37	1	220345388	220345388	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr1:220345388G>A	ENST00000358951.2	-	23	2536	c.2420C>T	c.(2419-2421)gCc>gTc	p.A807V		NM_012414.3	NP_036546.2	Q9H2M9	RBGPR_HUMAN	RAB3 GTPase activating protein subunit 2 (non-catalytic)	807					establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of GTPase activity (GO:0043087)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme activator activity (GO:0008047)|enzyme regulator activity (GO:0030234)|GTPase activator activity (GO:0005096)|protein heterodimerization activity (GO:0046982)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(131;0.0443)		CTCATCGATGGCCACTATAGG	0.423																																					p.A807V		Atlas-SNP	.											.	RAB3GAP2	120	.	0			c.C2420T						PASS	.						45.0	44.0	44.0					1																	220345388		2203	4300	6503	SO:0001583	missense	25782	exon23			TCGATGGCCACTA	AB020646	CCDS31028.1	1q41	2014-03-03			ENSG00000118873	ENSG00000118873			17168	protein-coding gene	gene with protein product		609275				15696165, 16532399, 24482476	Standard	NM_012414		Approved	RAB3-GAP150, KIAA0839, DKFZP434D245, SPG69	uc010puk.1	Q9H2M9	OTTHUMG00000037139	ENST00000358951.2:c.2420C>T	chr1.hg19:g.220345388G>A	ENSP00000351832:p.Ala807Val	169.0	0.0	.		172.0	46.0	.	NM_012414	A6H8V0|O75872|Q9HAB0|Q9UFJ7|Q9UQ15	Missense_Mutation	SNP	ENST00000358951.2	hg19	CCDS31028.1	.	.	.	.	.	.	.	.	.	.	G	16.90	3.250887	0.59212	.	.	ENSG00000118873	ENST00000358951	T	0.32753	1.44	5.71	5.71	0.89125	.	0.048492	0.85682	D	0.000000	T	0.40932	0.1137	L	0.31065	0.9	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.05500	-1.0881	10	0.02654	T	1	.	19.8635	0.96793	0.0:0.0:1.0:0.0	.	807	Q9H2M9	RBGPR_HUMAN	V	807	ENSP00000351832:A807V	ENSP00000351832:A807V	A	-	2	0	RAB3GAP2	218412011	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	8.901000	0.92560	2.700000	0.92200	0.650000	0.86243	GCC	.	.	.	none		0.423	RAB3GAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090205.2	NM_012414	
OBSCN	84033	hgsc.bcm.edu	37	1	228468061	228468061	+	Silent	SNP	A	A	G			TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr1:228468061A>G	ENST00000422127.1	+	29	7889	c.7845A>G	c.(7843-7845)gtA>gtG	p.V2615V	OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000570156.2_Silent_p.V3044V|OBSCN_ENST00000359599.6_Silent_p.V1462V|OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000284548.11_Silent_p.V2615V	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	2615	Ig-like 25.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				ACACGCTGGTACTGAAGAGCA	0.632																																					p.V3044V		Atlas-SNP	.											.	OBSCN	2142	.	0			c.A9132G						PASS	.						35.0	41.0	39.0					1																	228468061		2126	4221	6347	SO:0001819	synonymous_variant	84033	exon34			GCTGGTACTGAAG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.7845A>G	chr1.hg19:g.228468061A>G		71.0	0.0	.		50.0	19.0	.	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	hg19	CCDS58065.1																																																																																			.	.	.	none		0.632	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
LMAN2L	81562	hgsc.bcm.edu	37	2	97400231	97400231	+	Silent	SNP	C	C	T	rs199689213		TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr2:97400231C>T	ENST00000264963.4	-	3	361	c.339G>A	c.(337-339)gtG>gtA	p.V113V	LMAN2L_ENST00000377079.4_Silent_p.V113V|LMAN2L_ENST00000537039.1_5'UTR|LMAN2L_ENST00000534882.1_5'UTR|LMAN2L_ENST00000426463.2_5'UTR	NM_030805.3	NP_110432.1	Q9H0V9	LMA2L_HUMAN	lectin, mannose-binding 2-like	113	L-type lectin-like. {ECO:0000255|PROSITE- ProRule:PRU00658}.				ER to Golgi vesicle-mediated transport (GO:0006888)|protein folding (GO:0006457)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle (GO:0030134)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	mannose binding (GO:0005537)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|lung(2)|skin(1)|urinary_tract(1)	7						TTTTGAAGTGCACCTGCAACT	0.478													C|||	1	0.000199681	0.0	0.0	5008	,	,		21277	0.0		0.0	False		,,,				2504	0.001				p.V113V		Atlas-SNP	.											.	LMAN2L	27	.	0			c.G339A						PASS	.						193.0	171.0	178.0					2																	97400231		2203	4300	6503	SO:0001819	synonymous_variant	81562	exon3			GAAGTGCACCTGC	AL136617	CCDS2023.1, CCDS46365.1	2q11.1	2008-02-05			ENSG00000114988	ENSG00000114988			19263	protein-coding gene	gene with protein product		609552				12609988	Standard	NM_001142292		Approved	DKFZp564L2423, VIPL	uc002swv.3	Q9H0V9	OTTHUMG00000130453	ENST00000264963.4:c.339G>A	chr2.hg19:g.97400231C>T		57.0	0.0	.		71.0	43.0	.	NM_030805	B4DSH3|D3DXH6|Q53GV3|Q53S67|Q63HN6|Q8NBQ6|Q9BQ14	Silent	SNP	ENST00000264963.4	hg19	CCDS2023.1																																																																																			.	C|0.999;T|0.001	0.001	weak		0.478	LMAN2L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252844.1	NM_030805	
FN1	2335	hgsc.bcm.edu	37	2	216269139	216269139	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr2:216269139G>A	ENST00000359671.1	-	20	3491	c.3226C>T	c.(3226-3228)Ccc>Tcc	p.P1076S	FN1_ENST00000345488.5_Missense_Mutation_p.P1076S|FN1_ENST00000432072.2_Missense_Mutation_p.P1076S|FN1_ENST00000354785.4_Missense_Mutation_p.P1076S|FN1_ENST00000336916.4_Missense_Mutation_p.P1076S|FN1_ENST00000357867.4_Missense_Mutation_p.P1076S|FN1_ENST00000346544.3_Missense_Mutation_p.P1076S|FN1_ENST00000357009.2_Missense_Mutation_p.P1076S|FN1_ENST00000446046.1_Missense_Mutation_p.P1076S|FN1_ENST00000443816.1_Missense_Mutation_p.P1076S|FN1_ENST00000356005.4_Missense_Mutation_p.P1076S|FN1_ENST00000323926.6_Missense_Mutation_p.P1076S|FN1_ENST00000421182.1_Missense_Mutation_p.P1076S			P02751	FINC_HUMAN	fibronectin 1	1076	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316, ECO:0000255|PROSITE-ProRule:PRU00478, ECO:0000255|PROSITE-ProRule:PRU00479}.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	GTGGCTTTGGGGCTCTCTTGG	0.443																																					p.P1076S		Atlas-SNP	.											.	FN1	521	.	0			c.C3226T						PASS	.						96.0	92.0	93.0					2																	216269139		2203	4300	6503	SO:0001583	missense	2335	exon20			CTTTGGGGCTCTC		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.3226C>T	chr2.hg19:g.216269139G>A	ENSP00000352696:p.Pro1076Ser	95.0	0.0	.		112.0	32.0	.	NM_212476	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	ENST00000359671.1	hg19		.	.	.	.	.	.	.	.	.	.	G	15.97	2.989242	0.53934	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005	T;T;T;T;T;T;T;T;T;T;T;T;T	0.59364	0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27	5.83	5.83	0.93111	.	0.090164	0.46758	D	0.000261	T	0.61800	0.2376	N	0.25647	0.755	0.37259	D	0.906904	P;B;B;P;P;B;P;D;D;B	0.76494	0.925;0.03;0.028;0.925;0.891;0.055;0.792;0.998;0.999;0.338	P;B;B;P;P;B;P;D;D;B	0.87578	0.79;0.062;0.054;0.661;0.688;0.089;0.507;0.998;0.998;0.287	T	0.65861	-0.6065	10	0.48119	T	0.1	.	9.6598	0.39947	0.0:0.233:0.5644:0.2026	.	1076;1076;1076;1076;1076;1076;1076;1076;1076;1076	P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15	.;.;.;.;.;.;.;.;.;.	S	1076	ENSP00000394423:P1076S;ENSP00000323534:P1076S;ENSP00000338200:P1076S;ENSP00000350534:P1076S;ENSP00000346839:P1076S;ENSP00000352696:P1076S;ENSP00000265312:P1076S;ENSP00000273049:P1076S;ENSP00000349509:P1076S;ENSP00000410422:P1076S;ENSP00000415018:P1076S;ENSP00000399538:P1076S;ENSP00000348285:P1076S	ENSP00000265313:P1076S	P	-	1	0	FN1	215977384	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.440000	0.35024	2.770000	0.95276	0.655000	0.94253	CCC	.	.	.	none		0.443	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476	
COL4A3	1285	hgsc.bcm.edu	37	2	228172490	228172490	+	Silent	SNP	A	A	C			TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr2:228172490A>C	ENST00000396578.3	+	48	4479	c.4317A>C	c.(4315-4317)gcA>gcC	p.A1439A	AC097662.2_ENST00000396588.2_RNA|AC097662.2_ENST00000433324.1_RNA|AC097662.2_ENST00000439598.2_RNA	NM_000091.4	NP_000082.2	Q01955	CO4A3_HUMAN	collagen, type IV, alpha 3 (Goodpasture antigen)	1439	Epitope recognized by Goodpasture antibodies.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|blood circulation (GO:0008015)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|collagen catabolic process (GO:0030574)|endothelial cell apoptotic process (GO:0072577)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|sensory perception of sound (GO:0007605)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metalloendopeptidase inhibitor activity (GO:0008191)|structural molecule activity (GO:0005198)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		GATCACCTGCAACCTGGACAA	0.473																																					p.A1439A		Atlas-SNP	.											.	COL4A3	293	.	0			c.A4317C						PASS	.						114.0	112.0	113.0					2																	228172490		1987	4165	6152	SO:0001819	synonymous_variant	1285	exon48			ACCTGCAACCTGG		CCDS42829.1	2q36-q37	2014-09-17			ENSG00000169031	ENSG00000169031		"""Collagens"""	2204	protein-coding gene	gene with protein product	"""tumstatin"""	120070				1737849	Standard	NM_000091		Approved		uc002vom.2	Q01955	OTTHUMG00000149891	ENST00000396578.3:c.4317A>C	chr2.hg19:g.228172490A>C		290.0	0.0	.		293.0	168.0	.	NM_000091	Q53QQ1|Q53R14|Q53RW8|Q9BQT2|Q9NYC4|Q9UDJ9|Q9UDK9|Q9UDL0|Q9UDL1	Silent	SNP	ENST00000396578.3	hg19	CCDS42829.1																																																																																			.	.	.	none		0.473	COL4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331409.2	NM_000091	
KIF1A	547	hgsc.bcm.edu	37	2	241696846	241696846	+	Intron	SNP	C	C	A			TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr2:241696846C>A	ENST00000320389.7	-	25	2714				KIF1A_ENST00000498729.2_Missense_Mutation_p.E916D	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A						anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		cctcatcctcctcctcctcct	0.687																																					p.E916D		Atlas-SNP	.											.	KIF1A	152	.	0			c.G2748T						PASS	.																																			SO:0001627	intron_variant	547	exon27			ATCCTCCTCCTCC	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.2555+930G>T	chr2.hg19:g.241696846C>A		76.0	0.0	.		110.0	6.0	.	NM_001244008	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	ENST00000320389.7	hg19	CCDS46561.1	.	.	.	.	.	.	.	.	.	.	C	11.67	1.707384	0.30322	.	.	ENSG00000130294	ENST00000498729;ENST00000373308;ENST00000404283	T;T	0.73047	-0.63;-0.71	4.04	3.1	0.35709	.	.	.	.	.	T	0.49830	0.1580	.	.	.	0.26677	N	0.971617	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.002	T	0.24835	-1.0149	8	0.11794	T	0.64	.	10.7257	0.46066	0.3406:0.6594:0.0:0.0	.	916;916	F5H045;Q12756-2	.;.	D	916	ENSP00000438388:E916D;ENSP00000384231:E916D	ENSP00000362405:E916D	E	-	3	2	KIF1A	241345519	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	3.037000	0.49775	1.793000	0.52555	0.462000	0.41574	GAG	.	.	.	none		0.687	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	NM_138483	
SH3TC1	54436	hgsc.bcm.edu	37	4	8238155	8238155	+	Splice_Site	SNP	G	G	C	rs546239040		TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr4:8238155G>C	ENST00000245105.3	+	16	3623	c.3556G>C	c.(3556-3558)Ggg>Cgg	p.G1186R	SH3TC1_ENST00000539824.1_Splice_Site_p.G1110R	NM_018986.3	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1	1186										NS(1)|breast(3)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33						CATCACCCTGGGTAAGCCCCC	0.647																																					p.G1186R	NSCLC(145;2298 2623 35616 37297)	Atlas-SNP	.											.	SH3TC1	105	.	0			c.G3556C						PASS	.						28.0	25.0	26.0					4																	8238155		2043	3933	5976	SO:0001630	splice_region_variant	54436	exon16			ACCCTGGGTAAGC	AK074093	CCDS3399.1	4p16.1	2013-01-11			ENSG00000125089	ENSG00000125089		"""Tetratricopeptide (TTC) repeat domain containing"""	26009	protein-coding gene	gene with protein product							Standard	NM_018986		Approved	FLJ20356	uc003gkv.4	Q8TE82	OTTHUMG00000160934	ENST00000245105.3:c.3556+1G>C	chr4.hg19:g.8238155G>C		225.0	0.0	.		154.0	58.0	.	NM_018986	Q4W5G5	Missense_Mutation	SNP	ENST00000245105.3	hg19	CCDS3399.1	.	.	.	.	.	.	.	.	.	.	G	17.02	3.282626	0.59867	.	.	ENSG00000125089	ENST00000245105;ENST00000539824;ENST00000535265	T;T	0.79352	-1.0;-1.26	3.71	3.71	0.42584	Tetratricopeptide-like helical (1);	0.000000	0.64402	D	0.000001	D	0.87265	0.6134	M	0.78049	2.395	0.58432	D	0.999994	D	0.89917	1.0	D	0.81914	0.995	D	0.89430	0.3716	10	0.87932	D	0	-34.6905	15.0602	0.71947	0.0:0.0:1.0:0.0	.	1186	Q8TE82	S3TC1_HUMAN	R	1186;1110;1015	ENSP00000245105:G1186R;ENSP00000441045:G1110R	ENSP00000245105:G1186R	G	+	1	0	SH3TC1	8289055	1.000000	0.71417	0.995000	0.50966	0.242000	0.25591	7.799000	0.85936	2.108000	0.64289	0.555000	0.69702	GGG	.	.	.	none		0.647	SH3TC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206991.2	NM_018986	Missense_Mutation
ARHGAP24	83478	hgsc.bcm.edu	37	4	86491717	86491717	+	Missense_Mutation	SNP	C	C	T	rs377269441	byFrequency	TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr4:86491717C>T	ENST00000395184.1	+	2	489	c.23C>T	c.(22-24)aCg>aTg	p.T8M	ARHGAP24_ENST00000506421.1_3'UTR|ARHGAP24_ENST00000503995.1_Missense_Mutation_p.T8M	NM_001025616.2	NP_001020787.2	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24	8					activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of ruffle assembly (GO:1900028)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|wound healing, spreading of epidermal cells (GO:0035313)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)	Rac GTPase activator activity (GO:0030675)			breast(3)|cervix(1)|endometrium(3)|large_intestine(4)|lung(10)|skin(1)|stomach(1)|urinary_tract(1)	24		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)		AATGACTCCACGGAGAACCCC	0.473													C|||	3	0.000599042	0.0023	0.0	5008	,	,		17976	0.0		0.0	False		,,,				2504	0.0				p.T8M		Atlas-SNP	.											.	ARHGAP24	116	.	0			c.C23T						PASS	.	C	MET/THR	2,4404	4.2+/-10.8	0,2,2201	71.0	63.0	66.0		23	-1.1	0.0	4		66	1,8599	1.2+/-3.3	0,1,4299	no	missense	ARHGAP24	NM_001025616.2	81	0,3,6500	TT,TC,CC		0.0116,0.0454,0.0231	benign	8/749	86491717	3,13003	2203	4300	6503	SO:0001583	missense	83478	exon2			ACTCCACGGAGAA	AK091196	CCDS3611.1, CCDS34025.1, CCDS43246.1	4q22.1	2013-01-10			ENSG00000138639	ENSG00000138639		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	25361	protein-coding gene	gene with protein product		610586				11230166, 15254788	Standard	NM_001042669		Approved	DKFZP564B1162, FLJ33877, FilGAP	uc003hpk.3	Q8N264	OTTHUMG00000130427	ENST00000395184.1:c.23C>T	chr4.hg19:g.86491717C>T	ENSP00000378611:p.Thr8Met	74.0	0.0	.		60.0	26.0	.	NM_001025616	Q4KMG1|Q6ZNV3|Q86TI5|Q86WE4|Q9H0T6	Missense_Mutation	SNP	ENST00000395184.1	hg19	CCDS34025.1	.	.	.	.	.	.	.	.	.	.	C	12.05	1.821481	0.32237	4.54E-4	1.16E-4	ENSG00000138639	ENST00000395184;ENST00000503995	T;T	0.13307	2.84;2.6	5.81	-1.08	0.09936	Pleckstrin homology-type (1);	1.720280	0.02385	N	0.079112	T	0.05960	0.0155	N	0.02011	-0.69	0.09310	N	1	B;B;B	0.13145	0.0;0.0;0.007	B;B;B	0.09377	0.001;0.001;0.004	T	0.34079	-0.9843	10	0.33141	T	0.24	.	7.8497	0.29446	0.0:0.3655:0.118:0.5164	.	8;8;153	Q8N264;Q8N264-4;Q8N264-5	RHG24_HUMAN;.;.	M	8	ENSP00000378611:T8M;ENSP00000423206:T8M	ENSP00000378611:T8M	T	+	2	0	ARHGAP24	86710741	0.000000	0.05858	0.000000	0.03702	0.979000	0.70002	-0.748000	0.04818	-0.625000	0.05604	0.655000	0.94253	ACG	.	.	.	weak		0.473	ARHGAP24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252815.2	NM_031305	
ZSWIM6	57688	hgsc.bcm.edu	37	5	60839459	60839459	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr5:60839459C>T	ENST00000252744.5	+	14	2963	c.2963C>T	c.(2962-2964)gCc>gTc	p.A988V		NM_020928.1	NP_065979.1	Q9HCJ5	ZSWM6_HUMAN	zinc finger, SWIM-type containing 6	988					neuron projection morphogenesis (GO:0048812)|regulation of neuron migration (GO:2001222)		zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)	8						CTGCAGTGTGCCATGAAGGAT	0.557																																					p.A988V		Atlas-SNP	.											.	ZSWIM6	51	.	0			c.C2963T						PASS	.						65.0	58.0	60.0					5																	60839459		692	1591	2283	SO:0001583	missense	57688	exon14			AGTGTGCCATGAA	BC039438	CCDS47215.1	5q12.1	2011-03-17			ENSG00000130449	ENSG00000130449		"""Zinc fingers, SWIM-type"""	29316	protein-coding gene	gene with protein product		615951				10997877, 16427614	Standard	NM_020928		Approved	KIAA1577	uc003jsr.3	Q9HCJ5	OTTHUMG00000162388	ENST00000252744.5:c.2963C>T	chr5.hg19:g.60839459C>T	ENSP00000252744:p.Ala988Val	59.0	0.0	.		57.0	28.0	.	NM_020928		Missense_Mutation	SNP	ENST00000252744.5	hg19	CCDS47215.1	.	.	.	.	.	.	.	.	.	.	c	26.8	4.775862	0.90195	.	.	ENSG00000130449	ENST00000252744	T	0.58506	0.33	4.87	4.87	0.63330	.	0.000000	0.85682	D	0.000000	T	0.78084	0.4228	M	0.79926	2.475	0.58432	D	0.999999	D	0.76494	0.999	D	0.83275	0.996	T	0.81568	-0.0873	10	0.87932	D	0	-8.6025	18.1999	0.89834	0.0:1.0:0.0:0.0	.	988	Q9HCJ5	ZSWM6_HUMAN	V	988	ENSP00000252744:A988V	ENSP00000252744:A988V	A	+	2	0	ZSWIM6	60875216	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.648000	0.83479	2.528000	0.85240	0.556000	0.70494	GCC	.	.	.	none		0.557	ZSWIM6-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368710.1	NM_020928	
CD180	4064	hgsc.bcm.edu	37	5	66479374	66479374	+	Missense_Mutation	SNP	G	G	T			TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr5:66479374G>T	ENST00000256447.4	-	3	1454	c.1297C>A	c.(1297-1299)Cac>Aac	p.H433N	CTD-2306M10.1_ENST00000602471.1_lincRNA	NM_005582.2	NP_005573.2	Q99467	CD180_HUMAN	CD180 molecule	433					B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(2)|kidney(7)|large_intestine(12)|liver(1)|lung(8)|ovary(1)|stomach(2)	34		Lung NSC(167;4.94e-05)|Prostate(74;0.00601)|Ovarian(174;0.0654)|Breast(144;0.198)|Colorectal(97;0.234)		Lung(70;0.0046)		GCATTAATGTGTAAGCGGGTA	0.453																																					p.H433N		Atlas-SNP	.											.	CD180	78	.	0			c.C1297A						PASS	.						175.0	182.0	179.0					5																	66479374		2203	4300	6503	SO:0001583	missense	4064	exon3			TAATGTGTAAGCG	D83597	CCDS3992.1	5q12	2008-02-05	2006-03-28	2005-06-07	ENSG00000134061	ENSG00000134061		"""CD molecules"""	6726	protein-coding gene	gene with protein product		602226	"""lymphocyte antigen 64 (mouse) homolog, radioprotective, 105kD"", ""CD180 antigen"""	LY64		9763566, 8975706	Standard	NM_005582		Approved	RP105, Ly78	uc003juy.2	Q99467	OTTHUMG00000131229	ENST00000256447.4:c.1297C>A	chr5.hg19:g.66479374G>T	ENSP00000256447:p.His433Asn	92.0	0.0	.		78.0	28.0	.	NM_005582	B2R7Z7|Q32MM5	Missense_Mutation	SNP	ENST00000256447.4	hg19	CCDS3992.1	.	.	.	.	.	.	.	.	.	.	G	0.265	-0.997055	0.02145	.	.	ENSG00000134061	ENST00000256447	T	0.56941	0.43	4.81	1.92	0.25849	.	0.981481	0.08336	N	0.961541	T	0.34077	0.0885	L	0.27975	0.815	0.09310	N	1	B	0.25235	0.121	B	0.23018	0.043	T	0.25257	-1.0137	10	0.16420	T	0.52	.	4.3619	0.11206	0.0748:0.1263:0.41:0.3888	.	433	Q99467	CD180_HUMAN	N	433	ENSP00000256447:H433N	ENSP00000256447:H433N	H	-	1	0	CD180	66515130	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-0.155000	0.10115	0.185000	0.20105	0.563000	0.77884	CAC	.	.	.	none		0.453	CD180-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253973.2	NM_005582	
KDM3B	51780	hgsc.bcm.edu	37	5	137728920	137728920	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr5:137728920C>T	ENST00000314358.5	+	9	2890	c.2690C>T	c.(2689-2691)cCc>cTc	p.P897L	KDM3B_ENST00000394866.1_Missense_Mutation_p.P553L|KDM3B_ENST00000542866.1_5'UTR	NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B	897					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						TCTGGAGAGCCCTTCCTGCAG	0.512																																					p.P897L		Atlas-SNP	.											.	KDM3B	177	.	0			c.C2690T						PASS	.						127.0	114.0	118.0					5																	137728920		2203	4300	6503	SO:0001583	missense	51780	exon9			GAGAGCCCTTCCT	AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	ENST00000314358.5:c.2690C>T	chr5.hg19:g.137728920C>T	ENSP00000326563:p.Pro897Leu	95.0	0.0	.		78.0	41.0	.	NM_016604	A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Missense_Mutation	SNP	ENST00000314358.5	hg19	CCDS34242.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.382255	0.82792	.	.	ENSG00000120733	ENST00000314358;ENST00000545151;ENST00000394866	T;T	0.70045	0.14;-0.45	6.08	6.08	0.98989	.	0.210265	0.51477	D	0.000095	T	0.62780	0.2456	N	0.22421	0.69	0.80722	D	1	P;B	0.46512	0.879;0.374	P;B	0.45998	0.5;0.084	T	0.63919	-0.6528	10	0.51188	T	0.08	-18.7842	20.2751	0.98485	0.0:1.0:0.0:0.0	.	553;897	Q7LBC6-2;Q7LBC6	.;KDM3B_HUMAN	L	897;687;553	ENSP00000326563:P897L;ENSP00000378335:P553L	ENSP00000326563:P897L	P	+	2	0	KDM3B	137756819	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.890000	0.99128	0.655000	0.94253	CCC	.	.	.	none		0.512	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373597.1	NM_016604	
WWC1	23286	hgsc.bcm.edu	37	5	167881045	167881045	+	Silent	SNP	A	A	G	rs201870717|rs116415672	byFrequency	TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr5:167881045A>G	ENST00000265293.4	+	18	3100	c.2598A>G	c.(2596-2598)ggA>ggG	p.G866G	WWC1_ENST00000522140.1_3'UTR|WWC1_ENST00000521089.1_Silent_p.G866G	NM_001161661.1|NM_001161662.1|NM_015238.2	NP_001155133.1|NP_001155134.1|NP_056053.1	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1	866	Glu-rich.|Interaction with histone H3.				cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|hippo signaling (GO:0035329)|negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of MAPK cascade (GO:0043410)|regulation of hippo signaling (GO:0035330)|regulation of intracellular transport (GO:0032386)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(1)|skin(4)	43	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		aggaggagggagaagaggaTG	0.542																																					p.G866G		Atlas-SNP	.											.	WWC1	98	.	0			c.A2598G						PASS	.						119.0	113.0	115.0					5																	167881045		2202	4300	6502	SO:0001819	synonymous_variant	23286	exon18			GGAGGGAGAAGAG	AF506799	CCDS4366.1, CCDS54945.1	5q34	2014-06-13	2006-11-09		ENSG00000113645	ENSG00000113645		"""WW, C2 and coiled-coil domain containing"""	29435	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 168"""	610533	"""WW, C2 and coiled-coil domain containing 1"""			10048485, 12559952	Standard	NM_001161661		Approved	KIBRA, KIAA0869, PPP1R168	uc011den.2	Q8IX03	OTTHUMG00000130408	ENST00000265293.4:c.2598A>G	chr5.hg19:g.167881045A>G		78.0	0.0	.		74.0	18.0	.	NM_015238	B4DK05|O94946|Q6MZX4|Q6Y2F8|Q7Z4G8|Q8WVM4|Q9BT29	Silent	SNP	ENST00000265293.4	hg19	CCDS4366.1	.	.	.	.	.	.	.	.	.	.	A	4.385	0.071000	0.08436	.	.	ENSG00000113645	ENST00000393895;ENST00000524228	.	.	.	4.51	0.519	0.17035	.	.	.	.	.	T	0.41834	0.1176	.	.	.	0.54753	D	0.99998	.	.	.	.	.	.	T	0.20840	-1.0263	4	.	.	.	.	1.5039	0.02482	0.5457:0.1811:0.099:0.1742	.	.	.	.	G	828;643	.	.	R	+	1	2	WWC1	167813623	0.495000	0.26051	0.050000	0.19076	0.001000	0.01503	0.164000	0.16542	-0.074000	0.12820	-0.499000	0.04595	AGA	.	.	.	weak		0.542	WWC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252791.2	NM_015238	
MMS22L	253714	hgsc.bcm.edu	37	6	97702477	97702477	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr6:97702477C>T	ENST00000275053.4	-	10	1340	c.1075G>A	c.(1075-1077)Gca>Aca	p.A359T	MMS22L_ENST00000369251.2_Missense_Mutation_p.A359T	NM_198468.2	NP_940870.2	Q6ZRQ5	MMS22_HUMAN	MMS22-like, DNA repair protein	359					double-strand break repair via homologous recombination (GO:0000724)|replication fork processing (GO:0031297)	nuclear replication fork (GO:0043596)				breast(1)|endometrium(9)|kidney(2)|large_intestine(12)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	50						TAAAATGATGCTACATGAGTA	0.333																																					p.A359T		Atlas-SNP	.											.	MMS22L	102	.	0			c.G1075A						PASS	.						116.0	116.0	116.0					6																	97702477		2203	4300	6503	SO:0001583	missense	253714	exon10			ATGATGCTACATG		CCDS5039.1	6q16.3	2010-11-11	2010-11-11	2010-11-11	ENSG00000146263	ENSG00000146263			21475	protein-coding gene	gene with protein product		615614	"""chromosome 6 open reading frame 167"""	C6orf167		21055983, 21055984	Standard	NM_198468		Approved	dJ39B17.2	uc003ppb.3	Q6ZRQ5	OTTHUMG00000015248	ENST00000275053.4:c.1075G>A	chr6.hg19:g.97702477C>T	ENSP00000275053:p.Ala359Thr	112.0	0.0	.		63.0	24.0	.	NM_198468	D6R9Y8|D6RBQ4|E1P529|Q5THT2|Q68CQ6|Q68D32	Missense_Mutation	SNP	ENST00000275053.4	hg19	CCDS5039.1	.	.	.	.	.	.	.	.	.	.	C	26.8	4.768632	0.90020	.	.	ENSG00000146263	ENST00000275053;ENST00000369251;ENST00000510018;ENST00000482634	T;T;T;T	0.51574	0.7;0.7;0.7;0.7	5.09	5.09	0.68999	.	0.237263	0.35067	N	0.003479	T	0.58708	0.2141	M	0.69823	2.125	0.51482	D	0.999929	D;D	0.67145	0.996;0.981	P;P	0.61800	0.894;0.715	T	0.64228	-0.6457	10	0.72032	D	0.01	-5.7806	16.6752	0.85277	0.0:1.0:0.0:0.0	.	359;359	E2QRD4;Q6ZRQ5	.;MMS22_HUMAN	T	359;359;247;51	ENSP00000275053:A359T;ENSP00000358254:A359T;ENSP00000427288:A247T;ENSP00000421225:A51T	ENSP00000275053:A359T	A	-	1	0	MMS22L	97809198	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.404000	0.66344	2.364000	0.80123	0.655000	0.94253	GCA	.	.	.	none		0.333	MMS22L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041573.3	NM_198468	
TTYH3	80727	hgsc.bcm.edu	37	7	2671817	2671817	+	Missense_Mutation	SNP	T	T	C			TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr7:2671817T>C	ENST00000258796.7	+	1	233	c.28T>C	c.(28-30)Tgg>Cgg	p.W10R	TTYH3_ENST00000407643.1_Missense_Mutation_p.W10R	NM_025250.2	NP_079526.1	Q9C0H2	TTYH3_HUMAN	tweety family member 3	10					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)|intracellular calcium activated chloride channel activity (GO:0005229)			kidney(1)|large_intestine(3)|lung(9)|prostate(2)|upper_aerodigestive_tract(2)	17		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;2.04e-14)		CGCGGCGCCCTGGTGGGTGAG	0.751																																					p.W10R		Atlas-SNP	.											.	TTYH3	36	.	0			c.T28C						PASS	.						7.0	9.0	8.0					7																	2671817		2139	4188	6327	SO:0001583	missense	80727	exon1			GCGCCCTGGTGGG		CCDS34588.1	7p22	2013-09-02	2013-09-02		ENSG00000136295	ENSG00000136295			22222	protein-coding gene	gene with protein product		608919	"""tweety homolog 3 (Drosophila)"""				Standard	NM_025250		Approved	KIAA1691	uc003smp.3	Q9C0H2	OTTHUMG00000152050	ENST00000258796.7:c.28T>C	chr7.hg19:g.2671817T>C	ENSP00000258796:p.Trp10Arg	61.0	0.0	.		72.0	28.0	.	NM_025250	A4D201|B7WP98|Q6L749|Q6ZVG3|Q8TEG6	Missense_Mutation	SNP	ENST00000258796.7	hg19	CCDS34588.1	.	.	.	.	.	.	.	.	.	.	T	14.47	2.544055	0.45280	.	.	ENSG00000136295	ENST00000258796;ENST00000407643	T;T	0.10382	2.89;2.88	4.09	2.9	0.33743	.	0.164594	0.43919	U	0.000511	T	0.27559	0.0677	M	0.74881	2.28	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.00862	-1.1536	10	0.36615	T	0.2	.	8.2175	0.31521	0.1789:0.0:0.0:0.8211	.	10	Q9C0H2	TTYH3_HUMAN	R	10	ENSP00000258796:W10R;ENSP00000385316:W10R	ENSP00000258796:W10R	W	+	1	0	TTYH3	2638343	0.969000	0.33509	1.000000	0.80357	0.546000	0.35178	1.685000	0.37659	0.544000	0.28883	0.260000	0.18958	TGG	.	.	.	none		0.751	TTYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325082.2	XM_166523	
KCTD7	154881	hgsc.bcm.edu	37	7	66103373	66103373	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr7:66103373G>A	ENST00000275532.3	+	3	632	c.448G>A	c.(448-450)Gag>Aag	p.E150K	KCTD7_ENST00000443322.1_Missense_Mutation_p.E150K	NM_001167961.2|NM_153033.4	NP_001161433.1|NP_694578.1	Q96MP8	KCTD7_HUMAN	potassium channel tetramerization domain containing 7	150					cell death (GO:0008219)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|urinary_tract(1)	16						ACTGAAGGGCGAGAAGGTGCG	0.597																																					p.E150K		Atlas-SNP	.											.	KCTD7	26	.	0			c.G448A						PASS	.						89.0	76.0	80.0					7																	66103373		2203	4300	6503	SO:0001583	missense	154881	exon3			AAGGGCGAGAAGG	AK056631	CCDS5534.1, CCDS55117.1	7q11.21	2014-09-17	2013-06-20		ENSG00000243335	ENSG00000243335			21957	protein-coding gene	gene with protein product		611725	"""potassium channel tetramerisation domain containing 7"""			12477932	Standard	NM_001167961		Approved	FLJ32069, EPM3, CLN14	uc003tve.3	Q96MP8	OTTHUMG00000129543	ENST00000275532.3:c.448G>A	chr7.hg19:g.66103373G>A	ENSP00000275532:p.Glu150Lys	147.0	0.0	.		224.0	60.0	.	NM_001167961	A4D2M4|Q8IVR0	Missense_Mutation	SNP	ENST00000275532.3	hg19	CCDS5534.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	25.2|25.2	4.608515|4.608515	0.87258|0.87258	.|.	.|.	ENSG00000243335|ENSG00000243335	ENST00000275532;ENST00000443322|ENST00000449064	T;T|.	0.66460|.	-0.21;-0.21|.	5.93|5.93	5.93|5.93	0.95920|0.95920	.|.	.|0.467978	.|0.15967	.|N	.|0.235981	T|T	0.75766|0.75766	0.3894|0.3894	L|L	0.61218|0.61218	1.895|1.895	0.80722|0.80722	D|D	1|1	P|.	0.43412|.	0.806|.	B|.	0.41202|.	0.35|.	T|T	0.74166|0.74166	-0.3753|-0.3753	9|7	0.42905|0.56958	T|D	0.14|0.05	.|.	19.3421|19.3421	0.94347|0.94347	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	150|.	Q96MP8|.	KCTD7_HUMAN|.	K|Q	150|93	ENSP00000275532:E150K;ENSP00000411624:E150K|.	ENSP00000275532:E150K|ENSP00000388463:R93Q	E|R	+|+	1|2	0|0	KCTD7|KCTD7	65740808|65740808	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	9.152000|9.152000	0.94680|0.94680	2.826000|2.826000	0.97356|0.97356	0.655000|0.655000	0.94253|0.94253	GAG|CGA	.	.	.	none		0.597	KCTD7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251733.2	NM_153033	
PAXIP1	22976	hgsc.bcm.edu	37	7	154760427	154760427	+	Missense_Mutation	SNP	T	T	A			TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr7:154760427T>A	ENST00000404141.1	-	7	1638	c.1484A>T	c.(1483-1485)cAt>cTt	p.H495L	PAXIP1_ENST00000397192.1_Missense_Mutation_p.H495L|PAXIP1_ENST00000473219.1_5'UTR			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1	495	Gln-rich.			Missing (in Ref. 4; AAB91434). {ECO:0000305}.	adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		ctgcagggcatgctgctgctg	0.602																																					p.H495L		Atlas-SNP	.											.	PAXIP1	150	.	0			c.A1484T						PASS	.						31.0	36.0	34.0					7																	154760427		1789	3250	5039	SO:0001583	missense	22976	exon7			AGGGCATGCTGCT	U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.1484A>T	chr7.hg19:g.154760427T>A	ENSP00000384048:p.His495Leu	25.0	0.0	.		31.0	13.0	.	NM_007349	O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	Missense_Mutation	SNP	ENST00000404141.1	hg19	CCDS47753.1	.	.	.	.	.	.	.	.	.	.	T	15.10	2.732484	0.48939	.	.	ENSG00000157212	ENST00000404141;ENST00000397192;ENST00000323199	D;D	0.89746	-2.56;-2.56	4.81	4.81	0.61882	.	0.000000	0.45867	U	0.000323	T	0.80253	0.4589	L	0.29908	0.895	0.39697	D	0.971138	B;B;B;B	0.33238	0.18;0.403;0.403;0.18	B;B;B;B	0.28232	0.04;0.087;0.087;0.04	T	0.77803	-0.2451	10	0.10377	T	0.69	-8.3358	14.0572	0.64776	0.0:0.0:0.0:1.0	.	448;404;461;495	B4DEQ6;Q6ZW49-3;Q6ZW49-1;Q6ZW49	.;.;.;PAXI1_HUMAN	L	495;495;448	ENSP00000384048:H495L;ENSP00000380376:H495L	ENSP00000319149:H448L	H	-	2	0	PAXIP1	154391360	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	3.606000	0.54095	1.796000	0.52611	0.528000	0.53228	CAT	.	.	.	none		0.602	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322223.1	NM_007349	
NCOA2	10499	hgsc.bcm.edu	37	8	71040937	71040937	+	Splice_Site	SNP	C	C	T			TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr8:71040937C>T	ENST00000452400.2	-	17	3784	c.3603G>A	c.(3601-3603)caG>caA	p.Q1201Q	NCOA2_ENST00000267974.4_Splice_Site_p.Q289Q	NM_006540.2	NP_006531.1	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	1201					cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucose metabolic process (GO:0010906)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|signal transducer activity (GO:0004871)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)		PAX3/NCOA2(4)|HEY1/NCOA2(10)	NS(1)|breast(4)|endometrium(7)|kidney(4)|large_intestine(10)|lung(25)|ovary(1)|pancreas(2)|prostate(2)|skin(4)	60	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			AAGAACAGACCTGCTGTGCTT	0.562			T	"""RUNXBP2, HEY1"""	"""AML, Chondrosarcoma"""																																p.Q1201Q		Atlas-SNP	.		Dom	yes		8	8q13.1	10499	nuclear receptor coactivator 2 (TIF2)		L	.	NCOA2	147	.	0			c.G3603A						PASS	.						98.0	100.0	100.0					8																	71040937		2043	4181	6224	SO:0001630	splice_region_variant	10499	exon17			ACAGACCTGCTGT	X97674	CCDS47872.1	8q13.3	2011-07-01			ENSG00000140396	ENSG00000140396		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7669	protein-coding gene	gene with protein product		601993				9111344, 8670870	Standard	XM_005251128		Approved	TIF2, GRIP1, NCoA-2, KAT13C, bHLHe75	uc003xyn.1	Q15596	OTTHUMG00000164671	ENST00000452400.2:c.3603+1G>A	chr8.hg19:g.71040937C>T		45.0	0.0	.		26.0	9.0	.	NM_006540	Q14CD2	Silent	SNP	ENST00000452400.2	hg19	CCDS47872.1	.	.	.	.	.	.	.	.	.	.	C	16.05	3.012869	0.54468	.	.	ENSG00000140396	ENST00000518363	.	.	.	5.89	5.89	0.94794	.	.	.	.	.	T	0.74989	0.3789	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.72191	-0.4365	4	.	.	.	.	18.4423	0.90671	0.0:1.0:0.0:0.0	.	.	.	.	K	302	.	.	R	-	2	0	NCOA2	71203491	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	6.981000	0.76166	2.793000	0.96121	0.655000	0.94253	AGA	.	.	.	none		0.562	NCOA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379696.1		Silent
SC5D	6309	hgsc.bcm.edu	37	11	121174116	121174116	+	Missense_Mutation	SNP	A	A	T			TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr11:121174116A>T	ENST00000392789.2	+	2	269	c.32A>T	c.(31-33)tAt>tTt	p.Y11F	SC5D_ENST00000534230.1_Missense_Mutation_p.Y11F|SC5D_ENST00000264027.4_Missense_Mutation_p.Y11F	NM_001024956.2	NP_001020127.1	O75845	SC5D_HUMAN	sterol-C5-desaturase	11					cholesterol biosynthetic process (GO:0006695)|cholesterol biosynthetic process via lathosterol (GO:0033490)|fatty acid biosynthetic process (GO:0006633)|lipid metabolic process (GO:0006629)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	C-5 sterol desaturase activity (GO:0000248)|iron ion binding (GO:0005506)|lathosterol oxidase activity (GO:0050046)										GCAGATTACTATTTTTTTACA	0.383																																					p.Y11F		Atlas-SNP	.											.	.	.	.	0			c.A32T						PASS	.						159.0	144.0	149.0					11																	121174116		2203	4299	6502	SO:0001583	missense	6309	exon2			ATTACTATTTTTT		CCDS8435.1	11q23.3	2013-03-04	2013-03-04	2013-03-04	ENSG00000109929	ENSG00000109929	1.14.21.6	"""Fatty acid hydroxylase domain containing"""	10547	protein-coding gene	gene with protein product	"""lathosterol oxidase"""	602286	"""sterol-C5-desaturase (fungal ERG3, delta-5-desaturase)-like"", ""sterol-C5-desaturase (ERG3 delta-5-desaturase homolog, fungal)-like"", ""sterol-C5-desaturase (ERG3 delta-5-desaturase homolog, S. cerevisiae)-like"""	SC5DL		8976377	Standard	NM_006918		Approved		uc001pxu.3	O75845	OTTHUMG00000166068	ENST00000392789.2:c.32A>T	chr11.hg19:g.121174116A>T	ENSP00000376539:p.Tyr11Phe	83.0	0.0	.		58.0	20.0	.	NM_001024956	O00119|Q6GTM5|Q9UK15	Missense_Mutation	SNP	ENST00000392789.2	hg19	CCDS8435.1	.	.	.	.	.	.	.	.	.	.	A	14.53	2.562520	0.45694	.	.	ENSG00000109929	ENST00000264027;ENST00000527762;ENST00000534230;ENST00000392789	D;D;D;D	0.86627	-1.76;-1.77;-2.15;-1.76	6.01	4.87	0.63330	.	0.112103	0.64402	D	0.000006	D	0.85440	0.5697	M	0.74881	2.28	0.32097	N	0.59109	B;P;P	0.45348	0.027;0.704;0.856	B;B;B	0.41440	0.027;0.221;0.357	D	0.85106	0.0960	10	0.27082	T	0.32	-11.9118	10.2655	0.43452	0.7368:0.0:0.0:0.2632	.	11;11;11	O75845;E9PQ91;E9PPW5	SC5D_HUMAN;.;.	F	11	ENSP00000264027:Y11F;ENSP00000436290:Y11F;ENSP00000432550:Y11F;ENSP00000376539:Y11F	ENSP00000264027:Y11F	Y	+	2	0	SC5DL	120679326	1.000000	0.71417	0.224000	0.23877	0.434000	0.31775	6.037000	0.70956	1.080000	0.41073	0.528000	0.53228	TAT	.	.	.	none		0.383	SC5D-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387702.1	NM_001024956	
KRT3	3850	hgsc.bcm.edu	37	12	53183951	53183951	+	Missense_Mutation	SNP	C	C	T	rs570613061|rs60125653	byFrequency	TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr12:53183951C>T	ENST00000417996.2	-	9	1836	c.1762G>A	c.(1762-1764)Ggc>Agc	p.G588S	KRT3_ENST00000309505.3_Missense_Mutation_p.G589S	NM_057088.2	NP_476429.2	P12035	K2C3_HUMAN	keratin 3	588	Gly-rich.|Tail.				epithelial cell differentiation (GO:0030855)|intermediate filament cytoskeleton organization (GO:0045104)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|skin(1)	23						GAGCCAAAgccgctgccaccg	0.697																																					p.G588S		Atlas-SNP	.											KRT3,rectum,carcinoma,0,2	KRT3	65	.	0			c.G1762A						PASS	.						14.0	31.0	25.0					12																	53183951		1574	3123	4697	SO:0001583	missense	3850	exon9			CAAAGCCGCTGCC		CCDS44895.1	12q13.13	2013-01-16			ENSG00000186442	ENSG00000186442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6440	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 3"", ""cytokeratin 3"""	148043				7510223, 16831889	Standard	NM_057088		Approved	CK3, K3	uc001say.3	P12035	OTTHUMG00000169799	ENST00000417996.2:c.1762G>A	chr12.hg19:g.53183951C>T	ENSP00000413479:p.Gly588Ser	25.0	0.0	.		36.0	4.0	.	NM_057088	A6NIS2|Q701L8	Missense_Mutation	SNP	ENST00000417996.2	hg19	CCDS44895.1	.	.	.	.	.	.	.	.	.	.	C	13.67	2.307617	0.40795	.	.	ENSG00000186442	ENST00000417996;ENST00000309505	D;D	0.91351	-2.83;-2.83	3.4	-1.34	0.09143	.	0.507655	0.14827	N	0.296110	T	0.80149	0.4570	N	0.22421	0.69	0.09310	N	1	B	0.18166	0.026	B	0.08055	0.003	T	0.65302	-0.6201	10	0.34782	T	0.22	.	7.4497	0.27231	0.0:0.4872:0.0:0.5128	.	588	P12035	K2C3_HUMAN	S	588;589	ENSP00000413479:G588S;ENSP00000312206:G589S	ENSP00000312206:G589S	G	-	1	0	KRT3	51470218	0.000000	0.05858	0.005000	0.12908	0.008000	0.06430	-1.682000	0.01935	-0.284000	0.09102	-0.258000	0.10820	GGC	.	.	.	none		0.697	KRT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405930.1	NM_057088	
METTL21C	196541	hgsc.bcm.edu	37	13	103343200	103343200	+	Missense_Mutation	SNP	T	T	A			TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr13:103343200T>A	ENST00000267273.6	-	2	250	c.245A>T	c.(244-246)gAa>gTa	p.E82V		NM_001010977.1	NP_001010977.1	Q5VZV1	MT21C_HUMAN	methyltransferase like 21C	82					peptidyl-lysine methylation (GO:0018022)|protein methylation (GO:0006479)	nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)			breast(1)|large_intestine(3)|lung(2)|skin(1)	7						CTCTATGGATTCCTGGATGAC	0.463																																					p.E82V		Atlas-SNP	.											.	METTL21C	23	.	0			c.A245T						PASS	.						158.0	134.0	142.0					13																	103343200		2203	4300	6503	SO:0001583	missense	196541	exon2			ATGGATTCCTGGA		CCDS32003.1	13q33.1	2011-03-03	2011-03-03	2011-03-03	ENSG00000139780	ENSG00000139780			33717	protein-coding gene	gene with protein product		615259	"""chromosome 13 open reading frame 39"""	C13orf39			Standard	NM_001010977		Approved	LOC196541	uc001vpj.4	Q5VZV1	OTTHUMG00000017304	ENST00000267273.6:c.245A>T	chr13.hg19:g.103343200T>A	ENSP00000267273:p.Glu82Val	129.0	0.0	.		115.0	55.0	.	NM_001010977		Missense_Mutation	SNP	ENST00000267273.6	hg19	CCDS32003.1	.	.	.	.	.	.	.	.	.	.	T	28.2	4.898708	0.91962	.	.	ENSG00000139780	ENST00000267273	T	0.08008	3.14	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.36524	0.0970	M	0.88512	2.96	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.30090	-0.9990	10	0.66056	D	0.02	-13.0518	15.9872	0.80168	0.0:0.0:0.0:1.0	.	82	Q5VZV1	MT21C_HUMAN	V	82	ENSP00000267273:E82V	ENSP00000267273:E82V	E	-	2	0	METTL21C	102141201	1.000000	0.71417	0.632000	0.29296	0.950000	0.60333	7.423000	0.80229	2.367000	0.80283	0.528000	0.53228	GAA	.	.	.	none		0.463	METTL21C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045682.2	NM_001010977	
NTRK3	4916	hgsc.bcm.edu	37	15	88576204	88576204	+	Missense_Mutation	SNP	G	G	T			TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr15:88576204G>T	ENST00000360948.2	-	13	1630	c.1469C>A	c.(1468-1470)aCg>aAg	p.T490K	NTRK3_ENST00000558306.1_5'UTR|NTRK3_ENST00000557856.1_Missense_Mutation_p.T482K|NTRK3_ENST00000540489.2_Missense_Mutation_p.T490K|NTRK3_ENST00000542733.2_Missense_Mutation_p.T392K|NTRK3_ENST00000558676.1_Missense_Mutation_p.T482K|NTRK3_ENST00000355254.2_Missense_Mutation_p.T490K|NTRK3_ENST00000394480.2_Missense_Mutation_p.T490K|NTRK3_ENST00000357724.2_Missense_Mutation_p.T482K|NTRK3_ENST00000317501.3_Missense_Mutation_p.T490K	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	490					activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			TGACGAGGGCGTGGTGATGCC	0.607			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																											p.T490K		Atlas-SNP	.		Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	.	NTRK3	587	.	0			c.C1469A						PASS	.						101.0	63.0	76.0					15																	88576204		2201	4299	6500	SO:0001583	missense	4916	exon14			GAGGGCGTGGTGA	U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.1469C>A	chr15.hg19:g.88576204G>T	ENSP00000354207:p.Thr490Lys	36.0	0.0	.		34.0	12.0	.	NM_001012338	B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Missense_Mutation	SNP	ENST00000360948.2	hg19	CCDS32322.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.990206	0.74589	.	.	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254;ENST00000542733;ENST00000540489;ENST00000317501	T;T;T;T;T;T;T	0.74209	-0.82;-0.78;-0.74;-0.82;-0.72;-0.05;-0.05	4.91	3.96	0.45880	.	0.049576	0.85682	D	0.000000	T	0.74245	0.3691	L	0.55213	1.73	0.58432	D	0.999999	P;P;P;D;P;D	0.55800	0.605;0.91;0.873;0.973;0.904;0.964	B;B;P;P;P;P	0.49528	0.205;0.298;0.535;0.47;0.493;0.614	T	0.76471	-0.2947	10	0.72032	D	0.01	.	11.0307	0.47772	0.0945:0.0:0.9055:0.0	.	392;482;482;490;490;490	B7Z7U4;E9PG56;B7Z4C5;Q96CY4;Q16288-3;Q16288	.;.;.;.;.;NTRK3_HUMAN	K	490;490;482;490;392;490;490	ENSP00000377990:T490K;ENSP00000354207:T490K;ENSP00000350356:T482K;ENSP00000347397:T490K;ENSP00000437773:T392K;ENSP00000444673:T490K;ENSP00000318328:T490K	ENSP00000318328:T490K	T	-	2	0	NTRK3	86377208	1.000000	0.71417	0.758000	0.31321	0.749000	0.42624	3.300000	0.51834	1.209000	0.43321	0.650000	0.86243	ACG	.	.	.	none		0.607	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding			
RECQL5	9400	hgsc.bcm.edu	37	17	73654500	73654500	+	Missense_Mutation	SNP	A	A	G			TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr17:73654500A>G	ENST00000317905.5	-	7	1186	c.1027T>C	c.(1027-1029)Tac>Cac	p.Y343H	RECQL5_ENST00000423245.2_Missense_Mutation_p.Y316H|RECQL5_ENST00000420326.2_Missense_Mutation_p.Y343H|RECQL5_ENST00000340830.5_Missense_Mutation_p.Y343H|RECQL5_ENST00000584999.1_Missense_Mutation_p.Y343H	NM_004259.6	NP_004250.4	O94762	RECQ5_HUMAN	RecQ protein-like 5	343	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				chromosome separation (GO:0051304)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|mitotic nuclear division (GO:0007067)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA helicase activity (GO:0003678)|nucleic acid binding (GO:0003676)|RNA polymerase II core binding (GO:0000993)			breast(1)|cervix(3)|endometrium(3)|kidney(7)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	36	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			TCCTGGTAGTACCCAGCCATA	0.547								Other identified genes with known or suspected DNA repair function																													p.Y343H		Atlas-SNP	.											.	RECQL5	77	.	0			c.T1027C						PASS	.						115.0	117.0	116.0					17																	73654500		2203	4300	6503	SO:0001583	missense	9400	exon7			GGTAGTACCCAGC	AB006533	CCDS32735.1, CCDS42380.1, CCDS45777.1	17q25	2014-03-07	2014-03-07	2014-03-07	ENSG00000108469	ENSG00000108469			9950	protein-coding gene	gene with protein product	"""RecQ protein 5"""	603781				9878247	Standard	NM_004259		Approved	RecQ5, FLJ90603	uc010dgl.3	O94762		ENST00000317905.5:c.1027T>C	chr17.hg19:g.73654500A>G	ENSP00000317636:p.Tyr343His	68.0	0.0	.		73.0	24.0	.	NM_001003715	Q9H0B1|Q9P1W7|Q9UNC8	Missense_Mutation	SNP	ENST00000317905.5	hg19	CCDS42380.1	.	.	.	.	.	.	.	.	.	.	A	15.21	2.766636	0.49574	.	.	ENSG00000108469	ENST00000423245;ENST00000317905;ENST00000420326;ENST00000340830	T;T;T	0.80480	-1.38;-1.38;-1.38	5.84	5.84	0.93424	Helicase, C-terminal (3);	0.059843	0.64402	D	0.000001	D	0.93776	0.8010	H	0.97852	4.09	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.998	D	0.95965	0.8965	10	0.87932	D	0	-12.8087	16.2108	0.82158	1.0:0.0:0.0:0.0	.	343;316;343	O94762;Q6P4G0;O94762-3	RECQ5_HUMAN;.;.	H	343	ENSP00000317636:Y343H;ENSP00000414933:Y343H;ENSP00000341983:Y343H	ENSP00000317636:Y343H	Y	-	1	0	RECQL5	71166095	1.000000	0.71417	0.981000	0.43875	0.775000	0.43874	9.339000	0.96797	2.232000	0.73038	0.533000	0.62120	TAC	.	.	.	none		0.547	RECQL5-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448207.1	NM_004259	
CEACAM3	1084	hgsc.bcm.edu	37	19	42314872	42314872	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr19:42314872G>A	ENST00000357396.3	+	6	871	c.630G>A	c.(628-630)atG>atA	p.M210I	CEACAM3_ENST00000221999.4_Missense_Mutation_p.V193I|CEACAM3_ENST00000344550.4_Missense_Mutation_p.V193I	NM_001815.2	NP_001806.2	P40198	CEAM3_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 3	210						integral component of membrane (GO:0016021)				endometrium(2)|kidney(4)|large_intestine(1)|lung(4)|prostate(3)|skin(4)|stomach(1)	19						GTCCACAGATGTCCCCTCTCT	0.577																																					p.M210I		Atlas-SNP	.											.	CEACAM3	37	.	0			c.G630A						PASS	.						96.0	83.0	88.0					19																	42314872		2203	4300	6503	SO:0001583	missense	1084	exon6			ACAGATGTCCCCT	E03349	CCDS12586.2, CCDS62685.1	19q13.2	2013-01-11			ENSG00000170956	ENSG00000170956		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1815	protein-coding gene	gene with protein product		609142		CGM1			Standard	NM_001815		Approved	CD66d	uc002orn.2	P40198	OTTHUMG00000150142	ENST00000357396.3:c.630G>A	chr19.hg19:g.42314872G>A	ENSP00000349971:p.Met210Ile	93.0	0.0	.		48.0	19.0	.	NM_001815	G5E978|Q3KPH9	Missense_Mutation	SNP	ENST00000357396.3	hg19	CCDS12586.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.335|0.335	-0.954094|-0.954094	0.02285|0.02285	.|.	.|.	ENSG00000170956|ENSG00000170956	ENST00000357396|ENST00000221999;ENST00000344550	T|T;T	0.01113|0.01165	5.32|5.24;5.24	2.13|2.13	-4.26|-4.26	0.03755|0.03755	.|.	.|.	.|.	.|.	.|.	T|T	0.00815|0.00815	0.0027|0.0027	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	1|1	B|B	0.13594|0.31174	0.008|0.311	B|B	0.15052|0.23716	0.012|0.048	T|T	0.43718|0.43718	-0.9374|-0.9374	8|9	.|0.59425	.|D	.|0.04	.|.	1.0806|1.0806	0.01642|0.01642	0.2181:0.1802:0.4221:0.1797|0.2181:0.1802:0.4221:0.1797	.|.	210|193	P40198|G5E978	CEAM3_HUMAN|.	I|I	210|193	ENSP00000349971:M210I|ENSP00000221999:V193I;ENSP00000341725:V193I	.|ENSP00000221999:V193I	M|V	+|+	3|1	0|0	CEACAM3|CEACAM3	47006712|47006712	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-1.916000|-1.916000	0.01576|0.01576	-1.442000|-1.442000	0.01955|0.01955	-1.295000|-1.295000	0.01343|0.01343	ATG|GTC	.	.	.	none		0.577	CEACAM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316509.2	NM_001815	
ADAMTS1	9510	hgsc.bcm.edu	37	21	28213400	28213400	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr21:28213400G>A	ENST00000284984.3	-	4	1749	c.1295C>T	c.(1294-1296)tCa>tTa	p.S432L		NM_006988.3	NP_008919.3	Q9UHI8	ATS1_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 1	432	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				heart trabecula formation (GO:0060347)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|negative regulation of cell proliferation (GO:0008285)|ovulation from ovarian follicle (GO:0001542)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(20)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	42		Breast(209;0.000962)		Lung(58;0.215)		GGAAAGCATTGACGCCATCAT	0.483																																					p.S432L		Atlas-SNP	.											.	ADAMTS1	131	.	0			c.C1295T						PASS	.						219.0	161.0	181.0					21																	28213400		2203	4300	6503	SO:0001583	missense	9510	exon4			AGCATTGACGCCA	AF060152	CCDS33524.1	21q21.3	2008-05-14	2005-08-19		ENSG00000154734	ENSG00000154734		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	217	protein-coding gene	gene with protein product		605174	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 1"""			10438512	Standard	NM_006988		Approved	C3-C5, METH1, KIAA1346	uc002ymf.3	Q9UHI8	OTTHUMG00000078688	ENST00000284984.3:c.1295C>T	chr21.hg19:g.28213400G>A	ENSP00000284984:p.Ser432Leu	109.0	0.0	.		88.0	35.0	.	NM_006988	D3DSD5|Q9NSJ8|Q9P2K0|Q9UH83|Q9UP80	Missense_Mutation	SNP	ENST00000284984.3	hg19	CCDS33524.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.767069	0.90020	.	.	ENSG00000154734	ENST00000284984;ENST00000517777	T;D	0.87179	3.86;-2.22	5.35	5.35	0.76521	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	.	.	.	.	D	0.92724	0.7687	M	0.68317	2.08	0.80722	D	1	D	0.64830	0.994	D	0.67725	0.953	D	0.92773	0.6234	9	0.87932	D	0	.	19.6142	0.95626	0.0:0.0:1.0:0.0	.	432	Q9UHI8	ATS1_HUMAN	L	432;170	ENSP00000284984:S432L;ENSP00000429557:S170L	ENSP00000284984:S432L	S	-	2	0	ADAMTS1	27135271	1.000000	0.71417	0.358000	0.25811	0.795000	0.44927	9.208000	0.95075	2.941000	0.99782	0.655000	0.94253	TCA	.	.	.	none		0.483	ADAMTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171650.2		
KCNJ15	3772	hgsc.bcm.edu	37	21	39671219	39671219	+	Silent	SNP	C	C	A			TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr21:39671219C>A	ENST00000328656.4	+	4	339	c.36C>A	c.(34-36)ccC>ccA	p.P12P	KCNJ15_ENST00000398938.2_Silent_p.P12P|KCNJ15_ENST00000398934.1_Silent_p.P12P|KCNJ15_ENST00000398932.1_Silent_p.P12P|KCNJ15_ENST00000398930.1_Silent_p.P12P	NM_001276437.1|NM_001276438.1|NM_001276439.1|NM_002243.3	NP_001263366.1|NP_001263367.1|NP_001263368.1|NP_002234.2	Q99712	KCJ15_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 15	12					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	24					Yohimbine(DB01392)	CCAGCACCCCCCTGGTGAAGC	0.527																																					p.D12E		Atlas-SNP	.											.	KCNJ15	43	.	0			c.C36A						PASS	.						56.0	52.0	53.0					21																	39671219		2203	4300	6503	SO:0001819	synonymous_variant	3772	exon3			CACCCCCCTGGTG	Y10745	CCDS13656.1	21q22.2	2011-07-05			ENSG00000157551	ENSG00000157551		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6261	protein-coding gene	gene with protein product		602106				9299242, 8995301, 16382105	Standard	NM_170736		Approved	Kir4.2, Kir1.3, IRKK	uc002ywx.4	Q99712	OTTHUMG00000090609	ENST00000328656.4:c.36C>A	chr21.hg19:g.39671219C>A		155.0	0.0	.		116.0	39.0	.	NM_170736	D3DSH5|O00564|Q96L28|Q99446	Missense_Mutation	SNP	ENST00000328656.4	hg19	CCDS13656.1																																																																																			.	.	.	none		0.527	KCNJ15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207181.2	NM_002243	
PSMG1	8624	hgsc.bcm.edu	37	21	40555300	40555300	+	Silent	SNP	C	C	T			TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr21:40555300C>T	ENST00000331573.3	-	1	477	c.12G>A	c.(10-12)acG>acA	p.T4T	PSMG1_ENST00000380900.2_Silent_p.T4T|AF129408.17_ENST00000608767.1_RNA	NM_001261824.1|NM_003720.3	NP_001248753.1|NP_003711.1	O95456	PSMG1_HUMAN	proteasome (prosome, macropain) assembly chaperone 1	4				T -> S (in Ref. 3; CAG46650). {ECO:0000305}.	cerebellar granule cell precursor proliferation (GO:0021930)|proteasome assembly (GO:0043248)|proteasome core complex assembly (GO:0080129)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)				autonomic_ganglia(1)|endometrium(2)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(2)	8		Prostate(19;8.44e-08)				CTCCGAAGAACGTGGCCGCCA	0.721																																					p.T4T		Atlas-SNP	.											.	PSMG1	11	.	0			c.G12A						PASS	.						11.0	9.0	10.0					21																	40555300		2170	4244	6414	SO:0001819	synonymous_variant	8624	exon1			GAAGAACGTGGCC	AJ006291	CCDS13660.1, CCDS13661.1	21q22.3	2007-10-23	2007-10-23	2007-10-23	ENSG00000183527	ENSG00000183527			3043	protein-coding gene	gene with protein product		605296	"""Down syndrome critical region gene 2"""	DSCR2		10872820, 17189198	Standard	NM_003720		Approved	c21-LRP, LRPC21, PAC1	uc002yxi.4	O95456	OTTHUMG00000066034	ENST00000331573.3:c.12G>A	chr21.hg19:g.40555300C>T		24.0	0.0	.		32.0	14.0	.	NM_203433	B5BUN2|Q6FHA3|Q6FHD3|Q6S713	Silent	SNP	ENST00000331573.3	hg19	CCDS13660.1																																																																																			.	.	.	none		0.721	PSMG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141404.2	NM_003720	
SREBF2	6721	hgsc.bcm.edu	37	22	42274013	42274013	+	Silent	SNP	C	C	T			TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr22:42274013C>T	ENST00000361204.4	+	9	1813	c.1647C>T	c.(1645-1647)gtC>gtT	p.V549V		NM_004599.2	NP_004590.2	Q12772	SRBP2_HUMAN	sterol regulatory element binding transcription factor 2	549					cellular lipid metabolic process (GO:0044255)|cellular response to laminar fluid shear stress (GO:0071499)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cholesterol homeostasis (GO:2000188)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|response to low-density lipoprotein particle (GO:0055098)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SREBP-SCAP-Insig complex (GO:0032937)	E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(6)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						GTGTGATTGTCCTGAGCGTCT	0.557																																					p.V549V		Atlas-SNP	.											.	SREBF2	99	.	0			c.C1647T						PASS	.						158.0	149.0	152.0					22																	42274013		2203	4300	6503	SO:0001819	synonymous_variant	6721	exon9			GATTGTCCTGAGC	U02031	CCDS14023.1	22q13.2	2013-05-21			ENSG00000198911	ENSG00000198911		"""Basic helix-loop-helix proteins"""	11290	protein-coding gene	gene with protein product		600481				7903453	Standard	NM_004599		Approved	SREBP2, bHLHd2	uc003bbi.3	Q12772	OTTHUMG00000151261	ENST00000361204.4:c.1647C>T	chr22.hg19:g.42274013C>T		78.0	0.0	.		55.0	21.0	.	NM_004599	Q05BD5|Q6GTH7|Q86V36|Q9UH04	Silent	SNP	ENST00000361204.4	hg19	CCDS14023.1																																																																																			.	.	.	none		0.557	SREBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321956.1	NM_004599	
ZNF462	58499	hgsc.bcm.edu	37	9	109736499	109736500	+	Frame_Shift_Del	DEL	CC	CC	-			TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	CC	CC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr9:109736499_109736500delCC	ENST00000277225.5	+	9	7066_7067	c.6777_6778delCC	c.(6775-6780)tgcctcfs	p.L2260fs	ZNF462_ENST00000457913.1_Frame_Shift_Del_p.L2320fs|ZNF462_ENST00000441147.2_Frame_Shift_Del_p.L1166fs|ZNF462_ENST00000542028.1_Frame_Shift_Del_p.L217fs|RP11-508N12.2_ENST00000439901.1_RNA			Q96JM2	ZN462_HUMAN	zinc finger protein 462	2260					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						GTCCTCTCTGCCTCTATCACAC	0.53																																					p.2259_2259del		Atlas-Indel,Pindel	.											.	ZNF462	322	.	0			c.6776_6777del						PASS	.																																			SO:0001589	frameshift_variant	58499	exon9			.	AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.6777_6778delCC	chr9.hg19:g.109736499_109736500delCC	ENSP00000277225:p.Leu2260fs	84.0	0.0	0		66.0	11.0	0.166667	NM_021224	Q5T0T4|Q8N408	Frame_Shift_Del	DEL	ENST00000277225.5	hg19	CCDS35096.1																																																																																			.	.	.	none		0.530	ZNF462-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053532.2	NM_021224	
ZNF257	113835	hgsc.bcm.edu	37	19	22272080	22272084	+	Frame_Shift_Del	DEL	ACTGG	ACTGG	-	rs368738613		TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	ACTGG	ACTGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr19:22272080_22272084delACTGG	ENST00000594947.1	+	4	1672_1676	c.1528_1532delACTGG	c.(1528-1533)actggafs	p.TG510fs		NM_033468.2	NP_258429.2	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	510					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|lung(4)	6		all_lung(12;0.0961)|Lung NSC(12;0.103)				GATAATTCATACTGGAGAGAAACCC	0.39																																					p.509_511del		Atlas-Indel,Pindel	.											.	ZNF257	156	.	0			c.1527_1531del						PASS	.																																			SO:0001589	frameshift_variant	113835	exon4			.	AF070651	CCDS46030.1	19p12	2014-02-14			ENSG00000197134	ENSG00000197134		"""Zinc fingers, C2H2-type"", ""-"""	13498	protein-coding gene	gene with protein product		606957				10585455	Standard	NM_033468		Approved	BMZF-4	uc010ecx.3	Q9Y2Q1	OTTHUMG00000182927	ENST00000594947.1:c.1528_1532delACTGG	chr19.hg19:g.22272080_22272084delACTGG	ENSP00000470209:p.Thr510fs	73.0	0.0	0		66.0	19.0	0.287879	NM_033468	B3KPS4|E9PG34|Q8NE34	Frame_Shift_Del	DEL	ENST00000594947.1	hg19	CCDS46030.1																																																																																			.	.	.	none		0.390	ZNF257-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464382.1		
SNRNP200	23020	hgsc.bcm.edu	37	2	96950320	96950340	+	Splice_Site	DEL	ATACCTGGCGGGCAGAGGAGG	ATACCTGGCGGGCAGAGGAGG	-	rs372471318|rs376605359|rs190395367|rs143898031	byFrequency	TCGA-B3-A6W5-01A-12D-A33Q-10	TCGA-B3-A6W5-10A-01D-A33Q-10	ATACCTGGCGGGCAGAGGAGG	ATACCTGGCGGGCAGAGGAGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec2328b7-a0f9-49c8-b4e9-a58bbe773253	2943c0fb-d6d4-4cfb-af57-36d91e6005ba	g.chr2:96950320_96950340delATACCTGGCGGGCAGAGGAGG	ENST00000323853.5	-	31	4242_4245	c.4165_4168delCCTCCTCTGCCCGCCAGGTAT	c.(4165-4170)cctcct>ct	p.PP1389del	SNRNP200_ENST00000349783.5_Intron	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	1389	Helicase ATP-binding 2. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						CAGTCCATGTATACCTGGCGGGCAGAGGAGGGAGGCAGAAC	0.529																																					p.1389_1390del		Atlas-Indel,Pindel	.											.	SNRNP200	195	.	0			c.4165_4169del						PASS	.																																			SO:0001630	splice_region_variant	23020	exon31			.	AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.4165-1CCTCCTCTGCCCGCCAGGTAT>-	chr2.hg19:g.96950320_96950340delATACCTGGCGGGCAGAGGAGG		51.0	0.0	0		42.0	16.0	0.380952	NM_014014	O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Frame_Shift_Del	DEL	ENST00000323853.5	hg19	CCDS2020.1																																																																																			.	.	.	none		0.529	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252846.2	NM_014014	In_Frame_Del
