#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PIGV	55650	hgsc.bcm.edu	37	1	27121059	27121059	+	Silent	SNP	C	C	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr1:27121059C>T	ENST00000374145.1	+	3	1216	c.534C>T	c.(532-534)ttC>ttT	p.F178F	PIGV_ENST00000449950.2_Intron|PIGV_ENST00000078527.4_Silent_p.F178F	NM_001202554.1	NP_001189483.1	Q9NUD9	PIGV_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class V	178					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	mannosyltransferase activity (GO:0000030)			NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(2)	14		all_cancers(24;3.93e-26)|all_epithelial(13;3.96e-23)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.26e-54)|Epithelial(14;2.85e-53)|OV - Ovarian serous cystadenocarcinoma(117;1.91e-30)|Colorectal(126;1.31e-09)|COAD - Colon adenocarcinoma(152;3.45e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000504)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.0222)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.153)|LUSC - Lung squamous cell carcinoma(448;0.227)		TCCTGACATTCAGTGCCATGG	0.562																																					p.F178F		Atlas-SNP	.											.	PIGV	47	.	0			c.C534T						PASS	.						79.0	78.0	78.0					1																	27121059		2203	4300	6503	SO:0001819	synonymous_variant	55650	exon3			GACATTCAGTGCC	AK000484	CCDS287.1	1p36.11	2013-02-26	2006-06-28		ENSG00000060642	ENSG00000060642		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	26031	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 2"", ""dol-P-Man dependent GPI mannosyltransferase"""	610274	"""phosphatidylinositol glycan, class V"""			15623507	Standard	NM_017837		Approved	FLJ20477	uc001bmz.3	Q9NUD9	OTTHUMG00000004005	ENST00000374145.1:c.534C>T	chr1.hg19:g.27121059C>T		116.0	0.0	.		180.0	57.0	.	NM_001202554	D3DPL2|Q5JYG7|Q5JYG8|Q5JYG9|Q9NX26	Silent	SNP	ENST00000374145.1	hg19	CCDS287.1																																																																																			.	.	.	none		0.562	PIGV-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011441.1	NM_017837	
SLC9A1	6548	hgsc.bcm.edu	37	1	27428600	27428600	+	Silent	SNP	C	C	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr1:27428600C>T	ENST00000263980.3	-	9	2417	c.1842G>A	c.(1840-1842)ctG>ctA	p.L614L	SLC9A1_ENST00000490329.1_5'Flank|SLC9A1_ENST00000545949.1_Silent_p.L275L	NM_003047.4	NP_003038.2	P19634	SL9A1_HUMAN	solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1	614					carbohydrate metabolic process (GO:0005975)|cardiac muscle cell differentiation (GO:0055007)|cell growth (GO:0016049)|cellular response to acidic pH (GO:0071468)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|hydrogen ion transmembrane transport (GO:1902600)|ion transport (GO:0006811)|negative regulation of apoptotic process (GO:0043066)|neuron death (GO:0070997)|positive regulation of action potential (GO:0045760)|positive regulation of cell growth (GO:0030307)|positive regulation of mitochondrial membrane permeability (GO:0035794)|protein oligomerization (GO:0051259)|regulation of intracellular pH (GO:0051453)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|regulation of the force of heart contraction (GO:0002026)|response to acidic pH (GO:0010447)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|sodium ion export (GO:0071436)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium-dependent protein binding (GO:0048306)|sodium:proton antiporter activity (GO:0015385)|solute:proton antiporter activity (GO:0015299)			central_nervous_system(1)|cervix(3)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;2.19e-50)|OV - Ovarian serous cystadenocarcinoma(117;1.8e-29)|Colorectal(126;7.61e-09)|COAD - Colon adenocarcinoma(152;9.32e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000521)|KIRC - Kidney renal clear cell carcinoma(1967;0.00079)|STAD - Stomach adenocarcinoma(196;0.00125)|READ - Rectum adenocarcinoma(331;0.046)	Amiloride(DB00594)	GCTCGGAAGGCAGGGACTTGG	0.582																																					p.L614L		Atlas-SNP	.											.	SLC9A1	68	.	0			c.G1842A						PASS	.						136.0	126.0	129.0					1																	27428600		2203	4300	6503	SO:0001819	synonymous_variant	6548	exon9			GGAAGGCAGGGAC	M81768	CCDS295.1	1p36.1-p35	2014-06-13	2012-03-22		ENSG00000090020	ENSG00000090020		"""Solute carriers"""	11071	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 143"""	107310	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 1 (antiporter, Na+/H+, amiloride sensitive)"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 1"""	APNH, NHE1		8283968	Standard	NM_003047		Approved	PPP1R143	uc001bnm.4	P19634	OTTHUMG00000004271	ENST00000263980.3:c.1842G>A	chr1.hg19:g.27428600C>T		166.0	0.0	.		270.0	74.0	.	NM_003047	B1ALD6|D3DPL4|Q96EM2	Silent	SNP	ENST00000263980.3	hg19	CCDS295.1																																																																																			.	.	.	none		0.582	SLC9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012336.2	NM_003047	
MACF1	23499	hgsc.bcm.edu	37	1	39907695	39907695	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr1:39907695T>G	ENST00000372915.3	+	74	18528	c.18441T>G	c.(18439-18441)aaT>aaG	p.N6147K	MACF1_ENST00000289893.4_Missense_Mutation_p.N4691K|MACF1_ENST00000361689.2_Missense_Mutation_p.N4189K|MACF1_ENST00000539005.1_Missense_Mutation_p.N4059K|MACF1_ENST00000317713.7_Missense_Mutation_p.N4189K|MACF1_ENST00000567887.1_Missense_Mutation_p.N6285K|MACF1_ENST00000564288.1_Missense_Mutation_p.N6248K|MACF1_ENST00000545844.1_Missense_Mutation_p.N4189K			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	6147					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CTGACCTCAATACTGTTAAAG	0.353																																					p.N4189K		Atlas-SNP	.											.	MACF1	909	.	0			c.T12567G						PASS	.						118.0	110.0	113.0					1																	39907695		2203	4300	6503	SO:0001583	missense	23499	exon72			CCTCAATACTGTT	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.18441T>G	chr1.hg19:g.39907695T>G	ENSP00000362006:p.Asn6147Lys	217.0	0.0	.		45.0	12.0	.	NM_012090	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.72|16.72	3.201648|3.201648	0.58234|0.58234	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893|ENST00000372925	T;T;T;T;T;T|.	0.48836|.	0.8;0.8;0.8;0.8;0.8;0.8|.	5.62|5.62	4.71|4.71	0.59529|0.59529	.|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.33990|0.33990	0.0882|0.0882	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	D;P|.	0.55605|.	0.972;0.843|.	P;P|.	0.55455|.	0.776;0.62|.	T|T	0.14727|0.14727	-1.0462|-1.0462	10|5	0.32370|.	T|.	0.25|.	.|.	9.9927|9.9927	0.41881|0.41881	0.0:0.8446:0.0:0.1554|0.0:0.8446:0.0:0.1554	.|.	6147;4189|.	Q9UPN3;F8W8Q1|.	MACF1_HUMAN;.|.	K|D	4189;6147;4189;4189;4059;4691|3193	ENSP00000439537:N4189K;ENSP00000362006:N6147K;ENSP00000354573:N4189K;ENSP00000313438:N4189K;ENSP00000444364:N4059K;ENSP00000289893:N4691K|.	ENSP00000289893:N4691K|.	N|Y	+|+	3|1	2|0	MACF1|MACF1	39680282|39680282	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	2.512000|2.512000	0.45485|0.45485	1.352000|1.352000	0.45808|0.45808	-0.366000|-0.366000	0.07423|0.07423	AAT|TAC	.	.	.	none		0.353	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
MCOLN3	55283	hgsc.bcm.edu	37	1	85491700	85491700	+	Silent	SNP	A	A	G			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr1:85491700A>G	ENST00000370589.2	-	9	1069	c.1017T>C	c.(1015-1017)aaT>aaC	p.N339N	MCOLN3_ENST00000370587.1_3'UTR|MCOLN3_ENST00000474447.1_5'Flank|MCOLN3_ENST00000341115.4_Silent_p.N283N|WDR63_ENST00000370596.1_Intron	NM_018298.10	NP_060768.8	Q8TDD5	MCLN3_HUMAN	mucolipin 3	339					auditory receptor cell differentiation (GO:0042491)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|locomotory behavior (GO:0007626)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(6)|kidney(3)|large_intestine(9)|lung(12)|prostate(3)|skin(1)	34				all cancers(265;0.00957)|Epithelial(280;0.0254)		TGTACCATCCATTGACAAATT	0.333																																					p.N339N		Atlas-SNP	.											.	MCOLN3	74	.	0			c.T1017C						PASS	.						57.0	56.0	56.0					1																	85491700		2203	4300	6503	SO:0001819	synonymous_variant	55283	exon9			CCATCCATTGACA	AF475085	CCDS701.1, CCDS58009.1	1p22.3	2011-12-16			ENSG00000055732	ENSG00000055732		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13358	protein-coding gene	gene with protein product		607400				16382100	Standard	NM_018298		Approved	TRPML3, FLJ11006, TRP-ML3	uc001dkp.3	Q8TDD5	OTTHUMG00000009955	ENST00000370589.2:c.1017T>C	chr1.hg19:g.85491700A>G		64.0	0.0	.		40.0	13.0	.	NM_018298	Q5T4H5|Q5T4H6|Q9NV09	Silent	SNP	ENST00000370589.2	hg19	CCDS701.1																																																																																			.	.	.	none		0.333	MCOLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027569.2	NM_018298	
ATP1A2	477	hgsc.bcm.edu	37	1	160105304	160105304	+	Silent	SNP	C	C	A			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr1:160105304C>A	ENST00000361216.3	+	16	2285	c.2196C>A	c.(2194-2196)ggC>ggA	p.G732G	ATP1A2_ENST00000392233.3_Silent_p.G732G	NM_000702.3	NP_000693.1	P50993	AT1A2_HUMAN	ATPase, Na+/K+ transporting, alpha 2 polypeptide	732					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|locomotion (GO:0040011)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of heart contraction (GO:0045822)|negative regulation of striated muscle contraction (GO:0045988)|neurotransmitter uptake (GO:0001504)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of smooth muscle contraction (GO:0006940)|regulation of striated muscle contraction (GO:0006942)|regulation of the force of heart contraction (GO:0002026)|regulation of vasoconstriction (GO:0019229)|relaxation of cardiac muscle (GO:0055119)|response to nicotine (GO:0035094)|sodium ion export from cell (GO:0036376)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	caveola (GO:0005901)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|endosome (GO:0005768)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(30)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	69	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			TTGCCATGGGCATCTCTGGCT	0.602																																					p.G732G		Atlas-SNP	.											.	ATP1A2	167	.	0			c.C2196A						PASS	.						169.0	125.0	140.0					1																	160105304		2203	4300	6503	SO:0001819	synonymous_variant	477	exon16			CATGGGCATCTCT	AB018321	CCDS1196.1	1q23.2	2014-09-17	2010-04-20		ENSG00000018625	ENSG00000018625	3.6.3.9	"""ATPases / P-type"""	800	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-2"", ""sodium pump subunit alpha-2"", ""sodium-potassium ATPase catalytic subunit alpha-2"""	182340	"""migraine, hemiplegic 2"", ""ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide"""	MHP2		9403481	Standard	NM_000702		Approved	FHM2	uc001fvc.3	P50993	OTTHUMG00000024080	ENST00000361216.3:c.2196C>A	chr1.hg19:g.160105304C>A		142.0	0.0	.		246.0	97.0	.	NM_000702	D3DVE4|Q07059|Q5JW74|Q86UZ5|Q9UQ25	Silent	SNP	ENST00000361216.3	hg19	CCDS1196.1	.	.	.	.	.	.	.	.	.	.	C	5.352	0.250270	0.10130	.	.	ENSG00000018625	ENST00000447527	.	.	.	4.31	2.27	0.28462	.	.	.	.	.	T	0.32406	0.0828	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.19844	-1.0293	4	.	.	.	.	4.575	0.12228	0.1513:0.6098:0.1479:0.091	.	.	.	.	E	443	.	.	A	+	2	0	ATP1A2	158371928	0.489000	0.26004	1.000000	0.80357	0.433000	0.31745	-0.303000	0.08210	1.154000	0.42482	0.561000	0.74099	GCA	.	.	.	none		0.602	ATP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060642.2	NM_000702	
IRF6	3664	hgsc.bcm.edu	37	1	209964089	209964089	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr1:209964089G>C	ENST00000367021.3	-	7	983	c.811C>G	c.(811-813)Ctg>Gtg	p.L271V	IRF6_ENST00000542854.1_Missense_Mutation_p.L176V	NM_006147.3	NP_006138.1	O14896	IRF6_HUMAN	interferon regulatory factor 6	271					cell cycle arrest (GO:0007050)|cell development (GO:0048468)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|large_intestine(4)|lung(12)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	28				OV - Ovarian serous cystadenocarcinoma(81;0.0351)		ACCTGCTCCAGGCTGACGGGA	0.572										HNSCC(57;0.16)																											p.L271V		Atlas-SNP	.											.	IRF6	65	.	0			c.C811G						PASS	.						80.0	76.0	77.0					1																	209964089		2203	4300	6503	SO:0001583	missense	3664	exon7			GCTCCAGGCTGAC	AL022398	CCDS1492.1, CCDS55681.1	1q32.2-q32.3	2011-02-10			ENSG00000117595	ENSG00000117595			6121	protein-coding gene	gene with protein product		607199	"""Van der Woude syndrome"""	VWS, LPS		12219090	Standard	NM_006147		Approved	OFC6, VWS1	uc001hhq.2	O14896	OTTHUMG00000036521	ENST00000367021.3:c.811C>G	chr1.hg19:g.209964089G>C	ENSP00000355988:p.Leu271Val	229.0	0.0	.		167.0	71.0	.	NM_006147	B4DLE2|D3DT90|F5GWX8|G0ZTL0	Missense_Mutation	SNP	ENST00000367021.3	hg19	CCDS1492.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.139845	0.77775	.	.	ENSG00000117595	ENST00000367021;ENST00000542854;ENST00000456314	D;D;D	0.95788	-3.57;-3.57;-3.81	6.17	5.26	0.73747	SMAD domain-like (1);SMAD/FHA domain (1);Interferon regulatory factor-3 (1);	0.000000	0.85682	D	0.000000	D	0.95557	0.8556	L	0.39397	1.21	0.58432	D	0.999995	D	0.89917	1.0	D	0.91635	0.999	D	0.93440	0.6793	9	.	.	.	.	9.4637	0.38800	0.1513:0.0:0.8487:0.0	.	271	O14896	IRF6_HUMAN	V	271;176;271	ENSP00000355988:L271V;ENSP00000440532:L176V;ENSP00000403855:L271V	.	L	-	1	2	IRF6	208030712	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.122000	0.57910	2.941000	0.99782	0.655000	0.94253	CTG	.	.	.	none		0.572	IRF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088827.1	NM_006147	
PRKCE	5581	hgsc.bcm.edu	37	2	45879507	45879507	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr2:45879507G>C	ENST00000306156.3	+	1	595	c.268G>C	c.(268-270)Ggc>Cgc	p.G90R		NM_005400.2	NP_005391.1	Q02156	KPCE_HUMAN	protein kinase C, epsilon	90	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to ethanol (GO:0071361)|cellular response to hypoxia (GO:0071456)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|locomotory exploration behavior (GO:0035641)|macrophage activation involved in immune response (GO:0002281)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cellular glucuronidation (GO:2001031)|positive regulation of cytokinesis (GO:0032467)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of insulin secretion (GO:0032024)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|release of sequestered calcium ion into cytosol (GO:0051209)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|TRAM-dependent toll-like receptor 4 signaling pathway (GO:0035669)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|ethanol binding (GO:0035276)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|receptor activator activity (GO:0030546)|signal transducer activity (GO:0004871)		MBOAT2/PRKCE(2)	breast(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(13)|ovary(3)|upper_aerodigestive_tract(2)	34		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)		Tamoxifen(DB00675)	TGCCCCCATAGGCTACGACGA	0.622																																					p.G90R		Atlas-SNP	.											.	PRKCE	58	.	0			c.G268C						PASS	.						64.0	54.0	57.0					2																	45879507		2203	4300	6503	SO:0001583	missense	5581	exon1			CCCATAGGCTACG		CCDS1824.1	2p21	2009-07-10			ENSG00000171132	ENSG00000171132	2.7.11.1		9401	protein-coding gene	gene with protein product		176975				1382605, 7877991	Standard	NM_005400		Approved		uc002rut.3	Q02156	OTTHUMG00000128817	ENST00000306156.3:c.268G>C	chr2.hg19:g.45879507G>C	ENSP00000306124:p.Gly90Arg	53.0	0.0	.		98.0	43.0	.	NM_005400	B0LPH7|Q32MQ3|Q53SL4|Q53SM5|Q9UE81	Missense_Mutation	SNP	ENST00000306156.3	hg19	CCDS1824.1	.	.	.	.	.	.	.	.	.	.	G	34	5.307076	0.95629	.	.	ENSG00000171132	ENST00000421201;ENST00000306156	T;T	0.71461	-0.57;-0.57	4.95	4.95	0.65309	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.062205	0.64402	D	0.000006	D	0.84629	0.5514	M	0.86651	2.83	0.80722	D	1	D	0.67145	0.996	D	0.68943	0.961	T	0.83162	-0.0098	10	0.16896	T	0.51	.	18.1985	0.89830	0.0:0.0:1.0:0.0	.	90	Q02156	KPCE_HUMAN	R	90	ENSP00000394574:G90R;ENSP00000306124:G90R	ENSP00000306124:G90R	G	+	1	0	PRKCE	45733011	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.802000	0.99131	2.270000	0.75569	0.561000	0.74099	GGC	.	.	.	none		0.622	PRKCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250751.2		
REV1	51455	hgsc.bcm.edu	37	2	100019166	100019166	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr2:100019166C>T	ENST00000258428.3	-	21	3710	c.3482G>A	c.(3481-3483)gGa>gAa	p.G1161E	RP11-527J8.1_ENST00000608144.1_RNA|REV1_ENST00000465835.1_5'Flank|REV1_ENST00000393445.3_Missense_Mutation_p.G1160E	NM_001037872.1|NM_016316.2	NP_001032961.1|NP_057400.1	Q9UBZ9	REV1_HUMAN	REV1, polymerase (DNA directed)	1161	Protein interaction domain; mediates interaction with DNA polymerase zeta.				DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|error-prone translesion synthesis (GO:0042276)|response to UV (GO:0009411)	nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|deoxycytidyl transferase activity (GO:0017125)|DNA-directed DNA polymerase activity (GO:0003887)|magnesium ion binding (GO:0000287)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(12)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TTCAACAGCTCCAGCTAGATT	0.493								Direct reversal of damage																													p.G1161E		Atlas-SNP	.											.	REV1	100	.	0			c.G3482A						PASS	.						99.0	97.0	98.0					2																	100019166		2203	4300	6503	SO:0001583	missense	51455	exon21			ACAGCTCCAGCTA	AF206019	CCDS2045.1, CCDS42722.1	2q11.1-q11.2	2012-05-18	2012-05-18	2006-11-07	ENSG00000135945	ENSG00000135945		"""DNA polymerases"""	14060	protein-coding gene	gene with protein product		606134	"""REV1 (yeast homolog)- like"", ""REV1-like (yeast)"", ""REV1 homolog (S. cerevisiae)"""	REV1L		10536157	Standard	XM_005263968		Approved		uc002tad.3	Q9UBZ9	OTTHUMG00000130636	ENST00000258428.3:c.3482G>A	chr2.hg19:g.100019166C>T	ENSP00000258428:p.Gly1161Glu	198.0	0.0	.		123.0	51.0	.	NM_016316	O95941|Q53SI7|Q9C0J4|Q9NUP2	Missense_Mutation	SNP	ENST00000258428.3	hg19	CCDS2045.1	.	.	.	.	.	.	.	.	.	.	C	33	5.204692	0.95033	.	.	ENSG00000135945	ENST00000393445;ENST00000258428	T;T	0.38077	1.16;1.16	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.64046	0.2563	M	0.74881	2.28	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.63906	-0.6531	10	0.66056	D	0.02	.	20.3854	0.98941	0.0:1.0:0.0:0.0	.	1161;1160	Q9UBZ9;Q9UBZ9-2	REV1_HUMAN;.	E	1160;1161	ENSP00000377091:G1160E;ENSP00000258428:G1161E	ENSP00000258428:G1161E	G	-	2	0	REV1	99385598	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.844000	0.75390	2.825000	0.97269	0.655000	0.94253	GGA	.	.	.	none		0.493	REV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253123.2	NM_016316	
NUP210	23225	hgsc.bcm.edu	37	3	13415370	13415370	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr3:13415370G>A	ENST00000254508.5	-	12	1517	c.1435C>T	c.(1435-1437)Cac>Tac	p.H479Y		NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	479					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					CTGCCACCGTGGGCCTGCGGA	0.592																																					p.H479Y		Atlas-SNP	.											.	NUP210	182	.	0			c.C1435T						PASS	.						87.0	65.0	72.0					3																	13415370		2203	4300	6503	SO:0001583	missense	23225	exon12			CACCGTGGGCCTG	AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.1435C>T	chr3.hg19:g.13415370G>A	ENSP00000254508:p.His479Tyr	40.0	0.0	.		65.0	25.0	.	NM_024923	A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Missense_Mutation	SNP	ENST00000254508.5	hg19	CCDS33704.1	.	.	.	.	.	.	.	.	.	.	G	11.47	1.647580	0.29246	.	.	ENSG00000132182	ENST00000254508	T	0.41400	1.0	5.8	3.99	0.46301	Invasin/intimin cell-adhesion (1);	0.386148	0.30003	N	0.010650	T	0.31918	0.0812	L	0.57536	1.79	0.37940	D	0.932281	B;B	0.09022	0.002;0.001	B;B	0.08055	0.003;0.001	T	0.21999	-1.0229	10	0.02654	T	1	.	8.5233	0.33289	0.1373:0.1281:0.7346:0.0	.	479;479	Q8TEM1-2;Q8TEM1	.;PO210_HUMAN	Y	479	ENSP00000254508:H479Y	ENSP00000254508:H479Y	H	-	1	0	NUP210	13390370	0.997000	0.39634	0.794000	0.32065	0.780000	0.44128	2.395000	0.44459	0.784000	0.33661	0.655000	0.94253	CAC	.	.	.	none		0.592	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340085.1	NM_024923	
TRANK1	9881	hgsc.bcm.edu	37	3	36873055	36873055	+	Silent	SNP	C	C	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr3:36873055C>T	ENST00000429976.2	-	21	8134	c.7887G>A	c.(7885-7887)ctG>ctA	p.L2629L	TRANK1_ENST00000428977.2_Silent_p.L2079L|TRANK1_ENST00000301807.6_Silent_p.L2079L	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	2629							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						CCAAACAGAGCAGGCGGTTTA	0.532																																					p.L2629L		Atlas-SNP	.											.	TRANK1	398	.	0			c.G7887A						PASS	.						60.0	62.0	61.0					3																	36873055		2004	4167	6171	SO:0001819	synonymous_variant	9881	exon21			ACAGAGCAGGCGG	AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.7887G>A	chr3.hg19:g.36873055C>T		49.0	0.0	.		85.0	32.0	.	NM_014831	Q8N8K0	Silent	SNP	ENST00000429976.2	hg19	CCDS46789.2																																																																																			.	.	.	none		0.532	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014831	
ACAA1	30	hgsc.bcm.edu	37	3	38178134	38178134	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr3:38178134C>G	ENST00000333167.8	-	2	386	c.214G>C	c.(214-216)Gtt>Ctt	p.V72L	MYD88_ENST00000417037.2_5'Flank|ACAA1_ENST00000301810.7_Missense_Mutation_p.V72L|ACAA1_ENST00000444607.2_Missense_Mutation_p.V72L|MYD88_ENST00000443433.2_5'Flank|ACAA1_ENST00000544624.1_5'UTR|MYD88_ENST00000396334.3_5'Flank|ACAA1_ENST00000450296.1_Missense_Mutation_p.V72L|MYD88_ENST00000424893.1_5'Flank|MYD88_ENST00000495303.1_5'Flank	NM_001607.3	NP_001598.1	P09110	THIK_HUMAN	acetyl-CoA acyltransferase 1	72					alpha-linolenic acid metabolic process (GO:0036109)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	acetyl-CoA C-acyltransferase activity (GO:0003988)|palmitoyl-CoA oxidase activity (GO:0016401)			endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)	9				KIRC - Kidney renal clear cell carcinoma(284;0.0523)|Kidney(284;0.0657)		TCCTTGAGAACCGCGGTCATG	0.642																																					p.V72L		Atlas-SNP	.											.	ACAA1	32	.	0			c.G214C						PASS	.						53.0	47.0	49.0					3																	38178134		2203	4300	6503	SO:0001583	missense	30	exon2			TGAGAACCGCGGT	X14813	CCDS2673.1, CCDS46794.1	3p22.2	2012-05-16	2010-04-30		ENSG00000060971	ENSG00000060971	2.3.1.16		82	protein-coding gene	gene with protein product	"""peroxisomal 3-oxoacyl-Coenzyme A thiolase"""	604054	"""acetyl-Coenzyme A acyltransferase 1"""				Standard	NM_001607		Approved		uc003cht.3	P09110	OTTHUMG00000131087	ENST00000333167.8:c.214G>C	chr3.hg19:g.38178134C>G	ENSP00000333664:p.Val72Leu	60.0	0.0	.		94.0	28.0	.	NM_001130410	G5E935|Q96CA6	Missense_Mutation	SNP	ENST00000333167.8	hg19	CCDS2673.1	.	.	.	.	.	.	.	.	.	.	C	17.65	3.442786	0.63067	.	.	ENSG00000060971	ENST00000333167;ENST00000301810;ENST00000450296;ENST00000358122;ENST00000444607	D;D;D;D	0.93604	-2.13;-2.13;-3.25;-2.13	4.85	4.85	0.62838	Thiolase-like, subgroup (1);Thiolase, N-terminal (1);Thiolase-like (1);	0.212850	0.38605	N	0.001627	D	0.87164	0.6109	N	0.17278	0.47	0.80722	D	1	B;B;B;B	0.18863	0.001;0.003;0.031;0.0	B;B;B;B	0.17979	0.003;0.02;0.019;0.004	T	0.82806	-0.0275	10	0.14656	T	0.56	-17.5296	17.9617	0.89087	0.0:1.0:0.0:0.0	.	4;72;72;72	F5GXL8;C9JDE9;G5E935;P09110	.;.;.;THIK_HUMAN	L	72;72;72;4;72	ENSP00000333664:V72L;ENSP00000301810:V72L;ENSP00000395183:V72L;ENSP00000391918:V72L	ENSP00000301810:V72L	V	-	1	0	ACAA1	38153138	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.483000	0.60264	2.230000	0.72887	0.655000	0.94253	GTT	.	.	.	none		0.642	ACAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342980.1	NM_001607	
HPSE	10855	hgsc.bcm.edu	37	4	84243394	84243394	+	Silent	SNP	G	G	A			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr4:84243394G>A	ENST00000405413.2	-	3	487	c.351C>T	c.(349-351)taC>taT	p.Y117Y	HPSE_ENST00000512196.1_Silent_p.Y117Y|HPSE_ENST00000311412.5_Silent_p.Y117Y|HPSE_ENST00000513463.1_Silent_p.Y117Y	NM_006665.5	NP_006656.2	Q9Y251	HPSE_HUMAN	heparanase	117					carbohydrate metabolic process (GO:0005975)|cell-matrix adhesion (GO:0007160)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan catabolic process (GO:0030200)|positive regulation of blood coagulation (GO:0030194)|positive regulation of hair follicle development (GO:0051798)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation vascular endothelial growth factor production (GO:0010575)|proteoglycan metabolic process (GO:0006029)|regulation of hair follicle development (GO:0051797)|small molecule metabolic process (GO:0044281)|vascular wound healing (GO:0061042)	extracellular region (GO:0005576)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|membrane raft (GO:0045121)|nucleus (GO:0005634)	beta-glucuronidase activity (GO:0004566)|heparanase activity (GO:0030305)|protein dimerization activity (GO:0046983)|syndecan binding (GO:0045545)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	20		Hepatocellular(203;0.114)		COAD - Colon adenocarcinoma(81;0.141)	Dalteparin(DB06779)|Heparin(DB01109)	GAGATTGCCAGTAACTTCTCT	0.403																																					p.Y117Y		Atlas-SNP	.											.	HPSE	55	.	0			c.C351T						PASS	.						85.0	87.0	86.0					4																	84243394		2203	4300	6503	SO:0001819	synonymous_variant	10855	exon2			TTGCCAGTAACTT	AF144325	CCDS3602.1, CCDS54774.1, CCDS56337.1	4q21.3	2008-02-05			ENSG00000173083	ENSG00000173083			5164	protein-coding gene	gene with protein product		604724				10395325, 10395326	Standard	NM_006665		Approved	HPA, HSE1, HPSE1	uc003hoj.4	Q9Y251	OTTHUMG00000130425	ENST00000405413.2:c.351C>T	chr4.hg19:g.84243394G>A		166.0	0.0	.		56.0	24.0	.	NM_001199830	A9JIG7|C7F7I3|C7F7I4|E9PCA9|E9PGR1|Q53GE5|Q9UL39	Silent	SNP	ENST00000405413.2	hg19	CCDS3602.1																																																																																			.	.	.	none		0.403	HPSE-001	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252812.2	NM_006665	
FAM198B	51313	hgsc.bcm.edu	37	4	159092402	159092402	+	Silent	SNP	A	A	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr4:159092402A>T	ENST00000296530.8	-	2	747	c.126T>A	c.(124-126)acT>acA	p.T42T	RP11-597D13.9_ENST00000505532.1_RNA|FAM198B_ENST00000393807.5_Silent_p.T42T|RP11-597D13.9_ENST00000514381.1_RNA|FAM198B_ENST00000592057.1_Silent_p.T42T|FAM198B_ENST00000589306.1_Intron|RP11-597D13.9_ENST00000503611.1_RNA|RP11-597D13.9_ENST00000509463.1_RNA|FAM198B_ENST00000585682.1_Silent_p.T42T	NM_016613.6	NP_057697.2	Q6UWH4	F198B_HUMAN	family with sequence similarity 198, member B	42						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(14)|skin(2)|urinary_tract(1)	26						TGGCACACGCAGTGCCCAGCA	0.637																																					p.T42T		Atlas-SNP	.											.	FAM198B	134	.	0			c.T126A						PASS	.						42.0	44.0	43.0					4																	159092402		2202	4299	6501	SO:0001819	synonymous_variant	51313	exon2			ACACGCAGTGCCC		CCDS3798.1, CCDS34087.1	4q32.1	2012-11-29	2009-10-19	2009-10-19	ENSG00000164125	ENSG00000164125			25312	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 18"""	C4orf18		12975309	Standard	NM_001031700		Approved	FLJ38155, DKFZp434L142	uc003ipr.4	Q6UWH4	OTTHUMG00000161537	ENST00000296530.8:c.126T>A	chr4.hg19:g.159092402A>T		172.0	0.0	.		301.0	115.0	.	NM_016613	Q498Z3|Q6IAF9|Q6ZMF2|Q86XL0	Silent	SNP	ENST00000296530.8	hg19	CCDS3798.1																																																																																			.	.	.	none		0.637	FAM198B-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365230.1	NM_001031700, NM_016613	
FAM173B	134145	hgsc.bcm.edu	37	5	10249973	10249973	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr5:10249973C>T	ENST00000511437.1	-	1	25	c.13G>A	c.(13-15)Gga>Aga	p.G5R	CCT5_ENST00000506600.1_5'Flank|FAM173B_ENST00000510052.1_5'UTR|CTD-2256P15.1_ENST00000509915.1_RNA|CCT5_ENST00000515390.1_5'Flank|CCT5_ENST00000280326.4_5'Flank|CCT5_ENST00000515676.1_5'Flank|CCT5_ENST00000503026.1_5'Flank|FAM173B_ENST00000280330.8_5'UTR|FAM173B_ENST00000510047.1_Missense_Mutation_p.G5R	NM_199133.3	NP_954584.2	Q6P4H8	F173B_HUMAN	family with sequence similarity 173, member B	5						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	16						GCCTCACCTCCTCCTCCCTCC	0.532																																					p.G5R		Atlas-SNP	.											.	FAM173B	24	.	0			c.G13A						PASS	.						21.0	28.0	26.0					5																	10249973		1815	4066	5881	SO:0001583	missense	134145	exon1			CACCTCCTCCTCC		CCDS43301.1, CCDS58942.1	5p15.2	2008-08-08			ENSG00000150756	ENSG00000150756			27029	protein-coding gene	gene with protein product						12477932	Standard	NM_199133		Approved		uc003jeo.3	Q6P4H8	OTTHUMG00000161771	ENST00000511437.1:c.13G>A	chr5.hg19:g.10249973C>T	ENSP00000422338:p.Gly5Arg	116.0	0.0	.		122.0	45.0	.	NM_199133	B4DT41|B4DXK2|E9PBZ4	Missense_Mutation	SNP	ENST00000511437.1	hg19	CCDS43301.1	.	.	.	.	.	.	.	.	.	.	C	15.01	2.707244	0.48412	.	.	ENSG00000150756	ENST00000511437;ENST00000510047	T;T	0.19250	2.16;2.23	4.76	4.76	0.60689	.	2.684740	0.03150	N	0.167810	T	0.32823	0.0842	L	0.34521	1.04	0.30467	N	0.773718	P;P	0.50943	0.94;0.901	P;P	0.51615	0.675;0.476	T	0.30001	-0.9993	10	0.87932	D	0	.	13.2821	0.60222	0.0:1.0:0.0:0.0	.	5;5	E9PBZ4;Q6P4H8	.;F173B_HUMAN	R	5	ENSP00000422338:G5R;ENSP00000420876:G5R	ENSP00000424210:G5R	G	-	1	0	FAM173B	10302973	0.990000	0.36364	0.880000	0.34516	0.780000	0.44128	0.276000	0.18716	2.166000	0.68216	0.561000	0.74099	GGA	.	.	.	none		0.532	FAM173B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000366048.2	NM_199133	
ARHGEF28	64283	hgsc.bcm.edu	37	5	73163796	73163796	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr5:73163796G>C	ENST00000426542.2	+	18	2268	c.2248G>C	c.(2248-2250)Gga>Cga	p.G750R	ARHGEF28_ENST00000545377.1_Missense_Mutation_p.G750R|ARHGEF28_ENST00000513042.2_Missense_Mutation_p.G750R|ARHGEF28_ENST00000287898.5_Missense_Mutation_p.G750R|ARHGEF28_ENST00000296799.4_Missense_Mutation_p.G437R|ARHGEF28_ENST00000296794.6_Missense_Mutation_p.G750R|ARHGEF28_ENST00000437974.1_Missense_Mutation_p.G750R			Q8N1W1	ARG28_HUMAN	Rho guanine nucleotide exchange factor (GEF) 28	750					central nervous system neuron axonogenesis (GO:0021955)|intracellular signal transduction (GO:0035556)|neurofilament cytoskeleton organization (GO:0060052)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|RNA binding (GO:0003723)	p.G750R(4)									GGAGACTGTGGGACAGGTCCA	0.522																																					p.G750R		Atlas-SNP	.											NP_001073948_1,NS,carcinoma,0,2	.	.	.	4	Substitution - Missense(4)	lung(4)	c.G2248C						PASS	.						104.0	99.0	101.0					5																	73163796		1962	4159	6121	SO:0001583	missense	64283	exon19			ACTGTGGGACAGG		CCDS47231.1, CCDS47231.2, CCDS54870.1, CCDS58957.1	5q13.2	2012-08-08			ENSG00000214944	ENSG00000214944			30322	protein-coding gene	gene with protein product		612790				9199174, 11058585	Standard	NM_001177693		Approved	RGNEF, p190RhoGEF, RIP2	uc010izf.3	Q8N1W1	OTTHUMG00000162454	ENST00000426542.2:c.2248G>C	chr5.hg19:g.73163796G>C	ENSP00000412175:p.Gly750Arg	81.0	0.0	.		33.0	12.0	.	NM_001080479	B2RXG7|B4E3K4|B5MDA3|B7ZW32|E9PC75|Q8NCM7|Q96E37|Q9H6L3|Q9H6W0	Missense_Mutation	SNP	ENST00000426542.2	hg19	CCDS54870.1	.	.	.	.	.	.	.	.	.	.	G	2.497	-0.316052	0.05422	.	.	ENSG00000214944	ENST00000296794;ENST00000545377;ENST00000513042;ENST00000287898;ENST00000437974;ENST00000426542;ENST00000296799	T;T;T;T;T;T;T	0.10192	3.16;3.16;3.15;2.9;3.16;3.15;3.0	5.67	4.72	0.59763	.	.	.	.	.	T	0.10208	0.0250	L	0.44542	1.39	0.09310	N	1	B;B;B;P	0.36282	0.014;0.027;0.015;0.546	B;B;B;B	0.36244	0.005;0.005;0.019;0.22	T	0.18209	-1.0344	9	0.20519	T	0.43	.	10.1606	0.42849	0.0:0.175:0.6902:0.1348	.	437;750;750;750	B5MDA3;Q8N1W1;E9PC75;Q8N1W1-4	.;RGNEF_HUMAN;.;.	R	750;750;750;750;750;750;437	ENSP00000296794:G750R;ENSP00000441913:G750R;ENSP00000441436:G750R;ENSP00000287898:G750R;ENSP00000411459:G750R;ENSP00000412175:G750R;ENSP00000296799:G437R	ENSP00000287898:G750R	G	+	1	0	RP11-428C6.1	73199552	0.004000	0.15560	0.021000	0.16686	0.002000	0.02628	1.469000	0.35343	2.671000	0.90904	0.585000	0.79938	GGA	.	.	.	none		0.522	ARHGEF28-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000368975.1		
SHROOM1	134549	hgsc.bcm.edu	37	5	132160478	132160478	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr5:132160478G>T	ENST00000378679.3	-	6	1874	c.1070C>A	c.(1069-1071)cCt>cAt	p.P357H	SHROOM1_ENST00000319854.3_Missense_Mutation_p.P357H|SHROOM1_ENST00000378676.1_Intron|SHROOM1_ENST00000488072.1_5'Flank	NM_001172700.1	NP_001166171.1	Q2M3G4	SHRM1_HUMAN	shroom family member 1	357					actin filament bundle assembly (GO:0051017)|cell morphogenesis (GO:0000902)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|myosin II complex (GO:0016460)	actin filament binding (GO:0051015)			endometrium(1)|kidney(4)|large_intestine(2)|lung(4)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TAACTCTGCAGGATACATCAC	0.567																																					p.P357H		Atlas-SNP	.											.	SHROOM1	35	.	0			c.C1070A						PASS	.						60.0	62.0	61.0					5																	132160478		2203	4300	6503	SO:0001583	missense	134549	exon3			TCTGCAGGATACA	AF314142	CCDS4161.1, CCDS54902.1	5q31.1	2007-05-03			ENSG00000164403	ENSG00000164403			24084	protein-coding gene	gene with protein product		611179				11853319, 16615870	Standard	NM_133456		Approved	APXL2, KIAA1960	uc003kxy.2	Q2M3G4	OTTHUMG00000059835	ENST00000378679.3:c.1070C>A	chr5.hg19:g.132160478G>T	ENSP00000367950:p.Pro357His	110.0	0.0	.		204.0	78.0	.	NM_133456	B7WP40|B7ZL01|Q8TDP0|Q8TF41	Missense_Mutation	SNP	ENST00000378679.3	hg19	CCDS54902.1	.	.	.	.	.	.	.	.	.	.	G	9.923	1.212785	0.22289	.	.	ENSG00000164403	ENST00000378679;ENST00000319854	T;T	0.24350	1.86;1.86	3.93	3.06	0.35304	.	0.509864	0.20038	N	0.100569	T	0.18130	0.0435	L	0.27053	0.805	0.19300	N	0.999977	B;B	0.27498	0.18;0.113	B;B	0.29176	0.099;0.046	T	0.19976	-1.0289	10	0.72032	D	0.01	-3.8793	9.1379	0.36886	0.0:0.0:0.7829:0.2171	.	357;357	Q2M3G4-2;Q2M3G4	.;SHRM1_HUMAN	H	357	ENSP00000367950:P357H;ENSP00000324245:P357H	ENSP00000324245:P357H	P	-	2	0	SHROOM1	132188377	0.141000	0.22595	0.029000	0.17559	0.002000	0.02628	1.458000	0.35223	1.222000	0.43521	-0.268000	0.10319	CCT	.	.	.	none		0.567	SHROOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000133033.1	NM_133456	
SEC24A	10802	hgsc.bcm.edu	37	5	134002687	134002687	+	Splice_Site	SNP	G	G	A			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr5:134002687G>A	ENST00000398844.2	+	3	1027		c.e3+1		SEC24A_ENST00000322887.4_Splice_Site	NM_021982.2	NP_068817.1	O95486	SC24A_HUMAN	SEC24 family member A						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of protein secretion (GO:0050714)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045714)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	36			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AACCAAGAAGGTAAGTGAACC	0.438																																					.		Atlas-SNP	.											.	SEC24A	77	.	0			c.739+1G>A						PASS	.						40.0	39.0	39.0					5																	134002687		1833	4087	5920	SO:0001630	splice_region_variant	10802	exon3			AAGAAGGTAAGTG	AJ131244	CCDS43363.1, CCDS58967.1	5q31.1	2013-10-21	2013-10-21		ENSG00000113615	ENSG00000113615			10703	protein-coding gene	gene with protein product		607183	"""SEC24 (S. cerevisiae) related gene family, member A"", ""SEC24 family, member A (S. cerevisiae)"""			10075675, 10329445	Standard	NM_021982		Approved		uc003kzs.3	O95486	OTTHUMG00000163064	ENST00000398844.2:c.739+1G>A	chr5.hg19:g.134002687G>A		99.0	0.0	.		137.0	50.0	.	NM_001252231	A8MVW3|Q8WUV2|Q96GP7	Splice_Site	SNP	ENST00000398844.2	hg19	CCDS43363.1	.	.	.	.	.	.	.	.	.	.	G	17.08	3.297202	0.60086	.	.	ENSG00000113615	ENST00000398844;ENST00000322887	.	.	.	4.94	4.94	0.65067	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.7049	0.85369	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SEC24A	134030586	1.000000	0.71417	1.000000	0.80357	0.712000	0.41017	5.912000	0.69948	2.428000	0.82296	0.603000	0.83216	.	.	.	.	none		0.438	SEC24A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371563.1		Intron
SPOCK1	6695	hgsc.bcm.edu	37	5	136834142	136834142	+	Missense_Mutation	SNP	C	C	A	rs200001053		TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr5:136834142C>A	ENST00000394945.1	-	2	275	c.106G>T	c.(106-108)Ggc>Tgc	p.G36C	SPOCK1_ENST00000282223.7_Missense_Mutation_p.G36C	NM_004598.3	NP_004589.1	Q08629	TICN1_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1	36					cell adhesion (GO:0007155)|central nervous system neuron differentiation (GO:0021953)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron projection development (GO:0010977)|nervous system development (GO:0007399)|neurogenesis (GO:0022008)|neuron migration (GO:0001764)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|postsynaptic density (GO:0014069)|proteinaceous extracellular matrix (GO:0005578)|sarcoplasm (GO:0016528)	calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			AGGAAATTGCCGTGGTTGGGG	0.682																																					p.G36C		Atlas-SNP	.											.	SPOCK1	58	.	0			c.G106T						PASS	.						22.0	21.0	21.0					5																	136834142		2203	4299	6502	SO:0001583	missense	6695	exon2			AATTGCCGTGGTT	AF231124	CCDS4191.1	5q31.2	2008-02-05	2005-11-04	2005-11-04	ENSG00000152377	ENSG00000152377			11251	protein-coding gene	gene with protein product		602264	"""sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican)"""	TIC1, SPOCK		9545645	Standard	NM_004598		Approved	testican-1	uc003lbp.3	Q08629	OTTHUMG00000129157	ENST00000394945.1:c.106G>T	chr5.hg19:g.136834142C>A	ENSP00000378401:p.Gly36Cys	37.0	0.0	.		56.0	17.0	.	NM_004598	B3KSW3|Q59EW0|Q8N630|Q9UCL8	Missense_Mutation	SNP	ENST00000394945.1	hg19	CCDS4191.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.179946	0.78564	.	.	ENSG00000152377	ENST00000394945;ENST00000282223;ENST00000505690	T;T;T	0.55588	0.54;0.54;0.51	3.66	2.77	0.32553	.	0.371240	0.21081	N	0.080484	T	0.58509	0.2127	L	0.56199	1.76	0.25077	N	0.990954	D	0.62365	0.991	P	0.55965	0.788	T	0.51576	-0.8688	10	0.66056	D	0.02	.	9.9319	0.41528	0.204:0.796:0.0:0.0	.	36	Q08629	TICN1_HUMAN	C	36	ENSP00000378401:G36C;ENSP00000282223:G36C;ENSP00000424517:G36C	ENSP00000282223:G36C	G	-	1	0	SPOCK1	136862041	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.898000	0.63238	0.626000	0.30322	0.462000	0.41574	GGC	.	C|1.000;G|0.000	.	alt		0.682	SPOCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251222.1	NM_004598	
KIF6	221458	hgsc.bcm.edu	37	6	39313488	39313488	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr6:39313488G>T	ENST00000287152.7	-	21	2403	c.2309C>A	c.(2308-2310)cCa>cAa	p.P770Q	KIF6_ENST00000538893.1_Missense_Mutation_p.P714Q|KIF6_ENST00000373215.3_Missense_Mutation_p.P753Q|KIF6_ENST00000394362.1_Missense_Mutation_p.P204Q|KIF6_ENST00000373216.3_Missense_Mutation_p.P753Q|KIF6_ENST00000373213.4_Missense_Mutation_p.P609Q|KIF6_ENST00000541946.1_Missense_Mutation_p.P221Q|KIF6_ENST00000229913.5_Missense_Mutation_p.P221Q	NM_145027.4	NP_659464.3	Q6ZMV9	KIF6_HUMAN	kinesin family member 6	770					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|male germ cell nucleus (GO:0001673)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(16)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						GTCTTCCAGTGGGGTGCTGGT	0.557																																					p.P770Q		Atlas-SNP	.											.	KIF6	233	.	0			c.C2309A						PASS	.						124.0	107.0	113.0					6																	39313488		2203	4300	6503	SO:0001583	missense	221458	exon21			TCCAGTGGGGTGC	AL832634	CCDS4844.1, CCDS75449.1	6p21.2	2010-03-30			ENSG00000164627	ENSG00000164627		"""Kinesins"""	21202	protein-coding gene	gene with protein product		613919	"""chromosome 6 open reading frame 102"""	C6orf102			Standard	NM_145027		Approved	dJ1043E3.1, MGC33317, dJ137F1.4, dJ188D3.1, DKFZp451I2418	uc003oot.2	Q6ZMV9	OTTHUMG00000014648	ENST00000287152.7:c.2309C>A	chr6.hg19:g.39313488G>T	ENSP00000287152:p.Pro770Gln	53.0	0.0	.		67.0	29.0	.	NM_145027	Q2MDE3|Q2MDE4|Q5T8J6|Q6ZWE3|Q86T87|Q8WTV4	Missense_Mutation	SNP	ENST00000287152.7	hg19	CCDS4844.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.700|6.700	0.497738|0.497738	0.12762|0.12762	.|.	.|.	ENSG00000164627|ENSG00000164627	ENST00000458470|ENST00000287152;ENST00000394362;ENST00000373216;ENST00000373213;ENST00000229913;ENST00000373215;ENST00000538893;ENST00000541946	.|T;T;T;T;T;T;T;T	.|0.71222	.|-0.49;1.51;-0.53;-0.31;1.53;-0.49;-0.55;1.49	4.12|4.12	-1.35|-1.35	0.09114|0.09114	.|.	.|.	.|.	.|.	.|.	T|T	0.11665|0.11665	0.0284|0.0284	N|N	0.01352|0.01352	-0.895|-0.895	0.09310|0.09310	N|N	1|1	.|B;B;B;B	.|0.26195	.|0.09;0.09;0.144;0.054	.|B;B;B;B	.|0.29440	.|0.048;0.03;0.102;0.022	T|T	0.20940|0.20940	-1.0260|-1.0260	5|9	.|0.09084	.|T	.|0.74	.|.	1.384|1.384	0.02236|0.02236	0.1966:0.3047:0.3385:0.1602|0.1966:0.3047:0.3385:0.1602	.|.	.|753;714;753;770	.|E7EUN7;F6VGH2;Q6ZMV9-3;Q6ZMV9	.|.;.;.;KIF6_HUMAN	N|Q	645|770;204;753;609;221;753;714;221	.|ENSP00000287152:P770Q;ENSP00000377889:P204Q;ENSP00000362312:P753Q;ENSP00000362309:P609Q;ENSP00000229913:P221Q;ENSP00000362311:P753Q;ENSP00000441435:P714Q;ENSP00000439064:P221Q	.|ENSP00000229913:P221Q	H|P	-|-	1|2	0|0	KIF6|KIF6	39421466|39421466	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.191000|0.191000	0.23601|0.23601	-1.263000|-1.263000	0.02850|0.02850	-0.421000|-0.421000	0.07416|0.07416	0.563000|0.563000	0.77884|0.77884	CAC|CCA	.	.	.	none		0.557	KIF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040455.2	NM_145027	
NR2E1	7101	hgsc.bcm.edu	37	6	108499383	108499383	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr6:108499383T>G	ENST00000368986.4	+	5	1288	c.580T>G	c.(580-582)Ttc>Gtc	p.F194V	NR2E1_ENST00000368983.3_Missense_Mutation_p.F231V	NM_003269.3	NP_003260.1	Q9Y466	NR2E1_HUMAN	nuclear receptor subfamily 2, group E, member 1	194	Ligand-binding. {ECO:0000250}.				aggressive behavior (GO:0002118)|amygdala development (GO:0021764)|anterior commissure morphogenesis (GO:0021960)|behavioral fear response (GO:0001662)|cell fate commitment (GO:0045165)|cerebral cortex neuron differentiation (GO:0021895)|dentate gyrus development (GO:0021542)|extracellular matrix organization (GO:0030198)|forebrain generation of neurons (GO:0021872)|gene expression (GO:0010467)|glial cell migration (GO:0008347)|layer formation in cerebral cortex (GO:0021819)|long-term synaptic potentiation (GO:0060291)|negative regulation of apoptotic process (GO:0043066)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|olfactory bulb development (GO:0021772)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle (GO:0045787)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of stem cell proliferation (GO:2000648)|regulation of cell migration involved in sprouting angiogenesis (GO:0090049)|regulation of dendrite morphogenesis (GO:0048814)|regulation of timing of neuron differentiation (GO:0060164)|retina development in camera-type eye (GO:0060041)|social behavior (GO:0035176)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|visual perception (GO:0007601)	nucleoplasm (GO:0005654)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(16)|prostate(1)|skin(3)	30		all_cancers(87;8.13e-05)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00866)|Colorectal(196;0.0637)		BRCA - Breast invasive adenocarcinoma(108;0.013)|Epithelial(106;0.0521)|all cancers(137;0.068)|OV - Ovarian serous cystadenocarcinoma(136;0.0689)		CAGACTTCTCTTCATGAGCAT	0.527																																					p.F194V		Atlas-SNP	.											.	NR2E1	57	.	0			c.T580G						PASS	.						123.0	104.0	110.0					6																	108499383		2203	4300	6503	SO:0001583	missense	7101	exon5			CTTCTCTTCATGA	Y13276	CCDS5063.1, CCDS69165.1	6q21	2013-01-16			ENSG00000112333	ENSG00000112333		"""Nuclear hormone receptors"""	7973	protein-coding gene	gene with protein product		603849		TLX		9628820	Standard	NM_003269		Approved	TLL, XTLL	uc003psg.3	Q9Y466	OTTHUMG00000015319	ENST00000368986.4:c.580T>G	chr6.hg19:g.108499383T>G	ENSP00000357982:p.Phe194Val	181.0	0.0	.		79.0	29.0	.	NM_003269	Q6ZMP8	Missense_Mutation	SNP	ENST00000368986.4	hg19	CCDS5063.1	.	.	.	.	.	.	.	.	.	.	T	31	5.077084	0.94000	.	.	ENSG00000112333	ENST00000368986;ENST00000368983	T;T	0.50813	0.73;0.73	5.6	5.6	0.85130	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.043698	0.85682	D	0.000000	T	0.30070	0.0753	N	0.26092	0.79	0.80722	D	1	P	0.46621	0.881	P	0.48089	0.566	T	0.07009	-1.0795	10	0.30854	T	0.27	.	14.0221	0.64563	0.0:0.0:0.0:1.0	.	194	Q9Y466	NR2E1_HUMAN	V	194;231	ENSP00000357982:F194V;ENSP00000357979:F231V	ENSP00000357979:F231V	F	+	1	0	NR2E1	108606076	1.000000	0.71417	0.970000	0.41538	0.957000	0.61999	7.698000	0.84413	2.134000	0.65973	0.528000	0.53228	TTC	.	.	.	none		0.527	NR2E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041712.2		
HIPK2	28996	hgsc.bcm.edu	37	7	139299101	139299101	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr7:139299101T>C	ENST00000406875.3	-	8	2015	c.1921A>G	c.(1921-1923)Aca>Gca	p.T641A	HIPK2_ENST00000428878.2_Missense_Mutation_p.T614A|HIPK2_ENST00000342645.6_Missense_Mutation_p.T641A	NM_022740.4	NP_073577.3	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2	641	Interaction with SKI and SMAD1.				adult walking behavior (GO:0007628)|anterior/posterior pattern specification (GO:0009952)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|erythrocyte differentiation (GO:0030218)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|retina layer formation (GO:0010842)|SMAD protein signal transduction (GO:0060395)|smoothened signaling pathway (GO:0007224)|transforming growth factor beta receptor signaling pathway (GO:0007179)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|virion binding (GO:0046790)			breast(4)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Melanoma(164;0.205)					ATCTGGGCTGTTCCTGTCTGC	0.597																																					p.T641A		Atlas-SNP	.											.	HIPK2	192	.	0			c.A1921G						PASS	.						47.0	54.0	52.0					7																	139299101		1956	4149	6105	SO:0001583	missense	28996	exon8			GGGCTGTTCCTGT	AF208291	CCDS75666.1, CCDS75667.1	7q32-q34	2004-01-29	2001-11-29		ENSG00000064393	ENSG00000064393			14402	protein-coding gene	gene with protein product		606868	"""homeodomain-interacting protein kinase 2"""			11120354	Standard	NM_001113239		Approved		uc003vvf.4	Q9H2X6	OTTHUMG00000157704	ENST00000406875.3:c.1921A>G	chr7.hg19:g.139299101T>C	ENSP00000385571:p.Thr641Ala	39.0	0.0	.		107.0	46.0	.	NM_022740	Q75MR7|Q8WWI4|Q9H2Y1	Missense_Mutation	SNP	ENST00000406875.3	hg19		.	.	.	.	.	.	.	.	.	.	T	12.91	2.079694	0.36662	.	.	ENSG00000064393	ENST00000406875;ENST00000428878;ENST00000342645	T;T;T	0.50277	0.75;0.8;0.78	5.39	2.9	0.33743	.	.	.	.	.	T	0.33847	0.0877	.	.	.	0.43667	D	0.996098	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.06481	-1.0824	8	0.27785	T	0.31	.	9.7368	0.40392	0.0:0.1461:0.0:0.8539	.	641;614	Q9H2X6;Q9H2X6-3	HIPK2_HUMAN;.	A	641;614;641	ENSP00000385571:T641A;ENSP00000413724:T614A;ENSP00000343108:T641A	ENSP00000343108:T641A	T	-	1	0	HIPK2	138949641	1.000000	0.71417	0.996000	0.52242	0.984000	0.73092	0.813000	0.27225	0.383000	0.24910	0.460000	0.39030	ACA	.	.	.	none		0.597	HIPK2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000349430.3	NM_022740	
SLC35G5	83650	hgsc.bcm.edu	37	8	11188719	11188719	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr8:11188719G>A	ENST00000382435.4	+	1	323	c.104G>A	c.(103-105)gGt>gAt	p.G35D		NM_001282300.1|NM_054028.1	NP_001269229.1|NP_473369.1	Q96KT7	S35G5_HUMAN	solute carrier family 35, member G5	35						integral component of membrane (GO:0016021)		p.G35D(1)									CAGCCCTCTGGTGCCACCAAT	0.682																																					p.G35D		Atlas-SNP	.											AMAC1L2,NS,carcinoma,0,1	.	.	.	1	Substitution - Missense(1)	endometrium(1)	c.G104A						PASS	.																																			SO:0001583	missense	83650	exon1			CCTCTGGTGCCAC	AJ291677	CCDS5980.1	8p23.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000177710	ENSG00000177710		"""Solute carriers"""	15546	protein-coding gene	gene with protein product		615199	"""acyl-malonyl condensing enzyme 1-like 2"""	AMAC, AMAC1L2			Standard	NM_054028		Approved		uc003wtp.1	Q96KT7	OTTHUMG00000090653	ENST00000382435.4:c.104G>A	chr8.hg19:g.11188719G>A	ENSP00000371872:p.Gly35Asp	118.0	1.0	.		273.0	14.0	.	NM_054028	A2RRL6	Missense_Mutation	SNP	ENST00000382435.4	hg19	CCDS5980.1	.	.	.	.	.	.	.	.	.	.	A	0.007	-1.973298	0.00452	.	.	ENSG00000177710	ENST00000382435	T	0.23348	1.91	0.34	0.34	0.15985	.	0.293668	0.23411	N	0.048476	T	0.06280	0.0162	N	0.02539	-0.55	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.28267	-1.0049	9	0.09084	T	0.74	0.0032	.	.	.	.	35	Q96KT7	S35G5_HUMAN	D	35	ENSP00000371872:G35D	ENSP00000371872:G35D	G	+	2	0	SLC35G5	11226129	0.973000	0.33851	0.352000	0.25734	0.047000	0.14425	0.142000	0.16096	-1.532000	0.01747	-2.047000	0.00414	GGT	.	.	.	none		0.682	SLC35G5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207313.2	NM_054028	
FGFR1	2260	hgsc.bcm.edu	37	8	38271216	38271216	+	Missense_Mutation	SNP	G	G	T	rs377620009		TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr8:38271216G>T	ENST00000447712.2	-	18	3340	c.2399C>A	c.(2398-2400)cCg>cAg	p.P800Q	FGFR1_ENST00000532791.1_Missense_Mutation_p.P798Q|FGFR1_ENST00000397108.4_Missense_Mutation_p.P798Q|FGFR1_ENST00000425967.3_Missense_Mutation_p.P831Q|FGFR1_ENST00000326324.6_Missense_Mutation_p.P709Q|FGFR1_ENST00000397113.2_Missense_Mutation_p.P798Q|FGFR1_ENST00000397091.5_Missense_Mutation_p.P798Q|FGFR1_ENST00000356207.5_Missense_Mutation_p.P711Q|FGFR1_ENST00000341462.5_Missense_Mutation_p.P800Q|FGFR1_ENST00000335922.5_Missense_Mutation_p.P790Q|FGFR1_ENST00000397103.1_Missense_Mutation_p.P711Q	NM_001174063.1|NM_015850.3|NM_023110.2	NP_001167534.1|NP_056934.2|NP_075598.2	P11362	FGFR1_HUMAN	fibroblast growth factor receptor 1	800					angiogenesis (GO:0001525)|auditory receptor cell development (GO:0060117)|axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell maturation (GO:0048469)|cell migration (GO:0016477)|chondrocyte differentiation (GO:0002062)|chordate embryonic development (GO:0043009)|embryonic limb morphogenesis (GO:0030326)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lung-associated mesenchyme development (GO:0060484)|MAPK cascade (GO:0000165)|mesenchymal cell differentiation (GO:0048762)|midbrain development (GO:0030901)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|outer ear morphogenesis (GO:0042473)|paraxial mesoderm development (GO:0048339)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)|regulation of cell differentiation (GO:0045595)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of lateral mesodermal cell fate specification (GO:0048378)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ventricular zone neuroblast division (GO:0021847)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)		FGFR1/ZNF703(2)	breast(2)|central_nervous_system(7)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	50	all_cancers(2;9.05e-47)|all_epithelial(2;2.64e-50)|all_lung(3;1.71e-23)|Lung NSC(2;3.61e-23)|Colorectal(12;0.000442)	Breast(189;1.48e-05)|all_lung(54;0.00354)|Lung NSC(58;0.0138)|Hepatocellular(245;0.065)	Epithelial(3;3.96e-34)|all cancers(3;3.06e-30)|BRCA - Breast invasive adenocarcinoma(5;2.28e-21)|COAD - Colon adenocarcinoma(9;0.24)		Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	CTCGGGCAGCGGCTCATGAGA	0.662		1	T	"""BCR, FOP, ZNF198, CEP1"""	"""MPD, NHL"""		"""Pfeiffer syndrome, Kallman syndrome"""																														p.P831Q	Melanoma(146;1153 1840 21453 21841 43625)	Atlas-SNP	.		Dom	yes		8	8p11.2-p11.1	2260	fibroblast growth factor receptor 1	yes	L	Q7Z2S2_HUMAN,NS,carcinoma,0,4	FGFR1	284	.	0			c.C2492A						PASS	.						21.0	28.0	26.0					8																	38271216		2059	4189	6248	SO:0001583	missense	2260	exon19			GGCAGCGGCTCAT	M34185	CCDS6107.2, CCDS43730.1, CCDS43731.1, CCDS43732.1, CCDS55221.1, CCDS55222.1, CCDS55223.1	8p11.23-p11.22	2014-04-03	2008-08-01		ENSG00000077782	ENSG00000077782	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3688	protein-coding gene	gene with protein product	"""Pfeiffer syndrome"""	136350	"""fms-related tyrosine kinase 2"""	FLT2, KAL2		2162671	Standard	NM_015850		Approved	H2, H3, H4, H5, CEK, FLG, BFGFR, N-SAM, CD331	uc011lbu.2	P11362	OTTHUMG00000147366	ENST00000447712.2:c.2399C>A	chr8.hg19:g.38271216G>T	ENSP00000400162:p.Pro800Gln	40.0	0.0	.		50.0	3.0	.	NM_001174067	A8K6T9|A8K8V5|C1KBH8|P17049|Q02063|Q02065|Q14306|Q14307|Q53H63|Q59H40|Q5BJG2|Q8N685|Q9UD50|Q9UDF0|Q9UDF1|Q9UDF2	Missense_Mutation	SNP	ENST00000447712.2	hg19	CCDS6107.2	.	.	.	.	.	.	.	.	.	.	G	25.9	4.689014	0.88735	.	.	ENSG00000077782	ENST00000397091;ENST00000425967;ENST00000447712;ENST00000341462;ENST00000532791;ENST00000397113;ENST00000356207;ENST00000335922;ENST00000326324;ENST00000397103;ENST00000397108	T;T;T;T;T;T;T;T;T;T;T	0.75938	-0.98;-0.98;-0.98;-0.98;-0.98;-0.98;-0.98;-0.98;-0.98;-0.98;-0.98	5.53	5.53	0.82687	.	0.101061	0.64402	D	0.000002	D	0.86389	0.5921	M	0.76574	2.34	0.58432	D	0.999997	D;D;D;D;D	0.71674	0.996;0.996;0.994;0.998;0.996	D;D;P;D;D	0.70487	0.956;0.956;0.905;0.969;0.956	D	0.87462	0.2408	10	0.87932	D	0	.	19.4585	0.94906	0.0:0.0:1.0:0.0	.	709;709;800;790;798	P11362-14;P11362-4;P11362;P11362-20;P11362-2	.;.;FGFR1_HUMAN;.;.	Q	798;831;800;800;798;798;711;790;709;711;798	ENSP00000380280:P798Q;ENSP00000393312:P831Q;ENSP00000400162:P800Q;ENSP00000340636:P800Q;ENSP00000432972:P798Q;ENSP00000380302:P798Q;ENSP00000348537:P711Q;ENSP00000337247:P790Q;ENSP00000327229:P709Q;ENSP00000380292:P711Q;ENSP00000380297:P798Q	ENSP00000327229:P709Q	P	-	2	0	FGFR1	38390373	1.000000	0.71417	0.955000	0.39395	0.952000	0.60782	7.781000	0.85668	2.602000	0.87976	0.655000	0.94253	CCG	.	.	.	alt		0.662	FGFR1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
TYRP1	7306	hgsc.bcm.edu	37	9	12694339	12694339	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr9:12694339C>G	ENST00000388918.5	+	2	472	c.343C>G	c.(343-345)Cct>Gct	p.P115A	TYRP1_ENST00000381137.2_5'UTR|TYRP1_ENST00000381136.2_5'Flank	NM_000550.2	NP_000541.1	P17643	TYRP1_HUMAN	tyrosinase-related protein 1	115					acetoacetic acid metabolic process (GO:0043438)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome organization (GO:0032438)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)|melanosome membrane (GO:0033162)	copper ion binding (GO:0005507)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, another compound as one donor, and incorporation of one atom of oxygen (GO:0016716)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|stomach(1)	22		all_cancers(3;3.1e-05)|all_lung(3;1.7e-06)|Lung NSC(3;2.09e-06)|all_epithelial(3;0.000695)|all_hematologic(3;0.0033)|Acute lymphoblastic leukemia(23;0.0744)		GBM - Glioblastoma multiforme(50;9.85e-06)		GACGTGCCGTCCTGGCTGGAG	0.507									Oculocutaneous Albinism																												p.P115A		Atlas-SNP	.											.	TYRP1	60	.	0			c.C343G						PASS	.						35.0	33.0	34.0					9																	12694339		2203	4300	6503	SO:0001583	missense	7306	exon2	Familial Cancer Database		TGCCGTCCTGGCT	L33830	CCDS34990.1	9p23	2013-01-08			ENSG00000107165	ENSG00000107165			12450	protein-coding gene	gene with protein product		115501		TYRP, CAS2		9434945	Standard	NM_000550		Approved	GP75, CATB, TRP, b-PROTEIN, OCA3	uc003zkv.4	P17643	OTTHUMG00000021034	ENST00000388918.5:c.343C>G	chr9.hg19:g.12694339C>G	ENSP00000373570:p.Pro115Ala	63.0	0.0	.		48.0	14.0	.	NM_000550	P78468|P78469|Q13721|Q15679	Missense_Mutation	SNP	ENST00000388918.5	hg19	CCDS34990.1	.	.	.	.	.	.	.	.	.	.	C	15.79	2.937217	0.52972	.	.	ENSG00000107165	ENST00000388918	D	0.98926	-5.24	5.5	5.5	0.81552	Uncharacterised domain, di-copper centre (2);	0.097920	0.64402	D	0.000001	D	0.97324	0.9125	L	0.55834	1.745	0.80722	D	1	B	0.10296	0.003	B	0.14578	0.011	D	0.95286	0.8390	9	.	.	.	-1.287	19.7727	0.96373	0.0:1.0:0.0:0.0	.	115	P17643	TYRP1_HUMAN	A	115	ENSP00000373570:P115A	.	P	+	1	0	TYRP1	12684339	0.998000	0.40836	1.000000	0.80357	0.744000	0.42396	3.774000	0.55341	2.758000	0.94735	0.563000	0.77884	CCT	.	.	.	none		0.507	TYRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055502.3	NM_000550	
KIF12	113220	hgsc.bcm.edu	37	9	116859620	116859620	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr9:116859620A>T	ENST00000374118.3	-	4	430	c.193T>A	c.(193-195)Ttt>Att	p.F65I	KIF12_ENST00000473174.1_Intron	NM_138424.1	NP_612433.1	Q96FN5	KIF12_HUMAN	kinesin family member 12	198	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	17						AGACTCCCAAATTCCACCACC	0.602																																					p.F65I		Atlas-SNP	.											.	KIF12	35	.	0			c.T193A						PASS	.						41.0	43.0	43.0					9																	116859620		2203	4300	6503	SO:0001583	missense	113220	exon4			TCCCAAATTCCAC	BC010626	CCDS6801.1	9q33.1	2008-02-05			ENSG00000136883	ENSG00000136883		"""Kinesins"""	21495	protein-coding gene	gene with protein product		611278					Standard	NM_138424		Approved		uc004bif.3	Q96FN5	OTTHUMG00000020533	ENST00000374118.3:c.193T>A	chr9.hg19:g.116859620A>T	ENSP00000363232:p.Phe65Ile	71.0	0.0	.		92.0	32.0	.	NM_138424	Q5TBE0	Missense_Mutation	SNP	ENST00000374118.3	hg19	CCDS6801.1	.	.	.	.	.	.	.	.	.	.	A	6.945	0.544191	0.13312	.	.	ENSG00000136883	ENST00000374118;ENST00000259410	T	0.70045	-0.45	5.5	0.00987	0.14080	Kinesin, motor domain (4);	0.463632	0.22239	N	0.062709	T	0.33000	0.0848	N	0.01817	-0.705	0.23906	N	0.996504	B	0.10296	0.003	B	0.15484	0.013	T	0.21245	-1.0251	10	0.52906	T	0.07	.	4.5522	0.12117	0.4767:0.0:0.0832:0.4401	.	198	Q96FN5	KIF12_HUMAN	I	65;198	ENSP00000363232:F65I	ENSP00000259410:F198I	F	-	1	0	KIF12	115899441	0.889000	0.30405	0.842000	0.33263	0.054000	0.15201	1.421000	0.34815	-0.251000	0.09542	-0.451000	0.05528	TTT	.	.	.	none		0.602	KIF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053751.1	NM_138424	
METTL10	399818	hgsc.bcm.edu	37	10	126477651	126477651	+	Silent	SNP	A	A	G			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr10:126477651A>G	ENST00000368836.2	-	3	288	c.252T>C	c.(250-252)ctT>ctC	p.L84L	RP11-12J10.3_ENST00000494792.1_Missense_Mutation_p.L49S	NM_212554.2	NP_997719.2	Q5JPI9	MET10_HUMAN	methyltransferase like 10	84							methyltransferase activity (GO:0008168)			endometrium(1)|large_intestine(2)|lung(1)|urinary_tract(1)	5		all_lung(145;0.0186)|Lung NSC(174;0.0295)|all_neural(114;0.116)|Colorectal(57;0.172)		Colorectal(40;0.101)|COAD - Colon adenocarcinoma(40;0.111)		TTCCAATATCAAGCACTGAAG	0.348																																					p.L84L		Atlas-SNP	.											.	METTL10	16	.	0			c.T252C						PASS	.						172.0	152.0	159.0					10																	126477651		2203	4300	6503	SO:0001819	synonymous_variant	399818	exon3			AATATCAAGCACT		CCDS31307.1	10q26.13	2010-01-15			ENSG00000203791	ENSG00000203791			33787	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 138"""	C10orf138			Standard	NM_212554		Approved	Em:AC068896.3	uc001lhy.1	Q5JPI9	OTTHUMG00000019217	ENST00000368836.2:c.252T>C	chr10.hg19:g.126477651A>G		182.0	0.0	.		110.0	39.0	.	NM_212554	A8MPY7	Silent	SNP	ENST00000368836.2	hg19	CCDS31307.1																																																																																			.	.	.	none		0.348	METTL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050884.1	NM_212554	
OTUB1	55611	hgsc.bcm.edu	37	11	63756155	63756155	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr11:63756155G>T	ENST00000538426.1	+	3	194	c.150G>T	c.(148-150)gaG>gaT	p.E50D	OTUB1_ENST00000536443.1_3'UTR|OTUB1_ENST00000422031.2_Missense_Mutation_p.E87D|OTUB1_ENST00000541478.1_Intron|OTUB1_ENST00000543004.1_Missense_Mutation_p.E59D|OTUB1_ENST00000428192.2_Missense_Mutation_p.E50D|OTUB1_ENST00000543988.1_Missense_Mutation_p.E20D|OTUB1_ENST00000535715.1_Missense_Mutation_p.E50D	NM_017670.2	NP_060140.2	Q96FW1	OTUB1_HUMAN	OTU deubiquitinase, ubiquitin aldehyde binding 1	50					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|immune system process (GO:0002376)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein K48-linked deubiquitination (GO:0071108)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	NEDD8-specific protease activity (GO:0019784)|omega peptidase activity (GO:0008242)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)	6						TGGTGTCAGAGCGGCTGGAGC	0.537																																					p.E50D		Atlas-SNP	.											.	OTUB1	19	.	0			c.G150T						PASS	.						114.0	116.0	115.0					11																	63756155		2201	4297	6498	SO:0001583	missense	55611	exon3			GTCAGAGCGGCTG	AY177200	CCDS8055.1	11q13.1	2014-02-24	2014-02-24			ENSG00000167770		"""OTU domain containing"""	23077	protein-coding gene	gene with protein product		608337	"""OTU domain, ubiquitin aldehyde binding 1"""			12704427, 19383985	Standard	NM_017670		Approved	FLJ20113, FLJ40710	uc001nyf.1	Q96FW1		ENST00000538426.1:c.150G>T	chr11.hg19:g.63756155G>T	ENSP00000444357:p.Glu50Asp	346.0	0.0	.		515.0	141.0	.	NM_017670	Q32Q78|Q96II3|Q9NXQ4|Q9P0B8	Missense_Mutation	SNP	ENST00000538426.1	hg19	CCDS8055.1	.	.	.	.	.	.	.	.	.	.	G	8.534	0.871741	0.17322	.	.	ENSG00000167770	ENST00000535715;ENST00000428192;ENST00000422031;ENST00000538426;ENST00000543004;ENST00000543988	T;T;T;T;T;T	0.47177	0.85;0.85;0.85;0.85;0.85;0.85	5.49	5.49	0.81192	.	.	.	.	.	T	0.29491	0.0735	N	0.17248	0.465	0.35424	D	0.793481	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.29971	-0.9994	9	0.15952	T	0.53	.	10.7288	0.46085	0.0876:0.0:0.9124:0.0	.	87;50	B4DPD5;Q96FW1	.;OTUB1_HUMAN	D	50;50;87;50;59;20	ENSP00000440211:E50D;ENSP00000402551:E50D;ENSP00000416973:E87D;ENSP00000444357:E50D;ENSP00000437453:E59D;ENSP00000441328:E20D	ENSP00000416973:E87D	E	+	3	2	OTUB1	63512731	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	1.546000	0.36179	2.753000	0.94483	0.591000	0.81541	GAG	.	.	.	none		0.537	OTUB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396277.1	NM_017670	
IGSF9B	22997	hgsc.bcm.edu	37	11	133814179	133814179	+	Silent	SNP	C	C	A			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr11:133814179C>A	ENST00000321016.8	-	3	575	c.345G>T	c.(343-345)gtG>gtT	p.V115V	IGSF9B_ENST00000533871.2_Silent_p.V115V			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	115	Ig-like 1.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		CCAGCATGAGCACTTTGCACT	0.577																																					p.V115V		Atlas-SNP	.											.	IGSF9B	290	.	0			c.G345T						PASS	.						108.0	116.0	113.0					11																	133814179		2103	4231	6334	SO:0001819	synonymous_variant	22997	exon3			CATGAGCACTTTG	AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.345G>T	chr11.hg19:g.133814179C>A		59.0	0.0	.		67.0	32.0	.	NM_014987	G5EA26	Silent	SNP	ENST00000321016.8	hg19																																																																																				.	.	.	none		0.577	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_290502	
ATP11A	23250	hgsc.bcm.edu	37	13	113516824	113516825	+	Missense_Mutation	DNP	GC	GC	AG	rs140812688		TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr13:113516824_113516825GC>AG	ENST00000487903.1	+	25	3014_3015	c.2926_2927GC>AG	c.(2926-2928)GCa>AGa	p.A976R	ATP11A_ENST00000375645.3_Missense_Mutation_p.A976R|ATP11A_ENST00000375630.2_Missense_Mutation_p.A976R|ATP11A_ENST00000283558.8_Missense_Mutation_p.A976R			P98196	AT11A_HUMAN	ATPase, class VI, type 11A	976					phospholipid translocation (GO:0045332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(12)|lung(17)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	51	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				ACTGTTTGACGCACTGGTGTTC	0.535																																					p.A976T|p.A976G		Atlas-SNP	.											.	ATP11A	225	.	0			c.G2926A|c.C2927G						PASS	.																																			SO:0001583	missense	23250	exon25			TTTGACGCACTGG|TTGACGCACTGGT	AB028944	CCDS32011.1	13q34	2010-04-20	2007-09-19		ENSG00000068650	ENSG00000068650	3.6.3.1	"""ATPases / P-type"""	13552	protein-coding gene	gene with protein product	"""potential phospholipid-transporting ATPase IH"", ""phospholipid-translocating ATPase"""	605868	"""ATPase, Class VI, type 11A"""			11015572	Standard	NM_032189		Approved	ATPIH, ATPIS, KIAA1021	uc001vsj.4	P98196	OTTHUMG00000017371	Exception_encountered	chr13.hg19:g.113516824_113516825delinsAG	ENSP00000420387:p.Ala976Arg	86.0	0.0	.		92.0	38.0	.	NM_032189	Q5VXT2	Missense_Mutation	SNP	ENST00000487903.1	hg19	CCDS32011.1																																																																																			.	G|1.000;A|0.000|.	0.000|.	weak|none		0.535	ATP11A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000045834.3	NM_015205	
ZFYVE26	23503	hgsc.bcm.edu	37	14	68282659	68282659	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr14:68282659C>A	ENST00000347230.4	-	2	160	c.22G>T	c.(22-24)Gag>Tag	p.E8*	ZFYVE26_ENST00000555452.1_Nonsense_Mutation_p.E8*	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	8					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		GCAGCTTCCTCTTTTCCAAAT	0.478																																					p.E8X		Atlas-SNP	.											.	ZFYVE26	223	.	0			c.G22T						PASS	.						30.0	30.0	30.0					14																	68282659		2203	4300	6503	SO:0001587	stop_gained	23503	exon2			CTTCCTCTTTTCC	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.22G>T	chr14.hg19:g.68282659C>A	ENSP00000251119:p.Glu8*	56.0	0.0	.		64.0	24.0	.	NM_015346	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Nonsense_Mutation	SNP	ENST00000347230.4	hg19	CCDS9788.1	.	.	.	.	.	.	.	.	.	.	C	37	6.195059	0.97367	.	.	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000555452	.	.	.	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-20.4213	20.2576	0.98430	0.0:1.0:0.0:0.0	.	.	.	.	X	8	.	ENSP00000251119:E8X	E	-	1	0	ZFYVE26	67352412	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.200000	0.72118	2.783000	0.95769	0.655000	0.94253	GAG	.	.	.	none		0.478	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346	
DICER1	23405	hgsc.bcm.edu	37	14	95556880	95556880	+	Silent	SNP	G	G	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr14:95556880G>T	ENST00000526495.1	-	29	6015	c.5724C>A	c.(5722-5724)gcC>gcA	p.A1908A	DICER1_ENST00000343455.3_Silent_p.A1908A|DICER1_ENST00000541352.1_3'UTR|DICER1_ENST00000527416.2_5'UTR|DICER1_ENST00000393063.1_Silent_p.A1908A|DICER1_ENST00000556045.1_Silent_p.A806A|DICER1_ENST00000527414.1_Silent_p.A1908A			Q9UPY3	DICER_HUMAN	dicer 1, ribonuclease type III	1908	DRBM. {ECO:0000255|PROSITE- ProRule:PRU00266}.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac muscle cell development (GO:0055013)|cerebral cortex development (GO:0021987)|defense response to virus (GO:0051607)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|hair follicle cell proliferation (GO:0071335)|hair follicle morphogenesis (GO:0031069)|inner ear receptor cell development (GO:0060119)|intestinal epithelial cell development (GO:0060576)|lung development (GO:0030324)|mRNA stabilization (GO:0048255)|multicellular organism growth (GO:0035264)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|olfactory bulb interneuron differentiation (GO:0021889)|peripheral nervous system myelin formation (GO:0032290)|positive regulation of gene expression (GO:0010628)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of myelination (GO:0031643)|positive regulation of Schwann cell differentiation (GO:0014040)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|production of siRNA involved in RNA interference (GO:0030422)|regulation of cell cycle (GO:0051726)|regulation of enamel mineralization (GO:0070173)|regulation of neuron differentiation (GO:0045664)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of viral genome replication (GO:0045069)|reproductive structure development (GO:0048608)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|spinal cord motor neuron differentiation (GO:0021522)|spindle assembly (GO:0051225)|spleen development (GO:0048536)|stem cell maintenance (GO:0019827)|targeting of mRNA for destruction involved in RNA interference (GO:0030423)|zygote asymmetric cell division (GO:0010070)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|growth cone (GO:0030426)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|ribonuclease III activity (GO:0004525)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(13)|kidney(3)|large_intestine(10)|lung(33)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	75		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		GGCTTCGGAGGGCTCTTCTTG	0.413			"""Mis F, N"""		"""sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma"""	pleuropulmonary blastoma			Familial Multinodular Goiter ;DICER 1 syndrome																												p.A1908A		Atlas-SNP	.	yes	Rec	yes	Familial Pleuropulmonary Blastoma	14	14q32.13	23405	"""dicer 1, ribonuclease type III """		"""E, M, O"""	.	DICER1	181	.	0			c.C5724A						PASS	.						187.0	186.0	187.0					14																	95556880		2203	4300	6503	SO:0001819	synonymous_variant	23405	exon28	Familial Cancer Database	Adolescent Multinodular Goiter, incl. Multinodular Euthyroid Goiter & Non-Medullary Thyroid Cancer;incl. Pleuropulmonary Blastoma, Familial ; Cystic Nephroma, Familial	TCGGAGGGCTCTT	AB028449	CCDS9931.1, CCDS55941.1	14q32.13	2014-09-17	2008-02-20		ENSG00000100697	ENSG00000100697			17098	protein-coding gene	gene with protein product	"""dicer 1, double-stranded RNA-specific endoribonuclease"""	606241	"""Dicer1, Dcr-1 homolog (Drosophila)"", ""multinodular goitre 1"""	MNG1		10051563, 10786632, 21205968	Standard	NM_177438		Approved	Dicer, KIAA0928, K12H4.8-LIKE, HERNA	uc001ydw.2	Q9UPY3	OTTHUMG00000166134	ENST00000526495.1:c.5724C>A	chr14.hg19:g.95556880G>T		468.0	0.0	.		95.0	36.0	.	NM_030621	A7E2D3|B3KRG4|E0AD28|O95943|Q9UQ02	Silent	SNP	ENST00000526495.1	hg19	CCDS9931.1																																																																																			.	.	.	none		0.413	DICER1-004	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387997.1		
SIVA1	10572	hgsc.bcm.edu	37	14	105222013	105222013	+	Silent	SNP	C	C	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr14:105222013C>T	ENST00000329967.6	+	2	267	c.165C>T	c.(163-165)gaC>gaT	p.D55D	SIVA1_ENST00000347067.5_Intron	NM_006427.3	NP_006418.2	O15304	SIVA_HUMAN	SIVA1, apoptosis-inducing factor	55	Interaction with BCL2L1 isoform Bcl-x(L) and inhibition of BCL2L1 anti-apoptotic activity.				activation-induced cell death of T cells (GO:0006924)|extrinsic apoptotic signaling pathway (GO:0097191)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|response to virus (GO:0009615)|viral process (GO:0016032)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	CD27 receptor binding (GO:0005175)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|prostate(1)	3		all_cancers(154;0.14)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00153)|OV - Ovarian serous cystadenocarcinoma(23;0.0148)|Epithelial(46;0.0396)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.173)		CCTACCTGGACCACGTGTGGG	0.607																																					p.D55D		Atlas-SNP	.											.	SIVA1	12	.	0			c.C165T						PASS	.						92.0	88.0	89.0					14																	105222013		2203	4300	6503	SO:0001819	synonymous_variant	10572	exon2			CCTGGACCACGTG	U82938	CCDS9992.1, CCDS9993.1	14q32.33	2007-03-19							17712	protein-coding gene	gene with protein product		605567				9177220	Standard	NM_006427		Approved	SIVA, Siva-1, Siva-2, CD27BP	uc001yph.3	O15304		ENST00000329967.6:c.165C>T	chr14.hg19:g.105222013C>T		228.0	0.0	.		314.0	98.0	.	NM_006427	Q96P98|Q9UPD6	Silent	SNP	ENST00000329967.6	hg19	CCDS9992.1	.	.	.	.	.	.	.	.	.	.	C	3.241	-0.155408	0.06544	.	.	ENSG00000184990	ENST00000556195	.	.	.	4.89	3.01	0.34805	.	.	.	.	.	T	0.55641	0.1933	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50499	-0.8821	4	.	.	.	-28.3879	7.3185	0.26513	0.0:0.783:0.0:0.217	.	.	.	.	I	73	.	.	T	+	2	0	SIVA1	104293058	0.105000	0.21958	0.720000	0.30636	0.302000	0.27658	0.003000	0.13083	1.027000	0.39758	0.462000	0.41574	ACC	.	.	.	none		0.607	SIVA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410541.1	NM_006427	
CES4A	283848	hgsc.bcm.edu	37	16	67038037	67038037	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr16:67038037C>A	ENST00000326686.5	+	9	990	c.990C>A	c.(988-990)gaC>gaA	p.D330E	CES4A_ENST00000535696.1_Missense_Mutation_p.D236E|CES4A_ENST00000398354.1_Missense_Mutation_p.D330E|CES4A_ENST00000338718.4_Missense_Mutation_p.D353E|CES4A_ENST00000540579.1_Missense_Mutation_p.D232E|CES4A_ENST00000540947.2_Missense_Mutation_p.D330E|CES4A_ENST00000541479.1_Missense_Mutation_p.D353E			Q5XG92	EST4A_HUMAN	carboxylesterase 4A	330						extracellular region (GO:0005576)	carboxylic ester hydrolase activity (GO:0052689)			large_intestine(2)|liver(2)|lung(4)|ovary(1)	9						TCCCAGATGACCCTTTGGTGC	0.512																																					p.D330E		Atlas-SNP	.											.	CES4A	24	.	0			c.C990A						PASS	.						232.0	229.0	230.0					16																	67038037		2041	4186	6227	SO:0001583	missense	283848	exon9			AGATGACCCTTTG	AK094783	CCDS42174.1, CCDS42174.2, CCDS54024.1, CCDS54025.1, CCDS42174.3	16q22.1	2011-10-25	2010-10-12	2010-10-12	ENSG00000172824	ENSG00000172824		"""Carboxylesterases"""	26741	protein-coding gene	gene with protein product			"""carboxylesterase 8 (putative)"""	CES8		12975309, 17364878, 20931200	Standard	NM_001190201		Approved	FLJ37464	uc010vix.2	Q5XG92		ENST00000326686.5:c.990C>A	chr16.hg19:g.67038037C>A	ENSP00000314145:p.Asp330Glu	284.0	0.0	.		399.0	143.0	.	NM_173815	A8KAJ6|B7Z349|B7Z3L2|B7Z6R3|Q6UX55|Q8N9F4	Missense_Mutation	SNP	ENST00000326686.5	hg19		.	.	.	.	.	.	.	.	.	.	c	1.498	-0.552834	0.03996	.	.	ENSG00000172824	ENST00000540947;ENST00000541479;ENST00000338718;ENST00000398354;ENST00000326686;ENST00000538199;ENST00000540579;ENST00000535696	T;T;T;T;T;T;T;T	0.66995	-0.24;-0.24;-0.24;-0.24;-0.24;-0.24;-0.24;-0.24	4.63	0.0898	0.14460	Carboxylesterase, type B (1);	0.569501	0.15610	N	0.253409	T	0.52773	0.1755	L	0.41415	1.275	0.09310	N	1	B;B;B;B	0.19331	0.023;0.004;0.02;0.035	B;B;B;B	0.28305	0.022;0.004;0.088;0.021	T	0.45977	-0.9224	10	0.49607	T	0.09	.	4.644	0.12563	0.0:0.4819:0.153:0.3651	.	236;353;330;353	Q5XG92-7;F8WEE9;Q5XG92;F5H5S4	.;.;EST4A_HUMAN;.	E	330;353;353;330;330;293;232;236	ENSP00000444052:D330E;ENSP00000443175:D353E;ENSP00000340714:D353E;ENSP00000381397:D330E;ENSP00000314145:D330E;ENSP00000441103:D293E;ENSP00000441907:D232E;ENSP00000441644:D236E	ENSP00000314145:D330E	D	+	3	2	CES4A	65595538	0.000000	0.05858	0.009000	0.14445	0.083000	0.17756	-0.546000	0.06062	-0.221000	0.09973	0.486000	0.48141	GAC	.	.	.	none		0.512	CES4A-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_173815	
KAT7	11143	hgsc.bcm.edu	37	17	47869250	47869250	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr17:47869250G>T	ENST00000259021.4	+	2	298	c.18G>T	c.(16-18)agG>agT	p.R6S	KAT7_ENST00000509773.1_Missense_Mutation_p.R6S|FAM117A_ENST00000514018.1_5'Flank|KAT7_ENST00000503935.2_5'UTR|KAT7_ENST00000510819.1_Missense_Mutation_p.R6S|KAT7_ENST00000424009.2_Missense_Mutation_p.R6S|KAT7_ENST00000435742.2_5'UTR|KAT7_ENST00000454930.2_Missense_Mutation_p.R6S	NM_007067.4	NP_008998.1	O95251	KAT7_HUMAN	K(lysine) acetyltransferase 7	6					chromatin organization (GO:0006325)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										TATTACAGAGGAATGCAGGCA	0.423																																					p.R6S		Atlas-SNP	.											.	.	.	.	0			c.G18T						PASS	.						148.0	136.0	140.0					17																	47869250		2203	4300	6503	SO:0001583	missense	11143	exon2			ACAGAGGAATGCA	AF074606	CCDS11554.1, CCDS56035.1, CCDS56036.1, CCDS56037.1, CCDS56038.1	17q21.32	2013-01-10	2011-07-21	2011-07-21	ENSG00000136504	ENSG00000136504	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	17016	protein-coding gene	gene with protein product	"""histone acetyltransferase binding to ORC1"""	609880	"""MYST histone acetyltransferase 2"""	MYST2		10438470, 10930412	Standard	NM_001199155		Approved	HBOA, HBO1, ZC2HC7	uc002ipm.3	O95251	OTTHUMG00000161770	ENST00000259021.4:c.18G>T	chr17.hg19:g.47869250G>T	ENSP00000259021:p.Arg6Ser	322.0	0.0	.		434.0	102.0	.	NM_001199158	B3KN74|B4DF85|B4DFB4|B4DFE0|B4DGY4|E7ER15|G5E9K7	Missense_Mutation	SNP	ENST00000259021.4	hg19	CCDS11554.1	.	.	.	.	.	.	.	.	.	.	G	15.49	2.848691	0.51164	.	.	ENSG00000136504	ENST00000259021;ENST00000454930;ENST00000509773;ENST00000510819;ENST00000424009	.	.	.	5.6	2.52	0.30459	.	0.093201	0.64402	D	0.000001	T	0.63189	0.2490	L	0.48642	1.525	0.80722	D	1	D;D;D;B;P	0.54601	0.967;0.967;0.967;0.421;0.557	P;P;P;B;B	0.60789	0.879;0.879;0.879;0.058;0.124	T	0.62144	-0.6916	9	0.87932	D	0	-16.1716	9.2677	0.37652	0.3015:0.0:0.6985:0.0	.	6;6;6;6;6	B4DFE0;B4DFB4;E7ER15;O95251;G5E9K7	.;.;.;KAT7_HUMAN;.	S	6	.	ENSP00000259021:R6S	R	+	3	2	KAT7	45224249	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	1.877000	0.39598	0.295000	0.22570	-0.137000	0.14449	AGG	.	.	.	none		0.423	KAT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366032.1	NM_007067	
ACSBG2	81616	hgsc.bcm.edu	37	19	6177251	6177251	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr19:6177251T>G	ENST00000586696.1	+	8	1026	c.750T>G	c.(748-750)atT>atG	p.I250M	ACSBG2_ENST00000591741.1_3'UTR|ACSBG2_ENST00000252669.5_Missense_Mutation_p.I250M|ACSBG2_ENST00000588304.1_Missense_Mutation_p.I200M|ACSBG2_ENST00000591403.1_Missense_Mutation_p.I250M|ACSBG2_ENST00000588485.1_Missense_Mutation_p.I63M			Q5FVE4	ACBG2_HUMAN	acyl-CoA synthetase bubblegum family member 2	250					cell differentiation (GO:0030154)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid metabolic process (GO:0001676)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acyl-CoA hydrolase activity (GO:0047617)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)	p.I250M(3)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(3)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TCACGTGGATTGCAGGAGCAG	0.433																																					p.I250M		Atlas-SNP	.											ACSBG2,NS,carcinoma,0,4	ACSBG2	83	.	3	Substitution - Missense(3)	endometrium(2)|kidney(1)	c.T750G						PASS	.						97.0	69.0	78.0					19																	6177251		2203	4300	6503	SO:0001583	missense	81616	exon8			GTGGATTGCAGGA		CCDS12159.1, CCDS74269.1	19p13.3	2012-10-02			ENSG00000130377	ENSG00000130377		"""Acyl-CoA synthetase family"""	24174	protein-coding gene	gene with protein product	"""bubblegum related protein"""	614363				11230166	Standard	XM_005259653		Approved	BGR, PRTD-NY3, DKFZp434K1635	uc002meh.1	Q5FVE4	OTTHUMG00000180754	ENST00000586696.1:c.750T>G	chr19.hg19:g.6177251T>G	ENSP00000465589:p.Ile250Met	109.0	0.0	.		87.0	4.0	.	NM_030924	B3KSF2|Q6UWJ3|Q7Z5A0|Q8WW03|Q96M36|Q9BYZ3|Q9H0C4	Missense_Mutation	SNP	ENST00000586696.1	hg19	CCDS12159.1	.	.	.	.	.	.	.	.	.	.	T	8.593	0.885063	0.17540	.	.	ENSG00000130377	ENST00000252669	T	0.10477	2.87	4.48	-8.78	0.00824	AMP-dependent synthetase/ligase (1);	1.500690	0.04439	N	0.370611	T	0.03564	0.0102	N	0.03154	-0.405	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.16722	0.016;0.007	T	0.41124	-0.9526	10	0.49607	T	0.09	-6.8573	2.6506	0.04998	0.499:0.0951:0.1226:0.2833	.	250;250	B4DYU1;Q5FVE4	.;ACBG2_HUMAN	M	250	ENSP00000252669:I250M	ENSP00000252669:I250M	I	+	3	3	ACSBG2	6128251	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-3.884000	0.00342	-1.157000	0.02815	-0.778000	0.03378	ATT	.	.	.	none		0.433	ACSBG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452898.1	NM_030924	
ITPKC	80271	hgsc.bcm.edu	37	19	41223385	41223385	+	Silent	SNP	A	A	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr19:41223385A>T	ENST00000263370.2	+	1	378	c.345A>T	c.(343-345)ccA>ccT	p.P115P	ADCK4_ENST00000243583.6_5'Flank|ADCK4_ENST00000450541.1_5'Flank|ADCK4_ENST00000324464.3_5'Flank	NM_025194.2	NP_079470.1	Q96DU7	IP3KC_HUMAN	inositol-trisphosphate 3-kinase C	115					inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)	14			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			AGACGGAGCCAGACAGGTCCA	0.597																																					p.P115P		Atlas-SNP	.											.	ITPKC	36	.	0			c.A345T						PASS	.						51.0	58.0	56.0					19																	41223385		2202	4300	6502	SO:0001819	synonymous_variant	80271	exon1			GGAGCCAGACAGG	Y11999	CCDS12563.1	19q13.1	2011-04-28	2011-04-28		ENSG00000086544	ENSG00000086544	2.7.1.127		14897	protein-coding gene	gene with protein product		606476	"""inositol 1,4,5-trisphosphate 3-kinase C"""			11085927	Standard	NM_025194		Approved	IP3KC, IP3-3KC	uc002oot.3	Q96DU7		ENST00000263370.2:c.345A>T	chr19.hg19:g.41223385A>T		139.0	0.0	.		201.0	65.0	.	NM_025194	Q9UE25|Q9Y475	Silent	SNP	ENST00000263370.2	hg19	CCDS12563.1																																																																																			.	.	.	none		0.597	ITPKC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463104.1	NM_025194	
ALDH16A1	126133	hgsc.bcm.edu	37	19	49971767	49971767	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr19:49971767A>T	ENST00000293350.4	+	15	2231	c.2068A>T	c.(2068-2070)Act>Tct	p.T690S	ALDH16A1_ENST00000433981.2_Missense_Mutation_p.T525S|ALDH16A1_ENST00000540132.1_Missense_Mutation_p.T527S|ALDH16A1_ENST00000455361.2_Missense_Mutation_p.T639S|CTD-3148I10.9_ENST00000599536.1_Intron	NM_153329.3	NP_699160.2	Q8IZ83	A16A1_HUMAN	aldehyde dehydrogenase 16 family, member A1	690						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|skin(2)|urinary_tract(3)	20		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0251)		CTACGGCAACACTGTGGTCAT	0.687																																					p.T690S		Atlas-SNP	.											.	ALDH16A1	54	.	0			c.A2068T						PASS	.						123.0	129.0	127.0					19																	49971767		2203	4300	6503	SO:0001583	missense	126133	exon15			GGCAACACTGTGG	AY007096	CCDS12766.1, CCDS46141.1	19q13.33	2014-08-12			ENSG00000161618	ENSG00000161618		"""Aldehyde dehydrogenases"""	28114	protein-coding gene	gene with protein product		613358					Standard	NM_153329		Approved	MGC10204	uc002pnt.3	Q8IZ83	OTTHUMG00000183163	ENST00000293350.4:c.2068A>T	chr19.hg19:g.49971767A>T	ENSP00000293350:p.Thr690Ser	345.0	0.0	.		542.0	197.0	.	NM_153329	B4DLQ1|C9JBH6|Q86YF0|Q8IYL4|Q8TEI8	Missense_Mutation	SNP	ENST00000293350.4	hg19	CCDS12766.1	.	.	.	.	.	.	.	.	.	.	A	3.550	-0.091783	0.07053	.	.	ENSG00000161618	ENST00000293350;ENST00000455361;ENST00000540132;ENST00000433981	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	4.37	-5.8	0.02347	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.561034	0.18181	N	0.149153	T	0.53899	0.1825	N	0.20845	0.615	0.09310	N	1	B;B;B	0.13145	0.003;0.007;0.004	B;B;B	0.17098	0.007;0.012;0.017	T	0.46748	-0.9169	10	0.13108	T	0.6	-7.5334	9.9685	0.41738	0.1664:0.0:0.7061:0.1275	.	527;639;690	F5H4B6;B4DLQ1;Q8IZ83	.;.;A16A1_HUMAN	S	690;639;527;525	ENSP00000293350:T690S;ENSP00000410142:T639S;ENSP00000445088:T527S;ENSP00000398675:T525S	ENSP00000293350:T690S	T	+	1	0	ALDH16A1	54663579	0.000000	0.05858	0.003000	0.11579	0.071000	0.16799	-0.795000	0.04580	-0.972000	0.03559	0.397000	0.26171	ACT	.	.	.	none		0.687	ALDH16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465358.1	NM_153329	
ZNF134	7693	hgsc.bcm.edu	37	19	58131703	58131703	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr19:58131703C>A	ENST00000396161.5	+	3	526	c.216C>A	c.(214-216)caC>caA	p.H72Q	ZNF134_ENST00000597975.1_3'UTR	NM_003435.3	NP_003426.3	P52741	ZN134_HUMAN	zinc finger protein 134	72					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(3)|prostate(1)	11		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)		AGGGTACACACCATGGACTGA	0.493																																					p.H72Q		Atlas-SNP	.											.	ZNF134	34	.	0			c.C216A						PASS	.						108.0	104.0	105.0					19																	58131703		2041	4225	6266	SO:0001583	missense	7693	exon3			TACACACCATGGA	U09412	CCDS42638.1	19q13.4	2013-01-08	2006-06-13			ENSG00000213762		"""Zinc fingers, C2H2-type"""	12918	protein-coding gene	gene with protein product		604076	"""zinc finger protein 134 (clone pHZ-15)"""			7557990	Standard	NM_003435		Approved	pHZ-15	uc002qpn.2	P52741		ENST00000396161.5:c.216C>A	chr19.hg19:g.58131703C>A	ENSP00000379464:p.His72Gln	293.0	1.0	.		82.0	29.0	.	NM_003435	Q9Y4B2	Missense_Mutation	SNP	ENST00000396161.5	hg19	CCDS42638.1	.	.	.	.	.	.	.	.	.	.	C	13.72	2.322492	0.41096	.	.	ENSG00000213762	ENST00000418193;ENST00000396161	T	0.66995	-0.24	4.05	0.456	0.16655	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.63153	0.2487	M	0.81682	2.555	0.09310	N	1	B	0.30211	0.273	B	0.28638	0.092	T	0.58719	-0.7587	9	0.87932	D	0	.	5.1641	0.15077	0.163:0.6473:0.0:0.1897	.	72	P52741	ZN134_HUMAN	Q	139;72	ENSP00000379464:H72Q	ENSP00000379464:H72Q	H	+	3	2	ZNF134	62823515	0.000000	0.05858	0.000000	0.03702	0.967000	0.64934	0.316000	0.19469	0.092000	0.17331	0.655000	0.94253	CAC	.	.	.	none		0.493	ZNF134-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466808.1	NM_003435	
HTATSF1	27336	hgsc.bcm.edu	37	X	135594033	135594033	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chrX:135594033A>T	ENST00000218364.4	+	9	2303	c.2129A>T	c.(2128-2130)gAg>gTg	p.E710V	HTATSF1_ENST00000535601.1_Missense_Mutation_p.E710V	NM_014500.4	NP_055315.2	O43719	HTSF1_HUMAN	HIV-1 Tat specific factor 1	710	Asp/Glu-rich (acidic).|Mediates interaction with the P-TEFb complex.				regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(14)|ovary(3)|prostate(1)	30	Acute lymphoblastic leukemia(192;0.000127)					TTTGATGAGGAGGAAGATTCC	0.458																																					p.E710V		Atlas-SNP	.											.	HTATSF1	66	.	0			c.A2129T						PASS	.						221.0	193.0	203.0					X																	135594033		2203	4300	6503	SO:0001583	missense	27336	exon10			ATGAGGAGGAAGA	U76992	CCDS14657.1	Xq26.3	2013-02-12	2006-01-09		ENSG00000102241	ENSG00000102241		"""RNA binding motif (RRM) containing"""	5276	protein-coding gene	gene with protein product		300346	"""HIV TAT specific factor 1"""			8849451	Standard	NM_014500		Approved	TAT-SF1	uc004ezx.3	O43719	OTTHUMG00000022510	ENST00000218364.4:c.2129A>T	chrX.hg19:g.135594033A>T	ENSP00000218364:p.Glu710Val	131.0	1.0	.		17.0	14.0	.	NM_001163280	D3DWG9|Q59G06|Q99730	Missense_Mutation	SNP	ENST00000218364.4	hg19	CCDS14657.1	.	.	.	.	.	.	.	.	.	.	A	9.409	1.080079	0.20309	.	.	ENSG00000102241	ENST00000535601;ENST00000218364;ENST00000415377	T;T	0.34667	1.35;1.35	2.64	2.64	0.31445	.	.	.	.	.	T	0.21227	0.0511	N	0.14661	0.345	0.09310	N	1	P	0.42757	0.789	B	0.38655	0.278	T	0.08006	-1.0743	9	0.87932	D	0	-2.0207	8.2917	0.31960	1.0:0.0:0.0:0.0	.	710	O43719	HTSF1_HUMAN	V	710;710;676	ENSP00000442699:E710V;ENSP00000218364:E710V	ENSP00000218364:E710V	E	+	2	0	HTATSF1	135421699	0.836000	0.29430	0.004000	0.12327	0.938000	0.57974	2.165000	0.42396	1.296000	0.44742	0.235000	0.17854	GAG	.	.	.	none		0.458	HTATSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058497.1	NM_014500	
CEP192	55125	hgsc.bcm.edu	37	18	13049324	13049324	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr18:13049324delT	ENST00000325971.8	+	14	2339	c.746delT	c.(745-747)gttfs	p.V249fs	CEP192_ENST00000506447.1_Frame_Shift_Del_p.V845fs|CEP192_ENST00000430049.2_Frame_Shift_Del_p.V370fs			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	249					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						GCAGCTATTGTTTATGTTGAA	0.383																																					p.V845fs		Atlas-INDEL	.											.	CEP192	340	.	0			c.2533delG						PASS	.						100.0	95.0	97.0					18																	13049324		2203	4300	6503	SO:0001589	frameshift_variant	55125	exon16			.	AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.746delT	chr18.hg19:g.13049324delT	ENSP00000317156:p.Val249fs	249.0	0.0	0		61.0	19.0	0.311475	NM_032142	A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Frame_Shift_Del	DEL	ENST00000325971.8	hg19																																																																																				.	.	.	none		0.383	CEP192-201	KNOWN	basic	protein_coding	protein_coding		NM_032142	
BTN3A2	11118	hgsc.bcm.edu	37	6	26370805	26370805	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr6:26370805delA	ENST00000356386.2	+	5	877	c.689delA	c.(688-690)gaafs	p.E230fs	BTN3A2_ENST00000527422.1_Frame_Shift_Del_p.E230fs|BTN3A2_ENST00000377708.2_Frame_Shift_Del_p.E230fs|BTN3A2_ENST00000508906.2_Frame_Shift_Del_p.E188fs|BTN3A2_ENST00000396934.3_Frame_Shift_Del_p.E207fs|BTN3A2_ENST00000532994.1_3'UTR|BTN3A2_ENST00000396948.1_Frame_Shift_Del_p.E230fs	NM_001197246.2|NM_001197247.1|NM_007047.3	NP_001184175.1|NP_001184176.1|NP_008978.2	P78410	BT3A2_HUMAN	butyrophilin, subfamily 3, member A2	230					interferon-gamma secretion (GO:0072643)|T cell mediated immunity (GO:0002456)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(5)	10						CTCGGCCTGGAAAAGACAGCC	0.522																																					p.E230fs		Atlas-INDEL	.											.	BTN3A2	44	.	0			c.688delG						PASS	.						105.0	103.0	103.0					6																	26370805		2203	4300	6503	SO:0001589	frameshift_variant	11118	exon5			.	U90546	CCDS4605.1, CCDS56399.1, CCDS56400.1	6p22.1	2014-01-14			ENSG00000186470	ENSG00000186470		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	1139	protein-coding gene	gene with protein product		613594				9149941	Standard	NM_007047		Approved	BTN3.2	uc010jqi.2	P78410	OTTHUMG00000014450	ENST00000356386.2:c.689delA	chr6.hg19:g.26370805delA	ENSP00000348751:p.Glu230fs	253.0	0.0	0		196.0	70.0	0.357143	NM_007047	B4DRT7|B4E103|F5H791|F8W6E0|O00477|O15338|O75658|Q76PA0|Q9BU81|Q9NR44	Frame_Shift_Del	DEL	ENST00000356386.2	hg19	CCDS4605.1																																																																																			.	.	.	none		0.522	BTN3A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040113.2		
ERF	2077	hgsc.bcm.edu	37	19	42752789	42752790	+	In_Frame_Ins	INS	-	-	AAA			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr19:42752789_42752790insAAA	ENST00000222329.4	-	4	1631_1632	c.1474_1475insTTT	c.(1474-1476)tgt>tTTTgt	p.491_492insF	ERF_ENST00000595941.1_5'Flank|AC006486.9_ENST00000594664.1_Intron|ERF_ENST00000440177.2_In_Frame_Ins_p.416_417insF	NM_006494.2	NP_006485.2	P50548	ERF_HUMAN	Ets2 repressor factor	491					cell cycle (GO:0007049)|cell differentiation (GO:0030154)|chorio-allantoic fusion (GO:0060710)|ectodermal cell differentiation (GO:0010668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)|trophoblast giant cell differentiation (GO:0060707)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(7)|skin(1)	17		Prostate(69;0.00682)				TTCGAGGCGACAGTCTTCACTC	0.698																																					p.C492delinsFC		Atlas-INDEL	.											.	ERF	47	.	0			c.1475_1476insTTT						PASS	.																																			SO:0001652	inframe_insertion	2077	exon4			.	U58535	CCDS12600.1	19q13	2008-07-16				ENSG00000105722			3444	protein-coding gene	gene with protein product	"""Ets2 repressor factor"""	611888				7588608, 9192842	Standard	XM_005258644		Approved	PE-2, PE2	uc002ote.4	P50548		ENST00000222329.4:c.1474_1475insTTT	chr19.hg19:g.42752789_42752790insAAA	ENSP00000222329:p.Asp491_Cys492insPhe	190.0	0.0	0		249.0	60.0	0.240964	NM_006494	B2RAP1|B7Z4R0|Q59G38|Q9UPI7	In_Frame_Ins	INS	ENST00000222329.4	hg19	CCDS12600.1																																																																																			.	.	.	none		0.698	ERF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463684.1	NM_006494	
COX7A1	1346	hgsc.bcm.edu	37	19	36642400	36642402	+	In_Frame_Del	DEL	TGT	TGT	-	rs375983153		TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	TGT	TGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr19:36642400_36642402delTGT	ENST00000292907.3	-	3	610_612	c.149_151delACA	c.(148-153)aacatc>atc	p.N50del	COX7A1_ENST00000437291.2_5'UTR	NM_001864.2	NP_001855.1	P24310	CX7A1_HUMAN	cytochrome c oxidase subunit VIIa polypeptide 1 (muscle)	50					generation of precursor metabolites and energy (GO:0006091)|hydrogen ion transmembrane transport (GO:1902600)	integral component of membrane (GO:0016021)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	cytochrome-c oxidase activity (GO:0004129)			endometrium(2)|large_intestine(1)	3	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			CGGTACAGGATGTTGTCAACGAT	0.626																																					p.50_51del		Atlas-INDEL	.											.	COX7A1	9	.	0			c.150_152del						PASS	.																																			SO:0001651	inframe_deletion	1346	exon3			.	BC002757	CCDS12490.1	19q13.1	2011-07-04			ENSG00000161281	ENSG00000161281	1.9.3.1	"""Mitochondrial respiratory chain complex / Complex IV"""	2287	protein-coding gene	gene with protein product		123995		COX7A		1327965, 2550906	Standard	NM_001864		Approved	COX7AH	uc002odm.1	P24310	OTTHUMG00000048144	ENST00000292907.3:c.149_151delACA	chr19.hg19:g.36642403_36642405delTGT	ENSP00000292907:p.Asn50del	194.0	0.0	0		242.0	64.0	0.264463	NM_001864		In_Frame_Del	DEL	ENST00000292907.3	hg19	CCDS12490.1																																																																																			.	.	.	none		0.626	COX7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109545.2	NM_001864	
OSBPL5	114879	hgsc.bcm.edu	37	11	3143300	3143300	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr11:3143300delT	ENST00000263650.7	-	5	488	c.329delA	c.(328-330)aagfs	p.K111fs	OSBPL5_ENST00000525498.1_Frame_Shift_Del_p.K63fs|OSBPL5_ENST00000348039.5_Frame_Shift_Del_p.K111fs|OSBPL5_ENST00000389989.3_Frame_Shift_Del_p.K111fs|OSBPL5_ENST00000542243.1_Frame_Shift_Del_p.E26fs	NM_020896.3	NP_065947.1	Q9H0X9	OSBL5_HUMAN	oxysterol binding protein-like 5	111					cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|Golgi to plasma membrane transport (GO:0006893)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	cholesterol binding (GO:0015485)|oxysterol binding (GO:0008142)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	25		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		GGCGCGCTTCTTCTCCTGCCG	0.687																																					p.K110fs		Atlas-INDEL	.											.	OSBPL5	78	.	0			c.330delG						PASS	.						43.0	34.0	37.0					11																	3143300		2191	4291	6482	SO:0001589	frameshift_variant	114879	exon5			.	AF392453	CCDS31343.1, CCDS31344.1	11p15.4	2013-01-10			ENSG00000021762	ENSG00000021762		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16392	protein-coding gene	gene with protein product		606733					Standard	NM_145638		Approved	KIAA1534, ORP5	uc001lxk.2	Q9H0X9	OTTHUMG00000011702	ENST00000263650.7:c.329delA	chr11.hg19:g.3143300delT	ENSP00000263650:p.Lys111fs	9.0	0.0	0		25.0	11.0	0.44	NM_145638	A6NDP0|A6NJS8|Q54A90|Q8N596|Q9BZB0|Q9P1Z4	Frame_Shift_Del	DEL	ENST00000263650.7	hg19	CCDS31344.1																																																																																			.	.	.	none		0.687	OSBPL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032332.2		
MAST4	375449	hgsc.bcm.edu	37	5	66438012	66438022	+	Frame_Shift_Del	DEL	AGGCAGAATTT	AGGCAGAATTT	-			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	AGGCAGAATTT	AGGCAGAATTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr5:66438012_66438022delAGGCAGAATTT	ENST00000403625.2	+	20	2859_2869	c.2564_2574delAGGCAGAATTT	c.(2563-2574)aaggcagaatttfs	p.KAEF855fs	MAST4_ENST00000261569.7_Frame_Shift_Del_p.KAEF661fs|MAST4_ENST00000403666.1_Frame_Shift_Del_p.KAEF666fs|MAST4_ENST00000405643.1_Frame_Shift_Del_p.KAEF676fs|MAST4_ENST00000404260.3_Frame_Shift_Del_p.KAEF858fs	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	858	AGC-kinase C-terminal.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		CTGAGACAGAAGGCAGAATTTATTCCCCAAC	0.403																																					p.855_858del		Atlas-INDEL	.											.	MAST4	218	.	0			c.2563_2573del						PASS	.																																			SO:0001589	frameshift_variant	375449	exon20			.	AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.2564_2574delAGGCAGAATTT	chr5.hg19:g.66438012_66438022delAGGCAGAATTT	ENSP00000385727:p.Lys855fs	271.0	0.0	0		41.0	16.0	0.390244	NM_001164664	A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Frame_Shift_Del	DEL	ENST00000403625.2	hg19	CCDS54861.1																																																																																			.	.	.	none		0.403	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326324.2		
HIST1H2AD	3013	hgsc.bcm.edu	37	6	26199108	26199109	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	CA	CA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr6:26199108_26199109delCA	ENST00000341023.1	-	1	362_363	c.363_364delTG	c.(361-366)actgagfs	p.E122fs	HIST1H2BF_ENST00000359985.1_5'Flank|HIST1H3D_ENST00000356476.2_5'Flank|HIST1H3D_ENST00000377831.5_5'UTR	NM_021065.2	NP_066409.1	P20671	H2A1D_HUMAN	histone cluster 1, H2ad	122						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)	6		all_hematologic(11;0.196)				TGGTGACTCTCAGTCTTCTTGG	0.485																																					p.122_122del		Atlas-INDEL	.											.	HIST1H2AD	20	.	0			c.364_365del						PASS	.																																			SO:0001589	frameshift_variant	3013	exon1			.	Z80776	CCDS4591.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196866	ENSG00000196866		"""Histones / Replication-dependent"""	4729	protein-coding gene	gene with protein product		602792	"""H2A histone family, member G"", ""histone 1, H2ad"""	H2AFG		9119399, 12408966	Standard	NM_021065		Approved	H2A/g, H2A.3	uc003ngw.4	P20671	OTTHUMG00000014437	ENST00000341023.1:c.363_364delTG	chr6.hg19:g.26199108_26199109delCA	ENSP00000341094:p.Glu122fs	194.0	0.0	0		285.0	27.0	0.0947368	NM_021065	A0PK91|P57754|Q6FGY6	Frame_Shift_Del	DEL	ENST00000341023.1	hg19	CCDS4591.1																																																																																			.	.	.	none		0.485	HIST1H2AD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040100.1	NM_021065	
CTBP1	1487	hgsc.bcm.edu	37	4	1232016	1232016	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr4:1232016delA	ENST00000290921.6	-	2	331	c.150delT	c.(148-150)actfs	p.T50fs	CTBP1_ENST00000510568.1_Frame_Shift_Del_p.T39fs|CTBP1_ENST00000382952.3_Frame_Shift_Del_p.T39fs|CTBP1_ENST00000515690.1_5'UTR	NM_001328.2	NP_001319.1	Q13363	CTBP1_HUMAN	C-terminal binding protein 1	50	Interaction with GLIS2 1. {ECO:0000250}.				Golgi organization (GO:0007030)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone H4 acetylation (GO:0090241)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone deacetylation (GO:0031065)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of transcription by chromatin organization (GO:0034401)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|urinary_tract(1)	8			OV - Ovarian serous cystadenocarcinoma(23;0.00818)	Colorectal(103;0.2)		AGAAGGCCACAGTGGCCACGT	0.657																																					p.V51fs		Atlas-INDEL	.											.	CTBP1	30	.	0			c.151delG						PASS	.						69.0	66.0	67.0					4																	1232016		2202	4298	6500	SO:0001589	frameshift_variant	1487	exon2			.	U37408	CCDS3348.1, CCDS43203.1	4p16	2008-02-05			ENSG00000159692	ENSG00000159692			2494	protein-coding gene	gene with protein product	"""brefeldin A-ribosylated substrate"""	602618				9479502	Standard	XM_005272261		Approved	BARS	uc003gcv.1	Q13363	OTTHUMG00000089259	ENST00000290921.6:c.150delT	chr4.hg19:g.1232016delA	ENSP00000290921:p.Thr50fs	164.0	0.0	0		275.0	80.0	0.290909	NM_001328	Q4W5N3|Q7Z2Q5	Frame_Shift_Del	DEL	ENST00000290921.6	hg19	CCDS3348.1																																																																																			.	.	.	none		0.657	CTBP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000202938.1	NM_001328	
KIAA0430	9665	hgsc.bcm.edu	37	16	15716936	15716936	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr16:15716936delA	ENST00000396368.3	-	11	2521	c.2315delT	c.(2314-2316)ttcfs	p.F772fs	KIAA0430_ENST00000602337.1_Frame_Shift_Del_p.F769fs|KIAA0430_ENST00000540441.2_Intron|KIAA0430_ENST00000548025.1_Frame_Shift_Del_p.F769fs|KIAA0430_ENST00000344181.3_Frame_Shift_Del_p.F441fs|KIAA0430_ENST00000551742.1_Frame_Shift_Del_p.F772fs	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430	772					double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						TGCAATGTTGAAAGCAAGCGG	0.408																																					p.F772fs		Atlas-INDEL	.											.	KIAA0430	154	.	0			c.2316delC						PASS	.						91.0	88.0	89.0					16																	15716936		1865	4105	5970	SO:0001589	frameshift_variant	9665	exon11			.	AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.2315delT	chr16.hg19:g.15716936delA	ENSP00000379654:p.Phe772fs	253.0	0.0	0		195.0	63.0	0.323077	NM_001184998	A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Frame_Shift_Del	DEL	ENST00000396368.3	hg19	CCDS10562.2																																																																																			.	.	.	none		0.408	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252131.2	NM_014647	
