#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
OR2M7	391196	hgsc.bcm.edu	37	1	248487257	248487257	+	Missense_Mutation	SNP	A	A	C	rs144715512		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:248487257A>C	ENST00000317965.2	-	1	642	c.614T>G	c.(613-615)gTa>gGa	p.V205G		NM_001004691.1	NP_001004691.1	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M, member 7	205						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(6)|large_intestine(3)|lung(29)|skin(3)	42	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AACAAGCATTACTATACAGCA	0.433																																					p.V205G		Atlas-SNP	.											OR2M7,NS,carcinoma,0,1	OR2M7	84	.	0			c.T614G						PASS	.						287.0	275.0	279.0					1																	248487257		2203	4300	6503	SO:0001583	missense	391196	exon1			AGCATTACTATAC	BK004486	CCDS31111.1	1q44	2012-08-09			ENSG00000177186	ENSG00000177186		"""GPCR / Class A : Olfactory receptors"""	19594	protein-coding gene	gene with protein product							Standard	NM_001004691		Approved		uc010pzk.2	Q8NG81	OTTHUMG00000040461	ENST00000317965.2:c.614T>G	chr1.hg19:g.248487257A>C	ENSP00000324557:p.Val205Gly	299.0	1.0	.		50.0	2.0	.	NM_001004691	B2RNL0|Q6IEX6	Missense_Mutation	SNP	ENST00000317965.2	hg19	CCDS31111.1	.	.	.	.	.	.	.	.	.	.	A	8.086	0.773543	0.16051	.	.	ENSG00000177186	ENST00000317965	T	0.39229	1.09	1.55	0.00354	0.14055	GPCR, rhodopsin-like superfamily (1);	1.653810	0.04603	U	0.398866	T	0.34948	0.0915	L	0.45285	1.41	0.09310	N	1	B	0.15719	0.014	B	0.26770	0.073	T	0.43750	-0.9372	10	0.72032	D	0.01	.	2.386	0.04365	0.5781:0.0:0.1782:0.2437	.	205	Q8NG81	OR2M7_HUMAN	G	205	ENSP00000324557:V205G	ENSP00000324557:V205G	V	-	2	0	OR2M7	246553880	0.000000	0.05858	0.061000	0.19648	0.178000	0.23041	0.670000	0.25157	0.708000	0.31955	0.163000	0.16589	GTA	.	A|1.000;G|0.000	.	alt		0.433	OR2M7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097357.1	NM_001004691	
TMEM214	54867	hgsc.bcm.edu	37	2	27259433	27259433	+	Missense_Mutation	SNP	T	T	G	rs564964647		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr2:27259433T>G	ENST00000238788.9	+	6	861	c.799T>G	c.(799-801)Ttt>Gtt	p.F267V	TMEM214_ENST00000404032.3_Missense_Mutation_p.F222V	NM_017727.4	NP_060197.4	Q6NUQ4	TM214_HUMAN	transmembrane protein 214	267					apoptotic process (GO:0006915)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)	18						TCAAGCAGGTTTTGCCAACCT	0.567																																					p.F267V		Atlas-SNP	.											.	TMEM214	41	.	0			c.T799G						PASS	.						103.0	103.0	103.0					2																	27259433		1943	4141	6084	SO:0001583	missense	54867	exon6			GCAGGTTTTGCCA		CCDS42664.1, CCDS46242.1	2p23.3	2013-06-19			ENSG00000119777	ENSG00000119777			25983	protein-coding gene	gene with protein product						23661706	Standard	NM_001083590		Approved	FLJ20254	uc002ria.4	Q6NUQ4	OTTHUMG00000151999	ENST00000238788.9:c.799T>G	chr2.hg19:g.27259433T>G	ENSP00000238788:p.Phe267Val	124.0	0.0	.		611.0	177.0	.	NM_017727	A6NNF2|B3KUI9|B5MCD8|D6W547|Q53SW1|Q69YH4|Q8NC45|Q8WZ37|Q9NXH2	Missense_Mutation	SNP	ENST00000238788.9	hg19	CCDS42664.1	.	.	.	.	.	.	.	.	.	.	T	27.9	4.873746	0.91664	.	.	ENSG00000119777	ENST00000238788;ENST00000404032;ENST00000537397	T;T	0.52295	0.67;0.67	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.63861	0.2547	M	0.74258	2.255	0.80722	D	1	D;P	0.56746	0.977;0.917	P;P	0.57679	0.794;0.825	T	0.65417	-0.6173	10	0.42905	T	0.14	-14.1771	15.3509	0.74384	0.0:0.0:0.0:1.0	.	222;267	Q6NUQ4-2;Q6NUQ4	.;TM214_HUMAN	V	267;222;9	ENSP00000238788:F267V;ENSP00000384417:F222V	ENSP00000238788:F267V	F	+	1	0	TMEM214	27112937	1.000000	0.71417	0.436000	0.26797	0.968000	0.65278	7.508000	0.81686	2.128000	0.65567	0.459000	0.35465	TTT	.	.	.	none		0.567	TMEM214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324748.1	NM_017727	
CGREF1	10669	hgsc.bcm.edu	37	2	27327221	27327221	+	Missense_Mutation	SNP	G	G	T	rs112618911		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr2:27327221G>T	ENST00000260595.5	-	2	306	c.14C>A	c.(13-15)aCg>aAg	p.T5K	CGREF1_ENST00000452318.2_Intron|CGREF1_ENST00000405600.1_Missense_Mutation_p.T5K|CGREF1_ENST00000402394.1_Missense_Mutation_p.T5K|CGREF1_ENST00000312734.4_Missense_Mutation_p.T5K|CGREF1_ENST00000404694.3_Missense_Mutation_p.T127K|CGREF1_ENST00000402550.1_Missense_Mutation_p.T5K			Q99674	CGRE1_HUMAN	cell growth regulator with EF-hand domain 1	5					cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			kidney(1)|lung(4)|ovary(1)|prostate(2)|skin(1)|soft_tissue(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CACTGTCATCGTCAAAGGTAA	0.567																																					p.T5K		Atlas-SNP	.											.	CGREF1	31	.	0			c.C14A						PASS	.						67.0	59.0	62.0					2																	27327221		2203	4300	6503	SO:0001583	missense	10669	exon2			GTCATCGTCAAAG	BC034764	CCDS33162.1, CCDS33162.2, CCDS54339.1	2p23.3	2013-01-10			ENSG00000138028	ENSG00000138028		"""EF-hand domain containing"""	16962	protein-coding gene	gene with protein product		606137				8968090	Standard	NM_006569		Approved	CGR11	uc002riq.3	Q99674	OTTHUMG00000152009	ENST00000260595.5:c.14C>A	chr2.hg19:g.27327221G>T	ENSP00000260595:p.Thr5Lys	37.0	0.0	.		149.0	38.0	.	NM_001166239	A6NHV7|B4DXY8|B5MCB7|B5MCC9|B5MCP5|E7EU99|Q8N4B7	Missense_Mutation	SNP	ENST00000260595.5	hg19		.	.	.	.	.	.	.	.	.	.	A	13.14	2.147472	0.37923	.	.	ENSG00000138028	ENST00000402550;ENST00000402394;ENST00000405600;ENST00000389521;ENST00000312734;ENST00000404694;ENST00000260595	T;T;T;T;T	0.31247	1.5;1.5;1.5;1.5;1.5	4.73	-7.65	0.01281	.	1.833840	0.02770	N	0.119586	T	0.16300	0.0392	N	0.12182	0.205	0.09310	N	1	B;B;B	0.10296	0.002;0.002;0.003	B;B;B	0.06405	0.002;0.002;0.002	T	0.20638	-1.0269	10	0.44086	T	0.13	-10.5345	8.4971	0.33134	0.1308:0.0:0.5748:0.2945	.	127;5;5	B5MCC9;B5MCP5;Q99674	.;.;CGRE1_HUMAN	K	5;5;5;5;5;127;5	ENSP00000385452:T5K;ENSP00000386113:T5K;ENSP00000324025:T5K;ENSP00000385574:T127K;ENSP00000260595:T5K	ENSP00000260595:T5K	T	-	2	0	CGREF1	27180725	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.719000	0.04974	-2.518000	0.00499	-1.007000	0.02485	ACG	.	G|0.998;A|0.002	.	alt		0.567	CGREF1-201	KNOWN	basic	protein_coding	protein_coding		NM_006569	
CEBPZ	10153	hgsc.bcm.edu	37	2	37454852	37454852	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr2:37454852G>A	ENST00000234170.5	-	2	1629	c.1484C>T	c.(1483-1485)cCt>cTt	p.P495L		NM_005760.2	NP_005751.2	Q03701	CEBPZ_HUMAN	CCAAT/enhancer binding protein (C/EBP), zeta	495					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|endometrium(2)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28		all_hematologic(82;0.21)				CTGGGAATAAGGGTATGCCCT	0.368																																					p.P495L		Atlas-SNP	.											.	CEBPZ	68	.	0			c.C1484T						PASS	.						83.0	79.0	80.0					2																	37454852		2203	4300	6503	SO:0001583	missense	10153	exon2			GAATAAGGGTATG	M37197	CCDS1787.1	2p22.3	2008-09-03	2008-09-03		ENSG00000115816	ENSG00000115816			24218	protein-coding gene	gene with protein product		612828				2247079, 12534345	Standard	NM_005760		Approved	CBF2, CTF2	uc002rpz.3	Q03701	OTTHUMG00000100960	ENST00000234170.5:c.1484C>T	chr2.hg19:g.37454852G>A	ENSP00000234170:p.Pro495Leu	69.0	0.0	.		34.0	20.0	.	NM_005760	Q8NE75	Missense_Mutation	SNP	ENST00000234170.5	hg19	CCDS1787.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.952289	0.73787	.	.	ENSG00000115816	ENST00000234170;ENST00000545744	T	0.24538	1.85	5.59	5.59	0.84812	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.64494	0.2603	M	0.93898	3.47	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74247	-0.3727	10	0.87932	D	0	.	19.6055	0.95580	0.0:0.0:1.0:0.0	.	495	Q03701	CEBPZ_HUMAN	L	495	ENSP00000234170:P495L	ENSP00000234170:P495L	P	-	2	0	CEBPZ	37308356	1.000000	0.71417	1.000000	0.80357	0.726000	0.41606	9.296000	0.96104	2.631000	0.89168	0.650000	0.86243	CCT	.	.	.	none		0.368	CEBPZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218569.2	NM_005760	
GPR45	11250	hgsc.bcm.edu	37	2	105858582	105858582	+	Silent	SNP	C	C	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr2:105858582C>G	ENST00000258456.1	+	1	383	c.267C>G	c.(265-267)ccC>ccG	p.P89P		NM_007227.3	NP_009158.3	Q9Y5Y3	GPR45_HUMAN	G protein-coupled receptor 45	89						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	28						GCTGCATGCCCTTCACCGCCG	0.627																																					p.P89P		Atlas-SNP	.											.	GPR45	73	.	0			c.C267G						PASS	.						125.0	115.0	118.0					2																	105858582		2203	4300	6503	SO:0001819	synonymous_variant	11250	exon1			CATGCCCTTCACC	AF118266	CCDS2066.1	2q11.1-q12	2012-08-21			ENSG00000135973	ENSG00000135973		"""GPCR / Class A : Orphans"""	4503	protein-coding gene	gene with protein product		604838				10036181	Standard	NM_007227		Approved	PSP24, PSP24A	uc002tco.1	Q9Y5Y3	OTTHUMG00000130805	ENST00000258456.1:c.267C>G	chr2.hg19:g.105858582C>G		151.0	0.0	.		527.0	245.0	.	NM_007227	Q6NWS4|Q6NXU6	Silent	SNP	ENST00000258456.1	hg19	CCDS2066.1																																																																																			.	.	.	none		0.627	GPR45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253348.1	NM_007227	
TFCP2L1	29842	hgsc.bcm.edu	37	2	122042681	122042681	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr2:122042681A>T	ENST00000263707.5	-	1	102	c.5T>A	c.(4-6)cTc>cAc	p.L2H		NM_014553.2	NP_055368.1	Q9NZI6	TF2L1_HUMAN	transcription factor CP2-like 1	2	Mediate transcriptional repression.				cell morphogenesis (GO:0000902)|cytoplasm organization (GO:0007028)|determination of adult lifespan (GO:0008340)|epithelial cell maturation (GO:0002070)|female pregnancy (GO:0007565)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of growth (GO:0045927)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|salivary gland development (GO:0007431)|steroid biosynthetic process (GO:0006694)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			cervix(1)|endometrium(4)|large_intestine(5)|lung(7)|ovary(1)|pancreas(2)|skin(1)|stomach(1)	22	Renal(3;0.01)					GTGCCAGAAGAGCATGGCTGG	0.756																																					p.L2H		Atlas-SNP	.											.	TFCP2L1	54	.	0			c.T5A						PASS	.						17.0	16.0	16.0					2																	122042681		2192	4286	6478	SO:0001583	missense	29842	exon1			CAGAAGAGCATGG	AF198488	CCDS2134.1	2q14	2008-02-05			ENSG00000115112	ENSG00000115112			17925	protein-coding gene	gene with protein product		609785				10644752, 11073954	Standard	NM_014553		Approved	LBP-9, CRTR1	uc002tmx.3	Q9NZI6	OTTHUMG00000131443	ENST00000263707.5:c.5T>A	chr2.hg19:g.122042681A>T	ENSP00000263707:p.Leu2His	14.0	0.0	.		31.0	19.0	.	NM_014553	Q4ZG43	Missense_Mutation	SNP	ENST00000263707.5	hg19	CCDS2134.1	.	.	.	.	.	.	.	.	.	.	a	17.41	3.381885	0.61845	.	.	ENSG00000115112	ENST00000263707	T	0.26373	1.74	4.1	4.1	0.47936	.	0.097761	0.43747	U	0.000539	T	0.39835	0.1093	L	0.38175	1.15	0.58432	D	0.999999	D;D	0.89917	1.0;0.988	D;P	0.87578	0.998;0.832	T	0.29518	-1.0009	10	0.87932	D	0	.	12.7432	0.57266	1.0:0.0:0.0:0.0	.	2;2	Q5JV87;Q9NZI6	.;TF2L1_HUMAN	H	2	ENSP00000263707:L2H	ENSP00000263707:L2H	L	-	2	0	TFCP2L1	121759151	1.000000	0.71417	1.000000	0.80357	0.009000	0.06853	6.622000	0.74233	1.467000	0.48044	0.398000	0.26397	CTC	.	.	.	none		0.756	TFCP2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338539.1	NM_014553	
ALS2	57679	hgsc.bcm.edu	37	2	202626257	202626257	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr2:202626257G>A	ENST00000264276.6	-	4	832	c.460C>T	c.(460-462)Cag>Tag	p.Q154*	ALS2_ENST00000496244.1_5'UTR|ALS2_ENST00000467448.1_Nonsense_Mutation_p.Q154*	NM_020919.3	NP_065970.2	Q96Q42	ALS2_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	154					behavioral fear response (GO:0001662)|cell death (GO:0008219)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|locomotory behavior (GO:0007626)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Rab GTPase activity (GO:0032851)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of Ran GTPase activity (GO:0032853)|protein localization (GO:0008104)|receptor recycling (GO:0001881)|regulation of endosome size (GO:0051036)|response to oxidative stress (GO:0006979)|synaptic transmission, glutamatergic (GO:0035249)|vesicle organization (GO:0016050)	centrosome (GO:0005813)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome (GO:0005769)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|ruffle (GO:0001726)|vesicle (GO:0031982)	protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(22)|ovary(1)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	72						CACGCCAACTGTAAAATCCTG	0.522																																					p.Q154X		Atlas-SNP	.											.	ALS2	172	.	0			c.C460T						PASS	.						79.0	79.0	79.0					2																	202626257		2073	4196	6269	SO:0001587	stop_gained	57679	exon4			CCAACTGTAAAAT	AB053305	CCDS42800.1, CCDS46492.1	2q33-q35	2014-09-17	2004-06-23		ENSG00000003393	ENSG00000003393		"""Rho guanine nucleotide exchange factors"""	443	protein-coding gene	gene with protein product	"""alsin"""	606352	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 6"""	ALS2CR6		11586298	Standard	NM_020919		Approved		uc002uyo.3	Q96Q42	OTTHUMG00000154507	ENST00000264276.6:c.460C>T	chr2.hg19:g.202626257G>A	ENSP00000264276:p.Gln154*	50.0	0.0	.		121.0	55.0	.	NM_001135745	Q53TT1|Q53TV2|Q8N1E0|Q96PC4|Q96Q41|Q9H973|Q9HCK9	Nonsense_Mutation	SNP	ENST00000264276.6	hg19	CCDS42800.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.582281	0.86748	.	.	ENSG00000003393	ENST00000264276;ENST00000467448	.	.	.	6.17	6.17	0.99709	.	0.056382	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	.	.	.	X	154	.	ENSP00000264276:Q154X	Q	-	1	0	ALS2	202334502	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	5.405000	0.66351	2.941000	0.99782	0.655000	0.94253	CAG	.	.	.	none		0.522	ALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335562.3	NM_020919	
CIDEC	63924	hgsc.bcm.edu	37	3	9911862	9911862	+	Missense_Mutation	SNP	G	G	C	rs201802471|rs368273807		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr3:9911862G>C	ENST00000336832.2	-	4	491	c.352C>G	c.(352-354)Ccc>Gcc	p.P118A	CIDEC_ENST00000383817.1_Intron|CIDEC_ENST00000423850.1_Missense_Mutation_p.P44A|CIDEC_ENST00000455015.1_Missense_Mutation_p.P44A|CIDEC_ENST00000430427.1_Missense_Mutation_p.P128A|CIDEC_ENST00000443115.1_Intron	NM_001199552.1|NM_001199623.1|NM_022094.3	NP_001186481.1|NP_001186552.1|NP_071377.2	Q96AQ7	CIDEC_HUMAN	cell death-inducing DFFA-like effector c	118	CIDE-N. {ECO:0000255|PROSITE- ProRule:PRU00447}.				apoptotic process (GO:0006915)|execution phase of apoptosis (GO:0097194)|lipid particle organization (GO:0034389)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|lipid particle (GO:0005811)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|endometrium(1)|lung(2)|ovary(1)|skin(1)	8	Medulloblastoma(99;0.227)					TCTGATGGGGGCTGCCATTTC	0.542																																					p.P131A		Atlas-SNP	.											.,1	CIDEC	22	.	0			c.C391G						PASS	.						70.0	72.0	72.0					3																	9911862		2203	4300	6503	SO:0001583	missense	63924	exon4			ATGGGGGCTGCCA		CCDS2587.1, CCDS56239.1, CCDS74897.1	3p25	2004-07-26			ENSG00000187288	ENSG00000187288			24229	protein-coding gene	gene with protein product		612120				12429024	Standard	NM_001199623		Approved	CIDE-3, FLJ20871, Fsp27	uc021wsw.1	Q96AQ7	OTTHUMG00000128522	ENST00000336832.2:c.352C>G	chr3.hg19:g.9911862G>C	ENSP00000338642:p.Pro118Ala	114.0	0.0	.		367.0	90.0	.	NM_001199623	C9JMN7|Q67DW9|Q9GZY9	Missense_Mutation	SNP	ENST00000336832.2	hg19	CCDS2587.1	.	.	.	.	.	.	.	.	.	.	G	13.53	2.265024	0.40095	.	.	ENSG00000187288	ENST00000336832;ENST00000455015;ENST00000423850;ENST00000430427	T;T;T;T	0.47869	0.83;0.83;0.83;0.83	5.78	1.72	0.24424	Caspase-activated nuclease CIDE-N (2);	0.213000	0.49916	N	0.000130	T	0.47040	0.1424	M	0.71036	2.16	0.80722	D	1	B;B	0.33528	0.034;0.416	B;B	0.40506	0.026;0.331	T	0.33701	-0.9858	10	0.51188	T	0.08	-13.7547	5.8544	0.18712	0.2576:0.1378:0.6046:0.0	.	118;128	Q96AQ7;C9JMN7	CIDEC_HUMAN;.	A	118;44;44;128	ENSP00000338642:P118A;ENSP00000392975:P44A;ENSP00000400649:P44A;ENSP00000408631:P128A	ENSP00000338642:P118A	P	-	1	0	CIDEC	9886862	0.940000	0.31905	0.348000	0.25681	0.967000	0.64934	1.716000	0.37981	0.025000	0.15241	0.461000	0.40582	CCC	.	G|0.999;C|0.001	0.001	weak		0.542	CIDEC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250334.1	NM_022094	
DTX3L	151636	hgsc.bcm.edu	37	3	122283388	122283388	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr3:122283388G>T	ENST00000296161.4	+	1	304	c.115G>T	c.(115-117)Ggg>Tgg	p.G39W	DTX3L_ENST00000383661.3_Missense_Mutation_p.G39W|PARP9_ENST00000462315.1_5'Flank|PARP9_ENST00000360356.2_5'UTR|PARP9_ENST00000492382.1_5'Flank|PARP9_ENST00000471785.1_5'Flank|PARP9_ENST00000477522.2_5'UTR	NM_138287.3	NP_612144.1	Q8TDB6	DTX3L_HUMAN	deltex 3 like, E3 ubiquitin ligase	39					cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|histone monoubiquitination (GO:0010390)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(114;0.0459)		CTCGGGCGGCGGGGAGTGCAC	0.672																																					p.G39W		Atlas-SNP	.											.	DTX3L	59	.	0			c.G115T						PASS	.						48.0	57.0	54.0					3																	122283388		2203	4299	6502	SO:0001583	missense	151636	exon1			GGCGGCGGGGAGT		CCDS3015.1	3q21.1	2014-01-28	2014-01-28		ENSG00000163840	ENSG00000163840		"""RING-type (C3HC4) zinc fingers"""	30323	protein-coding gene	gene with protein product	"""rhysin 2"""	613143	"""deltex 3-like (Drosophila)"""			12670957, 22411408	Standard	NM_138287		Approved	BBAP	uc003efk.3	Q8TDB6	OTTHUMG00000159524	ENST00000296161.4:c.115G>T	chr3.hg19:g.122283388G>T	ENSP00000296161:p.Gly39Trp	115.0	0.0	.		365.0	62.0	.	NM_138287	B3KWH6|Q53ZZ3|Q5MJP7	Missense_Mutation	SNP	ENST00000296161.4	hg19	CCDS3015.1	.	.	.	.	.	.	.	.	.	.	G	16.54	3.152626	0.57259	.	.	ENSG00000163840	ENST00000296161;ENST00000383661	T;T	0.69040	0.13;-0.37	4.59	4.59	0.56863	.	0.000000	0.47455	D	0.000228	T	0.81749	0.4888	M	0.80982	2.52	0.37919	D	0.931622	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.86218	0.1629	10	0.87932	D	0	-25.6532	14.2431	0.65971	0.0:0.0:1.0:0.0	.	39;39	Q8TDB6-2;Q8TDB6	.;DTX3L_HUMAN	W	39	ENSP00000296161:G39W;ENSP00000373157:G39W	ENSP00000296161:G39W	G	+	1	0	DTX3L	123766078	1.000000	0.71417	1.000000	0.80357	0.039000	0.13416	5.884000	0.69729	2.342000	0.79632	0.655000	0.94253	GGG	.	.	.	none		0.672	DTX3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355966.1	NM_138287	
FAM43A	131583	hgsc.bcm.edu	37	3	194408136	194408136	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr3:194408136A>G	ENST00000329759.4	+	1	1515	c.581A>G	c.(580-582)aAc>aGc	p.N194S		NM_153690.4	NP_710157.2	Q8N2R8	FA43A_HUMAN	family with sequence similarity 43, member A	194										breast(2)|central_nervous_system(1)|lung(6)|skin(1)	10	all_cancers(143;2.04e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.147)	OV - Ovarian serous cystadenocarcinoma(49;8.37e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;1.78e-05)		ACGTCGGCCAACGCGCTGGCG	0.672																																					p.N194S		Atlas-SNP	.											.	FAM43A	24	.	0			c.A581G						PASS	.						5.0	4.0	4.0					3																	194408136		2020	3974	5994	SO:0001583	missense	131583	exon1			CGGCCAACGCGCT	AK074503	CCDS33923.1	3q29	2004-07-28			ENSG00000185112	ENSG00000185112			26888	protein-coding gene	gene with protein product						12477932	Standard	NM_153690		Approved	FLJ90022	uc003fuj.3	Q8N2R8	OTTHUMG00000156016	ENST00000329759.4:c.581A>G	chr3.hg19:g.194408136A>G	ENSP00000371397:p.Asn194Ser	0.0	0.0	.		24.0	5.0	.	NM_153690	A3KME2|Q8IXP4|Q8WZ07	Missense_Mutation	SNP	ENST00000329759.4	hg19	CCDS33923.1	.	.	.	.	.	.	.	.	.	.	A	8.875	0.950325	0.18431	.	.	ENSG00000185112	ENST00000329759	T	0.62364	0.03	5.07	3.85	0.44370	Pleckstrin homology-type (1);	0.222998	0.44688	D	0.000422	T	0.40119	0.1104	N	0.13098	0.295	0.31328	N	0.685214	B	0.33171	0.4	B	0.33960	0.173	T	0.40403	-0.9565	10	0.07644	T	0.81	-38.1095	12.0384	0.53438	0.8111:0.1889:0.0:0.0	.	194	Q8N2R8	FA43A_HUMAN	S	194	ENSP00000371397:N194S	ENSP00000371397:N194S	N	+	2	0	FAM43A	195889425	0.999000	0.42202	1.000000	0.80357	0.903000	0.53119	3.528000	0.53524	1.913000	0.55393	0.379000	0.24179	AAC	.	.	.	none		0.672	FAM43A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342734.1	NM_153690	
PDCD6	10016	hgsc.bcm.edu	37	5	311485	311485	+	Missense_Mutation	SNP	G	G	A	rs368897410		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr5:311485G>A	ENST00000264933.4	+	5	545	c.445G>A	c.(445-447)Gac>Aac	p.D149N	AHRR_ENST00000512529.1_Intron|AHRR_ENST00000505113.1_Intron|PDCD6_ENST00000511482.1_3'UTR|PDCD6_ENST00000505221.1_Intron|PDCD6_ENST00000507528.1_Missense_Mutation_p.D147N|AHRR_ENST00000316418.5_Intron	NM_001267556.1|NM_001267558.1|NM_013232.3	NP_001254485.1|NP_001254487.1|NP_037364.1	O75340	PDCD6_HUMAN	programmed cell death 6	149	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|cellular response to heat (GO:0034605)|intracellular protein transport (GO:0006886)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|proteolysis (GO:0006508)|response to calcium ion (GO:0051592)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|calcium-dependent protein binding (GO:0048306)|protein dimerization activity (GO:0046983)			breast(2)|endometrium(1)|large_intestine(4)|lung(1)	8			Epithelial(17;0.00193)|OV - Ovarian serous cystadenocarcinoma(19;0.00489)|all cancers(22;0.00511)|Lung(60;0.113)			GATTGCCTTCGACGACTTCAT	0.582																																					p.D149N		Atlas-SNP	.											.	PDCD6	24	.	0			c.G445A						PASS	.	G	,ASN/ASP,	1,4405	2.1+/-5.4	0,1,2202	92.0	76.0	81.0		,445,	5.7	0.9	5		81	0,8600		0,0,4300	no	intron,missense,intron	PDCD6,AHRR	NM_001242412.1,NM_013232.3,NM_020731.4	,23,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,probably-damaging,	,149/192,	311485	1,13005	2203	4300	6503	SO:0001583	missense	10016	exon5			GCCTTCGACGACT	AF035606	CCDS3854.1, CCDS58940.1, CCDS58941.1, CCDS75222.1, CCDS75223.1	5p15.33	2013-01-10			ENSG00000249915	ENSG00000249915		"""EF-hand domain containing"""	8765	protein-coding gene	gene with protein product	"""apoptosis-linked gene-2"""	601057				8560270	Standard	NM_013232		Approved	ALG-2, PEF1B	uc003jat.1	O75340	OTTHUMG00000090283	ENST00000264933.4:c.445G>A	chr5.hg19:g.311485G>A	ENSP00000264933:p.Asp149Asn	37.0	0.0	.		163.0	44.0	.	NM_013232	B2RD16|E7ESR3|Q2YDC2|Q5TZS0	Missense_Mutation	SNP	ENST00000264933.4	hg19	CCDS3854.1	.	.	.	.	.	.	.	.	.	.	g	36	5.640171	0.96693	2.27E-4	0.0	ENSG00000249915	ENST00000264933;ENST00000507528;ENST00000507473	T;T;T	0.79141	1.36;1.36;-1.24	5.72	5.72	0.89469	EF-hand-like domain (1);	.	.	.	.	D	0.88789	0.6532	M	0.82132	2.575	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.995;0.997	D	0.89735	0.3929	9	0.87932	D	0	.	17.3651	0.87362	0.0:0.0:1.0:0.0	.	147;149	Q2YDC2;O75340	.;PDCD6_HUMAN	N	149;147;62	ENSP00000264933:D149N;ENSP00000423815:D147N;ENSP00000425370:D62N	ENSP00000264933:D149N	D	+	1	0	PDCD6	364485	1.000000	0.71417	0.914000	0.36105	0.835000	0.47333	9.347000	0.97059	2.692000	0.91855	0.655000	0.94253	GAC	.	.	.	weak		0.582	PDCD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206609.2	NM_013232	
NSUN2	54888	hgsc.bcm.edu	37	5	6616902	6616902	+	Missense_Mutation	SNP	G	G	T	rs138724893		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr5:6616902G>T	ENST00000264670.6	-	9	1270	c.959C>A	c.(958-960)aCg>aAg	p.T320K	NSUN2_ENST00000539938.1_Missense_Mutation_p.T84K|NSUN2_ENST00000506139.1_Missense_Mutation_p.T285K	NM_017755.5	NP_060225.4	Q08J23	NSUN2_HUMAN	NOP2/Sun RNA methyltransferase family, member 2	320					mitotic nuclear division (GO:0007067)|tRNA methylation (GO:0030488)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|tRNA (cytosine-5-)-methyltransferase activity (GO:0016428)|tRNA binding (GO:0000049)	p.T320M(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	41						TAGTGAACACGTGGAATACAC	0.468																																					p.T320K		Atlas-SNP	.											NSUN2,NS,carcinoma,0,1	NSUN2	82	.	1	Substitution - Missense(1)	prostate(1)	c.C959A						PASS	.						151.0	133.0	139.0					5																	6616902		2203	4300	6503	SO:0001583	missense	54888	exon9			GAACACGTGGAAT	AK000310	CCDS3869.1, CCDS54832.1	5p15.32	2014-01-31	2012-06-12		ENSG00000037474	ENSG00000037474		"""NOP2/Sun domain containing"""	25994	protein-coding gene	gene with protein product	"""tRNA methyltransferase 4 homolog (S. cerevisiae)"", ""Myc-induced SUN-domain-containing protein"""	610916	"""NOL1/NOP2/Sun domain family, member 2"", ""NOP2/Sun domain family, member 2"", ""mental retardation, non-syndromic, autosomal recessive, 5"""	MRT5		17071714, 22541559	Standard	NM_017755		Approved	FLJ20303, TRM4, Misu	uc003jdu.3	Q08J23	OTTHUMG00000090455	ENST00000264670.6:c.959C>A	chr5.hg19:g.6616902G>T	ENSP00000264670:p.Thr320Lys	68.0	0.0	.		86.0	38.0	.	NM_017755	A8K529|B2RNR4|B3KP09|B4DQW2|G3V1R4|Q9BVN4|Q9H858|Q9NXD9	Missense_Mutation	SNP	ENST00000264670.6	hg19	CCDS3869.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.517699	0.85495	.	.	ENSG00000037474	ENST00000264670;ENST00000539938;ENST00000506139	T;T;T	0.26810	1.71;1.71;1.71	5.56	4.69	0.59074	Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (1);	0.092104	0.85682	D	0.000000	T	0.70133	0.3189	H	0.99507	4.6	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.84435	0.0579	10	0.87932	D	0	-41.0989	14.8419	0.70233	0.0693:0.0:0.9307:0.0	.	285;320	B4DQW2;Q08J23	.;NSUN2_HUMAN	K	320;84;285	ENSP00000264670:T320K;ENSP00000444338:T84K;ENSP00000420957:T285K	ENSP00000264670:T320K	T	-	2	0	NSUN2	6669902	1.000000	0.71417	0.047000	0.18901	0.855000	0.48748	8.772000	0.91757	1.498000	0.48600	0.650000	0.86243	ACG	.	G|1.000;A|0.000	.	alt		0.468	NSUN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206902.1	NM_017755	
MEGF10	84466	hgsc.bcm.edu	37	5	126753406	126753406	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr5:126753406G>A	ENST00000274473.6	+	11	1474	c.1207G>A	c.(1207-1209)Gga>Aga	p.G403R	MEGF10_ENST00000508365.1_Missense_Mutation_p.G403R|MEGF10_ENST00000503335.2_Missense_Mutation_p.G403R|MEGF10_ENST00000418761.2_Missense_Mutation_p.G403R	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	403	Necessary for interaction with AP2M1, self-assembly and formation of the irregular, mosaic-like adhesion pattern.				homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		ATGTTCTCCTGGATTCTACGG	0.532																																					p.G403R		Atlas-SNP	.											.	MEGF10	152	.	0			c.G1207A						PASS	.						121.0	103.0	109.0					5																	126753406		2203	4300	6503	SO:0001583	missense	84466	exon11			TCTCCTGGATTCT	AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.1207G>A	chr5.hg19:g.126753406G>A	ENSP00000274473:p.Gly403Arg	45.0	0.0	.		106.0	49.0	.	NM_032446	Q68DE5|Q8WUL3	Missense_Mutation	SNP	ENST00000274473.6	hg19	CCDS4142.1	.	.	.	.	.	.	.	.	.	.	G	33	5.226760	0.95173	.	.	ENSG00000145794	ENST00000503335;ENST00000508365;ENST00000418761;ENST00000274473	T;T;T;T	0.72394	-0.65;-0.65;-0.65;-0.65	5.69	5.69	0.88448	EGF-like, laminin (2);	0.000000	0.64402	D	0.000001	D	0.89392	0.6702	H	0.95816	3.725	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	D	0.90450	0.4438	10	0.44086	T	0.13	-11.0125	19.8251	0.96614	0.0:0.0:1.0:0.0	.	403;403	Q96KG7-2;Q96KG7	.;MEG10_HUMAN	R	403	ENSP00000423354:G403R;ENSP00000423195:G403R;ENSP00000416284:G403R;ENSP00000274473:G403R	ENSP00000274473:G403R	G	+	1	0	MEGF10	126781305	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.864000	0.99589	2.692000	0.91855	0.655000	0.94253	GGA	.	.	.	none		0.532	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250973.2	NM_032446	
TCERG1	10915	hgsc.bcm.edu	37	5	145838701	145838701	+	Silent	SNP	T	T	C	rs555146294		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr5:145838701T>C	ENST00000296702.5	+	4	731	c.693T>C	c.(691-693)gcT>gcC	p.A231A	TCERG1_ENST00000394421.2_Silent_p.A231A	NM_006706.3	NP_006697.2	O14776	TCRG1_HUMAN	transcription elongation regulator 1	231	Ala/Gln-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription coactivator activity (GO:0003713)	p.A231A(2)		breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(18)|lung(9)|ovary(2)|prostate(3)|skin(1)	46		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			aggctcaggctcaggcacaag	0.687													T|||	1	0.000199681	0.0	0.0	5008	,	,		12922	0.0		0.0	False		,,,				2504	0.001				p.A231A		Atlas-SNP	.											TCERG1,NS,carcinoma,0,2	TCERG1	148	.	2	Substitution - coding silent(2)	kidney(1)|endometrium(1)	c.T693C						PASS	.						29.0	33.0	32.0					5																	145838701		2203	4300	6503	SO:0001819	synonymous_variant	10915	exon4			TCAGGCTCAGGCA	AF017789	CCDS4282.1, CCDS43379.1	5q31	2010-01-25	2002-01-24	2002-01-25	ENSG00000113649	ENSG00000113649			15630	protein-coding gene	gene with protein product	"""transcription factor CA150"", ""co-activator of 150 kDa"", ""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"", ""TATA box-binding protein-associated factor 2S"""	605409	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"""	TAF2S		9315662, 11003711	Standard	XM_005268365		Approved	CA150, Urn1	uc003lob.3	O14776	OTTHUMG00000129683	ENST00000296702.5:c.693T>C	chr5.hg19:g.145838701T>C		39.0	0.0	.		129.0	8.0	.	NM_006706	Q2NKN2|Q59EA1	Silent	SNP	ENST00000296702.5	hg19	CCDS4282.1																																																																																			.	.	.	none		0.687	TCERG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251886.1	NM_001040006	
TFAP2A	7020	hgsc.bcm.edu	37	6	10398708	10398708	+	Missense_Mutation	SNP	T	T	G	rs201591227		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr6:10398708T>G	ENST00000482890.1	-	8	1608	c.1256A>C	c.(1255-1257)aAc>aCc	p.N419T	TFAP2A_ENST00000319516.4_Missense_Mutation_p.N415T|TFAP2A_ENST00000379604.2_Missense_Mutation_p.N419T|TFAP2A_ENST00000379608.3_Missense_Mutation_p.N413T|TFAP2A_ENST00000379613.3_Missense_Mutation_p.N421T|TFAP2A_ENST00000497266.1_5'Flank			P05549	AP2A_HUMAN	transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)	419					anterior neuropore closure (GO:0021506)|basement membrane organization (GO:0071711)|bone morphogenesis (GO:0060349)|cellular response to iron ion (GO:0071281)|cornea development in camera-type eye (GO:0061303)|embryonic body morphogenesis (GO:0010172)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|embryonic pattern specification (GO:0009880)|epidermis morphogenesis (GO:0048730)|eyelid development in camera-type eye (GO:0061029)|face morphogenesis (GO:0060325)|forebrain neuron development (GO:0021884)|inner ear morphogenesis (GO:0042472)|keratinocyte development (GO:0003334)|kidney development (GO:0001822)|lens induction in camera-type eye (GO:0060235)|metanephric nephron development (GO:0072210)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell development (GO:0014032)|oculomotor nerve formation (GO:0021623)|optic cup structural organization (GO:0003409)|optic vesicle morphogenesis (GO:0003404)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of tooth mineralization (GO:0070172)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell differentiation (GO:0045595)|regulation of neuron differentiation (GO:0045664)|retina layer formation (GO:0010842)|sensory perception of sound (GO:0007605)|sympathetic nervous system development (GO:0048485)|transcription from RNA polymerase II promoter (GO:0006366)|trigeminal nerve development (GO:0021559)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	13	Breast(50;0.0427)|Ovarian(93;0.0991)	all_hematologic(90;0.107)				CGTGTGGCTGTTGGGGTTGTT	0.622																																					p.N419T		Atlas-SNP	.											.	TFAP2A	129	.	0			c.A1256C						PASS	.						317.0	330.0	326.0					6																	10398708		2203	4300	6503	SO:0001583	missense	7020	exon7			TGGCTGTTGGGGT	X52611	CCDS4510.1, CCDS34337.1, CCDS43422.1	6p24.3	2013-09-19	2001-11-28		ENSG00000137203	ENSG00000137203			11742	protein-coding gene	gene with protein product		107580	"""transcription factor AP-2 alpha (activating enhancer-binding protein 2 alpha)"""	TFAP2, AP2TF		1916817, 3063603	Standard	NM_001032280		Approved	AP-2	uc003myr.3	P05549	OTTHUMG00000014235	ENST00000482890.1:c.1256A>C	chr6.hg19:g.10398708T>G	ENSP00000418541:p.Asn419Thr	715.0	1.0	.		1832.0	626.0	.	NM_003220	Q13777|Q5TAV5|Q8N1C6	Missense_Mutation	SNP	ENST00000482890.1	hg19	CCDS4510.1	.	.	.	.	.	.	.	.	.	.	T	12.06	1.825513	0.32237	.	.	ENSG00000137203	ENST00000379613;ENST00000379604;ENST00000319516;ENST00000379608;ENST00000482890	D;D;D;D;D	0.97114	-4.25;-4.25;-4.25;-4.25;-4.25	5.41	5.41	0.78517	.	0.042320	0.85682	D	0.000000	D	0.97247	0.9100	L	0.55481	1.735	0.80722	D	1	D;D;D	0.71674	0.993;0.983;0.998	D;P;D	0.83275	0.968;0.829;0.996	D	0.96866	0.9636	10	0.34782	T	0.22	-13.6146	15.4442	0.75216	0.0:0.0:0.0:1.0	.	415;419;413	Q5TAV5;P05549;Q8N1C6	.;AP2A_HUMAN;.	T	421;419;415;413;419	ENSP00000368933:N421T;ENSP00000368924:N419T;ENSP00000316516:N415T;ENSP00000368928:N413T;ENSP00000418541:N419T	ENSP00000316516:N415T	N	-	2	0	TFAP2A	10506694	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.249000	0.58766	2.048000	0.60808	0.533000	0.62120	AAC	.	.	.	weak		0.622	TFAP2A-007	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353619.2	NM_003220	
CAP2	10486	hgsc.bcm.edu	37	6	17507928	17507928	+	Silent	SNP	T	T	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr6:17507928T>C	ENST00000229922.2	+	6	1033	c.501T>C	c.(499-501)acT>acC	p.T167T	CAP2_ENST00000489374.1_Intron|CAP2_ENST00000493172.1_Intron|CAP2_ENST00000465994.1_Intron|CAP2_ENST00000378990.2_Silent_p.T141T	NM_006366.2	NP_006357.1	P40123	CAP2_HUMAN	CAP, adenylate cyclase-associated protein, 2 (yeast)	167					activation of adenylate cyclase activity (GO:0007190)|axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|establishment or maintenance of cell polarity (GO:0007163)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(4)|urinary_tract(1)	27	Breast(50;0.0333)|Ovarian(93;0.0386)	all_hematologic(90;0.0466)	all cancers(50;0.194)|Epithelial(50;0.227)			CCTTTTACACTAACAGGGTCT	0.413																																					p.T167T		Atlas-SNP	.											.	CAP2	61	.	0			c.T501C						PASS	.						138.0	124.0	129.0					6																	17507928		2203	4300	6503	SO:0001819	synonymous_variant	10486	exon6			TTACACTAACAGG	BC008481	CCDS4539.1	6p22.3	2008-02-05			ENSG00000112186	ENSG00000112186			20039	protein-coding gene	gene with protein product						7962207, 8761950	Standard	NM_006366		Approved		uc003ncb.3	P40123	OTTHUMG00000014311	ENST00000229922.2:c.501T>C	chr6.hg19:g.17507928T>C		143.0	0.0	.		132.0	50.0	.	NM_006366	B2R5Y3|B7Z1C4|B7Z214|Q6IAY2	Silent	SNP	ENST00000229922.2	hg19	CCDS4539.1																																																																																			.	.	.	none		0.413	CAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039952.2		
HIST1H1C	3006	hgsc.bcm.edu	37	6	26056427	26056427	+	Missense_Mutation	SNP	T	T	G	rs182693914		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr6:26056427T>G	ENST00000343677.2	-	1	272	c.230A>C	c.(229-231)aAc>aCc	p.N77T		NM_005319.3	NP_005310.1	P16403	H12_HUMAN	histone cluster 1, H1c	77	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	34						GATACGGCTGTTGTTTTTCTC	0.527																																					p.N77T		Atlas-SNP	.											HIST1H1C,NS,carcinoma,0,1	HIST1H1C	80	.	0			c.A230C						PASS	.						106.0	111.0	109.0					6																	26056427		2203	4300	6503	SO:0001583	missense	3006	exon1			CGGCTGTTGTTTT	X57129	CCDS4577.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000187837	ENSG00000187837		"""Histones / Replication-dependent"""	4716	protein-coding gene	gene with protein product		142710	"""H1 histone family, member 2"", ""histone 1, H1c"""	H1F2		2759094, 12408966	Standard	NM_005319		Approved	H1.2, H1s-1, H1c	uc003nfw.3	P16403	OTTHUMG00000016140	ENST00000343677.2:c.230A>C	chr6.hg19:g.26056427T>G	ENSP00000339566:p.Asn77Thr	162.0	2.0	.		476.0	201.0	.	NM_005319	A8K4I2	Missense_Mutation	SNP	ENST00000343677.2	hg19	CCDS4577.1	.	.	.	.	.	.	.	.	.	.	T	18.74	3.688031	0.68271	.	.	ENSG00000187837	ENST00000343677	T	0.08984	3.03	5.63	5.63	0.86233	Histone H1/H5 (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.152097	0.56097	D	0.000023	T	0.24275	0.0588	M	0.85945	2.785	0.80722	D	1	D	0.64830	0.994	D	0.71870	0.975	T	0.02617	-1.1133	10	0.66056	D	0.02	-32.5039	15.3144	0.74062	0.0:0.0:0.0:1.0	.	77	P16403	H12_HUMAN	T	77	ENSP00000339566:N77T	ENSP00000339566:N77T	N	-	2	0	HIST1H1C	26164406	1.000000	0.71417	1.000000	0.80357	0.303000	0.27691	6.087000	0.71362	2.271000	0.75665	0.533000	0.62120	AAC	.	.	.	weak		0.527	HIST1H1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043372.1	NM_005319	
CAV2	858	hgsc.bcm.edu	37	7	116140377	116140377	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr7:116140377T>A	ENST00000222693.4	+	2	606	c.214T>A	c.(214-216)Tgc>Agc	p.C72S	AC002066.1_ENST00000446355.2_RNA|CAV2_ENST00000393480.2_Missense_Mutation_p.C72S|CAV2_ENST00000343213.2_Intron|CAV2_ENST00000462876.1_3'UTR	NM_001206747.1|NM_001206748.1|NM_001233.4	NP_001193676.1|NP_001193677.1|NP_001224.1	P51636	CAV2_HUMAN	caveolin 2	72					caveola assembly (GO:0070836)|endoplasmic reticulum organization (GO:0007029)|mitochondrion organization (GO:0007005)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of endothelial cell proliferation (GO:0001938)|protein oligomerization (GO:0051259)|regulation of mitosis (GO:0007088)|skeletal muscle fiber development (GO:0048741)|synaptic transmission (GO:0007268)|vesicle docking (GO:0048278)|vesicle fusion (GO:0006906)|vesicle organization (GO:0016050)	acrosomal membrane (GO:0002080)|caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lipid particle (GO:0005811)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|transport vesicle (GO:0030133)	D1 dopamine receptor binding (GO:0031748)|protein homodimerization activity (GO:0042803)			large_intestine(1)|lung(1)|skin(1)	3	all_epithelial(6;1.53e-06)|Lung NSC(10;0.00592)|all_lung(10;0.00642)		STAD - Stomach adenocarcinoma(10;0.00878)			AGTGTGGATCTGCAGCCATGC	0.542																																					p.C72S		Atlas-SNP	.											.	CAV2	10	.	0			c.T214A						PASS	.						169.0	138.0	149.0					7																	116140377		2203	4300	6503	SO:0001583	missense	858	exon2			TGGATCTGCAGCC	AF035752	CCDS5765.1, CCDS5766.1	7q31	2006-02-09			ENSG00000105971	ENSG00000105971			1528	protein-coding gene	gene with protein product		601048				8552590, 10087206	Standard	NM_001233		Approved	CAV	uc003vid.3	P51636	OTTHUMG00000023414	ENST00000222693.4:c.214T>A	chr7.hg19:g.116140377T>A	ENSP00000222693:p.Cys72Ser	69.0	0.0	.		348.0	92.0	.	NM_001233	A4D0U2|Q9UGM7	Missense_Mutation	SNP	ENST00000222693.4	hg19	CCDS5766.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.420268	0.83559	.	.	ENSG00000105971	ENST00000222693;ENST00000393480	D;D	0.92249	-3.0;-3.0	4.6	4.6	0.57074	.	0.193833	0.56097	D	0.000032	D	0.93213	0.7838	M	0.85197	2.74	0.39643	D	0.970342	P	0.35656	0.514	B	0.41135	0.348	D	0.93194	0.6586	10	0.36615	T	0.2	-15.4697	14.2879	0.66258	0.0:0.0:0.0:1.0	.	72	P51636	CAV2_HUMAN	S	72	ENSP00000222693:C72S;ENSP00000377120:C72S	ENSP00000222693:C72S	C	+	1	0	CAV2	115927613	0.972000	0.33761	1.000000	0.80357	0.995000	0.86356	1.530000	0.36007	1.828000	0.53243	0.460000	0.39030	TGC	.	.	.	none		0.542	CAV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059735.4	NM_001233	
DPYSL2	1808	hgsc.bcm.edu	37	8	26505196	26505196	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr8:26505196T>A	ENST00000311151.5	+	11	1573	c.1161T>A	c.(1159-1161)aaT>aaA	p.N387K	DPYSL2_ENST00000521913.1_Missense_Mutation_p.N351K|DPYSL2_ENST00000523027.1_Missense_Mutation_p.N351K	NM_001386.5	NP_001377.1	Q16555	DPYL2_HUMAN	dihydropyrimidinase-like 2	387					axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|endocytosis (GO:0006897)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|olfactory bulb development (GO:0021772)|positive regulation of glutamate secretion (GO:0014049)|pyrimidine nucleobase catabolic process (GO:0006208)|regulation of neuron differentiation (GO:0045664)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|signal transduction (GO:0007165)|spinal cord development (GO:0021510)|synaptic vesicle transport (GO:0048489)	axon (GO:0030424)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	dihydropyrimidinase activity (GO:0004157)			breast(1)|endometrium(5)|large_intestine(8)|lung(3)|prostate(1)|skin(1)|stomach(1)	20		all_cancers(63;0.121)|Ovarian(32;2.68e-05)|all_epithelial(46;0.116)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;3.33e-10)|Colorectal(74;0.183)		CCAGCACCAATGCAGCCAAAG	0.552																																					p.N492K		Atlas-SNP	.											.	DPYSL2	49	.	0			c.T1476A						PASS	.						133.0	121.0	125.0					8																	26505196		2203	4300	6503	SO:0001583	missense	1808	exon11			CACCAATGCAGCC	D78013	CCDS6051.1, CCDS59096.1	8p22-p21	2011-09-28			ENSG00000092964	ENSG00000092964			3014	protein-coding gene	gene with protein product		602463				8973361	Standard	NM_001197293		Approved	DRP-2, DHPRP2, CRMP2, DRP2	uc003xfa.3	Q16555	OTTHUMG00000099439	ENST00000311151.5:c.1161T>A	chr8.hg19:g.26505196T>A	ENSP00000309539:p.Asn387Lys	106.0	0.0	.		190.0	118.0	.	NM_001197293	A8K5H2|B4DR31|D3DSS7|O00424	Missense_Mutation	SNP	ENST00000311151.5	hg19	CCDS6051.1	.	.	.	.	.	.	.	.	.	.	T	19.82	3.898016	0.72639	.	.	ENSG00000092964	ENST00000545637;ENST00000521913;ENST00000311151;ENST00000522745;ENST00000523027	D;D;D;D	0.92595	-3.07;-3.07;-3.07;-3.07	5.22	-6.76	0.01732	Amidohydrolase 1 (1);Metal-dependent hydrolase, composite domain (1);	0.000000	0.85682	D	0.000000	D	0.96144	0.8743	M	0.92367	3.3	0.53688	D	0.999974	D;P	0.76494	0.999;0.835	D;B	0.83275	0.996;0.269	D	0.94988	0.8132	10	0.66056	D	0.02	-27.4582	18.9516	0.92643	0.0:0.601:0.0:0.399	.	387;443	Q16555;Q59GB4	DPYL2_HUMAN;.	K	26;351;387;387;351	ENSP00000427985:N351K;ENSP00000309539:N387K;ENSP00000428909:N387K;ENSP00000431117:N351K	ENSP00000309539:N387K	N	+	3	2	DPYSL2	26561113	0.000000	0.05858	0.783000	0.31826	0.973000	0.67179	-2.232000	0.01205	-1.277000	0.02411	-1.098000	0.02139	AAT	.	.	.	none		0.552	DPYSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216904.3	NM_001386	
TLN1	7094	hgsc.bcm.edu	37	9	35711016	35711016	+	Silent	SNP	C	C	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr9:35711016C>T	ENST00000314888.9	-	31	4436	c.4083G>A	c.(4081-4083)aaG>aaA	p.K1361K	TLN1_ENST00000540444.1_Silent_p.K1361K	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	1361	Interaction with SYNM.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TATCACACTCCTTCTGGCCGG	0.532																																					p.K1361K		Atlas-SNP	.											.	TLN1	185	.	0			c.G4083A						PASS	.						107.0	94.0	98.0					9																	35711016		2203	4300	6503	SO:0001819	synonymous_variant	7094	exon31			ACACTCCTTCTGG	AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.4083G>A	chr9.hg19:g.35711016C>T		49.0	0.0	.		184.0	49.0	.	NM_006289	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Silent	SNP	ENST00000314888.9	hg19	CCDS35009.1																																																																																			.	.	.	none		0.532	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052353.2	NM_006289	
ZCCHC6	79670	hgsc.bcm.edu	37	9	88940291	88940291	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr9:88940291G>C	ENST00000375963.3	-	12	1919	c.1747C>G	c.(1747-1749)Cgg>Ggg	p.R583G	ZCCHC6_ENST00000375961.2_Missense_Mutation_p.R583G|ZCCHC6_ENST00000277141.6_5'UTR|ZCCHC6_ENST00000375960.2_Missense_Mutation_p.R460G|ZCCHC6_ENST00000469004.1_5'Flank	NM_001185059.1|NM_024617.3	NP_001171988.1|NP_078893.2	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	583	PAP-associated 1.				RNA 3'-end processing (GO:0031123)		poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	46						TTCAATTCCCGAGATACCAAT	0.403																																					p.R583G		Atlas-SNP	.											.	ZCCHC6	105	.	0			c.C1747G						PASS	.						101.0	98.0	99.0					9																	88940291		2203	4300	6503	SO:0001583	missense	79670	exon12			ATTCCCGAGATAC	AL832026	CCDS35057.1, CCDS55323.1	9q21	2014-03-05			ENSG00000083223	ENSG00000083223		"""Zinc fingers, CCHC domain containing"""	25817	protein-coding gene	gene with protein product	"""TUTase7"""					11214970	Standard	NM_001185059		Approved	KIAA1711, FLJ13409, PAPD6, TUT7	uc004aoq.3	Q5VYS8	OTTHUMG00000020137	ENST00000375963.3:c.1747C>G	chr9.hg19:g.88940291G>C	ENSP00000365130:p.Arg583Gly	81.0	0.0	.		34.0	12.0	.	NM_024617	Q5H9T0|Q5VYS5|Q5VYS7|Q658Z9|Q659A2|Q6MZJ3|Q8N5F0|Q96N57|Q96NE8|Q9C0F2|Q9H8M6	Missense_Mutation	SNP	ENST00000375963.3	hg19	CCDS35057.1	.	.	.	.	.	.	.	.	.	.	G	18.25	3.583577	0.65992	.	.	ENSG00000083223	ENST00000375960;ENST00000375961;ENST00000375963	T;T;T	0.78707	-1.2;-1.2;-1.2	5.1	5.1	0.69264	PAP/25A-associated (1);	0.000000	0.85682	D	0.000000	D	0.87358	0.6157	M	0.76838	2.35	0.54753	D	0.999989	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.88322	0.2963	10	0.72032	D	0.01	-11.8038	13.6554	0.62336	0.0:0.0:0.8455:0.1544	.	460;583	Q5VYS8-4;Q5VYS8	.;TUT7_HUMAN	G	460;583;583	ENSP00000365127:R460G;ENSP00000365128:R583G;ENSP00000365130:R583G	ENSP00000365127:R460G	R	-	1	2	ZCCHC6	88130111	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.937000	0.56575	2.658000	0.90341	0.650000	0.86243	CGG	.	.	.	none		0.403	ZCCHC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052918.1	NM_024617	
ANK3	288	hgsc.bcm.edu	37	10	61819138	61819138	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr10:61819138G>C	ENST00000280772.2	-	41	12837	c.12646C>G	c.(12646-12648)Cga>Gga	p.R4216G	RP11-388P9.2_ENST00000414383.1_RNA|ANK3_ENST00000355288.2_Missense_Mutation_p.R840G|ANK3_ENST00000503366.1_Missense_Mutation_p.R1707G|ANK3_ENST00000373827.2_Missense_Mutation_p.R1700G	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	4216					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						GTTACTCTTCGAGCTTGAGCG	0.408																																					p.R4216G		Atlas-SNP	.											ANK3_ENST00000355288,colon,carcinoma,0,2	ANK3	703	.	0			c.C12646G						PASS	.						201.0	175.0	184.0					10																	61819138		2203	4300	6503	SO:0001583	missense	288	exon41			CTCTTCGAGCTTG	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.12646C>G	chr10.hg19:g.61819138G>C	ENSP00000280772:p.Arg4216Gly	139.0	0.0	.		39.0	2.0	.	NM_020987	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	hg19	CCDS7258.1	.	.	.	.	.	.	.	.	.	.	G	13.70	2.315261	0.40996	.	.	ENSG00000151150	ENST00000280772;ENST00000373827;ENST00000373820;ENST00000355288;ENST00000503366;ENST00000395299;ENST00000373817	T;T;T;T;T	0.79352	-0.67;-1.26;0.38;-0.38;-1.22	5.56	4.65	0.58169	.	0.000000	0.30329	U	0.009875	T	0.73783	0.3631	L	0.29908	0.895	0.80722	D	1	P;P;P;P;B;P;D	0.58268	0.889;0.543;0.889;0.945;0.447;0.543;0.982	B;B;B;P;B;B;P	0.49752	0.301;0.162;0.394;0.597;0.307;0.162;0.621	T	0.77464	-0.2578	10	0.72032	D	0.01	.	13.835	0.63404	0.0733:0.0:0.9267:0.0	.	1707;840;1700;4216;941;840;239	E9PE32;A8KA62;Q5CZH9;Q12955;F5GXK0;B1AQT2;B1AQT0	.;.;.;ANK3_HUMAN;.;.;.	G	4216;1700;298;840;1707;1686;941	ENSP00000280772:R4216G;ENSP00000362933:R1700G;ENSP00000362926:R298G;ENSP00000347436:R840G;ENSP00000425236:R1707G	ENSP00000280772:R4216G	R	-	1	2	ANK3	61489144	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	7.006000	0.76329	2.623000	0.88846	0.455000	0.32223	CGA	.	.	.	none		0.408	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
SEC31B	25956	hgsc.bcm.edu	37	10	102255181	102255181	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr10:102255181C>G	ENST00000370345.3	-	19	2530	c.2433G>C	c.(2431-2433)gaG>gaC	p.E811D	SEC31B_ENST00000494350.1_5'Flank	NM_015490.3	NP_056305.1	Q9NQW1	SC31B_HUMAN	SEC31 homolog B (S. cerevisiae)	811					protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|vesicle coat (GO:0030120)				NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(3)|lung(17)|ovary(1)|urinary_tract(1)	36		Colorectal(252;0.117)		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)		AAGATGATGTCTCTTTAGAGT	0.488																																					p.E811D		Atlas-SNP	.											.	SEC31B	84	.	0			c.G2433C						PASS	.						69.0	61.0	63.0					10																	102255181		2203	4300	6503	SO:0001583	missense	25956	exon19			TGATGTCTCTTTA	AF274863	CCDS7495.1	10q24.32	2013-01-10	2006-10-05	2006-09-07	ENSG00000075826	ENSG00000075826		"""WD repeat domain containing"""	23197	protein-coding gene	gene with protein product		610258	"""SEC31-like 2 (S. cerevisiae)"""	SEC31L2		16495487	Standard	NM_015490		Approved	SEC31B-1, DKFZP434M183	uc001krc.1	Q9NQW1	OTTHUMG00000019342	ENST00000370345.3:c.2433G>C	chr10.hg19:g.102255181C>G	ENSP00000359370:p.Glu811Asp	40.0	0.0	.		33.0	17.0	.	NM_015490	B7ZM75|Q6MZS3|Q86UF0|Q9Y4Q8	Missense_Mutation	SNP	ENST00000370345.3	hg19	CCDS7495.1	.	.	.	.	.	.	.	.	.	.	C	12.40	1.927568	0.34002	.	.	ENSG00000075826	ENST00000370345	T	0.51325	0.71	5.76	-1.7	0.08159	.	0.960732	0.08733	N	0.901781	T	0.18676	0.0448	N	0.08118	0	0.09310	N	0.999998	B;B	0.32893	0.017;0.389	B;B	0.25987	0.006;0.065	T	0.13308	-1.0514	10	0.33141	T	0.24	-8.994	0.6819	0.00876	0.1758:0.2806:0.2804:0.2633	.	810;811	Q9NQW1-5;Q9NQW1	.;SC31B_HUMAN	D	811	ENSP00000359370:E811D	ENSP00000359370:E811D	E	-	3	2	SEC31B	102245171	.	.	0.335000	0.25508	0.480000	0.33159	.	.	-0.009000	0.14296	0.561000	0.74099	GAG	.	.	.	none		0.488	SEC31B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051198.1	NM_015490	
DCLRE1A	9937	hgsc.bcm.edu	37	10	115608965	115608965	+	Silent	SNP	A	A	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr10:115608965A>G	ENST00000361384.2	-	2	2816	c.1899T>C	c.(1897-1899)cgT>cgC	p.R633R	DCLRE1A_ENST00000369305.1_Silent_p.R633R	NM_014881.3	NP_055696.3	Q6PJP8	DCR1A_HUMAN	DNA cross-link repair 1A	633					mitotic nuclear division (GO:0007067)|nucleotide-excision repair (GO:0006289)	nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(2)|urinary_tract(1)	31				Epithelial(162;0.0157)|all cancers(201;0.0171)		TCTTTTTTTGACGCTGTGACC	0.368								Other identified genes with known or suspected DNA repair function																													p.R633R		Atlas-SNP	.											.	DCLRE1A	80	.	0			c.T1899C						PASS	.						162.0	164.0	163.0					10																	115608965		2203	4300	6503	SO:0001819	synonymous_variant	9937	exon2			TTTTTGACGCTGT		CCDS7584.1	10q25.1	2010-06-24	2010-06-24		ENSG00000198924	ENSG00000198924			17660	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	609682	"""DNA cross-link repair 1A (PSO2 homolog, S. cerevisiae)"""			9806498, 17804464	Standard	NM_014881		Approved	SNM1, PSO2, KIAA0086, hSNM1	uc031pxf.1	Q6PJP8	OTTHUMG00000019077	ENST00000361384.2:c.1899T>C	chr10.hg19:g.115608965A>G		145.0	0.0	.		225.0	84.0	.	NM_014881	D3DRC1|Q14701|Q6P5Y3|Q6PKL4	Silent	SNP	ENST00000361384.2	hg19	CCDS7584.1																																																																																			.	.	.	none		0.368	DCLRE1A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050444.1	NM_014881	
SLC43A3	29015	hgsc.bcm.edu	37	11	57188512	57188512	+	Missense_Mutation	SNP	C	C	T	rs148055054		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr11:57188512C>T	ENST00000395123.2	-	7	768	c.464G>A	c.(463-465)cGt>cAt	p.R155H	SLC43A3_ENST00000528098.1_5'UTR|SLC43A3_ENST00000395124.1_Missense_Mutation_p.R155H|SLC43A3_ENST00000533524.1_Missense_Mutation_p.R168H|SLC43A3_ENST00000529554.1_Missense_Mutation_p.R155H|SLC43A3_ENST00000352187.1_Missense_Mutation_p.R155H	NM_001278201.1|NM_014096.2	NP_001265130.1|NP_054815.2	Q8NBI5	S43A3_HUMAN	solute carrier family 43, member 3	155					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(10)|lung(4)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	27						GATGGTCGAACGGTGTTGGCC	0.448																																					p.R155H		Atlas-SNP	.											.	SLC43A3	54	.	0			c.G464A						PASS	.	C	HIS/ARG,HIS/ARG,HIS/ARG	1,4401	2.1+/-5.4	0,1,2200	156.0	128.0	138.0		464,464,464	5.8	1.0	11	dbSNP_134	138	0,8592		0,0,4296	no	missense,missense,missense	SLC43A3	NM_014096.2,NM_017611.2,NM_199329.1	29,29,29	0,1,6496	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging	155/492,155/492,155/492	57188512	1,12993	2201	4296	6497	SO:0001583	missense	29015	exon7			GTCGAACGGTGTT	AL157431	CCDS7956.1, CCDS60784.1	11q11	2013-05-22			ENSG00000134802	ENSG00000134802		"""Solute carriers"""	17466	protein-coding gene	gene with protein product	"""likely ortholog of mouse embryonic epithelial gene 1"""					7531438, 11704567	Standard	NM_017611		Approved	SEEEG-1, Eeg1, DKFZp762A227, FOAP-13, PRO1659	uc001nki.3	Q8NBI5	OTTHUMG00000167113	ENST00000395123.2:c.464G>A	chr11.hg19:g.57188512C>T	ENSP00000378555:p.Arg155His	63.0	0.0	.		91.0	35.0	.	NM_017611	B4DNR8|E7EQD2|Q9NSS4	Missense_Mutation	SNP	ENST00000395123.2	hg19	CCDS7956.1	.	.	.	.	.	.	.	.	.	.	C	35	5.465074	0.96257	2.27E-4	0.0	ENSG00000134802	ENST00000395123;ENST00000395124;ENST00000352187;ENST00000529554;ENST00000533524;ENST00000530005;ENST00000529113;ENST00000525474	T;T;T;T;T;T;D;D	0.84146	-0.35;-0.35;-0.35;-0.35;-0.35;-0.46;-1.81;-1.81	5.85	5.85	0.93711	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	D	0.93468	0.7916	M	0.87180	2.865	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.997;0.998	D	0.93715	0.7027	10	0.62326	D	0.03	-17.6544	17.9537	0.89062	0.0:1.0:0.0:0.0	.	155;168;155;155	B4DV87;E7EQD2;Q8NBI5;A8K2X6	.;.;S43A3_HUMAN;.	H	155;155;155;155;168;155;102;155	ENSP00000378555:R155H;ENSP00000378556:R155H;ENSP00000337561:R155H;ENSP00000436254:R155H;ENSP00000434515:R168H;ENSP00000435893:R155H;ENSP00000434293:R102H;ENSP00000436055:R155H	ENSP00000337561:R155H	R	-	2	0	SLC43A3	56945088	1.000000	0.71417	0.993000	0.49108	0.945000	0.59286	6.437000	0.73421	2.782000	0.95742	0.655000	0.94253	CGT	.	C|1.000;T|0.000	0.000	weak		0.448	SLC43A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000393057.1	NM_017611	
TMPRSS13	84000	hgsc.bcm.edu	37	11	117789447	117789447	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr11:117789447T>C	ENST00000430170.2	-	2	215	c.128A>G	c.(127-129)cAg>cGg	p.Q43R	TMPRSS13_ENST00000528626.1_Missense_Mutation_p.Q43R|TMPRSS13_ENST00000524993.1_Missense_Mutation_p.Q43R|TMPRSS13_ENST00000445164.2_Missense_Mutation_p.Q43R|TMPRSS13_ENST00000526090.1_Missense_Mutation_p.Q43R	NM_001244995.1	NP_001231924.1	Q9BYE2	TMPSD_HUMAN	transmembrane protease, serine 13	43	13 X 5 AA repeats of A-S-P-A-[GLQR].|4 X 5 AA repeats of T-P-P-G-R.|Ala-rich.					blood microparticle (GO:0072562)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|pancreas(1)|prostate(1)|urinary_tract(1)	20	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)		TGGAGATGCCTGGGCTGGAGA	0.662																																					p.Q43R		Atlas-SNP	.											.	TMPRSS13	75	.	0			c.A128G						PASS	.						42.0	49.0	47.0					11																	117789447		1901	4116	6017	SO:0001583	missense	84000	exon2			GATGCCTGGGCTG	AB048796	CCDS41721.1, CCDS55788.1, CCDS55789.1, CCDS58185.1	11q23	2010-04-13	2005-03-11	2005-03-12	ENSG00000137747	ENSG00000137747		"""Serine peptidases / Transmembrane"""	29808	protein-coding gene	gene with protein product		610050	"""transmembrane protease, serine 11"""	TMPRSS11		11267681	Standard	NM_001077263		Approved	MSPL	uc001prs.2	Q9BYE2	OTTHUMG00000166992	ENST00000430170.2:c.128A>G	chr11.hg19:g.117789447T>C	ENSP00000387702:p.Gln43Arg	60.0	0.0	.		280.0	12.0	.	NM_001206790	B4DTM9|E9PIJ5|F8WAJ3|Q86YM4|Q96JY8|Q9BYE1	Missense_Mutation	SNP	ENST00000430170.2	hg19	CCDS58185.1	.	.	.	.	.	.	.	.	.	.	T	4.646	0.120139	0.08881	.	.	ENSG00000137747	ENST00000528626;ENST00000336500;ENST00000524993;ENST00000430170;ENST00000445164;ENST00000526090	D;D;D;D;D	0.87650	-2.28;-2.24;-2.25;-2.24;-2.14	2.41	-1.65	0.08291	.	.	.	.	.	T	0.73466	0.3590	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.57906	-0.7730	9	0.33141	T	0.24	.	5.582	0.17254	0.0:0.5323:0.0:0.4677	.	43;43	Q9BYE2-4;E9PRA0	.;.	R	43	ENSP00000435813:Q43R;ENSP00000434279:Q43R;ENSP00000387702:Q43R;ENSP00000394114:Q43R;ENSP00000436502:Q43R	ENSP00000337113:Q43R	Q	-	2	0	TMPRSS13	117294657	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.101000	0.00604	-0.033000	0.13736	-0.271000	0.10264	CAG	.	.	.	none		0.662	TMPRSS13-006	PUTATIVE	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000392318.1	NM_032046	
ST3GAL4	6484	hgsc.bcm.edu	37	11	126276866	126276866	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr11:126276866G>C	ENST00000526727.1	+	3	504	c.130G>C	c.(130-132)Gag>Cag	p.E44Q	ST3GAL4_ENST00000526756.1_3'UTR|ST3GAL4_ENST00000444328.2_Missense_Mutation_p.E44Q|ST3GAL4_ENST00000532243.1_Missense_Mutation_p.E43Q|ST3GAL4_ENST00000392669.2_Missense_Mutation_p.E44Q|ST3GAL4_ENST00000530591.1_Missense_Mutation_p.E40Q|ST3GAL4_ENST00000356132.4_Missense_Mutation_p.E44Q|ST3GAL4_ENST00000227495.6_Missense_Mutation_p.E40Q|ST3GAL4_ENST00000449406.2_Missense_Mutation_p.E33Q|ST3GAL4_ENST00000534083.1_Missense_Mutation_p.E44Q|ST3GAL4_ENST00000534457.1_Missense_Mutation_p.E39Q			Q11206	SIA4C_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 4	44					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cognition (GO:0050890)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)|monosialoganglioside sialyltransferase activity (GO:0047288)			endometrium(1)|large_intestine(2)|lung(5)|stomach(1)	9	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0739)|all_lung(97;0.0798)|all_neural(223;0.138)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0767)		AGAGAAGAAGGAGCCGTGCCT	0.547																																					p.E44Q		Atlas-SNP	.											.	ST3GAL4	25	.	0			c.G130C						PASS	.						85.0	86.0	86.0					11																	126276866		2201	4298	6499	SO:0001583	missense	6484	exon4			AAGAAGGAGCCGT	X74570	CCDS8474.1, CCDS58193.1, CCDS58194.1	11q23-q24	2013-03-01	2003-01-14	2005-02-07	ENSG00000110080	ENSG00000110080	2.4.99.4	"""Sialyltransferases"""	10864	protein-coding gene	gene with protein product	"""ST3Gal IV"""	104240	"""sialyltransferase 4C (beta-galactosidase alpha-2,3-sialytransferase)"""	CGS23, SIAT4, NANTA3, SIAT4C		8557707, 8288606	Standard	NM_006278		Approved	STZ, SAT3, FLJ11867	uc001qds.3	Q11206	OTTHUMG00000165830	ENST00000526727.1:c.130G>C	chr11.hg19:g.126276866G>C	ENSP00000436047:p.Glu44Gln	94.0	0.0	.		419.0	165.0	.	NM_001254757	A8K6B2|O60497|Q8N6A6|Q8NFG7|Q96QQ9	Missense_Mutation	SNP	ENST00000526727.1	hg19	CCDS58193.1	.	.	.	.	.	.	.	.	.	.	G	13.82	2.349790	0.41599	.	.	ENSG00000110080	ENST00000227495;ENST00000444328;ENST00000356132;ENST00000530591;ENST00000534083;ENST00000526311;ENST00000528858;ENST00000534452;ENST00000392669;ENST00000526727;ENST00000449406;ENST00000532243;ENST00000534457	T;T;T;T;T;T;T;T;T;T;T	0.43688	0.94;0.94;0.97;0.94;0.94;0.94;0.94;0.94;0.95;0.94;0.94	5.4	3.42	0.39159	.	0.741690	0.13270	N	0.400600	T	0.28234	0.0697	L	0.50333	1.59	0.09310	N	1	P;P;P	0.49559	0.925;0.454;0.454	B;B;B	0.37346	0.247;0.105;0.105	T	0.09530	-1.0670	10	0.13470	T	0.59	.	6.0778	0.19925	0.1787:0.1907:0.6306:0.0	.	25;40;44	Q9HAA9;Q6IBE6;Q11206	.;.;SIA4C_HUMAN	Q	40;44;44;40;44;44;44;44;44;44;33;43;39	ENSP00000227495:E40Q;ENSP00000394354:E44Q;ENSP00000348451:E44Q;ENSP00000433989:E40Q;ENSP00000433318:E44Q;ENSP00000432424:E44Q;ENSP00000376437:E44Q;ENSP00000436047:E44Q;ENSP00000399444:E33Q;ENSP00000434349:E43Q;ENSP00000434668:E39Q	ENSP00000227495:E40Q	E	+	1	0	ST3GAL4	125782076	0.018000	0.18449	0.992000	0.48379	0.963000	0.63663	1.290000	0.33319	2.527000	0.85204	0.561000	0.74099	GAG	.	.	.	none		0.547	ST3GAL4-003	PUTATIVE	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386470.1	NM_006278	
MYBPC1	4604	hgsc.bcm.edu	37	12	102038482	102038482	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr12:102038482A>T	ENST00000550270.1	+	10	798	c.798A>T	c.(796-798)aaA>aaT	p.K266N	MYBPC1_ENST00000551300.1_Missense_Mutation_p.K167N|MYBPC1_ENST00000361466.2_Missense_Mutation_p.K291N|MYBPC1_ENST00000550501.1_Intron|RP11-755O11.2_ENST00000552081.1_RNA|MYBPC1_ENST00000553190.1_Missense_Mutation_p.K266N|MYBPC1_ENST00000392934.3_Missense_Mutation_p.K253N|RP11-755O11.2_ENST00000547027.1_RNA|MYBPC1_ENST00000547509.1_Missense_Mutation_p.K252N|MYBPC1_ENST00000452455.2_Missense_Mutation_p.K266N|MYBPC1_ENST00000441232.1_Missense_Mutation_p.K266N|MYBPC1_ENST00000545503.2_Missense_Mutation_p.K266N|MYBPC1_ENST00000549145.1_Missense_Mutation_p.K279N|MYBPC1_ENST00000360610.2_Missense_Mutation_p.K266N|MYBPC1_ENST00000361685.2_Missense_Mutation_p.K291N|MYBPC1_ENST00000536007.1_Missense_Mutation_p.K247N|MYBPC1_ENST00000547405.1_Missense_Mutation_p.K240N|MYBPC1_ENST00000541119.1_Missense_Mutation_p.K254N			Q00872	MYPC1_HUMAN	myosin binding protein C, slow type	266	Ig-like C2-type 2.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myofibril (GO:0030016)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	57						AGGTTGACAAAGGAGGCAGAG	0.368																																					p.K291N		Atlas-SNP	.											.	MYBPC1	235	.	0			c.A873T						PASS	.						86.0	82.0	83.0					12																	102038482		2203	4300	6503	SO:0001583	missense	4604	exon12			TGACAAAGGAGGC		CCDS9083.1, CCDS9084.1, CCDS9085.1, CCDS55877.1, CCDS58268.1, CCDS58269.1, CCDS58270.1, CCDS58271.1, CCDS58272.1, CCDS58273.1	12q23.2	2013-02-11	2001-11-28		ENSG00000196091	ENSG00000196091		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7549	protein-coding gene	gene with protein product		160794	"""myosin-binding protein C, slow-type"""			8375400, 16918501	Standard	NM_002465		Approved		uc010svs.2	Q00872	OTTHUMG00000170274	ENST00000550270.1:c.798A>T	chr12.hg19:g.102038482A>T	ENSP00000449702:p.Lys266Asn	40.0	0.0	.		65.0	18.0	.	NM_206819	B4DKR5|B7Z8G8|B7ZL02|B7ZL09|B7ZL10|E7ESM5|E7EWS6|G3XAE8|Q15497|Q17RR7|Q569K7|Q86T48|Q86TC8|Q8N3L2	Missense_Mutation	SNP	ENST00000550270.1	hg19	CCDS9085.1	.	.	.	.	.	.	.	.	.	.	A	23.3	4.395297	0.83011	.	.	ENSG00000196091	ENST00000547405;ENST00000452455;ENST00000441232;ENST00000360610;ENST00000392934;ENST00000547509;ENST00000361685;ENST00000549145;ENST00000553190;ENST00000540770;ENST00000545503;ENST00000536007;ENST00000541119;ENST00000361466;ENST00000551300;ENST00000550270	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98;0.98;0.98;0.98;0.98;0.98;0.98;0.98;0.98;0.98;0.98	5.8	5.8	0.92144	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	0.000000	0.56097	D	0.000037	T	0.69806	0.3152	M	0.87328	2.875	0.80722	D	1	P;D;D;D;D;P;D;D;P;D;D	0.89917	0.623;1.0;0.999;1.0;0.999;0.623;0.999;1.0;0.863;0.999;0.999	P;D;D;D;D;P;D;D;P;D;D	0.91635	0.499;0.999;0.993;0.999;0.998;0.627;0.998;0.999;0.614;0.998;0.999	T	0.75926	-0.3145	10	0.87932	D	0	.	15.8202	0.78633	1.0:0.0:0.0:0.0	.	247;254;266;266;253;240;266;266;291;291;279	B7ZL02;B7ZL10;E7EWS6;B7ZL09;E7ESM5;Q17RR7;Q00872-3;Q00872;G3XAE8;Q00872-2;F8VZY0	.;.;.;.;.;.;.;MYPC1_HUMAN;.;.;.	N	240;266;266;266;253;252;291;279;266;291;266;247;254;291;167;266	ENSP00000448175:K240N;ENSP00000400908:K266N;ENSP00000388989:K266N;ENSP00000353822:K266N;ENSP00000376665:K253N;ENSP00000447362:K252N;ENSP00000354845:K291N;ENSP00000447660:K279N;ENSP00000447900:K266N;ENSP00000440034:K266N;ENSP00000446128:K247N;ENSP00000442847:K254N;ENSP00000354849:K291N;ENSP00000447116:K167N;ENSP00000449702:K266N	ENSP00000353822:K266N	K	+	3	2	MYBPC1	100562613	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.038000	0.64177	2.212000	0.71576	0.533000	0.62120	AAA	.	.	.	none		0.368	MYBPC1-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000408806.1		
ACAD10	80724	hgsc.bcm.edu	37	12	112174685	112174685	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr12:112174685T>A	ENST00000313698.4	+	12	1746	c.1591T>A	c.(1591-1593)Tat>Aat	p.Y531N	ACAD10_ENST00000455480.2_Missense_Mutation_p.Y562N|ACAD10_ENST00000549590.1_Missense_Mutation_p.Y531N|ACAD10_ENST00000392636.2_Missense_Mutation_p.Y133N|ACAD10_ENST00000413681.3_3'UTR	NM_025247.5	NP_079523.3	Q6JQN1	ACD10_HUMAN	acyl-CoA dehydrogenase family, member 10	531						mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|hydrolase activity (GO:0016787)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(17)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(5)	47						TGCAGAGGAGTATTTCAGGAT	0.502																																					p.Y562N		Atlas-SNP	.											.	ACAD10	93	.	0			c.T1684A						PASS	.						124.0	112.0	116.0					12																	112174685		2203	4300	6503	SO:0001583	missense	80724	exon13			GAGGAGTATTTCA	AY323912	CCDS31903.1, CCDS44973.1	12q24.12	2012-10-02	2010-04-30		ENSG00000111271	ENSG00000111271			21597	protein-coding gene	gene with protein product		611181	"""acyl-Coenzyme A dehydrogenase family, member 10"""			15560374	Standard	NM_025247		Approved	MGC5601	uc009zvx.3	Q6JQN1	OTTHUMG00000169602	ENST00000313698.4:c.1591T>A	chr12.hg19:g.112174685T>A	ENSP00000325137:p.Tyr531Asn	44.0	0.0	.		132.0	50.0	.	NM_001136538	G3XAJ0|Q8N828|Q8NAP2|Q96BX5	Missense_Mutation	SNP	ENST00000313698.4	hg19	CCDS31903.1	.	.	.	.	.	.	.	.	.	.	T	19.30	3.801553	0.70682	.	.	ENSG00000111271	ENST00000392636;ENST00000413681;ENST00000549590;ENST00000455480;ENST00000313698	T;T;T;T	0.30448	1.53;1.53;1.53;1.53	5.29	4.14	0.48551	Protein kinase-like domain (1);	0.289517	0.34133	N	0.004238	T	0.61887	0.2383	M	0.92880	3.355	0.37403	D	0.912927	D;D;D	0.89917	0.997;0.999;1.0	P;D;D	0.91635	0.879;0.957;0.999	T	0.72020	-0.4416	10	0.66056	D	0.02	.	10.4594	0.44570	0.0:0.0776:0.0:0.9224	.	562;531;531	G3XAJ0;Q6JQN1;Q6JQN1-2	.;ACD10_HUMAN;.	N	133;531;531;562;531	ENSP00000376411:Y133N;ENSP00000446959:Y531N;ENSP00000389813:Y562N;ENSP00000325137:Y531N	ENSP00000325137:Y531N	Y	+	1	0	ACAD10	110659068	0.972000	0.33761	0.981000	0.43875	0.974000	0.67602	1.626000	0.37039	0.863000	0.35553	0.459000	0.35465	TAT	.	.	.	none		0.502	ACAD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368307.1	NM_025247	
EP400	57634	hgsc.bcm.edu	37	12	132551479	132551479	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr12:132551479T>A	ENST00000333577.4	+	50	8931	c.8822T>A	c.(8821-8823)aTc>aAc	p.I2941N	EP400_ENST00000330386.6_Missense_Mutation_p.I2824N|EP400_ENST00000332482.4_Missense_Mutation_p.I2868N|EP400_ENST00000389562.2_Missense_Mutation_p.I2904N|EP400_ENST00000389561.2_Missense_Mutation_p.I2905N			Q96L91	EP400_HUMAN	E1A binding protein p400	2941					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		GTCGCGGGGATCAGCGTGGCG	0.687																																					p.I2905N		Atlas-SNP	.											.	EP400	370	.	0			c.T8714A						PASS	.						29.0	29.0	29.0					12																	132551479		2203	4299	6502	SO:0001583	missense	57634	exon49			CGGGGATCAGCGT	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8822T>A	chr12.hg19:g.132551479T>A	ENSP00000333602:p.Ile2941Asn	47.0	0.0	.		89.0	35.0	.	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Missense_Mutation	SNP	ENST00000333577.4	hg19		.	.	.	.	.	.	.	.	.	.	T	18.43	3.621758	0.66787	.	.	ENSG00000183495	ENST00000333577;ENST00000389561;ENST00000389562;ENST00000332482;ENST00000330386;ENST00000541296	D;D;D;D;D	0.92545	-3.06;-3.05;-2.99;-3.01;-3.02	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	D	0.93112	0.7807	L	0.34521	1.04	0.44899	D	0.997913	D;D;D;D	0.89917	0.992;1.0;1.0;1.0	D;D;D;D	0.87578	0.976;0.998;0.998;0.998	D	0.92827	0.6277	10	0.40728	T	0.16	.	14.4084	0.67099	0.0:0.0:0.0:1.0	.	2941;2905;2824;2904	Q96L91;Q96L91-2;Q96L91-4;Q96L91-5	EP400_HUMAN;.;.;.	N	2941;2905;2904;2868;2824;2905	ENSP00000333602:I2941N;ENSP00000374212:I2905N;ENSP00000374213:I2904N;ENSP00000331737:I2868N;ENSP00000330620:I2824N	ENSP00000330620:I2824N	I	+	2	0	EP400	131117432	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.698000	0.84413	1.817000	0.53016	0.454000	0.30748	ATC	.	.	.	none		0.687	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
IFT88	8100	hgsc.bcm.edu	37	13	21189985	21189985	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr13:21189985T>G	ENST00000319980.6	+	16	1520	c.1193T>G	c.(1192-1194)gTa>gGa	p.V398G	IFT88_ENST00000382778.4_Missense_Mutation_p.V398G|IFT88_ENST00000351808.5_Missense_Mutation_p.V389G|IFT88_ENST00000461115.1_3'UTR|IFT88_ENST00000537103.1_Missense_Mutation_p.V370G	NM_175605.3	NP_783195.2	Q13099	IFT88_HUMAN	intraflagellar transport 88	398					anterior/posterior pattern specification (GO:0009952)|cardiac muscle cell differentiation (GO:0055007)|cardiac septum morphogenesis (GO:0060411)|cilium morphogenesis (GO:0060271)|cochlea development (GO:0090102)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|embryonic digit morphogenesis (GO:0042733)|epidermal stem cell homeostasis (GO:0036334)|epidermis development (GO:0008544)|epithelial cell morphogenesis (GO:0003382)|eye development (GO:0001654)|forebrain morphogenesis (GO:0048853)|heart formation (GO:0060914)|inner ear receptor stereocilium organization (GO:0060122)|kidney development (GO:0001822)|liver development (GO:0001889)|lung vasculature development (GO:0060426)|negative regulation of epithelial cell proliferation (GO:0050680)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|protein localization (GO:0008104)|regulation of autophagic vacuole assembly (GO:2000785)|regulation of cilium assembly (GO:1902017)|regulation of fat cell differentiation (GO:0045598)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of protein processing (GO:0070613)|regulation of smoothened signaling pathway (GO:0008589)|response to fluid shear stress (GO:0034405)|smoothened signaling pathway (GO:0007224)|sperm axoneme assembly (GO:0007288)|spermatid nucleus elongation (GO:0007290)|spinal cord dorsal/ventral patterning (GO:0021513)|telencephalon development (GO:0021537)	acrosomal membrane (GO:0002080)|apical part of cell (GO:0045177)|axonemal basal plate (GO:0097541)|centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|kinocilium (GO:0060091)|motile cilium (GO:0031514)|motile primary cilium (GO:0031512)|photoreceptor connecting cilium (GO:0032391)				breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	27		all_cancers(29;5.79e-25)|all_epithelial(30;2.57e-20)|all_lung(29;3.13e-16)|Lung SC(185;0.0262)|Ovarian(182;0.0825)|Hepatocellular(188;0.244)		all cancers(112;0.000667)|Epithelial(112;0.00119)|OV - Ovarian serous cystadenocarcinoma(117;0.0141)|Lung(94;0.0183)|LUSC - Lung squamous cell carcinoma(192;0.0528)		ATTGCTCCTGTAATTGAAACA	0.279																																					p.V398G		Atlas-SNP	.											.	IFT88	83	.	0			c.T1193G						PASS	.						81.0	91.0	87.0					13																	21189985		2203	4295	6498	SO:0001583	missense	8100	exon16			CTCCTGTAATTGA	AK058172	CCDS31944.1, CCDS31945.1	13q12.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000032742	ENSG00000032742		"""Intraflagellar transport homologs"", ""Tetratricopeptide (TTC) repeat domain containing"""	20606	protein-coding gene	gene with protein product	"""polaris homolog"""	600595	"""tetratricopeptide repeat domain 10"", ""intraflagellar transport 88 homolog (Chlamydomonas)"""	TTC10		7633404	Standard	XM_005266546		Approved	hTg737, Tg737, D13S1056E, MGC26259	uc001uni.3	Q13099	OTTHUMG00000016517	ENST00000319980.6:c.1193T>G	chr13.hg19:g.21189985T>G	ENSP00000323580:p.Val398Gly	62.0	0.0	.		181.0	63.0	.	NM_175605	A2A491|B4DUS2|Q5SZJ6|Q8N719	Missense_Mutation	SNP	ENST00000319980.6	hg19	CCDS31944.1	.	.	.	.	.	.	.	.	.	.	T	19.63	3.863350	0.71949	.	.	ENSG00000032742	ENST00000382778;ENST00000389374;ENST00000351808;ENST00000319980;ENST00000537103	T;T;T;T	0.35789	1.31;1.29;1.29;1.31	5.59	3.19	0.36642	.	0.122813	0.56097	D	0.000035	T	0.34978	0.0916	M	0.74647	2.275	0.80722	D	1	B;P;P;B	0.37985	0.433;0.594;0.613;0.104	B;B;B;B	0.36845	0.234;0.164;0.197;0.058	T	0.22765	-1.0207	10	0.66056	D	0.02	-16.2168	6.1242	0.20170	0.0:0.3259:0.0:0.6741	.	370;398;196;398	F5H6C2;E7EW86;Q6MZX0;Q13099	.;.;.;IFT88_HUMAN	G	398;261;389;398;370	ENSP00000372228:V398G;ENSP00000261632:V389G;ENSP00000323580:V398G;ENSP00000437719:V370G	ENSP00000323580:V398G	V	+	2	0	IFT88	20087985	0.997000	0.39634	0.988000	0.46212	0.997000	0.91878	2.622000	0.46427	0.942000	0.37525	0.528000	0.53228	GTA	.	.	.	none		0.279	IFT88-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044075.3	NM_006531	
IFT88	8100	hgsc.bcm.edu	37	13	21189988	21189988	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr13:21189988T>A	ENST00000319980.6	+	16	1523	c.1196T>A	c.(1195-1197)aTt>aAt	p.I399N	IFT88_ENST00000382778.4_Missense_Mutation_p.I399N|IFT88_ENST00000351808.5_Missense_Mutation_p.I390N|IFT88_ENST00000461115.1_3'UTR|IFT88_ENST00000537103.1_Missense_Mutation_p.I371N	NM_175605.3	NP_783195.2	Q13099	IFT88_HUMAN	intraflagellar transport 88	399					anterior/posterior pattern specification (GO:0009952)|cardiac muscle cell differentiation (GO:0055007)|cardiac septum morphogenesis (GO:0060411)|cilium morphogenesis (GO:0060271)|cochlea development (GO:0090102)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|embryonic digit morphogenesis (GO:0042733)|epidermal stem cell homeostasis (GO:0036334)|epidermis development (GO:0008544)|epithelial cell morphogenesis (GO:0003382)|eye development (GO:0001654)|forebrain morphogenesis (GO:0048853)|heart formation (GO:0060914)|inner ear receptor stereocilium organization (GO:0060122)|kidney development (GO:0001822)|liver development (GO:0001889)|lung vasculature development (GO:0060426)|negative regulation of epithelial cell proliferation (GO:0050680)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|protein localization (GO:0008104)|regulation of autophagic vacuole assembly (GO:2000785)|regulation of cilium assembly (GO:1902017)|regulation of fat cell differentiation (GO:0045598)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of protein processing (GO:0070613)|regulation of smoothened signaling pathway (GO:0008589)|response to fluid shear stress (GO:0034405)|smoothened signaling pathway (GO:0007224)|sperm axoneme assembly (GO:0007288)|spermatid nucleus elongation (GO:0007290)|spinal cord dorsal/ventral patterning (GO:0021513)|telencephalon development (GO:0021537)	acrosomal membrane (GO:0002080)|apical part of cell (GO:0045177)|axonemal basal plate (GO:0097541)|centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|kinocilium (GO:0060091)|motile cilium (GO:0031514)|motile primary cilium (GO:0031512)|photoreceptor connecting cilium (GO:0032391)				breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	27		all_cancers(29;5.79e-25)|all_epithelial(30;2.57e-20)|all_lung(29;3.13e-16)|Lung SC(185;0.0262)|Ovarian(182;0.0825)|Hepatocellular(188;0.244)		all cancers(112;0.000667)|Epithelial(112;0.00119)|OV - Ovarian serous cystadenocarcinoma(117;0.0141)|Lung(94;0.0183)|LUSC - Lung squamous cell carcinoma(192;0.0528)		GCTCCTGTAATTGAAACATCT	0.279																																					p.I399N		Atlas-SNP	.											.	IFT88	83	.	0			c.T1196A						PASS	.						81.0	90.0	87.0					13																	21189988		2203	4293	6496	SO:0001583	missense	8100	exon16			CTGTAATTGAAAC	AK058172	CCDS31944.1, CCDS31945.1	13q12.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000032742	ENSG00000032742		"""Intraflagellar transport homologs"", ""Tetratricopeptide (TTC) repeat domain containing"""	20606	protein-coding gene	gene with protein product	"""polaris homolog"""	600595	"""tetratricopeptide repeat domain 10"", ""intraflagellar transport 88 homolog (Chlamydomonas)"""	TTC10		7633404	Standard	XM_005266546		Approved	hTg737, Tg737, D13S1056E, MGC26259	uc001uni.3	Q13099	OTTHUMG00000016517	ENST00000319980.6:c.1196T>A	chr13.hg19:g.21189988T>A	ENSP00000323580:p.Ile399Asn	61.0	0.0	.		180.0	60.0	.	NM_175605	A2A491|B4DUS2|Q5SZJ6|Q8N719	Missense_Mutation	SNP	ENST00000319980.6	hg19	CCDS31944.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.408083	0.83340	.	.	ENSG00000032742	ENST00000382778;ENST00000389374;ENST00000351808;ENST00000319980;ENST00000537103	T;T;T;T	0.40756	1.03;1.02;1.02;1.04	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.69717	0.3142	M	0.88105	2.93	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;1.0;0.998	D;D;D;D	0.79784	0.986;0.979;0.993;0.991	T	0.76564	-0.2913	10	0.87932	D	0	-20.545	14.7446	0.69480	0.0:0.0:0.0:1.0	.	371;399;197;399	F5H6C2;E7EW86;Q6MZX0;Q13099	.;.;.;IFT88_HUMAN	N	399;262;390;399;371	ENSP00000372228:I399N;ENSP00000261632:I390N;ENSP00000323580:I399N;ENSP00000437719:I371N	ENSP00000323580:I399N	I	+	2	0	IFT88	20087988	1.000000	0.71417	0.996000	0.52242	0.994000	0.84299	7.260000	0.78391	2.121000	0.65114	0.528000	0.53228	ATT	.	.	.	none		0.279	IFT88-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044075.3	NM_006531	
CLMN	79789	hgsc.bcm.edu	37	14	95669398	95669398	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr14:95669398T>C	ENST00000298912.4	-	9	2401	c.2288A>G	c.(2287-2289)tAt>tGt	p.Y763C		NM_024734.3	NP_079010.2	Q96JQ2	CLMN_HUMAN	calmin (calponin-like, transmembrane)	763					negative regulation of cell proliferation (GO:0008285)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(17)|prostate(3)|skin(3)	44				Epithelial(152;0.193)		GTCTGGCATATAGCCCTCTGG	0.567																																					p.Y763C		Atlas-SNP	.											.	CLMN	103	.	0			c.A2288G						PASS	.						38.0	39.0	39.0					14																	95669398		2203	4300	6503	SO:0001583	missense	79789	exon9			GGCATATAGCCCT	AB033014	CCDS9933.1	14q32.13	2012-10-02			ENSG00000165959	ENSG00000165959			19972	protein-coding gene	gene with protein product		611121				11386753	Standard	NM_024734		Approved	FLJ12383, KIAA1188, KIAA0500	uc001yef.2	Q96JQ2	OTTHUMG00000171629	ENST00000298912.4:c.2288A>G	chr14.hg19:g.95669398T>C	ENSP00000298912:p.Tyr763Cys	20.0	0.0	.		206.0	84.0	.	NM_024734	B2RAR7|Q9H713|Q9HA23|Q9HA57|Q9UFP4|Q9ULN2	Missense_Mutation	SNP	ENST00000298912.4	hg19	CCDS9933.1	.	.	.	.	.	.	.	.	.	.	T	9.014	0.983104	0.18889	.	.	ENSG00000165959	ENST00000298912	D	0.92647	-3.08	5.22	-4.75	0.03239	.	0.879712	0.09454	N	0.800049	D	0.83718	0.5315	L	0.39397	1.21	0.09310	N	1	B	0.12630	0.006	B	0.08055	0.003	T	0.68055	-0.5510	10	0.40728	T	0.16	.	3.381	0.07255	0.1129:0.3809:0.1154:0.3907	.	763	Q96JQ2	CLMN_HUMAN	C	763	ENSP00000298912:Y763C	ENSP00000298912:Y763C	Y	-	2	0	CLMN	94739151	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.163000	0.03138	-0.982000	0.03515	-1.236000	0.01555	TAT	.	.	.	none		0.567	CLMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414518.2		
FBXO22	26263	hgsc.bcm.edu	37	15	76196905	76196905	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr15:76196905G>A	ENST00000308275.3	+	2	319	c.214G>A	c.(214-216)Ggc>Agc	p.G72S	FBXO22_ENST00000565131.1_3'UTR|FBXO22_ENST00000453211.2_Missense_Mutation_p.G72S|FBXO22_ENST00000540507.1_Intron	NM_147188.2	NP_671717.1	Q8NEZ5	FBX22_HUMAN	F-box protein 22	72					cellular protein modification process (GO:0006464)|cellular response to starvation (GO:0009267)|nucleocytoplasmic transport (GO:0006913)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein polyubiquitination (GO:0000209)|regulation of skeletal muscle fiber development (GO:0048742)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21						GATCTCCGCAGGCCTGGCGGA	0.602																																					p.G72S		Atlas-SNP	.											.	FBXO22	60	.	0			c.G214A						PASS	.						108.0	101.0	103.0					15																	76196905		2197	4294	6491	SO:0001583	missense	26263	exon2			TCCGCAGGCCTGG	AF174602	CCDS10287.1, CCDS45310.1	15q23	2008-10-03	2004-06-15		ENSG00000167196	ENSG00000167196		"""F-boxes /  ""other"""""	13593	protein-coding gene	gene with protein product	"""FIST domain containing 1"""	609096	"""F-box only protein 22"""			10531035, 10531037, 17855421	Standard	NM_147188		Approved	FBX22, FISTC1	uc002bbk.3	Q8NEZ5	OTTHUMG00000142841	ENST00000308275.3:c.214G>A	chr15.hg19:g.76196905G>A	ENSP00000307833:p.Gly72Ser	129.0	0.0	.		305.0	92.0	.	NM_012170	Q0D2P8|Q6PIL5|Q8IXW3|Q9H824|Q9UKC0	Missense_Mutation	SNP	ENST00000308275.3	hg19	CCDS10287.1	.	.	.	.	.	.	.	.	.	.	G	6.702	0.498156	0.12762	.	.	ENSG00000167196	ENST00000308275;ENST00000453211	.	.	.	3.51	0.501	0.16925	.	0.746536	0.11012	N	0.609403	T	0.13841	0.0335	N	0.03608	-0.345	0.09310	N	0.999993	B;B	0.09022	0.0;0.002	B;B	0.08055	0.001;0.003	T	0.33599	-0.9862	9	0.12103	T	0.63	-1.7367	7.3984	0.26950	0.0987:0.332:0.5694:0.0	.	72;72	Q8NEZ5;Q8NEZ5-3	FBX22_HUMAN;.	S	72	.	ENSP00000307833:G72S	G	+	1	0	FBXO22	73983960	0.001000	0.12720	0.002000	0.10522	0.591000	0.36615	0.233000	0.17911	0.106000	0.17784	0.563000	0.77884	GGC	.	.	.	none		0.602	FBXO22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286477.2	NM_147188	
CREBBP	1387	hgsc.bcm.edu	37	16	3808859	3808859	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr16:3808859A>G	ENST00000262367.5	-	17	4174	c.3365T>C	c.(3364-3366)aTt>aCt	p.I1122T	CREBBP_ENST00000382070.3_Missense_Mutation_p.I1084T	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1122	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		ACTTACTGGAATTCCGAGGAG	0.438			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.I1122T		Atlas-SNP	.		Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	CREBBP	546	.	0			c.T3365C						PASS	.						69.0	68.0	68.0					16																	3808859		2197	4300	6497	SO:0001583	missense	1387	exon17			ACTGGAATTCCGA	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.3365T>C	chr16.hg19:g.3808859A>G	ENSP00000262367:p.Ile1122Thr	64.0	0.0	.		62.0	14.0	.	NM_004380	D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	ENST00000262367.5	hg19	CCDS10509.1	.	.	.	.	.	.	.	.	.	.	A	14.55	2.568041	0.45798	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	T;T	0.19532	2.14;2.14	5.05	5.05	0.67936	Bromodomain (6);Bromodomain, conserved site (1);	0.000000	0.64402	D	0.000001	T	0.54303	0.1850	M	0.89534	3.04	0.80722	D	1	D;D	0.59767	0.986;0.986	D;D	0.97110	1.0;1.0	T	0.64952	-0.6286	10	0.72032	D	0.01	-13.4551	15.0885	0.72174	1.0:0.0:0.0:0.0	.	1152;1122	Q4LE28;Q92793	.;CBP_HUMAN	T	1122;1152;1084	ENSP00000262367:I1122T;ENSP00000371502:I1084T	ENSP00000262367:I1122T	I	-	2	0	CREBBP	3748860	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	9.067000	0.93955	2.022000	0.59522	0.459000	0.35465	ATT	.	.	.	none		0.438	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	
HERPUD1	9709	hgsc.bcm.edu	37	16	56970652	56970652	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr16:56970652G>T	ENST00000439977.2	+	4	551	c.354G>T	c.(352-354)gaG>gaT	p.E118D	HERPUD1_ENST00000379792.2_Missense_Mutation_p.E93D|HERPUD1_ENST00000344114.4_Missense_Mutation_p.E117D|HERPUD1_ENST00000570273.1_3'UTR|HERPUD1_ENST00000300302.5_Missense_Mutation_p.E117D	NM_001010989.1|NM_014685.2	NP_001010989.1|NP_055500.1	Q15011	HERP1_HUMAN	homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1	118					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular calcium ion homeostasis (GO:0006874)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of protein binding (GO:0032092)|regulation of protein ubiquitination (GO:0031396)|response to unfolded protein (GO:0006986)|ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|stomach(1)	11						AGTATCCTGAGGATTCCTCAA	0.443			T	ERG	prostate																																p.E118D		Atlas-SNP	.		Dom	yes		16	16q12.2-q13	9709	"""homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1"""		E	.	HERPUD1	28	.	0			c.G354T						PASS	.						142.0	131.0	135.0					16																	56970652		2198	4300	6498	SO:0001583	missense	9709	exon4			TCCTGAGGATTCC	AB034989	CCDS10771.1, CCDS45492.1	16q13	2008-05-14			ENSG00000051108	ENSG00000051108			13744	protein-coding gene	gene with protein product		608070				10922362, 10708769	Standard	NM_001010989		Approved	KIAA0025, Mif1, HERP, SUP	uc002eke.2	Q15011	OTTHUMG00000133276	ENST00000439977.2:c.354G>T	chr16.hg19:g.56970652G>T	ENSP00000409555:p.Glu118Asp	85.0	0.0	.		77.0	41.0	.	NM_014685	E9PGD1|O60644|Q6IAN8|Q96D92	Missense_Mutation	SNP	ENST00000439977.2	hg19	CCDS10771.1	.	.	.	.	.	.	.	.	.	.	G	11.41	1.631353	0.28978	.	.	ENSG00000051108	ENST00000439977;ENST00000379792;ENST00000300302;ENST00000344114	T;T	0.44881	1.51;0.91	6.16	3.15	0.36227	.	0.708796	0.14867	N	0.293775	T	0.20577	0.0495	N	0.08118	0	0.26730	N	0.970611	B;B;B;B;B;B	0.20988	0.017;0.008;0.033;0.0;0.05;0.029	B;B;B;B;B;B	0.19666	0.008;0.026;0.022;0.0;0.019;0.009	T	0.21552	-1.0242	10	0.14656	T	0.56	-20.3489	8.8344	0.35104	0.2378:0.0:0.7622:0.0	.	118;117;118;93;117;118	B4E3N8;Q15011-3;A4UAE9;E9PGD1;Q15011-2;Q15011	.;.;.;.;.;HERP1_HUMAN	D	117;93;118;117	ENSP00000369118:E93D;ENSP00000340931:E117D	ENSP00000300302:E118D	E	+	3	2	HERPUD1	55528153	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	0.509000	0.22707	0.939000	0.37446	0.650000	0.86243	GAG	.	.	.	none		0.443	HERPUD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257056.5		
ZFHX3	463	hgsc.bcm.edu	37	16	72984698	72984698	+	Silent	SNP	G	G	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr16:72984698G>A	ENST00000268489.5	-	3	3558	c.2886C>T	c.(2884-2886)ggC>ggT	p.G962G	ZFHX3_ENST00000397992.5_Silent_p.G48G	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	962					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				TCATGTGCAGGCCCAGCATGT	0.607																																					p.G962G		Atlas-SNP	.											.	ZFHX3	404	.	0			c.C2886T						PASS	.						106.0	90.0	96.0					16																	72984698		2198	4300	6498	SO:0001819	synonymous_variant	463	exon3			GTGCAGGCCCAGC	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.2886C>T	chr16.hg19:g.72984698G>A		38.0	0.0	.		260.0	65.0	.	NM_006885	D3DWS8|O15101|Q13719	Silent	SNP	ENST00000268489.5	hg19	CCDS10908.1																																																																																			.	.	.	none		0.607	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
USP6	9098	hgsc.bcm.edu	37	17	5042939	5042939	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr17:5042939A>C	ENST00000574788.1	+	22	3698	c.1468A>C	c.(1468-1470)Acc>Ccc	p.T490P	USP6_ENST00000332776.4_Missense_Mutation_p.T490P|USP6_ENST00000304328.5_Missense_Mutation_p.T173P|USP6_ENST00000250066.6_Missense_Mutation_p.T490P			P35125	UBP6_HUMAN	ubiquitin specific peptidase 6	490					cellular protein modification process (GO:0006464)|protein deubiquitination (GO:0016579)|regulation of vesicle-mediated transport (GO:0060627)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	calmodulin binding (GO:0005516)|cysteine-type endopeptidase activity (GO:0004197)|nucleic acid binding (GO:0003676)|Rab GTPase activator activity (GO:0005097)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						CCAGCTGGCCACCTGCTGGCA	0.607			T	"""COL1A1, CDH11, ZNF9, OMD"""	aneurysmal bone cysts																																p.T490P		Atlas-SNP	.		Dom	yes		17	17p13	9098	ubiquitin specific peptidase 6 (Tre-2 oncogene)		M	.	USP6	213	.	0			c.A1468C						PASS	.						44.0	48.0	47.0					17																	5042939		2203	4300	6503	SO:0001583	missense	9098	exon14			CTGGCCACCTGCT	X63547	CCDS11069.2	17p13	2014-06-12	2014-06-12		ENSG00000129204	ENSG00000129204	3.4.19.12	"""Ubiquitin-specific peptidases"""	12629	protein-coding gene	gene with protein product	"""ubiquitin carboxyl-terminal hydrolase 6"", ""TBC1D3 and USP32 fusion"", ""Tre-2 oncogene"""	604334	"""ubiquitin specific protease 6 (Tre-2 oncogene)"", ""TRE oncogene, Smith Magenis syndrome chromosome region"", ""ubiquitin specific peptidase 6 (Tre-2 oncogene)"""	HRP1, TRESMCR		12838346, 1349106	Standard	NM_004505		Approved	Tre-2, TRE17, Tre2	uc002gav.1	P35125	OTTHUMG00000099449	ENST00000574788.1:c.1468A>C	chr17.hg19:g.5042939A>C	ENSP00000460380:p.Thr490Pro	66.0	0.0	.		325.0	20.0	.	NM_004505	Q15634|Q86WP6|Q8IWT4	Missense_Mutation	SNP	ENST00000574788.1	hg19	CCDS11069.2	.	.	.	.	.	.	.	.	.	.	A	0.016	-1.512750	0.00975	.	.	ENSG00000129204	ENST00000332776;ENST00000250066;ENST00000304328	T;T;T	0.13901	2.55;3.03;2.73	0.0465	0.0465	0.14256	.	0.094876	0.64402	D	0.000001	T	0.09423	0.0232	N	0.08118	0	0.09310	N	1	P;P	0.47106	0.89;0.797	P;B	0.52554	0.702;0.321	T	0.20773	-1.0265	9	0.38643	T	0.18	.	.	.	.	.	173;490	P35125-2;P35125	.;UBP6_HUMAN	P	490;490;173	ENSP00000328010:T490P;ENSP00000250066:T490P;ENSP00000305473:T173P	ENSP00000250066:T490P	T	+	1	0	USP6	4983663	0.933000	0.31639	0.264000	0.24511	0.260000	0.26232	-0.165000	0.09968	0.115000	0.18071	0.113000	0.15668	ACC	.	.	.	none		0.607	USP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438990.1	NM_004505	
PER1	5187	hgsc.bcm.edu	37	17	8047043	8047043	+	Silent	SNP	T	T	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr17:8047043T>G	ENST00000317276.4	-	19	2850	c.2613A>C	c.(2611-2613)ccA>ccC	p.P871P	PER1_ENST00000581082.1_Silent_p.P848P|PER1_ENST00000578089.1_5'UTR	NM_002616.2	NP_002607.2	O15534	PER1_HUMAN	period circadian clock 1	871	Pro-rich.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|entrainment of circadian clock by photoperiod (GO:0043153)|histone H3 acetylation (GO:0043966)|histone H3 deacetylation (GO:0070932)|histone H4 acetylation (GO:0043967)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of circadian rhythm (GO:0042752)|regulation of cytokine production involved in inflammatory response (GO:1900015)|regulation of hair cycle (GO:0042634)|regulation of p38MAPK cascade (GO:1900744)|regulation of sodium ion transport (GO:0002028)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|E-box binding (GO:0070888)|kinase binding (GO:0019900)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|signal transducer activity (GO:0004871)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(15)|ovary(4)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						TAGTGGCTGGTGGGGTGGGCC	0.672			T	ETV6	"""AML, CMML"""			Other conserved DNA damage response genes																													p.P871P		Atlas-SNP	.		Dom	yes		17	17p13.1-17p12	5187	period homolog 1 (Drosophila)		L	PER1,NS,carcinoma,0,1	PER1	104	.	0			c.A2613C						PASS	.						9.0	11.0	10.0					17																	8047043		2183	4270	6453	SO:0001819	synonymous_variant	5187	exon19			GGCTGGTGGGGTG	AB002107	CCDS11131.1	17p13.1	2012-12-13	2012-12-13			ENSG00000179094			8845	protein-coding gene	gene with protein product		602260	"""period (Drosophila) homolog 1"", ""period homolog 1 (Drosophila)"""	PER		9323128	Standard	NM_002616		Approved	RIGUI	uc002gkd.3	O15534		ENST00000317276.4:c.2613A>C	chr17.hg19:g.8047043T>G		11.0	1.0	.		52.0	29.0	.	NM_002616	B2RPA8|B4DI49|D3DTR3	Silent	SNP	ENST00000317276.4	hg19	CCDS11131.1																																																																																			.	.	.	none		0.672	PER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441481.2		
KRTAP4-6	81871	hgsc.bcm.edu	37	17	39296395	39296395	+	Silent	SNP	A	A	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr17:39296395A>G	ENST00000345847.4	-	1	344	c.345T>C	c.(343-345)tgT>tgC	p.C115C		NM_030976.1	NP_112238.1	Q9BYQ5	KRA46_HUMAN	keratin associated protein 4-6	115	30 X 5 AA repeats of C-C-[IRQVEL]-[SPTR]- [STVQRCP].					keratin filament (GO:0045095)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(1)|prostate(1)|urinary_tract(1)	9						AGCTGGGGCGACAGCAGCTGG	0.642																																					p.C115C		Atlas-SNP	.											.	KRTAP4-6	46	.	0			c.T345C						PASS	.																																			SO:0001819	synonymous_variant	81871	exon1			GGGGCGACAGCAG	AJ406938	CCDS54125.1	17q21.2	2013-06-25			ENSG00000198090	ENSG00000198090		"""Keratin associated proteins"""	18909	protein-coding gene	gene with protein product			"""keratin associated protein 4-15"""	KRTAP4-15			Standard	NM_030976		Approved	KAP4.6, KAP4.15	uc010cxk.2	Q9BYQ5	OTTHUMG00000133634	ENST00000345847.4:c.345T>C	chr17.hg19:g.39296395A>G		51.0	0.0	.		187.0	11.0	.	NM_030976	Q9BYR1	Silent	SNP	ENST00000345847.4	hg19	CCDS54125.1																																																																																			.	.	.	none		0.642	KRTAP4-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257779.1		
KRTAP4-2	85291	hgsc.bcm.edu	37	17	39334233	39334233	+	Missense_Mutation	SNP	T	T	G	rs560495299	byFrequency	TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr17:39334233T>G	ENST00000377726.2	-	1	227	c.184A>C	c.(184-186)Agc>Cgc	p.S62R		NM_033062.3	NP_149051	Q9BYR5	KRA42_HUMAN	keratin associated protein 4-2	62	20 X 5 AA repeats OF C-C-[GRQVS]-[SPT]- [VSTQ].					keratin filament (GO:0045095)				kidney(2)|lung(4)|upper_aerodigestive_tract(1)	7		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			CAGCTGGGGCTGCAGCAGGTG	0.657													T|||	17	0.00339457	0.0023	0.0014	5008	,	,		17958	0.0099		0.0	False		,,,				2504	0.0031				p.S62R		Atlas-SNP	.											.	KRTAP4-2	93	.	0			c.A184C						PASS	.						40.0	46.0	44.0					17																	39334233		2201	4298	6499	SO:0001583	missense	85291	exon1			TGGGGCTGCAGCA	AJ406934	CCDS11384.1	17q21.2	2013-06-25			ENSG00000244537	ENSG00000244537		"""Keratin associated proteins"""	18900	protein-coding gene	gene with protein product						11279113	Standard	NM_033062		Approved	KAP4.2	uc002hwd.3	Q9BYR5	OTTHUMG00000133437	ENST00000377726.2:c.184A>C	chr17.hg19:g.39334233T>G	ENSP00000366955:p.Ser62Arg	123.0	0.0	.		477.0	30.0	.	NM_033062	A0JP64	Missense_Mutation	SNP	ENST00000377726.2	hg19	CCDS11384.1	.	.	.	.	.	.	.	.	.	.	.	0.738	-0.777466	0.02929	.	.	ENSG00000244537	ENST00000377726;ENST00000458321	T	0.00603	6.28	4.67	-1.59	0.08453	.	1.674050	0.04249	N	0.338307	T	0.00178	0.0005	N	0.00011	-3.005	0.09310	N	1	B	0.16802	0.019	B	0.20955	0.032	T	0.51608	-0.8684	10	0.12766	T	0.61	.	14.1242	0.65210	0.0:0.0:0.3626:0.6374	.	62	Q9BYR5	KRA42_HUMAN	R	62;179	ENSP00000366955:S62R	ENSP00000366955:S62R	S	-	1	0	KRTAP4-2	36587759	0.000000	0.05858	0.001000	0.08648	0.119000	0.20118	-2.321000	0.01119	-0.438000	0.07232	-1.986000	0.00452	AGC	.	.	.	none		0.657	KRTAP4-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257305.1		
KRTAP4-1	85285	hgsc.bcm.edu	37	17	39340878	39340878	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr17:39340878T>G	ENST00000398472.1	-	1	716	c.229A>C	c.(229-231)Agc>Cgc	p.S77R				Q9BYQ7	KRA41_HUMAN	keratin associated protein 4-1	77	18 X 5 AA repeats of C-C-[GRQC]-[SPT]- [VSTL].					keratin filament (GO:0045095)				kidney(1)|large_intestine(1)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	5		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			ACACCACAGCTGGGGCGGCAG	0.642																																					p.S77R		Atlas-SNP	.											.	KRTAP4-1	58	.	0			c.A229C						PASS	.						21.0	25.0	24.0					17																	39340878		2070	4197	6267	SO:0001583	missense	85285	exon1			CACAGCTGGGGCG	AC006070		17q21.2	2013-06-25			ENSG00000198443	ENSG00000198443		"""Keratin associated proteins"""	18907	protein-coding gene	gene with protein product			"""keratin associated protein 4-10"""	KRTAP4-10		11279113	Standard	NM_033060		Approved	KAP4.1, KAP4.10	uc002hwe.4	Q9BYQ7	OTTHUMG00000132081	ENST00000398472.1:c.229A>C	chr17.hg19:g.39340878T>G	ENSP00000381489:p.Ser77Arg	104.0	0.0	.		197.0	9.0	.	NM_033060	A8MWS7|Q3SYF2	Missense_Mutation	SNP	ENST00000398472.1	hg19		.	.	.	.	.	.	.	.	.	.	T	13.90	2.375762	0.42105	.	.	ENSG00000244537;ENSG00000198443;ENSG00000198443	ENST00000458321;ENST00000398472;ENST00000334190	T	0.00737	5.76	5.02	2.28	0.28536	.	.	.	.	.	T	0.00637	0.0021	.	.	.	0.25986	N	0.98232	B	0.21905	0.062	B	0.15870	0.014	T	0.49322	-0.8952	8	0.59425	D	0.04	.	1.9461	0.03357	0.2357:0.2353:0.0:0.5289	.	77	Q9BYQ7	KRA41_HUMAN	R	73;77;77	ENSP00000381489:S77R	ENSP00000335483:S77R	S	-	1	0	KRTAP4-2;KRTAP4-1	36594404	0.742000	0.28228	1.000000	0.80357	0.970000	0.65996	0.669000	0.25142	1.854000	0.53819	0.482000	0.46254	AGC	.	.	.	none		0.642	KRTAP4-1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000255108.1	NM_033060	
GHDC	84514	hgsc.bcm.edu	37	17	40344945	40344945	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr17:40344945G>T	ENST00000301671.8	-	3	807	c.366C>A	c.(364-366)gaC>gaA	p.D122E	GHDC_ENST00000436923.2_Missense_Mutation_p.D122E|GHDC_ENST00000428494.2_Intron|GHDC_ENST00000587427.1_Missense_Mutation_p.D122E|GHDC_ENST00000414034.3_Missense_Mutation_p.D122E|GHDC_ENST00000593209.1_Missense_Mutation_p.D122E|GHDC_ENST00000590520.1_5'Flank			Q8N2G8	GHDC_HUMAN	GH3 domain containing	122						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		all_cancers(22;0.000229)|Breast(137;0.00104)|all_epithelial(22;0.00304)		BRCA - Breast invasive adenocarcinoma(366;0.124)		CCTCCCCAAGGTCCTGGTTTG	0.607																																					p.D122E		Atlas-SNP	.											.	GHDC	63	.	0			c.C366A						PASS	.						105.0	118.0	113.0					17																	40344945		2203	4300	6503	SO:0001583	missense	84514	exon4			CCCAAGGTCCTGG	AF316997, BC011056	CCDS11422.1, CCDS45682.1	17q21.2	2006-08-02				ENSG00000167925			24438	protein-coding gene	gene with protein product		608587				11161808, 11735219	Standard	NR_024573		Approved	LGP1	uc002hzf.4	Q8N2G8		ENST00000301671.8:c.366C>A	chr17.hg19:g.40344945G>T	ENSP00000301671:p.Asp122Glu	144.0	0.0	.		674.0	230.0	.	NM_001142623	B4DQS4|E9PDB5|Q9BXM6	Missense_Mutation	SNP	ENST00000301671.8	hg19	CCDS11422.1	.	.	.	.	.	.	.	.	.	.	G	0.862	-0.734923	0.03111	.	.	ENSG00000167925	ENST00000393854;ENST00000414034;ENST00000301671;ENST00000436923	.	.	.	4.61	1.41	0.22369	.	1.247040	0.05644	N	0.583915	T	0.19886	0.0478	N	0.14661	0.345	0.09310	N	1	B;B	0.26400	0.148;0.009	B;B	0.24394	0.053;0.007	T	0.25082	-1.0142	9	0.18276	T	0.48	-0.018	4.8152	0.13363	0.1998:0.1781:0.6221:0.0	.	122;122	Q8N2G8-2;Q8N2G8	.;GHDC_HUMAN	E	66;122;122;122	.	ENSP00000301671:D122E	D	-	3	2	GHDC	37598471	0.000000	0.05858	0.002000	0.10522	0.094000	0.18550	0.158000	0.16422	0.544000	0.28883	0.561000	0.74099	GAC	.	.	.	none		0.607	GHDC-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449794.1	NM_032484	
ITGB4	3691	hgsc.bcm.edu	37	17	73732406	73732406	+	Missense_Mutation	SNP	G	G	C	rs201929789		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr17:73732406G>C	ENST00000200181.3	+	15	1986	c.1799G>C	c.(1798-1800)cGc>cCc	p.R600P	ITGB4_ENST00000579662.1_Missense_Mutation_p.R600P|ITGB4_ENST00000450894.3_Missense_Mutation_p.R600P|ITGB4_ENST00000339591.3_Missense_Mutation_p.R600P|ITGB4_ENST00000449880.2_Missense_Mutation_p.R600P|ITGB4_ENST00000584558.1_3'UTR	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	600	Cysteine-rich tandem repeats.				amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			GAGTGTGGCCGCTGCCACTGC	0.632																																					p.R600P		Atlas-SNP	.											ITGB4,colon,carcinoma,0,1	ITGB4	165	.	0			c.G1799C						PASS	.						65.0	69.0	67.0					17																	73732406		2203	4300	6503	SO:0001583	missense	3691	exon15			GTGGCCGCTGCCA		CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.1799G>C	chr17.hg19:g.73732406G>C	ENSP00000200181:p.Arg600Pro	123.0	0.0	.		385.0	151.0	.	NM_001005731	A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Missense_Mutation	SNP	ENST00000200181.3	hg19	CCDS11727.1	.	.	.	.	.	.	.	.	.	.	G	13.70	2.314176	0.40996	.	.	ENSG00000132470	ENST00000450894;ENST00000200181;ENST00000339591;ENST00000449880	D;D;D	0.94862	-3.54;-3.54;-3.54	4.6	4.6	0.57074	.	0.067612	0.64402	D	0.000010	D	0.97222	0.9092	M	0.83774	2.66	0.58432	D	0.999999	D;D;D;D;D	0.89917	0.999;0.999;1.0;1.0;1.0	D;D;D;D;D	0.79784	0.916;0.961;0.993;0.985;0.985	D	0.98032	1.0377	10	0.72032	D	0.01	.	16.4661	0.84079	0.0:0.0:1.0:0.0	.	560;600;600;600;600	B4E3N0;P16144-5;P16144-3;A0AVL6;P16144	.;.;.;.;ITB4_HUMAN	P	516;600;600;600	ENSP00000200181:R600P;ENSP00000344079:R600P;ENSP00000400217:R600P	ENSP00000200181:R600P	R	+	2	0	ITGB4	71244001	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.642000	0.67888	2.095000	0.63458	0.558000	0.71614	CGC	.	G|0.998;C|0.002	0.002	weak		0.632	ITGB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448334.1		
ABHD17A	81926	hgsc.bcm.edu	37	19	1881347	1881347	+	Silent	SNP	A	A	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:1881347A>G	ENST00000292577.7	-	2	652	c.219T>C	c.(217-219)cgT>cgC	p.R73R	ABHD17A_ENST00000250974.9_Silent_p.R73R|ABHD17A_ENST00000590661.1_Silent_p.R73R	NM_001130111.1	NP_001123583.1	Q96GS6	AB17A_HUMAN	abhydrolase domain containing 17A	73						extracellular region (GO:0005576)|membrane (GO:0016020)	hydrolase activity (GO:0016787)										GGAAGTCGGCACGCTCCGTCA	0.716																																					p.R73R		Atlas-SNP	.											FAM108A1,NS,carcinoma,0,1	FAM108A1	29	.	0			c.T219C						PASS	.						19.0	22.0	21.0					19																	1881347		2188	4262	6450	SO:0001819	synonymous_variant	81926	exon2			GTCGGCACGCTCC	BC020512	CCDS32867.1, CCDS45902.1	19p13.3	2013-03-15	2013-03-15	2013-03-15	ENSG00000129968	ENSG00000129968		"""Abhydrolase domain containing"""	28756	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 27"", ""family with sequence similarity 108, member A1"""	C19orf27, FAM108A1		14702039	Standard	NM_031213		Approved	MGC5244	uc002lug.3	Q96GS6	OTTHUMG00000171872	ENST00000292577.7:c.219T>C	chr19.hg19:g.1881347A>G		75.0	0.0	.		190.0	8.0	.	NM_031213	A8K0G8|D6W5Z9|Q6PJU2|Q8WUH9|Q9BWL0|Q9H7Q9	Silent	SNP	ENST00000292577.7	hg19	CCDS45902.1																																																																																			.	.	.	none		0.716	ABHD17A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415556.2	NM_031213	
PLEKHJ1	55111	hgsc.bcm.edu	37	19	2234038	2234038	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:2234038G>T	ENST00000589097.1	-	6	1456	c.343C>A	c.(343-345)Ctc>Atc	p.L115I	PLEKHJ1_ENST00000589791.1_5'UTR|PLEKHJ1_ENST00000587394.2_Missense_Mutation_p.L115I|PLEKHJ1_ENST00000586608.2_Missense_Mutation_p.L116I|PLEKHJ1_ENST00000591099.2_Silent_p.A84A|SF3A2_ENST00000221494.5_5'Flank|PLEKHJ1_ENST00000587962.2_Missense_Mutation_p.L115I|PLEKHJ1_ENST00000326631.2_Missense_Mutation_p.L115I|MIR1227_ENST00000408484.1_RNA			Q9NW61	PKHJ1_HUMAN	pleckstrin homology domain containing, family J member 1	115										endometrium(1)|kidney(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TAGAAGATGAGGCTTCTCCGC	0.642																																					p.L115I		Atlas-SNP	.											.	PLEKHJ1	7	.	0			c.C343A						PASS	.						119.0	107.0	111.0					19																	2234038		2203	4300	6503	SO:0001583	missense	55111	exon5			AGATGAGGCTTCT	AK001159	CCDS12083.1, CCDS74251.1	19p13.3	2013-01-10				ENSG00000104886		"""Pleckstrin homology (PH) domain containing"""	18211	protein-coding gene	gene with protein product	"""guanine nucleotide releasing protein x"""					11602354	Standard	XM_006722784		Approved	FLJ10297	uc002lvf.1	Q9NW61		ENST00000589097.1:c.343C>A	chr19.hg19:g.2234038G>T	ENSP00000465391:p.Leu115Ile	176.0	0.0	.		567.0	185.0	.	NM_018049	B3KUQ9|D6W604	Missense_Mutation	SNP	ENST00000589097.1	hg19	CCDS12083.1	.	.	.	.	.	.	.	.	.	.	G	12.10	1.836779	0.32421	.	.	ENSG00000104886	ENST00000326631	.	.	.	4.05	2.94	0.34122	.	0.176721	0.36591	N	0.002508	T	0.28234	0.0697	L	0.32530	0.975	0.42701	D	0.993613	P	0.42692	0.787	B	0.33121	0.158	T	0.06881	-1.0802	9	0.33940	T	0.23	-16.6324	7.7627	0.28961	0.0916:0.0:0.7474:0.161	.	115	Q9NW61	PKHJ1_HUMAN	I	115	.	ENSP00000318075:L115I	L	-	1	0	PLEKHJ1	2185038	1.000000	0.71417	0.983000	0.44433	0.410000	0.31052	5.117000	0.64667	1.788000	0.52465	0.561000	0.74099	CTC	.	.	.	none		0.642	PLEKHJ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451255.1	NM_018049	
KDM4B	23030	hgsc.bcm.edu	37	19	5131903	5131903	+	Silent	SNP	G	G	C	rs544835411		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:5131903G>C	ENST00000159111.4	+	13	2009	c.1791G>C	c.(1789-1791)ccG>ccC	p.P597P	KDM4B_ENST00000536461.1_Silent_p.P631P	NM_015015.2	NP_055830	O94953	KDM4B_HUMAN	lysine (K)-specific demethylase 4B	597					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(1)|liver(1)|lung(14)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32						TTCAGGCACCGTCCACATTTT	0.652																																					p.P597P		Atlas-SNP	.											.	KDM4B	120	.	0			c.G1791C						PASS	.						36.0	39.0	38.0					19																	5131903		2201	4299	6500	SO:0001819	synonymous_variant	23030	exon13			GGCACCGTCCACA	AB020683	CCDS12138.1	19p13.3	2013-01-23	2009-04-06	2009-04-06		ENSG00000127663		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	29136	protein-coding gene	gene with protein product	"""tudor domain containing 14B"""	609765	"""jumonji domain containing 2B"""	JMJD2B		10048485, 15138608	Standard	NM_015015		Approved	KIAA0876, TDRD14B	uc002mbq.4	O94953		ENST00000159111.4:c.1791G>C	chr19.hg19:g.5131903G>C		31.0	0.0	.		89.0	20.0	.	NM_015015	B9EGN8|D6W631|O75274|Q6P3R5|Q9P1V1|Q9UF40	Silent	SNP	ENST00000159111.4	hg19	CCDS12138.1																																																																																			.	.	.	none		0.652	KDM4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450558.1	NM_015015	
CCDC130	81576	hgsc.bcm.edu	37	19	13875777	13875777	+	IGR	SNP	C	C	T	rs558173579	byFrequency	TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:13875777C>T	ENST00000586600.1	+	0	1922				MRI1_ENST00000319545.8_Silent_p.L75L|MRI1_ENST00000040663.6_Silent_p.L75L			P13994	CC130_HUMAN	coiled-coil domain containing 130						response to virus (GO:0009615)					endometrium(2)|kidney(1)|large_intestine(3)|ovary(1)|skin(2)|urinary_tract(1)	10			OV - Ovarian serous cystadenocarcinoma(19;6.02e-23)|Epithelial(5;2.58e-18)			TCGCCGCGCTCGTGGCCTTCG	0.756													C|||	13	0.00259585	0.0098	0.0	5008	,	,		6863	0.0		0.0	False		,,,				2504	0.0				p.L75L		Atlas-SNP	.											.	MRI1	35	.	0			c.C225T						PASS	.						4.0	5.0	4.0					19																	13875777		1806	3486	5292	SO:0001628	intergenic_variant	84245	exon2			CGCGCTCGTGGCC	AF250306	CCDS12296.1	19p13.13	2008-02-05				ENSG00000104957			28118	protein-coding gene	gene with protein product						3203696	Standard	NM_030818		Approved	MGC10471	uc002mxc.1	P13994			chr19.hg19:g.13875777C>T		0.0	0.0	.		8.0	6.0	.	NM_001031727	Q9BQ72	Silent	SNP	ENST00000586600.1	hg19	CCDS12296.1																																																																																			.	.	.	none		0.756	CCDC130-001	KNOWN	alternative_5_UTR|upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453216.2	NM_030818	
UBA2	10054	hgsc.bcm.edu	37	19	34921484	34921484	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:34921484G>C	ENST00000246548.4	+	2	212	c.142G>C	c.(142-144)Gat>Cat	p.D48H	UBA2_ENST00000439527.2_5'UTR|CTD-2588C8.8_ENST00000592220.1_RNA	NM_005499.2	NP_005490.1	Q9UBT2	SAE2_HUMAN	ubiquitin-like modifier activating enzyme 2	48					cellular protein metabolic process (GO:0044267)|positive regulation of catalytic activity (GO:0043085)|post-translational protein modification (GO:0043687)|protein sumoylation (GO:0016925)|SMT3-dependent protein catabolic process (GO:0019950)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|SUMO activating enzyme complex (GO:0031510)	ATP binding (GO:0005524)|enzyme activator activity (GO:0008047)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|SUMO activating enzyme activity (GO:0019948)			breast(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	20	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			TTTGTAGATTGATCTGGATAC	0.358																																					p.D48H		Atlas-SNP	.											.	UBA2	53	.	0			c.G142C						PASS	.						185.0	170.0	175.0					19																	34921484		2203	4300	6503	SO:0001583	missense	10054	exon2			TAGATTGATCTGG	BC003153	CCDS12439.1	19q13.11	2008-02-05	2007-11-30	2007-11-30		ENSG00000126261		"""Ubiquitin-like modifier activating enzymes"""	30661	protein-coding gene	gene with protein product	"""UBA2, ubiquitin-activating enzyme E1 homolog (yeast)"""	613295	"""SUMO1 activating enzyme subunit 2"""	SAE2		10187858, 9920803	Standard	NM_005499		Approved	FLJ13058, HRIHFB2115, ARX	uc002nvk.3	Q9UBT2		ENST00000246548.4:c.142G>C	chr19.hg19:g.34921484G>C	ENSP00000246548:p.Asp48His	95.0	0.0	.		152.0	52.0	.	NM_005499	B3KWB9|O95605|Q59H87|Q6IBP6|Q9NTJ1|Q9UED2	Missense_Mutation	SNP	ENST00000246548.4	hg19	CCDS12439.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.624070	0.87560	.	.	ENSG00000126261	ENST00000246548	D	0.84442	-1.85	5.22	5.22	0.72569	UBA/THIF-type NAD/FAD binding fold (1);Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);	0.100210	0.64402	D	0.000001	D	0.96565	0.8879	H	0.99937	4.99	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	D	0.98698	1.0699	10	0.87932	D	0	-19.2256	17.8923	0.88876	0.0:0.0:1.0:0.0	.	48	Q9UBT2	SAE2_HUMAN	H	48	ENSP00000246548:D48H	ENSP00000246548:D48H	D	+	1	0	UBA2	39613324	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.953000	0.93041	2.603000	0.88011	0.563000	0.77884	GAT	.	.	.	none		0.358	UBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459257.3	NM_005499	
RYR1	6261	hgsc.bcm.edu	37	19	39039030	39039030	+	Silent	SNP	T	T	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:39039030T>C	ENST00000359596.3	+	89	12252	c.12252T>C	c.(12250-12252)cgT>cgC	p.R4084R	RYR1_ENST00000360985.3_Silent_p.R4079R|RYR1_ENST00000355481.4_Silent_p.R4079R			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	4084					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CGGATCCCCGTGGCCTCATCT	0.557																																					p.R4084R		Atlas-SNP	.											.	RYR1	708	.	0			c.T12252C						PASS	.						132.0	113.0	119.0					19																	39039030		2203	4300	6503	SO:0001819	synonymous_variant	6261	exon89			TCCCCGTGGCCTC	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.12252T>C	chr19.hg19:g.39039030T>C		99.0	0.0	.		299.0	101.0	.	NM_000540	Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	ENST00000359596.3	hg19	CCDS33011.1																																																																																			.	.	.	none		0.557	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
FCGBP	8857	hgsc.bcm.edu	37	19	40366038	40366038	+	Silent	SNP	C	C	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:40366038C>G	ENST00000221347.6	-	30	14203	c.14196G>C	c.(14194-14196)ccG>ccC	p.P4732P		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	4732						extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GACAGAAGTCCGGCCGCCTCC	0.647																																					p.P4732P		Atlas-SNP	.											.	FCGBP	416	.	0			c.G14196C						PASS	.																																			SO:0001819	synonymous_variant	8857	exon30			GAAGTCCGGCCGC	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.14196G>C	chr19.hg19:g.40366038C>G		164.0	0.0	.		205.0	59.0	.	NM_003890	O95784	Silent	SNP	ENST00000221347.6	hg19	CCDS12546.1																																																																																			.	.	.	none		0.647	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
NUCB1	4924	hgsc.bcm.edu	37	19	49422348	49422348	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:49422348G>A	ENST00000405315.4	+	9	1212	c.878G>A	c.(877-879)cGa>cAa	p.R293Q	NUCB1_ENST00000485798.1_Intron|NUCB1_ENST00000263273.5_Missense_Mutation_p.R293Q|NUCB1-AS1_ENST00000416432.1_RNA|NUCB1_ENST00000407032.1_Missense_Mutation_p.R293Q	NM_006184.5	NP_006175.2	Q02818	NUCB1_HUMAN	nucleobindin 1	293	Binds to GNAI2 and GNAI3. {ECO:0000250}.|EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.					endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)			cervix(1)|endometrium(4)|large_intestine(4)|lung(8)	17		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000171)|all cancers(93;0.000333)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0244)		GAGGAGGAGCGACTGCGCATG	0.612																																					p.R293Q		Atlas-SNP	.											.	NUCB1	44	.	0			c.G878A						PASS	.						56.0	58.0	58.0					19																	49422348		2203	4300	6503	SO:0001583	missense	4924	exon9			AGGAGCGACTGCG	BC002356	CCDS12740.1	19q13.33	2013-01-10			ENSG00000104805	ENSG00000104805		"""EF-hand domain containing"""	8043	protein-coding gene	gene with protein product		601323				8661046	Standard	NM_006184		Approved	NUC, Calnuc	uc002plb.4	Q02818	OTTHUMG00000152514	ENST00000405315.4:c.878G>A	chr19.hg19:g.49422348G>A	ENSP00000385923:p.Arg293Gln	39.0	0.0	.		126.0	43.0	.	NM_006184	B2RD64|Q15838|Q7Z4J7|Q9BUR1	Missense_Mutation	SNP	ENST00000405315.4	hg19	CCDS12740.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.875643|5.875643	0.97055|0.97055	.|.	.|.	ENSG00000104805|ENSG00000104805	ENST00000424608|ENST00000405315;ENST00000407032;ENST00000263273	.|T;T;T	.|0.71698	.|-0.59;-0.59;-0.59	5.01|5.01	5.01|5.01	0.66863|0.66863	.|EF-hand-like domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.81437|0.81437	0.4822|0.4822	M|M	0.64630|0.64630	1.985|1.985	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.72982	.|0.979;0.979	T|T	0.80596|0.80596	-0.1312|-0.1312	5|10	.|0.40728	.|T	.|0.16	.|.	16.1855|16.1855	0.81948|0.81948	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|293;293	.|Q02818;Q53GX6	.|NUCB1_HUMAN;.	N|Q	263|293	.|ENSP00000385923:R293Q;ENSP00000385211:R293Q;ENSP00000263273:R293Q	.|ENSP00000263273:R293Q	D|R	+|+	1|2	0|0	NUCB1|NUCB1	54114160|54114160	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	9.177000|9.177000	0.94849|0.94849	2.514000|2.514000	0.84764|0.84764	0.591000|0.591000	0.81541|0.81541	GAC|CGA	.	.	.	none		0.612	NUCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326545.2	NM_006184	
ZNF665	79788	hgsc.bcm.edu	37	19	53668284	53668284	+	Nonsense_Mutation	SNP	T	T	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:53668284T>A	ENST00000600412.1	-	2	1379	c.1264A>T	c.(1264-1266)Aag>Tag	p.K422*	CTD-2245F17.2_ENST00000600257.1_RNA|ZNF665_ENST00000396424.3_Nonsense_Mutation_p.K487*			Q9H7R5	ZN665_HUMAN	zinc finger protein 665	422					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	35				GBM - Glioblastoma multiforme(134;0.0196)		TCATCACACTTGTAAGGTTTC	0.413																																					p.K487X		Atlas-SNP	.											.	ZNF665	136	.	0			c.A1459T						PASS	.						91.0	95.0	93.0					19																	53668284		2203	4300	6503	SO:0001587	stop_gained	79788	exon4			CACACTTGTAAGG		CCDS46169.1	19q13.42	2013-01-08				ENSG00000197497		"""Zinc fingers, C2H2-type"", ""-"""	25885	protein-coding gene	gene with protein product							Standard	NM_024733		Approved	FLJ14345	uc010eqm.1	Q9H7R5		ENST00000600412.1:c.1264A>T	chr19.hg19:g.53668284T>A	ENSP00000469154:p.Lys422*	88.0	0.0	.		217.0	68.0	.	NM_024733	A8K5T8	Nonsense_Mutation	SNP	ENST00000600412.1	hg19		.	.	.	.	.	.	.	.	.	.	T	17.85	3.490740	0.64074	.	.	ENSG00000197497	ENST00000396424	.	.	.	2.18	1.14	0.20703	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.3597	0.21420	0.0:0.1475:0.0:0.8525	.	.	.	.	X	487	.	ENSP00000379702:K487X	K	-	1	0	ZNF665	58360096	0.000000	0.05858	0.027000	0.17364	0.049000	0.14656	-2.447000	0.01010	1.001000	0.39076	0.358000	0.22013	AAG	.	.	.	none		0.413	ZNF665-002	PUTATIVE	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000464179.1	NM_024733	
LILRB2	10288	hgsc.bcm.edu	37	19	54783677	54783677	+	Silent	SNP	C	C	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:54783677C>T	ENST00000391749.4	-	4	595	c.324G>A	c.(322-324)gaG>gaA	p.E108E	LILRB2_ENST00000314446.5_Silent_p.E108E|LILRB2_ENST00000391746.1_Silent_p.E108E|LILRB2_ENST00000434421.1_5'UTR|LILRB2_ENST00000471216.1_5'Flank|LILRB2_ENST00000391748.1_Silent_p.E108E|MIR4752_ENST00000579672.1_RNA	NM_001278406.1	NP_001265335.1	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2	108	Ig-like C2-type 1.				cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|negative regulation of antigen processing and presentation (GO:0002578)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T cell tolerance induction (GO:0002666)|regulation of dendritic cell differentiation (GO:2001198)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|inhibitory MHC class I receptor activity (GO:0032396)|MHC class I protein binding (GO:0042288)|MHC class Ib protein binding (GO:0023029)|protein phosphatase 1 binding (GO:0008157)|receptor activity (GO:0004872)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(30)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	44	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GGTCACTGAGCTCAGACCACC	0.602																																					p.E108E		Atlas-SNP	.											.	LILRB2	94	.	0			c.G324A						PASS	.						105.0	105.0	105.0					19																	54783677		2203	4300	6503	SO:0001819	synonymous_variant	10288	exon4			ACTGAGCTCAGAC	AF000574	CCDS12886.1, CCDS42612.1, CCDS62791.1, CCDS62792.1	19q13.4	2013-01-11			ENSG00000131042	ENSG00000131042		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6606	protein-coding gene	gene with protein product		604815				9151699, 9079806	Standard	XM_006722966		Approved	LIR-2, ILT4, MIR-10, LIR2, CD85d, MIR10	uc002qfb.3	Q8N423	OTTHUMG00000064896	ENST00000391749.4:c.324G>A	chr19.hg19:g.54783677C>T		101.0	0.0	.		359.0	108.0	.	NM_005874	A8MU67|C9JF29|O75017|Q8NHJ7|Q8NHJ8	Silent	SNP	ENST00000391749.4	hg19	CCDS12886.1																																																																																			.	.	.	none		0.602	LILRB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139510.1		
ZNF71	58491	hgsc.bcm.edu	37	19	57133670	57133670	+	Missense_Mutation	SNP	T	T	G	rs575219516		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:57133670T>G	ENST00000328070.6	+	3	1249	c.1015T>G	c.(1015-1017)Tcc>Gcc	p.S339A		NM_021216.4	NP_067039.1	Q9NQZ8	ZNF71_HUMAN	zinc finger protein 71	339					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S339A(1)		endometrium(3)|large_intestine(5)|lung(13)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	26				GBM - Glioblastoma multiforme(193;0.062)|Lung(386;0.0681)|LUSC - Lung squamous cell carcinoma(496;0.18)		CAGCCAGAGCTCCTACCTCAT	0.632													.|||	1	0.000199681	0.0	0.0014	5008	,	,		21342	0.0		0.0	False		,,,				2504	0.0				p.S339A		Atlas-SNP	.											ZNF71,NS,carcinoma,0,1	ZNF71	69	.	1	Substitution - Missense(1)	endometrium(1)	c.T1015G						PASS	.						87.0	80.0	82.0					19																	57133670		2203	4300	6503	SO:0001583	missense	58491	exon3			CAGAGCTCCTACC	X60074	CCDS12947.1	19q13.4	2013-01-08	2006-05-12			ENSG00000197951		"""Zinc fingers, C2H2-type"""	13141	protein-coding gene	gene with protein product		194545	"""zinc finger protein 71 (Cos26)"""			1639391	Standard	NM_021216		Approved	Cos26, EZFIT	uc002qnm.4	Q9NQZ8		ENST00000328070.6:c.1015T>G	chr19.hg19:g.57133670T>G	ENSP00000328245:p.Ser339Ala	127.0	0.0	.		180.0	9.0	.	NM_021216	Q15919|Q9UC09|Q9UQD3	Missense_Mutation	SNP	ENST00000328070.6	hg19	CCDS12947.1	.	.	.	.	.	.	.	.	.	.	T	11.73	1.726062	0.30593	.	.	ENSG00000197951	ENST00000328070	T	0.35421	1.31	3.76	1.4	0.22301	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.34135	0.0887	M	0.69358	2.11	0.09310	N	1	B	0.21452	0.056	B	0.15052	0.012	T	0.27157	-1.0082	9	0.44086	T	0.13	.	8.5519	0.33458	0.0:0.0:0.3775:0.6225	.	339	Q9NQZ8	ZNF71_HUMAN	A	339	ENSP00000328245:S339A	ENSP00000328245:S339A	S	+	1	0	ZNF71	61825482	0.000000	0.05858	0.996000	0.52242	0.982000	0.71751	-3.336000	0.00507	0.480000	0.27534	0.459000	0.35465	TCC	.	.	.	none		0.632	ZNF71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459798.2	NM_021216	
NF2	4771	hgsc.bcm.edu	37	22	30000103	30000103	+	Splice_Site	SNP	T	T	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr22:30000103T>G	ENST00000338641.4	+	1	555		c.e1+2		NF2_ENST00000361452.4_Splice_Site|NF2_ENST00000353887.4_Splice_Site|NF2_ENST00000413209.2_Splice_Site|NF2_ENST00000334961.7_Splice_Site|NF2_ENST00000397789.3_Splice_Site|NF2_ENST00000403999.3_Splice_Site|NF2_ENST00000361166.4_Splice_Site|NF2_ENST00000347330.5_Splice_Site|NF2_ENST00000403435.1_Splice_Site|NF2_ENST00000361676.4_Splice_Site	NM_000268.3|NM_016418.5|NM_181832.2	NP_000259.1|NP_057502.2|NP_861970.1	P35240	MERL_HUMAN	neurofibromin 2 (merlin)						actin cytoskeleton organization (GO:0030036)|cell-cell junction organization (GO:0045216)|ectoderm development (GO:0007398)|hippocampus development (GO:0021766)|lens fiber cell differentiation (GO:0070306)|mesoderm formation (GO:0001707)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of DNA replication (GO:0008156)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell differentiation (GO:0045597)|positive regulation of stress fiber assembly (GO:0051496)|regulation of hippo signaling (GO:0035330)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of protein localization to nucleus (GO:1900180)|regulation of protein stability (GO:0031647)|Schwann cell proliferation (GO:0014010)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|cleavage furrow (GO:0032154)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome (GO:0005769)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)		p.?(1)		NS(1)|bone(2)|breast(5)|central_nervous_system(21)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(17)|large_intestine(9)|liver(1)|lung(9)|meninges(372)|ovary(2)|pituitary(1)|pleura(9)|prostate(1)|skin(7)|soft_tissue(303)|stomach(2)|thyroid(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	776						AATTGCGAGGTAACCGGCCGG	0.562			"""D, Mis, N, F, S, O"""		"""meningioma, acoustic neuroma, renal """	"""meningioma, acoustic neuroma"""			Neurofibromatosis, type 2																												.		Atlas-SNP	.	yes	Rec	yes	Neurofibromatosis type 2	22	22q12.2	4771	neurofibromatosis type 2 gene		O	.	NF2	1312	.	1	Unknown(1)	lung(1)	c.114+2T>G						PASS	.						35.0	25.0	29.0					22																	30000103		2202	4299	6501	SO:0001630	splice_region_variant	4771	exon1	Familial Cancer Database	NF2, Central Neurofibromatosis, Bilateral Acoustic Neurofibromatosis	GCGAGGTAACCGG	L11353	CCDS13861.1, CCDS13862.1, CCDS13863.1, CCDS13864.1, CCDS13865.1, CCDS54516.1	22q12.2	2014-09-17	2007-12-17		ENSG00000186575	ENSG00000186575		"""A-kinase anchor proteins"""	7773	protein-coding gene	gene with protein product	"""moesin-ezrin-radixin like"", ""schwannomin"""	607379	"""neurofibromin 2 (bilateral acoustic neuroma)"""			10591208	Standard	NM_000268		Approved	merlin	uc003age.4	P35240	OTTHUMG00000030727	ENST00000338641.4:c.114+2T>G	chr22.hg19:g.30000103T>G		7.0	0.0	.		17.0	15.0	.	NM_016418	O95683|Q8WUJ2|Q969N0|Q969Q3|Q96T30|Q96T31|Q96T32|Q96T33|Q9BTW3|Q9UNG9|Q9UNH3|Q9UNH4	Splice_Site	SNP	ENST00000338641.4	hg19	CCDS13861.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.472138	0.84533	.	.	ENSG00000186575	ENST00000413209;ENST00000347330;ENST00000338641;ENST00000403435;ENST00000361452;ENST00000397822;ENST00000403999;ENST00000334961;ENST00000353887;ENST00000397789;ENST00000361676;ENST00000361166	.	.	.	5.37	5.37	0.77165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0321	0.71717	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	NF2	28330103	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	5.795000	0.69074	2.034000	0.60081	0.459000	0.35465	.	.	.	.	none		0.562	NF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075615.3	NM_000268	Intron
MAOA	4128	hgsc.bcm.edu	37	X	43590945	43590945	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chrX:43590945A>C	ENST00000338702.3	+	8	923	c.800A>C	c.(799-801)aAa>aCa	p.K267T	MAOA_ENST00000542639.1_Missense_Mutation_p.K134T	NM_000240.3	NP_000231.1	P21397	AOFA_HUMAN	monoamine oxidase A	267					cellular biogenic amine metabolic process (GO:0006576)|dopamine catabolic process (GO:0042420)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	primary amine oxidase activity (GO:0008131)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	18					Almotriptan(DB00918)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Minaprine(DB00805)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Naratriptan(DB00952)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Riboflavin(DB00140)|Rizatriptan(DB00953)|Selegiline(DB01037)|Sertraline(DB01104)|Sumatriptan(DB00669)|Testosterone(DB00624)|Tranylcypromine(DB00752)|Zolmitriptan(DB00315)|Zonisamide(DB00909)	TTTTAGTGCAAATACGTAATT	0.418																																					p.K267T		Atlas-SNP	.											.	MAOA	48	.	0			c.A800C						PASS	.						110.0	82.0	92.0					X																	43590945		2203	4300	6503	SO:0001583	missense	4128	exon8			AGTGCAAATACGT		CCDS14260.1, CCDS59163.1	Xp11.4-p11.3	2008-02-05			ENSG00000189221	ENSG00000189221	1.4.3.4		6833	protein-coding gene	gene with protein product		309850					Standard	NM_000240		Approved		uc004dfy.4	P21397	OTTHUMG00000021387	ENST00000338702.3:c.800A>C	chrX.hg19:g.43590945A>C	ENSP00000340684:p.Lys267Thr	82.0	0.0	.		95.0	30.0	.	NM_000240	B4DF46|Q16426	Missense_Mutation	SNP	ENST00000338702.3	hg19	CCDS14260.1	.	.	.	.	.	.	.	.	.	.	A	10.50	1.367611	0.24771	.	.	ENSG00000189221	ENST00000338702;ENST00000542639	D;D	0.92699	-3.09;-3.09	5.81	-4.19	0.03835	Amine oxidase (1);	0.452762	0.27682	N	0.018281	D	0.92280	0.7551	M	0.86420	2.815	0.40067	D	0.975962	B	0.20887	0.049	B	0.28991	0.097	T	0.76729	-0.2852	10	0.72032	D	0.01	.	16.9162	0.86152	0.7596:0.0:0.2404:0.0	.	267	P21397	AOFA_HUMAN	T	267;134	ENSP00000340684:K267T;ENSP00000440846:K134T	ENSP00000340684:K267T	K	+	2	0	MAOA	43475889	0.137000	0.22531	0.008000	0.14137	0.362000	0.29581	-0.156000	0.10100	-1.760000	0.01312	-0.488000	0.04728	AAA	.	.	.	none		0.418	MAOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056300.1	NM_000240	
NOX1	27035	hgsc.bcm.edu	37	X	100099033	100099033	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chrX:100099033T>C	ENST00000372966.3	-	13	1808	c.1603A>G	c.(1603-1605)Act>Gct	p.T535A	NOX1_ENST00000217885.5_Missense_Mutation_p.T486A|NOX1_ENST00000372964.1_Intron|NOX1_ENST00000372960.4_Missense_Mutation_p.T498A	NM_007052.4|NM_013955.2	NP_008983.2|NP_039249.1	Q9Y5S8	NOX1_HUMAN	NADPH oxidase 1	535	Interaction with NOXO1.				angiogenesis (GO:0001525)|cell migration (GO:0016477)|cellular response to hyperoxia (GO:0071455)|cellular stress response to acidic pH (GO:1990451)|extracellular matrix organization (GO:0030198)|hydrogen peroxide metabolic process (GO:0042743)|inflammatory response (GO:0006954)|intracellular pH elevation (GO:0051454)|NADP metabolic process (GO:0006739)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of JNK cascade (GO:0046330)|positive regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902177)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation vascular endothelial growth factor production (GO:0010575)|proton transport (GO:0015992)|regulation of blood pressure (GO:0008217)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|respiratory burst (GO:0045730)|signal transduction (GO:0007165)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|early endosome (GO:0005769)|integral component of membrane (GO:0016021)|invadopodium membrane (GO:0071438)|NADPH oxidase complex (GO:0043020)	metal ion binding (GO:0046872)|NADP binding (GO:0050661)|Rac GTPase binding (GO:0048365)|superoxide-generating NADPH oxidase activity (GO:0016175)|voltage-gated proton channel activity (GO:0030171)			cervix(1)|lung(3)|ovary(1)|skin(2)	7						TTTGCCAAAGTCCGAGGGCCA	0.433																																					p.T535A		Atlas-SNP	.											.	NOX1	79	.	0			c.A1603G						PASS	.						65.0	51.0	55.0					X																	100099033		2202	4299	6501	SO:0001583	missense	27035	exon13			CCAAAGTCCGAGG	AF127763	CCDS14474.1, CCDS14475.1, CCDS65298.1	Xq22	2008-08-01			ENSG00000007952	ENSG00000007952			7889	protein-coding gene	gene with protein product	"""mitogenic oxidase (pyridine nucleotide-dependent superoxide-generating)"", ""NADPH oxidase homolog-1"", ""NADPH oxidase 1 variant NOH-1L"""	300225				10485709, 10615049	Standard	NM_007052		Approved	NOH1, NOH-1, MOX1, GP91-2	uc004egj.3	Q9Y5S8	OTTHUMG00000022007	ENST00000372966.3:c.1603A>G	chrX.hg19:g.100099033T>C	ENSP00000362057:p.Thr535Ala	20.0	0.0	.		34.0	13.0	.	NM_007052	A8K836|O95691|Q2PP02	Missense_Mutation	SNP	ENST00000372966.3	hg19	CCDS14474.1	.	.	.	.	.	.	.	.	.	.	t	0.927	-0.714078	0.03206	.	.	ENSG00000007952	ENST00000372966;ENST00000217885;ENST00000372960	D;T;D	0.94650	-3.48;0.09;-3.48	5.09	-0.337	0.12654	Ferric reductase, NAD binding (1);	0.458064	0.22296	N	0.061923	T	0.70456	0.3226	N	0.00277	-1.72	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.001;0.002	T	0.70938	-0.4736	10	0.02654	T	1	-0.2036	5.1658	0.15084	0.0:0.3874:0.3302:0.2825	.	498;486;535	A6NGA6;Q9Y5S8-3;Q9Y5S8	.;.;NOX1_HUMAN	A	535;486;498	ENSP00000362057:T535A;ENSP00000217885:T486A;ENSP00000362051:T498A	ENSP00000217885:T486A	T	-	1	0	NOX1	99985689	0.000000	0.05858	0.000000	0.03702	0.904000	0.53231	0.069000	0.14552	-0.326000	0.08564	0.483000	0.47432	ACT	.	.	.	none		0.433	NOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057495.1	NM_007052	
FLT4	2324	hgsc.bcm.edu	37	5	180052935	180052936	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr5:180052935_180052936insG	ENST00000261937.6	-	10	1432_1433	c.1354_1355insC	c.(1354-1356)ctgfs	p.L452fs	FLT4_ENST00000393347.3_Frame_Shift_Ins_p.L452fs|FLT4_ENST00000424276.2_5'UTR|FLT4_ENST00000502649.1_Frame_Shift_Ins_p.L452fs	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	452	Ig-like C2-type 5.				blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GCTGAGAGGCAGGGGCACCCCG	0.649																																					p.L452fs	Colon(97;1075 1466 27033 27547 35871)	Atlas-INDEL	.											.	FLT4	356	.	0			c.1355_1356insC						PASS	.																																			SO:0001589	frameshift_variant	2324	exon10			.	X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.1355dupC	chr5.hg19:g.180052939_180052939dupG	ENSP00000261937:p.Leu452fs	69.0	0.0	0		323.0	30.0	0.0928793	NM_182925	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Frame_Shift_Ins	INS	ENST00000261937.6	hg19	CCDS4457.1																																																																																			.	.	.	none		0.649	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253527.4		
SCMH1	22955	hgsc.bcm.edu	37	1	41579112	41579113	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:41579112_41579113insG	ENST00000326197.7	-	7	856_857	c.557_558insC	c.(556-558)ccafs	p.P186fs	SCMH1_ENST00000402904.2_Frame_Shift_Ins_p.P186fs|SCMH1_ENST00000372597.1_Frame_Shift_Ins_p.P139fs|SCMH1_ENST00000337495.5_Frame_Shift_Ins_p.P196fs|SCMH1_ENST00000456518.2_Intron|SCMH1_ENST00000397171.2_Frame_Shift_Ins_p.P125fs|SCMH1_ENST00000397174.2_Frame_Shift_Ins_p.P166fs|SCMH1_ENST00000361191.5_Frame_Shift_Ins_p.P125fs|SCMH1_ENST00000372595.1_Frame_Shift_Ins_p.P125fs|SCMH1_ENST00000361705.3_Frame_Shift_Ins_p.P139fs|SCMH1_ENST00000372596.1_Frame_Shift_Ins_p.P125fs					sex comb on midleg homolog 1 (Drosophila)											breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(2)|pancreas(2)|upper_aerodigestive_tract(1)	15	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)|Breast(333;0.162)	Myeloproliferative disorder(586;0.0393)				CAATAGTGGCTGGGCAAATGAA	0.53																																					p.P196fs		Atlas-INDEL	.											.	SCMH1	120	.	0			c.588_589insC						PASS	.																																			SO:0001589	frameshift_variant	22955	exon8			.	AF149045	CCDS461.1, CCDS30688.1, CCDS53301.1, CCDS53302.1, CCDS53303.1, CCDS53304.1	1p34	2013-01-10			ENSG00000010803	ENSG00000010803		"""Sterile alpha motif (SAM) domain containing"""	19003	protein-coding gene	gene with protein product						10524249	Standard	NM_012236		Approved	Scml3	uc001cgs.3	Q96GD3	OTTHUMG00000005720	ENST00000326197.7:c.558dupC	chr1.hg19:g.41579115_41579115dupG	ENSP00000318094:p.Pro186fs	55.0	0.0	0		107.0	20.0	0.186916	NM_001172219		Frame_Shift_Ins	INS	ENST00000326197.7	hg19	CCDS30688.1																																																																																			.	.	.	none		0.530	SCMH1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015656.1		
TMEM132E	124842	hgsc.bcm.edu	37	17	32964849	32964850	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr17:32964849_32964850insC	ENST00000321639.5	+	10	2881_2882	c.2553_2554insC	c.(2554-2556)cagfs	p.Q852fs		NM_207313.1	NP_997196.1	Q6IEE7	T132E_HUMAN	transmembrane protein 132E	852						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(28)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	57				BRCA - Breast invasive adenocarcinoma(366;0.231)		TGGGCAACGGGCAGCCGCTGCG	0.673																																					p.G851fs		Atlas-INDEL	.											.	TMEM132E	122	.	0			c.2553_2554insC						PASS	.																																			SO:0001589	frameshift_variant	124842	exon10			.	BN000149	CCDS11283.1	17q12	2012-11-01			ENSG00000181291	ENSG00000181291			26991	protein-coding gene	gene with protein product							Standard	NM_207313		Approved		uc002hif.3	Q6IEE7	OTTHUMG00000132927	ENST00000321639.5:c.2554dupC	chr17.hg19:g.32964850_32964850dupC	ENSP00000316532:p.Gln852fs	69.0	0.0	0		347.0	19.0	0.054755	NM_207313	Q8WUF4|Q8WVA5	Frame_Shift_Ins	INS	ENST00000321639.5	hg19	CCDS11283.1																																																																																			.	.	.	none		0.673	TMEM132E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256440.2	NM_207313	
CTCFL	140690	hgsc.bcm.edu	37	20	56098886	56098887	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr20:56098886_56098887insC	ENST00000608263.1	-	1	1036_1037	c.375_376insG	c.(373-378)gggcccfs	p.P126fs	CTCFL_ENST00000423479.3_Frame_Shift_Ins_p.P126fs|CTCFL_ENST00000539382.1_Intron|CTCFL_ENST00000371196.2_Frame_Shift_Ins_p.P126fs|CTCFL_ENST00000422869.2_Frame_Shift_Ins_p.P126fs|CTCFL_ENST00000502686.2_Intron|CTCFL_ENST00000608158.1_Frame_Shift_Ins_p.P126fs|CTCFL_ENST00000608440.1_Frame_Shift_Ins_p.P126fs|CTCFL_ENST00000432255.2_Frame_Shift_Ins_p.P126fs|CTCFL_ENST00000609232.1_Frame_Shift_Ins_p.P126fs|CTCFL_ENST00000243914.3_Frame_Shift_Ins_p.P126fs|CTCFL_ENST00000429804.3_Frame_Shift_Ins_p.P126fs|CTCFL_ENST00000608425.1_Frame_Shift_Ins_p.P126fs|CTCFL_ENST00000608903.1_Intron|CTCFL_ENST00000608858.1_Intron|CTCFL_ENST00000481655.2_Frame_Shift_Ins_p.P126fs|CTCFL_ENST00000433949.3_Intron	NM_001269041.1	NP_001255970.1	Q8NI51	CTCFL_HUMAN	CCCTC-binding factor (zinc finger protein)-like	126					cell cycle (GO:0007049)|DNA methylation involved in gamete generation (GO:0043046)|histone methylation (GO:0016571)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of histone H3-K4 methylation (GO:0051569)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(28)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58	Lung NSC(12;0.00132)|all_lung(29;0.00433)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;3.95e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.09e-07)			CTCTGCCGGGGCCCTTCCTCAA	0.579																																					p.P126fs		Atlas-INDEL	.											.	CTCFL	97	.	0			c.376_377insG						PASS	.																																			SO:0001589	frameshift_variant	140690	exon1			.		CCDS13459.1, CCDS58776.1, CCDS58777.1, CCDS58778.1, CCDS58779.1, CCDS58780.1, CCDS58781.1, CCDS58782.1, CCDS68161.1, CCDS68162.1, CCDS68163.1, CCDS68164.1	20q13.31	2013-01-08			ENSG00000124092	ENSG00000124092		"""Zinc fingers, C2H2-type"""	16234	protein-coding gene	gene with protein product	"""cancer/testis antigen 27"""	607022					Standard	NM_001269040		Approved	dJ579F20.2, BORIS, CT27	uc010giw.1	Q8NI51	OTTHUMG00000032829	ENST00000608263.1:c.376dupG	chr20.hg19:g.56098889_56098889dupC	ENSP00000476783:p.Pro126fs	119.0	0.0	0		415.0	24.0	0.0578313	NM_001269044	A0S6W1|A1L4C6|A6XGL8|A6XGM2|A6XGM3|A6XGM8|A6XGN0|A6XGN1|A6XGN2|A6XGN3|A6XGN4|E7EQ27|E7EUE3|E9PBA9|Q5JUG4|Q9BZ30|Q9NQJ3	Frame_Shift_Ins	INS	ENST00000608263.1	hg19	CCDS13459.1																																																																																			.	.	.	none		0.579	CTCFL-019	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472040.1	NM_080618	
URGCP	55665	hgsc.bcm.edu	37	7	43916495	43916495	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr7:43916495delC	ENST00000453200.1	-	6	3060	c.2567delG	c.(2566-2568)ggcfs	p.G856fs	URGCP_ENST00000443736.1_Frame_Shift_Del_p.G813fs|URGCP_ENST00000402306.3_Frame_Shift_Del_p.G847fs|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000336086.6_Frame_Shift_Del_p.G813fs|URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000447717.3_Frame_Shift_Del_p.G813fs|URGCP_ENST00000223341.7_Frame_Shift_Del_p.G813fs			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	856	VLIG-type G.				cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GAAGCCGTCGCCCTGTTTCTC	0.637																																					p.G856fs		Atlas-INDEL	.											.	URGCP	170	.	0			c.2568delC						PASS	.						29.0	31.0	30.0					7																	43916495		1994	4175	6169	SO:0001589	frameshift_variant	55665	exon6			.		CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.2567delG	chr7.hg19:g.43916495delC	ENSP00000396918:p.Gly856fs	42.0	0.0	0		167.0	39.0	0.233533	NM_001077663	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Frame_Shift_Del	DEL	ENST00000453200.1	hg19	CCDS47578.1																																																																																			.	.	.	none		0.637	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338995.1	NM_001077664	
AHCY	191	hgsc.bcm.edu	37	20	32868894	32868914	+	In_Frame_Del	DEL	CTGGGCTTGCTTCTCAGTTAG	CTGGGCTTGCTTCTCAGTTAG	-			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	CTGGGCTTGCTTCTCAGTTAG	CTGGGCTTGCTTCTCAGTTAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr20:32868894_32868914delCTGGGCTTGCTTCTCAGTTAG	ENST00000217426.2	-	10	1302_1322	c.1225_1245delCTAACTGAGAAGCAAGCCCAG	c.(1225-1245)ctaactgagaagcaagcccagdel	p.LTEKQAQ409del	RP4-785G19.5_ENST00000512005.1_RNA|AHCY_ENST00000538132.1_In_Frame_Del_p.LTEKQAQ381del|CTD-3216D2.5_ENST00000609218.1_RNA	NM_000687.2	NP_000678.1	P23526	SAHH_HUMAN	adenosylhomocysteinase	409					cellular nitrogen compound metabolic process (GO:0034641)|chronic inflammatory response to antigenic stimulus (GO:0002439)|circadian sleep/wake cycle (GO:0042745)|homocysteine biosynthetic process (GO:0071268)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|S-adenosylhomocysteine catabolic process (GO:0019510)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|nucleus (GO:0005634)	adenosylhomocysteinase activity (GO:0004013)|adenyl nucleotide binding (GO:0030554)|NAD binding (GO:0051287)			endometrium(6)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						TGCCCAGGTACTGGGCTTGCTTCTCAGTTAGCTTGGTCAAC	0.566																																					p.409_416del		Atlas-INDEL	.											.	AHCY	43	.	0			c.1226_1246del						PASS	.																																			SO:0001651	inframe_deletion	191	exon10			.	M61832	CCDS13233.1, CCDS54457.1	20q11.22	2009-06-12	2009-06-12		ENSG00000101444	ENSG00000101444	3.3.1.1		343	protein-coding gene	gene with protein product		180960	"""S-adenosylhomocysteine hydrolase"""			7079734, 6580258	Standard	NM_001161766		Approved	SAHH	uc002xai.3	P23526	OTTHUMG00000140098	ENST00000217426.2:c.1225_1245delCTAACTGAGAAGCAAGCCCAG	chr20.hg19:g.32868894_32868914delCTGGGCTTGCTTCTCAGTTAG	ENSP00000217426:p.Leu409_Gln415del	44.0	0.0	0		104.0	26.0	0.25	NM_000687	A8K307|B3KUN3|E1P5P2|F5H737|Q96A36	In_Frame_Del	DEL	ENST00000217426.2	hg19	CCDS13233.1																																																																																			.	.	.	none		0.566	AHCY-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078773.2	NM_000687	
