#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CLCN6	1185	hgsc.bcm.edu	37	1	11888206	11888206	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr1:11888206G>A	ENST00000346436.6	+	11	936	c.884G>A	c.(883-885)cGt>cAt	p.R295H	CLCN6_ENST00000376492.3_3'UTR|CLCN6_ENST00000376496.3_Missense_Mutation_p.R295H|CLCN6_ENST00000376487.3_Missense_Mutation_p.R273H|CLCN6_ENST00000312413.6_Missense_Mutation_p.R295H	NM_001286.3	NP_001277	P51797	CLCN6_HUMAN	chloride channel, voltage-sensitive 6	295					cell volume homeostasis (GO:0006884)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|response to mechanical stimulus (GO:0009612)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|voltage-gated chloride channel activity (GO:0005247)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(4)	36	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000816)|KIRC - Kidney renal clear cell carcinoma(229;0.00268)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		AACTTCTTCCGTTCTGGGATT	0.483																																					p.R295H		Atlas-SNP	.											.	CLCN6	77	.	0			c.G884A						PASS	.						224.0	231.0	229.0					1																	11888206		2203	4300	6503	SO:0001583	missense	1185	exon11			TCTTCCGTTCTGG	X83378	CCDS138.1, CCDS57972.1	1p36	2012-09-26	2012-02-23		ENSG00000011021	ENSG00000011021		"""Ion channels / Chloride channels : Voltage-sensitive"""	2024	protein-coding gene	gene with protein product		602726	"""chloride channel 6"""			8543009	Standard	NM_001286		Approved	CLC-6, KIAA0046, ClC-6	uc001ate.5	P51797	OTTHUMG00000002299	ENST00000346436.6:c.884G>A	chr1.hg19:g.11888206G>A	ENSP00000234488:p.Arg295His	636.0	0.0	.		990.0	54.0	.	NM_001286	A8K1T4|B4DGT7|F8W9R3|O60818|O60819|O60820|O60821|P78520|P78521|Q17R81|Q5SNW2|Q5SNW3|Q5SNX1|Q5SNX2|Q5SNX3|Q99427|Q99428|Q99429	Missense_Mutation	SNP	ENST00000346436.6	hg19	CCDS138.1	.	.	.	.	.	.	.	.	.	.	G	35	5.415466	0.96092	.	.	ENSG00000011021	ENST00000312413;ENST00000346436;ENST00000376487;ENST00000376496;ENST00000376492	D;D;D;D	0.94232	-3.36;-3.38;-3.38;-3.38	5.06	5.06	0.68205	Chloride channel, core (2);	0.048615	0.85682	D	0.000000	D	0.96046	0.8712	.	.	.	0.80722	D	1	D;D;D	0.76494	0.989;0.999;0.992	P;P;P	0.60117	0.459;0.869;0.594	D	0.96294	0.9216	9	0.66056	D	0.02	-10.0688	17.6173	0.88071	0.0:0.0:1.0:0.0	.	273;295;295	F8W9R3;P51797-3;P51797	.;.;CLCN6_HUMAN	H	295;295;273;295;295	ENSP00000308367:R295H;ENSP00000234488:R295H;ENSP00000365670:R273H;ENSP00000365679:R295H	ENSP00000308367:R295H	R	+	2	0	CLCN6	11810793	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.263000	0.95617	2.625000	0.88918	0.655000	0.94253	CGT	.	.	.	none		0.483	CLCN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006639.2	NM_001286	
FGR	2268	hgsc.bcm.edu	37	1	27943508	27943508	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr1:27943508G>A	ENST00000374005.3	-	7	830	c.542C>T	c.(541-543)tCc>tTc	p.S181F	FGR_ENST00000374004.1_Missense_Mutation_p.S181F|FGR_ENST00000399173.1_Missense_Mutation_p.S181F|FGR_ENST00000545953.1_Missense_Mutation_p.S115F	NM_005248.2	NP_005239.1	P09769	FGR_HUMAN	FGR proto-oncogene, Src family tyrosine kinase	181	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				blood coagulation (GO:0007596)|defense response to Gram-positive bacterium (GO:0050830)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of innate immune response (GO:0045088)|regulation of phagocytosis (GO:0050764)|regulation of protein kinase activity (GO:0045859)|response to virus (GO:0009615)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|Fc-gamma receptor I complex binding (GO:0034988)|immunoglobulin receptor binding (GO:0034987)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphotyrosine binding (GO:0001784)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(4)	16		all_lung(284;2.05e-05)|Colorectal(325;3.46e-05)|Lung NSC(340;3.67e-05)|Renal(390;0.00121)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00244)|KIRC - Kidney renal clear cell carcinoma(1967;0.0027)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		GATGGACAGGGAGTAGGCACC	0.567																																					p.S181F		Atlas-SNP	.											.	FGR	39	.	0			c.C542T						PASS	.						103.0	96.0	99.0					1																	27943508		2203	4300	6503	SO:0001583	missense	2268	exon7			GACAGGGAGTAGG	BC064382	CCDS305.1	1p36.2-p36.1	2014-06-25	2014-06-25		ENSG00000000938	ENSG00000000938		"""SH2 domain containing"""	3697	protein-coding gene	gene with protein product		164940	"""Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog"", ""v-fgr feline Gardner-Rasheed sarcoma viral oncogene homolog"", ""feline Gardner-Rasheed sarcoma viral oncogene homolog"""	SRC2		3922831	Standard	NM_001042729		Approved	c-fgr, p55c-fgr	uc001bom.3	P09769	OTTHUMG00000003516	ENST00000374005.3:c.542C>T	chr1.hg19:g.27943508G>A	ENSP00000363117:p.Ser181Phe	183.0	0.0	.		225.0	128.0	.	NM_001042729	D3DPL7|Q9UIQ3	Missense_Mutation	SNP	ENST00000374005.3	hg19	CCDS305.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.328135	0.81690	.	.	ENSG00000000938	ENST00000374005;ENST00000545953;ENST00000399173;ENST00000374004;ENST00000374003;ENST00000457296	D;D;D;D;D;D	0.89552	-2.53;-2.53;-2.53;-2.53;-2.53;-2.53	4.38	4.38	0.52667	SH2 motif (5);	0.000000	0.56097	D	0.000031	D	0.95079	0.8406	H	0.98199	4.17	0.50813	D	0.999899	D	0.57571	0.98	P	0.50754	0.649	D	0.97122	0.9812	10	0.87932	D	0	.	16.3789	0.83431	0.0:0.0:1.0:0.0	.	181	P09769	FGR_HUMAN	F	181;115;181;181;181;181	ENSP00000363117:S181F;ENSP00000445302:S115F;ENSP00000382126:S181F;ENSP00000363116:S181F;ENSP00000363115:S181F;ENSP00000407670:S181F	ENSP00000363115:S181F	S	-	2	0	FGR	27816095	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	5.670000	0.68088	2.348000	0.79779	0.491000	0.48974	TCC	.	.	.	none		0.567	FGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009772.1	NM_005248	
PABPC4	8761	hgsc.bcm.edu	37	1	40038244	40038244	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr1:40038244C>A	ENST00000372857.3	-	2	1000	c.208G>T	c.(208-210)Gac>Tac	p.D70Y	PABPC4_ENST00000372862.3_Missense_Mutation_p.D70Y|RP11-69E11.8_ENST00000415255.1_RNA|PABPC4_ENST00000529216.1_5'Flank|PABPC4_ENST00000372858.3_Missense_Mutation_p.D70Y|PABPC4_ENST00000372856.3_Missense_Mutation_p.D70Y	NM_003819.3	NP_003810.1	Q13310	PABP4_HUMAN	poly(A) binding protein, cytoplasmic 4 (inducible form)	70	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				blood coagulation (GO:0007596)|RNA catabolic process (GO:0006401)|RNA processing (GO:0006396)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(6)|prostate(1)|skin(3)	21	Lung NSC(20;1.55e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.89e-18)|Epithelial(16;6.17e-17)|all cancers(16;1.18e-15)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			TTCATGGTGTCCAAAGCCCGC	0.463																																					p.D70Y		Atlas-SNP	.											.	PABPC4	56	.	0			c.G208T						PASS	.						81.0	75.0	77.0					1																	40038244		2203	4300	6503	SO:0001583	missense	8761	exon2			TGGTGTCCAAAGC	U33818	CCDS438.1, CCDS44114.1, CCDS44115.1	1p34.2	2013-02-12	2001-11-28		ENSG00000090621	ENSG00000090621		"""RNA binding motif (RRM) containing"""	8557	protein-coding gene	gene with protein product		603407	"""poly(A)-binding protein, cytoplasmic 4 (inducible form)"""			10543404	Standard	NM_001135653		Approved	iPABP, APP-1	uc001cdl.2	Q13310	OTTHUMG00000009097	ENST00000372857.3:c.208G>T	chr1.hg19:g.40038244C>A	ENSP00000361948:p.Asp70Tyr	177.0	0.0	.		118.0	35.0	.	NM_001135653	B1ANQ8|Q4VC03|Q6P0N3	Missense_Mutation	SNP	ENST00000372857.3	hg19	CCDS438.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.994504	0.93167	.	.	ENSG00000090621	ENST00000372862;ENST00000372858;ENST00000372857;ENST00000372856;ENST00000451091	T;T;T;T;T	0.18016	2.24;2.24;2.24;2.24;2.24	5.69	5.69	0.88448	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.38692	0.1050	L	0.46157	1.445	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.76575	0.964;0.988;0.924	T	0.05649	-1.0872	10	0.87932	D	0	.	19.8057	0.96531	0.0:1.0:0.0:0.0	.	70;70;70	Q13310;Q13310-2;Q4VC03	PABP4_HUMAN;.;.	Y	70	ENSP00000361953:D70Y;ENSP00000361949:D70Y;ENSP00000361948:D70Y;ENSP00000361947:D70Y;ENSP00000406675:D70Y	ENSP00000361947:D70Y	D	-	1	0	PABPC4	39810831	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.705000	0.84606	2.682000	0.91365	0.655000	0.94253	GAC	.	.	.	none		0.463	PABPC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025220.1	NM_001135653	
CACNA1S	779	hgsc.bcm.edu	37	1	201039482	201039482	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr1:201039482G>A	ENST00000362061.3	-	17	2504	c.2278C>T	c.(2278-2280)Ccc>Tcc	p.P760S	CACNA1S_ENST00000367338.3_Missense_Mutation_p.P760S	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	760					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TCAGCCAGGGGACGTGGTCGG	0.587																																					p.P760S		Atlas-SNP	.											.	CACNA1S	249	.	0			c.C2278T						PASS	.						70.0	75.0	73.0					1																	201039482		2203	4300	6503	SO:0001583	missense	779	exon17			CCAGGGGACGTGG	L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.2278C>T	chr1.hg19:g.201039482G>A	ENSP00000355192:p.Pro760Ser	250.0	0.0	.		385.0	121.0	.	NM_000069	A4IF51|B1ALM2|Q12896|Q13934	Missense_Mutation	SNP	ENST00000362061.3	hg19	CCDS1407.1	.	.	.	.	.	.	.	.	.	.	G	16.37	3.105070	0.56291	.	.	ENSG00000081248	ENST00000362061;ENST00000367338	D;D	0.95821	-3.82;-3.73	4.18	4.18	0.49190	.	0.000000	0.85682	D	0.000000	D	0.97492	0.9179	M	0.79805	2.47	0.58432	D	0.999995	D	0.89917	1.0	D	0.91635	0.999	D	0.97283	0.9919	10	0.37606	T	0.19	.	16.8708	0.86040	0.0:0.0:1.0:0.0	.	760	Q13698	CAC1S_HUMAN	S	760	ENSP00000355192:P760S;ENSP00000356307:P760S	ENSP00000355192:P760S	P	-	1	0	CACNA1S	199306105	1.000000	0.71417	0.292000	0.24919	0.289000	0.27227	7.945000	0.87732	2.032000	0.59987	0.643000	0.83706	CCC	.	.	.	none		0.587	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087049.1	NM_000069	
MYCN	4613	hgsc.bcm.edu	37	2	16086058	16086058	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr2:16086058G>C	ENST00000281043.3	+	3	1531	c.1234G>C	c.(1234-1236)Gta>Cta	p.V412L		NM_005378.4	NP_005369.2	P04198	MYCN_HUMAN	v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog	412	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				branching morphogenesis of an epithelial tube (GO:0048754)|cartilage condensation (GO:0001502)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|lung development (GO:0030324)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|positive regulation of cell death (GO:0010942)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromatin (GO:0000785)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	31	all_cancers(1;1.35e-08)|all_neural(1;2.92e-24)|Lung SC(1;3.26e-07)|Medulloblastoma(1;6.9e-06)|all_lung(1;1.26e-05)|Glioma(3;0.135)|Acute lymphoblastic leukemia(172;0.155)|all_epithelial(1;0.169)|all_hematologic(175;0.197)		GBM - Glioblastoma multiforme(3;0.000332)			GCCGGAGTTGGTAAAGAATGA	0.572			A		neuroblastoma																																p.V412L		Atlas-SNP	.		Dom	yes		2	2p24.1	4613	"""v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)"""		O	.	MYCN	63	.	0			c.G1234C						PASS	.						90.0	100.0	97.0					2																	16086058		2203	4300	6503	SO:0001583	missense	4613	exon3			GAGTTGGTAAAGA	BC002712	CCDS1687.1	2p24.3	2013-08-14	2013-07-09		ENSG00000134323	ENSG00000134323		"""Basic helix-loop-helix proteins"""	7559	protein-coding gene	gene with protein product		164840		NMYC			Standard	XM_006711886		Approved	bHLHe37, N-myc, MYCNOT	uc002rci.3	P04198	OTTHUMG00000039579	ENST00000281043.3:c.1234G>C	chr2.hg19:g.16086058G>C	ENSP00000281043:p.Val412Leu	304.0	0.0	.		496.0	163.0	.	NM_005378	Q53XS5|Q6LDT9	Missense_Mutation	SNP	ENST00000281043.3	hg19	CCDS1687.1	.	.	.	.	.	.	.	.	.	.	G	15.87	2.959315	0.53400	.	.	ENSG00000134323	ENST00000281043;ENST00000426211	D	0.97976	-4.64	5.14	4.26	0.50523	Helix-loop-helix DNA-binding (5);	0.515918	0.19319	N	0.117200	D	0.94535	0.8240	L	0.27053	0.805	0.39651	D	0.970461	P	0.40144	0.704	B	0.40864	0.342	D	0.93971	0.7249	10	0.56958	D	0.05	-13.1384	10.2421	0.43319	0.1524:0.0:0.8476:0.0	.	412	P04198	MYCN_HUMAN	L	412;330	ENSP00000281043:V412L	ENSP00000281043:V412L	V	+	1	0	MYCN	16003509	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	4.154000	0.58125	1.331000	0.45412	-0.192000	0.12808	GTA	.	.	.	none		0.572	MYCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095469.2	NM_005378	
C2orf80	389073	hgsc.bcm.edu	37	2	209045533	209045533	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr2:209045533A>C	ENST00000341287.4	-	6	497	c.302T>G	c.(301-303)aTc>aGc	p.I101S	C2orf80_ENST00000453017.1_Missense_Mutation_p.I101S|C2orf80_ENST00000451346.1_Missense_Mutation_p.I82S	NM_001099334.2	NP_001092804	Q0P641	CB080_HUMAN	chromosome 2 open reading frame 80	101										endometrium(2)|large_intestine(3)|lung(6)|skin(2)	13						CTCAATCGGGATACTGTTCTG	0.363																																					p.I101S		Atlas-SNP	.											.	C2orf80	19	.	0			c.T302G						PASS	.						98.0	92.0	94.0					2																	209045533		1810	4083	5893	SO:0001583	missense	389073	exon6			ATCGGGATACTGT	AC016697, AW136505, BC035737	CCDS42809.1	2q33.3	2013-10-31			ENSG00000188674	ENSG00000188674			34352	protein-coding gene	gene with protein product	"""gonad development associated 1"""	615536				22080834, 24055526	Standard	NM_001099334		Approved	LOC389073, GONDA1	uc002vcr.3	Q0P641	OTTHUMG00000154751	ENST00000341287.4:c.302T>G	chr2.hg19:g.209045533A>C	ENSP00000343171:p.Ile101Ser	133.0	0.0	.		86.0	26.0	.	NM_001099334	A6NKZ3	Missense_Mutation	SNP	ENST00000341287.4	hg19	CCDS42809.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.20|14.20	2.465820|2.465820	0.43839|0.43839	.|.	.|.	ENSG00000188674|ENSG00000188674	ENST00000451342;ENST00000341287;ENST00000451346;ENST00000453017;ENST00000423952|ENST00000428015	T;T;T;T;T|.	0.54866|.	1.04;1.51;1.46;0.55;1.02|.	4.67|4.67	3.47|3.47	0.39725|0.39725	.|.	0.384012|.	0.22416|.	N|.	0.060357|.	T|.	0.33381|.	0.0861|.	L|L	0.32530|0.32530	0.975|0.975	0.28843|0.28843	N|N	0.896464|0.896464	B|.	0.29646|.	0.253|.	B|.	0.33799|.	0.17|.	T|.	0.22068|.	-1.0227|.	10|.	0.87932|.	D|.	0|.	-4.0257|-4.0257	7.2927|7.2927	0.26374|0.26374	0.8979:0.0:0.1021:0.0|0.8979:0.0:0.1021:0.0	.|.	101|.	Q0P641|.	CB080_HUMAN|.	S|X	26;101;82;101;14|52	ENSP00000389385:I26S;ENSP00000343171:I101S;ENSP00000405393:I82S;ENSP00000397144:I101S;ENSP00000413016:I14S|.	ENSP00000343171:I101S|.	I|Y	-|-	2|3	0|2	C2orf80|C2orf80	208753778|208753778	1.000000|1.000000	0.71417|0.71417	0.937000|0.937000	0.37676|0.37676	0.941000|0.941000	0.58515|0.58515	2.253000|2.253000	0.43205|0.43205	0.883000|0.883000	0.36040|0.36040	0.455000|0.455000	0.32223|0.32223	ATC|TAT	.	.	.	none		0.363	C2orf80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336931.1	NM_001099334	
MON1A	84315	hgsc.bcm.edu	37	3	49946456	49946456	+	Silent	SNP	G	G	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr3:49946456G>A	ENST00000417270.1	-	7	2376	c.1683C>T	c.(1681-1683)ctC>ctT	p.L561L	MON1A_ENST00000483022.1_5'Flank|CTD-2330K9.3_ENST00000419183.1_Intron|MON1A_ENST00000455683.2_Silent_p.L488L|MON1A_ENST00000296473.3_Silent_p.L650L			Q86VX9	MON1A_HUMAN	MON1 secretory trafficking family member A	553										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)	13				BRCA - Breast invasive adenocarcinoma(193;4.62e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		ATCAATAGGTGAGGGGCGTGA	0.607																																					p.L650L		Atlas-SNP	.											.	MON1A	41	.	0			c.C1950T						PASS	.						48.0	43.0	45.0					3																	49946456		2203	4300	6503	SO:0001819	synonymous_variant	84315	exon6			ATAGGTGAGGGGC	AK074404	CCDS2808.2, CCDS46830.1	3p21.31	2013-08-21	2013-08-21		ENSG00000164077	ENSG00000164077			28207	protein-coding gene	gene with protein product		611464	"""MON1 homolog A (yeast)"""			12477932	Standard	NM_032355		Approved	MGC13272, SAND1	uc003cxz.3	Q86VX9	OTTHUMG00000156737	ENST00000417270.1:c.1683C>T	chr3.hg19:g.49946456G>A		68.0	0.0	.		126.0	38.0	.	NM_032355	B2RDQ1|G5E9N1|Q8NAV7|Q9BRF3	Silent	SNP	ENST00000417270.1	hg19																																																																																				.	.	.	none		0.607	MON1A-005	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000345538.2	NM_032355	
TMF1	7110	hgsc.bcm.edu	37	3	69096707	69096707	+	Silent	SNP	T	T	C			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr3:69096707T>C	ENST00000398559.2	-	2	1365	c.1149A>G	c.(1147-1149)acA>acG	p.T383T	MIR3136_ENST00000583498.1_RNA|CTD-2013N24.2_ENST00000596732.1_RNA|CTD-2013N24.2_ENST00000598783.1_RNA|CTD-2013N24.2_ENST00000601735.1_RNA|CTD-2013N24.2_ENST00000595925.1_RNA|TMF1_ENST00000543976.1_Silent_p.T383T|CTD-2013N24.2_ENST00000596274.1_RNA|CTD-2013N24.2_ENST00000596523.1_RNA|CTD-2013N24.2_ENST00000597950.1_RNA|CTD-2013N24.2_ENST00000482368.2_RNA			P82094	TMF1_HUMAN	TATA element modulatory factor 1	383					acrosome assembly (GO:0001675)|cellular response to organic cyclic compound (GO:0071407)|defense response to bacterium (GO:0042742)|Leydig cell differentiation (GO:0033327)|luteinizing hormone secretion (GO:0032275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|positive regulation of cytokine production (GO:0001819)|positive regulation of testosterone secretion (GO:2000845)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of transcription, DNA-templated (GO:0006355)|sperm motility (GO:0030317)|spermatid nucleus differentiation (GO:0007289)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription cofactor activity (GO:0003712)			cervix(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;4.48e-05)|Epithelial(33;0.000274)|LUSC - Lung squamous cell carcinoma(21;0.0123)|KIRC - Kidney renal clear cell carcinoma(39;0.211)|Kidney(39;0.247)		GTATAACTAATGTTTCATTTA	0.383																																					p.T383T		Atlas-SNP	.											.	TMF1	77	.	0			c.A1149G						PASS	.						129.0	121.0	123.0					3																	69096707		1871	4109	5980	SO:0001819	synonymous_variant	7110	exon2			AACTAATGTTTCA		CCDS43105.1	3p21-p12	2009-02-11			ENSG00000144747	ENSG00000144747			11870	protein-coding gene	gene with protein product		601126				1409643	Standard	NM_007114		Approved	ARA160, TMF	uc003dnn.3	P82094	OTTHUMG00000158771	ENST00000398559.2:c.1149A>G	chr3.hg19:g.69096707T>C		229.0	0.0	.		106.0	42.0	.	NM_007114	B7ZLJ2|Q17R87|Q59GK0	Silent	SNP	ENST00000398559.2	hg19	CCDS43105.1																																																																																			.	.	.	none		0.383	TMF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352106.1	NM_007114	
ZBTB11	27107	hgsc.bcm.edu	37	3	101370247	101370247	+	Missense_Mutation	SNP	T	T	G	rs374150569		TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr3:101370247T>G	ENST00000312938.4	-	11	3505	c.2925A>C	c.(2923-2925)caA>caC	p.Q975H		NM_014415.3	NP_055230.2	O95625	ZBT11_HUMAN	zinc finger and BTB domain containing 11	975					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						CACTGCTTTCTTGTTCCTGCA	0.448																																					p.Q975H		Atlas-SNP	.											.	ZBTB11	77	.	0			c.A2925C						PASS	.						202.0	171.0	181.0					3																	101370247		2203	4300	6503	SO:0001583	missense	27107	exon11			GCTTTCTTGTTCC	U69274	CCDS2943.1	3q12.3	2013-01-09			ENSG00000066422	ENSG00000066422		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	16740	protein-coding gene	gene with protein product							Standard	NM_014415		Approved	ZNF-U69274, ZNF913	uc003dve.4	O95625	OTTHUMG00000159133	ENST00000312938.4:c.2925A>C	chr3.hg19:g.101370247T>G	ENSP00000326200:p.Gln975His	421.0	1.0	.		258.0	75.0	.	NM_014415	Q2NKP9	Missense_Mutation	SNP	ENST00000312938.4	hg19	CCDS2943.1	.	.	.	.	.	.	.	.	.	.	T	18.57	3.652999	0.67472	.	.	ENSG00000066422	ENST00000312938	T	0.12672	2.66	5.49	-2.58	0.06228	.	0.060521	0.64402	D	0.000003	T	0.10252	0.0251	N	0.24115	0.695	0.80722	D	1	D	0.62365	0.991	P	0.51999	0.687	T	0.20874	-1.0262	10	0.02654	T	1	-14.7598	12.7952	0.57556	0.0:0.4538:0.0:0.5462	.	975	O95625	ZBT11_HUMAN	H	975	ENSP00000326200:Q975H	ENSP00000326200:Q975H	Q	-	3	2	ZBTB11	102852937	0.931000	0.31567	0.982000	0.44146	0.882000	0.50991	-0.067000	0.11579	-0.456000	0.07043	0.454000	0.30748	CAA	.	.	.	alt		0.448	ZBTB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353441.2	NM_014415	
PVRL3	25945	hgsc.bcm.edu	37	3	110830989	110830989	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr3:110830989G>A	ENST00000485303.1	+	2	548	c.273G>A	c.(271-273)tgG>tgA	p.W91*	PVRL3_ENST00000493615.1_Nonsense_Mutation_p.W68*|PVRL3_ENST00000488016.1_3'UTR|PVRL3_ENST00000319792.3_Nonsense_Mutation_p.W91*	NM_001243286.1|NM_015480.2	NP_001230215.1|NP_056295.1	Q9NQS3	PVRL3_HUMAN	poliovirus receptor-related 3	91	Ig-like V-type.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|fertilization (GO:0009566)|homophilic cell adhesion (GO:0007156)|lens morphogenesis in camera-type eye (GO:0002089)|retina morphogenesis in camera-type eye (GO:0060042)|single organismal cell-cell adhesion (GO:0016337)	apical junction complex (GO:0043296)|cell-cell adherens junction (GO:0005913)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	cell adhesion molecule binding (GO:0050839)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(3)	19						AGATTTCATGGGAGAAGATAC	0.378																																					p.W91X		Atlas-SNP	.											.	PVRL3	78	.	0			c.G273A						PASS	.						79.0	75.0	77.0					3																	110830989		2203	4300	6503	SO:0001587	stop_gained	25945	exon2			TTCATGGGAGAAG	AF282874	CCDS2957.1, CCDS58842.1, CCDS58843.1	3q13	2013-01-29			ENSG00000177707	ENSG00000177707		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17664	protein-coding gene	gene with protein product		607147				11024295	Standard	NM_015480		Approved	nectin-3, PPR3, PVRR3, DKFZP566B0846, CDw113, CD113	uc003dxt.2	Q9NQS3	OTTHUMG00000159239	ENST00000485303.1:c.273G>A	chr3.hg19:g.110830989G>A	ENSP00000418070:p.Trp91*	178.0	0.0	.		13.0	4.0	.	NM_001243286	E9PFR0|Q6NVZ3|Q8NC05|Q8WVU4|Q9BVA9|Q9Y412	Nonsense_Mutation	SNP	ENST00000485303.1	hg19	CCDS2957.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.619371|5.619371	0.96649|0.96649	.|.	.|.	ENSG00000177707|ENSG00000177707	ENST00000486596|ENST00000461477;ENST00000485303;ENST00000319792;ENST00000493615;ENST00000481766	.|.	.|.	.|.	5.84|5.84	5.84|5.84	0.93424|0.93424	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.45875|.	0.1364|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.38001|.	-0.9681|.	3|.	.|0.02654	.|T	.|1	.|.	17.649|17.649	0.88157|0.88157	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	R|X	91|44;91;91;68;76	.|.	.|ENSP00000321514:W91X	G|W	+|+	1|3	0|0	PVRL3|PVRL3	112313679|112313679	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	8.517000|8.517000	0.90555|0.90555	2.760000|2.760000	0.94817|0.94817	0.655000|0.655000	0.94253|0.94253	GGA|TGG	.	.	.	none		0.378	PVRL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354045.1	NM_015480	
PIGZ	80235	hgsc.bcm.edu	37	3	196675120	196675120	+	Silent	SNP	A	A	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr3:196675120A>T	ENST00000412723.1	-	3	794	c.648T>A	c.(646-648)ctT>ctA	p.L216L	PIGZ_ENST00000443835.1_3'UTR	NM_025163.2	NP_079439.2	Q86VD9	PIGZ_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class Z	216					GPI anchor biosynthetic process (GO:0006506)|mannosylation (GO:0097502)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	alpha-1,2-mannosyltransferase activity (GO:0000026)|mannosyltransferase activity (GO:0000030)			breast(1)|endometrium(1)|lung(7)|ovary(3)|prostate(1)|urinary_tract(1)	14	all_cancers(143;1.05e-08)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.29e-24)|all cancers(36;2.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00603)		CAATGCCTCCAAGAAGCCAGC	0.637																																					p.L216L		Atlas-SNP	.											.	PIGZ	34	.	0			c.T648A						PASS	.						59.0	67.0	64.0					3																	196675120		2203	4299	6502	SO:0001819	synonymous_variant	80235	exon3			GCCTCCAAGAAGC	BC018804	CCDS3324.1	3q29	2013-02-26	2006-06-28		ENSG00000119227	ENSG00000119227		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	30596	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 4"", ""dol-P-Man dependent GPI mannosyltransferase"""	611671	"""phosphatidylinositol glycan, class Z"""			15208306	Standard	NM_025163		Approved	FLJ12768, MGC52163, SMP3	uc003fxh.3	Q86VD9	OTTHUMG00000155522	ENST00000412723.1:c.648T>A	chr3.hg19:g.196675120A>T		139.0	0.0	.		271.0	114.0	.	NM_025163	Q9H9G6	Silent	SNP	ENST00000412723.1	hg19	CCDS3324.1																																																																																			.	.	.	none		0.637	PIGZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340486.2	NM_025163	
RFC1	5981	hgsc.bcm.edu	37	4	39325032	39325032	+	Silent	SNP	C	C	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr4:39325032C>T	ENST00000381897.1	-	7	781	c.648G>A	c.(646-648)gaG>gaA	p.E216E	RFC1_ENST00000418436.1_5'UTR|RFC1_ENST00000349703.2_Silent_p.E216E	NM_001204747.1|NM_002913.4	NP_001191676.1|NP_002904.3	P35251	RFC1_HUMAN	replication factor C (activator 1) 1, 145kDa	216					DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA-dependent DNA replication (GO:0006261)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of catalytic activity (GO:0043085)|positive regulation of transcription, DNA-templated (GO:0045893)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|telomere maintenance via telomerase (GO:0007004)|transcription, DNA-templated (GO:0006351)|transcription-coupled nucleotide-excision repair (GO:0006283)	cell junction (GO:0030054)|DNA replication factor C complex (GO:0005663)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA clamp loader activity (GO:0003689)|double-stranded DNA binding (GO:0003690)|enzyme activator activity (GO:0008047)|sequence-specific DNA binding (GO:0043565)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16						GCAACTGCCTCTCCAGCTGTA	0.373																																					p.E216E	Colon(109;59 1555 12203 17579 39824)|Esophageal Squamous(18;360 542 16186 28570 51157)	Atlas-SNP	.											.	RFC1	114	.	0			c.G648A						PASS	.						149.0	124.0	132.0					4																	39325032		2203	4300	6503	SO:0001819	synonymous_variant	5981	exon7			CTGCCTCTCCAGC	L23320	CCDS3450.1, CCDS56329.1	4p14-p13	2010-04-21	2002-08-29		ENSG00000035928	ENSG00000035928		"""ATPases / AAA-type"""	9969	protein-coding gene	gene with protein product		102579	"""replication factor C (activator 1) 1 (145kD)"""			8114700	Standard	NM_002913		Approved	A1, PO-GA, RFC140, MHCBFB	uc003gty.2	P35251	OTTHUMG00000099363	ENST00000381897.1:c.648G>A	chr4.hg19:g.39325032C>T		169.0	0.0	.		33.0	12.0	.	NM_002913	A8K6E7|Q5XKF5|Q6PKU0|Q86V41|Q86V46	Silent	SNP	ENST00000381897.1	hg19	CCDS56329.1																																																																																			.	.	.	none		0.373	RFC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216808.1	NM_002913	
UGT2B7	7364	hgsc.bcm.edu	37	4	69968643	69968643	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr4:69968643A>T	ENST00000508661.1	+	3	1016	c.989A>T	c.(988-990)cAg>cTg	p.Q330L	UGT2B7_ENST00000305231.7_Missense_Mutation_p.Q330L|UGT2B7_ENST00000509763.1_3'UTR			P16662	UD2B7_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B7	330					androgen metabolic process (GO:0008209)|cellular glucuronidation (GO:0052695)|lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyltransferase activity (GO:0015020)			autonomic_ganglia(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38					Atorvastatin(DB01076)|Carbamazepine(DB00564)|Chenodeoxycholic acid(DB06777)|Codeine(DB00318)|Dabigatran etexilate(DB06695)|Dapagliflozin(DB06292)|Diclofenac(DB00586)|Epirubicin(DB00445)|Etodolac(DB00749)|Ezetimibe(DB00973)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Losartan(DB00678)|Lovastatin(DB00227)|Mitiglinide(DB01252)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Naproxen(DB00788)|Oxazepam(DB00842)|Pitavastatin(DB08860)|Silodosin(DB06207)|Simvastatin(DB00641)|Suprofen(DB00870)|Tapentadol(DB06204)|Valproic Acid(DB00313)|Zidovudine(DB00495)	GCCCTGGCCCAGATCCCACAA	0.428																																					p.Q330L		Atlas-SNP	.											.	UGT2B7	79	.	0			c.A989T						PASS	.						173.0	167.0	169.0					4																	69968643		2203	4300	6503	SO:0001583	missense	7364	exon3			TGGCCCAGATCCC	BC030974	CCDS3526.1	4q13	2008-02-05	2005-07-20		ENSG00000171234	ENSG00000171234		"""UDP glucuronosyltransferases"""	12554	protein-coding gene	gene with protein product		600068	"""UDP glycosyltransferase 2 family, polypeptide B7"""			2159463, 7835904	Standard	NM_001074		Approved	UGT2B9	uc003heg.4	P16662	OTTHUMG00000129404	ENST00000508661.1:c.989A>T	chr4.hg19:g.69968643A>T	ENSP00000427659:p.Gln330Leu	438.0	0.0	.		51.0	17.0	.	NM_001074	B2R810|Q6GTW0	Missense_Mutation	SNP	ENST00000508661.1	hg19		.	.	.	.	.	.	.	.	.	.	A	7.768	0.706788	0.15239	.	.	ENSG00000171234	ENST00000502942;ENST00000305231;ENST00000508661	T;T;T	0.61158	0.13;0.13;0.13	3.0	1.8	0.24995	.	0.000000	0.64402	U	0.000001	T	0.75125	0.3807	M	0.93898	3.47	0.22961	N	0.998502	P;P	0.47545	0.875;0.897	P;P	0.59424	0.857;0.657	T	0.66097	-0.6008	9	.	.	.	.	6.2555	0.20872	0.8699:0.0:0.1301:0.0	.	330;330	E9PBP8;P16662	.;UD2B7_HUMAN	L	81;330;330	ENSP00000426206:Q81L;ENSP00000304811:Q330L;ENSP00000427659:Q330L	.	Q	+	2	0	UGT2B7	70003232	1.000000	0.71417	0.097000	0.21041	0.105000	0.19272	6.429000	0.73387	0.370000	0.24538	0.477000	0.44152	CAG	.	.	.	none		0.428	UGT2B7-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000362103.1	NM_001074	
ANTXR2	118429	hgsc.bcm.edu	37	4	80992809	80992809	+	Splice_Site	SNP	C	C	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr4:80992809C>A	ENST00000307333.7	-	2	155		c.e2-1		ANTXR2_ENST00000295465.4_Splice_Site|ANTXR2_ENST00000346652.6_Splice_Site|ANTXR2_ENST00000403729.2_Splice_Site|ANTXR2_ENST00000404191.1_Splice_Site	NM_001145794.1	NP_001139266.1	P58335	ANTR2_HUMAN	anthrax toxin receptor 2						reproductive process (GO:0022414)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)	13						ACTCCCAGACCTGAAAGATGA	0.383									Juvenile Hyaline Fibromatosis																												.		Atlas-SNP	.											.	ANTXR2	97	.	0			c.153-1G>T						PASS	.						71.0	71.0	71.0					4																	80992809		1839	4093	5932	SO:0001630	splice_region_variant	118429	exon3	Familial Cancer Database	incl. Infantile Systemic Hyalinosis	CCAGACCTGAAAG	AY040326	CCDS47085.1, CCDS47086.1, CCDS68733.1	4q21.3	2004-01-15			ENSG00000163297	ENSG00000163297			21732	protein-coding gene	gene with protein product	"""capillary morphogenesis protein 2"""	608041				11683410, 12700348	Standard	NM_058172		Approved	CMG2, CMG-2, FLJ31074	uc003hlz.4	P58335	OTTHUMG00000151982	ENST00000307333.7:c.153-1G>T	chr4.hg19:g.80992809C>A		112.0	0.0	.		79.0	21.0	.	NM_058172	Q4W5H6|Q59E98|Q5JPE9|Q86UI1|Q8N4J8|Q8NB13|Q96NC7	Splice_Site	SNP	ENST00000307333.7	hg19	CCDS47086.1	.	.	.	.	.	.	.	.	.	.	C	15.41	2.826045	0.50739	.	.	ENSG00000163297	ENST00000403729;ENST00000346652;ENST00000307333;ENST00000295465	.	.	.	5.61	5.61	0.85477	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5222	0.84320	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ANTXR2	81211833	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	5.415000	0.66411	2.642000	0.89623	0.563000	0.77884	.	.	.	.	none		0.383	ANTXR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324663.1	NM_058172	Intron
STPG2	285555	hgsc.bcm.edu	37	4	98865112	98865112	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr4:98865112T>G	ENST00000295268.3	-	8	1069	c.980A>C	c.(979-981)aAc>aCc	p.N327T		NM_174952.2	NP_777612.1	Q8N412	STPG2_HUMAN	sperm-tail PG-rich repeat containing 2	327																	GTTAGTCAAGTTAGGTAATTC	0.323																																					p.N327T		Atlas-SNP	.											.	.	.	.	0			c.A980C						PASS	.						130.0	127.0	128.0					4																	98865112		2203	4300	6503	SO:0001583	missense	285555	exon8			GTCAAGTTAGGTA	BC036870	CCDS3645.1	4q22.3-q23	2013-10-11	2012-07-30	2012-07-30	ENSG00000163116	ENSG00000163116			28712	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 37"""	C4orf37		23031811	Standard	NM_174952		Approved	MGC46496	uc003htt.2	Q8N412	OTTHUMG00000131009	ENST00000295268.3:c.980A>C	chr4.hg19:g.98865112T>G	ENSP00000295268:p.Asn327Thr	329.0	0.0	.		29.0	9.0	.	NM_174952		Missense_Mutation	SNP	ENST00000295268.3	hg19	CCDS3645.1	.	.	.	.	.	.	.	.	.	.	T	4.606	0.112544	0.08831	.	.	ENSG00000163116	ENST00000522676;ENST00000295268	T;T	0.48201	0.82;2.71	4.0	4.0	0.46444	.	1.315340	0.04739	N	0.422540	T	0.38878	0.1057	L	0.29908	0.895	0.25587	N	0.986734	B	0.33694	0.421	B	0.29862	0.108	T	0.32375	-0.9909	10	0.59425	D	0.04	-9.3556	9.6357	0.39806	0.0:0.0:0.0:1.0	.	327	Q8N412	CD037_HUMAN	T	41;327	ENSP00000428346:N41T;ENSP00000295268:N327T	ENSP00000295268:N327T	N	-	2	0	C4orf37	99084135	0.997000	0.39634	0.663000	0.29738	0.803000	0.45373	2.716000	0.47219	2.041000	0.60428	0.456000	0.33151	AAC	.	.	.	none		0.323	STPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253642.1	NM_174952	
NPY2R	4887	hgsc.bcm.edu	37	4	156136059	156136059	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr4:156136059T>G	ENST00000329476.3	+	2	1457	c.968T>G	c.(967-969)cTt>cGt	p.L323R	NPY2R_ENST00000506608.1_Missense_Mutation_p.L323R	NM_000910.2	NP_000901.1	P49146	NPY2R_HUMAN	neuropeptide Y receptor Y2	323					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral fear response (GO:0001662)|cardiac left ventricle morphogenesis (GO:0003214)|locomotory behavior (GO:0007626)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neurological system process (GO:0031645)|negative regulation of secretion (GO:0051048)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuropeptide signaling pathway (GO:0007218)|nitric oxide mediated signal transduction (GO:0007263)|outflow tract morphogenesis (GO:0003151)|positive regulation of cell adhesion (GO:0045785)|positive regulation of circadian sleep/wake cycle, non-REM sleep (GO:0046010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of peptide secretion (GO:0002793)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of sensory perception of pain (GO:0051930)|secretion (GO:0046903)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|neuropeptide Y receptor activity (GO:0004983)|peptide YY receptor activity (GO:0001601)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(17)|prostate(1)|skin(5)|urinary_tract(1)	36	all_hematologic(180;0.24)	Renal(120;0.0854)			Cysteamine(DB00847)	GCCAATCCCCTTCTCTATGGC	0.527																																					p.L323R		Atlas-SNP	.											.	NPY2R	87	.	0			c.T968G						PASS	.						116.0	97.0	103.0					4																	156136059		2203	4300	6503	SO:0001583	missense	4887	exon2			ATCCCCTTCTCTA	U42766	CCDS3791.1	4q31	2012-08-08				ENSG00000185149		"""GPCR / Class A : Neuropeptide receptors : Y"""	7957	protein-coding gene	gene with protein product		162642				7559383	Standard	NM_000910		Approved		uc003ioq.3	P49146		ENST00000329476.3:c.968T>G	chr4.hg19:g.156136059T>G	ENSP00000332591:p.Leu323Arg	159.0	0.0	.		247.0	84.0	.	NM_000910	Q13281|Q13457|Q4W5G7|Q6AZZ6|Q9UE67	Missense_Mutation	SNP	ENST00000329476.3	hg19	CCDS3791.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.979528	0.74360	.	.	ENSG00000185149	ENST00000329476;ENST00000506608	T;T	0.56275	0.47;0.47	5.74	5.74	0.90152	GPCR, rhodopsin-like superfamily (1);	0.285408	0.32970	N	0.005436	T	0.78342	0.4268	M	0.93939	3.475	0.80722	D	1	P	0.51240	0.943	D	0.63113	0.911	D	0.84029	0.0358	10	0.72032	D	0.01	.	15.2138	0.73247	0.0:0.0:0.0:1.0	.	323	P49146	NPY2R_HUMAN	R	323	ENSP00000332591:L323R;ENSP00000426366:L323R	ENSP00000332591:L323R	L	+	2	0	NPY2R	156355509	0.998000	0.40836	0.885000	0.34714	0.928000	0.56348	8.040000	0.89188	2.189000	0.69895	0.523000	0.50628	CTT	.	.	.	none		0.527	NPY2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365128.1	NM_000910	
CDH9	1007	hgsc.bcm.edu	37	5	26906161	26906161	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr5:26906161C>T	ENST00000231021.4	-	5	890	c.718G>A	c.(718-720)Gac>Aac	p.D240N		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	240	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D240N(1)		breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						CCACCCATGTCTTTGGCCTGT	0.448																																					p.D240N	Melanoma(8;187 585 15745 40864 52829)	Atlas-SNP	.											CDH9,NS,carcinoma,0,4	CDH9	305	.	1	Substitution - Missense(1)	lung(1)	c.G718A						PASS	.						232.0	208.0	216.0					5																	26906161		2203	4300	6503	SO:0001583	missense	1007	exon5			CCATGTCTTTGGC	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.718G>A	chr5.hg19:g.26906161C>T	ENSP00000231021:p.Asp240Asn	282.0	0.0	.		54.0	12.0	.	NM_016279	Q3B7I5	Missense_Mutation	SNP	ENST00000231021.4	hg19	CCDS3893.1	.	.	.	.	.	.	.	.	.	.	C	35	5.553655	0.96501	.	.	ENSG00000113100	ENST00000231021	T	0.79940	-1.32	5.6	5.6	0.85130	Cadherin (5);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.92548	0.7633	M	0.93939	3.475	0.80722	D	1	D	0.76494	0.999	D	0.76575	0.988	D	0.93866	0.7158	9	.	.	.	.	18.5289	0.90984	0.0:1.0:0.0:0.0	.	240	Q9ULB4	CADH9_HUMAN	N	240	ENSP00000231021:D240N	.	D	-	1	0	CDH9	26941918	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.750000	0.85110	2.802000	0.96397	0.650000	0.86243	GAC	.	.	.	none		0.448	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279	
ANKHD1	54882	hgsc.bcm.edu	37	5	139908303	139908303	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr5:139908303G>C	ENST00000360839.2	+	29	5926	c.5772G>C	c.(5770-5772)gaG>gaC	p.E1924D	ANKHD1_ENST00000544120.1_Missense_Mutation_p.E307D|SNORD45_ENST00000363181.1_RNA|ANKHD1-EIF4EBP3_ENST00000532219.1_Missense_Mutation_p.E1924D|ANKHD1_ENST00000297183.6_Missense_Mutation_p.E1924D	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	1924						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TACCCTCAGAGTCTGCTGGAC	0.488																																					p.E1924D		Atlas-SNP	.											ANKHD1-EIF4EBP3,NS,carcinoma,0,2	ANKHD1	233	.	0			c.G5772C						PASS	.						81.0	77.0	78.0					5																	139908303		2203	4300	6503	SO:0001583	missense	54882	exon29			CTCAGAGTCTGCT	AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.5772G>C	chr5.hg19:g.139908303G>C	ENSP00000354085:p.Glu1924Asp	159.0	0.0	.		54.0	4.0	.	NM_017747	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Missense_Mutation	SNP	ENST00000360839.2	hg19	CCDS4225.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.835|9.835	1.189371|1.189371	0.21954|0.21954	.|.	.|.	ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000254996|ENSG00000131503	ENST00000360839;ENST00000297183;ENST00000253810;ENST00000431508;ENST00000536646;ENST00000433049;ENST00000544120;ENST00000532219|ENST00000435794;ENST00000432301	T;T;T;T;T;T|.	0.65916|.	-0.14;-0.18;1.89;1.89;1.48;-0.18|.	4.98|4.98	1.47|1.47	0.22746|0.22746	.|.	0.238205|.	0.41396|.	D|.	0.000887|.	T|T	0.33789|0.33789	0.0875|0.0875	L|L	0.34521|0.34521	1.04|1.04	0.25479|0.25479	N|N	0.987752|0.987752	B;P;B;P;B;B|.	0.42409|.	0.184;0.779;0.28;0.462;0.231;0.231|.	B;B;B;B;B;B|.	0.35510|.	0.055;0.204;0.118;0.121;0.054;0.054|.	T|T	0.25152|0.25152	-1.0140|-1.0140	10|5	0.19590|.	T|.	0.45|.	.|.	8.8813|8.8813	0.35376|0.35376	0.3024:0.0:0.6976:0.0|0.3024:0.0:0.6976:0.0	.|.	307;354;307;1924;1924;1924|.	Q8IWG5;Q9H059;F6WFL0;E9PF56;Q8IWZ2;Q8IWZ3|.	.;.;.;.;.;ANKH1_HUMAN|.	D|L	1924;1924;1924;580;359;446;307;1924|415;375	ENSP00000354085:E1924D;ENSP00000297183:E1924D;ENSP00000393204:E580D;ENSP00000390034:E446D;ENSP00000437687:E307D;ENSP00000432016:E1924D|.	ENSP00000432016:E1924D|.	E|V	+|+	3|1	2|0	ANKHD1-EIF4EBP3;ANKHD1|ANKHD1	139888487|139888487	0.997000|0.997000	0.39634|0.39634	0.996000|0.996000	0.52242|0.52242	0.985000|0.985000	0.73830|0.73830	0.224000|0.224000	0.17738|0.17738	0.419000|0.419000	0.25927|0.25927	0.650000|0.650000	0.86243|0.86243	GAG|GTC	.	.	.	none		0.488	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251672.1	NM_017747	
MED7	9443	hgsc.bcm.edu	37	5	156565887	156565887	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr5:156565887T>G	ENST00000286317.5	-	2	937	c.556A>C	c.(556-558)Act>Cct	p.T186P	MED7_ENST00000420343.1_Missense_Mutation_p.T186P	NM_004270.4	NP_004261.1	O43513	MED7_HUMAN	mediator complex subunit 7	186					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II transcription cofactor activity (GO:0001104)|transcription coactivator activity (GO:0003713)			kidney(1)|large_intestine(1)|lung(3)|urinary_tract(2)	7	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ATTGGTTCAGTTTTTACTCTC	0.373																																					p.T186P		Atlas-SNP	.											.	MED7	18	.	0			c.A556C						PASS	.						170.0	159.0	163.0					5																	156565887		2203	4300	6503	SO:0001583	missense	9443	exon2			GTTCAGTTTTTAC	AF104251	CCDS4334.1	5q33.3	2008-02-05	2007-07-30	2007-07-30	ENSG00000155868	ENSG00000155868			2378	protein-coding gene	gene with protein product		605045	"""cofactor required for Sp1 transcriptional activation, subunit 9, 33kDa"""	CRSP9		9989412	Standard	NM_004270		Approved	CRSP33	uc003lwm.4	O43513	OTTHUMG00000130243	ENST00000286317.5:c.556A>C	chr5.hg19:g.156565887T>G	ENSP00000286317:p.Thr186Pro	267.0	0.0	.		121.0	45.0	.	NM_001100816		Missense_Mutation	SNP	ENST00000286317.5	hg19	CCDS4334.1	.	.	.	.	.	.	.	.	.	.	T	13.62	2.291433	0.40494	.	.	ENSG00000155868	ENST00000286317;ENST00000420343;ENST00000524289	.	.	.	5.81	1.99	0.26369	.	0.426120	0.27048	N	0.021196	T	0.36248	0.0960	L	0.52573	1.65	0.35094	D	0.764574	P	0.45634	0.863	B	0.41271	0.352	T	0.40327	-0.9569	9	0.27082	T	0.32	-13.3431	5.9577	0.19283	0.1123:0.1921:0.0:0.6956	.	186	O43513	MED7_HUMAN	P	186	.	ENSP00000286317:T186P	T	-	1	0	MED7	156498465	0.995000	0.38212	0.985000	0.45067	0.991000	0.79684	0.479000	0.22228	0.098000	0.17522	0.533000	0.62120	ACT	.	.	.	none		0.373	MED7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252567.2	NM_004270	
SLC22A16	85413	hgsc.bcm.edu	37	6	110757106	110757106	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr6:110757106G>A	ENST00000368919.3	-	6	1436	c.1370C>T	c.(1369-1371)gCa>gTa	p.A457V	SLC22A16_ENST00000330550.4_Missense_Mutation_p.A423V|SLC22A16_ENST00000439654.1_Missense_Mutation_p.A457V	NM_033125.3	NP_149116.2	Q86VW1	S22AG_HUMAN	solute carrier family 22 (organic cation/carnitine transporter), member 16	457					acid secretion (GO:0046717)|amine transport (GO:0015837)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|organic cation transport (GO:0015695)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amine transmembrane transporter activity (GO:0005275)|carnitine transmembrane transporter activity (GO:0015226)|organic cation transmembrane transporter activity (GO:0015101)			breast(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	34		all_cancers(87;0.00221)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0485)|Colorectal(196;0.101)		OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.0921)|all cancers(137;0.115)	Doxorubicin(DB00997)|L-Carnitine(DB00583)	GAGGCCAAATGCTGCCCCGAT	0.363																																					p.A457V		Atlas-SNP	.											.	SLC22A16	81	.	0			c.C1370T						PASS	.						102.0	99.0	100.0					6																	110757106		2203	4300	6503	SO:0001583	missense	85413	exon6			CCAAATGCTGCCC		CCDS5084.1	6q21	2013-05-22	2008-01-11		ENSG00000004809	ENSG00000004809		"""Solute carriers"""	20302	protein-coding gene	gene with protein product		608276	"""solute carrier family 22 (organic cation transporter), member 16"""			12372408, 12089149, 17473959	Standard	NM_033125		Approved	FLIPT2, CT2, OKB1, OAT6	uc003puf.3	Q86VW1	OTTHUMG00000016171	ENST00000368919.3:c.1370C>T	chr6.hg19:g.110757106G>A	ENSP00000357915:p.Ala457Val	185.0	0.0	.		125.0	39.0	.	NM_033125	O14567|Q5JXM1|Q8IUG8|Q8IZD5|Q96M90|Q96RU0	Missense_Mutation	SNP	ENST00000368919.3	hg19	CCDS5084.1	.	.	.	.	.	.	.	.	.	.	G	16.34	3.095193	0.56075	.	.	ENSG00000004809	ENST00000368919;ENST00000451557;ENST00000330550;ENST00000439654	D;D;D;D	0.90133	-2.62;-2.62;-2.62;-2.62	4.75	0.519	0.17035	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.355691	0.31809	N	0.007039	T	0.81814	0.4902	L	0.56124	1.755	0.80722	D	1	B;B	0.31413	0.322;0.275	B;B	0.37550	0.253;0.164	T	0.76924	-0.2779	10	0.72032	D	0.01	.	8.3956	0.32555	0.3527:0.0:0.6473:0.0	.	457;423	Q86VW1;Q86VW1-2	S22AG_HUMAN;.	V	457;374;423;457	ENSP00000357915:A457V;ENSP00000395642:A374V;ENSP00000328583:A423V;ENSP00000408799:A457V	ENSP00000328583:A423V	A	-	2	0	SLC22A16	110863799	0.999000	0.42202	0.000000	0.03702	0.591000	0.36615	2.826000	0.48104	-0.101000	0.12219	-0.339000	0.08088	GCA	.	.	.	none		0.363	SLC22A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043428.1	NM_033125	
SYNJ2	8871	hgsc.bcm.edu	37	6	158449969	158449969	+	Silent	SNP	A	A	T	rs140060886		TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr6:158449969A>T	ENST00000355585.4	+	3	471	c.396A>T	c.(394-396)tcA>tcT	p.S132S	SYNJ2_ENST00000449859.2_Silent_p.S81S|SYNJ2_ENST00000367122.2_Silent_p.S132S|SYNJ2_ENST00000367121.3_Silent_p.S132S	NM_001178088.1|NM_003898.3	NP_001171559.1|NP_003889.1	O15056	SYNJ2_HUMAN	synaptojanin 2	132	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			biliary_tract(1)|endometrium(9)|kidney(3)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)		TCTATTTCTCATGGCCAAACG	0.542																																					p.S132S		Atlas-SNP	.											.	SYNJ2	111	.	0			c.A396T						PASS	.						66.0	67.0	66.0					6																	158449969		2203	4300	6503	SO:0001819	synonymous_variant	8871	exon3			TTTCTCATGGCCA	AB002346	CCDS5254.1	6q25.3	2008-05-15			ENSG00000078269	ENSG00000078269			11504	protein-coding gene	gene with protein product		609410					Standard	NM_003898		Approved	INPP5H	uc003qqx.2	O15056	OTTHUMG00000015904	ENST00000355585.4:c.396A>T	chr6.hg19:g.158449969A>T		133.0	0.0	.		235.0	70.0	.	NM_003898	Q5TA13|Q5TA16|Q5TA19|Q86XK0|Q8IZA8|Q9H226	Silent	SNP	ENST00000355585.4	hg19	CCDS5254.1	.	.	.	.	.	.	.	.	.	.	A	4.185	0.032976	0.08101	.	.	ENSG00000078269	ENST00000367113	.	.	.	4.62	-9.25	0.00666	.	.	.	.	.	T	0.35219	0.0924	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68868	-0.5295	4	.	.	.	.	9.0699	0.36486	0.2544:0.577:0.1011:0.0675	.	.	.	.	L	107	.	.	H	+	2	0	SYNJ2	158369957	0.008000	0.16893	0.903000	0.35520	0.321000	0.28281	-1.071000	0.03437	1.946000	0.56461	0.533000	0.62120	CAT	.	A|1.000;G|0.000	.	alt		0.542	SYNJ2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042858.2		
NOD1	10392	hgsc.bcm.edu	37	7	30475651	30475651	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr7:30475651T>A	ENST00000222823.4	-	11	3109	c.2584A>T	c.(2584-2586)Agg>Tgg	p.R862W		NM_006092.2	NP_006083.1	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain containing 1	862					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPK activity (GO:0000187)|apoptotic process (GO:0006915)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-8 biosynthetic process (GO:0042228)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of tumor necrosis factor production (GO:0032760)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|identical protein binding (GO:0042802)|peptidoglycan binding (GO:0042834)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|skin(2)	39						TGCAGGGCCCTCGCAAGGCTC	0.443																																					p.R862W		Atlas-SNP	.											.	NOD1	79	.	0			c.A2584T						PASS	.						129.0	106.0	114.0					7																	30475651		2203	4300	6503	SO:0001583	missense	10392	exon11			GGGCCCTCGCAAG	AF126484	CCDS5427.1	7p15-p14	2006-12-08	2006-12-08	2006-12-08	ENSG00000106100	ENSG00000106100		"""Nucleotide-binding domain and leucine rich repeat containing"""	16390	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 1"", ""NLR family, CARD domain containing 1"""	605980	"""caspase recruitment domain family, member 4"""	CARD4		10224040, 10329646	Standard	NM_006092		Approved	NLRC1, CLR7.1	uc003tav.3	Q9Y239	OTTHUMG00000023923	ENST00000222823.4:c.2584A>T	chr7.hg19:g.30475651T>A	ENSP00000222823:p.Arg862Trp	123.0	0.0	.		173.0	52.0	.	NM_006092	B4DTU3|Q549U4|Q8IWF5	Missense_Mutation	SNP	ENST00000222823.4	hg19	CCDS5427.1	.	.	.	.	.	.	.	.	.	.	T	8.038	0.763254	0.15914	.	.	ENSG00000106100	ENST00000222823	T	0.55052	0.54	5.12	-1.83	0.07833	.	0.871180	0.09788	N	0.755710	T	0.39145	0.1067	L	0.49126	1.545	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.36866	-0.9730	10	0.62326	D	0.03	.	1.2857	0.02050	0.1549:0.2137:0.3025:0.3289	.	862	Q9Y239	NOD1_HUMAN	W	862	ENSP00000222823:R862W	ENSP00000222823:R862W	R	-	1	2	NOD1	30442176	0.008000	0.16893	0.000000	0.03702	0.092000	0.18411	0.609000	0.24238	-0.810000	0.04375	-0.313000	0.08912	AGG	.	.	.	none		0.443	NOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250443.2		
EIF4H	7458	hgsc.bcm.edu	37	7	73601993	73601993	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr7:73601993A>G	ENST00000265753.8	+	2	251	c.112A>G	c.(112-114)Aca>Gca	p.T38A	EIF4H_ENST00000353999.6_Missense_Mutation_p.T38A|EIF4H_ENST00000495187.1_3'UTR	NM_022170.1	NP_071496.1	Q15056	IF4H_HUMAN	eukaryotic translation initiation factor 4H	38					cellular protein metabolic process (GO:0044267)|developmental growth (GO:0048589)|gene expression (GO:0010467)|regulation of translational initiation (GO:0006446)|sexual reproduction (GO:0019953)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(1)|lung(2)|prostate(1)	4						GGAGTTGCCCACAGAGCCCCC	0.527																																					p.T38A		Atlas-SNP	.											.	EIF4H	19	.	0			c.A112G						PASS	.						93.0	91.0	92.0					7																	73601993		2203	4297	6500	SO:0001583	missense	7458	exon2			TTGCCCACAGAGC		CCDS5564.1, CCDS5565.1	7q11.23	2013-02-12	2006-11-27	2006-11-27	ENSG00000106682	ENSG00000106682		"""RNA binding motif (RRM) containing"""	12741	protein-coding gene	gene with protein product		603431	"""Williams-Beuren syndrome chromosome region 1"""	WBSCR1		9516461, 15078951	Standard	NM_022170		Approved	WSCR1, KIAA0038	uc003uad.1	Q15056	OTTHUMG00000023025	ENST00000265753.8:c.112A>G	chr7.hg19:g.73601993A>G	ENSP00000265753:p.Thr38Ala	296.0	0.0	.		422.0	133.0	.	NM_022170	A8K3R1|D3DXF6|D3DXF8	Missense_Mutation	SNP	ENST00000265753.8	hg19	CCDS5564.1	.	.	.	.	.	.	.	.	.	.	A	16.19	3.053342	0.55218	.	.	ENSG00000106682	ENST00000265753;ENST00000353999	T;T	0.74002	-0.8;-0.8	5.05	5.05	0.67936	Nucleotide-binding, alpha-beta plait (1);	0.118143	0.64402	D	0.000020	T	0.72020	0.3409	L	0.55990	1.75	0.54753	D	0.999988	B;B;B;B	0.20368	0.012;0.012;0.044;0.006	B;B;B;B	0.28916	0.096;0.096;0.047;0.054	T	0.70310	-0.4907	10	0.49607	T	0.09	-15.2629	13.9042	0.63823	1.0:0.0:0.0:0.0	.	38;38;38;38	B4DMV6;Q75MU2;Q15056-2;Q15056	.;.;.;IF4H_HUMAN	A	38	ENSP00000265753:T38A;ENSP00000265754:T38A	ENSP00000265753:T38A	T	+	1	0	EIF4H	73239929	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.887000	0.63156	2.029000	0.59856	0.379000	0.24179	ACA	.	.	.	none		0.527	EIF4H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252375.2	NM_022170	
POR	5447	hgsc.bcm.edu	37	7	75615481	75615481	+	Missense_Mutation	SNP	A	A	G	rs72557954		TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr7:75615481A>G	ENST00000461988.1	+	15	1925	c.1820A>G	c.(1819-1821)tAc>tGc	p.Y607C	TMEM120A_ENST00000338761.4_RNA|TMEM120A_ENST00000493111.2_RNA|POR_ENST00000450476.1_Missense_Mutation_p.Y506C|POR_ENST00000419840.1_Intron|POR_ENST00000439269.1_Missense_Mutation_p.Y345C|POR_ENST00000545601.1_Missense_Mutation_p.Y415C|POR_ENST00000394893.1_Missense_Mutation_p.Y607C	NM_000941.2	NP_000932.3	P16435	NCPR_HUMAN	P450 (cytochrome) oxidoreductase	604					carnitine metabolic process (GO:0009437)|cellular organofluorine metabolic process (GO:0090346)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to peptide hormone stimulus (GO:0071375)|demethylation (GO:0070988)|fatty acid oxidation (GO:0019395)|flavonoid metabolic process (GO:0009812)|internal peptidyl-lysine acetylation (GO:0018393)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of lipase activity (GO:0060192)|nitrate catabolic process (GO:0043602)|nitric oxide catabolic process (GO:0046210)|oxidation-reduction process (GO:0055114)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of monooxygenase activity (GO:0032770)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|regulation of growth plate cartilage chondrocyte proliferation (GO:0003420)|response to drug (GO:0042493)|response to nutrient (GO:0007584)	endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|hydrolase activity (GO:0016787)|iron ion binding (GO:0005506)|iron-cytochrome-c reductase activity (GO:0047726)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric oxide dioxygenase activity (GO:0008941)			central_nervous_system(1)|endometrium(2)|kidney(2)|lung(3)|ovary(1)	9					Benzphetamine(DB00865)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Ethylmorphine(DB01466)|Flavin adenine dinucleotide(DB03147)|Lipoic Acid(DB00166)|Mitomycin(DB00305)|Nilutamide(DB00665)|Nitrofurantoin(DB00698)	CCCCAGGTCTACGTCCAGCAC	0.632																																					p.Y607C		Atlas-SNP	.											.	POR	46	.	0			c.A1820G	GRCh37	CM087168	POR	M	rs72557954	PASS	.						43.0	56.0	52.0					7																	75615481		2106	4224	6330	SO:0001583	missense	5447	exon15			AGGTCTACGTCCA	AF258341	CCDS5579.1	7q11.2	2006-12-05			ENSG00000127948	ENSG00000127948			9208	protein-coding gene	gene with protein product		124015				2516426	Standard	NM_000941		Approved	CYPOR, FLJ26468	uc003udy.3	P16435	OTTHUMG00000130413	ENST00000461988.1:c.1820A>G	chr7.hg19:g.75615481A>G	ENSP00000419970:p.Tyr607Cys	28.0	0.0	.		41.0	19.0	.	NM_000941	Q16455|Q197M5|Q8N181|Q9H3M8|Q9UDT3	Missense_Mutation	SNP	ENST00000461988.1	hg19	CCDS5579.1	.	.	.	.	.	.	.	.	.	.	A	11.75	1.731367	0.30684	.	.	ENSG00000127948	ENST00000461988;ENST00000394893;ENST00000545601;ENST00000450476;ENST00000439269	D;D;D;D;D	0.82081	-1.57;-1.57;-1.57;-1.57;-1.57	3.59	3.59	0.41128	Oxidoreductase FAD/NAD(P)-binding (1);Flavoprotein pyridine nucleotide cytochrome reductase (1);	0.127712	0.53938	D	0.000041	D	0.94512	0.8233	H	0.99336	4.52	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.95784	0.8819	10	0.87932	D	0	-33.1823	12.3556	0.55174	1.0:0.0:0.0:0.0	.	604;506;415;613	P16435;E7EVY7;F5H468;Q59ED7	NCPR_HUMAN;.;.;.	C	607;607;415;506;345	ENSP00000419970:Y607C;ENSP00000378355:Y607C;ENSP00000446149:Y415C;ENSP00000416572:Y506C;ENSP00000412490:Y345C	ENSP00000378355:Y607C	Y	+	2	0	POR	75453417	1.000000	0.71417	0.956000	0.39512	0.099000	0.18886	5.702000	0.68332	1.863000	0.54032	0.459000	0.35465	TAC	.	A|0.999;G|0.001	0.001	weak		0.632	POR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252796.7	NM_000941	
BAIAP2L1	55971	hgsc.bcm.edu	37	7	97933661	97933661	+	Silent	SNP	G	G	A	rs555687728		TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr7:97933661G>A	ENST00000005260.8	-	12	1484	c.1269C>T	c.(1267-1269)acC>acT	p.T423T		NM_018842.4	NP_061330.2	Q9UHR4	BI2L1_HUMAN	BAI1-associated protein 2-like 1	423					filopodium assembly (GO:0046847)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of actin filament polymerization (GO:0030838)|response to bacterium (GO:0009617)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)	p.T423T(1)		NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)	23	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		STAD - Stomach adenocarcinoma(171;0.215)			ACAAGTTCACGGTGCTGATGC	0.537													G|||	1	0.000199681	0.0	0.0	5008	,	,		18777	0.0		0.0	False		,,,				2504	0.001				p.T423T		Atlas-SNP	.											BAIAP2L1,NS,carcinoma,0,1	BAIAP2L1	61	.	1	Substitution - coding silent(1)	breast(1)	c.C1269T						PASS	.						119.0	99.0	105.0					7																	97933661		2203	4300	6503	SO:0001819	synonymous_variant	55971	exon12			GTTCACGGTGCTG	AF119666	CCDS34687.1	7q22.1	2012-10-04			ENSG00000006453	ENSG00000006453			21649	protein-coding gene	gene with protein product		611877					Standard	NM_018842		Approved	IRTKS	uc003upj.3	Q9UHR4	OTTHUMG00000165117	ENST00000005260.8:c.1269C>T	chr7.hg19:g.97933661G>A		99.0	0.0	.		245.0	50.0	.	NM_018842	A4D268|Q75L21|Q75L22|Q96CV4|Q9H5F5|Q9Y2M8	Silent	SNP	ENST00000005260.8	hg19	CCDS34687.1																																																																																			.	.	.	none		0.537	BAIAP2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334681.1	NM_018842	
ANKRD7	56311	hgsc.bcm.edu	37	7	117879989	117879989	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr7:117879989C>A	ENST00000265224.4	+	6	894	c.739C>A	c.(739-741)Cat>Aat	p.H247N	ANKRD7_ENST00000357099.4_Missense_Mutation_p.H267N|ANKRD7_ENST00000433239.1_Missense_Mutation_p.H194N|ANKRD7_ENST00000417525.1_Silent_p.A192A|ANKRD7_ENST00000477532.1_3'UTR	NM_019644.3	NP_062618.2	Q92527	ANKR7_HUMAN	ankyrin repeat domain 7	247					male gonad development (GO:0008584)	nucleus (GO:0005634)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)	29						CACTGCGAGCCATGGAAAGAA	0.338																																					p.H247N		Atlas-SNP	.											.	ANKRD7	44	.	0			c.C739A						PASS	.						95.0	90.0	92.0					7																	117879989		1874	4112	5986	SO:0001583	missense	56311	exon6			GCGAGCCATGGAA	D78334	CCDS43638.1	7q31	2013-01-10			ENSG00000106013	ENSG00000106013		"""Ankyrin repeat domain containing"""	18588	protein-coding gene	gene with protein product	"""testis-specific ankyrin motif containing protein"""	610731				8812458	Standard	NM_019644		Approved	TSA806	uc003vji.3	Q92527	OTTHUMG00000156960	ENST00000265224.4:c.739C>A	chr7.hg19:g.117879989C>A	ENSP00000265224:p.His247Asn	88.0	0.0	.		221.0	31.0	.	NM_019644	B4DYF5|Q96QN1|Q9UDM3	Missense_Mutation	SNP	ENST00000265224.4	hg19	CCDS43638.1	.	.	.	.	.	.	.	.	.	.	C	8.240	0.806672	0.16467	.	.	ENSG00000106013	ENST00000357099;ENST00000265224;ENST00000433239	T;T;T	0.39787	1.07;1.18;1.06	3.96	-7.92	0.01160	.	7.917730	0.01487	U	0.016939	T	0.22551	0.0544	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.08722	-1.0708	10	0.42905	T	0.14	-2.3393	0.7429	0.00977	0.3457:0.1668:0.1118:0.3758	.	247	Q92527	ANKR7_HUMAN	N	267;247;194	ENSP00000349612:H267N;ENSP00000265224:H247N;ENSP00000388473:H194N	ENSP00000265224:H247N	H	+	1	0	ANKRD7	117667225	0.002000	0.14202	0.000000	0.03702	0.000000	0.00434	-0.364000	0.07583	-2.334000	0.00630	-2.920000	0.00090	CAT	.	.	.	none		0.338	ANKRD7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346826.1	NM_001077708	
PRKAG2	51422	hgsc.bcm.edu	37	7	151262972	151262972	+	Splice_Site	SNP	C	C	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr7:151262972C>T	ENST00000287878.4	-	12	1738		c.e12-1		PRKAG2_ENST00000492843.1_Splice_Site|PRKAG2_ENST00000433631.2_Splice_Site|PRKAG2_ENST00000418337.2_Splice_Site|PRKAG2_ENST00000392801.2_Splice_Site	NM_016203.3	NP_057287.2	Q9UGJ0	AAKG2_HUMAN	protein kinase, AMP-activated, gamma 2 non-catalytic subunit						ATP biosynthetic process (GO:0006754)|carnitine shuttle (GO:0006853)|cell cycle arrest (GO:0007050)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|glycogen metabolic process (GO:0005977)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase activity (GO:0045860)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of fatty acid metabolic process (GO:0019217)|regulation of fatty acid oxidation (GO:0046320)|regulation of glucose import (GO:0046324)|regulation of glycolytic process (GO:0006110)|small molecule metabolic process (GO:0044281)|sterol biosynthetic process (GO:0016126)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|ATP binding (GO:0005524)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|phosphorylase kinase regulator activity (GO:0008607)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|upper_aerodigestive_tract(1)	26	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)	Acetylsalicylic acid(DB00945)	TATCAGACATCTAAACGGAAG	0.418																																					.		Atlas-SNP	.											.	PRKAG2	86	.	0			c.1234-1G>A						PASS	.						168.0	137.0	147.0					7																	151262972		2203	4300	6503	SO:0001630	splice_region_variant	51422	exon13			AGACATCTAAACG	AF087875	CCDS5928.1, CCDS43683.1, CCDS47752.1	7q35-q36	2014-09-17			ENSG00000106617	ENSG00000106617			9386	protein-coding gene	gene with protein product	"""AMPK gamma2"""	602743				8557660, 8621499	Standard	NM_024429		Approved	AAKG, AAKG2, H91620p, WPWS, CMH6	uc003wkk.3	Q9UGJ0	OTTHUMG00000157324	ENST00000287878.4:c.1234-1G>A	chr7.hg19:g.151262972C>T		151.0	0.0	.		87.0	31.0	.	NM_016203	Q53Y07|Q6NUI0|Q75MP4|Q9NUZ9|Q9UDN8|Q9ULX8	Splice_Site	SNP	ENST00000287878.4	hg19	CCDS5928.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.459439	0.84317	.	.	ENSG00000106617	ENST00000418337;ENST00000287878;ENST00000492843;ENST00000433631;ENST00000392801	.	.	.	6.06	6.06	0.98353	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.609	0.95594	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PRKAG2	150893905	1.000000	0.71417	1.000000	0.80357	0.802000	0.45316	7.538000	0.82048	2.882000	0.98803	0.655000	0.94253	.	.	.	.	none		0.418	PRKAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348440.2	NM_016203	Intron
FAM84B	157638	hgsc.bcm.edu	37	8	127569250	127569250	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr8:127569250G>C	ENST00000304916.3	-	2	840	c.385C>G	c.(385-387)Cag>Gag	p.Q129E	RP11-89K10.1_ENST00000519880.1_RNA|RP11-89K10.1_ENST00000520512.1_RNA|RP11-103H7.5_ENST00000524320.1_RNA|FAM84B_ENST00000517458.1_5'Flank|RP11-89K10.1_ENST00000517773.1_RNA	NM_174911.4	NP_777571.1	Q96KN1	FA84B_HUMAN	family with sequence similarity 84, member B	129						cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	5	Ovarian(5;9.43e-05)|Esophageal squamous(12;0.0012)|Hepatocellular(40;0.128)|Myeloproliferative disorder(2;0.135)		STAD - Stomach adenocarcinoma(47;0.000556)|Colorectal(2;0.0102)|Lung(2;0.0136)|READ - Rectum adenocarcinoma(2;0.0723)			TGCGGGTACTGAGCCTGCGAC	0.637																																					p.Q129E		Atlas-SNP	.											.	FAM84B	19	.	0			c.C385G						PASS	.						27.0	29.0	29.0					8																	127569250		2202	4299	6501	SO:0001583	missense	157638	exon2			GGTACTGAGCCTG	AJ417849	CCDS6358.1	8q24.13	2006-02-09				ENSG00000168672			24166	protein-coding gene	gene with protein product	"""breast cancer membrane-associated protein 101"", ""neurological/sensory 2"""	609483				12477722	Standard	NM_174911		Approved	BCMP101, NSE2	uc003yrz.2	Q96KN1		ENST00000304916.3:c.385C>G	chr8.hg19:g.127569250G>C	ENSP00000302578:p.Gln129Glu	109.0	0.0	.		156.0	43.0	.	NM_174911		Missense_Mutation	SNP	ENST00000304916.3	hg19	CCDS6358.1	.	.	.	.	.	.	.	.	.	.	G	14.26	2.480872	0.44044	.	.	ENSG00000168672	ENST00000304916	T	0.03152	4.03	4.81	4.81	0.61882	.	0.057812	0.64402	D	0.000001	T	0.14270	0.0345	M	0.63428	1.95	0.51767	D	0.999933	D	0.71674	0.998	D	0.67725	0.953	T	0.06215	-1.0839	10	0.27785	T	0.31	-11.9573	16.8556	0.86005	0.0:0.0:1.0:0.0	.	129	Q96KN1	FA84B_HUMAN	E	129	ENSP00000302578:Q129E	ENSP00000302578:Q129E	Q	-	1	0	FAM84B	127638432	1.000000	0.71417	0.977000	0.42913	0.005000	0.04900	7.807000	0.86032	2.181000	0.69327	0.467000	0.42956	CAG	.	.	.	none		0.637	FAM84B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381487.1	NM_174911	
SPATA31E1	286234	hgsc.bcm.edu	37	9	90501484	90501484	+	Silent	SNP	C	C	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr9:90501484C>T	ENST00000325643.5	+	4	2148	c.2082C>T	c.(2080-2082)acC>acT	p.T694T		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	694					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											TGCAGAAGACCGGGTTCAGGA	0.612																																					p.T694T		Atlas-SNP	.											.	.	.	.	0			c.C2082T						PASS	.						54.0	69.0	64.0					9																	90501484		2203	4300	6503	SO:0001819	synonymous_variant	286234	exon4			GAAGACCGGGTTC	AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.2082C>T	chr9.hg19:g.90501484C>T		160.0	0.0	.		234.0	65.0	.	NM_178828	B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Silent	SNP	ENST00000325643.5	hg19	CCDS6676.1																																																																																			.	.	.	none		0.612	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052954.2	NM_178828	
NUP214	8021	hgsc.bcm.edu	37	9	134010301	134010301	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr9:134010301A>T	ENST00000359428.5	+	8	992	c.848A>T	c.(847-849)cAc>cTc	p.H283L	RP11-544A12.4_ENST00000587264.1_RNA|RP11-544A12.4_ENST00000587408.1_RNA|RP11-544A12.4_ENST00000589667.1_RNA|RP11-544A12.4_ENST00000586290.1_RNA|NUP214_ENST00000411637.2_Missense_Mutation_p.H283L|RP11-544A12.4_ENST00000589540.1_RNA|RP11-544A12.4_ENST00000415391.2_RNA|RP11-544A12.4_ENST00000588378.1_RNA|NUP214_ENST00000451030.1_Missense_Mutation_p.H283L|RP11-544A12.4_ENST00000590461.1_RNA			P35658	NU214_HUMAN	nucleoporin 214kDa	283	Seven-bladed beta propeller.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)			NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		GAAGAAAAGCACCCAGAGATA	0.378			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																p.H283L	Pancreas(4;24 48 25510 30394 32571)	Atlas-SNP	.		Dom	yes		9	9q34.1	8021	nucleoporin 214kDa (CAN)		L	.	NUP214	166	.	0			c.A848T						PASS	.						69.0	67.0	67.0					9																	134010301		2203	4300	6503	SO:0001583	missense	8021	exon8			AAAAGCACCCAGA	X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.848A>T	chr9.hg19:g.134010301A>T	ENSP00000352400:p.His283Leu	111.0	0.0	.		57.0	17.0	.	NM_005085	A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Missense_Mutation	SNP	ENST00000359428.5	hg19	CCDS6940.1	.	.	.	.	.	.	.	.	.	.	A	19.58	3.855209	0.71719	.	.	ENSG00000126883	ENST00000359428;ENST00000411637;ENST00000451030;ENST00000541375	D;D;D	0.93488	-3.23;-3.23;-3.23	5.69	3.32	0.38043	WD40/YVTN repeat-like-containing domain (1);	0.000000	0.43110	D	0.000603	T	0.80954	0.4723	N	0.08118	0	0.31118	N	0.709181	B;B	0.33022	0.202;0.394	B;B	0.32022	0.099;0.139	T	0.75227	-0.3392	10	0.23891	T	0.37	-11.0116	3.1676	0.06541	0.5712:0.2182:0.2105:0.0	.	283;283	P35658-4;P35658	.;NU214_HUMAN	L	283	ENSP00000352400:H283L;ENSP00000396576:H283L;ENSP00000405014:H283L	ENSP00000352400:H283L	H	+	2	0	NUP214	133000122	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.069000	0.50026	0.950000	0.37743	0.528000	0.53228	CAC	.	.	.	none		0.378	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000054694.2	NM_005085	
FAM45A	404636	hgsc.bcm.edu	37	10	120879873	120879873	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr10:120879873A>T	ENST00000361432.2	+	5	528	c.502A>T	c.(502-504)Atg>Ttg	p.M168L	FAM45A_ENST00000489988.1_3'UTR|FAM45A_ENST00000535029.1_Intron|FAM45A_ENST00000544016.1_Missense_Mutation_p.M17L	NM_207009.2	NP_996892.1	Q8TCE6	FA45A_HUMAN	family with sequence similarity 45, member A	168										breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	14		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0293)		TCAGTTTGGAATGGAAACTGT	0.343																																					p.M168L		Atlas-SNP	.											.	FAM45A	30	.	0			c.A502T						PASS	.						87.0	84.0	85.0					10																	120879873		2203	4300	6503	SO:0001583	missense	404636	exon5			TTTGGAATGGAAA	AF168713	CCDS7609.1	10q25	2008-09-04			ENSG00000119979	ENSG00000119979			31793	protein-coding gene	gene with protein product							Standard	NM_207009		Approved			Q8TCE6	OTTHUMG00000019143	ENST00000361432.2:c.502A>T	chr10.hg19:g.120879873A>T	ENSP00000354688:p.Met168Leu	121.0	0.0	.		137.0	42.0	.	NM_207009	B1AMV6|B4DDC3|D3DRC8|Q9NXW4	Missense_Mutation	SNP	ENST00000361432.2	hg19	CCDS7609.1	.	.	.	.	.	.	.	.	.	.	A	8.904	0.957092	0.18507	.	.	ENSG00000119979	ENST00000546291;ENST00000361432;ENST00000544016	.	.	.	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.51719	0.1691	L	0.42245	1.32	0.58432	D	0.999999	B;B;B;B	0.22414	0.051;0.069;0.01;0.051	B;B;B;B	0.24701	0.055;0.04;0.022;0.037	T	0.48625	-0.9019	9	0.02654	T	1	.	15.0195	0.71617	1.0:0.0:0.0:0.0	.	95;17;160;168	B4DNL9;B4DMU4;Q8TCE6-2;Q8TCE6	.;.;.;FA45A_HUMAN	L	168;168;17	.	ENSP00000354688:M168L	M	+	1	0	FAM45A	120869863	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.380000	0.90149	2.285000	0.76669	0.533000	0.62120	ATG	.	.	.	none		0.343	FAM45A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050623.1	NM_207009	
TRIM48	79097	hgsc.bcm.edu	37	11	55032729	55032729	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr11:55032729G>T	ENST00000417545.2	+	2	484	c.398G>T	c.(397-399)aGc>aTc	p.S133I		NM_024114.3	NP_077019.2	Q8IWZ4	TRI48_HUMAN	tripartite motif containing 48	117						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(13)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						CTGTGCTCCAGCTCTCAGGAG	0.507																																					p.S133I		Atlas-SNP	.											.	TRIM48	149	.	0			c.G398T						PASS	.						53.0	49.0	50.0					11																	55032729		2190	4261	6451	SO:0001583	missense	79097	exon2			GCTCCAGCTCTCA	AF521869	CCDS7947.2	11q12	2013-01-09	2011-01-25		ENSG00000150244	ENSG00000150244		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19021	protein-coding gene	gene with protein product			"""tripartite motif-containing 48"""				Standard	NM_024114		Approved	RNF101	uc010rid.2	Q8IWZ4	OTTHUMG00000157011	ENST00000417545.2:c.398G>T	chr11.hg19:g.55032729G>T	ENSP00000402414:p.Ser133Ile	54.0	0.0	.		16.0	8.0	.	NM_024114	Q9BUW4	Missense_Mutation	SNP	ENST00000417545.2	hg19	CCDS7947.2	.	.	.	.	.	.	.	.	.	.	g	7.071	0.568353	0.13560	.	.	ENSG00000150244	ENST00000417545	T	0.42900	0.96	0.596	-1.19	0.09585	Zinc finger, B-box (3);	.	.	.	.	T	0.36524	0.0970	N	0.20610	0.595	0.09310	N	1	P	0.49961	0.93	P	0.57009	0.811	T	0.23797	-1.0178	9	0.62326	D	0.03	.	4.2471	0.10677	0.7213:0.0:0.2787:0.0	.	117	Q8IWZ4	TRI48_HUMAN	I	133	ENSP00000402414:S133I	ENSP00000402414:S133I	S	+	2	0	TRIM48	54789305	0.000000	0.05858	0.045000	0.18777	0.232000	0.25224	-0.139000	0.10358	-0.425000	0.07371	-0.506000	0.04501	AGC	.	.	.	none		0.507	TRIM48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347088.1		
COX8A	1351	hgsc.bcm.edu	37	11	63743765	63743765	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr11:63743765C>G	ENST00000314133.3	+	2	257	c.183C>G	c.(181-183)caC>caG	p.H61Q	AP000721.4_ENST00000535431.1_Intron	NM_004074.2	NP_004065.1	P10176	COX8A_HUMAN	cytochrome c oxidase subunit VIIIA (ubiquitous)	61					cellular metabolic process (GO:0044237)|generation of precursor metabolites and energy (GO:0006091)|hydrogen ion transmembrane transport (GO:1902600)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	cytochrome-c oxidase activity (GO:0004129)										TCCTGTCACACCTGGAGACCT	0.587																																					p.H61Q		Atlas-SNP	.											.	COX8A	6	.	0			c.C183G						PASS	.						200.0	160.0	173.0					11																	63743765		2201	4297	6498	SO:0001583	missense	1351	exon2			GTCACACCTGGAG	J04823	CCDS8054.1	11q12-q13	2011-07-04	2010-04-27	2004-03-24	ENSG00000176340	ENSG00000176340	1.9.3.1	"""Mitochondrial respiratory chain complex / Complex IV"""	2294	protein-coding gene	gene with protein product		123870	"""cytochrome c oxidase subunit VIII"", ""cytochrome c oxidase subunit 8A (ubiquitous)"""	COX8		2543673, 2847943	Standard	NM_004074		Approved	COX8-2, COX8L, VIII-L, COX, VIII	uc001nye.3	P10176	OTTHUMG00000167785	ENST00000314133.3:c.183C>G	chr11.hg19:g.63743765C>G	ENSP00000321260:p.His61Gln	314.0	0.0	.		522.0	139.0	.	NM_004074	P15955	Missense_Mutation	SNP	ENST00000314133.3	hg19	CCDS8054.1	.	.	.	.	.	.	.	.	.	.	C	17.58	3.425954	0.62733	.	.	ENSG00000176340	ENST00000314133	.	.	.	5.75	3.88	0.44766	Cytochrome c oxidase subunit VIII/photosystem I reaction centre subunit IX (1);	0.064498	0.64402	D	0.000010	T	0.47002	0.1422	.	.	.	0.34757	D	0.732368	B	0.33940	0.433	B	0.37091	0.241	T	0.59337	-0.7473	8	0.87932	D	0	-8.3625	8.2466	0.31693	0.0:0.7603:0.1565:0.0832	.	61	P10176	COX8A_HUMAN	Q	61	.	ENSP00000321260:H61Q	H	+	3	2	COX8A	63500341	0.967000	0.33354	0.996000	0.52242	0.629000	0.37895	0.650000	0.24858	0.774000	0.33427	0.655000	0.94253	CAC	.	.	.	none		0.587	COX8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396273.1	NM_004074	
SCYL1	57410	hgsc.bcm.edu	37	11	65305494	65305494	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr11:65305494G>A	ENST00000270176.5	+	16	2165	c.2088G>A	c.(2086-2088)tgG>tgA	p.W696*	SCYL1_ENST00000524944.1_Nonsense_Mutation_p.W696*|SCYL1_ENST00000527009.1_Nonsense_Mutation_p.W553*|SCYL1_ENST00000420247.2_Nonsense_Mutation_p.W679*|SCYL1_ENST00000525364.1_Nonsense_Mutation_p.W695*|SCYL1_ENST00000533862.1_Missense_Mutation_p.G684E|SCYL1_ENST00000534462.1_3'UTR|SCYL1_ENST00000279270.6_Nonsense_Mutation_p.W696*	NM_020680.3	NP_065731.3	Q96KG9	NTKL_HUMAN	SCY1-like 1 (S. cerevisiae)	696					peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|transcription, DNA-templated (GO:0006351)	cis-Golgi network (GO:0005801)|COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|protein tyrosine kinase activity (GO:0004713)			ovary(1)|skin(1)	2						GGAGCAGCTGGGAAGCTGAGG	0.637																																					p.W696X		Atlas-SNP	.											.	SCYL1	76	.	0			c.G2088A						PASS	.						34.0	36.0	35.0					11																	65305494		1905	4127	6032	SO:0001587	stop_gained	57410	exon16			CAGCTGGGAAGCT	AF225424	CCDS41672.1, CCDS44646.1	11q11-q12	2008-07-21	2002-11-26	2002-11-29	ENSG00000142186	ENSG00000142186			14372	protein-coding gene	gene with protein product	"""teratoma-associated tyrosine kinase"", ""telomerase transcriptional elements-interacting factor"", ""telomerase regulation-associated protein"""	607982	"""N-terminal kinase-like"""	NTKL		11118629	Standard	NM_020680		Approved	HT019, P105, GKLP, NKTL, TAPK, TRAP, TEIF, MGC78454	uc001oea.1	Q96KG9	OTTHUMG00000166325	ENST00000270176.5:c.2088G>A	chr11.hg19:g.65305494G>A	ENSP00000270176:p.Trp696*	35.0	0.0	.		45.0	18.0	.	NM_020680	A6NJF1|Q96G50|Q96KG8|Q96KH1|Q9HAW5|Q9HBL3|Q9NR53	Nonsense_Mutation	SNP	ENST00000270176.5	hg19	CCDS41672.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.30|12.30	1.897578|1.897578	0.33535|0.33535	.|.	.|.	ENSG00000142186|ENSG00000142186	ENST00000533862|ENST00000270176;ENST00000525364;ENST00000420247;ENST00000279270;ENST00000524944;ENST00000527009;ENST00000528545	T|.	0.12774|.	2.65|.	4.3|4.3	4.3|4.3	0.51218|0.51218	.|.	.|0.000000	.|0.50627	.|D	.|0.000105	T|.	0.43612|.	0.1255|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	B|.	0.22746|.	0.074|.	B|.	0.20955|.	0.032|.	T|.	0.48375|.	-0.9041|.	7|.	0.05436|0.11485	T|T	0.98|0.65	.|.	12.6154|12.6154	0.56573|0.56573	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	684|.	Q96KG9-6|.	.|.	E|X	684|696;695;679;696;696;553;168	ENSP00000437254:G684E|.	ENSP00000437254:G684E|ENSP00000270176:W696X	G|W	+|+	2|3	0|0	SCYL1|SCYL1	65062070|65062070	1.000000|1.000000	0.71417|0.71417	0.987000|0.987000	0.45799|0.45799	0.319000|0.319000	0.28217|0.28217	6.160000|6.160000	0.71862|0.71862	2.126000|2.126000	0.65437|0.65437	0.561000|0.561000	0.74099|0.74099	GGG|TGG	.	.	.	none		0.637	SCYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389159.2	NM_020680	
IGSF9B	22997	hgsc.bcm.edu	37	11	133805658	133805658	+	Splice_Site	SNP	C	C	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr11:133805658C>T	ENST00000321016.8	-	7	1052		c.e7-1		IGSF9B_ENST00000533871.2_Splice_Site			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B						homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		CTTCAGGTCGCTGCAAAGCGG	0.617																																					.		Atlas-SNP	.											.	IGSF9B	290	.	0			c.822-1G>A						PASS	.						20.0	24.0	22.0					11																	133805658		2117	4221	6338	SO:0001630	splice_region_variant	22997	exon8			AGGTCGCTGCAAA	AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.822-1G>A	chr11.hg19:g.133805658C>T		63.0	0.0	.		60.0	32.0	.	NM_014987	G5EA26	Splice_Site	SNP	ENST00000321016.8	hg19		.	.	.	.	.	.	.	.	.	.	C	33	5.219946	0.95139	.	.	ENSG00000080854	ENST00000321016;ENST00000533871;ENST00000527648	.	.	.	5.18	5.18	0.71444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0502	0.93039	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	IGSF9B	133310868	1.000000	0.71417	0.166000	0.22797	0.790000	0.44656	5.713000	0.68415	2.560000	0.86352	0.561000	0.74099	.	.	.	.	none		0.617	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_290502	Intron
PPFIA2	8499	hgsc.bcm.edu	37	12	81661720	81661720	+	Silent	SNP	A	A	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr12:81661720A>G	ENST00000549396.1	-	29	3617	c.3457T>C	c.(3457-3459)Tta>Cta	p.L1153L	PPFIA2_ENST00000545296.2_Intron|PPFIA2_ENST00000407050.4_Silent_p.L1052L|PPFIA2_ENST00000541570.2_Silent_p.L689L|PPFIA2_ENST00000550359.2_Silent_p.L1000L|PPFIA2_ENST00000552948.1_Silent_p.L1132L|PPFIA2_ENST00000443686.3_Silent_p.L1048L|RP11-121G22.3_ENST00000549161.1_lincRNA|PPFIA2_ENST00000549325.1_Silent_p.L1138L|PPFIA2_ENST00000541017.1_Silent_p.L339L|PPFIA2_ENST00000548586.1_Silent_p.L1147L|PPFIA2_ENST00000550584.2_Silent_p.L1153L|PPFIA2_ENST00000333447.7_Silent_p.L1141L	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	1153	SAM 3. {ECO:0000255|PROSITE- ProRule:PRU00184}.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						ATCTGTAATAATAAAGCTAAG	0.363																																					p.L1153L		Atlas-SNP	.											.	PPFIA2	207	.	0			c.T3457C						PASS	.						68.0	66.0	67.0					12																	81661720		1846	4101	5947	SO:0001819	synonymous_variant	8499	exon28			GTAATAATAAAGC	AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.3457T>C	chr12.hg19:g.81661720A>G		33.0	0.0	.		32.0	8.0	.	NM_001220473	B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Silent	SNP	ENST00000549396.1	hg19	CCDS55857.1																																																																																			.	.	.	none		0.363	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408030.1		
ZNF10	7556	hgsc.bcm.edu	37	12	133732280	133732280	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr12:133732280G>C	ENST00000248211.6	+	5	670	c.448G>C	c.(448-450)Gtg>Ctg	p.V150L	ZNF10_ENST00000402932.2_Intron|ZNF268_ENST00000416488.1_Intron|CTD-2140B24.4_ENST00000540096.2_Intron|ZNF10_ENST00000426665.2_Missense_Mutation_p.V150L	NM_015394.4	NP_056209.2	P21506	ZNF10_HUMAN	zinc finger protein 10	150				Missing (in Ref. 1). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|prostate(1)|skin(5)|urinary_tract(1)	26	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;1.28e-06)|all_epithelial(31;0.0051)|Lung NSC(355;0.00948)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		TTTGAGGCAAGTGGCATTCAC	0.428																																					p.V150L		Atlas-SNP	.											.	ZNF10	58	.	0			c.G448C						PASS	.						110.0	106.0	107.0					12																	133732280		2203	4300	6503	SO:0001583	missense	7556	exon5			AGGCAAGTGGCAT	X52332, BC024182	CCDS9283.1	12q24.33	2013-01-08	2005-05-22		ENSG00000256223	ENSG00000256223		"""Zinc fingers, C2H2-type"", ""-"""	12879	protein-coding gene	gene with protein product		194538	"""zinc finger protein 10 (KOX 1)"""			7865130, 8262519	Standard	NM_015394		Approved	KOX1	uc001ulq.3	P21506	OTTHUMG00000167944	ENST00000248211.6:c.448G>C	chr12.hg19:g.133732280G>C	ENSP00000248211:p.Val150Leu	148.0	0.0	.		43.0	10.0	.	NM_015394	B2RBS1|Q8TC91	Missense_Mutation	SNP	ENST00000248211.6	hg19	CCDS9283.1	.	.	.	.	.	.	.	.	.	.	G	13.56	2.273178	0.40194	.	.	ENSG00000256223	ENST00000248211;ENST00000426665;ENST00000537119	T;T;T	0.05447	3.44;3.44;4.56	4.44	4.44	0.53790	.	0.698949	0.11773	N	0.530882	T	0.04137	0.0115	N	0.16708	0.43	0.80722	D	1	P	0.34662	0.462	B	0.31614	0.133	T	0.51252	-0.8729	9	.	.	.	.	8.5148	0.33239	0.1041:0.0:0.8959:0.0	.	150	P21506	ZNF10_HUMAN	L	150;150;108	ENSP00000248211:V150L;ENSP00000393814:V150L;ENSP00000437397:V108L	.	V	+	1	0	ZNF10	132242353	0.671000	0.27521	1.000000	0.80357	0.991000	0.79684	1.986000	0.40677	2.460000	0.83146	0.655000	0.94253	GTG	.	.	.	none		0.428	ZNF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397182.1	NM_015394	
IL17D	53342	hgsc.bcm.edu	37	13	21295994	21295994	+	Silent	SNP	C	C	T	rs372465901		TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr13:21295994C>T	ENST00000304920.3	+	3	618	c.510C>T	c.(508-510)gtC>gtT	p.V170V		NM_138284.1	NP_612141.1	Q8TAD2	IL17D_HUMAN	interleukin 17D	170					inflammatory response (GO:0006954)	extracellular space (GO:0005615)				endometrium(1)|skin(1)	2		all_cancers(29;9.63e-24)|all_epithelial(30;1.09e-19)|all_lung(29;2.38e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000301)|Epithelial(112;0.000633)|OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Lung(94;0.0154)|LUSC - Lung squamous cell carcinoma(192;0.0414)		GCACCTGCGTCCCCGAGCCGG	0.706																																					p.V170V		Atlas-SNP	.											.	IL17D	4	.	0			c.C510T						PASS	.						39.0	39.0	39.0					13																	21295994		2190	4279	6469	SO:0001819	synonymous_variant	53342	exon3			CTGCGTCCCCGAG	AY078238	CCDS9292.1	13q11	2008-07-18			ENSG00000172458	ENSG00000172458		"""Interleukins and interleukin receptors"""	5984	protein-coding gene	gene with protein product	"""interleukin 27"""	607587				12097364	Standard	NM_138284		Approved	IL-22, IL-27, IL-17D, IL27, FLJ30846	uc001unm.3	Q8TAD2	OTTHUMG00000016521	ENST00000304920.3:c.510C>T	chr13.hg19:g.21295994C>T		104.0	0.0	.		209.0	72.0	.	NM_138284	B1AM69	Silent	SNP	ENST00000304920.3	hg19	CCDS9292.1																																																																																			.	.	.	alt		0.706	IL17D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044087.1	NM_138284	
COQ6	51004	hgsc.bcm.edu	37	14	74416885	74416885	+	5'Flank	SNP	T	T	C			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr14:74416885T>C	ENST00000334571.2	+	0	0				FAM161B_ENST00000534936.1_5'Flank|COQ6_ENST00000554920.1_5'Flank|COQ6_ENST00000238709.4_Splice_Site|COQ6_ENST00000394026.4_Splice_Site|FAM161B_ENST00000286544.3_Missense_Mutation_p.T12A	NM_182476.2	NP_872282.1	Q9Y2Z9	COQ6_HUMAN	coenzyme Q6 monooxygenase						small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	cell projection (GO:0042995)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	16				BRCA - Breast invasive adenocarcinoma(234;0.00337)		GGAGGCAAGGTTCGTTTTCCG	0.612																																					p.T12A		Atlas-SNP	.											.	FAM161B	67	.	0			c.A34G						PASS	.																																			SO:0001631	upstream_gene_variant	145483	exon1			GCAAGGTTCGTTT	AF132944	CCDS9823.1, CCDS9824.1, CCDS9824.2	14q24.1	2013-05-01	2013-05-01		ENSG00000119723	ENSG00000119723			20233	protein-coding gene	gene with protein product		614647	"""coenzyme Q6 homolog (yeast)"", ""coenzyme Q6 homolog, monooxygenase (yeast)"", ""coenzyme Q6 homolog, monooxygenase (S. cerevisiae)"""			21540551	Standard	NM_182476		Approved	CGI-10	uc001xph.3	Q9Y2Z9	OTTHUMG00000171260		chr14.hg19:g.74416885T>C	Exception_encountered	21.0	0.0	.		22.0	11.0	.	NM_152445	B7Z3K8|Q53GG6|Q86U30|Q96CA1|Q96CK2	Missense_Mutation	SNP	ENST00000334571.2	hg19	CCDS9823.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.01|13.01	2.110742|2.110742	0.37242|0.37242	.|.	.|.	ENSG00000119723|ENSG00000156050	ENST00000394026|ENST00000286544	.|T	.|0.14022	.|2.54	5.36|5.36	-10.7|-10.7	0.00240|0.00240	.|.	.|.	.|.	.|.	.|.	.|T	.|0.04815	.|0.0130	N|N	0.08118|0.08118	0|0	0.24012|0.24012	N|N	0.996171|0.996171	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.43228	.|-0.9404	.|7	.|0.87932	.|D	.|0	.|.	3.1572|3.1572	0.06508|0.06508	0.104:0.3282:0.3155:0.2523|0.104:0.3282:0.3155:0.2523	.|.	.|.	.|.	.|.	.|A	-1|12	.|ENSP00000286544:T12A	.|ENSP00000286544:T12A	.|T	+|-	.|1	.|0	COQ6|FAM161B	73486638|73486638	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.004000|0.004000	0.04260|0.04260	-4.592000|-4.592000	0.00211|0.00211	-3.382000|-3.382000	0.00175|0.00175	-0.219000|-0.219000	0.12488|0.12488	.|ACC	.	.	.	none		0.612	COQ6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412616.1		
IGF1R	3480	hgsc.bcm.edu	37	15	99465632	99465632	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr15:99465632C>A	ENST00000268035.6	+	11	3068	c.2457C>A	c.(2455-2457)aaC>aaA	p.N819K	IGF1R_ENST00000558762.1_Missense_Mutation_p.N819K	NM_000875.3	NP_000866.1	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor	819	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|epidermis development (GO:0008544)|establishment of cell polarity (GO:0030010)|exocrine pancreas development (GO:0031017)|immune response (GO:0006955)|inactivation of MAPKK activity (GO:0051389)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|male sex determination (GO:0030238)|mammary gland development (GO:0030879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|peptidyl-tyrosine autophosphorylation (GO:0038083)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of DNA replication (GO:0045740)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|prostate gland epithelium morphogenesis (GO:0060740)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein tetramerization (GO:0051262)|regulation of JNK cascade (GO:0046328)|response to vitamin E (GO:0033197)|signal transduction (GO:0007165)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor-activated receptor activity (GO:0005010)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(13)|lung(20)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		"""""""Insulin(DB00071)|Insulin Glargine(DB00047)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	GCGCCTCCAACTTCGTCTTTG	0.517																																					p.N819K		Atlas-SNP	.											.	IGF1R	147	.	0			c.C2457A						PASS	.						105.0	102.0	103.0					15																	99465632		2197	4297	6494	SO:0001583	missense	3480	exon11			CTCCAACTTCGTC	M69229	CCDS10378.1, CCDS73785.1	15q26.3	2013-02-11			ENSG00000140443	ENSG00000140443		"""CD molecules"", ""Fibronectin type III domain containing"""	5465	protein-coding gene	gene with protein product		147370				1316909	Standard	XM_006720486		Approved	JTK13, CD221, IGFIR, MGC18216, IGFR	uc002bul.3	P08069	OTTHUMG00000149851	ENST00000268035.6:c.2457C>A	chr15.hg19:g.99465632C>A	ENSP00000268035:p.Asn819Lys	209.0	0.0	.		350.0	122.0	.	NM_000875	B1B5Y2|Q14CV2|Q9UCC0	Missense_Mutation	SNP	ENST00000268035.6	hg19	CCDS10378.1	.	.	.	.	.	.	.	.	.	.	C	14.97	2.695512	0.48202	.	.	ENSG00000140443	ENST00000268035	T	0.68624	-0.34	5.5	4.59	0.56863	Immunoglobulin-like fold (1);	0.086755	0.47455	N	0.000239	T	0.57169	0.2035	L	0.44542	1.39	0.50171	D	0.999854	B;B	0.33964	0.434;0.18	B;B	0.34489	0.184;0.109	T	0.58747	-0.7582	10	0.54805	T	0.06	.	9.3354	0.38047	0.1455:0.7829:0.0:0.0716	.	819;819	C9J5X1;P08069	.;IGF1R_HUMAN	K	819	ENSP00000268035:N819K	ENSP00000268035:N819K	N	+	3	2	IGF1R	97283155	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	1.087000	0.30865	1.319000	0.45190	-0.127000	0.14921	AAC	.	.	.	none		0.517	IGF1R-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313537.2	NM_000875	
MKL2	57496	hgsc.bcm.edu	37	16	14346228	14346228	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr16:14346228T>G	ENST00000341243.5	+	13	2539	c.2539T>G	c.(2539-2541)Tca>Gca	p.S847A	MKL2_ENST00000574045.1_Missense_Mutation_p.S808A|MKL2_ENST00000318282.5_Missense_Mutation_p.S808A|MKL2_ENST00000571589.1_Missense_Mutation_p.S858A			Q9ULH7	MKL2_HUMAN	MKL/myocardin-like 2	847					blood vessel morphogenesis (GO:0048514)|cardiac muscle tissue development (GO:0048738)|embryonic organ development (GO:0048568)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|muscle organ development (GO:0007517)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(6)|liver(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						ACAGCCTAGTTCACCCCCGCC	0.522																																					p.S808A		Atlas-SNP	.											.	MKL2	103	.	0			c.T2422G						PASS	.						111.0	107.0	108.0					16																	14346228		2197	4300	6497	SO:0001583	missense	57496	exon15			CCTAGTTCACCCC	AB033069	CCDS32391.1	16p13.12	2012-11-29			ENSG00000186260	ENSG00000186260			29819	protein-coding gene	gene with protein product		609463				10574462	Standard	NM_014048		Approved	MRTF-B, FLJ31823	uc002dcg.3	Q9ULH7	OTTHUMG00000177379	ENST00000341243.5:c.2539T>G	chr16.hg19:g.14346228T>G	ENSP00000345841:p.Ser847Ala	208.0	0.0	.		246.0	70.0	.	NM_014048	A6ND53|B4DGT8|Q68CT1|Q6UB16|Q86WW2|Q8N226	Missense_Mutation	SNP	ENST00000341243.5	hg19		.	.	.	.	.	.	.	.	.	.	T	15.37	2.812492	0.50527	.	.	ENSG00000186260	ENST00000318282;ENST00000341243	.	.	.	5.98	4.89	0.63831	.	0.443487	0.25106	N	0.033091	T	0.29882	0.0747	L	0.41710	1.295	0.20563	N	0.999886	B;B	0.19583	0.022;0.037	B;B	0.15052	0.005;0.012	T	0.19353	-1.0308	9	0.22706	T	0.39	-7.812	6.5315	0.22330	0.1376:0.0725:0.0:0.7899	.	858;808	B4DGT8;Q9ULH7-4	.;.	A	808;847	.	ENSP00000339086:S808A	S	+	1	0	MKL2	14253729	1.000000	0.71417	0.041000	0.18516	0.317000	0.28152	4.265000	0.58865	1.089000	0.41292	-0.250000	0.11733	TCA	.	.	.	none		0.522	MKL2-202	KNOWN	basic	protein_coding	protein_coding		NM_014048	
BFAR	51283	hgsc.bcm.edu	37	16	14755800	14755800	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr16:14755800C>G	ENST00000261658.2	+	6	1112	c.835C>G	c.(835-837)Ccc>Gcc	p.P279A	BFAR_ENST00000563971.1_Missense_Mutation_p.P154A|BFAR_ENST00000426842.2_Missense_Mutation_p.P151A	NM_016561.2	NP_057645.1	Q9NZS9	BFAR_HUMAN	bifunctional apoptosis regulator	279					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	structural molecule activity (GO:0005198)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)	11						CAAGAGCTCCCCCAGGCTGAG	0.567																																					p.P279A		Atlas-SNP	.											.	BFAR	38	.	0			c.C835G						PASS	.						222.0	192.0	202.0					16																	14755800		2197	4300	6497	SO:0001583	missense	51283	exon6			AGCTCCCCCAGGC	AF173003	CCDS10554.1	16p13.2	2013-01-10			ENSG00000103429	ENSG00000103429		"""RING-type (C3HC4) zinc fingers"", ""Sterile alpha motif (SAM) domain containing"""	17613	protein-coding gene	gene with protein product						10716992	Standard	NM_016561		Approved	BAR, RNF47	uc002dco.3	Q9NZS9	OTTHUMG00000129848	ENST00000261658.2:c.835C>G	chr16.hg19:g.14755800C>G	ENSP00000261658:p.Pro279Ala	325.0	0.0	.		478.0	175.0	.	NM_016561	A8K4Z9|B4DUT0|D3DUG8	Missense_Mutation	SNP	ENST00000261658.2	hg19	CCDS10554.1	.	.	.	.	.	.	.	.	.	.	C	18.00	3.524396	0.64747	.	.	ENSG00000103429	ENST00000261658;ENST00000426842	T;T	0.55760	2.85;0.5	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.62950	0.2470	L	0.27053	0.805	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.85130	0.991;0.997;0.996	T	0.67142	-0.5745	10	0.87932	D	0	.	18.1703	0.89743	0.0:1.0:0.0:0.0	.	151;279;279	B4DUT0;B2R9R6;Q9NZS9	.;.;BFAR_HUMAN	A	279;151	ENSP00000261658:P279A;ENSP00000400634:P151A	ENSP00000261658:P279A	P	+	1	0	BFAR	14663301	1.000000	0.71417	0.584000	0.28653	0.249000	0.25844	7.391000	0.79828	2.513000	0.84729	0.655000	0.94253	CCC	.	.	.	none		0.567	BFAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252088.1	NM_016561	
GPRC5B	51704	hgsc.bcm.edu	37	16	19884048	19884048	+	Silent	SNP	G	G	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr16:19884048G>A	ENST00000300571.2	-	2	311	c.120C>T	c.(118-120)gaC>gaT	p.D40D	GPRC5B_ENST00000537135.1_Silent_p.D66D|GPRC5B_ENST00000535671.1_Silent_p.D40D|GPRC5B_ENST00000569847.1_Silent_p.D40D|GPRC5B_ENST00000569479.1_Silent_p.D40D	NM_016235.1	NP_057319.1	Q9NZH0	GPC5B_HUMAN	G protein-coupled receptor, class C, group 5, member B	40					glucose homeostasis (GO:0042593)|locomotory behavior (GO:0007626)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein tyrosine kinase activity (GO:0061098)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25						GAGGGAGGAGGTCCAGCCCAC	0.637																																					p.D40D		Atlas-SNP	.											.	GPRC5B	54	.	0			c.C120T						PASS	.						50.0	51.0	51.0					16																	19884048		2197	4300	6497	SO:0001819	synonymous_variant	51704	exon2			GAGGAGGTCCAGC	AF202640	CCDS10581.1	16p12	2014-01-30	2014-01-30		ENSG00000167191	ENSG00000167191		"""GPCR / Class C : Orphans"""	13308	protein-coding gene	gene with protein product		605948	"""G protein-coupled receptor, family C, group 1, member B"", ""G protein-coupled receptor, family C, group 5, member B"""			10493829, 10783259	Standard	XM_005255357		Approved	RAIG-2	uc002dgt.3	Q9NZH0	OTTHUMG00000131460	ENST00000300571.2:c.120C>T	chr16.hg19:g.19884048G>A		115.0	0.0	.		207.0	82.0	.	NM_016235	D2DFB0|O75205|Q8NBZ8	Silent	SNP	ENST00000300571.2	hg19	CCDS10581.1																																																																																			.	.	.	none		0.637	GPRC5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254285.1		
BCL7C	9274	hgsc.bcm.edu	37	16	30899187	30899187	+	Silent	SNP	C	C	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr16:30899187C>T	ENST00000215115.4	-	6	1668	c.653G>A	c.(652-654)tGa>tAa	p.*218*	AC106782.20_ENST00000572471.1_RNA|MIR4519_ENST00000564901.1_RNA|MIR4519_ENST00000570025.1_RNA|BCL7C_ENST00000380317.4_Intron|MIR4519_ENST00000565573.1_RNA	NM_004765.2	NP_004756.2	Q8WUZ0	BCL7C_HUMAN	B-cell CLL/lymphoma 7C	0					apoptotic process (GO:0006915)			p.*218L(1)		large_intestine(1)|lung(3)|prostate(1)|skin(1)	6			Colorectal(24;0.198)			GCCGGCTTCTCAGGGGTCAGG	0.592																																					p.X218X		Atlas-SNP	.											.	BCL7C	30	.	1	Nonstop extension(1)	lung(1)	c.G653A						PASS	.						81.0	107.0	98.0					16																	30899187		2196	4300	6496	SO:0001819	synonymous_variant	9274	exon6			GCTTCTCAGGGGT	AJ223980	CCDS10693.1, CCDS67012.1	16p11	2012-11-19			ENSG00000099385	ENSG00000099385			1006	protein-coding gene	gene with protein product		605847				9931421	Standard	NM_004765		Approved		uc002dzv.3	Q8WUZ0	OTTHUMG00000177719	ENST00000215115.4:c.653G>A	chr16.hg19:g.30899187C>T		404.0	0.0	.		677.0	259.0	.	NM_004765	O43770|Q6PD89	Silent	SNP	ENST00000215115.4	hg19	CCDS10693.1																																																																																			.	.	.	none		0.592	BCL7C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255547.3	NM_004765	
ZNF423	23090	hgsc.bcm.edu	37	16	49671278	49671278	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr16:49671278G>T	ENST00000561648.1	-	4	1838	c.1785C>A	c.(1783-1785)caC>caA	p.H595Q	ZNF423_ENST00000563137.2_Missense_Mutation_p.H535Q|ZNF423_ENST00000535559.1_Missense_Mutation_p.H478Q|ZNF423_ENST00000562520.1_Missense_Mutation_p.H535Q|ZNF423_ENST00000562871.1_Missense_Mutation_p.H535Q|ZNF423_ENST00000262383.2_Missense_Mutation_p.H595Q|ZNF423_ENST00000567169.1_Missense_Mutation_p.H478Q	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	595					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				ACTTCTTGCTGTGGGCCAGTG	0.572																																					p.H595Q		Atlas-SNP	.											.	ZNF423	463	.	0			c.C1785A						PASS	.						127.0	100.0	109.0					16																	49671278		2198	4300	6498	SO:0001583	missense	23090	exon4			CTTGCTGTGGGCC	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.1785C>A	chr16.hg19:g.49671278G>T	ENSP00000455426:p.His595Gln	150.0	0.0	.		318.0	99.0	.	NM_015069	O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	ENST00000561648.1	hg19	CCDS32445.1	.	.	.	.	.	.	.	.	.	.	G	8.424	0.846973	0.17034	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.08634	3.07;3.14	4.78	2.8	0.32819	.	0.047718	0.85682	D	0.000000	T	0.05273	0.0140	N	0.24115	0.695	0.37616	D	0.921121	B	0.26120	0.142	B	0.24394	0.053	T	0.43702	-0.9375	9	.	.	.	.	8.2567	0.31760	0.2436:0.0:0.7564:0.0	.	595	Q2M1K9	ZN423_HUMAN	Q	595;478	ENSP00000262383:H595Q;ENSP00000442321:H478Q	.	H	-	3	2	ZNF423	48228779	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.823000	0.55715	0.439000	0.26476	0.561000	0.74099	CAC	.	.	.	none		0.572	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069	
BBS2	583	hgsc.bcm.edu	37	16	56531663	56531663	+	Silent	SNP	G	G	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr16:56531663G>A	ENST00000245157.5	-	14	2209	c.1789C>T	c.(1789-1791)Cta>Tta	p.L597L	BBS2_ENST00000568104.1_Intron	NM_031885.3	NP_114091	Q9BXC9	BBS2_HUMAN	Bardet-Biedl syndrome 2	597					adult behavior (GO:0030534)|artery smooth muscle contraction (GO:0014824)|brain morphogenesis (GO:0048854)|cartilage development (GO:0051216)|cerebral cortex development (GO:0021987)|cilium morphogenesis (GO:0060271)|fat cell differentiation (GO:0045444)|Golgi to plasma membrane protein transport (GO:0043001)|hippocampus development (GO:0021766)|melanosome transport (GO:0032402)|negative regulation of appetite by leptin-mediated signaling pathway (GO:0038108)|negative regulation of gene expression (GO:0010629)|negative regulation of multicellular organism growth (GO:0040015)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|positive regulation of multicellular organism growth (GO:0040018)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|sperm axoneme assembly (GO:0007288)|striatum development (GO:0021756)|vasodilation (GO:0042311)|visual perception (GO:0007601)	BBSome (GO:0034464)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|skin(3)	26						ACCTTAACTAGCACCTTTCGT	0.373									Bardet-Biedl syndrome																												p.L597L		Atlas-SNP	.											.	BBS2	67	.	0			c.C1789T						PASS	.						141.0	133.0	136.0					16																	56531663		2198	4300	6498	SO:0001819	synonymous_variant	583	exon14	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	TAACTAGCACCTT	AF342736	CCDS32451.1	16q21	2013-01-08				ENSG00000125124			967	protein-coding gene	gene with protein product		606151		BBS		11285252	Standard	NM_031885		Approved		uc002ejd.2	Q9BXC9		ENST00000245157.5:c.1789C>T	chr16.hg19:g.56531663G>A		282.0	0.0	.		75.0	31.0	.	NM_031885	Q96CM0|Q96SN9	Silent	SNP	ENST00000245157.5	hg19	CCDS32451.1																																																																																			.	.	.	none		0.373	BBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434386.2	NM_031885	
ZC3H18	124245	hgsc.bcm.edu	37	16	88653023	88653023	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr16:88653023G>T	ENST00000301011.5	+	3	819	c.619G>T	c.(619-621)Gaa>Taa	p.E207*	ZC3H18_ENST00000452588.2_Nonsense_Mutation_p.E207*	NM_144604.3	NP_653205.3	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18	207						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(9)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	42				BRCA - Breast invasive adenocarcinoma(80;0.0542)		TGACCTGGAAGAAGGTGAAGT	0.542																																					p.E207X	Ovarian(121;375 2276 20373 38669)	Atlas-SNP	.											.	ZC3H18	90	.	0			c.G619T						PASS	.						136.0	105.0	116.0					16																	88653023		2198	4300	6498	SO:0001587	stop_gained	124245	exon3			CTGGAAGAAGGTG	BC001584	CCDS10967.1, CCDS73924.1	16q24.2-q24.3	2012-07-05			ENSG00000158545	ENSG00000158545		"""Zinc fingers, CCCH-type domain containing"""	25091	protein-coding gene	gene with protein product						17579712	Standard	NM_144604		Approved	NHN1	uc002fky.3	Q86VM9	OTTHUMG00000137679	ENST00000301011.5:c.619G>T	chr16.hg19:g.88653023G>T	ENSP00000301011:p.Glu207*	93.0	0.0	.		166.0	40.0	.	NM_144604	Q96DG4|Q96MP7	Nonsense_Mutation	SNP	ENST00000301011.5	hg19	CCDS10967.1	.	.	.	.	.	.	.	.	.	.	G	41	8.860379	0.98980	.	.	ENSG00000158545	ENST00000301011;ENST00000289509;ENST00000452588;ENST00000545404	.	.	.	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-25.7045	18.3833	0.90457	0.0:0.0:1.0:0.0	.	.	.	.	X	207;207;207;90	.	ENSP00000289509:E207X	E	+	1	0	ZC3H18	87180524	1.000000	0.71417	0.978000	0.43139	0.763000	0.43281	9.161000	0.94739	2.350000	0.79820	0.462000	0.41574	GAA	.	.	.	none		0.542	ZC3H18-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000269168.1	NM_144604	
C17orf107	100130311	hgsc.bcm.edu	37	17	4800540	4800540	+	5'Flank	SNP	T	T	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr17:4800540T>G	ENST00000381365.3	+	0	0				C17orf107_ENST00000521575.1_5'Flank|MINK1_ENST00000453408.3_Silent_p.V1299V|MINK1_ENST00000355280.6_Silent_p.V1319V|MINK1_ENST00000347992.7_Silent_p.V1290V	NM_001145536.1	NP_001139008.1	Q6ZR85	CQ107_HUMAN	chromosome 17 open reading frame 107											endometrium(2)	2						GCAGCCAAGTTTACTTCATGA	0.612																																					p.V1319V		Atlas-SNP	.											.	MINK1	110	.	0			c.T3957G						PASS	.						71.0	73.0	72.0					17																	4800540		1933	4140	6073	SO:0001631	upstream_gene_variant	50488	exon32			CCAAGTTTACTTC	AK128415	CCDS45591.1	17p13.2	2009-09-30			ENSG00000205710	ENSG00000205710			37238	protein-coding gene	gene with protein product							Standard	NM_001145536		Approved		uc002fzl.3	Q6ZR85	OTTHUMG00000164838		chr17.hg19:g.4800540T>G	Exception_encountered	72.0	0.0	.		96.0	26.0	.	NM_153827		Silent	SNP	ENST00000381365.3	hg19	CCDS45591.1																																																																																			.	.	.	none		0.612	C17orf107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380556.1	NM_001145536	
YBX2	51087	hgsc.bcm.edu	37	17	7193332	7193332	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr17:7193332C>A	ENST00000007699.5	-	6	866	c.803G>T	c.(802-804)gGa>gTa	p.G268V	YBX2_ENST00000570627.1_5'Flank	NM_015982.3	NP_057066.2	Q9Y2T7	YBOX2_HUMAN	Y box binding protein 2	268	Pro-rich.|Required for mRNA-binding.				mRNA stabilization (GO:0048255)|negative regulation of binding (GO:0051100)|negative regulation of translation (GO:0017148)|oocyte development (GO:0048599)|regulation of transcription, DNA-templated (GO:0006355)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)|translational attenuation (GO:0009386)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|polysome (GO:0005844)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|lipid binding (GO:0008289)|mRNA 3'-UTR binding (GO:0003730)|ribonucleoprotein complex binding (GO:0043021)|translation regulator activity (GO:0045182)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|skin(3)	12						TCGCTCATCTCCCTGCTGTTG	0.632																																					p.G268V		Atlas-SNP	.											.	YBX2	28	.	0			c.G803T						PASS	.						52.0	55.0	54.0					17																	7193332		2203	4300	6503	SO:0001583	missense	51087	exon6			TCATCTCCCTGCT	AF096834	CCDS11098.1	17p13.1	2013-12-20			ENSG00000006047	ENSG00000006047			17948	protein-coding gene	gene with protein product		611447				10100484, 9780336	Standard	NM_015982		Approved	MSY2, CSDA3	uc002gfq.2	Q9Y2T7	OTTHUMG00000177992	ENST00000007699.5:c.803G>T	chr17.hg19:g.7193332C>A	ENSP00000007699:p.Gly268Val	151.0	0.0	.		274.0	112.0	.	NM_015982	D3DTP1|Q8N4P0	Missense_Mutation	SNP	ENST00000007699.5	hg19	CCDS11098.1	.	.	.	.	.	.	.	.	.	.	C	15.48	2.845908	0.51164	.	.	ENSG00000006047	ENST00000007699	T	0.29142	1.58	5.34	5.34	0.76211	.	0.251035	0.34750	N	0.003707	T	0.52370	0.1730	M	0.62723	1.935	0.53688	D	0.999978	D	0.89917	1.0	D	0.74023	0.982	T	0.52426	-0.8577	10	0.72032	D	0.01	-13.9828	14.9276	0.70890	0.0:1.0:0.0:0.0	.	268	Q9Y2T7	YBOX2_HUMAN	V	268	ENSP00000007699:G268V	ENSP00000007699:G268V	G	-	2	0	YBX2	7134056	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	2.987000	0.49378	2.689000	0.91719	0.462000	0.41574	GGA	.	.	.	none		0.632	YBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440172.2	NM_015982	
SPEM1	374768	hgsc.bcm.edu	37	17	7324267	7324267	+	Silent	SNP	C	C	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr17:7324267C>A	ENST00000323675.3	+	3	298	c.273C>A	c.(271-273)gtC>gtA	p.V91V	RP11-104H15.7_ENST00000575310.1_RNA	NM_199339.2	NP_955371.2	Q8N4L4	SPEM1_HUMAN	spermatid maturation 1	91					sperm individualization (GO:0007291)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	12		Prostate(122;0.173)				CTCCTGCAGTCCATCTTCGGT	0.597																																					p.V91V		Atlas-SNP	.											.	SPEM1	41	.	0			c.C273A						PASS	.						112.0	120.0	117.0					17																	7324267		2106	4203	6309	SO:0001819	synonymous_variant	374768	exon3			TGCAGTCCATCTT	AK097400	CCDS42254.1	17p13.1	2011-12-12	2008-02-04	2008-02-04	ENSG00000181323	ENSG00000181323			32429	protein-coding gene	gene with protein product		615116	"""chromosome 17 open reading frame 83"""	C17orf83		17426145, 20558241, 21184802	Standard	NM_199339		Approved	FLJ40081	uc002ggv.3	Q8N4L4		ENST00000323675.3:c.273C>A	chr17.hg19:g.7324267C>A		176.0	0.0	.		335.0	133.0	.	NM_199339		Silent	SNP	ENST00000323675.3	hg19	CCDS42254.1																																																																																			.	.	.	none		0.597	SPEM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440932.1	NM_199339	
NCOR1	9611	hgsc.bcm.edu	37	17	15964734	15964734	+	Silent	SNP	A	A	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr17:15964734A>G	ENST00000268712.3	-	37	6119	c.5862T>C	c.(5860-5862)agT>agC	p.S1954S	NCOR1_ENST00000395851.1_Intron|NCOR1_ENST00000395857.3_Silent_p.S538S	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	1954	Interaction with C1D. {ECO:0000250}.|Poly-Ser.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		AAGAGTCTGAACTTTGAGAGC	0.428																																					p.S1954S		Atlas-SNP	.											.	NCOR1	240	.	0			c.T5862C						PASS	.						219.0	200.0	206.0					17																	15964734		2203	4300	6503	SO:0001819	synonymous_variant	9611	exon37			GTCTGAACTTTGA	AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.5862T>C	chr17.hg19:g.15964734A>G		367.0	0.0	.		325.0	87.0	.	NM_006311	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Silent	SNP	ENST00000268712.3	hg19	CCDS11175.1																																																																																			.	.	.	none		0.428	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131751.5	NM_006311	
PLEKHH3	79990	hgsc.bcm.edu	37	17	40821477	40821477	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr17:40821477C>A	ENST00000591022.1	-	12	2563	c.2176G>T	c.(2176-2178)Gag>Tag	p.E726*	PLEKHH3_ENST00000456950.2_5'UTR|PLEKHH3_ENST00000293349.6_Nonsense_Mutation_p.E723*|PLEKHH3_ENST00000412503.1_Nonsense_Mutation_p.E549*	NM_024927.4	NP_079203	Q7Z736	PKHH3_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 3	726	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				signal transduction (GO:0007165)	cytoskeleton (GO:0005856)|extracellular space (GO:0005615)				endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(2)|skin(2)	13		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.14)		AGCTGGCTCTCTCCCACCCTC	0.622																																					p.E726X		Atlas-SNP	.											.	PLEKHH3	49	.	0			c.G2176T						PASS	.						20.0	23.0	22.0					17																	40821477		2202	4300	6502	SO:0001587	stop_gained	79990	exon12			GGCTCTCTCCCAC	BC052978	CCDS11434.1	17q21.2	2013-01-11				ENSG00000068137		"""Pleckstrin homology (PH) domain containing"""	26105	protein-coding gene	gene with protein product						12477932	Standard	NM_024927		Approved	FLJ21019	uc002iau.3	Q7Z736		ENST00000591022.1:c.2176G>T	chr17.hg19:g.40821477C>A	ENSP00000468678:p.Glu726*	68.0	0.0	.		114.0	48.0	.	NM_024927	C9JQ76|Q59H20|Q96B28|Q9H7D6|Q9NT18	Nonsense_Mutation	SNP	ENST00000591022.1	hg19	CCDS11434.1	.	.	.	.	.	.	.	.	.	.	C	41	8.827108	0.98968	.	.	ENSG00000068137	ENST00000293349;ENST00000412503	.	.	.	4.43	4.43	0.53597	.	0.336296	0.21518	N	0.073272	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	-10.0927	16.1774	0.81862	0.0:1.0:0.0:0.0	.	.	.	.	X	726;549	.	ENSP00000293349:E726X	E	-	1	0	PLEKHH3	38075003	0.999000	0.42202	0.997000	0.53966	0.955000	0.61496	3.927000	0.56499	2.465000	0.83290	0.655000	0.94253	GAG	.	.	.	none		0.622	PLEKHH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452332.1	NM_024927	
TIMM44	10469	hgsc.bcm.edu	37	19	8002997	8002997	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr19:8002997T>A	ENST00000270538.3	-	3	495	c.227A>T	c.(226-228)gAa>gTa	p.E76V		NM_006351.3	NP_006342.2	O43615	TIM44_HUMAN	translocase of inner mitochondrial membrane 44 homolog (yeast)	76					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|P-P-bond-hydrolysis-driven protein transmembrane transporter activity (GO:0015450)			NS(1)|endometrium(3)|kidney(3)|large_intestine(2)|liver(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	17						TTCTTTCATTTCTTTGTTTTT	0.393																																					p.E76V		Atlas-SNP	.											.	TIMM44	47	.	0			c.A227T						PASS	.						194.0	192.0	193.0					19																	8002997		2203	4300	6503	SO:0001583	missense	10469	exon3			TTCATTTCTTTGT	AF026030	CCDS12192.1	19p13.3-p13.2	2008-07-04				ENSG00000104980			17316	protein-coding gene	gene with protein product		605058				10848612, 10339406	Standard	NM_006351		Approved	TIM44	uc002miz.3	O43615		ENST00000270538.3:c.227A>T	chr19.hg19:g.8002997T>A	ENSP00000270538:p.Glu76Val	319.0	0.0	.		485.0	164.0	.	NM_006351	A8K0R9|D6W664|Q8N193	Missense_Mutation	SNP	ENST00000270538.3	hg19	CCDS12192.1	.	.	.	.	.	.	.	.	.	.	T	25.4	4.629496	0.87660	.	.	ENSG00000104980	ENST00000270538	D	0.87491	-2.26	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	D	0.93625	0.7964	M	0.85777	2.775	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.94461	0.7676	10	0.87932	D	0	-30.5113	13.3329	0.60500	0.0:0.0:0.0:1.0	.	76	O43615	TIM44_HUMAN	V	76	ENSP00000270538:E76V	ENSP00000270538:E76V	E	-	2	0	TIMM44	7908997	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.452000	0.80683	2.047000	0.60756	0.528000	0.53228	GAA	.	.	.	none		0.393	TIMM44-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461596.3		
OR7E24	26648	hgsc.bcm.edu	37	19	9362275	9362275	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr19:9362275T>G	ENST00000456448.1	+	1	670	c.556T>G	c.(556-558)Tgc>Ggc	p.C186G		NM_001079935.1	NP_001073404.1	Q6IFN5	O7E24_HUMAN	olfactory receptor, family 7, subfamily E, member 24	186						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)	16						ACAGCTCACCTGCTTCAAGGA	0.403																																					p.C186G		Atlas-SNP	.											.	OR7E24	48	.	0			c.T556G						PASS	.						96.0	100.0	99.0					19																	9362275		2015	4185	6200	SO:0001583	missense	26648	exon1			CTCACCTGCTTCA	Y10529	CCDS45955.1	19p13.2	2012-08-09	2004-03-04	2004-03-05		ENSG00000237521		"""GPCR / Class A : Olfactory receptors"""	8396	protein-coding gene	gene with protein product			"""olfactory receptor, family 7, subfamily E, member 24 pseudogene"""	OR7E24P		9268701	Standard	NM_001079935		Approved	OR19-8, HSHT2, OR7E24Q	uc002mlb.1	Q6IFN5		ENST00000456448.1:c.556T>G	chr19.hg19:g.9362275T>G	ENSP00000387523:p.Cys186Gly	107.0	0.0	.		47.0	12.0	.	NM_001079935	B9EJD9|Q9UPJ1	Missense_Mutation	SNP	ENST00000456448.1	hg19	CCDS45955.1	.	.	.	.	.	.	.	.	.	.	t	10.40	1.340959	0.24339	.	.	ENSG00000237521	ENST00000456448	T	0.00224	8.51	2.21	-0.132	0.13489	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00241	0.0007	L	0.53249	1.67	0.09310	N	1	D	0.52996	0.957	P	0.50490	0.642	T	0.48614	-0.9020	9	0.87932	D	0	.	6.5019	0.22174	0.0:0.4011:0.0:0.5989	.	186	Q6IFN5	O7E24_HUMAN	G	186	ENSP00000387523:C186G	ENSP00000387523:C186G	C	+	1	0	OR7E24	9223275	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	1.214000	0.32419	-0.264000	0.09365	-0.483000	0.04790	TGC	.	.	.	none		0.403	OR7E24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449006.1		
UPF1	5976	hgsc.bcm.edu	37	19	18963808	18963808	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr19:18963808A>G	ENST00000599848.1	+	7	1194	c.985A>G	c.(985-987)Atc>Gtc	p.I329V	UPF1_ENST00000262803.5_Missense_Mutation_p.I329V			Q92900	RENT1_HUMAN	UPF1 regulator of nonsense transcripts homolog (yeast)	329	Sufficient for interaction with RENT2.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|dosage compensation by inactivation of X chromosome (GO:0009048)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40						TCAAGATAACATCACTGTCAG	0.537																																					p.I329V		Atlas-SNP	.											.	UPF1	88	.	0			c.A985G						PASS	.						131.0	115.0	120.0					19																	18963808		2203	4300	6503	SO:0001583	missense	5976	exon7			GATAACATCACTG	AF074016	CCDS12386.1, CCDS74315.1	19p13.2-p13.11	2012-02-29	2006-02-07	2006-02-07	ENSG00000005007	ENSG00000005007			9962	protein-coding gene	gene with protein product	"""UP Frameshift 1"", ""smg-2 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	601430	"""regulator of nonsense transcripts 1"""	RENT1		8855285, 9064659	Standard	XM_005260015		Approved	HUPF1, KIAA0221, NORF1, pNORF1, smg-2	uc002nkf.3	Q92900		ENST00000599848.1:c.985A>G	chr19.hg19:g.18963808A>G	ENSP00000470142:p.Ile329Val	231.0	0.0	.		287.0	92.0	.	NM_002911	O00239|O43343|Q86Z25|Q92842	Missense_Mutation	SNP	ENST00000599848.1	hg19		.	.	.	.	.	.	.	.	.	.	A	11.03	1.518996	0.27211	.	.	ENSG00000005007	ENST00000262803	D	0.88975	-2.45	4.16	4.16	0.48862	.	0.052684	0.64402	D	0.000001	T	0.79052	0.4381	N	0.16903	0.455	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.12156	0.003;0.007	T	0.72077	-0.4399	10	0.18276	T	0.48	-35.3027	12.395	0.55380	1.0:0.0:0.0:0.0	.	329;329	Q92900;Q92900-2	RENT1_HUMAN;.	V	329	ENSP00000262803:I329V	ENSP00000262803:I329V	I	+	1	0	UPF1	18824808	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.925000	0.92832	1.534000	0.49203	0.438000	0.28831	ATC	.	.	.	none		0.537	UPF1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000464684.1	NM_002911	
HSD17B14	51171	hgsc.bcm.edu	37	19	49316535	49316535	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr19:49316535A>C	ENST00000263278.4	-	9	976	c.710T>G	c.(709-711)tTc>tGc	p.F237C	BCAT2_ENST00000597011.1_5'Flank|BCAT2_ENST00000402551.1_5'Flank|BCAT2_ENST00000598162.1_5'Flank|BCAT2_ENST00000545387.2_5'Flank|BCAT2_ENST00000316273.6_5'Flank|BCAT2_ENST00000601496.1_5'Flank|HSD17B14_ENST00000599157.1_Missense_Mutation_p.F213C|BCAT2_ENST00000599246.1_5'Flank	NM_016246.2	NP_057330.2	Q9BPX1	DHB14_HUMAN	hydroxysteroid (17-beta) dehydrogenase 14	237					steroid catabolic process (GO:0006706)	cytosol (GO:0005829)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|testosterone 17-beta-dehydrogenase (NADP+) activity (GO:0047045)			large_intestine(3)|lung(1)|skin(1)	5		all_epithelial(76;7e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000341)|all cancers(93;0.000764)|GBM - Glioblastoma multiforme(486;0.0233)|Epithelial(262;0.0346)		GCCCGTGCAGAAGTTGGCTTC	0.677																																					p.F237C		Atlas-SNP	.											.	HSD17B14	25	.	0			c.T710G						PASS	.						24.0	22.0	23.0					19																	49316535		2201	4294	6495	SO:0001583	missense	51171	exon9			GTGCAGAAGTTGG	AF126781	CCDS12736.1	19q13.33	2011-09-14	2006-11-22	2006-11-22		ENSG00000087076		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	23238	protein-coding gene	gene with protein product	"""retinal short-chain dehydrogenase/reductase 3"", ""short chain dehydrogenase/reductase family 47C, member 1"""	612832	"""dehydrogenase/reductase (SDR family) member 10"""	DHRS10		10800688, 17067289, 19027726	Standard	XM_005258969		Approved	retSDR3, SDR47C1	uc002pkv.1	Q9BPX1		ENST00000263278.4:c.710T>G	chr19.hg19:g.49316535A>C	ENSP00000263278:p.Phe237Cys	18.0	0.0	.		46.0	22.0	.	NM_016246	Q9UKU3	Missense_Mutation	SNP	ENST00000263278.4	hg19	CCDS12736.1	.	.	.	.	.	.	.	.	.	.	A	14.03	2.414225	0.42817	.	.	ENSG00000087076	ENST00000263278	T	0.25250	1.81	4.54	4.54	0.55810	NAD(P)-binding domain (1);	0.056642	0.64402	D	0.000001	T	0.48732	0.1516	M	0.70787	2.145	0.48571	D	0.99967	D	0.89917	1.0	D	0.97110	1.0	T	0.51888	-0.8648	10	0.72032	D	0.01	.	12.4586	0.55718	1.0:0.0:0.0:0.0	.	237	Q9BPX1	DHB14_HUMAN	C	237	ENSP00000263278:F237C	ENSP00000263278:F237C	F	-	2	0	HSD17B14	54008347	1.000000	0.71417	0.995000	0.50966	0.070000	0.16714	4.249000	0.58766	1.991000	0.58162	0.379000	0.24179	TTC	.	.	.	none		0.677	HSD17B14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466212.1	NM_016246	
NKX2-4	644524	hgsc.bcm.edu	37	20	21376576	21376576	+	Silent	SNP	G	G	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr20:21376576G>T	ENST00000351817.4	-	2	1666	c.1038C>A	c.(1036-1038)gcC>gcA	p.A346A	RP11-227D2.3_ENST00000552439.1_RNA|RP11-227D2.3_ENST00000419666.2_RNA	NM_033176.1	NP_149416.1	Q9H2Z4	NKX24_HUMAN	NK2 homeobox 4	346					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			lung(2)|upper_aerodigestive_tract(1)	3						AGAGCAGGTTGGCGCCCAGGA	0.736																																					p.A346A		Atlas-SNP	.											.	NKX2-4	7	.	0			c.C1038A						PASS	.						18.0	19.0	18.0					20																	21376576		1266	2943	4209	SO:0001819	synonymous_variant	644524	exon2			CAGGTTGGCGCCC		CCDS42855.1	20p11.22	2012-03-09	2007-07-09	2002-10-04	ENSG00000125816	ENSG00000125816		"""Homeoboxes / ANTP class : NKL subclass"""	7837	protein-coding gene	gene with protein product		607808	"""NK-2 (Drosophila) homolog D"", ""NK2 transcription factor related, locus 4 (Drosophila)"""	NKX2D		1346742, 10818213	Standard	NM_033176		Approved	NKX2.4	uc010gcz.3	Q9H2Z4	OTTHUMG00000032022	ENST00000351817.4:c.1038C>A	chr20.hg19:g.21376576G>T		63.0	0.0	.		105.0	30.0	.	NM_033176	Q5VZV8	Silent	SNP	ENST00000351817.4	hg19	CCDS42855.1																																																																																			.	.	.	none		0.736	NKX2-4-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078270.2		
ACTR5	79913	hgsc.bcm.edu	37	20	37400319	37400319	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr20:37400319G>C	ENST00000243903.4	+	9	1721	c.1684G>C	c.(1684-1686)Gga>Cga	p.G562R		NM_024855.3	NP_079131.3	Q9H9F9	ARP5_HUMAN	ARP5 actin-related protein 5 homolog (yeast)	562					DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|UV-damage excision repair (GO:0070914)	cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)				kidney(2)|large_intestine(2)|liver(1)|lung(5)|skin(2)	12		Myeloproliferative disorder(115;0.00878)				AGAAAAGGGAGGAGAGTACCT	0.557																																					p.G562R		Atlas-SNP	.											.	ACTR5	44	.	0			c.G1684C						PASS	.						108.0	88.0	94.0					20																	37400319		2203	4300	6503	SO:0001583	missense	79913	exon9			AAGGGAGGAGAGT	AK022847	CCDS13308.1	20q12	2011-07-06	2001-11-28		ENSG00000101442	ENSG00000101442		"""INO80 complex subunits"""	14671	protein-coding gene	gene with protein product	"""INO80 complex subunit M"""		"""ARP5 (actin-related protein 5, yeast) homolog"""			16230350	Standard	NM_024855		Approved	FLJ12785, Arp5, INO80M	uc002xjd.2	Q9H9F9	OTTHUMG00000032456	ENST00000243903.4:c.1684G>C	chr20.hg19:g.37400319G>C	ENSP00000243903:p.Gly562Arg	123.0	0.0	.		187.0	75.0	.	NM_024855	Q86WF7|Q8IUY5|Q8N724|Q9BRN0|Q9BVB7	Missense_Mutation	SNP	ENST00000243903.4	hg19	CCDS13308.1	.	.	.	.	.	.	.	.	.	.	G	32	5.160871	0.94727	.	.	ENSG00000101442	ENST00000243903	T	0.07688	3.17	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	T	0.31263	0.0791	M	0.66439	2.03	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.00166	-1.1966	10	0.87932	D	0	-21.9656	20.6086	0.99469	0.0:0.0:1.0:0.0	.	562	Q9H9F9	ARP5_HUMAN	R	562	ENSP00000243903:G562R	ENSP00000243903:G562R	G	+	1	0	ACTR5	36833733	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.960000	0.93117	2.880000	0.98712	0.655000	0.94253	GGA	.	.	.	none		0.557	ACTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079205.2	NM_024855	
ZNFX1	57169	hgsc.bcm.edu	37	20	47864026	47864027	+	Missense_Mutation	DNP	GT	GT	AG			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G|T	G|T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr20:47864026_47864027GT>AG	ENST00000396105.1	-	14	5780_5781	c.5534_5535AC>CT	c.(5533-5535)cAC>cCT	p.H1845P	ZNFX1_ENST00000371754.4_Intron|ZNFX1_ENST00000371752.1_Missense_Mutation_p.H1845P|ZNFX1_ENST00000469991.1_5'Flank	NM_021035.2	NP_066363.1	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	1845							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(8)|kidney(7)|large_intestine(15)|liver(1)|lung(17)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	60			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			ACTTGAACCAGTGACCACGAGG	0.545																																					p.H1845H|p.H1845P		Atlas-SNP	.											.	ZNFX1	194	.	0			c.C5535T|c.A5534C						PASS	.																																			SO:0001583	missense	57169	exon14			GAACCAGTGACCA|AACCAGTGACCAC	AK022641	CCDS13417.1	20q13.13	2014-02-12			ENSG00000124201	ENSG00000124201			29271	protein-coding gene	gene with protein product						10718198	Standard	NM_021035		Approved	KIAA1404, FLJ11277	uc002xui.3	Q9P2E3	OTTHUMG00000032696	ENST00000396105.1:c.5534_5535delinsAG	chr20.hg19:g.47864026_47864027delinsAG	ENSP00000379412:p.His1845Pro	142.0	0.0	.		225.0|229.0	81.0|85.0	.	NM_021035	Q9BQM7|Q9BQM8|Q9H8C1|Q9H9S2|Q9NUM1|Q9NWW1	Silent|Missense_Mutation	SNP	ENST00000396105.1	hg19	CCDS13417.1																																																																																			.	.	.	none		0.545	ZNFX1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079647.2	NM_021035	
ZRSR2	8233	hgsc.bcm.edu	37	X	15841260	15841260	+	Silent	SNP	C	C	G			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chrX:15841260C>G	ENST00000307771.7	+	11	1368	c.1344C>G	c.(1342-1344)cgC>cgG	p.R448R		NM_005089.3	NP_005080.1	Q15696	U2AFM_HUMAN	zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2	448	Arg/Ser-rich (RS domain).				mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)	U12-type spliceosomal complex (GO:0005689)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|pre-mRNA 3'-splice site binding (GO:0030628)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(38)|kidney(1)|large_intestine(2)|ovary(2)	48	Hepatocellular(33;0.183)					gccggagccgCAGGAGCCGCC	0.647			"""F, S, Mis"""		"""MDS, CLL"""																																p.R448R	NSCLC(197;1631 3042 5741 31152)	Atlas-SNP	.		Rec	yes		X	Xp22.1	8233	"""zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2"""		L	.	ZRSR2	78	.	0			c.C1344G						PASS	.						7.0	9.0	9.0					X																	15841260		1924	3790	5714	SO:0001819	synonymous_variant	8233	exon11			GAGCCGCAGGAGC	BC050451	CCDS14172.1	Xp22.1	2014-09-17	2006-09-26	2006-09-26	ENSG00000169249	ENSG00000169249		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	23019	protein-coding gene	gene with protein product		300028	"""U2(RNU2) small nuclear RNA auxiliary factor 1-like 2"", ""U2 small nuclear RNA auxiliary factor 1-like 2"""	U2AF1L2		8586425, 9237760, 15146077	Standard	NM_005089		Approved	U2AF1-RS2, URP	uc004cxg.4	Q15696	OTTHUMG00000021184	ENST00000307771.7:c.1344C>G	chrX.hg19:g.15841260C>G		31.0	0.0	.		50.0	5.0	.	NM_005089	Q14D69	Silent	SNP	ENST00000307771.7	hg19	CCDS14172.1																																																																																			.	.	.	none		0.647	ZRSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055889.1	NM_005089	
SHROOM4	57477	hgsc.bcm.edu	37	X	50350751	50350751	+	Missense_Mutation	SNP	G	G	C	rs201290098		TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chrX:50350751G>C	ENST00000289292.7	-	6	3674	c.3391C>G	c.(3391-3393)Cag>Gag	p.Q1131E	SHROOM4_ENST00000376020.2_Missense_Mutation_p.Q1131E|SHROOM4_ENST00000460112.3_Missense_Mutation_p.Q1015E			Q9ULL8	SHRM4_HUMAN	shroom family member 4	1131	Gln-rich.			KQQ -> QQQQKQQE (in Ref. 1; BAA86516 and 3; AAI51241). {ECO:0000305}.	actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					tcctcctcctgttgcttctgc	0.582																																					p.Q1131E		Atlas-SNP	.											.	SHROOM4	171	.	0			c.C3391G						PASS	.						15.0	14.0	15.0					X																	50350751		2199	4294	6493	SO:0001583	missense	57477	exon6			CCTCCTGTTGCTT	AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.3391C>G	chrX.hg19:g.50350751G>C	ENSP00000289292:p.Gln1131Glu	55.0	0.0	.		101.0	5.0	.	NM_020717	A7E2X9|D6RFW0|Q96LA0	Missense_Mutation	SNP	ENST00000289292.7	hg19	CCDS35277.1	.	.	.	.	.	.	.	.	.	.	G	0.015	-1.554911	0.00918	.	.	ENSG00000158352	ENST00000289292;ENST00000376020;ENST00000460112	T;T;T	0.06449	3.3;3.3;3.3	4.89	-0.0454	0.13851	.	1.383290	0.04423	N	0.367895	T	0.03827	0.0108	N	0.24115	0.695	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.36456	-0.9747	10	0.02654	T	1	.	4.0399	0.09746	0.093:0.4322:0.3193:0.1556	.	1131	Q9ULL8	SHRM4_HUMAN	E	1131;1131;1015	ENSP00000289292:Q1131E;ENSP00000365188:Q1131E;ENSP00000421450:Q1015E	ENSP00000289292:Q1131E	Q	-	1	0	SHROOM4	50367491	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	0.374000	0.20501	-0.047000	0.13423	-0.434000	0.05882	CAG	.	.	.	weak		0.582	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056564.4	NM_020717	
MT-ATP6	4508	hgsc.bcm.edu	37	M	9010	9010	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chrM:9010G>A	ENST00000361899.2	+	1	484	c.484G>A	c.(484-486)Gct>Act	p.A162T	MT-TR_ENST00000387439.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-ND4_ENST00000361381.2_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-TS1_ENST00000387416.2_RNA			P00846	ATP6_HUMAN	mitochondrially encoded ATP synthase 6	162					ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|proton-transporting ATP synthase complex, coupling factor F(o) (GO:0045263)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)			breast(2)|endometrium(7)|kidney(8)|prostate(1)	18						TACGCCTAACCGCTAACATTA	0.468																																					p.A162T		Atlas-SNP	.											.	.	.	.	0			c.G484A						PASS	.																																			SO:0001583	missense	0	exon1			CTAACCGCTAACA			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198899	ENSG00000198899		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	7414	protein-coding gene	gene with protein product		516060	"""ATP synthase 6"", ""spicular retinitis pigmentosa with dementia, seizures, ataxia, proximal muscle weakness and sensory deficit"""	MTATP6, RP		7219534	Standard			Approved	ATP6, ATPase-6, Su6m		P00846		ENST00000361899.2:c.484G>A	chrM.hg19:g.9010G>A	ENSP00000354632:p.Ala162Thr	13.0	0.0	.		44.0	42.0	.	ENST00000361899	Q34772|Q5S8W5|Q5S9E7|Q5S9I6|Q5SA31|Q6RPB7|Q6VHC0|Q6VHE0|Q6WQF4|Q7YCC1|Q7YCF8|Q7YCG1|Q85KU8|Q85KX1|Q85L05|Q8HNQ4|Q8HNQ8|Q8WCX6|Q9B2U5|Q9B2Z2	Missense_Mutation	SNP	ENST00000361899.2	hg19																																																																																				.	.	.	none		0.468	MT-ATP6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024031	
SEC16A	9919	hgsc.bcm.edu	37	9	139369195	139369195	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr9:139369195delG	ENST00000371706.3	-	1	2372	c.2339delC	c.(2338-2340)cctfs	p.P780fs	SEC16A_ENST00000431893.2_Frame_Shift_Del_p.P780fs|SEC16A_ENST00000290037.6_Frame_Shift_Del_p.P780fs|SEC16A_ENST00000313050.7_Frame_Shift_Del_p.P958fs			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	780					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		GCTTCCAGCAGGGCTATTAGC	0.507																																					p.P958fs		Atlas-INDEL	.											.	SEC16A	249	.	0			c.2874delT						PASS	.						65.0	64.0	64.0					9																	139369195		1939	4138	6077	SO:0001589	frameshift_variant	9919	exon3			.	AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.2339delC	chr9.hg19:g.139369195delG	ENSP00000360771:p.Pro780fs	104.0	0.0	0		213.0	76.0	0.356808	NM_014866	A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Frame_Shift_Del	DEL	ENST00000371706.3	hg19																																																																																				.	.	.	none		0.507	SEC16A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000055077.1	XM_088459	
LCLAT1	253558	hgsc.bcm.edu	37	2	30863165	30863173	+	In_Frame_Del	DEL	GAAGAGAAA	GAAGAGAAA	-	rs200693287|rs150085223	byFrequency	TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	GAAGAGAAA	GAAGAGAAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr2:30863165_30863173delGAAGAGAAA	ENST00000309052.4	+	7	1134_1142	c.925_933delGAAGAGAAA	c.(925-933)gaagagaaadel	p.EEK309del	LCLAT1_ENST00000540623.1_In_Frame_Del_p.EEK271del|LCLAT1_ENST00000491680.2_3'UTR|LCLAT1_ENST00000379509.3_In_Frame_Del_p.EEK271del	NM_182551.3	NP_872357.2	Q6UWP7	LCLT1_HUMAN	lysocardiolipin acyltransferase 1	309					cardiolipin acyl-chain remodeling (GO:0035965)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|multicellular organismal development (GO:0007275)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)	19						CAAACGGTGGGAAGAGAAAGAAGAGAGGC	0.498																																					p.308_311del		Atlas-INDEL	.											.	LCLAT1	51	.	0			c.924_932del						PASS	.																																			SO:0001651	inframe_deletion	253558	exon7			.	AK095284	CCDS1772.1, CCDS42670.1	2p23.1	2008-12-15	2008-12-15	2008-12-15	ENSG00000172954	ENSG00000172954			26756	protein-coding gene	gene with protein product		614241	"""lysocardiolipin acyltransferase"""	LYCAT		18931347, 15152008, 16620771, 17675553	Standard	NM_001002257		Approved	FLJ37965, ALCAT1, AGPAT8	uc002rnl.3	Q6UWP7	OTTHUMG00000099349	ENST00000309052.4:c.925_933delGAAGAGAAA	chr2.hg19:g.30863165_30863173delGAAGAGAAA	ENSP00000310551:p.Glu309_Lys311del	220.0	0.0	0		186.0	23.0	0.123656	NM_182551	A6H8Z7|Q8N1Q7	In_Frame_Del	DEL	ENST00000309052.4	hg19	CCDS1772.1																																																																																			.	.	.	none		0.498	LCLAT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000216780.1	NM_182551	
LRRC4C	57689	hgsc.bcm.edu	37	11	40136626	40136630	+	Frame_Shift_Del	DEL	AGCAC	AGCAC	-			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	AGCAC	AGCAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr11:40136626_40136630delAGCAC	ENST00000278198.2	-	2	3176_3180	c.1213_1217delGTGCT	c.(1213-1218)gtgctcfs	p.VL405fs	LRRC4C_ENST00000528697.1_Frame_Shift_Del_p.VL405fs|LRRC4C_ENST00000530763.1_Frame_Shift_Del_p.VL405fs|LRRC4C_ENST00000527150.1_Frame_Shift_Del_p.VL405fs			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	405	Ig-like C2-type.				regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)				NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				ACCATCACTGAGCACAGCTATCCGC	0.454																																					p.405_406del		Atlas-INDEL	.											LRRC4C,NS,carcinoma,0,1	LRRC4C	190	.	0			c.1214_1218del						PASS	.																																			SO:0001589	frameshift_variant	57689	exon5			.	AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.1213_1217delGTGCT	chr11.hg19:g.40136626_40136630delAGCAC	ENSP00000278198:p.Val405fs	484.0	0.0	0		222.0	50.0	0.225225	NM_020929	A8K0T1|Q7L0N3	Frame_Shift_Del	DEL	ENST00000278198.2	hg19	CCDS31464.1																																																																																			.	.	.	none		0.454	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389499.1	NM_020929	
MAT2A	4144	hgsc.bcm.edu	37	2	85769094	85769097	+	Splice_Site	DEL	AAGT	AAGT	-			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	AAGT	AAGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr2:85769094_85769097delAAGT	ENST00000306434.3	+	5	671_672	c.548_549delAAGT	c.(547-549)caa>c	p.Q183fs	MAT2A_ENST00000490878.1_3'UTR|MAT2A_ENST00000409017.1_Splice_Site_p.Q120fs	NM_005911.5	NP_005902.1	P31153	METK2_HUMAN	methionine adenosyltransferase II, alpha	183					cellular nitrogen compound metabolic process (GO:0034641)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|methionine adenosyltransferase complex (GO:0048269)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methionine adenosyltransferase activity (GO:0004478)			breast(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	9					L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	TCTAAAACTCAAGTAAGTGATGAT	0.382																																					p.183_183del		Atlas-INDEL	.											.	MAT2A	23	.	0			c.547_549del						PASS	.																																			SO:0001630	splice_region_variant	4144	exon5			.		CCDS1977.1	2p11.2	2008-06-03			ENSG00000168906	ENSG00000168906			6904	protein-coding gene	gene with protein product		601468				1426236, 9703951	Standard	NM_005911		Approved	SAMS2, MATA2, MATII	uc002spr.3	P31153	OTTHUMG00000130174	ENST00000306434.3:c.549+1AAGT>-	chr2.hg19:g.85769098_85769101delAAGT		153.0	0.0	0		52.0	13.0	0.25	NM_005911	A8K511|B4DN45|D6W5L1|Q53SP5	In_Frame_Del	DEL	ENST00000306434.3	hg19	CCDS1977.1																																																																																			.	.	.	none		0.382	MAT2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252491.2	NM_005911	Frame_Shift_Del
CA6	765	hgsc.bcm.edu	37	1	9009376	9009376	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr1:9009376delA	ENST00000377443.2	+	2	138	c.134delA	c.(133-135)cagfs	p.Q45fs	CA6_ENST00000377436.3_Frame_Shift_Del_p.Q45fs|CA6_ENST00000377442.2_Intron|CA6_ENST00000480186.3_Frame_Shift_Del_p.Q45fs|CA6_ENST00000476083.1_Intron	NM_001215.3	NP_001206.2	P23280	CAH6_HUMAN	carbonic anhydrase VI	45					bicarbonate transport (GO:0015701)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|one-carbon metabolic process (GO:0006730)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|skin(5)	16	Ovarian(185;0.112)|all_lung(157;0.143)	all_epithelial(116;1.02e-19)|all_lung(118;3.6e-06)|Lung NSC(185;7.94e-06)|Renal(390;0.000147)|Breast(348;0.00123)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.9e-07)|COAD - Colon adenocarcinoma(227;8.28e-05)|Kidney(185;0.000268)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|STAD - Stomach adenocarcinoma(132;0.00184)|BRCA - Breast invasive adenocarcinoma(304;0.00192)|READ - Rectum adenocarcinoma(331;0.0649)	Mafenide(DB06795)|Zonisamide(DB00909)	TGTGGGGGCCAGAGACAGTCG	0.602																																					p.Q45fs		Atlas-INDEL	.											.	CA6	47	.	0			c.133delC						PASS	.						44.0	42.0	43.0					1																	9009376		2203	4300	6503	SO:0001589	frameshift_variant	765	exon2			.	M57892	CCDS30578.1, CCDS57970.1, CCDS57971.1	1p36.2	2008-02-05			ENSG00000131686	ENSG00000131686	4.2.1.1	"""Carbonic anhydrases"""	1380	protein-coding gene	gene with protein product		114780				9691177	Standard	NM_001215		Approved		uc031plc.1	P23280	OTTHUMG00000001763	ENST00000377443.2:c.134delA	chr1.hg19:g.9009376delA	ENSP00000366662:p.Gln45fs	80.0	0.0	0		153.0	59.0	0.385621	NM_001270500	E7EMQ1|Q5FBW3|Q5FC00|Q96QX8|Q9UF03	Frame_Shift_Del	DEL	ENST00000377443.2	hg19	CCDS30578.1																																																																																			.	.	.	none		0.602	CA6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000004911.1		
SLC16A13	201232	hgsc.bcm.edu	37	17	6942168	6942169	+	In_Frame_Ins	INS	-	-	ATA			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr17:6942168_6942169insATA	ENST00000308027.6	+	3	1349_1350	c.1041_1042insATA	c.(1042-1044)ata>ATAata	p.348_348I>II		NM_201566.2	NP_963860.1	Q7RTY0	MOT13_HUMAN	solute carrier family 16, member 13	348						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	10						TGTTGCAGATGATAGAGAGCAT	0.589																																					p.M347delinsMI		Atlas-INDEL	.											.	SLC16A13	28	.	0			c.1041_1042insATA						PASS	.																																			SO:0001652	inframe_insertion	201232	exon3			.	BN000145	CCDS11085.1	17p13.1	2013-07-18	2013-07-18		ENSG00000174327	ENSG00000174327		"""Solute carriers"""	31037	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 13"""		"""solute carrier family 16 (monocarboxylic acid transporters), member 13"""				Standard	NM_201566		Approved	MCT13	uc002geh.3	Q7RTY0	OTTHUMG00000102089	ENST00000308027.6:c.1042_1044dupATA	chr17.hg19:g.6942169_6942171dupATA	ENSP00000309751:p.Ile348dup	309.0	0.0	0		467.0	118.0	0.252677	NM_201566	A3KMG3|A5PKU5|Q2VP92	In_Frame_Ins	INS	ENST00000308027.6	hg19	CCDS11085.1																																																																																			.	.	.	none		0.589	SLC16A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219923.2		
C3orf17	25871	hgsc.bcm.edu	37	3	112736366	112736368	+	In_Frame_Del	DEL	CAT	CAT	-			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	CAT	CAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr3:112736366_112736368delCAT	ENST00000314400.5	-	2	379_381	c.188_190delATG	c.(187-192)gatgtg>gtg	p.D63del	RP11-572M11.4_ENST00000467342.1_RNA|RP11-572M11.4_ENST00000460707.1_RNA|C3orf17_ENST00000383675.2_In_Frame_Del_p.D63del|C3orf17_ENST00000393857.2_Intron|RP11-572M11.4_ENST00000470313.1_RNA|RP11-572M11.4_ENST00000496389.1_RNA	NM_015412.3	NP_056227.2	Q6NW34	CC017_HUMAN	chromosome 3 open reading frame 17	63					negative regulation of neuron differentiation (GO:0045665)|positive regulation of Notch signaling pathway (GO:0045747)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|kidney(2)|lung(6)|prostate(2)|skin(1)	13						GCACATAACACATCTGTTTCTGC	0.478																																					p.63_64del		Atlas-INDEL	.											.	C3orf17	37	.	0			c.189_191del						PASS	.																																			SO:0001651	inframe_deletion	25871	exon2			.	AL117573	CCDS33824.1	3q13.2	2009-11-06			ENSG00000163608	ENSG00000163608			24496	protein-coding gene	gene with protein product						12477932	Standard	NR_027794		Approved	DKFZP434F2021, NET17	uc003dzr.3	Q6NW34	OTTHUMG00000159286	ENST00000314400.5:c.188_190delATG	chr3.hg19:g.112736366_112736368delCAT	ENSP00000320251:p.Asp63del	162.0	0.0	0		86.0	23.0	0.267442	NM_015412	D3DN69|Q68DM6|Q9H7U0|Q9UFM4	In_Frame_Del	DEL	ENST00000314400.5	hg19	CCDS33824.1																																																																																			.	.	.	none		0.478	C3orf17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354405.3	NM_015412	
ITGA7	3679	hgsc.bcm.edu	37	12	56096870	56096870	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr12:56096870delT	ENST00000555728.1	-	2	327	c.299delA	c.(298-300)gagfs	p.E100fs	ITGA7_ENST00000347027.6_Frame_Shift_Del_p.E100fs|ITGA7_ENST00000257879.6_Frame_Shift_Del_p.E100fs|ITGA7_ENST00000257880.7_Frame_Shift_Del_p.E100fs|ITGA7_ENST00000394230.2_Frame_Shift_Del_p.E100fs|ITGA7_ENST00000452168.2_Intron|ITGA7_ENST00000394229.2_Frame_Shift_Del_p.E100fs|ITGA7_ENST00000553804.1_Frame_Shift_Del_p.E100fs			Q13683	ITA7_HUMAN	integrin, alpha 7	100					blood vessel morphogenesis (GO:0048514)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|regulation of cell shape (GO:0008360)|skeletal muscle tissue development (GO:0007519)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integrin alpha7-beta1 complex (GO:0034677)|muscle tendon junction (GO:0005927)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(16)|ovary(2)|prostate(2)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						GCAGTCAGTCTCCTCCAGGCT	0.642																																					p.E100fs		Atlas-INDEL	.											.	ITGA7	194	.	0			c.300delG						PASS	.						106.0	96.0	99.0					12																	56096870		2203	4300	6503	SO:0001589	frameshift_variant	3679	exon2			.		CCDS8888.1, CCDS44914.1, CCDS55832.1	12q13	2014-09-17				ENSG00000135424		"""Integrins"""	6143	protein-coding gene	gene with protein product		600536				7607681	Standard	NM_002206		Approved		uc001shh.3	Q13683		ENST00000555728.1:c.299delA	chr12.hg19:g.56096870delT	ENSP00000452387:p.Glu100fs	250.0	0.0	0		363.0	130.0	0.358127	NM_002206	B4E3U0|C9JMD3|C9JMZ6|O43197|Q86W93|Q9NY89|Q9UET0|Q9UEV2	Frame_Shift_Del	DEL	ENST00000555728.1	hg19																																																																																				.	.	.	none		0.642	ITGA7-014	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000410138.1	NM_002206	
PABPC4	8761	hgsc.bcm.edu	37	1	40038242	40038242	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr1:40038242delG	ENST00000372857.3	-	2	1002	c.210delC	c.(208-210)gacfs	p.D70fs	PABPC4_ENST00000372862.3_Frame_Shift_Del_p.D70fs|RP11-69E11.8_ENST00000415255.1_RNA|PABPC4_ENST00000529216.1_5'Flank|PABPC4_ENST00000372858.3_Frame_Shift_Del_p.D70fs|PABPC4_ENST00000372856.3_Frame_Shift_Del_p.D70fs	NM_003819.3	NP_003810.1	Q13310	PABP4_HUMAN	poly(A) binding protein, cytoplasmic 4 (inducible form)	70	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				blood coagulation (GO:0007596)|RNA catabolic process (GO:0006401)|RNA processing (GO:0006396)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(6)|prostate(1)|skin(3)	21	Lung NSC(20;1.55e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.89e-18)|Epithelial(16;6.17e-17)|all cancers(16;1.18e-15)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			AGTTCATGGTGTCCAAAGCCC	0.468																																					p.T71fs		Atlas-INDEL	.											.	PABPC4	56	.	0			c.211delA						PASS	.						83.0	77.0	79.0					1																	40038242		2203	4300	6503	SO:0001589	frameshift_variant	8761	exon2			.	U33818	CCDS438.1, CCDS44114.1, CCDS44115.1	1p34.2	2013-02-12	2001-11-28		ENSG00000090621	ENSG00000090621		"""RNA binding motif (RRM) containing"""	8557	protein-coding gene	gene with protein product		603407	"""poly(A)-binding protein, cytoplasmic 4 (inducible form)"""			10543404	Standard	NM_001135653		Approved	iPABP, APP-1	uc001cdl.2	Q13310	OTTHUMG00000009097	ENST00000372857.3:c.210delC	chr1.hg19:g.40038242delG	ENSP00000361948:p.Asp70fs	179.0	0.0	0		117.0	34.0	0.290598	NM_001135653	B1ANQ8|Q4VC03|Q6P0N3	Frame_Shift_Del	DEL	ENST00000372857.3	hg19	CCDS438.1																																																																																			.	.	.	none		0.468	PABPC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025220.1	NM_001135653	
FGF3	2248	hgsc.bcm.edu	37	11	69625463	69625464	+	Frame_Shift_Ins	INS	-	-	T			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr11:69625463_69625464insT	ENST00000334134.2	-	3	419_420	c.329_330insA	c.(328-330)cacfs	p.H110fs		NM_005247.2	NP_005238.1	P11487	FGF3_HUMAN	fibroblast growth factor 3	110					anatomical structure morphogenesis (GO:0009653)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of cardiac muscle tissue development (GO:0055026)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|otic vesicle formation (GO:0030916)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|post-anal tail morphogenesis (GO:0036342)|semicircular canal morphogenesis (GO:0048752)|signal transduction (GO:0007165)|thymus development (GO:0048538)	extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)	growth factor activity (GO:0008083)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|urinary_tract(1)	13			LUSC - Lung squamous cell carcinoma(11;5.05e-15)|STAD - Stomach adenocarcinoma(18;0.0278)			CGGCGCTGTAGTGCTCCTGCGG	0.639																																					p.H110fs		Atlas-INDEL	.											.	FGF3	27	.	0			c.330_331insA						PASS	.																																			SO:0001589	frameshift_variant	2248	exon3			.		CCDS8195.1	11q13	2010-06-25	2010-06-25		ENSG00000186895	ENSG00000186895			3681	protein-coding gene	gene with protein product	"""INT-2 proto-oncogene protein"", ""oncogene INT2"", ""V-INT2 murine mammary tumor virus integration site oncogene homolog"", ""murine mammary tumor virus integration site 2, mouse"""	164950	"""fibroblast growth factor 3 (murine mammary tumor virus integration site (v-int-2) oncogene homolog)"""	INT2			Standard	NM_005247		Approved	HBGF-3	uc001oph.3	P11487	OTTHUMG00000167888	ENST00000334134.2:c.330dupA	chr11.hg19:g.69625464_69625464dupT	ENSP00000334122:p.His110fs	132.0	0.0	0		174.0	54.0	0.310345	NM_005247	Q0VG69	Frame_Shift_Ins	INS	ENST00000334134.2	hg19	CCDS8195.1																																																																																			.	.	.	none		0.639	FGF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396835.1	NM_005247	
MZT2A	653784	hgsc.bcm.edu	37	2	132249519	132249520	+	Frame_Shift_Ins	INS	-	-	A			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr2:132249519_132249520insA	ENST00000309451.6	-	2	293_294	c.248_249insT	c.(247-249)cagfs	p.Q83fs	AC093838.4_ENST00000438378.2_RNA|MZT2A_ENST00000410036.2_5'UTR|MIR4784_ENST00000579560.1_RNA	NM_001085365.1	NP_001078834.1	Q6P582	MZT2A_HUMAN	mitotic spindle organizing protein 2A	83						centrosome (GO:0005813)|gamma-tubulin ring complex (GO:0008274)|spindle (GO:0005819)				breast(1)|lung(1)	2						TCGCTAGCCTCTGCCCGGCACA	0.703																																					p.Q83fs		Atlas-INDEL	.											.	MZT2A	6	.	0			c.249_250insT						PASS	.																																			SO:0001589	frameshift_variant	653784	exon2			.	BC018206	CCDS42758.1	2q21.1	2013-10-11	2010-07-22	2010-07-22	ENSG00000173272	ENSG00000173272			33187	protein-coding gene	gene with protein product	"""mitotic-spindle organizing protein associated with a ring of gamma-tubulin 2A"""	613449	"""family with sequence similarity 128, member A"""	FAM128A		20360068	Standard	NM_001085365		Approved	MOZART2A	uc002tsw.4	Q6P582	OTTHUMG00000153606	ENST00000309451.6:c.248_249insT	chr2.hg19:g.132249519_132249520insA	ENSP00000311500:p.Gln83fs	38.0	0.0	0		49.0	17.0	0.346939	NM_001085365	Q3SWV8|Q8WVB2	Frame_Shift_Ins	INS	ENST00000309451.6	hg19	CCDS42758.1																																																																																			.	.	.	none		0.703	MZT2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331811.2		
RAB11B	9230	hgsc.bcm.edu	37	19	8468330	8468331	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	CA	CA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr19:8468330_8468331delCA	ENST00000328024.6	+	5	763_764	c.545_546delCA	c.(544-546)gcafs	p.A182fs		NM_004218.3	NP_004209.2	Q15907	RB11B_HUMAN	RAB11B, member RAS oncogene family	182					cellular response to acidic pH (GO:0071468)|constitutive secretory pathway (GO:0045054)|establishment of protein localization to membrane (GO:0090150)|GTP catabolic process (GO:0006184)|insulin secretion involved in cellular response to glucose stimulus (GO:0035773)|melanosome transport (GO:0032402)|receptor recycling (GO:0001881)|regulated secretory pathway (GO:0045055)|regulation of anion transport (GO:0044070)|regulation of endocytic recycling (GO:2001135)|regulation of protein localization to cell surface (GO:2000008)|retrograde transport, endosome to plasma membrane (GO:1990126)|small GTPase mediated signal transduction (GO:0007264)|transferrin transport (GO:0033572)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|phagocytic vesicle (GO:0045335)|recycling endosome (GO:0055037)|recycling endosome membrane (GO:0055038)|synaptic vesicle (GO:0008021)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)			large_intestine(2)|lung(1)|ovary(1)	4						AAACAGATCGCAGACCGCGCTG	0.653																																					p.182_182del		Atlas-INDEL	.											.	RAB11B	15	.	0			c.544_545del						PASS	.																																			SO:0001589	frameshift_variant	9230	exon5			.	X79780	CCDS12201.1	19p13.2	2012-07-02			ENSG00000185236	ENSG00000185236		"""RAB, member RAS oncogene"""	9761	protein-coding gene	gene with protein product		604198				7811277	Standard	NM_004218		Approved	H-YPT3	uc002mju.4	Q15907		ENST00000328024.6:c.545_546delCA	chr19.hg19:g.8468330_8468331delCA	ENSP00000333547:p.Ala182fs	178.0	0.0	0		255.0	75.0	0.294118	NM_004218	A5YM50|B2R7I4|B4DMK0|D6W671|Q2YDT2|Q5U0I1|Q6FHR0|Q6FI42|Q8NI07	Frame_Shift_Del	DEL	ENST00000328024.6	hg19	CCDS12201.1																																																																																			.	.	.	none		0.653	RAB11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460343.2	NM_004218	
CEP250	11190	hgsc.bcm.edu	37	20	34091451	34091451	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr20:34091451delA	ENST00000397527.1	+	30	5974	c.5254delA	c.(5254-5256)aaafs	p.K1752fs	CEP250_ENST00000342580.4_Frame_Shift_Del_p.K1696fs	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	1752	Gln/Glu-rich.				centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			CCAGGAGCTCAAAGACCAGCT	0.577																																					p.L1751fs		Atlas-INDEL	.											.	CEP250	141	.	0			c.5253delC						PASS	.						81.0	80.0	80.0					20																	34091451		2203	4300	6503	SO:0001589	frameshift_variant	11190	exon30			.	AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.5254delA	chr20.hg19:g.34091451delA	ENSP00000380661:p.Lys1752fs	166.0	0.0	0		311.0	105.0	0.337621	NM_007186	E1P5Q3|O14812|O60588|Q9H450	Frame_Shift_Del	DEL	ENST00000397527.1	hg19	CCDS13255.1																																																																																			.	.	.	none		0.577	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078877.7	NM_007186	
KIAA1033	23325	hgsc.bcm.edu	37	12	105512257	105512259	+	In_Frame_Del	DEL	GTG	GTG	-			TCGA-B9-4116-01A-01D-1252-08	TCGA-B9-4116-10A-01D-1252-08	GTG	GTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	847c8d58-eb11-487b-bc85-d58a4d47fae7	21d19fa5-2fc4-4abc-8810-947be94de078	g.chr12:105512257_105512259delGTG	ENST00000332180.5	+	7	556_558	c.469_471delGTG	c.(469-471)gtgdel	p.V158del		NM_015275.1	NP_056090.1			KIAA1033											breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	41						GTGCTATGAAGTGGTGATGAACG	0.34																																					p.156_157del		Atlas-INDEL	.											.	KIAA1033	83	.	0			c.468_470del						PASS	.																																			SO:0001651	inframe_deletion	23325	exon7			.	AB028956	CCDS41826.1, CCDS73514.1	12q24.11	2014-05-09				ENSG00000136051			29174	protein-coding gene	gene with protein product		615748				20376207, 20498093, 21498477	Standard	XM_005268742		Approved	SWIP	uc001tld.3	Q2M389		ENST00000332180.5:c.469_471delGTG	chr12.hg19:g.105512260_105512262delGTG	ENSP00000328062:p.Val158del	194.0	0.0	0		36.0	11.0	0.305556	NM_015275		In_Frame_Del	DEL	ENST00000332180.5	hg19	CCDS41826.1																																																																																			.	.	.	none		0.340	KIAA1033-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406138.4	NM_015275	
