#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
IGHV3-30	28439	broad.mit.edu	37	14	106790926	106790926	+	RNA	SNP	C	C	A			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr14:106790926C>A	ENST00000390613.2	-	0	431									immunoglobulin heavy variable 3-30																		TCCTGAGCGCCCCCTGCCGCT	0.582																																																	0																																												8755			M83134		14q32.33	2012-02-08			ENSG00000211953	ENSG00000270550		"""Immunoglobulins / IGH locus"""	5591	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000152069		14.37:g.106790926C>A				RNA	SNP	ENST00000390613.2	37																																																																																					0.582	IGHV3-30-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene	OTTHUMT00000325163.1		NG_001019	
AGMAT	79814	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	15909873	15909873	+	Missense_Mutation	SNP	A	A	G	rs148899500		TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr1:15909873A>G	ENST00000375826.3	-	2	432	c.290T>C	c.(289-291)aTc>aCc	p.I97T	DNAJC16_ENST00000483270.1_Intron|RP4-680D5.2_ENST00000428945.1_RNA	NM_024758.4	NP_079034.3	Q9BSE5	SPEB_HUMAN	agmatine ureohydrolase (agmatinase)	97					agmatine biosynthetic process (GO:0097055)|cellular nitrogen compound metabolic process (GO:0034641)|polyamine metabolic process (GO:0006595)|putrescine biosynthetic process from arginine (GO:0033388)|small molecule metabolic process (GO:0044281)|spermidine biosynthetic process (GO:0008295)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	agmatinase activity (GO:0008783)|metal ion binding (GO:0046872)	p.I97T(1)		endometrium(1)|kidney(2)|large_intestine(6)|lung(2)|skin(1)	12		Breast(348;0.000207)|Colorectal(325;0.000258)|Lung NSC(340;0.000359)|all_lung(284;0.000486)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.93e-07)|COAD - Colon adenocarcinoma(227;3.91e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000121)|KIRC - Kidney renal clear cell carcinoma(229;0.00257)|STAD - Stomach adenocarcinoma(313;0.00734)|READ - Rectum adenocarcinoma(331;0.0649)		TTCTTCCCGGATGCGGCGAGG	0.547																																					NSCLC(126;1678 1780 25805 43508 49531)												1	Substitution - Missense(1)	kidney(1)						A	THR/ILE	2,4404	4.2+/-10.8	0,2,2201	51.0	46.0	48.0		290	5.1	1.0	1	dbSNP_134	48	0,8600		0,0,4300	no	missense	AGMAT	NM_024758.4	89	0,2,6501	GG,GA,AA		0.0,0.0454,0.0154	probably-damaging	97/353	15909873	2,13004	2203	4300	6503	SO:0001583	missense	79814			AY057097	CCDS160.1	1p36.13	2009-01-05			ENSG00000116771	ENSG00000116771			18407	protein-coding gene	gene with protein product						11804860, 14648699, 11914032	Standard	NM_024758		Approved	FLJ23384	uc001awv.2	Q9BSE5	OTTHUMG00000002357	ENST00000375826.3:c.290T>C	1.37:g.15909873A>G	ENSP00000364986:p.Ile97Thr		Q5TDH1|Q9H5J3	Missense_Mutation	SNP	ENST00000375826.3	37	CCDS160.1	.	.	.	.	.	.	.	.	.	.	A	19.69	3.874290	0.72180	4.54E-4	0.0	ENSG00000116771	ENST00000375826	T	0.41758	0.99	5.13	5.13	0.70059	Ureohydrolase domain (1);	0.000000	0.85682	D	0.000000	T	0.79563	0.4467	H	0.99487	4.59	0.50313	D	0.999869	D	0.89917	1.0	D	0.97110	1.0	D	0.88180	0.2870	10	0.87932	D	0	-23.1425	13.8194	0.63311	1.0:0.0:0.0:0.0	.	97	Q9BSE5	SPEB_HUMAN	T	97	ENSP00000364986:I97T	ENSP00000364986:I97T	I	-	2	0	AGMAT	15782460	1.000000	0.71417	0.994000	0.49952	0.680000	0.39746	8.364000	0.90105	1.952000	0.56665	0.456000	0.33151	ATC		0.547	AGMAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006763.1		NM_024758	
ASTE1	28990	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	130743620	130743620	+	Missense_Mutation	SNP	G	G	T			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr3:130743620G>T	ENST00000264992.3	-	3	972	c.531C>A	c.(529-531)agC>agA	p.S177R	NEK11_ENST00000510769.1_5'Flank|NEK11_ENST00000507910.1_5'Flank|NEK11_ENST00000429253.2_5'Flank|NEK11_ENST00000412440.2_5'Flank|ASTE1_ENST00000514044.1_Missense_Mutation_p.S177R|NEK11_ENST00000510688.1_5'Flank|NEK11_ENST00000511262.1_5'Flank|NEK11_ENST00000383366.4_5'Flank|NEK11_ENST00000356918.4_5'Flank	NM_014065.2	NP_054784.2	Q2TB18	ASTE1_HUMAN	asteroid homolog 1 (Drosophila)	177					DNA repair (GO:0006281)		nuclease activity (GO:0004518)	p.S177R(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)	22						TCCACTGAAAGCTATTCAATG	0.388																																																	1	Substitution - Missense(1)	kidney(1)											68.0	68.0	68.0					3																	130743620		2203	4300	6503	SO:0001583	missense	28990			AF113539	CCDS3068.1, CCDS75007.1	3q21.3	2005-11-17			ENSG00000034533	ENSG00000034533			25021	protein-coding gene	gene with protein product							Standard	NM_014065		Approved	HT001	uc003env.1	Q2TB18	OTTHUMG00000159644	ENST00000264992.3:c.531C>A	3.37:g.130743620G>T	ENSP00000264992:p.Ser177Arg		B4DFL9|Q3MIB6|Q8N6G4|Q96JY1|Q9UHX6	Missense_Mutation	SNP	ENST00000264992.3	37	CCDS3068.1	.	.	.	.	.	.	.	.	.	.	G	3.331	-0.136628	0.06711	.	.	ENSG00000034533	ENST00000514044;ENST00000264992;ENST00000446270	.	.	.	5.52	2.13	0.27403	.	0.491335	0.26397	N	0.024616	T	0.45955	0.1368	L	0.61218	1.895	0.40170	D	0.977167	P;P	0.42584	0.784;0.662	B;B	0.42138	0.377;0.377	T	0.37314	-0.9711	9	0.19590	T	0.45	-1.348	8.104	0.30874	0.1884:0.1286:0.683:0.0	.	177;177	D6RG30;Q2TB18	.;ASTE1_HUMAN	R	177	.	ENSP00000264992:S177R	S	-	3	2	ASTE1	132226310	0.196000	0.23350	0.979000	0.43373	0.064000	0.16182	0.516000	0.22817	1.338000	0.45544	-0.140000	0.14226	AGC		0.388	ASTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356659.1		NM_014065	
BLMH	642	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	28598331	28598331	+	Silent	SNP	T	T	C			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr17:28598331T>C	ENST00000261714.6	-	10	1278	c.1104A>G	c.(1102-1104)tcA>tcG	p.S368S	BLMH_ENST00000394819.3_Silent_p.S281S|BLMH_ENST00000582669.1_5'Flank	NM_000386.3	NP_000377.1	Q13867	BLMH_HUMAN	bleomycin hydrolase	368					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|carboxypeptidase activity (GO:0004180)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)	p.S368S(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(2)|ovary(1)|prostate(1)|stomach(1)	13					Bleomycin(DB00290)	GGGTCATAAGTGACTCACCAA	0.448																																					Pancreas(127;628 1772 12912 33293 36203)												1	Substitution - coding silent(1)	kidney(1)											131.0	117.0	122.0					17																	28598331		2203	4300	6503	SO:0001819	synonymous_variant	642			X92106	CCDS32604.1	17q11.2	2004-02-16				ENSG00000108578			1059	protein-coding gene	gene with protein product		602403				9407121, 9331073	Standard	NM_000386		Approved	BH	uc002hez.2	Q13867		ENST00000261714.6:c.1104A>G	17.37:g.28598331T>C			B2R796|Q53F86|Q9UER9	Silent	SNP	ENST00000261714.6	37	CCDS32604.1																																																																																				0.448	BLMH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447940.1		NM_000386	
TMEM243	79161	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	86827282	86827282	+	Missense_Mutation	SNP	A	A	G			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr7:86827282A>G	ENST00000433078.1	-	4	650	c.209T>C	c.(208-210)tTg>tCg	p.L70S	TMEM243_ENST00000257637.3_Missense_Mutation_p.L70S|TMEM243_ENST00000481425.1_5'UTR|TMEM243_ENST00000423734.1_Missense_Mutation_p.L70S			Q9BU79	TM243_HUMAN	transmembrane protein 243, mitochondrial	70						integral component of membrane (GO:0016021)		p.L70S(1)									AATACTACTCAAAGAGATGCA	0.368																																																	1	Substitution - Missense(1)	kidney(1)											145.0	128.0	134.0					7																	86827282		2203	4299	6502	SO:0001583	missense	0				CCDS5602.1	7q21.12	2012-12-03	2012-12-03	2012-12-03	ENSG00000135185	ENSG00000135185			21707	protein-coding gene	gene with protein product	"""MDR1 and mitochondrial taxol resistance associated gene"""		"""chromosome 7 open reading frame 23"""	C7orf23			Standard	NM_024315		Approved	MGC4175, MM-TRAG	uc003uio.3	Q9BU79	OTTHUMG00000130823	ENST00000433078.1:c.209T>C	7.37:g.86827282A>G	ENSP00000398083:p.Leu70Ser		A4D1C6|B2R9I4|D6W5P1	Missense_Mutation	SNP	ENST00000433078.1	37	CCDS5602.1	.	.	.	.	.	.	.	.	.	.	A	26.1	4.700700	0.88924	.	.	ENSG00000135185	ENST00000257637;ENST00000433078;ENST00000423734	.	.	.	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.78259	0.4255	M	0.69823	2.125	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.80632	-0.1296	9	0.72032	D	0.01	-8.3378	15.1227	0.72457	1.0:0.0:0.0:0.0	.	70	Q9BU79	CG023_HUMAN	S	70	.	ENSP00000257637:L70S	L	-	2	0	C7orf23	86665218	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.513000	0.90542	2.170000	0.68504	0.459000	0.35465	TTG		0.368	TMEM243-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334412.1		NM_024315	
CLDN16	10686	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	190106143	190106143	+	Missense_Mutation	SNP	G	G	T			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr3:190106143G>T	ENST00000264734.2	+	1	483	c.235G>T	c.(235-237)Gct>Tct	p.A79S	CLDN16_ENST00000456423.1_Missense_Mutation_p.A79S|CLDN16_ENST00000468220.1_Intron	NM_006580.3	NP_006571.1	Q9Y5I7	CLD16_HUMAN	claudin 16	79					calcium-independent cell-cell adhesion (GO:0016338)|cellular metal ion homeostasis (GO:0006875)|excretion (GO:0007588)|magnesium ion transport (GO:0015693)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|magnesium ion transmembrane transporter activity (GO:0015095)|structural molecule activity (GO:0005198)	p.A79S(1)		breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|skin(1)	19	all_cancers(143;3.61e-10)|Ovarian(172;0.0991)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.018)		TCAATACATCGCTTGCTTCTT	0.512																																																	1	Substitution - Missense(1)	kidney(1)											310.0	272.0	285.0					3																	190106143		2203	4300	6503	SO:0001583	missense	10686			AF152101	CCDS3296.1	3q28	2008-12-10			ENSG00000113946	ENSG00000113946		"""Claudins"""	2037	protein-coding gene	gene with protein product	"""paracellin-1"", ""hypomagnesemia 3, with hypercalciuria and nephrocalcinosis"""	603959				10390358	Standard	NM_006580		Approved	PCLN1, HOMG3	uc003fsi.3	Q9Y5I7	OTTHUMG00000156215	ENST00000264734.2:c.235G>T	3.37:g.190106143G>T	ENSP00000264734:p.Ala79Ser			Missense_Mutation	SNP	ENST00000264734.2	37	CCDS3296.1	.	.	.	.	.	.	.	.	.	.	G	11.53	1.664862	0.29604	.	.	ENSG00000113946	ENST00000264734;ENST00000456423	D;D	0.93712	-2.67;-3.27	5.91	5.91	0.95273	.	0.077448	0.52532	D	0.000064	D	0.94509	0.8232	L	0.56769	1.78	0.24098	N	0.995882	D;B	0.61080	0.989;0.027	P;B	0.55161	0.77;0.065	D	0.89753	0.3941	10	0.52906	T	0.07	-24.523	15.7957	0.78409	0.0:0.0:1.0:0.0	.	79;79	A0SDD8;Q9Y5I7	.;CLD16_HUMAN	S	79	ENSP00000264734:A79S;ENSP00000414136:A79S	ENSP00000264734:A79S	A	+	1	0	CLDN16	191588837	0.791000	0.28800	0.785000	0.31869	0.069000	0.16628	5.006000	0.63978	2.805000	0.96524	0.460000	0.39030	GCT		0.512	CLDN16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343519.1		NM_006580	
CLK1	1195	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	201725966	201725966	+	Missense_Mutation	SNP	G	G	A			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr2:201725966G>A	ENST00000321356.4	-	3	520	c.385C>T	c.(385-387)Cat>Tat	p.H129Y	Y_RNA_ENST00000516950.1_RNA|CLK1_ENST00000492793.1_5'UTR|CLK1_ENST00000434813.2_Missense_Mutation_p.H171Y	NM_004071.3	NP_004062.2	P49759	CLK1_HUMAN	CDC-like kinase 1	129					cell proliferation (GO:0008283)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)	p.H129Y(1)|p.H171Y(1)|p.H129N(1)		NS(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(12)|ovary(1)|pancreas(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						CATACCCCATGTGAACGACGA	0.358																																																	3	Substitution - Missense(3)	kidney(2)|lung(1)											150.0	150.0	150.0					2																	201725966		2203	4300	6503	SO:0001583	missense	1195			L29219	CCDS2331.1, CCDS54427.1	2q33	2008-05-02			ENSG00000013441	ENSG00000013441		"""CDC-like kinases"""	2068	protein-coding gene	gene with protein product		601951				9856501	Standard	NM_004071		Approved		uc002uwe.2	P49759	OTTHUMG00000132784	ENST00000321356.4:c.385C>T	2.37:g.201725966G>A	ENSP00000326830:p.His129Tyr		B4DFW7|Q0P694|Q8N5V8	Missense_Mutation	SNP	ENST00000321356.4	37	CCDS2331.1	.	.	.	.	.	.	.	.	.	.	G	13.44	2.239134	0.39598	.	.	ENSG00000013441	ENST00000321356;ENST00000357369;ENST00000434813	T;T	0.67171	-0.23;-0.25	4.42	4.42	0.53409	.	0.366537	0.28572	N	0.014879	T	0.66386	0.2784	L	0.60455	1.87	0.42164	D	0.991618	P;P	0.37176	0.586;0.586	B;B	0.40534	0.332;0.332	T	0.70594	-0.4829	10	0.49607	T	0.09	.	15.1958	0.73088	0.0:0.0:1.0:0.0	.	171;129	B4DFW7;P49759	.;CLK1_HUMAN	Y	129;129;171	ENSP00000326830:H129Y;ENSP00000394734:H171Y	ENSP00000326830:H129Y	H	-	1	0	CLK1	201434211	0.998000	0.40836	0.999000	0.59377	0.986000	0.74619	4.167000	0.58209	2.179000	0.69175	0.650000	0.86243	CAT		0.358	CLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256192.2			
COL22A1	169044	hgsc.bcm.edu;ucsc.edu	37	8	139638478	139638482	+	Frame_Shift_Del	DEL	TTCTT	TTCTT	-			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	TTCTT	TTCTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr8:139638478_139638482delTTCTT	ENST00000303045.6	-	51	4114_4118	c.3668_3672delAAGAA	c.(3667-3672)aaagaafs	p.KE1223fs	COL22A1_ENST00000435777.1_Frame_Shift_Del_p.KE1203fs|COL22A1_ENST00000341807.4_5'UTR	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1223	Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CAGGAGGGCCTTCTTTCCCCTAAAA	0.429										HNSCC(7;0.00092)																																							0																																										SO:0001589	frameshift_variant	169044			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.3668_3672delAAGAA	8.37:g.139638478_139638482delTTCTT	ENSP00000303153:p.Lys1223fs		B7ZMH0|C9K0G4|Q8IVT9	Frame_Shift_Del	DEL	ENST00000303045.6	37	CCDS6376.1																																																																																				0.429	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2		XM_291257	
COL6A2	1292	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	21	47533975	47533975	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr21:47533975C>A	ENST00000300527.4	+	5	893	c.789C>A	c.(787-789)taC>taA	p.Y263*	COL6A2_ENST00000310645.5_Nonsense_Mutation_p.Y263*|COL6A2_ENST00000397763.1_Nonsense_Mutation_p.Y263*|COL6A2_ENST00000409416.1_Nonsense_Mutation_p.Y263*|COL6A2_ENST00000357838.4_Nonsense_Mutation_p.Y263*	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	263	Triple-helical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)		p.Y263*(3)		NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		CCAAGGGCTACCGTGGACAGA	0.572																																																	3	Substitution - Nonsense(3)	kidney(3)											101.0	81.0	88.0					21																	47533975		2203	4300	6503	SO:0001587	stop_gained	1292			M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.789C>A	21.37:g.47533975C>A	ENSP00000300527:p.Tyr263*		Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Nonsense_Mutation	SNP	ENST00000300527.4	37	CCDS13728.1	.	.	.	.	.	.	.	.	.	.	C	36	5.906202	0.97087	.	.	ENSG00000142173	ENST00000300527;ENST00000357838;ENST00000310645;ENST00000409416;ENST00000397763	.	.	.	4.52	3.61	0.41365	.	0.208186	0.42682	D	0.000676	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.8902	6.4509	0.21903	0.1569:0.6918:0.0:0.1512	.	.	.	.	X	263	.	ENSP00000300527:Y263X	Y	+	3	2	COL6A2	46358403	0.995000	0.38212	1.000000	0.80357	0.946000	0.59487	1.898000	0.39809	2.237000	0.73441	0.643000	0.83706	TAC		0.572	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206971.1			
COMP	1311	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	18901411	18901411	+	Silent	SNP	G	G	A			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr19:18901411G>A	ENST00000222271.2	-	3	221	c.177C>T	c.(175-177)atC>atT	p.I59I	COMP_ENST00000425807.1_Silent_p.I59I|COMP_ENST00000542601.2_Silent_p.I26I	NM_000095.2	NP_000086.2	P49747	COMP_HUMAN	cartilage oligomeric matrix protein	59	COMP N-terminal.				apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|limb development (GO:0060173)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)|protease binding (GO:0002020)	p.I59I(1)		breast(6)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						TCAGGAACGTGATCTCCCTGA	0.622																																																	1	Substitution - coding silent(1)	kidney(1)											181.0	189.0	186.0					19																	18901411		2203	4300	6503	SO:0001819	synonymous_variant	1311			L32137	CCDS12385.1	19p13.1	2008-02-05				ENSG00000105664			2227	protein-coding gene	gene with protein product	"""thrombospondin-5"""	600310	"""cartilage oligomeric matrix protein (pseudoachondroplasia, epiphyseal dysplasia 1, multiple)"""	PSACH, EDM1, EPD1		7713493, 8307576	Standard	NM_000095		Approved	MED, THBS5	uc002nke.3	P49747	OTTHUMG00000169318	ENST00000222271.2:c.177C>T	19.37:g.18901411G>A			B4DKJ3|O14592|Q16388|Q16389|Q2NL86|Q8N4T2	Silent	SNP	ENST00000222271.2	37	CCDS12385.1																																																																																				0.622	COMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403457.1		NM_000095	
CTSW	1521	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	65648930	65648930	+	Missense_Mutation	SNP	G	G	T			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr11:65648930G>T	ENST00000307886.3	+	3	271	c.225G>T	c.(223-225)agG>agT	p.R75S	CTSW_ENST00000528419.1_Missense_Mutation_p.R75S	NM_001335.3	NP_001326	P56202	CATW_HUMAN	cathepsin W	75					immune response (GO:0006955)	membrane (GO:0016020)	cysteine-type peptidase activity (GO:0008234)	p.R75S(1)		central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(5)	9				READ - Rectum adenocarcinoma(159;0.168)		AGGCTCAGAGGCTGCAGGAGG	0.582																																																	1	Substitution - Missense(1)	kidney(1)											281.0	264.0	270.0					11																	65648930		2201	4296	6497	SO:0001583	missense	1521			AF055903	CCDS8117.1	11q13.1	2008-02-01	2006-12-05		ENSG00000172543	ENSG00000172543		"""Cathepsins"""	2546	protein-coding gene	gene with protein product		602364	"""cathepsin W (lymphopain)"""			9108299, 9675123	Standard	NM_001335		Approved		uc001ogc.1	P56202	OTTHUMG00000166663	ENST00000307886.3:c.225G>T	11.37:g.65648930G>T	ENSP00000311300:p.Arg75Ser		Q86VT4	Missense_Mutation	SNP	ENST00000307886.3	37	CCDS8117.1	.	.	.	.	.	.	.	.	.	.	G	10.77	1.444789	0.25987	.	.	ENSG00000172543	ENST00000307886;ENST00000528419;ENST00000526034	D;D;D	0.85088	-1.94;-1.94;-1.94	5.85	0.769	0.18492	Proteinase inhibitor I29, cathepsin propeptide (2);	1.058160	0.07368	N	0.885189	T	0.76414	0.3984	L	0.28192	0.835	0.21822	N	0.999526	B;B	0.22146	0.03;0.065	B;B	0.29440	0.102;0.089	T	0.63301	-0.6668	10	0.54805	T	0.06	.	4.9414	0.13967	0.3219:0.1438:0.5343:0.0	.	75;75	P56202;E9PI30	CATW_HUMAN;.	S	75;75;74	ENSP00000311300:R75S;ENSP00000436568:R75S;ENSP00000434267:R74S	ENSP00000311300:R75S	R	+	3	2	CTSW	65405506	0.907000	0.30839	0.061000	0.19648	0.402000	0.30811	1.292000	0.33342	-0.092000	0.12417	-0.136000	0.14681	AGG		0.582	CTSW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391042.1		NM_001335	
DENND4B	9909	hgsc.bcm.edu	37	1	153907297	153907297	+	Silent	SNP	C	C	T	rs557071025|rs544489048	byFrequency	TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr1:153907297C>T	ENST00000361217.4	-	18	3130	c.2712G>A	c.(2710-2712)caG>caA	p.Q904Q	DENND4B_ENST00000474386.1_5'Flank	NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	904	Gln-rich.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			gctgctgctgctgctgctgtt	0.632													c|||	1	0.000199681	0.0	0.0	5008	,	,		16455	0.0		0.0	False		,,,				2504	0.001																0													28.0	36.0	33.0					1																	153907297		2179	4277	6456	SO:0001819	synonymous_variant	9909			AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.2712G>A	1.37:g.153907297C>T			Q5T4K0	Silent	SNP	ENST00000361217.4	37	CCDS44228.1																																																																																				0.632	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090278.2		XM_375806	
DIP2B	57609	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	51092926	51092926	+	Missense_Mutation	SNP	T	T	G			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr12:51092926T>G	ENST00000301180.5	+	19	2300	c.2266T>G	c.(2266-2268)Tcc>Gcc	p.S756A		NM_173602.2	NP_775873.2	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B (Drosophila)	756						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.S756A(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(15)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	60						CTGTGTTAGCTCCAGAACTGG	0.413																																																	1	Substitution - Missense(1)	kidney(1)											163.0	140.0	148.0					12																	51092926		2203	4300	6503	SO:0001583	missense	57609			AB040896	CCDS31799.1	12q13.12	2012-10-02	2006-01-13		ENSG00000066084	ENSG00000066084			29284	protein-coding gene	gene with protein product		611379					Standard	XM_005269044		Approved	KIAA1463, FLJ34278	uc001rwv.3	Q9P265	OTTHUMG00000169475	ENST00000301180.5:c.2266T>G	12.37:g.51092926T>G	ENSP00000301180:p.Ser756Ala		Q6B011|Q8N1L5|Q8NB38	Missense_Mutation	SNP	ENST00000301180.5	37	CCDS31799.1	.	.	.	.	.	.	.	.	.	.	T	13.96	2.394195	0.42410	.	.	ENSG00000066084	ENST00000301180	T	0.42513	0.97	4.85	4.85	0.62838	AMP-dependent synthetase/ligase (1);	0.053759	0.85682	D	0.000000	T	0.26774	0.0655	N	0.12182	0.205	0.54753	D	0.999982	B	0.06786	0.001	B	0.15052	0.012	T	0.05566	-1.0877	10	0.27785	T	0.31	-13.2006	14.9182	0.70815	0.0:0.0:0.0:1.0	.	756	Q9P265	DIP2B_HUMAN	A	756	ENSP00000301180:S756A	ENSP00000301180:S756A	S	+	1	0	DIP2B	49379193	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.000000	0.63940	2.169000	0.68431	0.533000	0.62120	TCC		0.413	DIP2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404243.1		NM_173602	
DNAH3	55567	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	21098199	21098199	+	Missense_Mutation	SNP	G	G	C			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr16:21098199G>C	ENST00000261383.3	-	19	2847	c.2848C>G	c.(2848-2850)Cca>Gca	p.P950A	DNAH3_ENST00000415178.1_Missense_Mutation_p.P950A	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	950	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.P950A(2)		NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		TTCATTCCTGGGTTGCAGGAA	0.542																																																	2	Substitution - Missense(2)	kidney(2)											222.0	206.0	211.0					16																	21098199		2201	4300	6501	SO:0001583	missense	55567			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.2848C>G	16.37:g.21098199G>C	ENSP00000261383:p.Pro950Ala		O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.140083	0.77775	.	.	ENSG00000158486	ENST00000261383;ENST00000415178	T;T	0.62105	0.05;0.05	5.58	4.57	0.56435	Dynein heavy chain, domain-2 (1);	0.851521	0.10248	N	0.697554	D	0.82268	0.5000	M	0.92459	3.31	0.41617	D	0.988945	D	0.58620	0.983	P	0.57679	0.825	D	0.83931	0.0306	10	0.62326	D	0.03	.	16.4153	0.83731	0.0:0.0:0.8418:0.1582	.	950	Q8TD57	DYH3_HUMAN	A	950	ENSP00000261383:P950A;ENSP00000394245:P950A	ENSP00000261383:P950A	P	-	1	0	DNAH3	21005700	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.062000	0.71155	2.631000	0.89168	0.655000	0.94253	CCA		0.542	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1		NM_017539	
DNER	92737	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	230411681	230411681	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr2:230411681G>T	ENST00000341772.4	-	5	1109	c.975C>A	c.(973-975)tgC>tgA	p.C325*		NM_139072.3	NP_620711.3	Q8NFT8	DNER_HUMAN	delta/notch-like EGF repeat containing	325	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				central nervous system development (GO:0007417)|endocytosis (GO:0006897)|glial cell differentiation (GO:0010001)|neuron migration (GO:0001764)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|skeletal muscle fiber development (GO:0048741)|synapse assembly (GO:0007416)	dendrite (GO:0030425)|early endosome (GO:0005769)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|clathrin binding (GO:0030276)|transmembrane signaling receptor activity (GO:0004888)	p.C325*(1)		NS(2)|breast(1)|endometrium(7)|kidney(1)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	63		all_lung(227;0.00413)|Renal(207;0.0113)|Lung NSC(271;0.0211)|all_hematologic(139;0.105)|Acute lymphoblastic leukemia(138;0.175)		Epithelial(121;1.4e-11)|all cancers(144;7.7e-09)|LUSC - Lung squamous cell carcinoma(224;0.034)|Lung(119;0.0375)		GCTTCGTGGTGCATTTTCCTT	0.448																																																	1	Substitution - Nonsense(1)	kidney(1)											216.0	174.0	188.0					2																	230411681		2203	4300	6503	SO:0001587	stop_gained	92737			AY358891	CCDS33390.1	2q36.3	2006-10-26			ENSG00000187957	ENSG00000187957			24456	protein-coding gene	gene with protein product		607299				11950833, 11997712	Standard	NM_139072		Approved	UNQ26, bet	uc002vpv.3	Q8NFT8	OTTHUMG00000153637	ENST00000341772.4:c.975C>A	2.37:g.230411681G>T	ENSP00000345229:p.Cys325*		A6NP39|Q53R88|Q53TP7|Q53TQ5|Q8IYT0|Q8TB42|Q9NTF1|Q9UDM2	Nonsense_Mutation	SNP	ENST00000341772.4	37	CCDS33390.1	.	.	.	.	.	.	.	.	.	.	G	38	7.004769	0.97994	.	.	ENSG00000187957	ENST00000341772;ENST00000543700	.	.	.	5.8	0.0557	0.14316	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.0883	0.48099	0.5479:0.0:0.4521:0.0	.	.	.	.	X	325;53	.	ENSP00000345229:C325X	C	-	3	2	DNER	230119925	0.985000	0.35326	0.968000	0.41197	0.989000	0.77384	0.085000	0.14912	0.066000	0.16515	0.650000	0.86243	TGC		0.448	DNER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331902.1		NM_139072	
FBXO27	126433	hgsc.bcm.edu;ucsc.edu	37	19	39521925	39521925	+	Missense_Mutation	SNP	C	C	T			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr19:39521925C>T	ENST00000292853.4	-	3	519	c.400G>A	c.(400-402)Gac>Aac	p.D134N	FBXO27_ENST00000509137.2_Missense_Mutation_p.D134N|CTB-189B5.3_ENST00000597303.1_RNA|FBXO27_ENST00000600828.1_Missense_Mutation_p.D133N	NM_178820.3	NP_849142.1	Q8NI29	FBX27_HUMAN	F-box protein 27	134	FBA. {ECO:0000255|PROSITE- ProRule:PRU00482}.					SCF ubiquitin ligase complex (GO:0019005)	glycoprotein binding (GO:0001948)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(5)|ovary(1)|urinary_tract(2)	17	all_cancers(60;3.79e-07)|all_lung(34;1.26e-07)|Lung NSC(34;1.46e-07)|all_epithelial(25;4.69e-07)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			ACCCAGCCGTCCCCACCGTGT	0.567																																																	0													88.0	83.0	85.0					19																	39521925		2203	4300	6503	SO:0001583	missense	126433			AF436061	CCDS12527.1	19q13.2	2008-02-05	2004-06-15			ENSG00000161243		"""F-boxes /  ""other"""""	18753	protein-coding gene	gene with protein product		609099	"""F-box only protein 27"""			126433	Standard	NM_178820		Approved	Fbg5, Fbx27	uc002okh.3	Q8NI29		ENST00000292853.4:c.400G>A	19.37:g.39521925C>T	ENSP00000292853:p.Asp134Asn		Q96C87	Missense_Mutation	SNP	ENST00000292853.4	37	CCDS12527.1	.	.	.	.	.	.	.	.	.	.	C	16.62	3.174628	0.57692	.	.	ENSG00000161243	ENST00000292853;ENST00000509137	T;T	0.42513	0.97;0.97	3.66	-2.68	0.06041	Galactose-binding domain-like (1);F-box associated (FBA) domain (2);	1.007380	0.07998	N	0.988231	T	0.37489	0.1005	N	0.20445	0.575	0.09310	N	1	D	0.59767	0.986	P	0.61328	0.887	T	0.31336	-0.9947	10	0.27785	T	0.31	-5.9169	4.8575	0.13566	0.0:0.468:0.1503:0.3818	.	134	Q8NI29	FBX27_HUMAN	N	134	ENSP00000292853:D134N;ENSP00000437662:D134N	ENSP00000292853:D134N	D	-	1	0	FBXO27	44213765	0.000000	0.05858	0.000000	0.03702	0.549000	0.35272	-0.279000	0.08479	-0.516000	0.06470	-0.359000	0.07587	GAC		0.567	FBXO27-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463281.1			
GABRG2	2566	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	161580106	161580106	+	Missense_Mutation	SNP	C	C	T			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr5:161580106C>T	ENST00000361925.4	+	9	1356	c.1136C>T	c.(1135-1137)aCc>aTc	p.T379I	GABRG2_ENST00000393933.4_Missense_Mutation_p.T284I|GABRG2_ENST00000414552.2_Missense_Mutation_p.T427I|GABRG2_ENST00000356592.3_Missense_Mutation_p.T387I			P18507	GBRG2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 2	379					adult behavior (GO:0030534)|cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|post-embryonic development (GO:0009791)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|GABA-A receptor complex (GO:1902711)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.T387I(1)		NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(15)|lung(24)|ovary(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	62	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CAGGCCCCTACCATTGATATC	0.473																																																	1	Substitution - Missense(1)	kidney(1)											101.0	93.0	96.0					5																	161580106		2203	4300	6503	SO:0001583	missense	2566				CCDS4358.1, CCDS4359.1, CCDS47333.1	5q34	2012-06-22			ENSG00000113327	ENSG00000113327		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4087	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma 2"""	137164					Standard	NM_198904		Approved		uc010jjc.3	P18507	OTTHUMG00000130350	ENST00000361925.4:c.1136C>T	5.37:g.161580106C>T	ENSP00000354651:p.Thr379Ile		F5HB82|Q6GRL6|Q6PCC3|Q9UDB3|Q9UN15	Missense_Mutation	SNP	ENST00000361925.4	37	CCDS4358.1	.	.	.	.	.	.	.	.	.	.	C	13.01	2.109975	0.37242	.	.	ENSG00000113327	ENST00000356592;ENST00000414552;ENST00000361925;ENST00000393933	D;D;D;D	0.85629	-2.01;-2.01;-1.95;-1.95	5.95	5.95	0.96441	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.168223	0.39615	N	0.001320	T	0.77532	0.4144	N	0.14661	0.345	0.58432	D	0.999999	B;B;B	0.18741	0.03;0.001;0.002	B;B;B	0.15052	0.012;0.008;0.008	T	0.70121	-0.4959	10	0.44086	T	0.13	.	20.3932	0.98965	0.0:1.0:0.0:0.0	.	427;379;387	F5HB82;P18507;P18507-2	.;GBRG2_HUMAN;.	I	387;427;379;284	ENSP00000349000:T387I;ENSP00000410732:T427I;ENSP00000354651:T379I;ENSP00000377510:T284I	ENSP00000349000:T387I	T	+	2	0	GABRG2	161512684	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.003000	0.70701	2.824000	0.97209	0.655000	0.94253	ACC		0.473	GABRG2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252706.1			
GRK6	2870	broad.mit.edu;hgsc.bcm.edu	37	5	176863239	176863239	+	Missense_Mutation	SNP	A	A	C			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr5:176863239A>C	ENST00000355472.5	+	12	1391	c.1223A>C	c.(1222-1224)tAt>tCt	p.Y408S	GRK6_ENST00000528793.1_Missense_Mutation_p.Y408S|PRR7-AS1_ENST00000425316.3_RNA|GRK6_ENST00000355958.5_Missense_Mutation_p.Y408S|GRK6_ENST00000393576.3_Missense_Mutation_p.Y374S|GRK6_ENST00000507633.1_Missense_Mutation_p.Y408S	NM_001004106.2|NM_002082.3	NP_001004106.1|NP_002073.2	P43250	GRK6_HUMAN	G protein-coupled receptor kinase 6	408	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway (GO:0016055)	membrane (GO:0016020)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)	p.Y408S(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(5)|stomach(1)	25	all_cancers(89;1.15e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCCGAGGAGTATTCCGAGCGC	0.622																																																	1	Substitution - Missense(1)	kidney(1)											61.0	71.0	68.0					5																	176863239		2203	4300	6503	SO:0001583	missense	2870				CCDS34303.1, CCDS43406.1, CCDS47348.1	5q35	2011-01-14	2004-02-04	2004-02-06	ENSG00000198055	ENSG00000198055			4545	protein-coding gene	gene with protein product		600869		GPRK6		8415712	Standard	NM_002082		Approved		uc021yiu.1	P43250	OTTHUMG00000163401	ENST00000355472.5:c.1223A>C	5.37:g.176863239A>C	ENSP00000347655:p.Tyr408Ser		O60541|Q13652	Missense_Mutation	SNP	ENST00000355472.5	37	CCDS34303.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.316990	0.81469	.	.	ENSG00000198055	ENST00000355472;ENST00000507633;ENST00000393576;ENST00000355958;ENST00000528793	T;T;T;T;T	0.24723	1.84;1.84;1.84;1.84;1.84	5.76	5.76	0.90799	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.48021	0.1477	L	0.60904	1.88	0.80722	D	1	D;D;D;D	0.71674	0.998;0.973;0.997;0.992	D;P;D;P	0.69824	0.966;0.865;0.943;0.806	T	0.47249	-0.9132	10	0.87932	D	0	-17.8683	16.0816	0.81007	1.0:0.0:0.0:0.0	.	408;378;408;408	P43250;B3KPS5;P43250-2;D6RHX8	GRK6_HUMAN;.;.;.	S	408;408;374;408;408	ENSP00000347655:Y408S;ENSP00000427581:Y408S;ENSP00000377204:Y374S;ENSP00000348230:Y408S;ENSP00000433511:Y408S	ENSP00000347655:Y408S	Y	+	2	0	GRK6	176795845	1.000000	0.71417	0.996000	0.52242	0.759000	0.43091	7.261000	0.78400	2.211000	0.71520	0.454000	0.30748	TAT		0.622	GRK6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000373204.1		NM_002082	
MROH1	727957	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	145275539	145275539	+	Missense_Mutation	SNP	C	C	T			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr8:145275539C>T	ENST00000528919.1	+	12	1299	c.1178C>T	c.(1177-1179)tCt>tTt	p.S393F	MROH1_ENST00000326134.5_Missense_Mutation_p.S393F|MROH1_ENST00000534366.1_Missense_Mutation_p.S393F|MROH1_ENST00000398656.4_Missense_Mutation_p.S393F	NM_032450.2	NP_115826	Q8NDA8	MROH1_HUMAN	maestro heat-like repeat family member 1	393								p.S393F(1)									TTTATCCTGTCTTCCATGAGG	0.547																																																	1	Substitution - Missense(1)	kidney(1)											94.0	101.0	99.0					8																	145275539		2003	4158	6161	SO:0001583	missense	0				CCDS47938.1, CCDS47939.1, CCDS75803.1	8q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000179832	ENSG00000179832		"""maestro heat-like repeat containing"""	26958	protein-coding gene	gene with protein product			"""HEAT repeat containing 7A"""	HEATR7A		11347906	Standard	NM_032450		Approved	KIAA1833	uc003zbk.4	Q8NDA8	OTTHUMG00000165781	ENST00000528919.1:c.1178C>T	8.37:g.145275539C>T	ENSP00000435565:p.Ser393Phe		C9JWM5|D3DWL5|Q0P612|Q569G6|Q6NVW4|Q8N230|Q8NAD1|Q8ND95|Q96JJ4	Missense_Mutation	SNP	ENST00000528919.1	37	CCDS47938.1	.	.	.	.	.	.	.	.	.	.	C	14.52	2.559640	0.45590	.	.	ENSG00000179832	ENST00000398656;ENST00000534366;ENST00000528919;ENST00000326134	T;T;T;T	0.05139	3.49;3.49;3.49;3.49	5.19	5.19	0.71726	Armadillo-like helical (1);Armadillo-type fold (1);	0.090248	0.45126	U	0.000387	T	0.20536	0.0494	M	0.72894	2.215	0.80722	D	1	D;D;D	0.63880	0.993;0.989;0.989	P;P;P	0.61477	0.889;0.768;0.768	T	0.00189	-1.1939	10	0.44086	T	0.13	.	14.2098	0.65756	0.0:1.0:0.0:0.0	.	393;393;393	Q8NDA8-2;E9PHY8;Q8NDA8	.;.;HTR7A_HUMAN	F	393	ENSP00000381649:S393F;ENSP00000436636:S393F;ENSP00000435565:S393F;ENSP00000321737:S393F	ENSP00000321737:S393F	S	+	2	0	HEATR7A	145347527	0.966000	0.33281	0.765000	0.31456	0.209000	0.24338	4.284000	0.58983	2.399000	0.81585	0.561000	0.74099	TCT		0.547	MROH1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386183.1		NM_032450	
HRNR	388697	broad.mit.edu	37	1	152192654	152192654	+	Missense_Mutation	SNP	C	C	A			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr1:152192654C>A	ENST00000368801.2	-	3	1526	c.1451G>T	c.(1450-1452)gGc>gTc	p.G484V	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	484					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.G484V(1)		autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTGACCTGAGCCAGATCCATG	0.537																																																	1	Substitution - Missense(1)	kidney(1)											289.0	272.0	278.0					1																	152192654		2203	4300	6503	SO:0001583	missense	388697			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.1451G>T	1.37:g.152192654C>A	ENSP00000357791:p.Gly484Val		Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	37	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	c	8.879	0.951156	0.18431	.	.	ENSG00000197915	ENST00000368801	T	0.01981	4.52	3.79	3.79	0.43588	.	.	.	.	.	T	0.02156	0.0067	L	0.27053	0.805	0.35959	D	0.83449	D	0.89917	1.0	D	0.77004	0.989	T	0.64529	-0.6386	9	0.15952	T	0.53	.	11.0581	0.47931	0.0:1.0:0.0:0.0	.	484	Q86YZ3	HORN_HUMAN	V	484	ENSP00000357791:G484V	ENSP00000357791:G484V	G	-	2	0	HRNR	150459278	0.000000	0.05858	0.192000	0.23308	0.006000	0.05464	-0.202000	0.09451	1.957000	0.56846	0.499000	0.49734	GGC		0.537	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1		XM_373868	
HSPA4L	22824	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	128725181	128725181	+	Silent	SNP	A	A	G			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr4:128725181A>G	ENST00000296464.4	+	8	1335	c.924A>G	c.(922-924)caA>caG	p.Q308Q	HSPA4L_ENST00000439123.2_Silent_p.Q339Q|HSPA4L_ENST00000508776.1_Silent_p.Q308Q|HSPA4L_ENST00000505726.1_Silent_p.Q282Q	NM_014278.2	NP_055093.2	O95757	HS74L_HUMAN	heat shock 70kDa protein 4-like	308					protein folding (GO:0006457)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)	p.Q308Q(1)		central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	31						AATTTGAACAACTGTGTGCTT	0.363																																																	1	Substitution - coding silent(1)	kidney(1)											90.0	88.0	89.0					4																	128725181		2203	4300	6503	SO:0001819	synonymous_variant	22824			AB023421	CCDS3734.1	4q28	2011-09-07			ENSG00000164070	ENSG00000164070		"""Heat shock proteins / HSP70"""	17041	protein-coding gene	gene with protein product						10524232	Standard	NM_014278		Approved	APG-1, Osp94, HSPH3	uc003ifm.3	O95757	OTTHUMG00000133302	ENST00000296464.4:c.924A>G	4.37:g.128725181A>G			A2ICT2|Q4W5M5|Q8IWA2	Silent	SNP	ENST00000296464.4	37	CCDS3734.1																																																																																				0.363	HSPA4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257096.3		NM_014278	
IFT80	57560	broad.mit.edu;ucsc.edu	37	3	160025463	160025463	+	Missense_Mutation	SNP	C	C	A			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr3:160025463C>A	ENST00000326448.7	-	10	1496	c.1064G>T	c.(1063-1065)tGt>tTt	p.C355F	IFT80_ENST00000483465.1_Missense_Mutation_p.C218F|IFT80_ENST00000496589.1_Missense_Mutation_p.C218F|RP11-432B6.3_ENST00000483754.1_Missense_Mutation_p.C526F	NM_020800.2	NP_065851.1	Q9P2H3	IFT80_HUMAN	intraflagellar transport 80	355					bone morphogenesis (GO:0060349)|chondrocyte differentiation (GO:0002062)|cilium assembly (GO:0042384)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of non-canonical Wnt signaling pathway (GO:2000051)|osteoblast differentiation (GO:0001649)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)		p.C355F(1)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(12)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	36			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			GAACACGTAACATTGAAGAGA	0.368																																																	1	Substitution - Missense(1)	kidney(1)											120.0	111.0	114.0					3																	160025463		2203	4300	6503	SO:0001583	missense	57560			AB037795	CCDS3188.1, CCDS54668.1	3q25.33	2014-07-03	2014-07-03	2005-11-02	ENSG00000068885	ENSG00000068885		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29262	protein-coding gene	gene with protein product		611177	"""WD repeat domain 56"", ""intraflagellar transport 80 homolog (Chlamydomonas)"""	WDR56		10718198	Standard	NM_020800		Approved	KIAA1374	uc021xgq.1	Q9P2H3	OTTHUMG00000158953	ENST00000326448.7:c.1064G>T	3.37:g.160025463C>A	ENSP00000312778:p.Cys355Phe		B4E0K1|C9J8I0|Q3MJC4|Q86YF4|Q9UIX1	Missense_Mutation	SNP	ENST00000326448.7	37	CCDS3188.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.102694	0.76983	.	.	ENSG00000068885	ENST00000326448;ENST00000483465;ENST00000496589;ENST00000483325	T;T;T	0.80304	2.33;-1.36;-1.36	5.21	5.21	0.72293	WD40 repeat-like-containing domain (1);	0.000000	0.64402	U	0.000003	D	0.91492	0.7314	M	0.88906	2.99	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.92483	0.5994	10	0.56958	D	0.05	.	18.7743	0.91904	0.0:1.0:0.0:0.0	.	355	Q9P2H3	IFT80_HUMAN	F	355;218;218;36	ENSP00000312778:C355F;ENSP00000418196:C218F;ENSP00000420646:C218F	ENSP00000312778:C355F	C	-	2	0	IFT80	161508157	1.000000	0.71417	0.994000	0.49952	0.798000	0.45092	7.021000	0.76425	2.439000	0.82584	0.650000	0.86243	TGT		0.368	IFT80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352651.2		NM_020800	
KCNB2	9312	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	73480273	73480273	+	Missense_Mutation	SNP	T	T	A			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr8:73480273T>A	ENST00000523207.1	+	2	892	c.304T>A	c.(304-306)Ttc>Atc	p.F102I		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	102					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.F102I(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	CATTTTAAATTTCTACCGGAC	0.458																																																	1	Substitution - Missense(1)	kidney(1)											77.0	80.0	79.0					8																	73480273		2203	4300	6503	SO:0001583	missense	9312			U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.304T>A	8.37:g.73480273T>A	ENSP00000430846:p.Phe102Ile		Q7Z7D0|Q9BXD3	Missense_Mutation	SNP	ENST00000523207.1	37	CCDS6209.1	.	.	.	.	.	.	.	.	.	.	T	32	5.161254	0.94727	.	.	ENSG00000182674	ENST00000523207	D	0.82081	-1.57	5.93	5.93	0.95920	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.35436	U	0.003202	D	0.92818	0.7716	M	0.93016	3.37	0.58432	D	0.999999	D	0.56746	0.977	D	0.65573	0.936	D	0.94313	0.7547	10	0.87932	D	0	.	16.0678	0.80897	0.0:0.0:0.0:1.0	.	102	Q92953	KCNB2_HUMAN	I	102	ENSP00000430846:F102I	ENSP00000430846:F102I	F	+	1	0	KCNB2	73642827	1.000000	0.71417	0.993000	0.49108	0.945000	0.59286	8.040000	0.89188	2.281000	0.76405	0.533000	0.62120	TTC		0.458	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1		NM_004770	
C2CD5	9847	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	22676365	22676365	+	Missense_Mutation	SNP	C	C	T	rs547569146	byFrequency	TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr12:22676365C>T	ENST00000333957.4	-	7	1050	c.795G>A	c.(793-795)atG>atA	p.M265I	C2CD5_ENST00000536386.1_Missense_Mutation_p.M265I|C2CD5_ENST00000446597.1_Missense_Mutation_p.M265I|C2CD5_ENST00000542676.1_Missense_Mutation_p.M265I|C2CD5_ENST00000540703.1_5'UTR|C2CD5_ENST00000544930.1_Missense_Mutation_p.M67I|C2CD5_ENST00000396028.2_Missense_Mutation_p.M265I|C2CD5_ENST00000545552.1_Missense_Mutation_p.M265I	NM_014802.1	NP_055617.1	Q86YS7	C2CD5_HUMAN	C2 calcium-dependent domain containing 5	265					cellular response to insulin stimulus (GO:0032869)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|intracellular protein transmembrane transport (GO:0065002)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)	p.M265I(1)|p.M67I(1)									CTTACTCCTTCATTTCTTTGG	0.373													C|||	3	0.000599042	0.0	0.0	5008	,	,		14370	0.0		0.0	False		,,,				2504	0.0031																2	Substitution - Missense(2)	kidney(2)											79.0	73.0	75.0					12																	22676365		2203	4300	6503	SO:0001583	missense	0			AB011100	CCDS31758.1, CCDS66337.1, CCDS66338.1, CCDS66339.1, CCDS66340.1	12p12.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000111731	ENSG00000111731			29062	protein-coding gene	gene with protein product	"""138 kDa C2 domain-containing phosphoprotein"""		"""KIAA0528"""	KIAA0528		21907143	Standard	XM_005253538		Approved	CDP138	uc001rfq.3	Q86YS7	OTTHUMG00000169100	ENST00000333957.4:c.795G>A	12.37:g.22676365C>T	ENSP00000334229:p.Met265Ile		B4DJ03|B4DRN7|B7ZLL0|F5H2A1|F5H5R1|O60280|Q17RY7|Q7Z619|Q86SU3	Missense_Mutation	SNP	ENST00000333957.4	37	CCDS31758.1	.	.	.	.	.	.	.	.	.	.	C	9.702	1.154790	0.21371	.	.	ENSG00000111731	ENST00000333957;ENST00000446597;ENST00000536386;ENST00000396028;ENST00000542676;ENST00000545552;ENST00000544930;ENST00000544281	T;T;T;T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97;0.97;0.97;0.97	5.24	2.22	0.28083	.	0.267304	0.43919	N	0.000512	T	0.16041	0.0386	N	0.04508	-0.205	0.29125	N	0.88003	B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.09377	0.001;0.0;0.004;0.001;0.001;0.0	T	0.19192	-1.0313	10	0.12766	T	0.61	-7.9647	5.8909	0.18913	0.0:0.6365:0.1383:0.2252	.	265;265;67;265;265;265	F5H2A1;B4DRN7;F5H3N1;B7ZLL0;Q86YS7-2;Q86YS7	.;.;.;.;.;K0528_HUMAN	I	265;265;265;265;265;265;67;64	ENSP00000334229:M265I;ENSP00000388756:M265I;ENSP00000439392:M265I;ENSP00000379345:M265I;ENSP00000441951:M265I;ENSP00000443204:M265I;ENSP00000445288:M67I;ENSP00000443479:M64I	ENSP00000334229:M265I	M	-	3	0	KIAA0528	22567632	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.139000	0.31504	0.579000	0.29504	0.591000	0.81541	ATG		0.373	C2CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402257.1		NM_014802	
LMTK3	114783	broad.mit.edu	37	19	49001136	49001136	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr19:49001136delA	ENST00000600059.1	-	11	3417	c.3190delT	c.(3190-3192)tccfs	p.S1064fs	LMTK3_ENST00000270238.3_Frame_Shift_Del_p.S1093fs			Q96Q04	LMTK3_HUMAN	lemur tyrosine kinase 3	1064	Pro-rich.				negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(9)|prostate(1)	16		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000114)|all cancers(93;0.000141)|Epithelial(262;0.00854)|GBM - Glioblastoma multiforme(486;0.0231)		CCGTTCCGGGAGGAGACCACT	0.716																																																	0													4.0	5.0	5.0					19																	49001136		1724	3932	5656	SO:0001589	frameshift_variant	114783			AB067470	CCDS46136.1	19q13.33	2014-06-12				ENSG00000142235			19295	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 101"""						Standard	NM_001080434		Approved	KIAA1883, LMR3, TYKLM3, PPP1R101	uc002pjk.3	Q96Q04		ENST00000600059.1:c.3190delT	19.37:g.49001136delA	ENSP00000472020:p.Ser1064fs		Q4G0U1	Frame_Shift_Del	DEL	ENST00000600059.1	37																																																																																					0.716	LMTK3-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000466137.1		NM_052895	
BMS1P20	96610	broad.mit.edu	37	22	22661517	22661517	+	RNA	SNP	G	G	A	rs574597848	byFrequency	TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr22:22661517G>A	ENST00000426066.1	+	0	407					NR_027293.1				BMS1 pseudogene 20																		CTCAAGTCCCGAGATCCAATC	0.463													.|||	3	0.000599042	0.0	0.0	5008	,	,		21550	0.003		0.0	False		,,,				2504	0.0																0																																												96610					22q11.22	2013-09-20			ENSG00000236850	ENSG00000236850			49153	pseudogene	pseudogene							Standard	XR_430414		Approved				OTTHUMG00000151046		22.37:g.22661517G>A				RNA	SNP	ENST00000426066.1	37																																																																																					0.463	BMS1P20-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript	OTTHUMT00000473090.1			
MCM10	55388	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	13213138	13213138	+	Missense_Mutation	SNP	C	C	T			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr10:13213138C>T	ENST00000484800.2	+	3	327	c.224C>T	c.(223-225)gCc>gTc	p.A75V	MCM10_ENST00000378694.1_Missense_Mutation_p.A75V|MCM10_ENST00000378714.3_Missense_Mutation_p.A75V			Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10	75	N-terminal domain. {ECO:0000250}.				cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)	p.A75V(1)		central_nervous_system(1)|large_intestine(4)|ovary(2)|skin(1)|stomach(1)	9						GAAAATCTGGCCACTCTCTTT	0.488																																																	1	Substitution - Missense(1)	kidney(1)											101.0	100.0	100.0					10																	13213138		2203	4300	6503	SO:0001583	missense	55388			AB042719	CCDS7095.1, CCDS7096.1	10p13	2008-08-01	2007-04-04		ENSG00000065328	ENSG00000065328			18043	protein-coding gene	gene with protein product		609357	"""MCM10 minichromosome maintenance deficient 10 (S. cerevisiae)"""			11095689, 17699597	Standard	NM_018518		Approved	PRO2249, CNA43, DNA43	uc001ima.3	Q7L590	OTTHUMG00000017694	ENST00000484800.2:c.224C>T	10.37:g.13213138C>T	ENSP00000418268:p.Ala75Val		A8K9I6|B7ZKZ8|Q3MIR3|Q7LD55|Q96GX4|Q96NB6|Q9H0D7|Q9H3P9|Q9P177	Missense_Mutation	SNP	ENST00000484800.2	37	CCDS7096.1	.	.	.	.	.	.	.	.	.	.	C	16.52	3.146650	0.57151	.	.	ENSG00000065328	ENST00000378714;ENST00000361282;ENST00000484800;ENST00000378694	T;T;T	0.15834	2.4;2.4;2.39	5.91	4.03	0.46877	.	0.281705	0.40640	N	0.001051	T	0.24736	0.0600	M	0.62723	1.935	0.35079	D	0.763253	P;P;P	0.49185	0.92;0.908;0.851	B;P;B	0.45753	0.441;0.492;0.297	T	0.40232	-0.9574	10	0.62326	D	0.03	-13.593	14.249	0.66007	0.4112:0.5888:0.0:0.0	.	75;75;75	Q5T670;Q7L590-2;Q7L590	.;.;MCM10_HUMAN	V	75	ENSP00000367986:A75V;ENSP00000418268:A75V;ENSP00000367966:A75V	ENSP00000354945:A75V	A	+	2	0	MCM10	13253144	0.934000	0.31675	0.620000	0.29132	0.688000	0.40055	1.885000	0.39678	0.802000	0.34089	0.655000	0.94253	GCC		0.488	MCM10-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356853.1		NM_182751	
MED12L	116931	broad.mit.edu;ucsc.edu	37	3	151134124	151134124	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr3:151134124delC	ENST00000474524.1	+	41	6255	c.6217delC	c.(6217-6219)cccfs	p.P2073fs	MED12L_ENST00000273432.4_Intron	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	2073	Gln-rich.					mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			gcagccccagccccagcagcc	0.542																																																	0													24.0	28.0	27.0					3																	151134124		2203	4299	6502	SO:0001589	frameshift_variant	116931			AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.6217delC	3.37:g.151134124delC	ENSP00000417235:p.Pro2073fs		Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Frame_Shift_Del	DEL	ENST00000474524.1	37	CCDS33876.1																																																																																				0.542	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357707.2		NM_053002	
DFNB59	494513	hgsc.bcm.edu	37	2	179321446	179321446	+	Intron	SNP	A	A	G			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr2:179321446A>G	ENST00000409117.3	+	4	905				DFNB59_ENST00000605419.1_Intron|DFNB59_ENST00000375129.4_Intron	NM_001042702.3	NP_001036167.1	Q0ZLH3	PJVK_HUMAN	deafness, autosomal recessive 59						sensory perception of sound (GO:0007605)	neuronal cell body (GO:0043025)				breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.0159)|all cancers(119;0.0564)			gtgagccgagattgtgccatt	0.473																																																	0													26.0	22.0	24.0					2																	179321446		692	1591	2283	SO:0001627	intron_variant	100302152			BC020859, BQ887979	CCDS42787.1	2q31.2	2011-07-01			ENSG00000204311	ENSG00000204311			29502	protein-coding gene	gene with protein product		610219				16804542	Standard	NM_001042702		Approved	pejvakin	uc002umi.4	Q0ZLH3	OTTHUMG00000154425	ENST00000409117.3:c.549+568A>G	2.37:g.179321446A>G			A0PK14|B9EJE2	RNA	SNP	ENST00000409117.3	37	CCDS42787.1																																																																																				0.473	DFNB59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335160.1			
MYL2	4633	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	111351119	111351119	+	Missense_Mutation	SNP	G	G	T			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr12:111351119G>T	ENST00000228841.8	-	5	331	c.284C>A	c.(283-285)cCt>cAt	p.P95H	MYL2_ENST00000548438.1_Missense_Mutation_p.P81H	NM_000432.3	NP_000423.2	P10916	MLRV_HUMAN	myosin, light chain 2, regulatory, cardiac, slow	95	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.		P -> A (in CMH10; with mid-left ventricular chamber thickening). {ECO:0000269|PubMed:8673105}.		cardiac muscle contraction (GO:0060048)|cardiac myofibril assembly (GO:0055003)|heart contraction (GO:0060047)|muscle cell fate specification (GO:0042694)|muscle fiber development (GO:0048747)|muscle filament sliding (GO:0030049)|negative regulation of cell growth (GO:0030308)|post-embryonic development (GO:0009791)|regulation of striated muscle contraction (GO:0006942)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|myofibril (GO:0030016)|myosin complex (GO:0016459)|sarcomere (GO:0030017)	actin monomer binding (GO:0003785)|calcium ion binding (GO:0005509)|myosin heavy chain binding (GO:0032036)|structural constituent of muscle (GO:0008307)	p.P95H(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)	12						GGTTTCCTCAGGGTCCGCTCC	0.577																																					GBM(14;268 426 18829 21617 25540)												1	Substitution - Missense(1)	kidney(1)											113.0	96.0	102.0					12																	111351119		2203	4300	6503	SO:0001583	missense	4633				CCDS31901.1	12q24.11	2014-09-17	2006-09-29		ENSG00000111245	ENSG00000111245		"""Myosins / Light chain"", ""EF-hand domain containing"""	7583	protein-coding gene	gene with protein product	"""cardiac ventricular myosin light chain 2"""	160781	"""myosin, light polypeptide 2, regulatory, cardiac, slow"""			1386340	Standard	NM_000432		Approved	CMH10	uc001try.4	P10916	OTTHUMG00000169535	ENST00000228841.8:c.284C>A	12.37:g.111351119G>T	ENSP00000228841:p.Pro95His		Q16123	Missense_Mutation	SNP	ENST00000228841.8	37	CCDS31901.1	.	.	.	.	.	.	.	.	.	.	G	16.79	3.221139	0.58560	.	.	ENSG00000111245	ENST00000228841;ENST00000548438;ENST00000550439	T;T	0.79141	-1.24;-1.24	5.07	5.07	0.68467	EF-hand-like domain (1);	0.101095	0.64402	D	0.000002	D	0.90147	0.6921	M	0.93375	3.41	0.80722	D	1	D	0.71674	0.998	P	0.61328	0.887	D	0.92913	0.6349	10	0.87932	D	0	.	17.2184	0.86950	0.0:0.0:1.0:0.0	.	95	P10916	MLRV_HUMAN	H	95;81;76	ENSP00000228841:P95H;ENSP00000447154:P81H	ENSP00000228841:P95H	P	-	2	0	MYL2	109835502	1.000000	0.71417	0.494000	0.27515	0.196000	0.23810	9.025000	0.93694	2.356000	0.79943	0.561000	0.74099	CCT		0.577	MYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404677.2		NM_000432	
NBPF12	149013	broad.mit.edu	37	1	146398422	146398422	+	Silent	SNP	G	G	A	rs371127857	byFrequency	TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr1:146398422G>A	ENST00000442909.2	+	7	1244	c.408G>A	c.(406-408)ccG>ccA	p.P136P	NBPF12_ENST00000446760.2_Silent_p.P136P|NBPF12_ENST00000309471.8_Silent_p.P61P			Q5TAG4	NBPFC_HUMAN	neuroblastoma breakpoint family, member 12	0	NBPF 2. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)		p.P136P(2)		ovary(2)	2						CGGATGAGCCGGACAAGTCCC	0.577													.|||	19	0.00379393	0.0053	0.0014	5008	,	,		20476	0.0		0.0	False		,,,				2504	0.0112																2	Substitution - coding silent(2)	kidney(2)																																								SO:0001819	synonymous_variant	100132406			BG154169	CCDS72881.1	1q21.1	2013-01-17	2011-06-28	2011-06-28	ENSG00000186275	ENSG00000268043		"""neuroblastoma breakpoint family"""	24297	protein-coding gene	gene with protein product		608607	"""KIAA1245"""	KIAA1245		11948409	Standard	NM_001278141		Approved	COAS1		Q5TAG4	OTTHUMG00000043708	ENST00000442909.2:c.408G>A	1.37:g.146398422G>A			O95877	Silent	SNP	ENST00000442909.2	37																																																																																					0.577	NBPF12-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000102086.3		XM_003119146	
NBPF12	149013	broad.mit.edu	37	1	146398425	146398425	+	Missense_Mutation	SNP	C	C	A	rs587641665	byFrequency	TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr1:146398425C>A	ENST00000442909.2	+	7	1247	c.411C>A	c.(409-411)gaC>gaA	p.D137E	NBPF12_ENST00000446760.2_Missense_Mutation_p.D137E|NBPF12_ENST00000309471.8_Missense_Mutation_p.D62E			Q5TAG4	NBPFC_HUMAN	neuroblastoma breakpoint family, member 12	0	NBPF 2. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)		p.D137E(6)		ovary(2)	2						ATGAGCCGGACAAGTCCCAGG	0.587													.|||	15	0.00299521	0.0045	0.0014	5008	,	,		19569	0.0		0.0	False		,,,				2504	0.0082																6	Substitution - Missense(6)	kidney(6)																																								SO:0001583	missense	100132406			BG154169	CCDS72881.1	1q21.1	2013-01-17	2011-06-28	2011-06-28	ENSG00000186275	ENSG00000268043		"""neuroblastoma breakpoint family"""	24297	protein-coding gene	gene with protein product		608607	"""KIAA1245"""	KIAA1245		11948409	Standard	NM_001278141		Approved	COAS1		Q5TAG4	OTTHUMG00000043708	ENST00000442909.2:c.411C>A	1.37:g.146398425C>A	ENSP00000391116:p.Asp137Glu		O95877	Missense_Mutation	SNP	ENST00000442909.2	37		.	.	.	.	.	.	.	.	.	.	N	10.15	1.271473	0.23221	.	.	ENSG00000186275	ENST00000446760;ENST00000442909;ENST00000309471	T;T;T	0.38722	2.65;3.4;1.12	1.12	1.12	0.20585	.	.	.	.	.	T	0.21145	0.0509	M	0.73598	2.24	0.09310	N	1	B	0.26845	0.161	B	0.18263	0.021	T	0.30031	-0.9992	9	0.72032	D	0.01	.	5.9887	0.19448	0.0:1.0:0.0:0.0	.	137	Q86T75-2	.	E	137;137;62	ENSP00000396525:D137E;ENSP00000391116:D137E;ENSP00000311131:D62E	ENSP00000311131:D62E	D	+	3	2	NBPF12	144765738	0.000000	0.05858	0.004000	0.12327	0.015000	0.08874	0.437000	0.21543	1.012000	0.39366	0.361000	0.22055	GAC		0.587	NBPF12-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000102086.3		XM_003119146	
PARP4	143	broad.mit.edu;ucsc.edu	37	13	25075850	25075850	+	Silent	SNP	T	T	C			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr13:25075850T>C	ENST00000381989.3	-	3	360	c.255A>G	c.(253-255)agA>agG	p.R85R		NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	85	BRCT. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.R85R(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		CATCCAAGAGTCTCTTTTCCC	0.408																																																	1	Substitution - coding silent(1)	kidney(1)											135.0	140.0	138.0					13																	25075850		2203	4300	6503	SO:0001819	synonymous_variant	143			AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.255A>G	13.37:g.25075850T>C			O75903|Q14682|Q5QNZ9|Q9H1M6	Silent	SNP	ENST00000381989.3	37	CCDS9307.1																																																																																				0.408	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044189.1		NM_006437	
PBRM1	55193	broad.mit.edu;hgsc.bcm.edu	37	3	52692333	52692333	+	Splice_Site	SNP	T	T	A			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr3:52692333T>A	ENST00000296302.7	-	5	530		c.e5-2		PBRM1_ENST00000394830.3_Splice_Site|PBRM1_ENST00000409114.3_Splice_Site|PBRM1_ENST00000409767.1_Splice_Site|PBRM1_ENST00000409057.1_Splice_Site|PBRM1_ENST00000356770.4_Splice_Site|PBRM1_ENST00000337303.4_Splice_Site|PBRM1_ENST00000410007.1_Splice_Site			Q86U86	PB1_HUMAN	polybromo 1						chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.?(6)		breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TGGAGAAGACTGGTAATGTGG	0.358			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	6	Unknown(6)	kidney(6)											58.0	54.0	55.0					3																	52692333		2203	4300	6503	SO:0001630	splice_region_variant	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.529-2A>T	3.37:g.52692333T>A			A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Splice_Site	SNP	ENST00000296302.7	37		.	.	.	.	.	.	.	.	.	.	T	12.70	2.017545	0.35606	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103;ENST00000431678	.	.	.	5.11	5.11	0.69529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5401	0.61668	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	PBRM1	52667373	1.000000	0.71417	0.903000	0.35520	0.156000	0.22039	5.704000	0.68347	1.943000	0.56356	0.524000	0.50904	.		0.358	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	Intron
PCM1	5108	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	17814231	17814232	+	Missense_Mutation	DNP	GA	GA	TT			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr8:17814231_17814232GA>TT	ENST00000519253.1	+	11	1842_1843	c.1591_1592GA>TT	c.(1591-1593)GAa>TTa	p.E531L	PCM1_ENST00000325083.8_Missense_Mutation_p.E531L|PCM1_ENST00000524226.1_Missense_Mutation_p.E531L			Q15154	PCM1_HUMAN	pericentriolar material 1	531					centrosome organization (GO:0051297)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|interkinetic nuclear migration (GO:0022027)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|microtubule anchoring (GO:0034453)|microtubule anchoring at centrosome (GO:0034454)|mitotic cell cycle (GO:0000278)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|positive regulation of intracellular protein transport (GO:0090316)|protein localization to centrosome (GO:0071539)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|pericentriolar material (GO:0000242)|protein complex (GO:0043234)	identical protein binding (GO:0042802)	p.E531V(1)|p.E531*(1)	PCM1/JAK2(30)	breast(4)|endometrium(8)|kidney(5)|large_intestine(16)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	48				Colorectal(111;0.0789)		TGAAGAAACTGAAGAGTCAGAA	0.356			T	"""RET, JAK2"""	"""papillary thyroid, CML, MPD"""																																			Dom	yes		8	8p22-p21.3	5108	pericentriolar material 1  (PTC4)		"""E, L"""	2	Substitution - Nonsense(1)|Substitution - Missense(1)	kidney(2)																																								SO:0001583	missense	5108				CCDS47812.1	8p22-p21.3	2008-08-08			ENSG00000078674	ENSG00000078674			8727	protein-coding gene	gene with protein product		600299				8120099, 15659651	Standard	NM_006197		Approved	PTC4	uc003wyi.4	Q15154	OTTHUMG00000163699	Exception_encountered	8.37:g.17814231_17814232delinsTT	ENSP00000431099:p.Glu531Leu		Q58F13|Q6P1K7|Q8NB85|Q9BWC1|Q9H4A2	Nonsense_Mutation|Missense_Mutation	SNP	ENST00000519253.1	37																																																																																					0.356	PCM1-003	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000374800.1		NM_006197	
PJA2	9867	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	108717359	108717359	+	Missense_Mutation	SNP	C	C	A			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr5:108717359C>A	ENST00000361189.2	-	3	316	c.77G>T	c.(76-78)gGa>gTa	p.G26V	PJA2_ENST00000511624.1_5'UTR|PJA2_ENST00000361557.3_Missense_Mutation_p.G26V	NM_014819.4	NP_055634.3	O43164	PJA2_HUMAN	praja ring finger 2, E3 ubiquitin protein ligase	26					long-term memory (GO:0007616)|protein ubiquitination (GO:0016567)|regulation of protein kinase A signaling (GO:0010738)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ligase activity (GO:0016874)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G26V(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	21		all_cancers(142;4.4e-06)|all_epithelial(76;8.17e-08)|Prostate(80;0.00676)|Lung NSC(167;0.0436)|Ovarian(225;0.0443)|all_lung(232;0.053)|Colorectal(57;0.0946)|Breast(839;0.151)		OV - Ovarian serous cystadenocarcinoma(64;3.46e-10)|Epithelial(69;6.02e-09)|COAD - Colon adenocarcinoma(37;0.224)		CTGATACCCTCCTGCTGGTTT	0.408																																																	1	Substitution - Missense(1)	kidney(1)											94.0	91.0	92.0					5																	108717359		2202	4300	6502	SO:0001583	missense	9867			AB007898	CCDS4099.1	5q22.1	2013-01-09	2012-02-23	2003-06-05	ENSG00000198961	ENSG00000198961		"""RING-type (C3HC4) zinc fingers"""	17481	protein-coding gene	gene with protein product			"""ring finger protein 131"", ""praja ring finger 2"""	RNF131			Standard	NM_014819		Approved	KIAA0438, Neurodap1	uc003kos.4	O43164	OTTHUMG00000128750	ENST00000361189.2:c.77G>T	5.37:g.108717359C>A	ENSP00000354775:p.Gly26Val		A8K6U4|D3DSZ5|Q68D49|Q8N1G5	Missense_Mutation	SNP	ENST00000361189.2	37	CCDS4099.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.551557	0.86127	.	.	ENSG00000198961	ENST00000361189;ENST00000361557	T;T	0.23147	1.92;1.92	5.71	5.71	0.89125	.	0.000000	0.64402	D	0.000001	T	0.52917	0.1764	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.52434	-0.8576	10	0.87932	D	0	-28.4911	19.8593	0.96777	0.0:1.0:0.0:0.0	.	26	O43164	PJA2_HUMAN	V	26	ENSP00000354775:G26V;ENSP00000355284:G26V	ENSP00000354775:G26V	G	-	2	0	PJA2	108745258	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.046000	0.71029	2.700000	0.92200	0.557000	0.71058	GGA		0.408	PJA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250663.1		NM_014819	
POMZP3	22932	broad.mit.edu	37	7	76247520	76247520	+	Missense_Mutation	SNP	C	C	G			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr7:76247520C>G	ENST00000310842.4	-	4	1009	c.325G>C	c.(325-327)Gct>Cct	p.A109P	POMZP3_ENST00000275569.4_Missense_Mutation_p.A109P|UPK3B_ENST00000419923.2_Intron|UPK3B_ENST00000443097.2_Intron|AC004980.7_ENST00000418663.1_RNA	NM_012230.3	NP_036362.3	Q6PJE2	POZP3_HUMAN	POM121 and ZP3 fusion	109								p.A109P(2)		kidney(3)|lung(2)	5		Myeloproliferative disorder(862;0.204)				GAGTCATTAGCAAAGTGGAAG	0.483																																																	2	Substitution - Missense(2)	kidney(2)											8.0	10.0	10.0					7																	76247520		2051	4020	6071	SO:0001583	missense	22932			U10099	CCDS5590.1, CCDS43606.1	7q11.2	2010-06-24	2010-06-24		ENSG00000146707	ENSG00000146707			9203	protein-coding gene	gene with protein product	"""POM-ZP3 fusion protein"", ""POM121/ZP3 fusion protein"""	600587	"""POM (POM121 rat homolog) and ZP3 fusion"", ""POM (POM121 homolog, rat) and ZP3 fusion"""			7789967	Standard	NM_012230		Approved	POM-ZP3, POM121	uc003uft.3	Q6PJE2	OTTHUMG00000023514	ENST00000310842.4:c.325G>C	7.37:g.76247520C>G	ENSP00000309233:p.Ala109Pro		F6STJ3|Q12903|Q9BWB4	Missense_Mutation	SNP	ENST00000310842.4	37	CCDS43606.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	-|-	9.185|9.185	1.024596|1.024596	0.19433|0.19433	.|.	.|.	ENSG00000146707|ENSG00000146707	ENST00000275569;ENST00000310842;ENST00000454397|ENST00000441393	T;T|.	0.81247|.	-1.47;-1.47|.	.|.	.|.	.|.	Zona pellucida sperm-binding protein (1);|.	0.441905|.	0.24841|.	U|.	0.035166|.	T|T	0.57095|0.57095	0.2030|0.2030	M|M	0.83012|0.83012	2.62|2.62	0.24240|0.24240	N|N	0.995361|0.995361	D|.	0.76494|.	0.999|.	D|.	0.74348|.	0.983|.	T|T	0.50617|0.50617	-0.8807|-0.8807	8|3	0.72032|.	D|.	0.01|.	.|.	.|.	.|.	.|.	.|.	109|.	Q6PJE2|.	POZP3_HUMAN|.	P|S	109;109;214|33	ENSP00000309233:A109P;ENSP00000405319:A214P|.	ENSP00000275569:A109P|.	A|C	-|-	1|2	0|0	POMZP3|POMZP3	76085456|76085456	0.969000|0.969000	0.33509|0.33509	0.748000|0.748000	0.31131|0.31131	0.709000|0.709000	0.40893|0.40893	1.582000|1.582000	0.36568|0.36568	0.392000|0.392000	0.25172|0.25172	0.391000|0.391000	0.25812|0.25812	GCT|TGC		0.483	POMZP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341775.1		NM_012230	
PRDM14	63978	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	70981667	70981667	+	Silent	SNP	A	A	G			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr8:70981667A>G	ENST00000276594.2	-	2	630	c.429T>C	c.(427-429)tgT>tgC	p.C143C		NM_024504.3	NP_078780.1	Q9GZV8	PRD14_HUMAN	PR domain containing 14	143					cell fate specification (GO:0001708)|cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|germ cell development (GO:0007281)|germ-line stem cell maintenance (GO:0030718)|histone H3-R26 methylation (GO:0034972)|homeostasis of number of cells within a tissue (GO:0048873)|inner cell mass cell fate commitment (GO:0001827)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|regulation of DNA methylation (GO:0044030)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.C143C(1)		NS(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Breast(64;0.193)		Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)			CAGGTCCACAACACGGGCCAC	0.587																																					NSCLC(129;99 1813 5906 40656 46114)												1	Substitution - coding silent(1)	kidney(1)											55.0	51.0	53.0					8																	70981667		2203	4300	6503	SO:0001819	synonymous_variant	63978			AF319458	CCDS6206.1	8q13.3	2013-01-08			ENSG00000147596	ENSG00000147596		"""Zinc fingers, C2H2-type"""	14001	protein-coding gene	gene with protein product		611781					Standard	NM_024504		Approved		uc003xym.3	Q9GZV8	OTTHUMG00000150495	ENST00000276594.2:c.429T>C	8.37:g.70981667A>G			Q86UX9	Silent	SNP	ENST00000276594.2	37	CCDS6206.1																																																																																				0.587	PRDM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318505.1			
PRPS2	5634	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	12827407	12827407	+	Missense_Mutation	SNP	G	G	A			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chrX:12827407G>A	ENST00000380668.5	+	3	489	c.361G>A	c.(361-363)Gcg>Acg	p.A121T	PRPS2_ENST00000398491.2_Missense_Mutation_p.A124T|PRPS2_ENST00000489404.1_Missense_Mutation_p.A121T	NM_001039091.2|NM_002765.4	NP_001034180.1|NP_002756.1	P11908	PRPS2_HUMAN	phosphoribosyl pyrophosphate synthetase 2	121					5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|AMP biosynthetic process (GO:0006167)|nucleobase-containing compound metabolic process (GO:0006139)|organ regeneration (GO:0031100)	extracellular vesicular exosome (GO:0070062)|ribose phosphate diphosphokinase complex (GO:0002189)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|ATP binding (GO:0005524)|carbohydrate binding (GO:0030246)|GDP binding (GO:0019003)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)|ribose phosphate diphosphokinase activity (GO:0004749)	p.A121T(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|urinary_tract(1)	16						GGTGGCTGGGGCGGATCACAT	0.408																																																	1	Substitution - Missense(1)	kidney(1)											152.0	132.0	139.0					X																	12827407		2203	4300	6503	SO:0001583	missense	5634			Y00971	CCDS14150.1, CCDS43918.1	Xp22.2	2012-10-02			ENSG00000101911	ENSG00000101911	2.7.6.1		9465	protein-coding gene	gene with protein product	"""PRS II"", ""ribose-phosphate diphosphokinase 2"""	311860				1962753	Standard	NM_002765		Approved		uc004cva.3	P11908	OTTHUMG00000021139	ENST00000380668.5:c.361G>A	X.37:g.12827407G>A	ENSP00000370043:p.Ala121Thr		Q0VDH9|Q0VDI0|Q15245|Q2TAK7	Missense_Mutation	SNP	ENST00000380668.5	37	CCDS14150.1	.	.	.	.	.	.	.	.	.	.	G	32	5.186328	0.94885	.	.	ENSG00000101911	ENST00000380663;ENST00000380668;ENST00000398491;ENST00000489404;ENST00000461630;ENST00000460220	D;D;D;D;T	0.95238	-3.34;-2.86;-2.86;-3.65;-0.78	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	D	0.97387	0.9145	M	0.87097	2.86	0.80722	D	1	D;D	0.65815	0.992;0.995	P;D	0.64410	0.843;0.925	D	0.98061	1.0393	10	0.66056	D	0.02	-17.7029	18.0503	0.89345	0.0:0.0:1.0:0.0	.	121;124	P11908;P11908-2	PRPS2_HUMAN;.	T	121;121;124;121;34;11	ENSP00000370038:A121T;ENSP00000370043:A121T;ENSP00000381504:A124T;ENSP00000419380:A121T;ENSP00000418911:A34T	ENSP00000370038:A121T	A	+	1	0	PRPS2	12737328	1.000000	0.71417	0.920000	0.36463	0.958000	0.62258	9.273000	0.95719	2.285000	0.76669	0.544000	0.68410	GCG		0.408	PRPS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055772.2		NM_002765	
PRSS55	203074	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	10396087	10396087	+	Silent	SNP	C	C	A			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr8:10396087C>A	ENST00000328655.3	+	5	883	c.843C>A	c.(841-843)acC>acA	p.T281T	PRSS55_ENST00000522210.1_Intron|PRSS51_ENST00000523024.1_RNA	NM_198464.3	NP_940866.2	Q6UWB4	PRS55_HUMAN	protease, serine, 55	281	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)	p.T281T(2)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)	31						AGAAGAACACCCCAGGGATAT	0.557																																																	2	Substitution - coding silent(2)	kidney(2)											105.0	111.0	109.0					8																	10396087		2203	4300	6503	SO:0001819	synonymous_variant	203074			AY358867	CCDS5976.1, CCDS56523.1	8p23.1	2014-01-21			ENSG00000184647	ENSG00000184647		"""Serine peptidases / Serine peptidases"""	30824	protein-coding gene	gene with protein product		615144				12975309, 18844450	Standard	NM_198464		Approved	T-SP1, UNQ9391, CT153	uc003wta.3	Q6UWB4	OTTHUMG00000129345	ENST00000328655.3:c.843C>A	8.37:g.10396087C>A			E5RJX5	Silent	SNP	ENST00000328655.3	37	CCDS5976.1																																																																																				0.557	PRSS55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251493.3		NM_198464	
PTPRQ	374462	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	80839468	80839468	+	Missense_Mutation	SNP	C	C	T			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr12:80839468C>T	ENST00000266688.5	+	3	361	c.361C>T	c.(361-363)Ctt>Ttt	p.L121F				Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	163	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)	p.L121F(1)		breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						TCTTACTAATCTTAATCCTGG	0.323																																																	1	Substitution - Missense(1)	kidney(1)											80.0	69.0	72.0					12																	80839468		692	1590	2282	SO:0001583	missense	374462			AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.361C>T	12.37:g.80839468C>T	ENSP00000266688:p.Leu121Phe			Missense_Mutation	SNP	ENST00000266688.5	37		.	.	.	.	.	.	.	.	.	.	C	19.72	3.880333	0.72294	.	.	ENSG00000139304	ENST00000551042;ENST00000266688	D;D	0.84873	-1.91;-1.91	5.82	5.82	0.92795	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	D	0.84051	0.5387	M	0.73372	2.23	0.42349	D	0.992364	P	0.36199	0.543	B	0.34991	0.193	D	0.85520	0.1203	9	0.87932	D	0	.	13.3123	0.60386	0.0:0.9279:0.0:0.0721	.	163	Q9UMZ3	PTPRQ_HUMAN	F	323;121	ENSP00000447522:L323F;ENSP00000266688:L121F	ENSP00000266688:L121F	L	+	1	0	PTPRQ	79363599	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.983000	0.49345	2.755000	0.94549	0.591000	0.81541	CTT		0.323	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_001145026	
RFFL	117584	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	33348596	33348596	+	Silent	SNP	G	G	A			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr17:33348596G>A	ENST00000315249.7	-	3	607	c.385C>T	c.(385-387)Ctg>Ttg	p.L129L	RFFL_ENST00000268850.7_Silent_p.L129L|RAD51L3-RFFL_ENST00000593039.1_Intron|RFFL_ENST00000413582.2_Silent_p.L129L|RFFL_ENST00000584655.1_Silent_p.L129L|RFFL_ENST00000394597.2_Silent_p.L129L|RFFL_ENST00000378516.2_Silent_p.L129L|RFFL_ENST00000447669.2_Silent_p.L129L|RFFL_ENST00000415395.2_Silent_p.L129L					ring finger and FYVE-like domain containing E3 ubiquitin protein ligase									p.L129L(1)		kidney(1)|large_intestine(2)|lung(3)	6		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		AAGAGCACCAGCTCTTCTTTC	0.552																																																	1	Substitution - coding silent(1)	kidney(1)											82.0	75.0	78.0					17																	33348596		2203	4300	6503	SO:0001819	synonymous_variant	117584			AF434816	CCDS11286.1	17q12	2012-02-23	2012-02-23		ENSG00000092871	ENSG00000092871		"""RING-type (C3HC4) zinc fingers"""	24821	protein-coding gene	gene with protein product		609735	"""ring finger and FYVE-like domain containing"""			15229288	Standard	NR_037713		Approved	rififylin, fring, RNF189, RNF34L	uc002hin.1	Q8WZ73	OTTHUMG00000132933	ENST00000315249.7:c.385C>T	17.37:g.33348596G>A				Silent	SNP	ENST00000315249.7	37	CCDS11286.1																																																																																				0.552	RFFL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256460.2		NM_057178	
RIMS2	9699	broad.mit.edu;ucsc.edu	37	8	104513249	104513249	+	Silent	SNP	T	T	C			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr8:104513249T>C	ENST00000406091.3	+	1	135	c.135T>C	c.(133-135)gaT>gaC	p.D45D	RP11-1C8.4_ENST00000523422.1_RNA|RP11-1C8.4_ENST00000517376.1_RNA	NM_001100117.2	NP_001093587.1	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	45	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.D45D(2)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			CCGTCATGGATAGGCAGAAGA	0.627										HNSCC(12;0.0054)																																							2	Substitution - coding silent(2)	kidney(2)											42.0	49.0	47.0					8																	104513249		1975	4147	6122	SO:0001819	synonymous_variant	9699			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000406091.3:c.135T>C	8.37:g.104513249T>C			B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Silent	SNP	ENST00000406091.3	37	CCDS55269.1																																																																																				0.627	RIMS2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_001100117	
ROBO2	6092	broad.mit.edu;ucsc.edu	37	3	77651362	77651362	+	Splice_Site	SNP	T	T	C			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr3:77651362T>C	ENST00000461745.1	+	20	3756	c.2856T>C	c.(2854-2856)gaT>gaC	p.D952D	ROBO2_ENST00000332191.8_Splice_Site_p.D952D|ROBO2_ENST00000487694.3_Splice_Site_p.D968D	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	952					apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)	p.D952D(1)|p.D968D(1)		NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		TCACCACAGATGTGCTGCCAC	0.438																																																	2	Substitution - coding silent(2)	kidney(2)											95.0	93.0	94.0					3																	77651362		1991	4162	6153	SO:0001630	splice_region_variant	6092			AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.2855-1T>C	3.37:g.77651362T>C			O43608|Q19AB4|Q19AB5	Silent	SNP	ENST00000461745.1	37	CCDS43109.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.10|12.10	1.837506|1.837506	0.32513|0.32513	.|.	.|.	ENSG00000185008|ENSG00000185008	ENST00000471893|ENST00000490991	.|.	.|.	.|.	5.83|5.83	5.83|5.83	0.93111|0.93111	.|.	.|.	.|.	.|.	.|.	T|T	0.72326|0.72326	0.3446|0.3446	.|.	.|.	.|.	0.58432|0.58432	D|D	0.999997|0.999997	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.73244|0.73244	-0.4044|-0.4044	3|3	.|.	.|.	.|.	.|.	16.2002|16.2002	0.82067|0.82067	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|.	.|.	.|.	R|T	27|109	.|.	.|.	C|M	+|+	1|2	0|0	ROBO2|ROBO2	77734052|77734052	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.404000|7.404000	0.79996|0.79996	2.231000|2.231000	0.72958|0.72958	0.454000|0.454000	0.30748|0.30748	TGT|ATG		0.438	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2		XM_031246	Silent
RPS24	6229	broad.mit.edu	37	10	79814397	79814397	+	Nonsense_Mutation	SNP	C	C	T			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr10:79814397C>T	ENST00000440692.1	+	5	641	c.499C>T	c.(499-501)Cag>Tag	p.Q167*	RPS24_ENST00000476545.1_3'UTR	NM_001142285.1	NP_001135757.1	P62847	RS24_HUMAN	ribosomal protein S24	0					cellular protein metabolic process (GO:0044267)|erythrocyte homeostasis (GO:0034101)|gene expression (GO:0010467)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal small subunit biogenesis (GO:0042274)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|small ribosomal subunit (GO:0015935)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)|translation initiation factor binding (GO:0031369)	p.Q167*(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(2)|skin(1)	5	all_cancers(46;0.0343)|all_epithelial(25;0.000959)|Breast(12;0.00113)|Prostate(51;0.0095)		Epithelial(14;0.00128)|OV - Ovarian serous cystadenocarcinoma(4;0.00248)|all cancers(16;0.00428)			GGTTGTGTGGCAGGTAGAAGT	0.547																																																	1	Substitution - Nonsense(1)	kidney(1)											46.0	48.0	48.0					10																	79814397		692	1591	2283	SO:0001587	stop_gained	6229			AB007159	CCDS7355.1, CCDS7356.1, CCDS44443.1	10q22	2011-04-06			ENSG00000138326	ENSG00000138326		"""S ribosomal proteins"""	10411	protein-coding gene	gene with protein product		602412				9027498, 9582194	Standard	NM_001142283		Approved	S24	uc001jzs.3	P62847	OTTHUMG00000018549	ENST00000440692.1:c.499C>T	10.37:g.79814397C>T	ENSP00000414321:p.Gln167*		E7EPK6|P16632|Q5T0P7|Q5T0P8|Q7Z3D1	Nonsense_Mutation	SNP	ENST00000440692.1	37	CCDS44443.1	.	.	.	.	.	.	.	.	.	.	C	8.875	0.950145	0.18431	.	.	ENSG00000138326	ENST00000440692	.	.	.	2.56	-4.87	0.03123	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	1.0666	0.01612	0.3438:0.2573:0.2656:0.1333	.	.	.	.	X	167	.	.	Q	+	1	0	RPS24	79484403	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-0.113000	0.10774	-1.194000	0.02684	0.563000	0.77884	CAG		0.547	RPS24-202	KNOWN	basic|CCDS	protein_coding	protein_coding			NM_001026	
SEMA3D	223117	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	84642124	84642124	+	Missense_Mutation	SNP	A	A	T			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr7:84642124A>T	ENST00000284136.6	-	15	1785	c.1742T>A	c.(1741-1743)aTc>aAc	p.I581N	SEMA3D_ENST00000484038.1_5'UTR	NM_152754.2	NP_689967.2	O95025	SEM3D_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D	581	PSI.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|membrane (GO:0016020)	receptor activity (GO:0004872)	p.I581N(1)		NS(1)|breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(19)|lung(29)|ovary(3)|pancreas(1)|prostate(4)|skin(2)	73						GCACTGGGTGATTGGGTCGCC	0.398																																					Ovarian(63;442 1191 17318 29975 31528)												1	Substitution - Missense(1)	kidney(1)											131.0	121.0	125.0					7																	84642124		2203	4300	6503	SO:0001583	missense	223117			BC029590	CCDS34676.1	7q21.11	2013-01-11			ENSG00000153993	ENSG00000153993		"""Semaphorins"", ""Immunoglobulin superfamily / V-set domain containing"""	10726	protein-coding gene	gene with protein product		609907					Standard	NM_152754		Approved	coll-2, Sema-Z2	uc003uic.3	O95025	OTTHUMG00000154569	ENST00000284136.6:c.1742T>A	7.37:g.84642124A>T	ENSP00000284136:p.Ile581Asn		A6NK46|Q6UW77|Q8NCQ1	Missense_Mutation	SNP	ENST00000284136.6	37	CCDS34676.1	.	.	.	.	.	.	.	.	.	.	A	14.80	2.642229	0.47153	.	.	ENSG00000153993	ENST00000284136	T	0.22336	1.96	5.93	5.93	0.95920	.	0.228496	0.49305	D	0.000147	T	0.16642	0.0400	N	0.20530	0.585	0.80722	D	1	B	0.26744	0.158	B	0.23574	0.047	T	0.03325	-1.1048	10	0.52906	T	0.07	.	16.3871	0.83514	1.0:0.0:0.0:0.0	.	581	O95025	SEM3D_HUMAN	N	581	ENSP00000284136:I581N	ENSP00000284136:I581N	I	-	2	0	SEMA3D	84480060	1.000000	0.71417	1.000000	0.80357	0.662000	0.39071	5.175000	0.65021	2.265000	0.75225	0.533000	0.62120	ATC		0.398	SEMA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336084.2		NM_152754	
SIAH2	6478	broad.mit.edu	37	3	150460088	150460088	+	Missense_Mutation	SNP	C	C	T	rs543249698		TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr3:150460088C>T	ENST00000312960.3	-	2	1342	c.815G>A	c.(814-816)cGg>cAg	p.R272Q		NM_005067.5	NP_005058.3	O43255	SIAH2_HUMAN	siah E3 ubiquitin protein ligase 2	272	SBD.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|cellular protein catabolic process (GO:0044257)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|regulation of protein ubiquitination (GO:0031396)|regulation of RNA biosynthetic process (GO:2001141)|small GTPase mediated signal transduction (GO:0007264)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R272Q(1)		endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|pancreas(1)	16			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			GGTCAATCTCCGCCGGTTCCC	0.562																																																	1	Substitution - Missense(1)	kidney(1)											92.0	73.0	79.0					3																	150460088		2203	4300	6503	SO:0001583	missense	6478			U76248	CCDS3152.1	3q25	2012-02-23	2012-02-23		ENSG00000181788	ENSG00000181788	6.3.2.1		10858	protein-coding gene	gene with protein product		602213	"""seven in absentia (Drosophila) homolog 2"", ""seven in absentia homolog 2 (Drosophila)"""			9334332	Standard	NM_005067		Approved		uc003eyi.3	O43255	OTTHUMG00000159847	ENST00000312960.3:c.815G>A	3.37:g.150460088C>T	ENSP00000322457:p.Arg272Gln		O43270	Missense_Mutation	SNP	ENST00000312960.3	37	CCDS3152.1	.	.	.	.	.	.	.	.	.	.	C	35	5.467483	0.96257	.	.	ENSG00000181788	ENST00000312960	T	0.26660	1.72	5.81	5.81	0.92471	TRAF-type (1);Seven-in-absentia protein, TRAF-like domain (1);TRAF-like (1);	0.000000	0.85682	D	0.000000	T	0.57844	0.2081	M	0.93939	3.475	0.50467	D	0.999871	D	0.76494	0.999	P	0.59546	0.859	T	0.68542	-0.5381	10	0.72032	D	0.01	.	15.1984	0.73116	0.0:0.9312:0.0:0.0688	.	272	O43255	SIAH2_HUMAN	Q	272	ENSP00000322457:R272Q	ENSP00000322457:R272Q	R	-	2	0	SIAH2	151942778	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	6.080000	0.71299	2.746000	0.94184	0.591000	0.81541	CGG		0.562	SIAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357697.1		NM_005067	
SMARCA4	6597	hgsc.bcm.edu	37	19	11106894	11106894	+	Missense_Mutation	SNP	A	A	C			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr19:11106894A>C	ENST00000429416.3	+	11	1880	c.1599A>C	c.(1597-1599)gaA>gaC	p.E533D	SMARCA4_ENST00000541122.2_Missense_Mutation_p.E533D|SMARCA4_ENST00000413806.3_Missense_Mutation_p.E533D|SMARCA4_ENST00000590574.1_Missense_Mutation_p.E533D|SMARCA4_ENST00000444061.3_Missense_Mutation_p.E533D|SMARCA4_ENST00000358026.2_Missense_Mutation_p.E533D|SMARCA4_ENST00000450717.3_Missense_Mutation_p.E533D|SMARCA4_ENST00000589677.1_Missense_Mutation_p.E533D|SMARCA4_ENST00000344626.4_Missense_Mutation_p.E533D	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	533					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				TGTAGGCTGAAGATGAGGAGG	0.567			"""F, N, Mis"""		NSCLC																																			Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	1	Unknown(1)	lung(1)											163.0	138.0	146.0					19																	11106894		2203	4300	6503	SO:0001583	missense	6597			D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.1599A>C	19.37:g.11106894A>C	ENSP00000395654:p.Glu533Asp		B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	37	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.567732	0.86439	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	T;T;T;T;T;T;T	0.39406	1.08;1.08;1.08;1.08;1.08;1.08;1.08	4.83	-6.24	0.02046	.	0.000000	0.85682	D	0.000000	T	0.51517	0.1679	L	0.46614	1.455	0.39854	D	0.973281	D;D;D;D;D;D;D	0.89917	1.0;0.999;1.0;0.998;0.999;1.0;1.0	D;D;D;D;D;D;D	0.77557	0.99;0.976;0.99;0.987;0.954;0.99;0.99	T	0.60520	-0.7247	10	0.87932	D	0	-29.4019	16.7093	0.85381	0.313:0.0:0.687:0.0	.	533;533;533;533;533;533;533	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;A7E2E1;P51532	.;.;.;.;.;.;SMCA4_HUMAN	D	533;533;597;533;533;533;533;533	ENSP00000395654:E533D;ENSP00000350720:E533D;ENSP00000343896:E533D;ENSP00000445036:E533D;ENSP00000392837:E533D;ENSP00000397783:E533D;ENSP00000414727:E533D	ENSP00000343896:E533D	E	+	3	2	SMARCA4	10967894	0.002000	0.14202	0.067000	0.19924	0.818000	0.46254	-0.896000	0.04114	-1.731000	0.01360	-0.371000	0.07208	GAA		0.567	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2		NM_003072	
TBC1D12	23232	broad.mit.edu	37	10	96290995	96290995	+	Silent	SNP	T	T	C			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr10:96290995T>C	ENST00000225235.4	+	12	2147	c.2037T>C	c.(2035-2037)gaT>gaC	p.D679D	TBC1D12_ENST00000485048.1_3'UTR	NM_015188.1	NP_056003.1	O60347	TBC12_HUMAN	TBC1 domain family, member 12	679	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)	p.D679D(1)		breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(2)	20		Colorectal(252;0.0429)				TACCACTTGATCTGGCCTGTC	0.373																																																	1	Substitution - coding silent(1)	kidney(1)											164.0	152.0	156.0					10																	96290995		1833	4088	5921	SO:0001819	synonymous_variant	23232			AB011180	CCDS41553.1	10q23.33	2013-09-20			ENSG00000108239	ENSG00000108239			29082	protein-coding gene	gene with protein product						9628581	Standard	NM_015188		Approved	KIAA0608	uc001kjr.2	O60347	OTTHUMG00000018794	ENST00000225235.4:c.2037T>C	10.37:g.96290995T>C			Q5VYA6|Q8WX26|Q8WX59|Q9UG83	Silent	SNP	ENST00000225235.4	37	CCDS41553.1																																																																																				0.373	TBC1D12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049482.2			
TNC	3371	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	117803275	117803275	+	Silent	SNP	G	G	T			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr9:117803275G>T	ENST00000350763.4	-	19	5748	c.5337C>A	c.(5335-5337)atC>atA	p.I1779I	TNC_ENST00000423613.2_Silent_p.I1506I|TNC_ENST00000345230.3_Silent_p.I1142I|TNC_ENST00000346706.3_Silent_p.I1233I|TNC_ENST00000340094.3_Silent_p.I1415I|TNC_ENST00000341037.4_Silent_p.I1597I|TNC_ENST00000537320.1_Silent_p.I1142I|TNC_ENST00000535648.1_Silent_p.I1324I|TNC_ENST00000542877.1_Silent_p.I1416I	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	1779	Fibronectin type-III 13. {ECO:0000255|PROSITE-ProRule:PRU00316}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)	p.I1779I(1)		NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						TCATGGCGATGATGCTGACAA	0.507																																																	1	Substitution - coding silent(1)	kidney(1)											204.0	169.0	181.0					9																	117803275		2203	4300	6503	SO:0001819	synonymous_variant	3371				CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.5337C>A	9.37:g.117803275G>T			C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Silent	SNP	ENST00000350763.4	37	CCDS6811.1	.	.	.	.	.	.	.	.	.	.	G	6.140	0.394044	0.11638	.	.	ENSG00000041982	ENST00000544972	.	.	.	6.08	5.16	0.70880	.	.	.	.	.	T	0.58666	0.2138	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57631	-0.7778	4	.	.	.	.	7.7397	0.28835	0.1361:0.1383:0.7256:0.0	.	.	.	.	N	342	.	.	H	-	1	0	TNC	116843096	1.000000	0.71417	0.352000	0.25734	0.547000	0.35210	1.581000	0.36558	1.525000	0.49052	0.655000	0.94253	CAT		0.507	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055418.2		NM_002160	
Unknown	0	broad.mit.edu	37	11	129567386	129567386	+	IGR	DEL	T	T	-			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr11:129567386delT								BARX2 (245215 upstream) : TMEM45B (118327 downstream)																							TCCCCAGGGGTTTTTTTCCAA	0.517																																																	0																																										SO:0001628	intergenic_variant	0																															11.37:g.129567386delT				RNA	DEL		37																																																																																				0	0.517									
LINC01234	100506465	broad.mit.edu	37	12	114184112	114184112	+	lincRNA	DEL	C	C	-			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr12:114184112delC	ENST00000547963.1	-	0	357																											ggtcttcattcccccacacAC	0.522																																																	0																																												0																															12.37:g.114184112delC				RNA	DEL	ENST00000547963.1	37																																																																																					0.522	RP11-438N16.1-002	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000405246.1			
WDR74	54663	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	62601147	62601147	+	Splice_Site	SNP	C	C	A	rs189126082		TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr11:62601147C>A	ENST00000525239.1	-	11	1459		c.e11-1		WDR74_ENST00000525752.1_Splice_Site|WDR74_ENST00000529106.1_Splice_Site|WDR74_ENST00000540620.1_5'Flank|STX5_ENST00000377897.4_5'Flank|WDR74_ENST00000278856.4_Splice_Site|WDR74_ENST00000311713.7_Intron|RP11-727F15.9_ENST00000535867.1_RNA|STX5_ENST00000394690.1_5'Flank|RP11-727F15.9_ENST00000535817.1_RNA|STX5_ENST00000294179.3_5'Flank|STX5_ENST00000541317.1_5'Flank			Q6RFH5	WDR74_HUMAN	WD repeat domain 74						blastocyst formation (GO:0001825)|RNA metabolic process (GO:0016070)	nucleolus (GO:0005730)|nucleus (GO:0005634)		p.?(2)		kidney(2)|large_intestine(1)|liver(1)|lung(3)|ovary(1)	8						TGAGATAAACCTGCAAAAGAT	0.552																																																	2	Unknown(2)	kidney(2)											38.0	38.0	38.0					11																	62601147		1961	4139	6100	SO:0001630	splice_region_variant	54663				CCDS44630.1	11q12.3	2013-01-09				ENSG00000133316		"""WD repeat domain containing"""	25529	protein-coding gene	gene with protein product							Standard	NM_018093		Approved	FLJ10439	uc001nvm.2	Q6RFH5		ENST00000525239.1:c.922-1G>T	11.37:g.62601147C>A			A8K8G5|Q9BRC9|Q9H6X8|Q9NVY2	Splice_Site	SNP	ENST00000525239.1	37	CCDS44630.1	.	.	.	.	.	.	.	.	.	.	C	18.96	3.734400	0.69189	.	.	ENSG00000133316	ENST00000529106;ENST00000525239;ENST00000278856;ENST00000525752	.	.	.	5.11	5.11	0.69529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0708	0.80928	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	WDR74	62357723	1.000000	0.71417	1.000000	0.80357	0.832000	0.47134	5.503000	0.66962	2.386000	0.81285	0.563000	0.77884	.		0.552	WDR74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395678.1		NM_018093	Intron
XYLT1	64131	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	17211800	17211800	+	Missense_Mutation	SNP	G	G	A	rs374020411		TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr16:17211800G>A	ENST00000261381.6	-	11	2344	c.2260C>T	c.(2260-2262)Cgc>Tgc	p.R754C		NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	754					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)	p.R754C(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						CCAAAGTTGCGGAATAGCCTC	0.572																																																	2	Substitution - Missense(2)	kidney(1)|endometrium(1)											84.0	74.0	77.0					16																	17211800		2197	4300	6497	SO:0001583	missense	64131			AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.2260C>T	16.37:g.17211800G>A	ENSP00000261381:p.Arg754Cys		Q9H1B6	Missense_Mutation	SNP	ENST00000261381.6	37	CCDS10569.1	.	.	.	.	.	.	.	.	.	.	G	19.93	3.918891	0.73098	.	.	ENSG00000103489	ENST00000261381	T	0.61859	0.07	5.08	4.1	0.47936	.	0.000000	0.85682	D	0.000000	T	0.76033	0.3931	M	0.84326	2.69	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79438	-0.1803	10	0.87932	D	0	-38.4378	12.032	0.53403	0.0:0.0:0.6862:0.3138	.	754	Q86Y38	XYLT1_HUMAN	C	754	ENSP00000261381:R754C	ENSP00000261381:R754C	R	-	1	0	XYLT1	17119301	1.000000	0.71417	0.999000	0.59377	0.962000	0.63368	2.510000	0.45468	1.212000	0.43366	0.462000	0.41574	CGC		0.572	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2		NM_022166	
ZBBX	79740	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	167045872	167045872	+	Silent	SNP	A	A	G			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr3:167045872A>G	ENST00000392766.2	-	11	1060	c.720T>C	c.(718-720)cgT>cgC	p.R240R	ZBBX_ENST00000469220.1_Intron|ZBBX_ENST00000392767.2_Silent_p.R240R|ZBBX_ENST00000307529.5_Silent_p.R240R|ZBBX_ENST00000392764.1_Silent_p.R211R|ZBBX_ENST00000455345.2_Silent_p.R240R	NM_001199201.1|NM_024687.3	NP_001186130.1|NP_078963.2	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	240						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.R240R(2)		NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(9)|liver(1)|lung(38)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	70						TTGGTTTTGTACGTTGTGCTC	0.353																																																	2	Substitution - coding silent(2)	kidney(2)											212.0	191.0	198.0					3																	167045872		1858	4097	5955	SO:0001819	synonymous_variant	79740			AK026702	CCDS3199.2, CCDS56295.1, CCDS56296.1	3q26.1	2010-03-23			ENSG00000169064	ENSG00000169064			26245	protein-coding gene	gene with protein product						12477932	Standard	NM_024687		Approved	FLJ23049	uc011bpc.2	A8MT70	OTTHUMG00000133560	ENST00000392766.2:c.720T>C	3.37:g.167045872A>G			A8MV69|B3KSC1|B5MDJ6|F2Z370|Q9H5T8	Silent	SNP	ENST00000392766.2	37	CCDS3199.2																																																																																				0.353	ZBBX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257657.3		NM_024687	
ZCCHC9	84240	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	80600728	80600728	+	Missense_Mutation	SNP	A	A	G			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr5:80600728A>G	ENST00000254037.2	+	1	3307	c.152A>G	c.(151-153)aAt>aGt	p.N51S	ZCCHC9_ENST00000506458.1_Intron|ZCCHC9_ENST00000407610.3_Missense_Mutation_p.N51S|ZCCHC9_ENST00000380199.5_Missense_Mutation_p.N51S|ZCCHC9_ENST00000438268.2_Missense_Mutation_p.N51S			Q8N567	ZCHC9_HUMAN	zinc finger, CCHC domain containing 9	51					negative regulation of phosphatase activity (GO:0010923)		poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.N51S(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)	13		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;8.18e-45)|Epithelial(54;2.72e-39)|all cancers(79;7.33e-34)		TCCCTCAAAAATGATGCACCC	0.388																																																	1	Substitution - Missense(1)	kidney(1)											86.0	84.0	85.0					5																	80600728		2203	4300	6503	SO:0001583	missense	84240			BC014841	CCDS4054.1	5q14.1	2013-01-09			ENSG00000131732	ENSG00000131732		"""Zinc fingers, CCHC domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25424	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 41"""					12477932	Standard	NM_032280		Approved	DKFZp761J139, PPP1R41	uc003khi.3	Q8N567	OTTHUMG00000119014	ENST00000254037.2:c.152A>G	5.37:g.80600728A>G	ENSP00000254037:p.Asn51Ser		B2RAE7|Q9H027	Missense_Mutation	SNP	ENST00000254037.2	37	CCDS4054.1	.	.	.	.	.	.	.	.	.	.	A	9.619	1.133228	0.21041	.	.	ENSG00000131732	ENST00000254037;ENST00000407610;ENST00000380199;ENST00000438268	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	5.33	2.9	0.33743	.	0.769128	0.13304	N	0.397992	T	0.33235	0.0856	L	0.46157	1.445	0.21064	N	0.999792	B	0.10296	0.003	B	0.08055	0.003	T	0.19811	-1.0294	10	0.33141	T	0.24	-11.2667	7.3482	0.26676	0.7479:0.0:0.2521:0.0	.	51	Q8N567	ZCHC9_HUMAN	S	51	ENSP00000254037:N51S;ENSP00000385047:N51S;ENSP00000369546:N51S;ENSP00000412637:N51S	ENSP00000254037:N51S	N	+	2	0	ZCCHC9	80636484	0.837000	0.29446	0.551000	0.28230	0.705000	0.40729	1.196000	0.32198	0.854000	0.35336	0.533000	0.62120	AAT		0.388	ZCCHC9-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239213.1		NM_032280	
ZNF175	7728	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	52090780	52090780	+	Missense_Mutation	SNP	G	G	A			TCGA-B4-5377-01A-01D-1501-10	TCGA-B4-5377-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a615b02d-fd18-47ef-bd66-6dba56de6981	85d470b3-45ce-4267-ab98-ce6cc5ca43d4	g.chr19:52090780G>A	ENST00000262259.2	+	5	1554	c.1196G>A	c.(1195-1197)gGc>gAc	p.G399D	ZNF175_ENST00000436511.2_Intron	NM_007147.2	NP_009078.1	Q9Y473	ZN175_HUMAN	zinc finger protein 175	399					defense response to virus (GO:0051607)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G399D(1)		NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000426)|OV - Ovarian serous cystadenocarcinoma(262;0.0257)		TGTGGCAAAGGCTTCTCCCAA	0.413																																																	1	Substitution - Missense(1)	kidney(1)											78.0	80.0	79.0					19																	52090780		2203	4300	6503	SO:0001583	missense	7728			D50419	CCDS12837.1	19q13.4	2013-01-08			ENSG00000105497	ENSG00000105497		"""Zinc fingers, C2H2-type"", ""-"""	12964	protein-coding gene	gene with protein product		601139				8838321	Standard	NM_007147		Approved	OTK18	uc002pxb.3	Q9Y473	OTTHUMG00000167771	ENST00000262259.2:c.1196G>A	19.37:g.52090780G>A	ENSP00000262259:p.Gly399Asp		A8K9H2	Missense_Mutation	SNP	ENST00000262259.2	37	CCDS12837.1	.	.	.	.	.	.	.	.	.	.	G	14.76	2.630920	0.46944	.	.	ENSG00000105497	ENST00000262259	T	0.18016	2.24	2.26	1.19	0.21007	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.25121	0.0610	M	0.64997	1.995	0.80722	D	1	D	0.53462	0.96	P	0.51777	0.679	T	0.04294	-1.0962	9	0.66056	D	0.02	.	8.8092	0.34956	0.0:0.2351:0.7648:0.0	.	399	Q9Y473	ZN175_HUMAN	D	399	ENSP00000262259:G399D	ENSP00000262259:G399D	G	+	2	0	ZNF175	56782592	0.000000	0.05858	1.000000	0.80357	0.993000	0.82548	0.159000	0.16442	0.508000	0.28173	0.655000	0.94253	GGC		0.413	ZNF175-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396205.1		NM_007147	
