#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ZYG11B	79699	hgsc.bcm.edu	37	1	53236935	53236935	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr1:53236935C>A	ENST00000294353.6	+	3	585	c.440C>A	c.(439-441)aCt>aAt	p.T147N	ZYG11B_ENST00000443756.2_Missense_Mutation_p.T147N|ZYG11B_ENST00000545132.1_Missense_Mutation_p.T147N	NM_024646.2	NP_078922.1	Q9C0D3	ZY11B_HUMAN	zyg-11 family member B, cell cycle regulator	147										breast(1)|endometrium(1)|kidney(6)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	30						AATTCATTAACTCTCTCCCTC	0.478																																					p.T147N		Atlas-SNP	.											.	ZYG11B	61	.	0			c.C440A						PASS	.						97.0	94.0	95.0					1																	53236935		2203	4300	6503	SO:0001583	missense	79699	exon3			CATTAACTCTCTC	AB051517	CCDS30717.1	1p32.3	2013-01-17	2012-12-10	2005-07-11	ENSG00000162378	ENSG00000162378		"""ZYG11 cell cycle regulator family"""	25820	protein-coding gene	gene with protein product			"""zyg-11 homolog (C. elegans)"", ""zyg-11 homolog B (C. elegans)"""	ZYG11		11214970	Standard	NM_024646		Approved	FLJ13456	uc001cuj.3	Q9C0D3	OTTHUMG00000008938	ENST00000294353.6:c.440C>A	chr1.hg19:g.53236935C>A	ENSP00000294353:p.Thr147Asn	169.0	0.0	.		73.0	24.0	.	NM_024646	Q8N2X3|Q9H8L8	Missense_Mutation	SNP	ENST00000294353.6	hg19	CCDS30717.1	.	.	.	.	.	.	.	.	.	.	C	15.14	2.745282	0.49151	.	.	ENSG00000162378	ENST00000443756;ENST00000545132;ENST00000294353	T;T;T	0.07021	3.23;3.23;3.23	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.09686	0.0238	L	0.38175	1.15	0.58432	D	0.999994	B;B	0.24258	0.1;0.027	B;B	0.22753	0.041;0.013	T	0.24977	-1.0145	10	0.23891	T	0.37	.	19.6182	0.95643	0.0:1.0:0.0:0.0	.	147;147	B4DK95;Q9C0D3	.;ZY11B_HUMAN	N	147	ENSP00000400522:T147N;ENSP00000441315:T147N;ENSP00000294353:T147N	ENSP00000294353:T147N	T	+	2	0	ZYG11B	53009523	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.662000	0.68032	2.653000	0.90120	0.650000	0.86243	ACT	.	.	.	none		0.478	ZYG11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024749.1	NM_024646	
SGIP1	84251	hgsc.bcm.edu	37	1	67138996	67138996	+	Missense_Mutation	SNP	C	C	A	rs142151342		TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr1:67138996C>A	ENST00000371037.4	+	12	670	c.593C>A	c.(592-594)gCt>gAt	p.A198D	SGIP1_ENST00000371035.3_Missense_Mutation_p.A155D|SGIP1_ENST00000371036.3_Missense_Mutation_p.A165D|SGIP1_ENST00000468286.1_3'UTR|SGIP1_ENST00000371039.1_Missense_Mutation_p.A166D|AL139147.1_ENST00000502413.2_Intron|SGIP1_ENST00000237247.6_Missense_Mutation_p.A202D	NM_032291.2	NP_115667.2	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting protein 1	198	Pro-rich.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of feeding behavior (GO:2000253)|positive regulation of receptor-mediated endocytosis (GO:0048260)|response to dietary excess (GO:0002021)	AP-2 adaptor complex (GO:0030122)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phospholipid binding (GO:0005543)|SH3 domain binding (GO:0017124)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(43)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	71						ACGGCCCTTGCTCCTCTCTTT	0.363																																					p.A198D		Atlas-SNP	.											.	SGIP1	272	.	0			c.C593A						PASS	.						177.0	185.0	183.0					1																	67138996		2203	4300	6503	SO:0001583	missense	84251	exon12			CCCTTGCTCCTCT	AL136561	CCDS30744.1	1p31.3	2008-02-05			ENSG00000118473	ENSG00000118473			25412	protein-coding gene	gene with protein product		611540				11230166	Standard	NM_032291		Approved	DKFZp761D221	uc001dcr.3	Q9BQI5	OTTHUMG00000009161	ENST00000371037.4:c.593C>A	chr1.hg19:g.67138996C>A	ENSP00000360076:p.Ala198Asp	620.0	0.0	.		301.0	95.0	.	NM_032291	A6NL81|A6NLD1|Q4LE32|Q5VYE2|Q5VYE3|Q5VYE4|Q68D76|Q6MZY6|Q8IWC2	Missense_Mutation	SNP	ENST00000371037.4	hg19	CCDS30744.1	.	.	.	.	.	.	.	.	.	.	C	13.76	2.332511	0.41297	.	.	ENSG00000118473	ENST00000237247;ENST00000371039;ENST00000424320;ENST00000371035;ENST00000371038;ENST00000407289;ENST00000371036;ENST00000371037	T;T;T;T;T;T	0.03330	3.97;3.97;3.97;3.97;3.97;3.97	5.73	5.73	0.89815	.	0.171335	0.52532	D	0.000074	T	0.04003	0.0112	N	0.17474	0.49	0.35690	D	0.814803	D	0.71674	0.998	D	0.76071	0.987	T	0.59736	-0.7398	10	0.11485	T	0.65	-18.8968	18.4621	0.90743	0.0:1.0:0.0:0.0	.	198	Q9BQI5	SGIP1_HUMAN	D	202;166;190;155;201;201;165;198	ENSP00000237247:A202D;ENSP00000360078:A166D;ENSP00000410439:A190D;ENSP00000360074:A155D;ENSP00000360075:A165D;ENSP00000360076:A198D	ENSP00000237247:A202D	A	+	2	0	SGIP1	66911584	0.996000	0.38824	1.000000	0.80357	0.595000	0.36748	4.773000	0.62331	2.718000	0.92993	0.650000	0.86243	GCT	.	C|1.000;G|0.000	.	alt		0.363	SGIP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000025395.4	NM_032291	
BCAR3	8412	hgsc.bcm.edu	37	1	94054731	94054731	+	Silent	SNP	C	C	T			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr1:94054731C>T	ENST00000370244.1	-	7	1020	c.732G>A	c.(730-732)caG>caA	p.Q244Q	BCAR3_ENST00000260502.6_Silent_p.Q244Q|BCAR3_ENST00000370247.3_Silent_p.Q153Q|BCAR3_ENST00000370243.1_Silent_p.Q244Q	NM_001261408.1	NP_001248337.1	O75815	BCAR3_HUMAN	breast cancer anti-estrogen resistance 3	244	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				lens morphogenesis in camera-type eye (GO:0002089)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|response to drug (GO:0042493)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)		guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(1)	25		all_lung(203;0.00145)|Lung NSC(277;0.00662)		all cancers(265;0.0126)|GBM - Glioblastoma multiforme(16;0.0467)|Epithelial(280;0.166)		TGGCGCCACTCTGCTGGGAGA	0.667																																					p.Q244Q		Atlas-SNP	.											.	BCAR3	62	.	0			c.G732A						PASS	.						30.0	30.0	30.0					1																	94054731		2203	4300	6503	SO:0001819	synonymous_variant	8412	exon5			GCCACTCTGCTGG	U92715	CCDS745.1, CCDS58010.1	1p22.1	2013-02-14			ENSG00000137936	ENSG00000137936		"""SH2 domain containing"""	973	protein-coding gene	gene with protein product		604704				9582273	Standard	NM_001261408		Approved	NSP2, SH2D3B	uc001dpz.4	O75815	OTTHUMG00000010301	ENST00000370244.1:c.732G>A	chr1.hg19:g.94054731C>T		61.0	0.0	.		94.0	35.0	.	NM_001261409	D3DT43|Q5TEW3|Q6UW40|Q9BR50	Silent	SNP	ENST00000370244.1	hg19	CCDS745.1																																																																																			.	.	.	none		0.667	BCAR3-003	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028420.1		
ATP1A1	476	hgsc.bcm.edu	37	1	116931576	116931576	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr1:116931576A>C	ENST00000295598.5	+	7	941	c.689A>C	c.(688-690)gAt>gCt	p.D230A	ATP1A1_ENST00000369496.4_Missense_Mutation_p.D199A|ATP1A1_ENST00000537345.1_Missense_Mutation_p.D230A|ATP1A1_ENST00000491156.1_3'UTR	NM_000701.7	NP_000692.2	P05023	AT1A1_HUMAN	ATPase, Na+/K+ transporting, alpha 1 polypeptide	230					ATP biosynthetic process (GO:0006754)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|membrane hyperpolarization (GO:0060081)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of glucocorticoid biosynthetic process (GO:0031947)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart contraction (GO:0045823)|positive regulation of striated muscle contraction (GO:0045989)|potassium ion import (GO:0010107)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of sodium ion transport (GO:0002028)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|chaperone binding (GO:0051087)|phosphatase activity (GO:0016791)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(2)|breast(2)|cervix(3)|endometrium(2)|kidney(5)|large_intestine(9)|lung(17)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Ciclopirox(DB01188)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Ethacrynic acid(DB00903)|Hydroflumethiazide(DB00774)|Ouabain(DB01092)|Trichlormethiazide(DB01021)	AGGTCTCCAGATTTCACAAAT	0.453																																					p.D230A		Atlas-SNP	.											.	ATP1A1	87	.	0			c.A689C						PASS	.						86.0	90.0	89.0					1																	116931576		2203	4300	6503	SO:0001583	missense	476	exon7			CTCCAGATTTCAC	D00099	CCDS887.1, CCDS53351.1, CCDS53352.1	1p13	2012-10-22			ENSG00000163399	ENSG00000163399	3.6.3.9	"""ATPases / P-type"""	799	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-1"", ""sodium pump subunit alpha-1"", ""sodium-potassium ATPase catalytic subunit alpha-1"""	182310					Standard	NM_000701		Approved		uc001ege.3	P05023	OTTHUMG00000012109	ENST00000295598.5:c.689A>C	chr1.hg19:g.116931576A>C	ENSP00000295598:p.Asp230Ala	193.0	0.0	.		89.0	38.0	.	NM_001160233	B2RBR6|B7Z2T5|B7Z3U6|F5H3A1|Q16689|Q6LDM4|Q9UCN1|Q9UJ20|Q9UJ21	Missense_Mutation	SNP	ENST00000295598.5	hg19	CCDS887.1	.	.	.	.	.	.	.	.	.	.	A	18.67	3.674536	0.67928	.	.	ENSG00000163399	ENST00000295598;ENST00000537345;ENST00000339159;ENST00000369496	D;D;D	0.90197	-2.63;-2.63;-2.63	5.14	5.14	0.70334	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.85682	D	0.000000	T	0.82098	0.4963	L	0.41027	1.25	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.81493	-0.0908	10	0.87932	D	0	.	15.1179	0.72419	1.0:0.0:0.0:0.0	.	230;230	F5H3A1;P05023	.;AT1A1_HUMAN	A	230;230;229;199	ENSP00000295598:D230A;ENSP00000445306:D230A;ENSP00000358508:D199A	ENSP00000295598:D230A	D	+	2	0	ATP1A1	116733099	1.000000	0.71417	0.971000	0.41717	0.988000	0.76386	9.139000	0.94554	2.165000	0.68154	0.533000	0.62120	GAT	.	.	.	none		0.453	ATP1A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000033481.5	NM_001160233	
CELF3	11189	hgsc.bcm.edu	37	1	151678722	151678722	+	Silent	SNP	T	T	C			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr1:151678722T>C	ENST00000290583.4	-	10	1897	c.1104A>G	c.(1102-1104)caA>caG	p.Q368Q	CELF3_ENST00000392706.3_Silent_p.Q163Q|RP11-98D18.1_ENST00000457548.1_RNA|CELF3_ENST00000290585.4_Silent_p.Q318Q|CELF3_ENST00000470688.1_5'UTR	NM_001172648.1|NM_007185.4	NP_001166119.1|NP_009116.3	Q5SZQ8	CELF3_HUMAN	CUGBP, Elav-like family member 3	368	Gln-rich.				mRNA splicing, via spliceosome (GO:0000398)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	21						gctgctgctgttgctgctgct	0.657																																					p.Q368Q		Atlas-SNP	.											CELF3,caecum,carcinoma,0,1	CELF3	49	.	0			c.A1104G						PASS	.						19.0	20.0	20.0					1																	151678722		2200	4297	6497	SO:0001819	synonymous_variant	11189	exon10			CTGCTGTTGCTGC	U80759	CCDS1002.1, CCDS53367.1	1q21	2013-02-12	2010-02-19	2010-02-19	ENSG00000159409	ENSG00000159409		"""Trinucleotide (CAG) repeat containing"", ""RNA binding motif (RRM) containing"""	11967	protein-coding gene	gene with protein product	"""expanded repeat domain, CAG/CTG 4"", ""CAG repeat domain"", ""CUG-BP and ETR-3 like factor 3"""	612678	"""trinucleotide repeat containing 4"""	TNRC4		9225980	Standard	XM_005244859		Approved	CAGH4, BRUNOL1, ERDA4, MGC57297	uc001eys.2	Q5SZQ8	OTTHUMG00000013064	ENST00000290583.4:c.1104A>G	chr1.hg19:g.151678722T>C		13.0	0.0	.		35.0	3.0	.	NM_007185	B7ZKK6|O15414|Q499Y6|Q5SZQ7|Q6NVK0|Q8IZ98|Q9BZC2|Q9HB30	Silent	SNP	ENST00000290583.4	hg19	CCDS1002.1	.	.	.	.	.	.	.	.	.	.	.	4.938	0.174339	0.09391	.	.	ENSG00000159409	ENST00000420342	.	.	.	3.25	1.39	0.22231	.	.	.	.	.	T	0.36496	0.0969	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.19943	-1.0290	4	.	.	.	-0.0118	5.4728	0.16680	0.0:0.7409:0.0:0.2591	.	.	.	.	S	369	.	.	N	-	2	0	CELF3	149945346	0.076000	0.21285	1.000000	0.80357	0.644000	0.38419	-0.812000	0.04496	0.416000	0.25844	-0.389000	0.06534	AAC	.	.	.	none		0.657	CELF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036663.2	NM_007185	
PGLYRP3	114771	hgsc.bcm.edu	37	1	153279661	153279661	+	Nonsense_Mutation	SNP	G	G	C			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr1:153279661G>C	ENST00000290722.1	-	2	190	c.138C>G	c.(136-138)taC>taG	p.Y46*		NM_052891.1	NP_443123.1	Q96LB9	PGRP3_HUMAN	peptidoglycan recognition protein 3	46					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(1)|liver(1)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	28	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTGTGATGATGTAGGCCACAG	0.622																																					p.Y46X		Atlas-SNP	.											.	PGLYRP3	55	.	0			c.C138G						PASS	.						53.0	47.0	49.0					1																	153279661		2203	4300	6503	SO:0001587	stop_gained	114771	exon2			GATGATGTAGGCC	AY035376	CCDS1035.1	1q21	2008-02-05			ENSG00000159527	ENSG00000159527			30014	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein I alpha precursor"""	608197				11461926	Standard	NM_052891		Approved	PGRPIA, PGLYRPIalpha, PGRP-Ialpha	uc001fbn.1	Q96LB9	OTTHUMG00000014044	ENST00000290722.1:c.138C>G	chr1.hg19:g.153279661G>C	ENSP00000290722:p.Tyr46*	42.0	0.0	.		74.0	23.0	.	NM_052891	A1A4U8|Q5SY65	Nonsense_Mutation	SNP	ENST00000290722.1	hg19	CCDS1035.1	.	.	.	.	.	.	.	.	.	.	G	14.60	2.582950	0.46006	.	.	ENSG00000159527	ENST00000290722	.	.	.	4.06	-2.35	0.06684	.	0.381500	0.19389	N	0.115444	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.6165	8.7113	0.34385	0.4751:0.0:0.5249:0.0	.	.	.	.	X	46	.	ENSP00000290722:Y46X	Y	-	3	2	PGLYRP3	151546285	0.000000	0.05858	0.045000	0.18777	0.020000	0.10135	-0.301000	0.08232	-0.603000	0.05767	-0.137000	0.14449	TAC	.	.	.	none		0.622	PGLYRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039488.1	NM_052891	
CAPN13	92291	hgsc.bcm.edu	37	2	30955349	30955349	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr2:30955349A>T	ENST00000295055.8	-	20	2058	c.1882T>A	c.(1882-1884)Ttc>Atc	p.F628I	CAPN13_ENST00000534090.2_Missense_Mutation_p.F628I	NM_144575.2	NP_653176.2	Q6MZZ7	CAN13_HUMAN	calpain 13	628					proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(1)	30	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.155)					AGGCTGGGGAAGCTGACCCTG	0.597																																					p.F628I		Atlas-SNP	.											.	CAPN13	70	.	0			c.T1882A						PASS	.						27.0	31.0	30.0					2																	30955349		2106	4221	6327	SO:0001583	missense	92291	exon20			TGGGGAAGCTGAC		CCDS46252.1	2p22-p21	2008-02-05			ENSG00000162949	ENSG00000162949			16663	protein-coding gene	gene with protein product		610228				11675017	Standard	NM_144575		Approved	FLJ23523	uc021vfm.1	Q6MZZ7	OTTHUMG00000152053	ENST00000295055.8:c.1882T>A	chr2.hg19:g.30955349A>T	ENSP00000295055:p.Phe628Ile	33.0	0.0	.		52.0	13.0	.	NM_144575	Q17RF0|Q580X1|Q8TE80	Missense_Mutation	SNP	ENST00000295055.8	hg19	CCDS46252.1	.	.	.	.	.	.	.	.	.	.	a	26.8	4.772877	0.90108	.	.	ENSG00000162949	ENST00000295055;ENST00000534090	T;T	0.35789	1.29;1.29	5.5	5.5	0.81552	EF-hand-like domain (1);	0.051382	0.85682	D	0.000000	T	0.63414	0.2509	M	0.87038	2.855	0.43787	D	0.996328	D	0.89917	1.0	D	0.68621	0.959	T	0.70539	-0.4844	10	0.87932	D	0	.	13.1283	0.59368	1.0:0.0:0.0:0.0	.	628	Q6MZZ7	CAN13_HUMAN	I	628	ENSP00000295055:F628I;ENSP00000431298:F628I	ENSP00000295055:F628I	F	-	1	0	CAPN13	30808853	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.047000	0.64232	2.094000	0.63399	0.529000	0.55759	TTC	.	.	.	none		0.597	CAPN13-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325101.2	NM_144575	
TRAK2	66008	hgsc.bcm.edu	37	2	202262967	202262967	+	Silent	SNP	G	G	A	rs201579398		TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr2:202262967G>A	ENST00000332624.3	-	6	1019	c.591C>T	c.(589-591)ttC>ttT	p.F197F	TRAK2_ENST00000430254.1_Silent_p.F197F	NM_015049.2	NP_055864.2	O60296	TRAK2_HUMAN	trafficking protein, kinesin binding 2	197	HAP1 N-terminal.				protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|endosome (GO:0005768)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GABA receptor binding (GO:0050811)|receptor binding (GO:0005102)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	23						AGGACTCATTGAACCGAAGAG	0.438																																					p.F197F		Atlas-SNP	.											.	TRAK2	62	.	0			c.C591T						PASS	.	G		0,4406		0,0,2203	128.0	123.0	125.0		591	4.9	1.0	2		125	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	TRAK2	NM_015049.2		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		197/915	202262967	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	66008	exon6			CTCATTGAACCGA	AB038951	CCDS2347.1	2q33.1	2012-03-05	2005-12-13	2005-12-13	ENSG00000115993	ENSG00000115993			13206	protein-coding gene	gene with protein product	"""gamma-aminobutyric acid(A) receptor-interacting factor"", ""milton homolog 2 (Drosophila)"", ""O-linked N-acetylglucosamine transferase interacting protein 98"""	607334	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 3"""	ALS2CR3		11161814, 16380713, 20230862	Standard	NM_015049		Approved	CALS-C, KIAA0549, GRIF-1, OIP98, MILT2	uc002uyb.4	O60296	OTTHUMG00000132822	ENST00000332624.3:c.591C>T	chr2.hg19:g.202262967G>A		230.0	0.0	.		17.0	9.0	.	NM_015049	E7EV21|Q8WVH7|Q96NS2|Q9C0K5|Q9C0K6	Silent	SNP	ENST00000332624.3	hg19	CCDS2347.1																																																																																			.	G|0.999;A|0.001	0.001	weak		0.438	TRAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256284.3	NM_015049	
SP140	11262	hgsc.bcm.edu	37	2	231177371	231177371	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr2:231177371C>T	ENST00000392045.3	+	27	2690	c.2576C>T	c.(2575-2577)gCt>gTt	p.A859V	SP140_ENST00000417495.3_Missense_Mutation_p.A745V|SP140_ENST00000420434.3_Missense_Mutation_p.A832V|SP140_ENST00000343805.6_Missense_Mutation_p.A799V|SP140_ENST00000486687.2_Intron|SP140_ENST00000350136.5_Missense_Mutation_p.A728V	NM_007237.4	NP_009168.4	Q13342	SP140_HUMAN	SP140 nuclear body protein	859					defense response (GO:0006952)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		GAAGTGTTTGCTATTCAGGAA	0.393																																					p.A859V		Atlas-SNP	.											.	SP140	121	.	0			c.C2576T						PASS	.						157.0	145.0	149.0					2																	231177371		1872	4114	5986	SO:0001583	missense	11262	exon27			TGTTTGCTATTCA	U63420	CCDS33392.1, CCDS42831.1, CCDS63149.1, CCDS63150.1, CCDS63151.1	2q37.1	2013-01-28			ENSG00000079263	ENSG00000079263		"""Zinc fingers, PHD-type"""	17133	protein-coding gene	gene with protein product		608602				8695863, 8910577, 12368356	Standard	NM_001005176		Approved	LYSP100-B, LYSP100-A	uc002vql.3	Q13342	OTTHUMG00000153670	ENST00000392045.3:c.2576C>T	chr2.hg19:g.231177371C>T	ENSP00000375899:p.Ala859Val	232.0	0.0	.		152.0	46.0	.	NM_007237	E7ESH9|E7EUR5|E9PFJ6|Q0VGE5|Q13341|Q3KR17|Q4ZG66|Q53TG1|Q6NSG4|Q92881|Q96TG3	Missense_Mutation	SNP	ENST00000392045.3	hg19	CCDS42831.1	.	.	.	.	.	.	.	.	.	.	C	17.17	3.321189	0.60634	.	.	ENSG00000079263	ENST00000350136;ENST00000392045;ENST00000417495;ENST00000343805;ENST00000420434	T;T;T;T	0.45668	0.89;0.89;0.89;0.89	3.48	2.5	0.30297	Bromodomain (3);	.	.	.	.	T	0.57562	0.2062	M	0.68952	2.095	0.23645	N	0.997215	D;P;D;D	0.64830	0.993;0.956;0.992;0.994	D;B;P;P	0.72625	0.978;0.39;0.708;0.663	T	0.38499	-0.9658	9	0.87932	D	0	-5.2094	7.4406	0.27181	0.2583:0.7417:0.0:0.0	.	832;745;799;859	E7EUR5;E7ESH9;E9PFJ6;Q13342	.;.;.;LY10_HUMAN	V	728;859;745;799;832	ENSP00000345846:A728V;ENSP00000375899:A859V;ENSP00000342096:A799V;ENSP00000398210:A832V	ENSP00000342096:A799V	A	+	2	0	SP140	230885615	0.425000	0.25498	0.936000	0.37596	0.918000	0.54935	0.202000	0.17295	1.966000	0.57179	0.462000	0.41574	GCT	.	.	.	none		0.393	SP140-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000332015.1	NM_007237	
IFT57	55081	hgsc.bcm.edu	37	3	107937434	107937434	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr3:107937434G>C	ENST00000264538.3	-	3	689	c.442C>G	c.(442-444)Ctt>Gtt	p.L148V		NM_018010.3	NP_060480.1	Q9NWB7	IFT57_HUMAN	intraflagellar transport 57	148					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cilium assembly (GO:0042384)|heart looping (GO:0001947)|intraciliary transport (GO:0042073)|left/right pattern formation (GO:0060972)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube closure (GO:0001843)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|dendrite terminus (GO:0044292)|Golgi apparatus (GO:0005794)|intraciliary transport particle B (GO:0030992)|photoreceptor connecting cilium (GO:0032391)	DNA binding (GO:0003677)			kidney(1)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	14			OV - Ovarian serous cystadenocarcinoma(3;0.0428)|Epithelial(53;0.246)			AAGCAATCAAGAACATAGCAT	0.343																																					p.L148V		Atlas-SNP	.											.	IFT57	44	.	0			c.C442G						PASS	.						73.0	74.0	73.0					3																	107937434		2203	4299	6502	SO:0001583	missense	55081	exon3			AATCAAGAACATA	AK001009	CCDS2951.1	3q13.13	2014-07-03	2014-07-03	2005-11-02	ENSG00000114446	ENSG00000114446		"""Intraflagellar transport homologs"""	17367	protein-coding gene	gene with protein product		606621	"""estrogen-related receptor beta like 1"", ""intraflagellar transport 57 homolog (Chlamydomonas)"""	ESRRBL1			Standard	NM_018010		Approved	FLJ10147, HIPPI, MHS4R2	uc003dwx.4	Q9NWB7	OTTHUMG00000159223	ENST00000264538.3:c.442C>G	chr3.hg19:g.107937434G>C	ENSP00000264538:p.Leu148Val	200.0	0.0	.		47.0	7.0	.	NM_018010	Q96DA9	Missense_Mutation	SNP	ENST00000264538.3	hg19	CCDS2951.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.034317	0.75617	.	.	ENSG00000114446	ENST00000264538	.	.	.	5.99	5.12	0.69794	.	0.000000	0.85682	D	0.000000	D	0.84584	0.5504	M	0.90977	3.165	0.80722	D	1	D	0.76494	0.999	D	0.71656	0.974	D	0.87397	0.2367	9	0.51188	T	0.08	.	15.0869	0.72162	0.0674:0.0:0.9326:0.0	.	148	Q9NWB7	IFT57_HUMAN	V	148	.	ENSP00000264538:L148V	L	-	1	0	IFT57	109420124	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.875000	0.69660	1.540000	0.49301	0.655000	0.94253	CTT	.	.	.	none		0.343	IFT57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353918.1	NM_018010	
PVRL3	25945	hgsc.bcm.edu	37	3	110852638	110852638	+	Missense_Mutation	SNP	T	T	G	rs537220727		TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr3:110852638T>G	ENST00000485303.1	+	6	1501	c.1226T>G	c.(1225-1227)gTa>gGa	p.V409G	PVRL3_ENST00000493615.1_Intron|PVRL3_ENST00000319792.3_3'UTR	NM_001243286.1|NM_015480.2	NP_001230215.1|NP_056295.1	Q9NQS3	PVRL3_HUMAN	poliovirus receptor-related 3	409					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|fertilization (GO:0009566)|homophilic cell adhesion (GO:0007156)|lens morphogenesis in camera-type eye (GO:0002089)|retina morphogenesis in camera-type eye (GO:0060042)|single organismal cell-cell adhesion (GO:0016337)	apical junction complex (GO:0043296)|cell-cell adherens junction (GO:0005913)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	cell adhesion molecule binding (GO:0050839)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(3)	19						ATTGCTAGTGTAGTGGGTGGG	0.438																																					p.V409G		Atlas-SNP	.											PVRL3,colon,carcinoma,0,1	PVRL3	78	.	0			c.T1226G						PASS	.						174.0	171.0	172.0					3																	110852638		2203	4300	6503	SO:0001583	missense	25945	exon6			CTAGTGTAGTGGG	AF282874	CCDS2957.1, CCDS58842.1, CCDS58843.1	3q13	2013-01-29			ENSG00000177707	ENSG00000177707		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17664	protein-coding gene	gene with protein product		607147				11024295	Standard	NM_015480		Approved	nectin-3, PPR3, PVRR3, DKFZP566B0846, CDw113, CD113	uc003dxt.2	Q9NQS3	OTTHUMG00000159239	ENST00000485303.1:c.1226T>G	chr3.hg19:g.110852638T>G	ENSP00000418070:p.Val409Gly	354.0	1.0	.		38.0	3.0	.	NM_015480	E9PFR0|Q6NVZ3|Q8NC05|Q8WVU4|Q9BVA9|Q9Y412	Missense_Mutation	SNP	ENST00000485303.1	hg19	CCDS2957.1	.	.	.	.	.	.	.	.	.	.	T	10.21	1.287793	0.23478	.	.	ENSG00000177707	ENST00000485303	T	0.19532	2.14	5.76	4.63	0.57726	Cytochrome c1, transmembrane anchor, C-terminal (1);	0.108700	0.64402	D	0.000009	T	0.15522	0.0374	L	0.38175	1.15	0.80722	D	1	B	0.27229	0.172	B	0.22386	0.039	T	0.05632	-1.0873	10	0.87932	D	0	.	7.2403	0.26092	0.0:0.1282:0.0:0.8717	.	409	Q9NQS3	PVRL3_HUMAN	G	409	ENSP00000418070:V409G	ENSP00000418070:V409G	V	+	2	0	PVRL3	112335328	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.306000	0.51881	2.206000	0.71126	0.383000	0.25322	GTA	.	.	.	none		0.438	PVRL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354045.1	NM_015480	
RARRES1	5918	hgsc.bcm.edu	37	3	158422600	158422600	+	Missense_Mutation	SNP	G	G	C	rs140091959		TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr3:158422600G>C	ENST00000237696.5	-	4	932	c.652C>G	c.(652-654)Ctc>Gtc	p.L218V	RARRES1_ENST00000498640.1_5'UTR|RARRES1_ENST00000479756.1_Missense_Mutation_p.L218V	NM_206963.1	NP_996846.1	P49788	TIG1_HUMAN	retinoic acid receptor responder (tazarotene induced) 1	218					negative regulation of cell proliferation (GO:0008285)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(1)|ovary(1)	9			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)		Tretinoin(DB00755)	ACACTAGTGAGCTGTGCCAAG	0.443																																					p.L218V		Atlas-SNP	.											.	RARRES1	22	.	0			c.C652G						PASS	.						114.0	102.0	106.0					3																	158422600		2203	4300	6503	SO:0001583	missense	5918	exon4			TAGTGAGCTGTGC	U27185	CCDS3184.1, CCDS54665.1	3q25.32	2013-07-29			ENSG00000118849	ENSG00000118849			9867	protein-coding gene	gene with protein product	"""latexin-like"""	605090				8601727, 9270552	Standard	NM_002888		Approved	TIG1, LXNL	uc003fci.3	P49788	OTTHUMG00000158834	ENST00000237696.5:c.652C>G	chr3.hg19:g.158422600G>C	ENSP00000237696:p.Leu218Val	94.0	0.0	.		44.0	11.0	.	NM_206963	Q8N1D7	Missense_Mutation	SNP	ENST00000237696.5	hg19	CCDS3184.1	.	.	.	.	.	.	.	.	.	.	-	6.185	0.402312	0.11696	.	.	ENSG00000118849	ENST00000237696;ENST00000479756	T;T	0.26660	1.72;1.72	5.2	2.23	0.28157	.	0.201181	0.42821	D	0.000657	T	0.17408	0.0418	L	0.33485	1.01	0.23969	N	0.996317	B;B	0.29136	0.234;0.036	B;B	0.32289	0.143;0.021	T	0.19484	-1.0304	10	0.23891	T	0.37	.	8.0807	0.30744	0.0:0.1549:0.525:0.3201	.	218;218	P49788-2;P49788	.;TIG1_HUMAN	V	218	ENSP00000237696:L218V;ENSP00000418556:L218V	ENSP00000237696:L218V	L	-	1	0	RARRES1	159905294	0.982000	0.34865	0.467000	0.27180	0.899000	0.52679	0.162000	0.16501	0.572000	0.29383	0.387000	0.25754	CTC	.	G|0.999;A|0.001	.	alt		0.443	RARRES1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352358.1		
EVC	2121	hgsc.bcm.edu	37	4	5721079	5721079	+	Silent	SNP	G	G	A	rs373072919		TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr4:5721079G>A	ENST00000264956.6	+	2	463	c.279G>A	c.(277-279)tcG>tcA	p.S93S	EVC_ENST00000509451.1_Silent_p.S93S|EVC_ENST00000382674.2_Silent_p.S93S	NM_153717.2	NP_714928.1	P57679	EVC_HUMAN	Ellis van Creveld syndrome	93					cartilage development (GO:0051216)|endochondral bone growth (GO:0003416)|muscle organ development (GO:0007517)|positive regulation of smoothened signaling pathway (GO:0045880)|skeletal system development (GO:0001501)|smoothened signaling pathway (GO:0007224)	ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|stomach(1)	28		Myeloproliferative disorder(84;0.117)				TGCAGATGTCGAAGGACAAGG	0.512																																					p.S93S		Atlas-SNP	.											.	EVC	90	.	0			c.G279A						PASS	.	G		0,4406		0,0,2203	251.0	241.0	245.0		279	-5.8	0.0	4		245	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	EVC	NM_153717.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		93/993	5721079	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	2121	exon2			GATGTCGAAGGAC	AF216184	CCDS3383.1	4p16	2008-07-03			ENSG00000072840	ENSG00000072840			3497	protein-coding gene	gene with protein product		604831				10700184	Standard	NM_153717		Approved	DWF-1	uc003gil.1	P57679	OTTHUMG00000090427	ENST00000264956.6:c.279G>A	chr4.hg19:g.5721079G>A		266.0	0.0	.		431.0	178.0	.	NM_153717		Silent	SNP	ENST00000264956.6	hg19	CCDS3383.1																																																																																			.	.	.	weak		0.512	EVC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206859.1		
KCTD8	386617	hgsc.bcm.edu	37	4	44449785	44449785	+	Silent	SNP	G	G	A			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr4:44449785G>A	ENST00000360029.3	-	1	1039	c.756C>T	c.(754-756)ctC>ctT	p.L252L	AC131951.1_ENST00000584757.1_RNA	NM_198353.2	NP_938167.1	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerization domain containing 8	252					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)				central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(3)|upper_aerodigestive_tract(4)	41						GGCTCTCGTTGAGCGTGTCCC	0.657										HNSCC(17;0.042)																											p.L252L		Atlas-SNP	.											.	KCTD8	96	.	0			c.C756T						PASS	.						40.0	34.0	36.0					4																	44449785		2203	4300	6503	SO:0001819	synonymous_variant	386617	exon1			CTCGTTGAGCGTG	AK123347	CCDS3467.1	4p13	2013-06-20	2013-06-20		ENSG00000183783	ENSG00000183783			22394	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 8"""				Standard	NM_198353		Approved		uc003gwu.3	Q6ZWB6	OTTHUMG00000099409	ENST00000360029.3:c.756C>T	chr4.hg19:g.44449785G>A		59.0	0.0	.		126.0	51.0	.	NM_198353	A2RU39	Silent	SNP	ENST00000360029.3	hg19	CCDS3467.1																																																																																			.	.	.	none		0.657	KCTD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216868.1		
LNX1	84708	hgsc.bcm.edu	37	4	54343092	54343092	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr4:54343092C>T	ENST00000263925.7	-	9	2034	c.1720G>A	c.(1720-1722)Gca>Aca	p.A574T	LNX1_ENST00000306888.2_Missense_Mutation_p.A478T|FIP1L1_ENST00000507166.1_Intron	NM_001126328.2	NP_001119800.1	Q8TBB1	LNX1_HUMAN	ligand of numb-protein X 1, E3 ubiquitin protein ligase	574	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				protein homooligomerization (GO:0051260)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|endometrium(3)|large_intestine(11)|lung(6)|ovary(3)|urinary_tract(4)	32	all_neural(26;0.153)		GBM - Glioblastoma multiforme(3;8.2e-46)|LUSC - Lung squamous cell carcinoma(32;0.0134)			AATGCCACTGCCTCACTCCGG	0.488																																					p.A574T		Atlas-SNP	.											.	LNX1	139	.	0			c.G1720A						PASS	.						166.0	166.0	166.0					4																	54343092		2203	4300	6503	SO:0001583	missense	84708	exon9			CCACTGCCTCACT	AF237782	CCDS3492.1, CCDS47057.1	4q12	2013-01-09	2012-02-23	2005-11-04	ENSG00000072201	ENSG00000072201		"""RING-type (C3HC4) zinc fingers"""	6657	protein-coding gene	gene with protein product		609732	"""ligand of numb-protein X"", ""ligand of numb-protein X 1"""	LNX		11521506, 11782429	Standard	NM_032622		Approved	MPDZ, PDZRN2	uc003hag.5	Q8TBB1	OTTHUMG00000102099	ENST00000263925.7:c.1720G>A	chr4.hg19:g.54343092C>T	ENSP00000263925:p.Ala574Thr	308.0	0.0	.		274.0	46.0	.	NM_001126328	Q4W5K7|Q8N4C2|Q96MJ7|Q9BY20	Missense_Mutation	SNP	ENST00000263925.7	hg19	CCDS47057.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.304671	0.81136	.	.	ENSG00000072201	ENST00000306888;ENST00000538207;ENST00000263925	T;T	0.51574	0.7;0.7	5.16	5.16	0.70880	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.76435	0.3987	M	0.91510	3.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.82024	-0.0662	10	0.87932	D	0	.	18.8374	0.92168	0.0:1.0:0.0:0.0	.	574;478	Q8TBB1;Q8TBB1-2	LNX1_HUMAN;.	T	478;412;574	ENSP00000302879:A478T;ENSP00000263925:A574T	ENSP00000263925:A574T	A	-	1	0	LNX1	54037849	1.000000	0.71417	0.998000	0.56505	0.311000	0.27955	6.748000	0.74877	2.687000	0.91594	0.561000	0.74099	GCA	.	.	.	none		0.488	LNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219934.2		
AGPAT9	84803	hgsc.bcm.edu	37	4	84457815	84457815	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr4:84457815T>C	ENST00000395226.2	+	2	258	c.40T>C	c.(40-42)Tgg>Cgg	p.W14R	AGPAT9_ENST00000264409.4_Missense_Mutation_p.W14R	NM_001256421.1	NP_001243350.1	Q53EU6	GPAT3_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 9	14					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|regulation of TOR signaling (GO:0032006)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)|glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|skin(3)	13		Hepatocellular(203;0.114)				CCTTTCCACCTGGCTGACGCT	0.582																																					p.W14R		Atlas-SNP	.											.	AGPAT9	41	.	0			c.T40C						PASS	.						88.0	69.0	75.0					4																	84457815		2203	4300	6503	SO:0001583	missense	84803	exon2			TCCACCTGGCTGA	AK055749	CCDS3606.1	4q21.23	2014-02-13	2008-01-29		ENSG00000138678	ENSG00000138678	2.3.1.15	"""1-acylglycerol-3-phosphate O-acyltransferases"""	28157	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, theta"""	610958	"""1-acylglycerol-3-phosphate O-acyltransferase 9 (lysophosphatidic acid acyltransferase, theta)"""			12975309	Standard	NM_001256421		Approved	MGC11324, LPAAT-theta, MAG1, HMFN0839	uc003how.4	Q53EU6	OTTHUMG00000130431	ENST00000395226.2:c.40T>C	chr4.hg19:g.84457815T>C	ENSP00000378651:p.Trp14Arg	80.0	0.0	.		214.0	44.0	.	NM_001256421	Q68CJ4|Q6GPI6|Q96NA3	Missense_Mutation	SNP	ENST00000395226.2	hg19	CCDS3606.1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.459554	0.84317	.	.	ENSG00000138678	ENST00000395226;ENST00000264409	T;T	0.48201	0.82;0.82	4.68	4.68	0.58851	.	0.000000	0.85682	D	0.000000	T	0.64405	0.2595	M	0.86028	2.79	0.47374	D	0.999407	D	0.58970	0.984	P	0.54372	0.75	T	0.71341	-0.4622	10	0.59425	D	0.04	-8.2831	13.1799	0.59649	0.0:0.0:0.0:1.0	.	14	Q53EU6	GPAT3_HUMAN	R	14	ENSP00000378651:W14R;ENSP00000264409:W14R	ENSP00000264409:W14R	W	+	1	0	AGPAT9	84676839	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	3.587000	0.53957	1.760000	0.52011	0.374000	0.22700	TGG	.	.	.	none		0.582	AGPAT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252821.3	NM_032717	
SEMA5A	9037	hgsc.bcm.edu	37	5	9119220	9119220	+	Silent	SNP	A	A	T			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr5:9119220A>T	ENST00000382496.5	-	15	2480	c.1815T>A	c.(1813-1815)tcT>tcA	p.S605S		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	605	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)			biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						TGCTGCAGGGAGACCACGAGG	0.652																																					p.S605S		Atlas-SNP	.											.	SEMA5A	236	.	0			c.T1815A						PASS	.						57.0	51.0	53.0					5																	9119220		2203	4300	6503	SO:0001819	synonymous_variant	9037	exon15			GCAGGGAGACCAC	U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.1815T>A	chr5.hg19:g.9119220A>T		38.0	0.0	.		79.0	20.0	.	NM_003966	D3DTC6|O60408|Q1RLL9	Silent	SNP	ENST00000382496.5	hg19	CCDS3875.1																																																																																			.	.	.	none		0.652	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206989.2		
RAI14	26064	hgsc.bcm.edu	37	5	34757668	34757668	+	Silent	SNP	C	C	T			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr5:34757668C>T	ENST00000265109.3	+	3	419	c.132C>T	c.(130-132)gcC>gcT	p.A44A	RAI14_ENST00000503673.1_Silent_p.A44A|RAI14_ENST00000515799.1_Silent_p.A47A|RAI14_ENST00000512629.1_Silent_p.A44A|RAI14_ENST00000506376.1_Silent_p.A36A|RAI14_ENST00000428746.2_Silent_p.A44A|RAI14_ENST00000397449.1_Silent_p.A37A|RAI14_ENST00000507276.1_3'UTR	NM_001145522.1|NM_015577.2	NP_001138994.1|NP_056392.2	Q9P0K7	RAI14_HUMAN	retinoic acid induced 14	44			A -> T (in dbSNP:rs17521570).			actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(19)|lung(22)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(31;0.000191)					AGAAGGGGGCCAGTGCCACCA	0.542																																					p.A47A		Atlas-SNP	.											.	RAI14	100	.	0			c.C141T						PASS	.						74.0	71.0	72.0					5																	34757668		2203	4300	6503	SO:0001819	synonymous_variant	26064	exon5			GGGGGCCAGTGCC	AB037755	CCDS34142.1, CCDS54837.1, CCDS54838.1, CCDS54839.1	5p13.3-p13.2	2013-01-10			ENSG00000039560	ENSG00000039560		"""Ankyrin repeat domain containing"""	14873	protein-coding gene	gene with protein product	"""novel retinal pigment epithelial"""	606586				11042181	Standard	NM_015577		Approved	NORPEG, KIAA1334, RAI13, DKFZp564G013	uc011coj.2	Q9P0K7	OTTHUMG00000162019	ENST00000265109.3:c.132C>T	chr5.hg19:g.34757668C>T		137.0	0.0	.		155.0	28.0	.	NM_001145525	E9PED3|Q6V1W9|Q7Z5I4|Q7Z733|Q9P2L2|Q9Y3T5	Silent	SNP	ENST00000265109.3	hg19	CCDS34142.1																																																																																			.	.	.	none		0.542	RAI14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366786.1	NM_015577	
PARP8	79668	hgsc.bcm.edu	37	5	50123848	50123848	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr5:50123848T>A	ENST00000281631.5	+	20	2206	c.2048T>A	c.(2047-2049)tTt>tAt	p.F683Y	PARP8_ENST00000505697.2_Missense_Mutation_p.F683Y|PARP8_ENST00000514067.2_Missense_Mutation_p.F641Y|PARP8_ENST00000505554.1_Missense_Mutation_p.F662Y|PARP8_ENST00000511363.2_3'UTR|PARP8_ENST00000514342.2_Missense_Mutation_p.F394Y|PARP8_ENST00000503750.2_Missense_Mutation_p.F641Y	NM_001178056.1|NM_024615.3	NP_001171527.1|NP_078891.2	Q8N3A8	PARP8_HUMAN	poly (ADP-ribose) polymerase family, member 8	683	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.					intracellular (GO:0005622)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Lung NSC(810;0.0305)|Breast(144;0.222)				GAATCCAATTTTAGAGCTGCT	0.383																																					p.F683Y		Atlas-SNP	.											.	PARP8	93	.	0			c.T2048A						PASS	.						127.0	124.0	125.0					5																	50123848		2203	4300	6503	SO:0001583	missense	79668	exon21			CCAATTTTAGAGC	AL834477	CCDS3954.1, CCDS54849.1	5q11.2	2010-02-16			ENSG00000151883	ENSG00000151883		"""Poly (ADP-ribose) polymerases"""	26124	protein-coding gene	gene with protein product						15273990	Standard	NM_001178055		Approved	FLJ21308, pART16	uc003joo.3	Q8N3A8	OTTHUMG00000096969	ENST00000281631.5:c.2048T>A	chr5.hg19:g.50123848T>A	ENSP00000281631:p.Phe683Tyr	217.0	0.0	.		125.0	41.0	.	NM_001178055	Q3KRB7|Q6DHZ1|Q9H754	Missense_Mutation	SNP	ENST00000281631.5	hg19	CCDS3954.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.379826	0.82682	.	.	ENSG00000151883	ENST00000505697;ENST00000503750;ENST00000514342;ENST00000281631;ENST00000514067;ENST00000505554;ENST00000503561;ENST00000423185	T;T;T;T;T;T	0.18502	2.21;2.21;2.21;2.21;2.21;2.21	5.7	5.7	0.88788	Poly(ADP-ribose) polymerase, catalytic domain (2);	0.059647	0.64402	D	0.000002	T	0.34193	0.0889	L	0.48935	1.535	0.54753	D	0.99998	D;P;P	0.53619	0.961;0.954;0.891	P;D;P	0.66351	0.492;0.943;0.492	T	0.01382	-1.1369	9	.	.	.	-16.5844	15.9599	0.79923	0.0:0.0:0.0:1.0	.	575;641;683	B4DQ81;Q8N3A8-2;Q8N3A8	.;.;PARP8_HUMAN	Y	683;641;394;683;641;662;394;394	ENSP00000422217:F683Y;ENSP00000440851:F641Y;ENSP00000439022:F394Y;ENSP00000281631:F683Y;ENSP00000424814:F641Y;ENSP00000423946:F662Y	.	F	+	2	0	PARP8	50159605	1.000000	0.71417	0.997000	0.53966	0.999000	0.98932	8.036000	0.88901	2.153000	0.67306	0.533000	0.62120	TTT	.	.	.	none		0.383	PARP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214035.3	NM_024615	
NR2F1	7025	hgsc.bcm.edu	37	5	92929424	92929424	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr5:92929424C>A	ENST00000327111.3	+	3	2835	c.1148C>A	c.(1147-1149)tCc>tAc	p.S383Y	NR2F1_ENST00000506162.1_3'UTR	NM_005654.4	NP_005645.1	P10589	COT1_HUMAN	nuclear receptor subfamily 2, group F, member 1	383					cerebral cortex regionalization (GO:0021796)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of neuron projection development (GO:0010977)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|retinoic acid-responsive element binding (GO:0044323)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(4)|large_intestine(6)|lung(2)|ovary(3)|prostate(1)|skin(1)|urinary_tract(2)	21		all_cancers(142;1.62e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0416)|all cancers(79;9.57e-18)		GTGTCCTCCTCCGTCATCGAG	0.582																																					p.S383Y		Atlas-SNP	.											.	NR2F1	56	.	0			c.C1148A						PASS	.						123.0	118.0	120.0					5																	92929424		2203	4300	6503	SO:0001583	missense	7025	exon3			CCTCCTCCGTCAT	BC004154	CCDS4068.1	5q14	2013-01-16			ENSG00000175745	ENSG00000175745		"""Nuclear hormone receptors"""	7975	protein-coding gene	gene with protein product		132890		ERBAL3, TFCOUP1		8530078	Standard	NM_005654		Approved	EAR-3, COUP-TFI, TCFCOUP1, SVP44	uc003kkj.3	P10589	OTTHUMG00000119079	ENST00000327111.3:c.1148C>A	chr5.hg19:g.92929424C>A	ENSP00000325819:p.Ser383Tyr	292.0	0.0	.		414.0	121.0	.	NM_005654		Missense_Mutation	SNP	ENST00000327111.3	hg19	CCDS4068.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.607237	0.87157	.	.	ENSG00000175745	ENST00000327111	D	0.96856	-4.15	6.17	6.17	0.99709	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (1);	0.000000	0.85682	D	0.000000	D	0.96482	0.8852	L	0.52206	1.635	0.80722	D	1	P	0.48294	0.908	P	0.50490	0.642	D	0.96365	0.9269	10	0.87932	D	0	.	20.4898	0.99202	0.0:1.0:0.0:0.0	.	383	P10589	COT1_HUMAN	Y	383	ENSP00000325819:S383Y	ENSP00000325819:S383Y	S	+	2	0	NR2F1	92955180	1.000000	0.71417	0.974000	0.42286	0.983000	0.72400	6.074000	0.71253	2.941000	0.99782	0.655000	0.94253	TCC	.	.	.	none		0.582	NR2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239293.2	NM_005654	
POU5F2	134187	hgsc.bcm.edu	37	5	93076682	93076682	+	Silent	SNP	A	A	T			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr5:93076682A>T	ENST00000510627.4	-	1	661	c.588T>A	c.(586-588)ctT>ctA	p.L196L	FAM172A_ENST00000395965.3_Intron|FAM172A_ENST00000505869.1_Intron|POU5F2_ENST00000606183.1_5'UTR|FAM172A_ENST00000509163.1_Intron|FAM172A_ENST00000509739.1_Intron|RP11-185E12.2_ENST00000606528.1_RNA	NM_153216.1	NP_694948.1	Q8N7G0	PO5F2_HUMAN	POU domain class 5, transcription factor 2	196					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)						all_cancers(142;3.87e-05)|all_epithelial(76;4.59e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0415)|all cancers(79;2.03e-19)		ATAAGCCCAGAAGGTTCTCTG	0.542																																					p.L196L		Atlas-SNP	.											.	POU5F2	10	.	0			c.T588A						PASS	.						107.0	107.0	107.0					5																	93076682		2115	4250	6365	SO:0001819	synonymous_variant	134187	exon1			GCCCAGAAGGTTC		CCDS59489.1	5q15	2011-06-20				ENSG00000248483		"""Homeoboxes / POU class"""	26367	protein-coding gene	gene with protein product						7908264	Standard	NM_153216		Approved	SPRM-1, FLJ25680	uc003kkl.1	Q8N7G0		ENST00000510627.4:c.588T>A	chr5.hg19:g.93076682A>T		166.0	0.0	.		208.0	66.0	.	NM_153216	Q15169|Q6MZL7|Q8N748	Silent	SNP	ENST00000510627.4	hg19	CCDS59489.1																																																																																			.	.	.	none		0.542	POU5F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369873.5	NM_153216	
FNIP1	96459	hgsc.bcm.edu	37	5	131042155	131042155	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr5:131042155C>A	ENST00000510461.1	-	9	958	c.863G>T	c.(862-864)cGt>cTt	p.R288L	FNIP1_ENST00000511848.1_Missense_Mutation_p.R288L|CTC-432M15.3_ENST00000514667.1_Intron|FNIP1_ENST00000307968.7_Missense_Mutation_p.R260L|FNIP1_ENST00000307954.8_Missense_Mutation_p.R243L	NM_133372.2	NP_588613	Q8TF40	FNIP1_HUMAN	folliculin interacting protein 1	288					cellular response to starvation (GO:0009267)|immature B cell differentiation (GO:0002327)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell apoptotic process (GO:0002904)|positive regulation of GTPase activity (GO:0043547)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|regulation of pro-B cell differentiation (GO:2000973)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34		all_cancers(142;0.00347)|Lung NSC(810;0.106)|all_lung(232;0.123)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0665)		GCGTCGCCAACGTCGCTGGTA	0.453																																					p.R288L		Atlas-SNP	.											.	FNIP1	104	.	0			c.G863T						PASS	.						100.0	93.0	96.0					5																	131042155		2203	4300	6503	SO:0001583	missense	96459	exon9			CGCCAACGTCGCT	DQ145719	CCDS34226.1, CCDS34227.1	5q23.3	2014-01-28				ENSG00000217128			29418	protein-coding gene	gene with protein product		610594				11853319, 17028174	Standard	NM_001008738		Approved	KIAA1961		Q8TF40		ENST00000510461.1:c.863G>T	chr5.hg19:g.131042155C>A	ENSP00000421985:p.Arg288Leu	201.0	0.0	.		68.0	15.0	.	NM_133372	D6RJH5|Q86T47|Q9BUT0	Missense_Mutation	SNP	ENST00000510461.1	hg19	CCDS34227.1	.	.	.	.	.	.	.	.	.	.	C	36	5.709610	0.96821	.	.	ENSG00000217128	ENST00000307968;ENST00000307954;ENST00000544351;ENST00000510461;ENST00000511848	T;T;T;T	0.47528	1.83;1.67;1.57;0.84	5.6	5.6	0.85130	.	.	.	.	.	T	0.73473	0.3591	M	0.83012	2.62	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;1.0;1.0	D;D;D;D	0.91635	0.998;0.994;0.998;0.999	T	0.76340	-0.2995	9	0.87932	D	0	-7.1358	19.9737	0.97296	0.0:1.0:0.0:0.0	.	288;288;260;288	A8K8V8;Q8TF40-2;Q8TF40-3;Q8TF40	.;.;.;FNIP1_HUMAN	L	260;243;48;288;288	ENSP00000309266:R260L;ENSP00000310453:R243L;ENSP00000421985:R288L;ENSP00000425619:R288L	ENSP00000310453:R243L	R	-	2	0	FNIP1	131070054	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	7.776000	0.85560	2.793000	0.96121	0.591000	0.81541	CGT	.	.	.	none		0.453	FNIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370077.1	NM_133372	
HLA-DQA2	3118	hgsc.bcm.edu	37	6	32713781	32713781	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr6:32713781C>T	ENST00000374940.3	+	3	647	c.545C>T	c.(544-546)tCt>tTt	p.S182F		NM_020056.4	NP_064440.1	P01906	DQA2_HUMAN	major histocompatibility complex, class II, DQ alpha 2	182	Alpha-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)			endometrium(2)|large_intestine(3)|lung(7)|skin(1)	13					"""""""Insulin(DB00071)"""	TTCCTCCCTTCTGCTGATGAG	0.502																																					p.S182F		Atlas-SNP	.											.	HLA-DQA2	27	.	0			c.C545T						PASS	.						191.0	211.0	204.0					6																	32713781		1511	2707	4218	SO:0001583	missense	3118	exon3			TCCCTTCTGCTGA		CCDS4753.1	6p21.3	2013-01-11			ENSG00000237541	ENSG00000237541		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4943	protein-coding gene	gene with protein product		613503		HLA-DXA			Standard	NM_020056		Approved		uc003obx.3	P01906	OTTHUMG00000031108	ENST00000374940.3:c.545C>T	chr6.hg19:g.32713781C>T	ENSP00000364076:p.Ser182Phe	417.0	1.0	.		286.0	92.0	.	NM_020056	A2BF37|B0V0E7|O19789|Q5SQ94|Q5SR04	Missense_Mutation	SNP	ENST00000374940.3	hg19	CCDS4753.1	.	.	.	.	.	.	.	.	.	.	.	13.77	2.336406	0.41398	.	.	ENSG00000237541	ENST00000374940	T	0.03152	4.03	3.06	2.06	0.26882	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.585185	0.16577	U	0.208364	T	0.10035	0.0246	M	0.89478	3.035	0.30030	N	0.813521	D	0.89917	1.0	D	0.97110	1.0	T	0.01553	-1.1326	10	0.66056	D	0.02	.	7.1176	0.25424	0.4092:0.5908:0.0:0.0	.	182	P01906	DQA2_HUMAN	F	182	ENSP00000364076:S182F	ENSP00000364076:S182F	S	+	2	0	HLA-DQA2	32821759	0.009000	0.17119	0.999000	0.59377	0.758000	0.43043	0.626000	0.24492	1.700000	0.51204	0.174000	0.16983	TCT	.	.	.	none		0.502	HLA-DQA2-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076179.2	NM_020056	
LEMD2	221496	hgsc.bcm.edu	37	6	33748926	33748926	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr6:33748926A>C	ENST00000293760.5	-	4	877	c.858T>G	c.(856-858)aaT>aaG	p.N286K	LEMD2_ENST00000508327.1_5'UTR|LEMD2_ENST00000502643.1_5'UTR	NM_181336.3	NP_851853.1	Q8NC56	LEMD2_HUMAN	LEM domain containing 2	286					negative regulation of MAPK cascade (GO:0043409)|skeletal muscle cell differentiation (GO:0035914)	integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|nuclear membrane (GO:0031965)				central_nervous_system(2)|endometrium(3)|large_intestine(1)|lung(2)|pancreas(1)	9						CACACTCAAAATTACCTAGGA	0.368																																					p.N286K		Atlas-SNP	.											.	LEMD2	20	.	0			c.T858G						PASS	.						74.0	68.0	70.0					6																	33748926		2203	4300	6503	SO:0001583	missense	221496	exon4			CTCAAAATTACCT		CCDS4785.1, CCDS47411.1	6p21.31	2009-11-06			ENSG00000161904	ENSG00000161904			21244	protein-coding gene	gene with protein product						12477932	Standard	NM_001143944		Approved	dJ482C21.1, NET25	uc011drm.2	Q8NC56	OTTHUMG00000014535	ENST00000293760.5:c.858T>G	chr6.hg19:g.33748926A>C	ENSP00000293760:p.Asn286Lys	115.0	0.0	.		152.0	49.0	.	NM_181336	B4DVH5|E7EVT2|Q5T972|Q5T974	Missense_Mutation	SNP	ENST00000293760.5	hg19	CCDS4785.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.71|19.71	3.877584|3.877584	0.72294|0.72294	.|.	.|.	ENSG00000161904|ENSG00000161904	ENST00000442696|ENST00000293760	.|.	.|.	.|.	5.65|5.65	3.27|3.27	0.37495|0.37495	.|Inner nuclear membrane protein MAN1 (1);	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.33876|0.33876	0.0878|0.0878	L|L	0.35414|0.35414	1.06|1.06	0.80722|0.80722	D|D	1|1	.|D	.|0.71674	.|0.998	.|D	.|0.64595	.|0.927	T|T	0.40664|0.40664	-0.9551|-0.9551	5|9	.|0.06099	.|T	.|0.92	-4.6423|-4.6423	8.5956|8.5956	0.33714|0.33714	0.8505:0.0:0.1495:0.0|0.8505:0.0:0.1495:0.0	.|.	.|286	.|Q8NC56	.|LEMD2_HUMAN	S|K	152|286	.|.	.|ENSP00000293760:N286K	I|N	-|-	2|3	0|2	LEMD2|LEMD2	33856904|33856904	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	2.063000|2.063000	0.41423|0.41423	0.432000|0.432000	0.26286|0.26286	0.533000|0.533000	0.62120|0.62120	ATT|AAT	.	.	.	none		0.368	LEMD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040209.3	XM_166338	
TTBK1	84630	hgsc.bcm.edu	37	6	43251695	43251695	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr6:43251695C>A	ENST00000259750.4	+	14	3300	c.3217C>A	c.(3217-3219)Ctg>Atg	p.L1073M		NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	1073					substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			CTCAGGCTCACTGTCGGCCAA	0.687																																					p.L1073M		Atlas-SNP	.											.	TTBK1	124	.	0			c.C3217A						PASS	.						18.0	19.0	18.0					6																	43251695		2183	4238	6421	SO:0001583	missense	84630	exon14			GGCTCACTGTCGG	AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.3217C>A	chr6.hg19:g.43251695C>A	ENSP00000259750:p.Leu1073Met	85.0	0.0	.		121.0	46.0	.	NM_032538	A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	Missense_Mutation	SNP	ENST00000259750.4	hg19	CCDS34455.1	.	.	.	.	.	.	.	.	.	.	C	12.46	1.945410	0.34377	.	.	ENSG00000146216	ENST00000259750	T	0.55413	0.52	5.02	3.14	0.36123	.	0.348022	0.23768	N	0.044741	T	0.27349	0.0671	L	0.36672	1.1	0.80722	D	1	B	0.19200	0.034	B	0.14023	0.01	T	0.30736	-0.9968	10	0.56958	D	0.05	.	11.2746	0.49159	0.1311:0.7259:0.143:0.0	.	1073	Q5TCY1	TTBK1_HUMAN	M	1073	ENSP00000259750:L1073M	ENSP00000259750:L1073M	L	+	1	2	TTBK1	43359673	0.733000	0.28132	0.999000	0.59377	0.950000	0.60333	1.377000	0.34317	2.326000	0.78906	0.455000	0.32223	CTG	.	.	.	none		0.687	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040584.3		
ROS1	6098	hgsc.bcm.edu	37	6	117746764	117746764	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr6:117746764C>G	ENST00000368508.3	-	1	254	c.56G>C	c.(55-57)tGc>tCc	p.C19S	GOPC_ENST00000467125.1_Intron|ROS1_ENST00000368507.3_Missense_Mutation_p.C19S	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	19					cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		AATCCATAGGCAGCCAAGAGT	0.388			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																p.C19S		Atlas-SNP	.		Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	.	ROS1	728	.	0			c.G56C						PASS	.						120.0	119.0	119.0					6																	117746764		2203	4300	6503	SO:0001583	missense	6098	exon1			CATAGGCAGCCAA	M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.56G>C	chr6.hg19:g.117746764C>G	ENSP00000357494:p.Cys19Ser	287.0	0.0	.		135.0	41.0	.	NM_002944	Q15368|Q5TDB5	Missense_Mutation	SNP	ENST00000368508.3	hg19	CCDS5116.1	.	.	.	.	.	.	.	.	.	.	C	13.17	2.155746	0.38021	.	.	ENSG00000047936	ENST00000368508;ENST00000368507	T;T	0.70631	-0.5;-0.5	5.11	2.22	0.28083	.	0.273852	0.26757	N	0.022646	T	0.41766	0.1173	L	0.51422	1.61	0.80722	D	1	B	0.14438	0.01	B	0.06405	0.002	T	0.42649	-0.9439	10	0.62326	D	0.03	.	3.545	0.07826	0.175:0.5642:0.1691:0.0917	.	19	P08922	ROS1_HUMAN	S	19	ENSP00000357494:C19S;ENSP00000357493:C19S	ENSP00000357493:C19S	C	-	2	0	ROS1	117853457	0.849000	0.29639	0.992000	0.48379	0.875000	0.50365	0.358000	0.20216	0.366000	0.24427	0.655000	0.94253	TGC	.	.	.	none		0.388	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043464.1		
TMEM184A	202915	hgsc.bcm.edu	37	7	1590513	1590513	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr7:1590513G>A	ENST00000297477.5	-	3	641	c.325C>T	c.(325-327)Ctc>Ttc	p.L109F		NM_001097620.1	NP_001091089.1	Q6ZMB5	T184A_HUMAN	transmembrane protein 184A	109					germ-line sex determination (GO:0018992)|regulation of protein localization (GO:0032880)|regulation of secretion (GO:0051046)	early endosome membrane (GO:0031901)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	12		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;5.88e-15)		CCGAGGAGGAGGAGGCTGAGC	0.632																																					p.L109F		Atlas-SNP	.											.	TMEM184A	35	.	0			c.C325T						PASS	.						88.0	97.0	94.0					7																	1590513		2203	4300	6503	SO:0001583	missense	202915	exon3			GGAGGAGGAGGCT		CCDS43537.1	7p22.3	2008-05-02			ENSG00000164855	ENSG00000164855			28797	protein-coding gene	gene with protein product						12477932	Standard	NM_001097620		Approved	MGC9712	uc003skv.4	Q6ZMB5	OTTHUMG00000119025	ENST00000297477.5:c.325C>T	chr7.hg19:g.1590513G>A	ENSP00000297477:p.Leu109Phe	120.0	0.0	.		200.0	47.0	.	NM_001097620	Q8TBQ6	Missense_Mutation	SNP	ENST00000297477.5	hg19	CCDS43537.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.153532	0.78114	.	.	ENSG00000164855	ENST00000297477;ENST00000319010;ENST00000414730;ENST00000441933;ENST00000431208	T;T;T;T;T	0.50548	0.74;0.74;0.74;0.74;0.74	5.15	5.15	0.70609	.	0.000000	0.64402	U	0.000001	T	0.52677	0.1749	M	0.70787	2.145	0.80722	D	1	P	0.36599	0.56	B	0.41813	0.367	T	0.56450	-0.7977	10	0.51188	T	0.08	-14.3095	12.9955	0.58644	0.0782:0.0:0.9218:0.0	.	109	Q6ZMB5	T184A_HUMAN	F	109	ENSP00000297477:L109F;ENSP00000325945:L109F;ENSP00000398382:L109F;ENSP00000389092:L109F;ENSP00000403499:L109F	ENSP00000297477:L109F	L	-	1	0	TMEM184A	1557039	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	7.819000	0.86621	2.396000	0.81511	0.407000	0.27541	CTC	.	.	.	none		0.632	TMEM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239229.4	NM_152689	
TFR2	7036	hgsc.bcm.edu	37	7	100228607	100228607	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr7:100228607C>T	ENST00000462107.1	-	10	1462	c.1175G>A	c.(1174-1176)gGc>gAc	p.G392D	TFR2_ENST00000544242.1_5'UTR|TFR2_ENST00000223051.3_Missense_Mutation_p.G392D|TFR2_ENST00000431692.1_Silent_p.G306G			Q9UP52	TFR2_HUMAN	transferrin receptor 2	392					cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transferrin receptor activity (GO:0004998)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)				Gallium nitrate(DB05260)	TGGCCCGGGGCCCAGGTGATA	0.612																																					p.G392D		Atlas-SNP	.											.	TFR2	53	.	0			c.G1175A						PASS	.						35.0	34.0	35.0					7																	100228607		2203	4300	6503	SO:0001583	missense	7036	exon9			CCGGGGCCCAGGT	AF053356	CCDS34707.1	7q22	2003-01-27			ENSG00000106327	ENSG00000106327			11762	protein-coding gene	gene with protein product		604720				9799793, 12130528	Standard	NM_003227		Approved	HFE3, TFRC2	uc003uvv.1	Q9UP52	OTTHUMG00000159598	ENST00000462107.1:c.1175G>A	chr7.hg19:g.100228607C>T	ENSP00000420525:p.Gly392Asp	34.0	0.0	.		83.0	23.0	.	NM_003227	A6NGM7|O75422|Q1HE13|Q9HA99|Q9NX67	Missense_Mutation	SNP	ENST00000462107.1	hg19	CCDS34707.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.012638	0.75161	.	.	ENSG00000106327	ENST00000223051;ENST00000462107	T;T	0.52983	0.64;0.64	4.74	4.74	0.60224	.	0.144170	0.45867	D	0.000322	T	0.70684	0.3252	M	0.91768	3.24	0.80722	D	1	D	0.69078	0.997	D	0.64042	0.921	T	0.73943	-0.3823	10	0.34782	T	0.22	-26.2357	13.0917	0.59169	0.0:1.0:0.0:0.0	.	392	Q9UP52	TFR2_HUMAN	D	392	ENSP00000223051:G392D;ENSP00000420525:G392D	ENSP00000223051:G392D	G	-	2	0	TFR2	100066543	1.000000	0.71417	1.000000	0.80357	0.667000	0.39255	1.935000	0.40173	2.470000	0.83445	0.561000	0.74099	GGC	.	.	.	none		0.612	TFR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356392.3	NM_003227	
KMT2C	58508	hgsc.bcm.edu	37	7	151882674	151882674	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr7:151882674T>G	ENST00000262189.6	-	34	5269	c.5051A>C	c.(5050-5052)aAa>aCa	p.K1684T	KMT2C_ENST00000355193.2_Missense_Mutation_p.K1684T	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	1684					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TGAGCTTGCTTTTCTCCACAA	0.343																																					p.K1684T		Atlas-SNP	.											.	MLL3	1564	.	0			c.A5051C						PASS	.						142.0	123.0	130.0					7																	151882674		2202	4300	6502	SO:0001583	missense	58508	exon34			CTTGCTTTTCTCC	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.5051A>C	chr7.hg19:g.151882674T>G	ENSP00000262189:p.Lys1684Thr	206.0	0.0	.		131.0	13.0	.	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	hg19	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	T	17.93	3.508980	0.64410	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.93604	-3.25;-3.25	5.03	5.03	0.67393	High mobility group, HMG1/HMG2 (1);	0.000000	0.49305	D	0.000155	D	0.94496	0.8228	L	0.38175	1.15	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.94705	0.7887	10	0.51188	T	0.08	.	14.7869	0.69810	0.0:0.0:0.0:1.0	.	1684;745	Q8NEZ4;Q8NEZ4-2	MLL3_HUMAN;.	T	1684	ENSP00000262189:K1684T;ENSP00000347325:K1684T	ENSP00000262189:K1684T	K	-	2	0	MLL3	151513607	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.888000	0.87302	1.889000	0.54706	0.523000	0.50628	AAA	.	.	.	none		0.343	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
AGPAT5	55326	hgsc.bcm.edu	37	8	6614714	6614714	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr8:6614714T>A	ENST00000285518.6	+	8	1212	c.900T>A	c.(898-900)gaT>gaA	p.D300E		NM_018361.3	NP_060831.2	Q9NUQ2	PLCE_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 5	300					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|hematopoietic progenitor cell differentiation (GO:0002244)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)		AGPAT5/MCPH1(2)	endometrium(2)|kidney(2)|large_intestine(4)|lung(3)	11			STAD - Stomach adenocarcinoma(24;0.0578)	READ - Rectum adenocarcinoma(644;0.156)|COAD - Colon adenocarcinoma(149;0.191)		AGTCACCAGATCCAGAAAGAA	0.323																																					p.D300E		Atlas-SNP	.											.	AGPAT5	31	.	0			c.T900A						PASS	.						44.0	45.0	45.0					8																	6614714		2203	4300	6503	SO:0001583	missense	55326	exon8			ACCAGATCCAGAA	AF375789	CCDS34796.1	8p23.1	2013-02-05	2013-02-05		ENSG00000155189	ENSG00000155189	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	20886	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, epsilon"""	614796	"""1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon)"""				Standard	NM_018361		Approved	FLJ11210, LPAAT-e, LPAAT-epsilon	uc003wqo.3	Q9NUQ2	OTTHUMG00000163656	ENST00000285518.6:c.900T>A	chr8.hg19:g.6614714T>A	ENSP00000285518:p.Asp300Glu	91.0	0.0	.		15.0	8.0	.	NM_018361	Q8IZ47|Q9BQG4	Missense_Mutation	SNP	ENST00000285518.6	hg19	CCDS34796.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.60|19.60	3.858531|3.858531	0.71834|0.71834	.|.	.|.	ENSG00000155189|ENSG00000155189	ENST00000285518|ENST00000518327	T|.	0.62232|.	0.04|.	6.04|6.04	2.42|2.42	0.29668|0.29668	.|.	0.087594|.	0.85682|.	D|.	0.000000|.	T|T	0.62624|0.62624	0.2443|0.2443	M|M	0.72576|0.72576	2.205|2.205	0.53005|0.53005	D|D	0.999968|0.999968	P|.	0.37663|.	0.604|.	B|.	0.34779|.	0.189|.	T|T	0.56932|0.56932	-0.7897|-0.7897	10|5	0.09843|.	T|.	0.71|.	-7.4458|-7.4458	7.7568|7.7568	0.28930|0.28930	0.0:0.3185:0.0:0.6815|0.0:0.3185:0.0:0.6815	.|.	300|.	Q9NUQ2|.	PLCE_HUMAN|.	E|N	300|117	ENSP00000285518:D300E|.	ENSP00000285518:D300E|.	D|I	+|+	3|2	2|0	AGPAT5|AGPAT5	6602122|6602122	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	1.618000|1.618000	0.36954|0.36954	0.190000|0.190000	0.20209|0.20209	0.459000|0.459000	0.35465|0.35465	GAT|ATC	.	.	.	none		0.323	AGPAT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374684.1	NM_018361	
TNKS	8658	hgsc.bcm.edu	37	8	9413684	9413684	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr8:9413684C>G	ENST00000310430.6	+	1	261	c.235C>G	c.(235-237)Cga>Gga	p.R79G	RP11-375N15.2_ENST00000607598.1_RNA|TNKS_ENST00000520408.1_Missense_Mutation_p.R79G|TNKS_ENST00000522110.1_Missense_Mutation_p.R79G	NM_003747.2	NP_003738.2	O95271	TNKS1_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase	79					mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|mRNA transport (GO:0051028)|negative regulation of DNA binding (GO:0043392)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein poly-ADP-ribosylation (GO:0070212)|protein polyubiquitination (GO:0000209)|protein transport (GO:0015031)|regulation of telomere maintenance via telomerase (GO:0032210)|spindle assembly (GO:0051225)|Wnt signaling pathway (GO:0016055)	chromosome, centromeric region (GO:0000775)|chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nuclear chromosome, telomeric region (GO:0000784)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	NAD+ ADP-ribosyltransferase activity (GO:0003950)|zinc ion binding (GO:0008270)	p.R79*(2)		NS(1)|endometrium(10)|kidney(6)|large_intestine(4)|lung(17)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	49				COAD - Colon adenocarcinoma(149;0.0467)		CGACAGGCCCCGATCCCCGGA	0.701																																					p.R79G		Atlas-SNP	.											TNKS_ENST00000310430,NS,carcinoma,-1,2	TNKS	198	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C235G						PASS	.						23.0	26.0	25.0					8																	9413684		2202	4299	6501	SO:0001583	missense	8658	exon1			AGGCCCCGATCCC	AF082556	CCDS5974.1	8p23.1	2013-01-10			ENSG00000173273	ENSG00000173273		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	11941	protein-coding gene	gene with protein product		603303				9822378, 10198177	Standard	XM_006716263		Approved	TIN1, TINF1, TNKS1, PARP-5a, PARP5A, pART5	uc003wss.3	O95271	OTTHUMG00000090481	ENST00000310430.6:c.235C>G	chr8.hg19:g.9413684C>G	ENSP00000311579:p.Arg79Gly	75.0	0.0	.		103.0	27.0	.	NM_003747	O95272|Q4G0F2	Missense_Mutation	SNP	ENST00000310430.6	hg19	CCDS5974.1	.	.	.	.	.	.	.	.	.	.	C	13.78	2.337846	0.41398	.	.	ENSG00000173273	ENST00000520408;ENST00000310430;ENST00000522110	T;T	0.62788	0.0;0.05	4.84	2.01	0.26516	.	0.123149	0.33457	N	0.004900	T	0.41096	0.1144	N	0.19112	0.55	0.26334	N	0.977462	B;B	0.17038	0.006;0.02	B;B	0.12837	0.008;0.008	T	0.28618	-1.0038	10	0.51188	T	0.08	.	5.6253	0.17478	0.3245:0.5507:0.0:0.1248	.	79;79	E7EWY6;O95271	.;TNKS1_HUMAN	G	79	ENSP00000428299:R79G;ENSP00000311579:R79G	ENSP00000311579:R79G	R	+	1	2	TNKS	9451094	0.020000	0.18652	0.999000	0.59377	0.985000	0.73830	0.272000	0.18644	0.719000	0.32188	-0.169000	0.13324	CGA	.	.	.	none		0.701	TNKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206935.1	NM_003747	
CCAR2	57805	hgsc.bcm.edu	37	8	22464154	22464154	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr8:22464154T>A	ENST00000308511.4	+	4	434	c.185T>A	c.(184-186)gTt>gAt	p.V62D	CCAR2_ENST00000520861.1_5'Flank|CCAR2_ENST00000389279.3_Missense_Mutation_p.V62D|CCAR2_ENST00000521301.1_Missense_Mutation_p.V62D			Q8N163	CCAR2_HUMAN	cell cycle and apoptosis regulator 2	62					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mRNA processing (GO:0006397)|negative regulation of catalytic activity (GO:0043086)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage checkpoint (GO:2000003)|regulation of circadian rhythm (GO:0042752)|regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of protein stability (GO:0031647)|response to UV (GO:0009411)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|DBIRD complex (GO:0044609)|mitochondrial matrix (GO:0005759)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)										ACTGGTATTGTTACCAGCTTG	0.463																																					p.V62D		Atlas-SNP	.											.	KIAA1967	72	.	0			c.T185A						PASS	.						154.0	131.0	139.0					8																	22464154		2203	4300	6503	SO:0001583	missense	57805	exon4			GTATTGTTACCAG	AL834351	CCDS34863.1	8p22	2013-08-22	2013-08-22	2013-08-22		ENSG00000158941			23360	protein-coding gene	gene with protein product	"""deleted in breast cancer"""	607359	"""KIAA1967"""	KIAA1967		12370419	Standard	NM_021174		Approved	DBC-1, DBC1, NET35	uc003xci.3	Q8N163		ENST00000308511.4:c.185T>A	chr8.hg19:g.22464154T>A	ENSP00000310670:p.Val62Asp	109.0	0.0	.		159.0	51.0	.	NM_021174	A6NL03|B2RB79|D3DSR6|Q6P0Q9|Q8N3G7|Q8N8M1|Q8TF34|Q9H9Q9|Q9HD12|Q9NT55	Missense_Mutation	SNP	ENST00000308511.4	hg19	CCDS34863.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.9|24.9	4.584955|4.584955	0.86748|0.86748	.|.	.|.	ENSG00000158941|ENSG00000158941	ENST00000523801;ENST00000518989|ENST00000308511;ENST00000521301;ENST00000389279;ENST00000521837;ENST00000523349	.|T;T	.|0.61040	.|0.14;0.14	5.87|5.87	5.87|5.87	0.94306|0.94306	.|.	.|0.000000	.|0.64402	.|D	.|0.000004	.|T	.|0.76905	.|0.4053	M|M	0.80982|0.80982	2.52|2.52	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.85130	.|0.997	.|T	.|0.80108	.|-0.1520	.|10	.|0.87932	.|D	.|0	-21.0092|-21.0092	14.0962|14.0962	0.65023|0.65023	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|62	.|Q8N163	.|K1967_HUMAN	X|D	69;14|62	.|ENSP00000310670:V62D;ENSP00000373930:V62D	.|ENSP00000310670:V62D	C|V	+|+	3|2	2|0	KIAA1967|KIAA1967	22520099|22520099	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	6.291000|6.291000	0.72719|0.72719	2.371000|2.371000	0.80710|0.80710	0.533000|0.533000	0.62120|0.62120	TGT|GTT	.	.	.	none		0.463	CCAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375865.1	NM_021174	
KCNS2	3788	hgsc.bcm.edu	37	8	99441267	99441267	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr8:99441267G>T	ENST00000287042.4	+	2	1410	c.1060G>T	c.(1060-1062)Gag>Tag	p.E354*	KCNS2_ENST00000521839.1_Nonsense_Mutation_p.E354*	NM_020697.2	NP_065748.1	Q9ULS6	KCNS2_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2	354					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			autonomic_ganglia(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	31	Breast(36;2.4e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.0448)			TGAAAAGGAGGAGAACGAGGG	0.577																																					p.E354X	Pancreas(138;844 2489 9202 24627)	Atlas-SNP	.											.	KCNS2	93	.	0			c.G1060T						PASS	.						89.0	80.0	83.0					8																	99441267		2203	4300	6503	SO:0001587	stop_gained	3788	exon2			AAGGAGGAGAACG	AB032970	CCDS6279.1	8q22	2011-07-05			ENSG00000156486	ENSG00000156486		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6301	protein-coding gene	gene with protein product		602906				9305895, 16382104	Standard	NM_020697		Approved	Kv9.2	uc003yin.3	Q9ULS6	OTTHUMG00000044337	ENST00000287042.4:c.1060G>T	chr8.hg19:g.99441267G>T	ENSP00000287042:p.Glu354*	148.0	0.0	.		202.0	51.0	.	NM_020697	A8KAN1	Nonsense_Mutation	SNP	ENST00000287042.4	hg19	CCDS6279.1	.	.	.	.	.	.	.	.	.	.	G	40	8.203350	0.98704	.	.	ENSG00000156486	ENST00000287042;ENST00000521839	.	.	.	5.91	5.91	0.95273	.	0.158483	0.56097	D	0.000029	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	20.3052	0.98627	0.0:0.0:1.0:0.0	.	.	.	.	X	354	.	ENSP00000287042:E354X	E	+	1	0	KCNS2	99510443	1.000000	0.71417	0.998000	0.56505	0.975000	0.68041	9.869000	0.99810	2.808000	0.96608	0.655000	0.94253	GAG	.	.	.	none		0.577	KCNS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103134.1	NM_020697	
FAM135B	51059	hgsc.bcm.edu	37	8	139164000	139164000	+	Silent	SNP	G	G	T			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr8:139164000G>T	ENST00000395297.1	-	13	2888	c.2718C>A	c.(2716-2718)ggC>ggA	p.G906G		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	906										NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			CTTTAGGCATGCCCTTTGGGG	0.458										HNSCC(54;0.14)																											p.G906G		Atlas-SNP	.											.	FAM135B	423	.	0			c.C2718A						PASS	.						128.0	126.0	127.0					8																	139164000		2203	4300	6503	SO:0001819	synonymous_variant	51059	exon13			AGGCATGCCCTTT	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.2718C>A	chr8.hg19:g.139164000G>T		307.0	0.0	.		335.0	98.0	.	NM_015912	B5MDB3|O95879|Q2WGJ7|Q3KP46	Silent	SNP	ENST00000395297.1	hg19	CCDS6375.2																																																																																			.	.	.	none		0.458	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912	
FAM135B	51059	hgsc.bcm.edu	37	8	139164004	139164004	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr8:139164004T>C	ENST00000395297.1	-	13	2884	c.2714A>G	c.(2713-2715)aAg>aGg	p.K905R		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	905										NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			AGGCATGCCCTTTGGGGTTTC	0.468										HNSCC(54;0.14)																											p.K905R		Atlas-SNP	.											.	FAM135B	423	.	0			c.A2714G						PASS	.						125.0	124.0	124.0					8																	139164004		2203	4300	6503	SO:0001583	missense	51059	exon13			ATGCCCTTTGGGG	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.2714A>G	chr8.hg19:g.139164004T>C	ENSP00000378710:p.Lys905Arg	310.0	0.0	.		338.0	94.0	.	NM_015912	B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	ENST00000395297.1	hg19	CCDS6375.2	.	.	.	.	.	.	.	.	.	.	T	15.06	2.721538	0.48728	.	.	ENSG00000147724	ENST00000395297	T	0.16597	2.33	5.33	4.15	0.48705	.	0.392353	0.28031	N	0.016877	T	0.19127	0.0459	L	0.32530	0.975	0.09310	N	1	P;P;B	0.51351	0.944;0.728;0.164	P;B;B	0.50617	0.646;0.343;0.04	T	0.04017	-1.0984	10	0.46703	T	0.11	-11.8381	9.5929	0.39557	0.1559:0.0:0.0:0.8441	.	905;905;905	Q49AJ0-3;Q49AJ0-4;Q49AJ0	.;.;F135B_HUMAN	R	905	ENSP00000378710:K905R	ENSP00000276737:K905R	K	-	2	0	FAM135B	139233186	0.652000	0.27349	0.013000	0.15412	0.286000	0.27126	4.148000	0.58085	0.833000	0.34828	0.533000	0.62120	AAG	.	.	.	none		0.468	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912	
UNC13B	10497	hgsc.bcm.edu	37	9	35375163	35375163	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr9:35375163A>G	ENST00000378495.3	+	13	1555	c.1333A>G	c.(1333-1335)Atg>Gtg	p.M445V	UNC13B_ENST00000378496.4_Missense_Mutation_p.M445V|UNC13B_ENST00000396787.1_Missense_Mutation_p.M457V	NM_006377.3	NP_006368.3	O14795	UN13B_HUMAN	unc-13 homolog B (C. elegans)	445					apoptotic process (GO:0006915)|excretion (GO:0007588)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synaptic vesicle priming (GO:0010808)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|terminal bouton (GO:0043195)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(16)|liver(2)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			CACTTCTGCAATGGCTACACG	0.537																																					p.M445V		Atlas-SNP	.											.	UNC13B	153	.	0			c.A1333G						PASS	.						240.0	213.0	222.0					9																	35375163		2203	4300	6503	SO:0001583	missense	10497	exon13			TCTGCAATGGCTA	AF020202	CCDS6579.1	9p13.3	2008-05-15	2003-10-17	2003-10-17	ENSG00000198722	ENSG00000198722			12566	protein-coding gene	gene with protein product		605836	"""unc-13-like (C. elegans)"""	UNC13		9607201	Standard	NM_006377		Approved	hmunc13, Unc13h2	uc003zwq.3	O14795	OTTHUMG00000019856	ENST00000378495.3:c.1333A>G	chr9.hg19:g.35375163A>G	ENSP00000367756:p.Met445Val	447.0	1.0	.		369.0	223.0	.	NM_006377	Q5VYM8	Missense_Mutation	SNP	ENST00000378495.3	hg19	CCDS6579.1	.	.	.	.	.	.	.	.	.	.	A	12.32	1.903474	0.33628	.	.	ENSG00000198722	ENST00000396787;ENST00000378495;ENST00000378496;ENST00000535471	T;T;T	0.61040	0.14;0.14;0.14	5.81	3.16	0.36331	.	0.084309	0.85682	D	0.000000	T	0.40932	0.1137	L	0.28504	0.86	0.45295	D	0.998291	B;B	0.23806	0.091;0.03	B;B	0.24006	0.05;0.019	T	0.17228	-1.0376	10	0.26408	T	0.33	-19.0987	8.125	0.30992	0.6561:0.1107:0.0:0.2332	.	445;445	F8W8M9;O14795	.;UN13B_HUMAN	V	457;445;445;32	ENSP00000380006:M457V;ENSP00000367756:M445V;ENSP00000367757:M445V	ENSP00000367756:M445V	M	+	1	0	UNC13B	35365163	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.969000	0.56816	1.010000	0.39314	0.482000	0.46254	ATG	.	.	.	none		0.537	UNC13B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052296.1	NM_006377	
ABL1	25	hgsc.bcm.edu	37	9	133748371	133748371	+	Silent	SNP	C	C	T			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr9:133748371C>T	ENST00000318560.5	+	6	1413	c.1032C>T	c.(1030-1032)gcC>gcT	p.A344A		NM_005157.4	NP_005148.2	P00519	ABL1_HUMAN	ABL proto-oncogene 1, non-receptor tyrosine kinase	344	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|autophagy (GO:0006914)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to dopamine (GO:1903351)|cellular response to oxidative stress (GO:0034599)|DNA damage induced protein phosphorylation (GO:0006975)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mismatch repair (GO:0006298)|mitochondrial depolarization (GO:0051882)|mitotic nuclear division (GO:0007067)|muscle cell differentiation (GO:0042692)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|regulation of response to DNA damage stimulus (GO:2001020)|regulation of transcription, DNA-templated (GO:0006355)|response to oxidative stress (GO:0006979)|signal transduction in response to DNA damage (GO:0042770)	actin cytoskeleton (GO:0015629)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase binding (GO:0051019)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|SH3 domain binding (GO:0017124)|syntaxin binding (GO:0019905)			breast(3)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1149)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	1195		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Bosutinib(DB06616)|Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Ponatinib(DB08901)|Regorafenib(DB08896)	TGTACATGGCCACTCAGATCT	0.577			"""T, Mis"""	"""BCR, ETV6, NUP214"""	"""CML, ALL, T-ALL"""																																p.A363A		Atlas-SNP	.		Dom	yes		9	9q34.1	25	v-abl Abelson murine leukemia viral oncogene homolog 1		L	.	ABL1	1632	.	0			c.C1089T						PASS	.						73.0	59.0	64.0					9																	133748371		2203	4300	6503	SO:0001819	synonymous_variant	25	exon6			CATGGCCACTCAG	M14752	CCDS35165.1, CCDS35166.1	9q34.1	2014-09-17	2014-06-26		ENSG00000097007	ENSG00000097007		"""SH2 domain containing"""	76	protein-coding gene	gene with protein product		189980	"""v-abl Abelson murine leukemia viral oncogene homolog 1"", ""c-abl oncogene 1, receptor tyrosine kinase"", ""c-abl oncogene 1, non-receptor tyrosine kinase"""	ABL		1857987, 12626632	Standard	NM_007313		Approved	JTK7, c-ABL, p150	uc004bzv.3	P00519	OTTHUMG00000020813	ENST00000318560.5:c.1032C>T	chr9.hg19:g.133748371C>T		137.0	0.0	.		143.0	90.0	.	NM_007313	A3KFJ3|Q13869|Q13870|Q16133|Q17R61|Q45F09	Silent	SNP	ENST00000318560.5	hg19	CCDS35166.1																																																																																			.	.	.	none		0.577	ABL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054684.1	NM_007313	
NODAL	4838	hgsc.bcm.edu	37	10	72195424	72195424	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr10:72195424T>A	ENST00000287139.3	-	2	508	c.509A>T	c.(508-510)gAg>gTg	p.E170V	AC022532.1_ENST00000420338.2_Missense_Mutation_p.L124H	NM_018055.4	NP_060525.3	Q96S42	NODAL_HUMAN	nodal growth differentiation factor	170					axial mesodermal cell fate specification (GO:0048327)|brain development (GO:0007420)|cell migration involved in gastrulation (GO:0042074)|digestive tract morphogenesis (GO:0048546)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic pattern specification (GO:0009880)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|endodermal cell differentiation (GO:0035987)|epiblast cell-extraembryonic ectoderm cell signaling involved in anterior/posterior axis specification (GO:0060802)|floor plate morphogenesis (GO:0033505)|formation of anatomical boundary (GO:0048859)|growth (GO:0040007)|heart looping (GO:0001947)|inhibition of neuroepithelial cell differentiation (GO:0002085)|left lung morphogenesis (GO:0060460)|liver development (GO:0001889)|maternal placenta development (GO:0001893)|maternal process involved in parturition (GO:0060137)|mesendoderm development (GO:0048382)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of chorionic trophoblast cell proliferation (GO:1901383)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of trophoblast cell migration (GO:1901164)|neural fold formation (GO:0001842)|nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900164)|placenta development (GO:0001890)|polarity specification of proximal/distal axis (GO:0010085)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900224)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of gastrulation (GO:0010470)|regulation of stem cell maintenance (GO:2000036)|SMAD protein signal transduction (GO:0060395)|stem cell maintenance (GO:0019827)|transforming growth factor beta receptor signaling pathway involved in primitive streak formation (GO:0090010)|trophectodermal cellular morphogenesis (GO:0001831)|vasculature development (GO:0001944)	extracellular space (GO:0005615)	morphogen activity (GO:0016015)|type I activin receptor binding (GO:0070698)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(2)	15						CATCTGCTTCTCCAGGGCCCC	0.602																																					p.E170V		Atlas-SNP	.											.	NODAL	32	.	0			c.A509T						PASS	.						37.0	37.0	37.0					10																	72195424		2203	4300	6503	SO:0001583	missense	4838	exon2			TGCTTCTCCAGGG	BC033585	CCDS7304.1	10q22.1	2012-12-07	2012-12-07		ENSG00000156574	ENSG00000156574			7865	protein-coding gene	gene with protein product		601265	"""nodal, mouse, homolog"", ""nodal homolog (mouse)"""			9354794	Standard	NM_018055		Approved		uc001jrc.2	Q96S42	OTTHUMG00000018408	ENST00000287139.3:c.509A>T	chr10.hg19:g.72195424T>A	ENSP00000287139:p.Glu170Val	74.0	0.0	.		122.0	38.0	.	NM_018055	Q2M3A5|Q8N4V3	Missense_Mutation	SNP	ENST00000287139.3	hg19	CCDS7304.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.27|14.27	2.486027|2.486027	0.44147|0.44147	.|.	.|.	ENSG00000156574|ENSG00000197604	ENST00000287139;ENST00000414871|ENST00000420338	D;D|.	0.85339|.	-1.97;-1.94|.	5.99|5.99	1.14|1.14	0.20703|0.20703	.|.	0.737242|.	0.13941|.	N|.	0.352164|.	T|T	0.39306|0.39306	0.1073|0.1073	L|L	0.56769|0.56769	1.78|1.78	0.28250|0.28250	N|N	0.925313|0.925313	B|.	0.17268|.	0.021|.	B|.	0.22880|.	0.042|.	T|T	0.46233|0.46233	-0.9206|-0.9206	10|6	0.31617|0.87932	T|D	0.26|0	.|.	1.0685|1.0685	0.01616|0.01616	0.1347:0.2379:0.2788:0.3486|0.1347:0.2379:0.2788:0.3486	.|.	170|.	Q96S42|.	NODAL_HUMAN|.	V|H	170;115|124	ENSP00000287139:E170V;ENSP00000394468:E115V|.	ENSP00000287139:E170V|ENSP00000411125:L124H	E|L	-|+	2|2	0|0	NODAL|AC022532.1	71865430|71865430	0.001000|0.001000	0.12720|0.12720	0.956000|0.956000	0.39512|0.39512	0.792000|0.792000	0.44763|0.44763	0.801000|0.801000	0.27055|0.27055	0.162000|0.162000	0.19483|0.19483	0.533000|0.533000	0.62120|0.62120	GAG|CTC	.	.	.	none		0.602	NODAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048511.1	NM_018055	
NOLC1	9221	hgsc.bcm.edu	37	10	103917239	103917239	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr10:103917239C>T	ENST00000605788.1	+	4	603	c.368C>T	c.(367-369)gCa>gTa	p.A123V	NOLC1_ENST00000603742.1_5'UTR|NOLC1_ENST00000405356.1_Missense_Mutation_p.A123V|NOLC1_ENST00000488254.2_Missense_Mutation_p.A124V	NM_001284389.1|NM_004741.3	NP_001271318.1|NP_004732.2	Q14978	NOLC1_HUMAN	nucleolar and coiled-body phosphoprotein 1	123	11 X 12 AA approximate repeats of an acidic serine cluster.				cell cycle (GO:0007049)|mitotic nuclear division (GO:0007067)|nucleolus organization (GO:0007000)|rRNA processing (GO:0006364)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	31		Colorectal(252;0.122)		Epithelial(162;5.19e-08)|all cancers(201;9.43e-07)		GCAGCCAAAGCATCAGAGAGT	0.512																																					p.A123V		Atlas-SNP	.											.	NOLC1	61	.	0			c.C368T						PASS	.						68.0	65.0	66.0					10																	103917239		2203	4300	6503	SO:0001583	missense	9221	exon4			CCAAAGCATCAGA	Z34289	CCDS7530.1, CCDS65925.1, CCDS65926.1	10q24.32	2008-08-01			ENSG00000166197	ENSG00000166197			15608	protein-coding gene	gene with protein product		602394				7657714, 10567578	Standard	XM_005270273		Approved	P130, KIAA0035, NOPP140, NOPP130	uc001kuo.2	Q14978	OTTHUMG00000018944	ENST00000605788.1:c.368C>T	chr10.hg19:g.103917239C>T	ENSP00000474710:p.Ala123Val	95.0	0.0	.		75.0	21.0	.	NM_004741	Q15030|Q5VV70|Q9BUV3	Missense_Mutation	SNP	ENST00000605788.1	hg19	CCDS7530.1	.	.	.	.	.	.	.	.	.	.	C	12.57	1.978454	0.34942	.	.	ENSG00000166197	ENST00000405356;ENST00000370007	T	0.43294	0.95	5.52	5.52	0.82312	.	0.307617	0.28589	N	0.014814	T	0.47967	0.1474	M	0.78801	2.425	0.28217	N	0.926698	P;P;P	0.42296	0.775;0.775;0.666	B;B;B	0.42282	0.382;0.382;0.212	T	0.57207	-0.7851	10	0.66056	D	0.02	-13.6615	11.8733	0.52534	0.272:0.728:0.0:0.0	.	124;123;123	Q14978-3;Q14978-2;Q14978	.;.;NOLC1_HUMAN	V	123	ENSP00000385410:A123V	ENSP00000359024:A123V	A	+	2	0	NOLC1	103907229	0.977000	0.34250	0.998000	0.56505	0.422000	0.31414	2.072000	0.41510	2.620000	0.88729	0.655000	0.94253	GCA	.	.	.	none		0.512	NOLC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000050012.2	NM_004741	
BRSK2	9024	hgsc.bcm.edu	37	11	1466623	1466623	+	Silent	SNP	C	C	T			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr11:1466623C>T	ENST00000528841.1	+	10	1296	c.912C>T	c.(910-912)gaC>gaT	p.D304D	BRSK2_ENST00000382179.1_Silent_p.D350D|BRSK2_ENST00000308230.5_Silent_p.D304D|BRSK2_ENST00000531197.1_Silent_p.D304D|BRSK2_ENST00000526678.1_Silent_p.D304D|BRSK2_ENST00000308219.9_Silent_p.D304D|BRSK2_ENST00000528710.1_Silent_p.D244D|BRSK2_ENST00000544817.1_5'UTR			Q8IWQ3	BRSK2_HUMAN	BR serine/threonine kinase 2	304	UBA.				actin cytoskeleton reorganization (GO:0031532)|axonogenesis (GO:0007409)|establishment of cell polarity (GO:0030010)|exocytosis (GO:0006887)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mitotic nuclear division (GO:0007067)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			endometrium(4)|large_intestine(1)|lung(5)	10		all_epithelial(84;4.17e-05)|Breast(177;0.000307)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00144)|Lung(200;0.0713)|LUSC - Lung squamous cell carcinoma(625;0.0842)		ACGTGCTGGACAGCATGCACT	0.667																																					p.D350D		Atlas-SNP	.											.	BRSK2	97	.	0			c.C1050T						PASS	.						34.0	42.0	39.0					11																	1466623		2132	4245	6377	SO:0001819	synonymous_variant	9024	exon10			GCTGGACAGCATG	AF020089	CCDS41590.1, CCDS58106.1, CCDS58107.1, CCDS58108.1, CCDS60696.1	11p15.5	2008-02-05	2003-09-11	2005-01-27	ENSG00000174672	ENSG00000174672			11405	protein-coding gene	gene with protein product	"""serine/threonine kinase 29"""	609236	"""chromsosome 11 open reading frame 7"""	C11orf7, STK29		9852686, 9929968	Standard	NM_001256629		Approved	PEN11B	uc001ltm.4	Q8IWQ3	OTTHUMG00000167089	ENST00000528841.1:c.912C>T	chr11.hg19:g.1466623C>T		43.0	0.0	.		58.0	24.0	.	NM_001256630	B3KVE9|E9PLM7|O60843|O95099|Q5J5B4|Q6ZMQ4|Q8TB60	Silent	SNP	ENST00000528841.1	hg19	CCDS58107.1																																																																																			.	.	.	none		0.667	BRSK2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393033.1	NM_003957	
CCDC73	493860	hgsc.bcm.edu	37	11	32623898	32623898	+	3'UTR	SNP	A	A	T			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr11:32623898A>T	ENST00000335185.5	-	0	3742				EIF3M_ENST00000531120.1_Missense_Mutation_p.N360Y|EIF3M_ENST00000524896.1_Missense_Mutation_p.N228Y	NM_001008391.2	NP_001008392.2	Q6ZRK6	CCD73_HUMAN	coiled-coil domain containing 73											NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	51	Breast(20;0.112)					CTGGAAACAAAATCTGAACAA	0.328																																					p.N360Y		Atlas-SNP	.											.	EIF3M	37	.	0			c.A1078T						PASS	.						93.0	93.0	93.0					11																	32623898		2202	4298	6500	SO:0001624	3_prime_UTR_variant	10480	exon11			AAACAAAATCTGA	AK128159	CCDS41630.1	11p13	2006-02-11			ENSG00000186714	ENSG00000186714			23261	protein-coding gene	gene with protein product		612328					Standard	NM_001008391		Approved	NY-SAR-79	uc001mtv.4	Q6ZRK6	OTTHUMG00000166279	ENST00000335185.5:c.*459T>A	chr11.hg19:g.32623898A>T		173.0	0.0	.		22.0	10.0	.	NM_006360	Q6P5Q7|Q6ZMW0|Q86WE7	Missense_Mutation	SNP	ENST00000335185.5	hg19	CCDS41630.1	.	.	.	.	.	.	.	.	.	.	A	17.70	3.454889	0.63290	.	.	ENSG00000149100	ENST00000531120;ENST00000524896;ENST00000526267	T;T;T	0.51325	1.26;0.72;0.71	5.7	5.7	0.88788	.	0.042254	0.85682	D	0.000000	T	0.62889	0.2465	M	0.82056	2.57	0.80722	D	1	D;D	0.61697	0.97;0.99	P;P	0.51615	0.675;0.675	T	0.69986	-0.4996	10	0.87932	D	0	-19.1647	15.9644	0.79956	1.0:0.0:0.0:0.0	.	228;360	B4E2Q4;Q7L2H7	.;EIF3M_HUMAN	Y	360;228;213	ENSP00000436049:N360Y;ENSP00000436787:N228Y;ENSP00000432139:N213Y	ENSP00000436787:N228Y	N	+	1	0	EIF3M	32580474	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	8.302000	0.89953	2.172000	0.68678	0.460000	0.39030	AAT	.	.	.	none		0.328	CCDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388874.2	NM_001008391	
TMX2	51075	hgsc.bcm.edu	37	11	57480106	57480106	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr11:57480106C>A	ENST00000278422.4	+	1	28	c.16C>A	c.(16-18)Cct>Act	p.P6T	TMX2-CTNND1_ENST00000528395.1_Missense_Mutation_p.P6T|TMX2_ENST00000378312.4_Missense_Mutation_p.P6T|MED19_ENST00000337672.2_5'Flank|MED19_ENST00000431606.2_5'Flank	NM_015959.3	NP_057043.1	Q9Y320	TMX2_HUMAN	thioredoxin-related transmembrane protein 2	6					cell redox homeostasis (GO:0045454)	integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|urinary_tract(2)	12						GGTCTTGGCACCTCTAATTGC	0.592																																					p.P6T		Atlas-SNP	.											.	TMX2	29	.	0			c.C16A						PASS	.						70.0	57.0	61.0					11																	57480106		2201	4296	6497	SO:0001583	missense	51075	exon1			TTGGCACCTCTAA	AF132965	CCDS7967.1, CCDS44601.1	11q12.1	2012-09-20	2009-02-23	2009-02-23	ENSG00000213593	ENSG00000213593		"""Protein disulfide isomerases"""	30739	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 12"""		"""thioredoxin domain containing 14"""	TXNDC14		12670024	Standard	NM_015959		Approved	PDIA12	uc001nlc.2	Q9Y320	OTTHUMG00000167200	ENST00000278422.4:c.16C>A	chr11.hg19:g.57480106C>A	ENSP00000278422:p.Pro6Thr	59.0	0.0	.		76.0	27.0	.	NM_015959	B7Z4R4|Q53G73|Q561W0|Q5J7Q7|Q8NBP9|Q9H3L1	Missense_Mutation	SNP	ENST00000278422.4	hg19	CCDS7967.1	.	.	.	.	.	.	.	.	.	.	C	18.57	3.651806	0.67472	.	.	ENSG00000213593	ENST00000378312;ENST00000278422	T	0.53857	0.6	5.98	5.98	0.97165	.	0.128810	0.53938	U	0.000057	T	0.64349	0.2590	L	0.43152	1.355	0.58432	D	0.999993	D;D	0.67145	0.996;0.985	P;P	0.58266	0.836;0.756	T	0.63919	-0.6528	10	0.66056	D	0.02	-4.5842	20.0512	0.97629	0.0:1.0:0.0:0.0	.	6;6	Q9Y320-2;Q9Y320	.;TMX2_HUMAN	T	6	ENSP00000367562:P6T	ENSP00000436274:P6T	P	+	1	0	TMX2	57236682	0.999000	0.42202	0.427000	0.26684	0.277000	0.26821	4.548000	0.60718	2.847000	0.97988	0.591000	0.81541	CCT	.	.	.	none		0.592	TMX2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393708.1	NM_015959	
MRPL49	740	hgsc.bcm.edu	37	11	64889268	64889268	+	5'Flank	SNP	G	G	T			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr11:64889268G>T	ENST00000279242.2	+	0	0				MRPL49_ENST00000534078.1_5'Flank|FAU_ENST00000531743.1_Silent_p.R6R|MRPL49_ENST00000526171.1_5'Flank|FAU_ENST00000529639.1_Silent_p.R6R|FAU_ENST00000525297.1_Silent_p.R6R|FAU_ENST00000279259.3_Silent_p.R6R|MRPL49_ENST00000531705.1_5'Flank|FAU_ENST00000527548.1_Silent_p.R6R|FAU_ENST00000434372.2_Silent_p.R6R|FAU_ENST00000529259.1_Silent_p.R6R	NM_004927.3	NP_004918.1	Q13405	RM49_HUMAN	mitochondrial ribosomal protein L49						translation (GO:0006412)	mitochondrial ribosome (GO:0005761)	structural constituent of ribosome (GO:0003735)			endometrium(1)|ovary(1)	2						GCTCCTGGGCGCGGACAAAGA	0.532																																					p.R6R		Atlas-SNP	.											.	FAU	17	.	0			c.C18A						PASS	.						71.0	64.0	66.0					11																	64889268		2201	4297	6498	SO:0001631	upstream_gene_variant	2197	exon2			CTGGGCGCGGACA		CCDS8096.1	11q13.1	2012-11-14	2001-10-16	2001-10-19	ENSG00000149792	ENSG00000149792		"""Mitochondrial ribosomal proteins / large subunits"""	1176	protein-coding gene	gene with protein product	"""neighbor of FAU"", ""next to FAU"""	606866	"""chromosome 11 open reading frame 4"""	C11orf4		8786148	Standard	NM_004927		Approved	NOF, NOF1, L49mt	uc001oda.2	Q13405	OTTHUMG00000165608		chr11.hg19:g.64889268G>T	Exception_encountered	110.0	0.0	.		160.0	39.0	.	NM_001997	B2R4G6	Silent	SNP	ENST00000279242.2	hg19	CCDS8096.1																																																																																			.	.	.	none		0.532	MRPL49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385293.1	NM_004927	
SIK2	23235	hgsc.bcm.edu	37	11	111590501	111590501	+	Silent	SNP	C	C	T			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr11:111590501C>T	ENST00000304987.3	+	10	1442	c.1269C>T	c.(1267-1269)gtC>gtT	p.V423V	SIK2_ENST00000533868.1_3'UTR	NM_015191.1	NP_056006.1	Q9H0K1	SIK2_HUMAN	salt-inducible kinase 2	423					insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of insulin receptor signaling pathway (GO:0046626)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	30						GCGTTTAGGTCAATGGCTGTC	0.517																																					p.V423V		Atlas-SNP	.											.	SIK2	89	.	0			c.C1269T						PASS	.						45.0	30.0	35.0					11																	111590501		2201	4297	6498	SO:0001819	synonymous_variant	23235	exon10			TTAGGTCAATGGC	AB018324	CCDS8347.1	11q23.1	2008-12-23	2008-12-23	2008-12-23	ENSG00000170145	ENSG00000170145			21680	protein-coding gene	gene with protein product		608973	"""SNF1-like kinase 2"""	SNF1LK2		15067358	Standard	NM_015191		Approved	KIAA0781, QIK, DKFZp434K1115, LOH11CR1I	uc001plt.3	Q9H0K1	OTTHUMG00000150644	ENST00000304987.3:c.1269C>T	chr11.hg19:g.111590501C>T		45.0	0.0	.		59.0	21.0	.	NM_015191	A8K5B8|B0YJ94|O94878|Q17RV0|Q6AZE2|Q76N03|Q8NCV7|Q96CZ8	Silent	SNP	ENST00000304987.3	hg19	CCDS8347.1																																																																																			.	.	.	none		0.517	SIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319352.3	NM_015191	
OAF	220323	hgsc.bcm.edu	37	11	120097580	120097581	+	Missense_Mutation	DNP	AC	AC	CA			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	A|C	A|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr11:120097580_120097581AC>CA	ENST00000328965.4	+	3	935_936	c.422_423AC>CA	c.(421-423)cAC>cCA	p.H141P	OAF_ENST00000531220.1_Missense_Mutation_p.H25P	NM_178507.2	NP_848602.1	Q86UD1	OAF_HUMAN	OAF homolog (Drosophila)	141						extracellular vesicular exosome (GO:0070062)				kidney(1)|lung(5)	6		Breast(109;0.00663)|Medulloblastoma(222;0.0523)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)		GAGCATCTGCACATGGATGTCG	0.619																																					p.H141P|p.H141Q		Atlas-SNP	.											.	OAF	12	.	0			c.A422C|c.C423A						PASS	.																																			SO:0001583	missense	220323	exon3			ATCTGCACATGGA|TCTGCACATGGAT	BC047726	CCDS8430.1	11q23.3	2010-11-23			ENSG00000184232	ENSG00000184232			28752	protein-coding gene	gene with protein product						12477932	Standard	NM_178507		Approved	MGC52117	uc001pxb.3	Q86UD1	OTTHUMG00000166139	Exception_encountered	chr11.hg19:g.120097580_120097581delinsCA	ENSP00000332613:p.His141Pro	142.0|139.0	0.0	.		182.0|183.0	60.0|57.0	.	NM_178507		Missense_Mutation	SNP	ENST00000328965.4	hg19	CCDS8430.1																																																																																			.	.	.	none		0.619	OAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388036.2	NM_178507	
SMARCC2	6601	hgsc.bcm.edu	37	12	56558312	56558312	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr12:56558312T>G	ENST00000267064.4	-	27	3429	c.3343A>C	c.(3343-3345)Aac>Cac	p.N1115H	SMARCC2_ENST00000347471.4_Intron|SMARCC2_ENST00000394023.3_Intron|SMARCC2_ENST00000550164.1_Missense_Mutation_p.N1146H|RP11-977G19.5_ENST00000553176.1_RNA	NM_003075.3	NP_003066.2	Q8TAQ2	SMRC2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	1115	Pro-rich.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(18;0.123)			CCATGCAGGTTAGGAGGAGCG	0.592																																					p.N1115H		Atlas-SNP	.											.	SMARCC2	212	.	0			c.A3343C						PASS	.						114.0	95.0	101.0					12																	56558312		2203	4300	6503	SO:0001583	missense	6601	exon27			GCAGGTTAGGAGG	U66616	CCDS8907.1, CCDS8908.1, CCDS55835.1	12q13.2	2008-05-14				ENSG00000139613			11105	protein-coding gene	gene with protein product		601734				8804307, 9693044	Standard	NM_001130420		Approved	BAF170, Rsc8, CRACC2	uc001skb.3	Q8TAQ2	OTTHUMG00000170288	ENST00000267064.4:c.3343A>C	chr12.hg19:g.56558312T>G	ENSP00000267064:p.Asn1115His	123.0	0.0	.		259.0	113.0	.	NM_003075	F8VTJ5|Q59GV3|Q92923|Q96E12|Q96GY4	Missense_Mutation	SNP	ENST00000267064.4	hg19	CCDS8907.1	.	.	.	.	.	.	.	.	.	.	T	14.73	2.622273	0.46840	.	.	ENSG00000139613	ENST00000550164;ENST00000267064	T;T	0.47528	0.85;0.84	5.28	4.1	0.47936	.	1.132090	0.06439	N	0.725536	T	0.33498	0.0865	N	0.14661	0.345	0.27631	N	0.948035	B	0.09022	0.002	B	0.04013	0.001	T	0.23833	-1.0177	9	.	.	.	-9.2359	11.5054	0.50463	0.0:0.0:0.1507:0.8493	.	1115	Q8TAQ2	SMRC2_HUMAN	H	1146;1115	ENSP00000449396:N1146H;ENSP00000267064:N1115H	.	N	-	1	0	SMARCC2	54844579	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.575000	0.36493	0.921000	0.36994	0.460000	0.39030	AAC	.	.	.	none		0.592	SMARCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408370.1		
GLI1	2735	hgsc.bcm.edu	37	12	57861143	57861143	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr12:57861143C>A	ENST00000228682.2	+	9	1031	c.940C>A	c.(940-942)Cgc>Agc	p.R314S	GLI1_ENST00000546141.1_Missense_Mutation_p.R273S|GLI1_ENST00000543426.1_Missense_Mutation_p.R186S	NM_005269.2	NP_005260.1	P08151	GLI1_HUMAN	GLI family zinc finger 1	314					cerebellar cortex morphogenesis (GO:0021696)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral pattern formation (GO:0009953)|epidermal cell differentiation (GO:0009913)|lung development (GO:0030324)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|notochord regression (GO:0060032)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|regulation of smoothened signaling pathway (GO:0008589)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|spermatogenesis (GO:0007283)|ventral midline development (GO:0007418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|primary cilium (GO:0072372)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(8)|lung(22)|ovary(6)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69			GBM - Glioblastoma multiforme(3;3.99e-32)			GTCATACTCACGCCTCGAAAA	0.542																																					p.R314S	Pancreas(157;841 1936 10503 41495 50368)	Atlas-SNP	.											GLI1,NS,carcinoma,-1,1	GLI1	141	.	0			c.C940A						PASS	.						109.0	96.0	101.0					12																	57861143		2203	4300	6503	SO:0001583	missense	2735	exon9			TACTCACGCCTCG		CCDS8940.1, CCDS53806.1, CCDS53807.1	12q13.2-q13.3	2013-01-25	2009-03-05	2005-01-14		ENSG00000111087		"""Zinc fingers, C2H2-type"""	4317	protein-coding gene	gene with protein product		165220	"""glioma-associated oncogene homolog 1 (zinc finger protein)"", ""glioma-associated oncogene family zinc finger 1"""	GLI		2850480	Standard	NM_005269		Approved		uc001snx.3	P08151		ENST00000228682.2:c.940C>A	chr12.hg19:g.57861143C>A	ENSP00000228682:p.Arg314Ser	123.0	0.0	.		190.0	38.0	.	NM_005269	D0EUY3|E9PQQ9|F5H6H8|Q8TDN9	Missense_Mutation	SNP	ENST00000228682.2	hg19	CCDS8940.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.759669	0.89932	.	.	ENSG00000111087	ENST00000543426;ENST00000228682;ENST00000546141;ENST00000528467;ENST00000443131	T;T;T;T	0.39406	1.08;1.08;1.08;1.08	4.64	3.69	0.42338	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.53938	D	0.000056	T	0.49098	0.1537	N	0.21448	0.665	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.53906	-0.8372	10	0.87932	D	0	.	13.7621	0.62973	0.1541:0.8459:0.0:0.0	.	314	P08151	GLI1_HUMAN	S	186;314;273;273;186	ENSP00000437607:R186S;ENSP00000228682:R314S;ENSP00000441006:R273S;ENSP00000434408:R273S	ENSP00000228682:R314S	R	+	1	0	GLI1	56147410	0.998000	0.40836	1.000000	0.80357	0.996000	0.88848	3.744000	0.55112	2.575000	0.86900	0.563000	0.77884	CGC	.	.	.	none		0.542	GLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394197.1	NM_005269	
C12orf66	144577	hgsc.bcm.edu	37	12	64615826	64615826	+	Silent	SNP	G	G	C			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr12:64615826G>C	ENST00000398055.3	-	1	245	c.192C>G	c.(190-192)gcC>gcG	p.A64A	C12orf66_ENST00000544871.1_Intron|RPS11P6_ENST00000535684.1_RNA|C12orf66_ENST00000540673.1_5'UTR|C12orf66_ENST00000311915.8_Silent_p.A64A	NM_152440.4	NP_689653	Q96MD2	CL066_HUMAN	chromosome 12 open reading frame 66	64										central_nervous_system(1)|large_intestine(1)|lung(2)|ovary(1)	5						AGACCTTCTCGGCCGCGGCCA	0.637																																					p.A64A		Atlas-SNP	.											.	C12orf66	28	.	0			c.C192G						PASS	.						26.0	30.0	29.0					12																	64615826		1954	4127	6081	SO:0001819	synonymous_variant	144577	exon1			CTTCTCGGCCGCG		CCDS41803.1, CCDS73490.1	12q14.2	2008-08-08			ENSG00000174206	ENSG00000174206			26517	protein-coding gene	gene with protein product						12477932	Standard	NM_152440		Approved	FLJ32549	uc001srw.4	Q96MD2	OTTHUMG00000168763	ENST00000398055.3:c.192C>G	chr12.hg19:g.64615826G>C		36.0	0.0	.		60.0	18.0	.	NM_152440	C9JX54|Q8IYA0	Silent	SNP	ENST00000398055.3	hg19	CCDS41803.1																																																																																			.	.	.	none		0.637	C12orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400921.1	NM_152440	
PEBP1	5037	hgsc.bcm.edu	37	12	118577333	118577333	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr12:118577333G>A	ENST00000261313.2	+	3	675	c.323G>A	c.(322-324)gGc>gAc	p.G108D	PEBP1_ENST00000542939.1_3'UTR	NM_002567.2	NP_002558.1	P30086	PEBP1_HUMAN	phosphatidylethanolamine binding protein 1	108	Interaction with RAF1.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|phosphatidylethanolamine binding (GO:0008429)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|serine-type endopeptidase inhibitor activity (GO:0004867)			ovary(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GATTATGTGGGCTCGGGGCCT	0.522																																					p.G108D	NSCLC(44;94 1357 12187 49467)	Atlas-SNP	.											.	PEBP1	13	.	0			c.G323A						PASS	.						123.0	110.0	115.0					12																	118577333		2203	4300	6503	SO:0001583	missense	5037	exon3			ATGTGGGCTCGGG	X85033	CCDS9187.1	12q24	2009-06-16	2006-02-16	2006-02-16	ENSG00000089220	ENSG00000089220			8630	protein-coding gene	gene with protein product	"""Raf kinase inhibitory protein"", ""hippocampal cholinergic neurostimulating peptide"""	604591	"""prostatic binding protein"""	PBP		15782137	Standard	NM_002567		Approved	RKIP, HCNP, PEBP	uc001twu.1	P30086	OTTHUMG00000168860	ENST00000261313.2:c.323G>A	chr12.hg19:g.118577333G>A	ENSP00000261313:p.Gly108Asp	193.0	0.0	.		249.0	101.0	.	NM_002567	B2R4S1	Missense_Mutation	SNP	ENST00000261313.2	hg19	CCDS9187.1	.	.	.	.	.	.	.	.	.	.	G	34	5.318256	0.95682	.	.	ENSG00000089220	ENST00000261313;ENST00000418769	T	0.56776	0.44	5.43	5.43	0.79202	.	0.047800	0.85682	D	0.000000	D	0.82751	0.5105	H	0.96805	3.885	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.85130	0.997;0.994	D	0.88070	0.2800	10	0.59425	D	0.04	.	19.2412	0.93883	0.0:0.0:1.0:0.0	.	108;108	B4DRT4;P30086	.;PEBP1_HUMAN	D	108	ENSP00000261313:G108D	ENSP00000261313:G108D	G	+	2	0	PEBP1	117061716	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	9.447000	0.97595	2.543000	0.85770	0.563000	0.77884	GGC	.	.	.	none		0.522	PEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401405.1	NM_002567	
RNF31	55072	hgsc.bcm.edu	37	14	24617213	24617213	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr14:24617213C>G	ENST00000324103.6	+	2	541	c.221C>G	c.(220-222)aCg>aGg	p.T74R	RNF31_ENST00000559275.1_5'UTR|RNF31_ENST00000382687.3_5'Flank|PSME2_ENST00000216802.5_5'Flank|PSME2_ENST00000560410.1_5'Flank|PSME2_ENST00000471700.2_5'Flank|RNF31_ENST00000557878.1_3'UTR	NM_017999.4	NP_060469.4	Q96EP0	RNF31_HUMAN	ring finger protein 31	74	Polyubiquitin-binding.				CD40 signaling pathway (GO:0023035)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein linear polyubiquitination (GO:0097039)|protein polyubiquitination (GO:0000209)|T cell receptor signaling pathway (GO:0050852)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|LUBAC complex (GO:0071797)	ligase activity (GO:0016874)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|prostate(4)|skin(2)|soft_tissue(1)	39				GBM - Glioblastoma multiforme(265;0.00861)		ACCCTGTCCACGGCTCTGAAC	0.607																																					p.T74R		Atlas-SNP	.											.	RNF31	95	.	0			c.C221G						PASS	.						80.0	85.0	83.0					14																	24617213		2063	4198	6261	SO:0001583	missense	55072	exon2			TGTCCACGGCTCT	AK000973	CCDS41931.1	14q11.2	2012-09-20			ENSG00000092098	ENSG00000092098		"""RING-type (C3HC4) zinc fingers"""	16031	protein-coding gene	gene with protein product	"""HOIL-1-interacting protein"""	612487				10422847	Standard	NM_017999		Approved	ZIBRA, FLJ10111, FLJ23501, HOIP	uc001wmn.1	Q96EP0	OTTHUMG00000028798	ENST00000324103.6:c.221C>G	chr14.hg19:g.24617213C>G	ENSP00000315112:p.Thr74Arg	127.0	0.0	.		176.0	55.0	.	NM_017999	A0A962|Q86VI2|Q8TEI0|Q96GB4|Q96NF1|Q9H5F1|Q9NWD2	Missense_Mutation	SNP	ENST00000324103.6	hg19	CCDS41931.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.498171	0.85069	.	.	ENSG00000092098	ENST00000324103	T	0.47869	0.83	5.31	5.31	0.75309	PUB domain (1);	0.130527	0.51477	D	0.000093	T	0.61135	0.2323	L	0.44542	1.39	0.80722	D	1	D	0.89917	1.0	D	0.70716	0.97	T	0.55730	-0.8095	9	.	.	.	-13.9514	17.9131	0.88940	0.0:1.0:0.0:0.0	.	74	Q96EP0	RNF31_HUMAN	R	74	ENSP00000315112:T74R	.	T	+	2	0	RNF31	23687053	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.011000	0.64011	2.779000	0.95612	0.655000	0.94253	ACG	.	.	.	none		0.607	RNF31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071921.3	NM_017999	
KIAA0391	9692	hgsc.bcm.edu	37	14	35593087	35593087	+	Silent	SNP	T	T	C			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr14:35593087T>C	ENST00000557565.1	+	2	1017	c.636T>C	c.(634-636)ggT>ggC	p.G212G	PPP2R3C_ENST00000261475.5_5'Flank|KIAA0391_ENST00000604948.1_Silent_p.G117G|KIAA0391_ENST00000534898.4_Silent_p.G212G|PPP2R3C_ENST00000555644.1_5'Flank|KIAA0391_ENST00000603588.1_Intron|KIAA0391_ENST00000605870.1_Intron|KIAA0391_ENST00000603544.1_Silent_p.G212G|KIAA0391_ENST00000321130.10_Silent_p.G212G|KIAA0391_ENST00000250377.7_Silent_p.G117G	NM_001282234.1	NP_001269163.1	O15091	MRRP3_HUMAN	KIAA0391	212					tRNA processing (GO:0008033)	mitochondrion (GO:0005739)				central_nervous_system(1)|endometrium(4)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	14	Breast(36;0.0545)|Hepatocellular(127;0.158)|Prostate(35;0.184)		Lung(238;2.93e-05)|LUAD - Lung adenocarcinoma(48;3.86e-05)|Epithelial(34;0.0114)|all cancers(34;0.0277)	GBM - Glioblastoma multiforme(112;0.0593)		AACCTAGAGGTTACAGTCTTC	0.358																																					p.G212G		Atlas-SNP	.											.	KIAA0391	35	.	0			c.T636C						PASS	.						49.0	50.0	49.0					14																	35593087		2203	4300	6503	SO:0001819	synonymous_variant	9692	exon2			TAGAGGTTACAGT	AB002389	CCDS32063.1, CCDS58312.1, CCDS58313.1, CCDS58314.1	14q13.2	2013-06-18			ENSG00000100890	ENSG00000100890			19958	protein-coding gene	gene with protein product	"""mitochondrial RNase P subunit 3"", ""proteinaceous RNase P"""	609947				9205841, 18984158	Standard	NM_001256678		Approved	MRPP3, PRORP	uc001wsy.2	O15091		ENST00000557565.1:c.636T>C	chr14.hg19:g.35593087T>C		146.0	0.0	.		69.0	4.0	.	NM_014672	B4DXD9|B4E0S8|B4E211|C4AM93|D3DS99|D3DSA1|Q86SZ4|Q86YB5|Q8N5L5	Silent	SNP	ENST00000557565.1	hg19	CCDS32063.1																																																																																			.	.	.	none		0.358	KIAA0391-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000411280.1	NM_014672	
SERPINA1	5265	hgsc.bcm.edu	37	14	94849213	94849213	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr14:94849213T>G	ENST00000448921.1	-	4	934	c.362A>C	c.(361-363)cAg>cCg	p.Q121P	SERPINA1_ENST00000449399.3_Missense_Mutation_p.Q121P|SERPINA1_ENST00000404814.4_Missense_Mutation_p.Q121P|SERPINA1_ENST00000437397.1_Missense_Mutation_p.Q121P|SERPINA1_ENST00000393087.4_Missense_Mutation_p.Q121P|SERPINA1_ENST00000393088.4_Missense_Mutation_p.Q121P|SERPINA1_ENST00000440909.1_Missense_Mutation_p.Q121P|SERPINA1_ENST00000355814.4_Missense_Mutation_p.Q121P|SERPINA1_ENST00000402629.1_Missense_Mutation_p.Q121P|SERPINA1_ENST00000555289.1_5'Flank	NM_001002236.2|NM_001127701.1|NM_001127703.1|NM_001127704.1|NM_001127705.1	NP_001002236.1|NP_001121173.1|NP_001121175.1|NP_001121176.1|NP_001121177.1	P01009	A1AT_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1	121					acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of proteolysis (GO:0030162)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)	glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|skin(6)|stomach(1)	24		all_cancers(154;0.0649)|all_epithelial(191;0.223)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)		GAGGAGTTCCTGGAAGCCTTC	0.572																																					p.Q121P		Atlas-SNP	.											.	SERPINA1	51	.	0			c.A362C						PASS	.						57.0	56.0	57.0					14																	94849213		2203	4300	6503	SO:0001583	missense	5265	exon4			AGTTCCTGGAAGC	X01683	CCDS9925.1	14q32.1	2014-02-18	2005-08-18		ENSG00000197249	ENSG00000197249		"""Serine (or cysteine) peptidase inhibitors"""	8941	protein-coding gene	gene with protein product	"""protease inhibitor 1 (anti-elastase), alpha-1-antitrypsin"""	107400	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1"""	PI		24172014	Standard	NM_000295		Approved	AAT, A1A, PI1, alpha-1-antitrypsin, A1AT, alpha1AT	uc010aux.3	P01009	OTTHUMG00000150355	ENST00000448921.1:c.362A>C	chr14.hg19:g.94849213T>G	ENSP00000416066:p.Gln121Pro	101.0	0.0	.		122.0	29.0	.	NM_001127701	A6PX14|B2RDQ8|Q0PVP5|Q13672|Q53XB8|Q5U0M1|Q7M4R2|Q86U18|Q86U19|Q96BF9|Q96ES1|Q9P1P0|Q9UCE6|Q9UCM3	Missense_Mutation	SNP	ENST00000448921.1	hg19	CCDS9925.1	.	.	.	.	.	.	.	.	.	.	T	14.75	2.629267	0.46944	.	.	ENSG00000197249	ENST00000440909;ENST00000448921;ENST00000437397;ENST00000355814;ENST00000393087;ENST00000393088;ENST00000404814;ENST00000449399;ENST00000402629;ENST00000554720;ENST00000556091;ENST00000557492	D;D;D;D;D;D;D;D;D;T;D;D	0.88431	-2.38;-2.38;-2.38;-2.38;-2.38;-2.38;-2.38;-2.38;-2.38;-0.96;-1.72;-1.72	5.8	-0.59	0.11679	Serpin domain (3);	0.589490	0.16883	N	0.195601	D	0.91472	0.7308	M	0.90082	3.085	0.21020	N	0.999801	B;B	0.25486	0.127;0.091	B;B	0.41946	0.136;0.371	D	0.87168	0.2219	10	0.72032	D	0.01	.	7.1129	0.25401	0.0:0.3182:0.1125:0.5693	.	121;121	P01009-2;P01009	.;A1AT_HUMAN	P	121;121;121;121;121;121;121;121;121;35;121;121	ENSP00000390299:Q121P;ENSP00000416066:Q121P;ENSP00000408474:Q121P;ENSP00000348068:Q121P;ENSP00000376802:Q121P;ENSP00000376803:Q121P;ENSP00000385960:Q121P;ENSP00000416354:Q121P;ENSP00000386094:Q121P;ENSP00000450561:Q35P;ENSP00000452169:Q121P;ENSP00000452452:Q121P	ENSP00000348068:Q121P	Q	-	2	0	SERPINA1	93918966	0.002000	0.14202	0.075000	0.20258	0.907000	0.53573	-0.082000	0.11304	-0.099000	0.12263	-0.379000	0.06801	CAG	.	.	.	none		0.572	SERPINA1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317768.2	NM_001002235	
WDR20	91833	hgsc.bcm.edu	37	14	102675938	102675938	+	Silent	SNP	T	T	C			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr14:102675938T>C	ENST00000342702.3	+	3	1462	c.1431T>C	c.(1429-1431)gaT>gaC	p.D477D	WDR20_ENST00000335263.5_Silent_p.D477D|WDR20_ENST00000499851.2_Silent_p.D220D|WDR20_ENST00000322340.5_Intron|WDR20_ENST00000556511.2_Silent_p.D416D|WDR20_ENST00000454394.2_Silent_p.D508D|WDR20_ENST00000545563.1_Silent_p.D304D|WDR20_ENST00000299135.6_3'UTR|WDR20_ENST00000556807.1_Silent_p.D416D|WDR20_ENST00000424963.2_Silent_p.D353D	NM_001242418.1|NM_144574.3	NP_001229347.1|NP_653175.2	Q8TBZ3	WDR20_HUMAN	WD repeat domain 20	477										breast(1)|large_intestine(2)|lung(4)|prostate(1)	8						ACGAGAAAGATCACAAGCGAA	0.473											OREG0022939	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D508D		Atlas-SNP	.											.	WDR20	35	.	0			c.T1524C						PASS	.						114.0	105.0	108.0					14																	102675938		2203	4300	6503	SO:0001819	synonymous_variant	91833	exon4			GAAAGATCACAAG	BC028387	CCDS9968.1, CCDS9969.1, CCDS9970.1, CCDS55942.1, CCDS55943.1, CCDS55944.1, CCDS55945.1	14q32.31	2013-01-09				ENSG00000140153		"""WD repeat domain containing"""	19667	protein-coding gene	gene with protein product							Standard	NM_181291		Approved	DMR, MGC33177, FLJ33659	uc010txu.2	Q8TBZ3		ENST00000342702.3:c.1431T>C	chr14.hg19:g.102675938T>C		204.0	0.0	.	1368	239.0	78.0	.	NM_001242417	B4DN18|E7EUY8|F8W9S4|G3V2F8|G3V5R0|H0YJJ1|Q86TU2|Q8NCN7|Q8WXX2|Q9UF86	Silent	SNP	ENST00000342702.3	hg19	CCDS9969.1	.	.	.	.	.	.	.	.	.	.	T	3.721	-0.057478	0.07317	.	.	ENSG00000140153	ENST00000556511	.	.	.	5.73	-3.12	0.05282	.	.	.	.	.	T	0.63604	0.2525	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.63093	-0.6714	4	.	.	.	.	14.198	0.65684	0.0:0.4331:0.0:0.5669	.	.	.	.	P	408	.	.	S	+	1	0	WDR20	101745691	0.985000	0.35326	0.982000	0.44146	0.999000	0.98932	0.241000	0.18065	-0.454000	0.07066	0.533000	0.62120	TCA	.	.	.	none		0.473	WDR20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414963.1	NM_181291	
PLCB2	5330	hgsc.bcm.edu	37	15	40590557	40590557	+	Missense_Mutation	SNP	G	G	A	rs201305253	byFrequency	TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr15:40590557G>A	ENST00000260402.3	-	11	1271	c.1022C>T	c.(1021-1023)tCg>tTg	p.S341L	PLCB2_ENST00000456256.2_Missense_Mutation_p.S341L|PLCB2-AS1_ENST00000559520.1_RNA|PLCB2_ENST00000557821.1_Missense_Mutation_p.S341L	NM_001284297.1|NM_004573.2	NP_001271226.1|NP_004564.2	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	341	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				activation of phospholipase C activity (GO:0007202)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|sensory perception of bitter taste (GO:0050913)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(3)	39		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		CATCTCAGCCGAGGAGAGGCC	0.627													G|||	2	0.000399361	0.0008	0.0	5008	,	,		20598	0.0		0.0	False		,,,				2504	0.001				p.S341L		Atlas-SNP	.											.	PLCB2	177	.	0			c.C1022T						PASS	.						33.0	36.0	35.0					15																	40590557		2082	4236	6318	SO:0001583	missense	5330	exon11			TCAGCCGAGGAGA		CCDS42020.1, CCDS61591.1, CCDS61592.1, CCDS73704.1	15q15.1	2012-01-23			ENSG00000137841	ENSG00000137841	3.1.4.11		9055	protein-coding gene	gene with protein product		604114				1644792, 9925923	Standard	XM_005254448		Approved	FLJ38135	uc001zld.3	Q00722	OTTHUMG00000172412	ENST00000260402.3:c.1022C>T	chr15.hg19:g.40590557G>A	ENSP00000260402:p.Ser341Leu	100.0	0.0	.		125.0	31.0	.	NM_004573	A8K6J2|B9EGH5	Missense_Mutation	SNP	ENST00000260402.3	hg19	CCDS42020.1	.	.	.	.	.	.	.	.	.	.	G	32	5.183791	0.94885	.	.	ENSG00000137841	ENST00000260402;ENST00000456256	T;T	0.59772	0.24;0.24	4.38	4.38	0.52667	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.136952	0.50627	D	0.000108	D	0.83151	0.5192	H	0.95712	3.71	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.999;0.952;0.997	D	0.88893	0.3347	10	0.87932	D	0	.	17.4798	0.87670	0.0:0.0:1.0:0.0	.	341;341;341	B9EGH5;Q00722-2;Q00722	.;.;PLCB2_HUMAN	L	341	ENSP00000260402:S341L;ENSP00000411991:S341L	ENSP00000260402:S341L	S	-	2	0	PLCB2	38377849	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.657000	0.98554	2.438000	0.82558	0.563000	0.77884	TCG	.	G|0.999;A|0.001	0.001	weak		0.627	PLCB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418430.1		
ANKDD1A	348094	hgsc.bcm.edu	37	15	65239709	65239709	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr15:65239709G>T	ENST00000380230.3	+	13	1276	c.1247G>T	c.(1246-1248)tGg>tTg	p.W416L	ANKDD1A_ENST00000395720.1_Missense_Mutation_p.W416L|ANKDD1A_ENST00000357698.3_Missense_Mutation_p.W384L|ANKDD1A_ENST00000395723.1_Missense_Mutation_p.W293L	NM_182703.3	NP_874362.3	Q495B1	AKD1A_HUMAN	ankyrin repeat and death domain containing 1A	416	Death. {ECO:0000255|PROSITE- ProRule:PRU00064}.				signal transduction (GO:0007165)					NS(1)|endometrium(1)|large_intestine(10)|liver(2)|lung(4)|ovary(1)|prostate(2)	21						TCTGTGCTGTGGCGGCTGGCC	0.597																																					p.W416L		Atlas-SNP	.											.	ANKDD1A	47	.	0			c.G1247T						PASS	.						45.0	40.0	42.0					15																	65239709		2202	4299	6501	SO:0001583	missense	348094	exon13			TGCTGTGGCGGCT		CCDS10197.2	15q22.31	2013-01-10	2006-02-16		ENSG00000166839	ENSG00000166839		"""Ankyrin repeat domain containing"""	28002	protein-coding gene	gene with protein product						12477932	Standard	NM_182703		Approved	FLJ25870	uc002aoa.3	Q495B1	OTTHUMG00000133051	ENST00000380230.3:c.1247G>T	chr15.hg19:g.65239709G>T	ENSP00000369579:p.Trp416Leu	53.0	0.0	.		65.0	22.0	.	NM_182703	Q495B2|Q495B3|Q8N7A0|Q8NBS5	Missense_Mutation	SNP	ENST00000380230.3	hg19	CCDS10197.2	.	.	.	.	.	.	.	.	.	.	G	23.9	4.469077	0.84533	.	.	ENSG00000166839	ENST00000380230;ENST00000357698;ENST00000395720;ENST00000395723	D;D;D;D	0.84070	-1.8;-1.8;-1.8;-1.8	4.63	4.63	0.57726	Death (1);DEATH-like (1);	0.000000	0.64402	D	0.000017	D	0.85758	0.5771	M	0.78637	2.42	0.80722	D	1	P	0.45283	0.855	P	0.48524	0.58	D	0.83545	0.0098	10	0.16420	T	0.52	-16.8697	16.2408	0.82408	0.0:0.0:1.0:0.0	.	416	Q495B1	AKD1A_HUMAN	L	416;384;416;293	ENSP00000369579:W416L;ENSP00000350329:W384L;ENSP00000379070:W416L;ENSP00000379073:W293L	ENSP00000350329:W384L	W	+	2	0	ANKDD1A	63026762	1.000000	0.71417	0.995000	0.50966	0.848000	0.48234	9.170000	0.94795	2.423000	0.82170	0.655000	0.94253	TGG	.	.	.	none		0.597	ANKDD1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256705.2	NM_182703	
FAM154B	283726	hgsc.bcm.edu	37	15	82574679	82574679	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr15:82574679A>C	ENST00000339465.5	+	3	542	c.473A>C	c.(472-474)cAt>cCt	p.H158P	FAM154B_ENST00000427381.2_Missense_Mutation_p.H143P|FAM154B_ENST00000565501.1_3'UTR	NM_001008226.1	NP_001008227.1	Q658L1	F154B_HUMAN	family with sequence similarity 154, member B	158										autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|skin(2)	19						TATATACCTCATCAGCTTGAA	0.433																																					p.H158P		Atlas-SNP	.											.	FAM154B	50	.	0			c.A473C						PASS	.						112.0	111.0	111.0					15																	82574679		2203	4300	6503	SO:0001583	missense	283726	exon3			TACCTCATCAGCT	AL833762	CCDS32310.1	15q25.2	2008-02-21				ENSG00000188659			33727	protein-coding gene	gene with protein product							Standard	XM_005254317		Approved	DKFZp666G057	uc002bgv.3	Q658L1		ENST00000339465.5:c.473A>C	chr15.hg19:g.82574679A>C	ENSP00000340445:p.His158Pro	370.0	0.0	.		51.0	9.0	.	NM_001008226	B4E2M2	Missense_Mutation	SNP	ENST00000339465.5	hg19	CCDS32310.1	.	.	.	.	.	.	.	.	.	.	A	19.09	3.760509	0.69763	.	.	ENSG00000188659	ENST00000339465;ENST00000427381	T;T	0.14391	2.51;2.51	3.9	3.9	0.45041	.	0.144157	0.45126	D	0.000381	T	0.35219	0.0924	M	0.77103	2.36	0.51012	D	0.999907	D;D	0.67145	0.996;0.992	D;D	0.69824	0.966;0.953	T	0.12142	-1.0559	10	0.37606	T	0.19	-13.415	13.1531	0.59500	1.0:0.0:0.0:0.0	.	143;158	B4E2M2;Q658L1	.;F154B_HUMAN	P	158;143	ENSP00000340445:H158P;ENSP00000403743:H143P	ENSP00000340445:H158P	H	+	2	0	FAM154B	80361734	0.998000	0.40836	0.633000	0.29310	0.980000	0.70556	4.775000	0.62346	1.751000	0.51876	0.438000	0.28831	CAT	.	.	.	none		0.433	FAM154B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419644.1	NM_001008226	
PALB2	79728	hgsc.bcm.edu	37	16	23646407	23646407	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr16:23646407A>T	ENST00000261584.4	-	4	1612	c.1460T>A	c.(1459-1461)gTc>gAc	p.V487D		NM_024675.3	NP_078951.2	Q86YC2	PALB2_HUMAN	partner and localizer of BRCA2	487	DNA-binding (with the preference D loop > dsDNA > ssDNA).				DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|inner cell mass cell proliferation (GO:0001833)|mesoderm development (GO:0007498)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|post-anal tail morphogenesis (GO:0036342)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(3)	55				GBM - Glioblastoma multiforme(48;0.0167)		GGGAGAGCTGACTTTAGTTAA	0.458			"""F, N, Mis"""			"""Wilms tumor, medulloblastoma, AML ,breast"""		Involved in tolerance or repair of DNA crosslinks																													p.V487D		Atlas-SNP	.	yes	Rec		"""Fanconi anaemia N, breast cancer susceptibility """	16	16p12.1	79728	partner and localizer of BRCA2		"""L, O, E"""	.	PALB2	108	.	0			c.T1460A						PASS	.						131.0	131.0	131.0					16																	23646407		2197	4300	6497	SO:0001583	missense	79728	exon4			GAGCTGACTTTAG		CCDS32406.1	16p12.1	2014-09-17				ENSG00000083093		"""Fanconi anemia, complementation groups"""	26144	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group N"""	610355				16793542, 17200672	Standard	NM_024675		Approved	FLJ21816, FANCN	uc002dlx.1	Q86YC2		ENST00000261584.4:c.1460T>A	chr16.hg19:g.23646407A>T	ENSP00000261584:p.Val487Asp	403.0	0.0	.		179.0	89.0	.	NM_024675	A6NIE1|Q8N7Y6|Q8ND31|Q9H6W1	Missense_Mutation	SNP	ENST00000261584.4	hg19	CCDS32406.1	.	.	.	.	.	.	.	.	.	.	A	10.89	1.479867	0.26511	.	.	ENSG00000083093	ENST00000261584	T	0.15603	2.41	5.67	1.89	0.25635	.	0.327339	0.25935	N	0.027358	T	0.28267	0.0698	M	0.63428	1.95	0.19775	N	0.999954	D	0.67145	0.996	P	0.62298	0.9	T	0.04693	-1.0933	10	0.59425	D	0.04	-1.5018	4.5066	0.11891	0.6154:0.2179:0.1667:0.0	.	487	Q86YC2	PALB2_HUMAN	D	487	ENSP00000261584:V487D	ENSP00000261584:V487D	V	-	2	0	PALB2	23553908	0.059000	0.20769	0.013000	0.15412	0.188000	0.23474	1.278000	0.33179	0.529000	0.28599	0.533000	0.62120	GTC	.	.	.	none		0.458	PALB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435287.2	NM_024675	
CYB5D1	124637	hgsc.bcm.edu	37	17	7762716	7762716	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr17:7762716C>T	ENST00000332439.4	+	4	625	c.473C>T	c.(472-474)tCc>tTc	p.S158F	LSMD1_ENST00000335155.5_5'Flank|LSMD1_ENST00000575071.1_5'Flank|LSMD1_ENST00000576384.1_5'Flank|LSMD1_ENST00000575208.1_5'Flank|LSMD1_ENST00000333775.5_5'Flank|CYB5D1_ENST00000571846.1_Intron|CYB5D1_ENST00000570446.1_Missense_Mutation_p.S30F|LSMD1_ENST00000575771.1_5'Flank|LSMD1_ENST00000576861.1_Intron|LSMD1_ENST00000570555.1_Intron	NM_144607.4	NP_653208.2	Q6P9G0	CB5D1_HUMAN	cytochrome b5 domain containing 1	158							heme binding (GO:0020037)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|large_intestine(2)|skin(2)	6		all_cancers(10;0.11)|Prostate(122;0.219)				GTTCTGGAGTCCATATGGGAA	0.502																																					p.S158F		Atlas-SNP	.											.	CYB5D1	16	.	0			c.C473T						PASS	.						47.0	45.0	46.0					17																	7762716		2203	4300	6503	SO:0001583	missense	124637	exon4			TGGAGTCCATATG	AK057061	CCDS11123.1	17p13.1	2006-01-12	2006-01-12						26516	protein-coding gene	gene with protein product						12477932	Standard	NM_144607		Approved	FLJ32499	uc002gjb.4	Q6P9G0		ENST00000332439.4:c.473C>T	chr17.hg19:g.7762716C>T	ENSP00000331479:p.Ser158Phe	107.0	0.0	.		111.0	24.0	.	NM_144607	D3DTQ8|Q96DM7	Missense_Mutation	SNP	ENST00000332439.4	hg19	CCDS11123.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.968751	0.74131	.	.	ENSG00000182224	ENST00000332439	T	0.45668	0.89	5.27	5.27	0.74061	.	0.155423	0.42821	D	0.000659	T	0.40372	0.1114	M	0.64997	1.995	0.50467	D	0.999875	B	0.31910	0.346	B	0.26864	0.074	T	0.42447	-0.9451	10	0.72032	D	0.01	-23.6807	13.3117	0.60384	0.1589:0.841:0.0:0.0	.	158	Q6P9G0	CB5D1_HUMAN	F	158	ENSP00000331479:S158F	ENSP00000331479:S158F	S	+	2	0	CYB5D1	7703441	0.999000	0.42202	0.979000	0.43373	0.882000	0.50991	4.339000	0.59322	2.449000	0.82847	0.462000	0.41574	TCC	.	.	.	none		0.502	CYB5D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440841.1	NM_144607	
ERBB2	2064	hgsc.bcm.edu	37	17	37876080	37876080	+	Silent	SNP	A	A	C			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr17:37876080A>C	ENST00000269571.5	+	16	2098	c.1939A>C	c.(1939-1941)Aga>Cga	p.R647R	ERBB2_ENST00000584450.1_Silent_p.R647R|ERBB2_ENST00000584601.1_Silent_p.R617R|ERBB2_ENST00000406381.2_Silent_p.R617R|ERBB2_ENST00000540147.1_Silent_p.R617R|ERBB2_ENST00000541774.1_Silent_p.R632R|ERBB2_ENST00000445658.2_Silent_p.R371R			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	647					axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	CGCCGAGCAGAGAGCCAGGTT	0.597		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																											p.R647R		Atlas-SNP	.		Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	.	ERBB2	429	.	0			c.A1939C						PASS	.						153.0	131.0	138.0					17																	37876080		2203	4300	6503	SO:0001819	synonymous_variant	2064	exon16			GAGCAGAGAGCCA	X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.1939A>C	chr17.hg19:g.37876080A>C		243.0	0.0	.		471.0	93.0	.	NM_004448	B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Silent	SNP	ENST00000269571.5	hg19	CCDS32642.1																																																																																			.	.	.	none		0.597	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445621.2		
ATXN7L3	56970	hgsc.bcm.edu	37	17	42275086	42275086	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr17:42275086C>A	ENST00000454077.2	-	2	63	c.64G>T	c.(64-66)Gag>Tag	p.E22*	ATXN7L3_ENST00000593073.1_Intron|ATXN7L3_ENST00000389384.4_Nonsense_Mutation_p.E22*|CTB-175E5.7_ENST00000586560.1_RNA	NM_020218.1	NP_064603.1			ataxin 7-like 3											kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(2)	12		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.113)		GCGTATATCTCCTGAGCGATG	0.577																																					p.E22X		Atlas-SNP	.											.	ATXN7L3	31	.	0			c.G64T						PASS	.						96.0	95.0	96.0					17																	42275086		1985	4163	6148	SO:0001587	stop_gained	56970	exon2			ATATCTCCTGAGC	AK056002	CCDS42345.1, CCDS45697.1	17q21	2010-03-10			ENSG00000087152	ENSG00000087152			25416	protein-coding gene	gene with protein product						15115762	Standard	NM_001098833		Approved	DKFZp761G2113	uc002ifz.3	Q14CW9		ENST00000454077.2:c.64G>T	chr17.hg19:g.42275086C>A	ENSP00000397259:p.Glu22*	159.0	0.0	.		328.0	58.0	.	NM_020218		Nonsense_Mutation	SNP	ENST00000454077.2	hg19	CCDS45697.1	.	.	.	.	.	.	.	.	.	.	C	17.71	3.456493	0.63401	.	.	ENSG00000087152	ENST00000454077;ENST00000389384	.	.	.	4.47	4.47	0.54385	.	0.064498	0.64402	U	0.000011	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	14.0541	0.64756	0.0:1.0:0.0:0.0	.	.	.	.	X	22	.	ENSP00000374035:E22X	E	-	1	0	ATXN7L3	39630612	1.000000	0.71417	1.000000	0.80357	0.174000	0.22865	7.490000	0.81461	2.010000	0.58986	0.655000	0.94253	GAG	.	.	.	none		0.577	ATXN7L3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457724.1		
ABCA6	23460	hgsc.bcm.edu	37	17	67108373	67108373	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr17:67108373C>T	ENST00000284425.2	-	16	2257	c.2083G>A	c.(2083-2085)Ggt>Agt	p.G695S		NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6	695	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)					ATAGAAGAACCTGCACACTTC	0.368																																					p.G695S		Atlas-SNP	.											ABCA6,middle_lobe,carcinoma,0,1	ABCA6	210	.	0			c.G2083A						PASS	.						156.0	164.0	162.0					17																	67108373		2203	4300	6503	SO:0001583	missense	23460	exon16			AAGAACCTGCACA	U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262		"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504				8894702	Standard	NM_080284		Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.2083G>A	chr17.hg19:g.67108373C>T	ENSP00000284425:p.Gly695Ser	548.0	0.0	.		63.0	28.0	.	NM_080284	Q6NSH9|Q8N856|Q8WWZ6	Missense_Mutation	SNP	ENST00000284425.2	hg19	CCDS11683.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.599754	0.87055	.	.	ENSG00000154262	ENST00000284425	T	0.80393	-1.37	4.65	4.65	0.58169	ABC transporter-like (1);	0.116516	0.38058	N	0.001826	D	0.94308	0.8171	H	0.99261	4.49	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96675	0.9499	10	0.87932	D	0	.	17.0385	0.86483	0.0:1.0:0.0:0.0	.	695	Q8N139	ABCA6_HUMAN	S	695	ENSP00000284425:G695S	ENSP00000284425:G695S	G	-	1	0	ABCA6	64619968	1.000000	0.71417	1.000000	0.80357	0.685000	0.39939	6.512000	0.73737	2.568000	0.86640	0.655000	0.94253	GGT	.	.	.	none		0.368	ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450463.1	NM_080284	
SPHK1	8877	hgsc.bcm.edu	37	17	74382029	74382029	+	Intron	SNP	G	G	A			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr17:74382029G>A	ENST00000545180.1	+	5	819				SPHK1_ENST00000323374.4_Intron|SPHK1_ENST00000392496.3_Intron|SPHK1_ENST00000592299.1_Intron|SPHK1_ENST00000590959.1_Missense_Mutation_p.G6S			Q9NYA1	SPHK1_HUMAN	sphingosine kinase 1						'de novo' posttranslational protein folding (GO:0051084)|blood vessel development (GO:0001568)|brain development (GO:0007420)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to starvation (GO:0009267)|cyclooxygenase pathway (GO:0019371)|female pregnancy (GO:0007565)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|lipid phosphorylation (GO:0046834)|negative regulation of apoptotic process (GO:0043066)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neurotransmitter secretion (GO:0001956)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of smooth muscle contraction (GO:0045987)|protein folding (GO:0006457)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of interleukin-1 beta production (GO:0032651)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|response to amine (GO:0014075)|response to ATP (GO:0033198)|response to interleukin-1 (GO:0070555)|response to magnesium ion (GO:0032026)|response to progesterone (GO:0032570)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingoid catabolic process (GO:0046521)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|D-erythro-sphingosine kinase activity (GO:0017050)|diacylglycerol kinase activity (GO:0004143)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|NAD+ kinase activity (GO:0003951)|protein phosphatase 2A binding (GO:0051721)|sphinganine kinase activity (GO:0008481)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)	11					Fingolimod(DB08868)	CCTAGTGGTCGGTTGCGGACG	0.667											OREG0024750	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G6S	GBM(90;966 1307 27369 33775 44498)	Atlas-SNP	.											.	SPHK1	24	.	0			c.G16A						PASS	.						23.0	24.0	24.0					17																	74382029		1923	4109	6032	SO:0001627	intron_variant	8877	exon3			GTGGTCGGTTGCG	BC030553	CCDS11744.1, CCDS45785.1, CCDS59297.1	17q25.2	2004-02-18				ENSG00000176170			11240	protein-coding gene	gene with protein product		603730				9726979	Standard	NM_182965		Approved	SPHK	uc002jrj.2	Q9NYA1		ENST00000545180.1:c.11-37G>A	chr17.hg19:g.74382029G>A		23.0	0.0	.	1152	38.0	19.0	.	NM_021972	Q8N632|Q96GK1|Q9HD92|Q9NY70|Q9NYL3	Missense_Mutation	SNP	ENST00000545180.1	hg19	CCDS45785.1																																																																																			.	.	.	none		0.667	SPHK1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450113.1	NM_182965, NM_021972	
ACSBG2	81616	hgsc.bcm.edu	37	19	6177251	6177251	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr19:6177251T>G	ENST00000586696.1	+	8	1026	c.750T>G	c.(748-750)atT>atG	p.I250M	ACSBG2_ENST00000252669.5_Missense_Mutation_p.I250M|ACSBG2_ENST00000588304.1_Missense_Mutation_p.I200M|ACSBG2_ENST00000591403.1_Missense_Mutation_p.I250M|ACSBG2_ENST00000588485.1_Missense_Mutation_p.I63M|ACSBG2_ENST00000591741.1_3'UTR			Q5FVE4	ACBG2_HUMAN	acyl-CoA synthetase bubblegum family member 2	250					cell differentiation (GO:0030154)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid metabolic process (GO:0001676)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acyl-CoA hydrolase activity (GO:0047617)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)	p.I250M(3)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(3)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TCACGTGGATTGCAGGAGCAG	0.433																																					p.I250M		Atlas-SNP	.											ACSBG2,NS,carcinoma,0,4	ACSBG2	83	.	3	Substitution - Missense(3)	endometrium(2)|kidney(1)	c.T750G						PASS	.						97.0	69.0	78.0					19																	6177251		2203	4300	6503	SO:0001583	missense	81616	exon8			GTGGATTGCAGGA		CCDS12159.1, CCDS74269.1	19p13.3	2012-10-02			ENSG00000130377	ENSG00000130377		"""Acyl-CoA synthetase family"""	24174	protein-coding gene	gene with protein product	"""bubblegum related protein"""	614363				11230166	Standard	XM_005259653		Approved	BGR, PRTD-NY3, DKFZp434K1635	uc002meh.1	Q5FVE4	OTTHUMG00000180754	ENST00000586696.1:c.750T>G	chr19.hg19:g.6177251T>G	ENSP00000465589:p.Ile250Met	76.0	0.0	.		72.0	5.0	.	NM_030924	B3KSF2|Q6UWJ3|Q7Z5A0|Q8WW03|Q96M36|Q9BYZ3|Q9H0C4	Missense_Mutation	SNP	ENST00000586696.1	hg19	CCDS12159.1	.	.	.	.	.	.	.	.	.	.	T	8.593	0.885063	0.17540	.	.	ENSG00000130377	ENST00000252669	T	0.10477	2.87	4.48	-8.78	0.00824	AMP-dependent synthetase/ligase (1);	1.500690	0.04439	N	0.370611	T	0.03564	0.0102	N	0.03154	-0.405	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.16722	0.016;0.007	T	0.41124	-0.9526	10	0.49607	T	0.09	-6.8573	2.6506	0.04998	0.499:0.0951:0.1226:0.2833	.	250;250	B4DYU1;Q5FVE4	.;ACBG2_HUMAN	M	250	ENSP00000252669:I250M	ENSP00000252669:I250M	I	+	3	3	ACSBG2	6128251	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-3.884000	0.00342	-1.157000	0.02815	-0.778000	0.03378	ATT	.	.	.	none		0.433	ACSBG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452898.1	NM_030924	
PRKCSH	5589	hgsc.bcm.edu	37	19	11558373	11558373	+	Silent	SNP	A	A	G			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr19:11558373A>G	ENST00000589838.1	+	10	969	c.969A>G	c.(967-969)gaA>gaG	p.E323E	PRKCSH_ENST00000412601.1_Silent_p.E323E|PRKCSH_ENST00000591462.1_Silent_p.E323E|PRKCSH_ENST00000587327.1_Silent_p.E323E|PRKCSH_ENST00000592741.1_Silent_p.E323E|PRKCSH_ENST00000252455.2_Silent_p.E323E			P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H	323	Glu-rich (acidic).				cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|N-glycan processing (GO:0006491)|negative regulation of neuron projection development (GO:0010977)|nitrogen compound metabolic process (GO:0006807)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein heterooligomerization (GO:0051291)|protein N-linked glycosylation via asparagine (GO:0018279)|renal system development (GO:0072001)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|phosphoprotein binding (GO:0051219)|protein kinase C binding (GO:0005080)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(3)	19						aggaggaggaagaagaggctg	0.642																																					p.E323E		Atlas-SNP	.											PRKCSH,colon,carcinoma,0,1	PRKCSH	55	.	0			c.A969G						PASS	.																																			SO:0001819	synonymous_variant	5589	exon11			GGAGGAAGAAGAG		CCDS32911.1, CCDS45977.1, CCDS74286.1	19p13.2	2014-01-30			ENSG00000130175	ENSG00000130175	2.7.11.1	"""EF-hand domain containing"""	9411	protein-coding gene	gene with protein product		177060	"""polycystic liver disease"""	G19P1, PCLD, PLD1		12529853	Standard	NM_002743		Approved		uc002mrt.3	P14314	OTTHUMG00000182029	ENST00000589838.1:c.969A>G	chr19.hg19:g.11558373A>G		43.0	0.0	.		52.0	5.0	.	NM_001001329	A8K318|Q96BU9|Q96D06|Q9P0W9	Silent	SNP	ENST00000589838.1	hg19	CCDS32911.1																																																																																			.	.	.	none		0.642	PRKCSH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458817.1		
ATP4A	495	hgsc.bcm.edu	37	19	36050918	36050918	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr19:36050918G>T	ENST00000262623.3	-	7	873	c.845C>A	c.(844-846)gCa>gAa	p.A282E		NM_000704.2	NP_000695.2	P20648	ATP4A_HUMAN	ATPase, H+/K+ exchanging, alpha polypeptide	282					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|ion transmembrane transport (GO:0034220)|pH reduction (GO:0045851)|regulation of proton transport (GO:0010155)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|magnesium ion binding (GO:0000287)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(26)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	53	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)	CGCCAGCGATGCGATGCGCCC	0.647																																					p.A282E		Atlas-SNP	.											.	ATP4A	123	.	0			c.C845A						PASS	.						96.0	73.0	81.0					19																	36050918		2203	4300	6503	SO:0001583	missense	495	exon7			AGCGATGCGATGC		CCDS12467.1	19q13.1	2010-04-20			ENSG00000105675	ENSG00000105675	3.6.3.10	"""ATPases / P-type"""	819	protein-coding gene	gene with protein product	"""gastric H,K-ATPase alpha subunit"", ""H(+)-K(+)-ATPase alpha subunit"", ""proton pump"""	137216				1330887	Standard	NM_000704		Approved	ATP6A	uc002oal.1	P20648	OTTHUMG00000048106	ENST00000262623.3:c.845C>A	chr19.hg19:g.36050918G>T	ENSP00000262623:p.Ala282Glu	167.0	0.0	.		257.0	72.0	.	NM_000704	O00738	Missense_Mutation	SNP	ENST00000262623.3	hg19	CCDS12467.1	.	.	.	.	.	.	.	.	.	.	G	16.50	3.140434	0.56936	.	.	ENSG00000105675	ENST00000262623	D	0.92495	-3.05	3.94	3.94	0.45596	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.077790	0.48767	D	0.000178	D	0.96324	0.8801	M	0.91920	3.255	0.80722	D	1	D	0.57899	0.981	D	0.66196	0.942	D	0.97050	0.9763	10	0.87932	D	0	.	13.8309	0.63380	0.0:0.0:1.0:0.0	.	282	P20648	ATP4A_HUMAN	E	282	ENSP00000262623:A282E	ENSP00000262623:A282E	A	-	2	0	ATP4A	40742758	1.000000	0.71417	0.276000	0.24689	0.038000	0.13279	9.600000	0.98282	2.203000	0.70933	0.561000	0.74099	GCA	.	.	.	none		0.647	ATP4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109470.2	NM_000704	
UBOX5	22888	hgsc.bcm.edu	37	20	3090943	3090943	+	Silent	SNP	G	G	A			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr20:3090943G>A	ENST00000217173.2	-	5	1906	c.1435C>T	c.(1435-1437)Ctg>Ttg	p.L479L	UBOX5_ENST00000348031.2_Silent_p.L425L|UBOX5-AS1_ENST00000454019.1_RNA|UBOX5-AS1_ENST00000446537.1_RNA	NM_001267584.1|NM_014948.3	NP_001254513.1|NP_055763.1			U-box domain containing 5											endometrium(1)|kidney(2)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)|skin(1)	20						TCGGGGCCCAGGATGCTCCCA	0.587																																					p.P477L		Atlas-SNP	.											.	UBOX5	47	.	0			c.C1430T						PASS	.						60.0	69.0	66.0					20																	3090943		2203	4300	6503	SO:0001819	synonymous_variant	22888	exon5			GGCCCAGGATGCT	AB020667	CCDS13046.1, CCDS13047.1	20p13	2013-01-28			ENSG00000185019	ENSG00000185019		"""RING-type (C3HC4) zinc fingers"", ""U-box domain containing"""	17777	protein-coding gene	gene with protein product						11274149	Standard	NM_014948		Approved	UIP5, KIAA0860, Ubce7ip5, RNF37	uc002whw.4	O94941	OTTHUMG00000031731	ENST00000217173.2:c.1435C>T	chr20.hg19:g.3090943G>A		165.0	0.0	.		253.0	97.0	.	NM_001267584		Missense_Mutation	SNP	ENST00000217173.2	hg19	CCDS13046.1																																																																																			.	.	.	none		0.587	UBOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077706.2	NM_014948	
ZSWIM1	90204	hgsc.bcm.edu	37	20	44512145	44512145	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr20:44512145A>T	ENST00000372523.1	+	2	1009	c.914A>T	c.(913-915)aAt>aTt	p.N305I	ZSWIM1_ENST00000372520.1_Missense_Mutation_p.N305I	NM_080603.4	NP_542170.3	Q9BR11	ZSWM1_HUMAN	zinc finger, SWIM-type containing 1	305						nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	13		Myeloproliferative disorder(115;0.028)				GCCCAGAACAATCATGCTCCC	0.542																																					p.N305I		Atlas-SNP	.											.	ZSWIM1	35	.	0			c.A914T						PASS	.						106.0	100.0	102.0					20																	44512145		2203	4300	6503	SO:0001583	missense	90204	exon2			AGAACAATCATGC	AL008726	CCDS13382.2	20q13.12	2013-09-20	2003-12-17	2003-12-19	ENSG00000168612	ENSG00000168612		"""Zinc fingers, SWIM-type"""	16155	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 162"""	C20orf162			Standard	NM_080603		Approved	dJ337O18.5	uc010ghi.3	Q9BR11	OTTHUMG00000074023	ENST00000372523.1:c.914A>T	chr20.hg19:g.44512145A>T	ENSP00000361601:p.Asn305Ile	207.0	0.0	.		330.0	103.0	.	NM_080603	Q5JZH2|Q9BR12|Q9BV30	Missense_Mutation	SNP	ENST00000372523.1	hg19	CCDS13382.2	.	.	.	.	.	.	.	.	.	.	A	1.890	-0.455649	0.04540	.	.	ENSG00000168612	ENST00000372523;ENST00000372520	T;T	0.23754	1.89;1.89	5.03	-5.13	0.02884	.	1.279150	0.05647	U	0.584537	T	0.15565	0.0375	N	0.19112	0.55	0.09310	N	1	B	0.33379	0.41	B	0.29440	0.102	T	0.20538	-1.0272	10	0.37606	T	0.19	-6.9614	13.0392	0.58889	0.2965:0.0964:0.607:0.0	.	305	Q9BR11	ZSWM1_HUMAN	I	305	ENSP00000361601:N305I;ENSP00000361598:N305I	ENSP00000361598:N305I	N	+	2	0	ZSWIM1	43945552	0.000000	0.05858	0.000000	0.03702	0.097000	0.18754	-3.302000	0.00520	-0.994000	0.03463	-0.256000	0.11100	AAT	.	.	.	none		0.542	ZSWIM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157064.2	NM_080603	
GRAMD4	23151	hgsc.bcm.edu	37	22	47068788	47068788	+	Missense_Mutation	SNP	G	G	A	rs371794625		TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr22:47068788G>A	ENST00000406902.1	+	14	1346	c.1133G>A	c.(1132-1134)cGc>cAc	p.R378H	GRAMD4_ENST00000361034.3_Missense_Mutation_p.R378H|GRAMD4_ENST00000408031.1_5'Flank			Q6IC98	GRAM4_HUMAN	GRAM domain containing 4	378					apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	12		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.166)		ATCTTTAAACGCTGCCCGAGG	0.577													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16350	0.0		0.0	False		,,,				2504	0.0				p.R378H		Atlas-SNP	.											.	GRAMD4	53	.	0			c.G1133A						PASS	.	G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	71.0	68.0	69.0		1133	4.6	1.0	22		69	0,8600		0,0,4300	no	missense	GRAMD4	NM_015124.3	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	378/579	47068788	1,13005	2203	4300	6503	SO:0001583	missense	23151	exon13			TTAAACGCTGCCC		CCDS33672.1	22q13.31	2008-03-03			ENSG00000075240	ENSG00000075240			29113	protein-coding gene	gene with protein product	"""death-inducing-protein"""	613691				15565177	Standard	NM_015124		Approved	KIAA0767, DIP	uc003bhx.3	Q6IC98	OTTHUMG00000150402	ENST00000406902.1:c.1133G>A	chr22.hg19:g.47068788G>A	ENSP00000385689:p.Arg378His	77.0	0.0	.		117.0	42.0	.	NM_015124	A9IN51|A9IN57|Q68EN0|Q9UGE6|Q9Y4B9	Missense_Mutation	SNP	ENST00000406902.1	hg19	CCDS33672.1	.	.	.	.	.	.	.	.	.	.	g	29.5	5.010183	0.93346	2.27E-4	0.0	ENSG00000075240	ENST00000406902;ENST00000361034	T;T	0.45276	0.9;0.9	4.63	4.63	0.57726	.	0.079168	0.49916	D	0.000133	T	0.51466	0.1676	L	0.48642	1.525	0.53688	D	0.99997	D	0.71674	0.998	P	0.56216	0.794	T	0.56177	-0.8022	10	0.87932	D	0	-22.1761	15.3516	0.74393	0.0:0.0:1.0:0.0	.	378	Q6IC98	GRAM4_HUMAN	H	378	ENSP00000385689:R378H;ENSP00000354313:R378H	ENSP00000354313:R378H	R	+	2	0	GRAMD4	45447452	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	8.900000	0.92551	2.294000	0.77228	0.563000	0.77884	CGC	.	.	.	weak		0.577	GRAMD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317969.1	NM_015124	
TBL1X	6907	hgsc.bcm.edu	37	X	9652170	9652170	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chrX:9652170T>C	ENST00000217964.7	+	6	939	c.299T>C	c.(298-300)cTc>cCc	p.L100P	TBL1X_ENST00000424279.1_Missense_Mutation_p.L49P|TBL1X_ENST00000407597.2_Missense_Mutation_p.L100P|TBL1X_ENST00000536365.1_Missense_Mutation_p.L49P|TBL1X_ENST00000380961.1_Missense_Mutation_p.L49P	NM_005647.3	NP_005638.1	O60907	TBL1X_HUMAN	transducin (beta)-like 1X-linked	100	F-box-like.				canonical Wnt signaling pathway (GO:0060070)|cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|histone binding (GO:0042393)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|cervix(1)|endometrium(5)|large_intestine(7)|lung(2)|ovary(1)|skin(2)	20		Hepatocellular(5;0.000888)				CCGGCCGCCCTCATCTCCATT	0.582																																					p.L100P		Atlas-SNP	.											.	TBL1X	103	.	0			c.T299C						PASS	.						94.0	71.0	79.0					X																	9652170		2203	4300	6503	SO:0001583	missense	6907	exon6			CCGCCCTCATCTC	Y12781	CCDS14133.1, CCDS48078.1	Xp22.3	2013-01-10	2002-05-22	2002-05-24	ENSG00000101849	ENSG00000101849		"""WD repeat domain containing"""	11585	protein-coding gene	gene with protein product		300196	"""transducin (beta)-like 1"""	TBL1		10330347	Standard	NM_005647		Approved	EBI	uc004csr.3	O60907	OTTHUMG00000021117	ENST00000217964.7:c.299T>C	chrX.hg19:g.9652170T>C	ENSP00000217964:p.Leu100Pro	65.0	0.0	.		91.0	4.0	.	NM_001139466	A8K044|A8K4J7|Q86UY2	Missense_Mutation	SNP	ENST00000217964.7	hg19	CCDS14133.1	.	.	.	.	.	.	.	.	.	.	T	19.16	3.774447	0.70107	.	.	ENSG00000101849	ENST00000407597;ENST00000424279;ENST00000536365;ENST00000380961;ENST00000415293;ENST00000217964	D;D;D;D;D	0.88896	-2.44;-2.11;-2.11;-2.11;-2.44	4.43	4.43	0.53597	.	0.000000	0.64402	D	0.000001	D	0.95217	0.8449	M	0.91300	3.195	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.95982	0.8978	10	0.87932	D	0	.	13.2538	0.60066	0.0:0.0:0.0:1.0	.	63;100	Q59F53;O60907	.;TBL1X_HUMAN	P	100;49;49;49;49;100	ENSP00000385988:L100P;ENSP00000394097:L49P;ENSP00000445317:L49P;ENSP00000370348:L49P;ENSP00000217964:L100P	ENSP00000217964:L100P	L	+	2	0	TBL1X	9612170	1.000000	0.71417	0.987000	0.45799	0.486000	0.33341	7.492000	0.81482	1.570000	0.49709	0.437000	0.28790	CTC	.	.	.	none		0.582	TBL1X-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055709.1	NM_005647	
CTAGE6	340307	hgsc.bcm.edu	37	7	143452754	143452754	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr7:143452754delA	ENST00000470691.2	-	1	2035	c.1998delT	c.(1996-1998)aatfs	p.N666fs	RNU6-267P_ENST00000516714.1_RNA	NM_178561.4	NP_848656.2	Q86UF2	CTGE6_HUMAN	CTAGE family, member 6	666						integral component of membrane (GO:0016021)						Melanoma(164;0.0903)					CTTTGGCATCATTTCTACTGG	0.418																																					p.D667fs		Atlas-INDEL	.											.	.	.	.	0			c.1999delG						PASS	.																																			SO:0001589	frameshift_variant	340307	exon1			.	BC043153	CCDS64790.1	7q35	2013-05-22	2013-02-25	2013-02-25	ENSG00000271321	ENSG00000271321			28644	protein-coding gene	gene with protein product			"""CTAGE family, member 6, pseudogene"""	CTAGE6P		12477932	Standard	NM_178561		Approved	MGC41943	uc003wdk.4	Q86UF2	OTTHUMG00000157770	ENST00000470691.2:c.1998delT	chr7.hg19:g.143452754delA	ENSP00000474388:p.Asn666fs	599.0	0.0	0		266.0	32.0	0.120301	NM_178561	A4FU29|Q3ZCM5	Frame_Shift_Del	DEL	ENST00000470691.2	hg19																																																																																				.	.	.	none		0.418	CTAGE6-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000349580.2	NM_178561	
FAM179B	23116	hgsc.bcm.edu	37	14	45433529	45433529	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr14:45433529delC	ENST00000361577.3	+	1	2119	c.1905delC	c.(1903-1905)cacfs	p.H635fs	KLHL28_ENST00000553817.1_Intron|FAM179B_ENST00000382233.2_Frame_Shift_Del_p.H635fs|FAM179B_ENST00000361462.2_Frame_Shift_Del_p.H635fs|KLHL28_ENST00000396128.4_5'Flank	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B	635										endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						ATAGCATGCACATTTATGGAT	0.453																																					p.H635fs		Atlas-INDEL	.											.	FAM179B	115	.	0			c.1904delA						PASS	.						98.0	86.0	90.0					14																	45433529		2203	4300	6503	SO:0001589	frameshift_variant	23116	exon1			.	AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.1905delC	chr14.hg19:g.45433529delC	ENSP00000355045:p.His635fs	114.0	0.0	0		59.0	19.0	0.322034	NM_015091	Q68D66|Q6PG27	Frame_Shift_Del	DEL	ENST00000361577.3	hg19	CCDS9681.1																																																																																			.	.	.	none		0.453	FAM179B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276791.1	XM_113781	
ISLR2	57611	hgsc.bcm.edu	37	15	74425252	74425252	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr15:74425252delG	ENST00000361742.3	+	4	926	c.157delG	c.(157-159)gtgfs	p.V53fs	ISLR2_ENST00000435464.1_Frame_Shift_Del_p.V53fs|ISLR2_ENST00000565159.1_Frame_Shift_Del_p.V53fs|ISLR2_ENST00000453268.2_Frame_Shift_Del_p.V53fs|ISLR2_ENST00000419208.1_Frame_Shift_Del_p.V53fs|ISLR2_ENST00000561975.1_Intron|ISLR2_ENST00000445793.1_Frame_Shift_Del_p.V53fs|ISLR2_ENST00000565540.1_Frame_Shift_Del_p.V53fs	NM_001130136.1|NM_020851.2	NP_001123608.1|NP_065902.1	Q6UXK2	ISLR2_HUMAN	immunoglobulin superfamily containing leucine-rich repeat 2	53					positive regulation of axon extension (GO:0045773)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|endometrium(6)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	36						GCCTGCCAACGTGACGACGCT	0.632																																					p.N52fs		Atlas-INDEL	.											ISLR2,colon,carcinoma,0,1	ISLR2	78	.	0			c.156delC						PASS	.						82.0	68.0	73.0					15																	74425252		2198	4297	6495	SO:0001589	frameshift_variant	57611	exon4			.		CCDS10259.1	15q24.1	2013-01-11			ENSG00000167178	ENSG00000167178		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29286	protein-coding gene	gene with protein product		614179				10819331, 12975309	Standard	NM_001130136		Approved	KIAA1465	uc010bjf.3	Q6UXK2	OTTHUMG00000137624	ENST00000361742.3:c.157delG	chr15.hg19:g.74425252delG	ENSP00000355402:p.Val53fs	171.0	0.0	0		234.0	76.0	0.324786	NM_001130136	A8K352|Q9P263	Frame_Shift_Del	DEL	ENST00000361742.3	hg19	CCDS10259.1																																																																																			.	.	.	none		0.632	ISLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269046.1	NM_020851	
IRF2BP2	359948	hgsc.bcm.edu	37	1	234743056	234743058	+	In_Frame_Del	DEL	AGC	AGC	-			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	AGC	AGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr1:234743056_234743058delAGC	ENST00000366609.3	-	2	1619_1621	c.1589_1591delGCT	c.(1588-1593)tgcttc>ttc	p.C530del	RP4-781K5.2_ENST00000436039.1_RNA|IRF2BP2_ENST00000366610.3_In_Frame_Del_p.C514del|IRF2BP2_ENST00000491430.1_5'UTR	NM_182972.2	NP_892017.2	Q7Z5L9	I2BP2_HUMAN	interferon regulatory factor 2 binding protein 2	530	Cys-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11	Ovarian(103;0.0303)	all_cancers(173;0.0236)|Prostate(94;0.0115)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)|Epithelial(3;6.2e-05)			GAGCAAGGGAAGCAGAACTTGTG	0.586																																					p.530_531del		Atlas-INDEL	.											.	IRF2BP2	37	.	0			c.1590_1592del						PASS	.																																			SO:0001651	inframe_deletion	359948	exon2			.	AY278023	CCDS1602.1, CCDS41475.1	1q42.3	2008-02-05			ENSG00000168264	ENSG00000168264			21729	protein-coding gene	gene with protein product		615332				12799427	Standard	NM_182972		Approved	IRF-2BP2	uc001hwg.3	Q7Z5L9	OTTHUMG00000037981	ENST00000366609.3:c.1589_1591delGCT	chr1.hg19:g.234743056_234743058delAGC	ENSP00000355568:p.Cys530del	217.0	0.0	0		313.0	74.0	0.236422	NM_182972	B1AM35|B1AM36|Q6P083|Q7Z5L8|Q8N351|Q8WUH8	In_Frame_Del	DEL	ENST00000366609.3	hg19	CCDS1602.1																																																																																			.	.	.	none		0.586	IRF2BP2-002	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000092705.1	NM_182972	
ARMC4	55130	hgsc.bcm.edu	37	10	28257893	28257893	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr10:28257893delT	ENST00000305242.5	-	9	1289	c.1197delA	c.(1195-1197)aaafs	p.K399fs	ARMC4_ENST00000537576.1_Frame_Shift_Del_p.K91fs|ARMC4_ENST00000545014.1_Intron|ARMC4_ENST00000480504.1_5'UTR|ARMC4_ENST00000239715.3_Frame_Shift_Del_p.K256fs	NM_018076.2	NP_060546.2	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	399					cell projection organization (GO:0030030)|cilium movement (GO:0003341)|left/right axis specification (GO:0070986)|outer dynein arm assembly (GO:0036158)|ventricular system development (GO:0021591)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(17)|liver(1)|lung(17)|ovary(5)|prostate(3)|skin(8)|stomach(2)|urinary_tract(3)	75						ATGGTCTTGGTTTTTCAAGTT	0.398																																					p.P400fs		Atlas-INDEL	.											.	ARMC4	177	.	0			c.1198delC						PASS	.						4.0	3.0	3.0					10																	28257893		1579	3445	5024	SO:0001589	frameshift_variant	55130	exon9			.	AL136859	CCDS7157.1	10p12.1-p11.23	2014-02-03			ENSG00000169126	ENSG00000169126		"""Armadillo repeat containing"""	25583	protein-coding gene	gene with protein product		615408				11230166	Standard	XM_005252485		Approved	FLJ10817, FLJ10376, DKFZP434P1735, CILD23	uc001itz.3	Q5T2S8	OTTHUMG00000017867	ENST00000305242.5:c.1197delA	chr10.hg19:g.28257893delT	ENSP00000306410:p.Lys399fs	513.0	0.0	0		177.0	24.0	0.135593	NM_018076	A8K906|B7Z7I1|Q9H0C0	Frame_Shift_Del	DEL	ENST00000305242.5	hg19	CCDS7157.1																																																																																			.	.	.	none		0.398	ARMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047339.1	NM_018076	
PCDHGA12	26025	hgsc.bcm.edu	37	5	140811171	140811177	+	Frame_Shift_Del	DEL	GGTATGT	GGTATGT	-			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	GGTATGT	GGTATGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr5:140811171_140811177delGGTATGT	ENST00000252085.3	+	1	987_993	c.845_851delGGTATGT	c.(844-852)cggtatgtgfs	p.RYV282fs	PCDHGB7_ENST00000398594.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA8_ENST00000398604.2_Intron	NM_003735.2|NM_032094.1	NP_003726.1|NP_115265.1	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12	282	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(23)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	58			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TATTCCTTCCGGTATGTGGACGACAAG	0.522																																					p.282_284del		Atlas-INDEL	.											.	PCDHGA12	271	.	0			c.844_850del						PASS	.																																			SO:0001589	frameshift_variant	26025	exon1			.	AF152506	CCDS4260.1, CCDS75346.1	5q31	2010-01-26	2002-05-23		ENSG00000253159	ENSG00000253159		"""Cadherins / Protocadherins : Clustered"""	8699	other	protocadherin	"""fibroblast cadherin FIB3"""	603059	"""cadherin 21"""	CDH21		10380929	Standard	NM_003735		Approved	KIAA0588, FIB3, PCDH-GAMMA-A12		O60330	OTTHUMG00000129611	ENST00000252085.3:c.845_851delGGTATGT	chr5.hg19:g.140811171_140811177delGGTATGT	ENSP00000252085:p.Arg282fs	177.0	0.0	0		254.0	63.0	0.248031	NM_032094	O15100|Q6UW70|Q9Y5D7	Frame_Shift_Del	DEL	ENST00000252085.3	hg19	CCDS4260.1																																																																																			.	.	.	none		0.522	PCDHGA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251806.2	NM_003735	
CTAGE15	441294	hgsc.bcm.edu	37	7	143270908	143270908	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr7:143270908delT	ENST00000420911.2	+	1	2015	c.1998delT	c.(1996-1998)aatfs	p.N666fs	RNU6-162P_ENST00000516228.1_RNA	NM_001008747.1	NP_001008747.1	A4D2H0	CTGEF_HUMAN	CTAGE family, member 15	666						integral component of membrane (GO:0016021)											CCAGTAGAAATGATGCCAAAG	0.418																																					p.N666fs		Atlas-INDEL	.											.	.	.	.	0			c.1997delA						PASS	.																																			SO:0001589	frameshift_variant	441294	exon1			.		CCDS64788.1	7q35	2013-02-25	2013-02-25	2013-02-25	ENSG00000176227	ENSG00000271079			37295	protein-coding gene	gene with protein product			"""CTAGE family, member 15, pseudogene"""	CTAGE15P			Standard	NM_001008747		Approved		uc011kth.3	A4D2H0	OTTHUMG00000153233	ENST00000420911.2:c.1998delT	chr7.hg19:g.143270908delT	ENSP00000474204:p.Asn666fs	578.0	0.0	0		260.0	27.0	0.103846	NM_001008747	A6H8Z8	Frame_Shift_Del	DEL	ENST00000420911.2	hg19																																																																																				.	.	.	none		0.418	CTAGE15-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000330280.2	NM_001008747	
MYO1H	283446	hgsc.bcm.edu	37	12	109834319	109834319	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr12:109834319delA	ENST00000431443.2	+	3	373	c.373delA	c.(373-375)accfs	p.T125fs	MYO1H_ENST00000310903.5_Frame_Shift_Del_p.T125fs	NM_001101421.3	NP_001094891.3	Q8N1T3	MYO1H_HUMAN	myosin IH	125	Myosin motor.					myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(17)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	47						TTTTGCAGTGACCTGCCCAAT	0.498																																					p.V124fs		Atlas-INDEL	.											.	MYO1H	98	.	0			c.372delG						PASS	.						71.0	71.0	71.0					12																	109834319		1896	4123	6019	SO:0001589	frameshift_variant	283446	exon3			.		CCDS53826.1	12q24.11	2011-09-27			ENSG00000174527	ENSG00000174527		"""Myosins / Myosin superfamily : Class I"""	13879	protein-coding gene	gene with protein product		614636					Standard	NM_001101421		Approved	FLJ37587	uc010sxn.1	Q8N1T3	OTTHUMG00000169252	ENST00000431443.2:c.373delA	chr12.hg19:g.109834319delA	ENSP00000444076:p.Thr125fs	100.0	0.0	0		135.0	21.0	0.155556	NM_001101421	F5H3C6	Frame_Shift_Del	DEL	ENST00000431443.2	hg19																																																																																				.	.	.	none		0.498	MYO1H-201	KNOWN	basic	protein_coding	protein_coding		NM_173597	
ZCCHC8	55596	hgsc.bcm.edu	37	12	122964832	122964833	+	Frame_Shift_Ins	INS	-	-	A			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr12:122964832_122964833insA	ENST00000336229.4	-	11	1174_1175	c.1044_1045insT	c.(1042-1047)gttggafs	p.G349fs	ZCCHC8_ENST00000538116.1_5'Flank|ZCCHC8_ENST00000543897.1_Frame_Shift_Ins_p.G111fs|ZCCHC8_ENST00000536306.1_Frame_Shift_Ins_p.G111fs	NM_017612.3	NP_060082.2	Q6NZY4	ZCHC8_HUMAN	zinc finger, CCHC domain containing 8	349					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(2)|large_intestine(8)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	23	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.25e-05)|Epithelial(86;0.000113)|BRCA - Breast invasive adenocarcinoma(302;0.202)		TGTATTTCTCCAACTTCTGTTT	0.371																																					p.G349fs		Atlas-INDEL	.											.	ZCCHC8	56	.	0			c.1045_1046insT						PASS	.																																			SO:0001589	frameshift_variant	55596	exon11			.	BC017704		12q24.31	2014-04-14				ENSG00000033030		"""Zinc fingers, CCHC domain containing"""	25265	protein-coding gene	gene with protein product						12477932	Standard	XM_005253581		Approved	DKFZp434E2220	uc001ucn.3	Q6NZY4		ENST00000336229.4:c.1045dupT	chr12.hg19:g.122964834_122964834dupA	ENSP00000337313:p.Gly349fs	44.0	0.0	0		59.0	26.0	0.440678	NM_017612	Q7L2P6|Q8N2K5|Q96SK7|Q9NSS2|Q9NSS3	Frame_Shift_Ins	INS	ENST00000336229.4	hg19																																																																																				.	.	.	none		0.371	ZCCHC8-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_017612	
ITM2B	9445	hgsc.bcm.edu	37	13	48830432	48830433	+	In_Frame_Ins	INS	-	-	CAA			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr13:48830432_48830433insCAA	ENST00000378565.5	+	3	569_570	c.366_367insCAA	c.(367-369)gaa>CAAgaa	p.122_123insQ	ITM2B_ENST00000378549.5_Intron	NM_021999.4	NP_068839.1	Q9Y287	ITM2B_HUMAN	integral membrane protein 2B	122	Necessary for interaction with APP and inhibitor effects on APP processing.				extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|nervous system development (GO:0007399)	endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle membrane (GO:0030660)|integral component of organelle membrane (GO:0031301)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|beta-amyloid binding (GO:0001540)			endometrium(1)|large_intestine(2)|lung(3)	6		all_cancers(8;2.2e-31)|all_epithelial(8;6.77e-15)|all_lung(13;9.67e-07)|all_hematologic(8;9.72e-06)|Lung NSC(96;8.3e-05)|Breast(56;0.000141)|Acute lymphoblastic leukemia(8;0.00045)|Prostate(109;0.000669)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;1.97e-06)		TTAAAATCTTTGAAGAAGAAGA	0.401																																					p.F122delinsFQ		Atlas-INDEL	.											.	ITM2B	24	.	0			c.366_367insCAA						PASS	.																																			SO:0001652	inframe_insertion	9445	exon3			.	AF092128	CCDS9409.1	13q14.2	2012-10-10			ENSG00000136156	ENSG00000136156		"""BRICHOS domain containing"""	6174	protein-coding gene	gene with protein product	"""BRICHOS domain containing 2B"""	603904				9795190	Standard	NM_021999		Approved	BRI, E25B, E3-16, BRICD2B	uc001vbz.3	Q9Y287	OTTHUMG00000016894	Exception_encountered	chr13.hg19:g.48830432_48830433insCAA	ENSP00000367828:p.Phe122_Glu123insGln	161.0	0.0	0		82.0	26.0	0.317073	NM_021999	Q5W0A3|Q96B24|Q9NYH1	In_Frame_Ins	INS	ENST00000378565.5	hg19	CCDS9409.1																																																																																			.	.	.	none		0.401	ITM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044870.3	NM_021999	
LINS	55180	hgsc.bcm.edu	37	15	101114034	101114034	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B9-4114-01A-01D-1252-08	TCGA-B9-4114-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cc2df365-fa55-4871-8e93-807b85a7e7d0	4acde02c-30d6-41f7-9fb2-b689951809b9	g.chr15:101114034delC	ENST00000314742.8	-	5	1266	c.1044delG	c.(1042-1044)gggfs	p.G348fs	LINS_ENST00000559149.1_5'UTR|LINS_ENST00000561308.1_Frame_Shift_Del_p.G348fs|LINS_ENST00000560133.1_Frame_Shift_Del_p.G229fs	NM_001040616.2	NP_001035706	Q8NG48	LINES_HUMAN	lines homolog (Drosophila)	348										central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(1)|skin(1)|stomach(4)	21						TCTTCAACAACCCCGAATTCA	0.448																																					p.L349fs		Atlas-INDEL	.											.	LINS	62	.	0			c.1045delT						PASS	.			0,4264		0,0,2132	146.0	133.0	137.0			2.5	0.1	15		137	2,8252		0,2,4125	no	frameshift	LINS	NM_001040616.2		0,2,6257	A1A1,A1R,RR		0.0242,0.0,0.016			101114034	2,12516	2203	4300	6503	SO:0001589	frameshift_variant	55180	exon5			.	AK095448	CCDS10385.1	15q26.3	2010-09-08	2010-09-08	2010-09-08	ENSG00000140471	ENSG00000140471			30922	protein-coding gene	gene with protein product		610350	"""lines homolog 1 (Drosophila)"""	LINS1		12119551, 8889548	Standard	NM_001040616		Approved	WINS1	uc002bwg.3	Q8NG48	OTTHUMG00000149865	ENST00000314742.8:c.1044delG	chr15.hg19:g.101114034delC	ENSP00000318423:p.Gly348fs	281.0	0.0	0		213.0	57.0	0.267606	NM_001040616	Q96FW2|Q9NVQ3	Frame_Shift_Del	DEL	ENST00000314742.8	hg19	CCDS10385.1																																																																																			.	.	.	none		0.448	LINS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313592.1	NM_018148	
