#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ECE1	1889	hgsc.bcm.edu	37	1	21585300	21585300	+	Silent	SNP	G	G	T			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr1:21585300G>T	ENST00000374893.6	-	6	722	c.648C>A	c.(646-648)gcC>gcA	p.A216A	ECE1_ENST00000357071.4_Silent_p.A204A|ECE1_ENST00000264205.6_Silent_p.A213A|ECE1_ENST00000415912.2_Silent_p.A200A|ECE1_ENST00000436918.2_Silent_p.A216A|ECE1_ENST00000528294.1_5'Flank	NM_001397.2	NP_001388.1	P42892	ECE1_HUMAN	endothelin converting enzyme 1	216					bradykinin catabolic process (GO:0010815)|calcitonin catabolic process (GO:0010816)|ear development (GO:0043583)|embryonic digit morphogenesis (GO:0042733)|endothelin maturation (GO:0034959)|heart development (GO:0007507)|hormone catabolic process (GO:0042447)|peptide hormone processing (GO:0016486)|pharyngeal system development (GO:0060037)|positive regulation of receptor recycling (GO:0001921)|protein processing (GO:0016485)|regulation of systemic arterial blood pressure by endothelin (GO:0003100)|regulation of vasoconstriction (GO:0019229)|substance P catabolic process (GO:0010814)	early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intrinsic component of endosome membrane (GO:0031302)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)|Weibel-Palade body (GO:0033093)	endopeptidase activity (GO:0004175)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|peptide hormone binding (GO:0017046)|protein homodimerization activity (GO:0042803)			endometrium(5)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	25		Lung NSC(340;1.14e-05)|all_lung(284;1.23e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00147)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0183)|OV - Ovarian serous cystadenocarcinoma(117;4.83e-27)|COAD - Colon adenocarcinoma(152;1.36e-06)|GBM - Glioblastoma multiforme(114;1.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000162)|STAD - Stomach adenocarcinoma(196;0.00326)|KIRC - Kidney renal clear cell carcinoma(1967;0.00755)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.206)		AGTTGTCCTTGGCCCAGGGAC	0.597																																					p.A216A		Atlas-SNP	.											.	ECE1	76	.	0			c.C648A						PASS	.						156.0	119.0	132.0					1																	21585300		2203	4300	6503	SO:0001819	synonymous_variant	1889	exon6			GTCCTTGGCCCAG	D49471	CCDS215.1, CCDS44081.1, CCDS44082.1, CCDS44083.1	1p36.1	2008-02-05			ENSG00000117298	ENSG00000117298			3146	protein-coding gene	gene with protein product		600423		ECE		7805846, 7864876, 17592116	Standard	NM_001397		Approved		uc001bei.2	P42892	OTTHUMG00000002625	ENST00000374893.6:c.648C>A	chr1.hg19:g.21585300G>T		106.0	0.0	.		106.0	35.0	.	NM_001397	A8K3P1|B4E291|Q14217|Q17RN5|Q2Z2K8|Q58GE7|Q5THM5|Q5THM7|Q5THM8|Q9UJQ6|Q9UPF4|Q9UPM4|Q9Y501	Silent	SNP	ENST00000374893.6	hg19	CCDS215.1																																																																																			.	.	.	none		0.597	ECE1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000007470.2	NM_001397	
KCNC4	3749	hgsc.bcm.edu	37	1	110768796	110768796	+	Silent	SNP	G	G	A			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr1:110768796G>A	ENST00000369787.3	+	3	1842	c.1815G>A	c.(1813-1815)cgG>cgA	p.R605R	KCNC4_ENST00000413138.3_Silent_p.R605R|KCNC4_ENST00000412512.2_Intron|KCNC4_ENST00000438661.2_Silent_p.R605R	NM_004978.4	NP_004969.2	Q03721	KCNC4_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 4	605					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(2)|lung(11)|ovary(1)|skin(2)	32		all_cancers(81;9.88e-06)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0238)|all cancers(265;0.0693)|Epithelial(280;0.0748)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.135)		GTAGTGTCCGGAAAGGTATGG	0.642																																					p.R605R		Atlas-SNP	.											.	KCNC4	113	.	0			c.G1815A						PASS	.						50.0	56.0	54.0					1																	110768796		2203	4300	6503	SO:0001819	synonymous_variant	3749	exon3			TGTCCGGAAAGGT	BC101769	CCDS821.1, CCDS44193.1	1p21	2012-07-05			ENSG00000116396	ENSG00000116396		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6236	protein-coding gene	gene with protein product		176265	"""chromosome 1 open reading frame 30"""	C1orf30		1920536, 1740329, 16382104	Standard	NM_004978		Approved	Kv3.4, HKSHIIIC	uc001dzh.3	Q03721	OTTHUMG00000011037	ENST00000369787.3:c.1815G>A	chr1.hg19:g.110768796G>A		70.0	0.0	.		96.0	37.0	.	NM_001039574	Q3MIM4|Q5TBI6	Silent	SNP	ENST00000369787.3	hg19	CCDS821.1																																																																																			.	.	.	none		0.642	KCNC4-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052146.2	NM_001039574	
ITLN2	142683	hgsc.bcm.edu	37	1	160924190	160924190	+	Missense_Mutation	SNP	A	A	T	rs145856391		TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr1:160924190A>T	ENST00000368029.3	-	2	123	c.66T>A	c.(64-66)agT>agA	p.S22R		NM_080878.2	NP_543154.1	Q8WWU7	ITLN2_HUMAN	intelectin 2	22						extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			endometrium(4)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(1)	19	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			CACTGCACCCACTGGTGGCCA	0.552											OREG0013934	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S22R		Atlas-SNP	.											.	ITLN2	35	.	0			c.T66A						PASS	.						101.0	93.0	96.0					1																	160924190		2201	4298	6499	SO:0001583	missense	142683	exon2			GCACCCACTGGTG	AY065973	CCDS1212.1	1q22-q23.5	2013-02-06			ENSG00000158764	ENSG00000158764		"""Fibrinogen C domain containing"""	20599	protein-coding gene	gene with protein product		609874				11181563	Standard	NM_080878		Approved	HL-2	uc001fxd.3	Q8WWU7	OTTHUMG00000028605	ENST00000368029.3:c.66T>A	chr1.hg19:g.160924190A>T	ENSP00000357008:p.Ser22Arg	16.0	0.0	.	1812	10.0	6.0	.	NM_080878	Q17RR2|Q5VYI0	Missense_Mutation	SNP	ENST00000368029.3	hg19	CCDS1212.1	.	.	.	.	.	.	.	.	.	.	A	0.005	-2.158971	0.00321	.	.	ENSG00000158764	ENST00000368029	T	0.17691	2.26	3.74	0.0268	0.14151	.	1.672490	0.04351	N	0.355594	T	0.01627	0.0052	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.38265	-0.9669	10	0.12103	T	0.63	-0.4519	0.7369	0.00967	0.343:0.1034:0.1768:0.3767	.	22;22	A6NI51;Q8WWU7	.;ITLN2_HUMAN	R	22	ENSP00000357008:S22R	ENSP00000357008:S22R	S	-	3	2	ITLN2	159190814	0.000000	0.05858	0.010000	0.14722	0.002000	0.02628	-0.072000	0.11486	-0.250000	0.09555	-2.614000	0.00158	AGT	.	A|1.000;G|0.000	.	alt		0.552	ITLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071465.1	NM_080878	
NIT1	4817	hgsc.bcm.edu	37	1	161090544	161090544	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr1:161090544C>A	ENST00000368009.2	+	7	1049	c.973C>A	c.(973-975)Cca>Aca	p.P325T	DEDD_ENST00000489249.1_5'Flank|NIT1_ENST00000392190.5_Missense_Mutation_p.P289T|NIT1_ENST00000368008.1_Intron|PFDN2_ENST00000368010.3_5'Flank|PFDN2_ENST00000468311.1_5'Flank|NIT1_ENST00000368007.4_Missense_Mutation_p.P310T	NM_005600.2	NP_005591.1	Q86X76	NIT1_HUMAN	nitrilase 1	325					nitrogen compound metabolic process (GO:0006807)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	nitrilase activity (GO:0000257)			NS(1)|breast(2)|endometrium(2)|large_intestine(3)|lung(3)|prostate(1)	12	all_cancers(52;3.39e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			TCTGGGTCACCCACTGTCTTA	0.567																																					p.P325T		Atlas-SNP	.											.	NIT1	41	.	0			c.C973A						PASS	.						50.0	44.0	46.0					1																	161090544		2202	4299	6501	SO:0001583	missense	4817	exon7			GGTCACCCACTGT	AF069984	CCDS1218.1, CCDS53401.1, CCDS53402.1, CCDS53403.1	1q21-q22	2008-05-14			ENSG00000158793	ENSG00000158793			7828	protein-coding gene	gene with protein product		604618				9671749	Standard	NM_005600		Approved		uc001fxv.2	Q86X76	OTTHUMG00000031473	ENST00000368009.2:c.973C>A	chr1.hg19:g.161090544C>A	ENSP00000356988:p.Pro325Thr	110.0	0.0	.		85.0	33.0	.	NM_005600	B1AQP3|D3DVF4|O76091	Missense_Mutation	SNP	ENST00000368009.2	hg19	CCDS1218.1	.	.	.	.	.	.	.	.	.	.	C	11.86	1.763738	0.31228	.	.	ENSG00000158793	ENST00000368009;ENST00000368007;ENST00000392190	T;T;T	0.78481	-1.16;-1.18;-1.13	4.9	4.9	0.64082	.	0.347201	0.28365	N	0.015606	T	0.69070	0.3070	N	0.08118	0	0.35810	D	0.823791	D;P	0.89917	1.0;0.61	D;B	0.83275	0.996;0.262	T	0.75687	-0.3231	10	0.45353	T	0.12	-10.3808	13.4666	0.61258	0.0:1.0:0.0:0.0	.	310;325	Q86X76-4;Q86X76	.;NIT1_HUMAN	T	325;310;289	ENSP00000356988:P325T;ENSP00000356986:P310T;ENSP00000376028:P289T	ENSP00000356986:P310T	P	+	1	0	NIT1	159357168	0.046000	0.20272	0.938000	0.37757	0.597000	0.36814	1.708000	0.37899	2.551000	0.86045	0.563000	0.77884	CCA	.	.	.	none		0.567	NIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077060.1		
LTBP1	4052	hgsc.bcm.edu	37	2	33622241	33622241	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr2:33622241G>T	ENST00000404816.2	+	33	5229	c.4876G>T	c.(4876-4878)Ggc>Tgc	p.G1626C	LTBP1_ENST00000390003.4_Missense_Mutation_p.G1301C|LTBP1_ENST00000418533.2_Missense_Mutation_p.G1258C|LTBP1_ENST00000404525.1_Missense_Mutation_p.G1247C|LTBP1_ENST00000402934.1_Missense_Mutation_p.G1245C|LTBP1_ENST00000354476.3_Missense_Mutation_p.G1627C|LTBP1_ENST00000407925.1_Missense_Mutation_p.G1300C|LTBP1_ENST00000272273.5_Missense_Mutation_p.G524C			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	1626	EGF-like 17. {ECO:0000255|PROSITE- ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				TGAGGAATGCGGCATCCTCAA	0.453																																					p.G1626C		Atlas-SNP	.											LTBP1,NS,carcinoma,0,1	LTBP1	317	.	0			c.G4876T						PASS	.						166.0	152.0	157.0					2																	33622241		2203	4300	6503	SO:0001583	missense	4052	exon33			GAATGCGGCATCC		CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.4876G>T	chr2.hg19:g.33622241G>T	ENSP00000386043:p.Gly1626Cys	80.0	0.0	.		69.0	3.0	.	NM_206943	A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Missense_Mutation	SNP	ENST00000404816.2	hg19	CCDS33177.2	.	.	.	.	.	.	.	.	.	.	G	28.4	4.920839	0.92249	.	.	ENSG00000049323	ENST00000404816;ENST00000354476;ENST00000390003;ENST00000418533;ENST00000402934;ENST00000404525;ENST00000407925;ENST00000272273	D;D;D;D;D;D;D;D	0.87571	-2.27;-2.27;-2.27;-2.27;-2.27;-2.27;-2.27;-2.27	5.49	5.49	0.81192	Matrix fibril-associated (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.93779	0.8011	M	0.78916	2.43	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.93794	0.7095	9	0.66056	D	0.02	.	19.7433	0.96241	0.0:0.0:1.0:0.0	.	524;1626;1258;1247;1300;1301;1627	E7EUU6;Q14766;E7EV71;Q14766-3;Q14766-2;Q14766-5;Q14766-4	.;LTBP1_HUMAN;.;.;.;.;.	C	1626;1627;1301;1258;1245;1247;1300;524	ENSP00000386043:G1626C;ENSP00000346467:G1627C;ENSP00000374653:G1301C;ENSP00000393057:G1258C;ENSP00000384373:G1245C;ENSP00000385359:G1247C;ENSP00000384091:G1300C;ENSP00000272273:G524C	ENSP00000272273:G524C	G	+	1	0	LTBP1	33475745	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.813000	0.99286	2.733000	0.93635	0.655000	0.94253	GGC	.	.	.	none		0.453	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	NM_206943	
C2orf78	388960	hgsc.bcm.edu	37	2	74043217	74043217	+	Silent	SNP	C	C	A			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr2:74043217C>A	ENST00000409561.1	+	3	1988	c.1867C>A	c.(1867-1869)Cga>Aga	p.R623R		NM_001080474.1	NP_001073943.1	A6NCI8	CB078_HUMAN	chromosome 2 open reading frame 78	623										cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|soft_tissue(1)|urinary_tract(1)	34						TAAAAAGCCCCGAAGCTCCCT	0.453																																					p.R623R		Atlas-SNP	.											.	C2orf78	150	.	0			c.C1867A						PASS	.						72.0	69.0	70.0					2																	74043217		1840	4088	5928	SO:0001819	synonymous_variant	388960	exon3			AAGCCCCGAAGCT	AC092653, AC136006, AK125975	CCDS46338.1	2p13.2	2008-07-18			ENSG00000187833	ENSG00000187833			34349	protein-coding gene	gene with protein product							Standard	NM_001080474		Approved	FLJ43987, hCG1989538, COG5373	uc002sjr.1	A6NCI8	OTTHUMG00000152819	ENST00000409561.1:c.1867C>A	chr2.hg19:g.74043217C>A		109.0	0.0	.		97.0	4.0	.	NM_001080474		Silent	SNP	ENST00000409561.1	hg19	CCDS46338.1																																																																																			.	.	.	none		0.453	C2orf78-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000328083.1	NM_001080474	
DARS	1615	hgsc.bcm.edu	37	2	136680361	136680361	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr2:136680361A>C	ENST00000264161.4	-	9	1019	c.804T>G	c.(802-804)atT>atG	p.I268M	DARS_ENST00000537273.1_Missense_Mutation_p.I168M	NM_001349.2	NP_001340.2	P14868	SYDC_HUMAN	aspartyl-tRNA synthetase	268					aspartyl-tRNA aminoacylation (GO:0006422)|gene expression (GO:0010467)|protein complex assembly (GO:0006461)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	aminoacylase activity (GO:0004046)|aspartate-tRNA ligase activity (GO:0004815)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|urinary_tract(2)	15				BRCA - Breast invasive adenocarcinoma(221;0.168)	L-Aspartic Acid(DB00128)	TACCTGGTCCAATAGAGAAAA	0.308																																					p.I268M		Atlas-SNP	.											.	DARS	44	.	0			c.T804G						PASS	.						81.0	81.0	81.0					2																	136680361		2203	4300	6503	SO:0001583	missense	1615	exon9			TGGTCCAATAGAG	J05032	CCDS2180.1	2q21.3	2011-07-01			ENSG00000115866	ENSG00000115866	6.1.1.12	"""Aminoacyl tRNA synthetases / Class II"""	2678	protein-coding gene	gene with protein product	"""aspartate tRNA ligase 1, cytoplasmic"""	603084				2674137	Standard	NM_001349		Approved		uc002tux.1	P14868	OTTHUMG00000131741	ENST00000264161.4:c.804T>G	chr2.hg19:g.136680361A>C	ENSP00000264161:p.Ile268Met	159.0	0.0	.		170.0	78.0	.	NM_001349	A8K3J2|D3DP77|Q2TNI3|Q32Q69|Q53HV4|Q53YC5|Q68CR9|Q9BW52	Missense_Mutation	SNP	ENST00000264161.4	hg19	CCDS2180.1	.	.	.	.	.	.	.	.	.	.	A	18.86	3.714290	0.68730	.	.	ENSG00000115866	ENST00000264161;ENST00000537273	D;D	0.84730	-1.89;-1.89	5.71	5.71	0.89125	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (D/K/N) (1);	0.105460	0.64402	D	0.000004	D	0.94820	0.8327	H	0.96547	3.84	0.53688	D	0.999978	D	0.58970	0.984	D	0.70227	0.968	D	0.96332	0.9244	10	0.87932	D	0	-18.2315	15.9798	0.80097	1.0:0.0:0.0:0.0	.	268	P14868	SYDC_HUMAN	M	268;168	ENSP00000264161:I268M;ENSP00000444192:I168M	ENSP00000264161:I268M	I	-	3	3	DARS	136396831	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.221000	0.42917	2.169000	0.68431	0.477000	0.44152	ATT	.	.	.	none		0.308	DARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254660.5	NM_001349	
PPIG	9360	hgsc.bcm.edu	37	2	170460568	170460568	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr2:170460568A>G	ENST00000260970.3	+	3	237	c.17A>G	c.(16-18)cAa>cGa	p.Q6R	PPIG_ENST00000409714.3_Missense_Mutation_p.Q6R|PPIG_ENST00000448752.2_Missense_Mutation_p.Q6R|PPIG_ENST00000462903.1_Missense_Mutation_p.Q6R	NM_004792.2	NP_004783.2	Q13427	PPIG_HUMAN	peptidylprolyl isomerase G (cyclophilin G)	6					protein folding (GO:0006457)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(17)|ovary(2)|stomach(1)|urinary_tract(1)	43					L-Proline(DB00172)	ATAAAGGTTCAACGTCCTCGA	0.308																																					p.Q6R		Atlas-SNP	.											.	PPIG	100	.	0			c.A17G						PASS	.						95.0	97.0	96.0					2																	170460568		2203	4300	6503	SO:0001583	missense	9360	exon3			AGGTTCAACGTCC	X99717	CCDS2235.1	2q31.1	2010-07-23	2006-01-12		ENSG00000138398	ENSG00000138398	6.1.1.16		14650	protein-coding gene	gene with protein product	"""SR-related CTD-associated factor 10"""	606093	"""peptidyl-prolyl isomerase G (cyclophilin G)"""			8973360, 9153302	Standard	NM_004792		Approved	CARS-Cyp, SRCyp, SCAF10	uc002uez.3	Q13427	OTTHUMG00000132206	ENST00000260970.3:c.17A>G	chr2.hg19:g.170460568A>G	ENSP00000260970:p.Gln6Arg	113.0	0.0	.		127.0	46.0	.	NM_004792	D3DPC5|D3DPC6|O00706|Q53R40|Q53SN4|Q96DG9	Missense_Mutation	SNP	ENST00000260970.3	hg19	CCDS2235.1	.	.	.	.	.	.	.	.	.	.	A	15.51	2.854084	0.51270	.	.	ENSG00000138398	ENST00000260970;ENST00000530133;ENST00000409714;ENST00000462903;ENST00000448752;ENST00000418888;ENST00000414307	T;T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01;1.01	5.19	4.0	0.46444	Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (1);Cyclophilin-like (1);	0.066333	0.64402	D	0.000008	T	0.35393	0.0930	N	0.17800	0.525	0.43403	D	0.995537	B;B;B;P	0.35107	0.149;0.149;0.444;0.484	B;B;B;B	0.43623	0.058;0.058;0.425;0.407	T	0.16600	-1.0397	10	0.41790	T	0.15	-4.8499	12.2535	0.54611	0.8577:0.1423:0.0:0.0	.	6;6;6;6	E9PG73;Q2NKQ6;Q13427-2;Q13427	.;.;.;PPIG_HUMAN	R	6	ENSP00000260970:Q6R;ENSP00000386245:Q6R;ENSP00000435987:Q6R;ENSP00000407083:Q6R;ENSP00000394202:Q6R;ENSP00000402222:Q6R	ENSP00000260970:Q6R	Q	+	2	0	PPIG	170168814	1.000000	0.71417	0.991000	0.47740	0.962000	0.63368	4.391000	0.59652	0.887000	0.36136	0.459000	0.35465	CAA	.	.	.	none		0.308	PPIG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255264.2		
ZAK	51776	hgsc.bcm.edu	37	2	174097114	174097114	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr2:174097114G>T	ENST00000375213.3	+	14	1208	c.1130G>T	c.(1129-1131)cGg>cTg	p.R377L	MLTK_ENST00000409176.2_Missense_Mutation_p.R377L|MLK7-AS1_ENST00000422703.1_RNA|MLK7-AS1_ENST00000423106.2_RNA	NM_016653.2	NP_057737.2	Q9NYL2	MLTK_HUMAN		377	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell death (GO:0008219)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|DNA damage checkpoint (GO:0000077)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|response to radiation (GO:0009314)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)										ACAGGGAAGCGGCTGCTGCTG	0.428																																					p.R377L		Atlas-SNP	.											.	ZAK	62	.	0			c.G1130T						PASS	.						156.0	157.0	157.0					2																	174097114		1971	4169	6140	SO:0001583	missense	0	exon14			GGAAGCGGCTGCT																												ENST00000375213.3:c.1130G>T	chr2.hg19:g.174097114G>T	ENSP00000364361:p.Arg377Leu	348.0	0.0	.		330.0	160.0	.	NM_016653	B3KPG2|Q53SX1|Q580W8|Q59GY5|Q86YW8|Q9HCC4|Q9HCC5|Q9HDD2|Q9NYE9	Missense_Mutation	SNP	ENST00000375213.3	hg19	CCDS42777.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.682483	0.88542	.	.	ENSG00000091436	ENST00000409176;ENST00000375213	T;T	0.47528	0.84;0.84	5.8	5.8	0.92144	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.051262	0.64402	D	0.000001	T	0.56485	0.1988	L	0.41573	1.285	0.80722	D	1	D	0.56287	0.975	P	0.58520	0.84	T	0.57585	-0.7786	10	0.87932	D	0	.	15.1807	0.72956	0.069:0.0:0.931:0.0	.	377	Q9NYL2	MLTK_HUMAN	L	377	ENSP00000387259:R377L;ENSP00000364361:R377L	ENSP00000364361:R377L	R	+	2	0	AC013461.1	173805360	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.414000	0.66405	2.736000	0.93811	0.643000	0.83706	CGG	.	.	.	none		0.428	MLTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255401.1		
GLS	2744	hgsc.bcm.edu	37	2	191827660	191827660	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr2:191827660A>G	ENST00000320717.3	+	18	2216	c.1958A>G	c.(1957-1959)gAc>gGc	p.D653G	GLS_ENST00000409428.1_Missense_Mutation_p.D158G	NM_014905.4	NP_055720.3	O94925	GLSK_HUMAN	glutaminase	653					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|glutamate secretion (GO:0014047)|glutamine catabolic process (GO:0006543)|neurotransmitter secretion (GO:0007269)|protein homotetramerization (GO:0051289)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|small molecule metabolic process (GO:0044281)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glutaminase activity (GO:0004359)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	16			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamine(DB00130)	GGAGATTCTGACAACGGGAAG	0.378																																					p.D653G		Atlas-SNP	.											.	GLS	47	.	0			c.A1958G						PASS	.						100.0	94.0	96.0					2																	191827660		2203	4300	6503	SO:0001583	missense	2744	exon18			ATTCTGACAACGG	AB020645	CCDS2308.1, CCDS58744.1	2q32-q34	2013-01-10			ENSG00000115419	ENSG00000115419	3.5.1.2	"""Ankyrin repeat domain containing"""	4331	protein-coding gene	gene with protein product		138280				10048485	Standard	NM_014905		Approved	KIAA0838, GLS1	uc002usf.3	O94925	OTTHUMG00000132701	ENST00000320717.3:c.1958A>G	chr2.hg19:g.191827660A>G	ENSP00000317379:p.Asp653Gly	117.0	0.0	.		119.0	50.0	.	NM_014905	Q9UL05|Q9UL06|Q9UL07|Q9UN40	Missense_Mutation	SNP	ENST00000320717.3	hg19	CCDS2308.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	6.749|6.749	0.506930|0.506930	0.12883|0.12883	.|.	.|.	ENSG00000115419|ENSG00000115419	ENST00000320717;ENST00000409428|ENST00000412247	T;T|.	0.52295|.	0.99;0.67|.	5.34|5.34	2.91|2.91	0.33838|0.33838	.|.	0.568432|.	0.20287|.	N|.	0.095338|.	T|T	0.22244|0.22244	0.0536|0.0536	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	0.999999|0.999999	B;B|.	0.15930|.	0.015;0.015|.	B;B|.	0.15870|.	0.014;0.014|.	T|T	0.21861|0.21861	-1.0233|-1.0233	10|6	0.23302|0.19147	T|T	0.38|0.46	-10.5512|-10.5512	9.8019|9.8019	0.40770|0.40770	0.7963:0.0:0.2037:0.0|0.7963:0.0:0.2037:0.0	.|.	653;653|.	A8K132;O94925|.	.;GLSK_HUMAN|.	G|A	653;158|153	ENSP00000317379:D653G;ENSP00000387177:D158G|.	ENSP00000317379:D653G|ENSP00000403329:T153A	D|T	+|+	2|1	0|0	GLS|GLS	191535905|191535905	0.329000|0.329000	0.24696|0.24696	0.798000|0.798000	0.32154|0.32154	0.981000|0.981000	0.71138|0.71138	2.092000|2.092000	0.41700|0.41700	1.036000|1.036000	0.39998|0.39998	0.533000|0.533000	0.62120|0.62120	GAC|ACA	.	.	.	none		0.378	GLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255999.2		
CYP20A1	57404	hgsc.bcm.edu	37	2	204154489	204154489	+	Splice_Site	SNP	T	T	C			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr2:204154489T>C	ENST00000356079.4	+	10	1096	c.973T>C	c.(973-975)Tat>Cat	p.Y325H	CYP20A1_ENST00000429815.2_Splice_Site_p.Y333H|CYP20A1_ENST00000461371.1_3'UTR	NM_177538.2	NP_803882.1	Q6UW02	CP20A_HUMAN	cytochrome P450, family 20, subfamily A, polypeptide 1	325						integral component of membrane (GO:0016021)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			cervix(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	11						TTAAAACAGATATTGTCAGCA	0.328																																					p.Y325H		Atlas-SNP	.											.	CYP20A1	40	.	0			c.T973C						PASS	.						46.0	46.0	46.0					2																	204154489		2203	4300	6503	SO:0001630	splice_region_variant	57404	exon10			AACAGATATTGTC	AK021770	CCDS2357.1	2q33	2008-02-05			ENSG00000119004	ENSG00000119004		"""Cytochrome P450s"""	20576	protein-coding gene	gene with protein product							Standard	NM_177538		Approved	CYP-M	uc002uzv.4	Q6UW02	OTTHUMG00000132854	ENST00000356079.4:c.972-1T>C	chr2.hg19:g.204154489T>C		153.0	0.0	.		132.0	60.0	.	NM_177538	Q4ZG61|Q8N4Q8|Q8WWA9|Q9HC04	Missense_Mutation	SNP	ENST00000356079.4	hg19	CCDS2357.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.045301	0.75846	.	.	ENSG00000119004	ENST00000356079;ENST00000421618;ENST00000429815	T;T	0.76186	-1.0;-1.0	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	D	0.87569	0.6210	M	0.84433	2.695	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.89608	0.3839	10	0.87932	D	0	-12.683	15.831	0.78752	0.0:0.0:0.0:1.0	.	333;325	E9PHG5;Q6UW02	.;CP20A_HUMAN	H	325;298;333	ENSP00000348380:Y325H;ENSP00000407860:Y333H	ENSP00000348380:Y325H	Y	+	1	0	CYP20A1	203862734	1.000000	0.71417	0.984000	0.44739	0.845000	0.48019	6.587000	0.74071	2.154000	0.67381	0.473000	0.43528	TAT	.	.	.	none		0.328	CYP20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256328.3	NM_020674	Missense_Mutation
HDLBP	3069	hgsc.bcm.edu	37	2	242170343	242170343	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr2:242170343G>C	ENST00000391975.1	-	25	3532	c.3305C>G	c.(3304-3306)aCc>aGc	p.T1102S	HDLBP_ENST00000427183.2_Missense_Mutation_p.T1069S|HDLBP_ENST00000310931.4_Missense_Mutation_p.T1102S|HDLBP_ENST00000391976.2_Missense_Mutation_p.T1102S	NM_203346.3	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein	1102	KH 13. {ECO:0000255|PROSITE- ProRule:PRU00117}.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)	cytoplasm (GO:0005737)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)			breast(7)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		CCCTGTGATGGTAATTTGGTC	0.527																																					p.T1102S		Atlas-SNP	.											.	HDLBP	118	.	0			c.C3305G						PASS	.						109.0	94.0	99.0					2																	242170343		2203	4300	6503	SO:0001583	missense	3069	exon25			GTGATGGTAATTT		CCDS2547.1, CCDS58760.1	2q37.3	2008-07-18	2008-07-18		ENSG00000115677	ENSG00000115677			4857	protein-coding gene	gene with protein product		142695	"""vigilin"""	VGL		1318310, 8390966	Standard	NM_005336		Approved	HBP	uc002waz.3	Q00341	OTTHUMG00000133391	ENST00000391975.1:c.3305C>G	chr2.hg19:g.242170343G>C	ENSP00000375836:p.Thr1102Ser	109.0	0.0	.		99.0	42.0	.	NM_005336	B4DTQ2|E7EM71|Q53QU2|Q9UCY3	Missense_Mutation	SNP	ENST00000391975.1	hg19	CCDS2547.1	.	.	.	.	.	.	.	.	.	.	G	13.15	2.150608	0.37923	.	.	ENSG00000115677	ENST00000391975;ENST00000391976;ENST00000310931;ENST00000427183	T;T;T;T	0.33216	1.42;1.42;1.42;1.42	5.53	4.66	0.58398	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.092124	0.85682	D	0.000000	T	0.30293	0.0760	L	0.52266	1.64	0.54753	D	0.999981	B;B	0.31318	0.319;0.16	B;B	0.39465	0.236;0.3	T	0.04333	-1.0959	10	0.12103	T	0.63	-51.7385	10.7199	0.46034	0.1453:0.0:0.8547:0.0	.	1069;1102	E7EM71;Q00341	.;VIGLN_HUMAN	S	1102;1102;1102;1069	ENSP00000375836:T1102S;ENSP00000375837:T1102S;ENSP00000312042:T1102S;ENSP00000399139:T1069S	ENSP00000312042:T1102S	T	-	2	0	HDLBP	241819016	1.000000	0.71417	1.000000	0.80357	0.289000	0.27227	6.493000	0.73658	1.352000	0.45808	-0.156000	0.13503	ACC	.	.	.	none		0.527	HDLBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257245.5	NM_203346	
ZNF501	115560	hgsc.bcm.edu	37	3	44776081	44776081	+	Silent	SNP	A	A	G			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr3:44776081A>G	ENST00000396048.2	+	3	605	c.168A>G	c.(166-168)ggA>ggG	p.G56G		NM_001258280.1|NM_145044.3	NP_001245209.1|NP_659481.2	Q96CX3	ZN501_HUMAN	zinc finger protein 501	56					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|large_intestine(4)|lung(3)|prostate(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.00843)|KIRC - Kidney renal clear cell carcinoma(197;0.0463)|Kidney(197;0.0579)		GTGAATGTGGAAGTTGTTTCC	0.403																																					p.G56G		Atlas-SNP	.											ZNF501,NS,neuroblastoma,0,1	ZNF501	27	.	0			c.A168G						PASS	.						94.0	107.0	103.0					3																	44776081		2188	4293	6481	SO:0001819	synonymous_variant	115560	exon3			ATGTGGAAGTTGT	BC013762	CCDS2720.2	3p21.32	2013-01-08			ENSG00000186446	ENSG00000186446		"""Zinc fingers, C2H2-type"""	23717	protein-coding gene	gene with protein product			"""zinc finger protein 52"""	ZNF52		1505991	Standard	NM_145044		Approved	MGC21738	uc003cnu.2	Q96CX3	OTTHUMG00000133048	ENST00000396048.2:c.168A>G	chr3.hg19:g.44776081A>G		128.0	0.0	.		200.0	62.0	.	NM_001258280	B4DLY7|Q96NU9	Silent	SNP	ENST00000396048.2	hg19	CCDS2720.2																																																																																			.	.	.	none		0.403	ZNF501-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256654.4	NM_145044	
RUVBL1	8607	hgsc.bcm.edu	37	3	127831784	127831784	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr3:127831784G>A	ENST00000322623.5	-	3	407	c.308C>T	c.(307-309)tCa>tTa	p.S103L	RUVBL1_ENST00000417360.1_Missense_Mutation_p.S103L|RUVBL1_ENST00000464873.1_Missense_Mutation_p.S43L	NM_003707.2	NP_003698.1	Q9Y265	RUVB1_HUMAN	RuvB-like AAA ATPase 1	103					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Ino80 complex (GO:0031011)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)			endometrium(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26				GBM - Glioblastoma multiforme(114;0.181)		GATCTCAGTTGAGTAAACTTC	0.502																																					p.S103L		Atlas-SNP	.											.	RUVBL1	38	.	0			c.C308T						PASS	.						154.0	141.0	146.0					3																	127831784		2203	4300	6503	SO:0001583	missense	8607	exon3			TCAGTTGAGTAAA	AF070735	CCDS3047.1	3q21	2013-09-12	2013-09-12		ENSG00000175792	ENSG00000175792		"""INO80 complex subunits"", ""ATPases / AAA-type"""	10474	protein-coding gene	gene with protein product	"""pontin"", ""INO80 complex subunit H"""	603449	"""RuvB (E coli homolog)-like 1"", ""RuvB-like 1 (E. coli)"", ""RuvB-like AAA ATPase"""			9774387, 9588198	Standard	NM_003707		Approved	TIP49, NMP238, RVB1, TIP49a, Pontin52, ECP54, TIH1, Rvb1, INO80H	uc003ekh.3	Q9Y265	OTTHUMG00000159658	ENST00000322623.5:c.308C>T	chr3.hg19:g.127831784G>A	ENSP00000318297:p.Ser103Leu	193.0	0.0	.		255.0	91.0	.	NM_003707	B2R5S0|P82276|Q1KMR0|Q53HK5|Q53HL7|Q53Y27|Q9BSX9	Missense_Mutation	SNP	ENST00000322623.5	hg19	CCDS3047.1	.	.	.	.	.	.	.	.	.	.	G	35	5.572289	0.96553	.	.	ENSG00000175792	ENST00000464873;ENST00000322623;ENST00000417360	T;T;T	0.74209	-0.82;-0.5;-0.06	5.79	5.79	0.91817	TIP49, C-terminal (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.92140	0.7508	H	0.98577	4.27	0.80722	D	1	D;D;P	0.63046	0.992;0.983;0.884	P;D;P	0.69142	0.897;0.962;0.766	D	0.94607	0.7801	10	0.87932	D	0	-15.933	20.0349	0.97554	0.0:0.0:1.0:0.0	.	103;103;43	Q9Y265-2;Q9Y265;E7ETR0	.;RUVB1_HUMAN;.	L	43;103;103	ENSP00000420738:S43L;ENSP00000318297:S103L;ENSP00000393755:S103L	ENSP00000318297:S103L	S	-	2	0	RUVBL1	129314474	1.000000	0.71417	0.963000	0.40424	0.881000	0.50899	9.869000	0.99810	2.735000	0.93741	0.591000	0.81541	TCA	.	.	.	none		0.502	RUVBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356728.2		
PCDH1	5097	hgsc.bcm.edu	37	5	141233645	141233645	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr5:141233645C>G	ENST00000287008.3	-	5	3823	c.3676G>C	c.(3676-3678)Gca>Cca	p.A1226P	PCDH1_ENST00000503492.1_3'UTR	NM_032420.2	NP_115796.2	Q08174	PCDH1_HUMAN	protocadherin 1	0					cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		TGGGCAGATGCCGGTGTGGCT	0.667																																					p.A1226P	Ovarian(132;1609 1739 4190 14731 45037)	Atlas-SNP	.											PCDH1,NS,carcinoma,0,1	PCDH1	119	.	0			c.G3676C						PASS	.						24.0	31.0	29.0					5																	141233645		2203	4300	6503	SO:0001583	missense	5097	exon5			CAGATGCCGGTGT	AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000287008.3:c.3676G>C	chr5.hg19:g.141233645C>G	ENSP00000287008:p.Ala1226Pro	46.0	0.0	.		39.0	21.0	.	NM_032420	Q8IUP2	Missense_Mutation	SNP	ENST00000287008.3	hg19	CCDS4267.1	.	.	.	.	.	.	.	.	.	.	C	7.872	0.728354	0.15507	.	.	ENSG00000156453	ENST00000287008	T	0.53640	0.61	3.89	3.89	0.44902	.	.	.	.	.	T	0.28863	0.0716	N	0.14661	0.345	0.80722	D	1	B	0.09022	0.002	B	0.06405	0.002	T	0.08554	-1.0716	9	0.34782	T	0.22	.	9.8085	0.40808	0.0:0.7904:0.2096:0.0	.	1226	Q08174-2	.	P	1226	ENSP00000287008:A1226P	ENSP00000287008:A1226P	A	-	1	0	PCDH1	141213829	1.000000	0.71417	1.000000	0.80357	0.847000	0.48162	2.372000	0.44257	2.457000	0.83068	0.462000	0.41574	GCA	.	.	.	none		0.667	PCDH1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320587.2	NM_032420	
SNRNP48	154007	hgsc.bcm.edu	37	6	7601644	7601644	+	Missense_Mutation	SNP	G	G	C	rs143226311	byFrequency	TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr6:7601644G>C	ENST00000342415.5	+	5	541	c.482G>C	c.(481-483)cGt>cCt	p.R161P		NM_152551.3	NP_689764.3	Q6IEG0	SNR48_HUMAN	small nuclear ribonucleoprotein 48kDa (U11/U12)	161					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	U12-type spliceosomal complex (GO:0005689)	metal ion binding (GO:0046872)			kidney(2)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	10						CAAGCTGATCGTCTTGCCCTC	0.368																																					p.R161P		Atlas-SNP	.											.	SNRNP48	32	.	0			c.G482C						PASS	.						116.0	112.0	114.0					6																	7601644		2203	4300	6503	SO:0001583	missense	154007	exon5			CTGATCGTCTTGC	AK056796	CCDS4502.1	6p24.3	2011-10-11	2008-10-29	2008-10-29	ENSG00000168566	ENSG00000168566			21368	protein-coding gene	gene with protein product	"""U11/U12 snRNP 48K"""		"""chromosome 6 open reading frame 151"""	C6orf151		15146077	Standard	XR_427825		Approved	FLJ32234, dJ512B11.2, dJ336K20B.1	uc003mxr.3	Q6IEG0	OTTHUMG00000014213	ENST00000342415.5:c.482G>C	chr6.hg19:g.7601644G>C	ENSP00000339834:p.Arg161Pro	228.0	0.0	.		174.0	63.0	.	NM_152551	A8K8P4|Q14C91|Q5T339|Q5THM1|Q5THM2|Q96MK1	Missense_Mutation	SNP	ENST00000342415.5	hg19	CCDS4502.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.334843	0.81801	.	.	ENSG00000168566	ENST00000342415	T	0.50548	0.74	5.95	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.62962	0.2471	M	0.82323	2.585	0.54753	D	0.999982	D	0.89917	1.0	D	0.85130	0.997	T	0.70916	-0.4742	10	0.87932	D	0	-15.5175	12.6775	0.56903	0.0793:0.0:0.9207:0.0	.	161	Q6IEG0	SNR48_HUMAN	P	161	ENSP00000339834:R161P	ENSP00000339834:R161P	R	+	2	0	SNRNP48	7546643	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	8.383000	0.90157	1.520000	0.48965	0.491000	0.48974	CGT	.	G|1.000;A|0.000	.	alt		0.368	SNRNP48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039787.3	NM_152551	
OR2B3	442184	hgsc.bcm.edu	37	6	29054989	29054989	+	Missense_Mutation	SNP	T	T	G	rs139090624		TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr6:29054989T>G	ENST00000377173.2	-	1	101	c.37A>C	c.(37-39)Ata>Cta	p.I13L		NM_001005226.2	NP_001005226.1	O76000	OR2B3_HUMAN	olfactory receptor, family 2, subfamily B, member 3	13						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(2)|lung(17)|prostate(1)|skin(2)	24						CCAAGTAGTATAAACTCTTTT	0.373																																					p.I13L		Atlas-SNP	.											.	OR2B3	44	.	0			c.A37C						PASS	.						67.0	67.0	67.0					6																	29054989		2203	4300	6503	SO:0001583	missense	442184	exon1			GTAGTATAAACTC		CCDS34358.1	6p22.2-p21.31	2012-08-09	2008-10-22	2008-10-22	ENSG00000204703	ENSG00000204703		"""GPCR / Class A : Olfactory receptors"""	8238	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily B, member 3 pseudogene"""	OR2B3P			Standard	NM_001005226		Approved	OR6-4	uc003nlx.3	O76000	OTTHUMG00000031226	ENST00000377173.2:c.37A>C	chr6.hg19:g.29054989T>G	ENSP00000366378:p.Ile13Leu	102.0	0.0	.		107.0	45.0	.	NM_001005226	B0UYQ1|Q5ST41|Q96R13	Missense_Mutation	SNP	ENST00000377173.2	hg19	CCDS34358.1	.	.	.	.	.	.	.	.	.	.	T	5.503	0.277866	0.10403	.	.	ENSG00000204703	ENST00000377173	T	0.00873	5.59	3.37	2.19	0.27852	.	0.523945	0.15199	U	0.275147	T	0.00412	0.0013	L	0.50993	1.605	0.09310	N	1	B	0.22003	0.063	B	0.23716	0.048	T	0.46775	-0.9167	10	0.42905	T	0.14	.	5.2242	0.15385	0.0:0.104:0.3105:0.5855	.	13	O76000	OR2B3_HUMAN	L	13	ENSP00000366378:I13L	ENSP00000366378:I13L	I	-	1	0	OR2B3	29162968	0.045000	0.20229	0.611000	0.29010	0.205000	0.24178	-0.114000	0.10757	0.370000	0.24538	-0.396000	0.06452	ATA	.	T|1.000;C|0.000	.	alt		0.373	OR2B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076469.2		
CDK13	8621	hgsc.bcm.edu	37	7	40127807	40127807	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr7:40127807T>C	ENST00000181839.4	+	12	3717	c.3112T>C	c.(3112-3114)Tcc>Ccc	p.S1038P	CDK13_ENST00000340829.5_Missense_Mutation_p.S1038P	NM_003718.4|NM_031267.3	NP_003709.3|NP_112557.2	Q14004	CDK13_HUMAN	cyclin-dependent kinase 13	1038					alternative mRNA splicing, via spliceosome (GO:0000380)|hemopoiesis (GO:0030097)|multicellular organismal development (GO:0007275)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|positive regulation of cell proliferation (GO:0008284)|regulation of mitosis (GO:0007088)|viral process (GO:0016032)	cyclin K-CDK13 complex (GO:0002945)|extracellular space (GO:0005615)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(2)|prostate(2)|skin(5)|stomach(2)|urinary_tract(1)	49						TGATGATGTTTCCACAATTAA	0.453																																					p.S1038P		Atlas-SNP	.											.	CDK13	114	.	0			c.T3112C						PASS	.						90.0	87.0	88.0					7																	40127807		2203	4300	6503	SO:0001583	missense	8621	exon12			GATGTTTCCACAA	M80629	CCDS5461.1, CCDS5462.1	7p14.1	2011-11-08	2009-12-16	2009-12-16	ENSG00000065883	ENSG00000065883		"""Cyclin-dependent kinases"""	1733	protein-coding gene	gene with protein product	"""cholinesterase-related cell division controller"""	603309	"""cell division cycle 2-like 5 (cholinesterase-related cell division controller)"""	CDC2L5		1731328, 19884882	Standard	NM_003718		Approved	CHED, CDC2L, KIAA1791	uc003thh.4	Q14004	OTTHUMG00000023726	ENST00000181839.4:c.3112T>C	chr7.hg19:g.40127807T>C	ENSP00000181839:p.Ser1038Pro	105.0	0.0	.		208.0	97.0	.	NM_003718	Q53G78|Q6DKQ9|Q75MH4|Q75MH5|Q96JN4|Q9H4A0|Q9H4A1|Q9UDR4	Missense_Mutation	SNP	ENST00000181839.4	hg19	CCDS5461.1	.	.	.	.	.	.	.	.	.	.	T	8.629	0.893231	0.17613	.	.	ENSG00000065883	ENST00000181839;ENST00000340829	T;T	0.34472	1.36;1.36	5.56	5.56	0.83823	.	.	.	.	.	T	0.21347	0.0514	N	0.04090	-0.28	0.28827	N	0.897359	P;B	0.41265	0.744;0.069	B;B	0.44044	0.439;0.014	T	0.05162	-1.0902	8	.	.	.	-7.2605	9.3088	0.37891	0.2509:0.0:0.0:0.7491	.	1038;1038	Q14004-2;Q14004	.;CDK13_HUMAN	P	1038	ENSP00000181839:S1038P;ENSP00000340557:S1038P	.	S	+	1	0	CDK13	40094332	1.000000	0.71417	1.000000	0.80357	0.728000	0.41692	3.739000	0.55075	2.250000	0.74265	0.477000	0.44152	TCC	.	.	.	none		0.453	CDK13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250726.2	NM_003718	
CUX1	1523	hgsc.bcm.edu	37	7	101837159	101837159	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr7:101837159G>A	ENST00000292535.7	+	13	1152	c.1114G>A	c.(1114-1116)Gct>Act	p.A372T	CUX1_ENST00000547394.2_Missense_Mutation_p.A367T|CUX1_ENST00000425244.2_Missense_Mutation_p.A337T|CUX1_ENST00000556210.1_Missense_Mutation_p.A372T|CUX1_ENST00000292538.4_Missense_Mutation_p.A383T|CUX1_ENST00000393824.3_Missense_Mutation_p.A344T|CUX1_ENST00000550008.2_Missense_Mutation_p.A372T|SNORA48_ENST00000517015.1_RNA|CUX1_ENST00000437600.4_Missense_Mutation_p.A381T|CUX1_ENST00000360264.3_Missense_Mutation_p.A383T|CUX1_ENST00000549414.2_Missense_Mutation_p.A372T|CUX1_ENST00000560541.1_3'UTR|CUX1_ENST00000546411.2_Missense_Mutation_p.A372T	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	372					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						GTCCGAGGGCGCTGGGACACA	0.517																																					p.A383T		Atlas-SNP	.											.	CUX1	253	.	0			c.G1147A						PASS	.						81.0	68.0	73.0					7																	101837159		2203	4300	6503	SO:0001583	missense	1523	exon13			GAGGGCGCTGGGA	M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.1114G>A	chr7.hg19:g.101837159G>A	ENSP00000292535:p.Ala372Thr	84.0	0.0	.		100.0	58.0	.	NM_001202543	B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Missense_Mutation	SNP	ENST00000292535.7	hg19	CCDS5721.1	.	.	.	.	.	.	.	.	.	.	G	16.57	3.161274	0.57368	.	.	ENSG00000257923	ENST00000292538;ENST00000547394;ENST00000360264;ENST00000425244;ENST00000437600;ENST00000292535;ENST00000549414;ENST00000550008;ENST00000546411;ENST00000556210	T;T;T;T;T;T;T;T;T;T	0.60797	1.36;1.36;0.17;1.35;1.36;0.17;0.18;0.18;0.16;0.16	5.71	3.92	0.45320	.	0.260144	0.32918	N	0.005499	T	0.28433	0.0703	N	0.04018	-0.295	0.45318	D	0.998318	B;B;B;B;B;B;B	0.32071	0.021;0.004;0.01;0.355;0.017;0.103;0.007	B;B;B;B;B;B;B	0.24006	0.004;0.001;0.005;0.05;0.007;0.017;0.004	T	0.08534	-1.0717	10	0.42905	T	0.14	-7.0079	5.9431	0.19203	0.1559:0.0:0.5972:0.2469	.	344;372;337;367;381;383;383	B4DZZ2;P39880;B3KV79;G3V1Z6;Q13948-2;Q13948;P39880-3	.;CUX1_HUMAN;.;.;.;CASP_HUMAN;.	T	383;367;383;337;381;372;372;372;372;372	ENSP00000292538:A383T;ENSP00000449371:A367T;ENSP00000353401:A383T;ENSP00000409745:A337T;ENSP00000414091:A381T;ENSP00000292535:A372T;ENSP00000446630:A372T;ENSP00000447373:A372T;ENSP00000450125:A372T;ENSP00000451558:A372T	ENSP00000292535:A372T	A	+	1	0	CUX1	101623879	0.969000	0.33509	0.996000	0.52242	0.920000	0.55202	1.299000	0.33424	0.775000	0.33450	0.561000	0.74099	GCT	.	.	.	none		0.517	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347535.1	NM_001913	
SLC13A1	6561	hgsc.bcm.edu	37	7	122774491	122774491	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr7:122774491C>G	ENST00000194130.2	-	8	944	c.905G>C	c.(904-906)tGg>tCg	p.W302S	SLC13A1_ENST00000539873.1_3'UTR	NM_022444.3	NP_071889.2	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 1	302					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	45					Succinic acid(DB00139)	CCACTGAAGCCAGATCCAGGA	0.418																																					p.W302S		Atlas-SNP	.											.	SLC13A1	110	.	0			c.G905C						PASS	.						126.0	107.0	114.0					7																	122774491		2203	4300	6503	SO:0001583	missense	6561	exon8			TGAAGCCAGATCC		CCDS5786.1	7q31.32	2013-07-18	2013-07-18		ENSG00000081800	ENSG00000081800		"""Solute carriers"""	10916	protein-coding gene	gene with protein product		606193	"""solute carrier family 13 (sodium/sulphate symporters), member 1"""			11161786	Standard	NM_022444		Approved	NaSi-1, NAS1	uc003vkm.3	Q9BZW2	OTTHUMG00000157087	ENST00000194130.2:c.905G>C	chr7.hg19:g.122774491C>G	ENSP00000194130:p.Trp302Ser	88.0	0.0	.		156.0	72.0	.	NM_022444	Q9H5Z0	Missense_Mutation	SNP	ENST00000194130.2	hg19	CCDS5786.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.154544	0.78114	.	.	ENSG00000081800	ENST00000194130	T	0.02974	4.09	6.04	6.04	0.98038	.	0.106696	0.64402	D	0.000001	T	0.17109	0.0411	M	0.79343	2.45	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.00002	-1.2618	10	0.72032	D	0.01	-10.0465	18.0887	0.89466	0.0:1.0:0.0:0.0	.	302;302	A4D0X1;Q9BZW2	.;S13A1_HUMAN	S	302	ENSP00000194130:W302S	ENSP00000194130:W302S	W	-	2	0	SLC13A1	122561727	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.962000	0.70364	2.873000	0.98535	0.563000	0.77884	TGG	.	.	.	none		0.418	SLC13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347404.1	NM_022444	
KAT6B	23522	hgsc.bcm.edu	37	10	76602897	76602897	+	Silent	SNP	G	G	T	rs569038847	byFrequency	TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr10:76602897G>T	ENST00000287239.4	+	3	771	c.282G>T	c.(280-282)ggG>ggT	p.G94G	KAT6B_ENST00000372724.1_Silent_p.G94G|KAT6B_ENST00000372711.1_Silent_p.G94G|KAT6B_ENST00000372725.1_Silent_p.G94G|KAT6B_ENST00000372714.1_Silent_p.G94G	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	94					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										CAGCCAAGGGGTCTAGAGGAT	0.473																																					p.G94G		Atlas-SNP	.											.	.	.	.	0			c.G282T						PASS	.						110.0	115.0	114.0					10																	76602897		2203	4300	6503	SO:0001819	synonymous_variant	23522	exon3			CAAGGGGTCTAGA	AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.282G>T	chr10.hg19:g.76602897G>T		347.0	0.0	.		467.0	142.0	.	NM_001256469	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Silent	SNP	ENST00000287239.4	hg19	CCDS7345.1																																																																																			.	.	.	none		0.473	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048771.1	NM_012330	
LRP4	4038	hgsc.bcm.edu	37	11	46897384	46897384	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr11:46897384G>A	ENST00000378623.1	-	26	3912	c.3670C>T	c.(3670-3672)Caa>Taa	p.Q1224*	LRP4-AS1_ENST00000531719.1_RNA|LRP4-AS1_ENST00000502049.2_RNA	NM_002334.3	NP_002325.2	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein 4	1224					dendrite morphogenesis (GO:0048813)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|limb development (GO:0060173)|negative regulation of axonogenesis (GO:0050771)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of presynaptic membrane organization (GO:1901631)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|proximal/distal pattern formation (GO:0009954)|regulation of protein phosphorylation (GO:0001932)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|synapse organization (GO:0050808)|synaptic growth at neuromuscular junction (GO:0051124)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|synaptic membrane (GO:0097060)	calcium ion binding (GO:0005509)|receptor tyrosine kinase binding (GO:0030971)|scaffold protein binding (GO:0097110)			breast(7)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(24)|ovary(3)|pancreas(2)|prostate(5)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	70				Lung(87;0.159)		CATAGCAGTTGGGAGCTGGCC	0.602																																					p.Q1224X		Atlas-SNP	.											.	LRP4	160	.	0			c.C3670T						PASS	.						117.0	87.0	97.0					11																	46897384		2201	4299	6500	SO:0001587	stop_gained	4038	exon26			GCAGTTGGGAGCT	AB011540	CCDS31478.1	11p11.2	2013-05-29			ENSG00000134569	ENSG00000134569		"""Low density lipoprotein receptors"""	6696	protein-coding gene	gene with protein product		604270				9693030	Standard	NM_002334		Approved	MEGF7, CLSS, LRP-4, SOST2	uc001ndn.4	O75096	OTTHUMG00000166700	ENST00000378623.1:c.3670C>T	chr11.hg19:g.46897384G>A	ENSP00000367888:p.Gln1224*	108.0	0.0	.		101.0	40.0	.	NM_002334	B2RN39|Q4AC85|Q5KTZ5	Nonsense_Mutation	SNP	ENST00000378623.1	hg19	CCDS31478.1	.	.	.	.	.	.	.	.	.	.	G	43	10.368400	0.99392	.	.	ENSG00000134569	ENST00000378623	.	.	.	5.71	5.71	0.89125	.	0.058544	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	.	19.8574	0.96764	0.0:0.0:1.0:0.0	.	.	.	.	X	1224	.	ENSP00000367888:Q1224X	Q	-	1	0	LRP4	46853960	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.670000	0.83925	2.704000	0.92352	0.555000	0.69702	CAA	.	.	.	none		0.602	LRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391133.1	NM_002334	
OR5I1	10798	hgsc.bcm.edu	37	11	55703836	55703836	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr11:55703836A>T	ENST00000301532.3	-	1	40	c.41T>A	c.(40-42)tTt>tAt	p.F14Y		NM_006637.1	NP_006628.1	Q13606	OR5I1_HUMAN	olfactory receptor, family 5, subfamily I, member 1	14					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(34)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						TAATAGAATAAACTCAGTGAC	0.358																																					p.F14Y		Atlas-SNP	.											.	OR5I1	110	.	0			c.T41A						PASS	.						50.0	49.0	49.0					11																	55703836		2201	4293	6494	SO:0001583	missense	10798	exon1			AGAATAAACTCAG	BC069093	CCDS7949.1	11q11	2012-08-09			ENSG00000167825	ENSG00000167825		"""GPCR / Class A : Olfactory receptors"""	8347	protein-coding gene	gene with protein product		608496				9017400, 9787077	Standard	NM_006637		Approved	HSOlf1, OLF1	uc010ris.2	Q13606	OTTHUMG00000166821	ENST00000301532.3:c.41T>A	chr11.hg19:g.55703836A>T	ENSP00000301532:p.Phe14Tyr	88.0	0.0	.		85.0	34.0	.	NM_006637	Q6IEU4	Missense_Mutation	SNP	ENST00000301532.3	hg19	CCDS7949.1	.	.	.	.	.	.	.	.	.	.	A	16.89	3.246108	0.59103	.	.	ENSG00000167825	ENST00000301532	T	0.04360	3.64	5.05	5.05	0.67936	.	0.000000	0.48767	D	0.000175	T	0.27027	0.0662	M	0.92412	3.305	0.35686	D	0.814491	D	0.63880	0.993	D	0.67548	0.952	T	0.50566	-0.8813	10	0.72032	D	0.01	.	13.0502	0.58950	1.0:0.0:0.0:0.0	.	14	Q13606	OR5I1_HUMAN	Y	14	ENSP00000301532:F14Y	ENSP00000301532:F14Y	F	-	2	0	OR5I1	55460412	1.000000	0.71417	0.960000	0.40013	0.238000	0.25445	8.249000	0.89833	2.020000	0.59435	0.519000	0.50382	TTT	.	.	.	none		0.358	OR5I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391528.1	NM_006637	
RBM4	5936	hgsc.bcm.edu	37	11	66411450	66411450	+	Silent	SNP	T	T	A			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr11:66411450T>A	ENST00000409406.1	+	2	1719	c.942T>A	c.(940-942)gcT>gcA	p.A314A	RBM14-RBM4_ENST00000412278.2_Silent_p.A289A|RBM4_ENST00000398692.4_Intron|RBM4_ENST00000578778.1_Intron|RBM4_ENST00000506523.2_Intron|RBM4_ENST00000408993.2_Silent_p.A314A|RBM4_ENST00000515838.2_3'UTR|RBM4_ENST00000530235.1_Intron|RBM4_ENST00000310092.7_Silent_p.A314A|RBM4_ENST00000514361.3_Silent_p.A289A|RBM14-RBM4_ENST00000500635.2_Intron|RBM4_ENST00000503028.2_Silent_p.A314A|RBM4_ENST00000396053.4_Intron			Q9BWF3	RBM4_HUMAN	RNA binding motif protein 4	314	Interaction with TNPO3.				cap-independent translational initiation (GO:0002190)|cell differentiation (GO:0030154)|circadian regulation of translation (GO:0097167)|entrainment of circadian clock by photoperiod (GO:0043153)|IRES-dependent translational initiation (GO:0002192)|mRNA processing (GO:0006397)|negative regulation of translation (GO:0017148)|negative regulation of translation in response to stress (GO:0032055)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|negative regulation of translational initiation (GO:0045947)|positive regulation of muscle cell differentiation (GO:0051149)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of nucleocytoplasmic transport (GO:0046822)|response to arsenic-containing substance (GO:0046685)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|stress-activated MAPK cascade (GO:0051403)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	miRNA binding (GO:0035198)|mRNA 3'-UTR binding (GO:0003730)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA intronic binding (GO:0097157)|pre-mRNA intronic pyrimidine-rich binding (GO:0097158)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(4)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13				Lung(977;0.0112)|LUSC - Lung squamous cell carcinoma(976;0.0266)		TGCGTCGCGCTACAGCCCCAG	0.617																																					p.A314A		Atlas-SNP	.											.	RBM4	34	.	0			c.T942A						PASS	.						47.0	52.0	50.0					11																	66411450		2091	4236	6327	SO:0001819	synonymous_variant	5936	exon3			TCGCGCTACAGCC	U89505	CCDS41676.1, CCDS55776.1, CCDS55777.1	11q13	2013-02-12			ENSG00000173933	ENSG00000173933		"""Zinc fingers, CCHC domain containing"", ""RNA binding motif (RRM) containing"""	9901	protein-coding gene	gene with protein product		602571				9169144, 16260624	Standard	NM_002896		Approved	LARK, RBM4A, ZCRB3A, ZCCHC21		Q9BWF3	OTTHUMG00000154171	ENST00000409406.1:c.942T>A	chr11.hg19:g.66411450T>A		136.0	0.0	.		161.0	59.0	.	NM_002896	B3KUN0|B4E1U0|E7EQS3|O02916|Q4VC48|Q6P1P2|Q8WU85	Silent	SNP	ENST00000409406.1	hg19	CCDS41676.1																																																																																			.	.	.	none		0.617	RBM4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334212.1	NM_002896	
PCF11	51585	hgsc.bcm.edu	37	11	82877725	82877725	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr11:82877725A>G	ENST00000298281.4	+	5	2238	c.1786A>G	c.(1786-1788)Aga>Gga	p.R596G		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	596					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)		p.R695R(1)|p.R596R(1)		cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						GTCTGCCAAAAGATGGAAATC	0.348																																					p.R596G		Atlas-SNP	.											PCF11_ENST00000298281,bladder,carcinoma,0,2	PCF11	220	.	2	Substitution - coding silent(2)	urinary_tract(2)	c.A1786G						PASS	.						73.0	75.0	74.0					11																	82877725		1759	3852	5611	SO:0001583	missense	51585	exon5			GCCAAAAGATGGA	AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.1786A>G	chr11.hg19:g.82877725A>G	ENSP00000298281:p.Arg596Gly	166.0	0.0	.		154.0	72.0	.	NM_015885	A6H8W7|O43671|Q6P0X8	Missense_Mutation	SNP	ENST00000298281.4	hg19	CCDS44689.1	.	.	.	.	.	.	.	.	.	.	A	15.47	2.844048	0.51164	.	.	ENSG00000165494	ENST00000298281;ENST00000530660;ENST00000530304	T;T;T	0.68903	0.49;-0.36;-0.17	6.07	-0.732	0.11147	.	0.000000	0.64402	D	0.000005	T	0.71099	0.3300	L	0.34521	1.04	0.41136	D	0.985927	D;D	0.76494	0.999;0.999	D;D	0.78314	0.991;0.991	T	0.67280	-0.5710	9	.	.	.	.	17.6867	0.88258	0.3868:0.6132:0.0:0.0	.	596;596	E9PQ01;O94913	.;PCF11_HUMAN	G	596	ENSP00000298281:R596G;ENSP00000434540:R596G;ENSP00000431567:R596G	.	R	+	1	2	PCF11	82555373	0.996000	0.38824	0.972000	0.41901	0.993000	0.82548	0.572000	0.23684	-0.360000	0.08138	-0.316000	0.08728	AGA	.	.	.	none		0.348	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392548.2	NM_015885	
C11orf65	160140	hgsc.bcm.edu	37	11	108276173	108276173	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr11:108276173T>C	ENST00000529391.1	-	5	552	c.543A>G	c.(541-543)atA>atG	p.I181M	C11orf65_ENST00000525729.1_Missense_Mutation_p.I132M|C11orf65_ENST00000393084.1_Missense_Mutation_p.I181M|C11orf65_ENST00000526725.1_5'UTR			Q8NCR3	CK065_HUMAN	chromosome 11 open reading frame 65	181										endometrium(1)|large_intestine(3)|lung(4)|ovary(2)	10		all_cancers(61;1.38e-11)|all_epithelial(67;3.16e-07)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;8.21e-06)|BRCA - Breast invasive adenocarcinoma(274;1.01e-05)|all cancers(92;0.000189)|Colorectal(284;0.114)|OV - Ovarian serous cystadenocarcinoma(223;0.144)		TCATCCACTCTATTTTTCTAA	0.338																																					p.I181M		Atlas-SNP	.											.	C11orf65	29	.	0			c.A543G						PASS	.						126.0	123.0	124.0					11																	108276173		2200	4298	6498	SO:0001583	missense	160140	exon6			CCACTCTATTTTT	BC059411	CCDS8340.1	11q22.3	2012-05-30			ENSG00000166323	ENSG00000166323			28519	protein-coding gene	gene with protein product						12477932	Standard	NM_152587		Approved	MGC33948	uc001pkh.3	Q8NCR3	OTTHUMG00000166489	ENST00000529391.1:c.543A>G	chr11.hg19:g.108276173T>C	ENSP00000436400:p.Ile181Met	98.0	0.0	.		107.0	49.0	.	NM_152587	B4DZU4|Q6PCA8	Missense_Mutation	SNP	ENST00000529391.1	hg19	CCDS8340.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.26|15.26	2.780994|2.780994	0.49891|0.49891	.|.	.|.	ENSG00000166323|ENSG00000166323	ENST00000525729;ENST00000529391;ENST00000393084;ENST00000533583|ENST00000524755	T;T;T;T|.	0.34859|.	1.34;1.34;1.34;1.34|.	5.18|5.18	2.62|2.62	0.31277|0.31277	.|.	0.055200|.	0.64402|.	D|.	0.000002|.	T|.	0.50051|.	0.1593|.	M|M	0.68593|0.68593	2.085|2.085	0.31954|0.31954	N|N	0.609249|0.609249	D;D|.	0.67145|.	0.971;0.996|.	P;D|.	0.67548|.	0.839;0.952|.	T|.	0.56619|.	-0.7949|.	10|.	0.62326|.	D|.	0.03|.	-23.4088|-23.4088	5.4186|5.4186	0.16388|0.16388	0.3028:0.0:0.1462:0.551|0.3028:0.0:0.1462:0.551	.|.	132;181|.	B4DZU4;Q8NCR3|.	.;CK065_HUMAN|.	M|W	132;181;181;163|13	ENSP00000433395:I132M;ENSP00000436400:I181M;ENSP00000376799:I181M;ENSP00000434500:I163M|.	ENSP00000376799:I181M|.	I|X	-|-	3|2	3|0	C11orf65|C11orf65	107781383|107781383	0.996000|0.996000	0.38824|0.38824	1.000000|1.000000	0.80357|0.80357	0.960000|0.960000	0.62799|0.62799	0.888000|0.888000	0.28268|0.28268	0.865000|0.865000	0.35603|0.35603	0.460000|0.460000	0.39030|0.39030	ATA|TAG	.	.	.	none		0.338	C11orf65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390010.3	NM_152587	
PRH1	5554	hgsc.bcm.edu	37	12	11035282	11035282	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr12:11035282T>A	ENST00000428168.2	-	3	153	c.116A>T	c.(115-117)gAg>gTg	p.E39V	PRR4_ENST00000536668.1_5'UTR	NM_006250.3	NP_006241.2	P02810	PRPC_HUMAN	proline-rich protein HaeIII subfamily 1	39	Inhibits hydroxyapatite formation, binds to hydroxyapatite and calcium.					extracellular space (GO:0005615)				endometrium(1)|kidney(1)|lung(2)|upper_aerodigestive_tract(1)	5				BRCA - Breast invasive adenocarcinoma(232;0.245)		TAGGAACTGCTCAGAGTCTCC	0.547																																					p.E39V		Atlas-SNP	.											.	PRH1	17	.	0			c.A116T						PASS	.						82.0	49.0	60.0					12																	11035282		2200	4286	6486	SO:0001583	missense	5554	exon3			AACTGCTCAGAGT			12p13.2	2013-05-10			ENSG00000231887	ENSG00000231887			9366	protein-coding gene	gene with protein product		168730				3009472	Standard	NM_001291314		Approved	Pa	uc021qvf.1	P02810		ENST00000428168.2:c.116A>T	chr12.hg19:g.11035282T>A	ENSP00000412436:p.Glu39Val	244.0	0.0	.		311.0	80.0	.	NM_006250	A2VCM0|A3KN66|A5D902|B2RMW2|Q4VBP2|Q53XA2|Q6P2F6	Missense_Mutation	SNP	ENST00000428168.2	hg19		.	.	.	.	.	.	.	.	.	.	T	9.894	1.205135	0.22205	.	.	ENSG00000231887	ENST00000428168	T	0.15487	2.42	1.5	-1.61	0.08399	.	.	.	.	.	T	0.15696	0.0378	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.30475	-0.9977	6	0.59425	D	0.04	.	4.6309	0.12500	0.0:0.3995:0.0:0.6005	.	.	.	.	V	39	ENSP00000412436:E39V	ENSP00000412436:E39V	E	-	2	0	PRH1	10926549	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.486000	0.02312	-0.466000	0.06943	0.459000	0.35465	GAG	.	.	.	none		0.547	PRH1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_006250	
LRP6	4040	hgsc.bcm.edu	37	12	12317326	12317326	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr12:12317326T>G	ENST00000261349.4	-	9	2009	c.1933A>C	c.(1933-1935)Att>Ctt	p.I645L	LRP6_ENST00000543091.1_Missense_Mutation_p.I645L	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	645	Beta-propeller 3.				anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				TCCAGAGAAATTCGTCTGATA	0.418																																					p.I645L		Atlas-SNP	.											.	LRP6	170	.	0			c.A1933C						PASS	.						105.0	104.0	104.0					12																	12317326		2203	4300	6503	SO:0001583	missense	4040	exon9			GAGAAATTCGTCT	AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.1933A>C	chr12.hg19:g.12317326T>G	ENSP00000261349:p.Ile645Leu	172.0	0.0	.		238.0	82.0	.	NM_002336	Q17RZ2	Missense_Mutation	SNP	ENST00000261349.4	hg19	CCDS8647.1	.	.	.	.	.	.	.	.	.	.	T	25.8	4.672125	0.88348	.	.	ENSG00000070018	ENST00000261349;ENST00000543091	D;D	0.91180	-2.8;-2.8	5.65	5.65	0.86999	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.64402	D	0.000008	D	0.94228	0.8147	L	0.60455	1.87	0.80722	D	1	P;B	0.40066	0.701;0.236	D;P	0.64877	0.93;0.578	D	0.92901	0.6339	10	0.33940	T	0.23	.	16.1778	0.81874	0.0:0.0:0.0:1.0	.	645;645	F5H7J9;O75581	.;LRP6_HUMAN	L	645	ENSP00000261349:I645L;ENSP00000442472:I645L	ENSP00000261349:I645L	I	-	1	0	LRP6	12208593	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.222000	0.72249	2.279000	0.76181	0.533000	0.62120	ATT	.	.	.	none		0.418	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400137.1		
KRT85	3891	hgsc.bcm.edu	37	12	52756665	52756665	+	Silent	SNP	C	C	G	rs1621938	byFrequency	TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr12:52756665C>G	ENST00000257901.3	-	6	1125	c.1050G>C	c.(1048-1050)acG>acC	p.T350T	KRT85_ENST00000544265.1_Silent_p.T138T	NM_002283.3	NP_002274.1	P78386	KRT85_HUMAN	keratin 85	350	Coil 2.|Rod.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(7)|liver(1)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	36	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		CAATCTCGGCCGTCAGCCTCT	0.587																																					p.T350T		Atlas-SNP	.											KRT85,caecum,carcinoma,0,1	KRT85	78	.	0			c.G1050C						PASS	.						147.0	120.0	129.0					12																	52756665		2203	4300	6503	SO:0001819	synonymous_variant	3891	exon6			CTCGGCCGTCAGC	X99140	CCDS8824.1, CCDS73472.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000135443	ENSG00000135443		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6462	protein-coding gene	gene with protein product	"""hard keratin type II"""	602767	"""keratin, hair, basic, 5"""	KRTHB5		9084137, 16831889	Standard	NM_002283		Approved	Hb-5	uc001sag.3	P78386	OTTHUMG00000169633	ENST00000257901.3:c.1050G>C	chr12.hg19:g.52756665C>G		144.0	1.0	.		199.0	67.0	.	NM_002283	Q9NSB1	Silent	SNP	ENST00000257901.3	hg19	CCDS8824.1																																																																																			.	C|0.975;T|0.025	.	alt		0.587	KRT85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405184.1	NM_002283	
DDX55	57696	hgsc.bcm.edu	37	12	124093348	124093348	+	Nonsense_Mutation	SNP	A	A	T			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr12:124093348A>T	ENST00000238146.4	+	6	573	c.523A>T	c.(523-525)Aga>Tga	p.R175*	DDX55_ENST00000538744.1_Nonsense_Mutation_p.R175*	NM_020936.1	NP_065987.1	Q8NHQ9	DDX55_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 55	175	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					membrane (GO:0016020)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000142)|Epithelial(86;0.000637)|all cancers(50;0.00772)		TGAGGCAGACAGACTTCTGGA	0.537																																					p.R175X		Atlas-SNP	.											.	DDX55	51	.	0			c.A523T						PASS	.						140.0	127.0	132.0					12																	124093348		2203	4300	6503	SO:0001587	stop_gained	57696	exon6			GCAGACAGACTTC	AB046815	CCDS9251.1	12q24.31	2003-06-13			ENSG00000111364	ENSG00000111364		"""DEAD-boxes"""	20085	protein-coding gene	gene with protein product						10997877	Standard	NM_020936		Approved	KIAA1595	uc001ufi.3	Q8NHQ9	OTTHUMG00000168695	ENST00000238146.4:c.523A>T	chr12.hg19:g.124093348A>T	ENSP00000238146:p.Arg175*	81.0	0.0	.		136.0	85.0	.	NM_020936	Q658L6|Q8IYH0|Q9HCH7	Nonsense_Mutation	SNP	ENST00000238146.4	hg19	CCDS9251.1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.529924	0.85706	.	.	ENSG00000111364	ENST00000238146;ENST00000538449;ENST00000538744	.	.	.	5.56	0.428	0.16499	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-35.4688	10.2464	0.43343	0.5084:0.4032:0.0:0.0884	.	.	.	.	X	175	.	ENSP00000238146:R175X	R	+	1	2	DDX55	122659301	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	1.558000	0.36309	0.084000	0.17077	0.460000	0.39030	AGA	.	.	.	none		0.537	DDX55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400616.2		
ARHGEF40	55701	hgsc.bcm.edu	37	14	21546590	21546590	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr14:21546590C>G	ENST00000298694.4	+	10	2316	c.2189C>G	c.(2188-2190)gCa>gGa	p.A730G	ARHGEF40_ENST00000298693.3_Missense_Mutation_p.A730G			Q8TER5	ARH40_HUMAN	Rho guanine nucleotide exchange factor (GEF) 40	730						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			large_intestine(4)|ovary(3)|upper_aerodigestive_tract(2)	9						CGGCTGACGGCACTGCAGAGG	0.632																																					p.A730G		Atlas-SNP	.											.	ARHGEF40	84	.	0			c.C2189G						PASS	.						58.0	61.0	60.0					14																	21546590		2203	4300	6503	SO:0001583	missense	55701	exon10			TGACGGCACTGCA		CCDS32041.1	14q11.2	2012-07-24			ENSG00000165801	ENSG00000165801		"""Rho guanine nucleotide exchange factors"""	25516	protein-coding gene	gene with protein product		610018				16143467	Standard	NM_001278529		Approved	solo, FLJ10357	uc001vzp.3	Q8TER5		ENST00000298694.4:c.2189C>G	chr14.hg19:g.21546590C>G	ENSP00000298694:p.Ala730Gly	238.0	0.0	.		168.0	44.0	.	NM_018071	A5PL07|Q9BWP5|Q9H7L6|Q9NTF9|Q9NW24	Missense_Mutation	SNP	ENST00000298694.4	hg19	CCDS32041.1	.	.	.	.	.	.	.	.	.	.	C	11.27	1.587748	0.28268	.	.	ENSG00000165801	ENST00000298694;ENST00000298693	T;T	0.02323	4.4;4.34	4.47	-0.131	0.13494	.	0.432236	0.19670	N	0.108771	T	0.01523	0.0049	N	0.14661	0.345	0.09310	N	1	B;B	0.22541	0.058;0.071	B;B	0.24155	0.051;0.048	T	0.47736	-0.9094	10	0.20046	T	0.44	.	3.5884	0.07979	0.4355:0.3333:0.0:0.2312	.	730;730	Q8TER5-4;Q8TER5	.;ARH40_HUMAN	G	730	ENSP00000298694:A730G;ENSP00000298693:A730G	ENSP00000298693:A730G	A	+	2	0	ARHGEF40	20616430	0.001000	0.12720	0.020000	0.16555	0.990000	0.78478	0.130000	0.15850	0.110000	0.17919	0.462000	0.41574	GCA	.	.	.	none		0.632	ARHGEF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413122.1		
ACIN1	22985	hgsc.bcm.edu	37	14	23564436	23564436	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr14:23564436A>C	ENST00000262710.1	-	1	387	c.60T>G	c.(58-60)aaT>aaG	p.N20K	ACIN1_ENST00000457657.1_Missense_Mutation_p.N20K|ACIN1_ENST00000605057.1_5'Flank|ACIN1_ENST00000555053.1_Missense_Mutation_p.N20K|C14orf119_ENST00000554203.1_5'Flank|C14orf119_ENST00000319074.4_5'UTR	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	20					apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		CTACCCCTCGATTACCACTCA	0.592																																					p.N20K		Atlas-SNP	.											.	ACIN1	147	.	0			c.T60G						PASS	.						98.0	98.0	98.0					14																	23564436		2203	4300	6503	SO:0001583	missense	22985	exon1			CCCTCGATTACCA	AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.60T>G	chr14.hg19:g.23564436A>C	ENSP00000262710:p.Asn20Lys	240.0	0.0	.		196.0	90.0	.	NM_001164814	B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Missense_Mutation	SNP	ENST00000262710.1	hg19	CCDS9587.1	.	.	.	.	.	.	.	.	.	.	A	19.37	3.814723	0.70912	.	.	ENSG00000100813	ENST00000262710;ENST00000457657;ENST00000555053	T;T;T	0.19806	2.36;2.12;2.36	5.45	4.3	0.51218	.	0.000000	0.38548	N	0.001657	T	0.15782	0.0380	N	0.08118	0	0.80722	D	1	P;P	0.48162	0.906;0.849	P;B	0.49192	0.602;0.398	T	0.04165	-1.0972	10	0.87932	D	0	-12.5512	10.7996	0.46480	0.8313:0.1687:0.0:0.0	.	20;20	G3V3M7;Q9UKV3	.;ACINU_HUMAN	K	20	ENSP00000262710:N20K;ENSP00000405677:N20K;ENSP00000451328:N20K	ENSP00000262710:N20K	N	-	3	2	ACIN1	22634276	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.665000	0.25083	2.288000	0.76882	0.482000	0.46254	AAT	.	.	.	none		0.592	ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071707.3	NM_014977	
IPO4	79711	hgsc.bcm.edu	37	14	24648037	24648037	+	IGR	SNP	C	C	T			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr14:24648037C>T	ENST00000354464.6	-	0	3646				REC8_ENST00000311457.3_Missense_Mutation_p.P372L|REC8_ENST00000559919.1_Missense_Mutation_p.P372L	NM_024658.3	NP_078934.3	Q8TEX9	IPO4_HUMAN	importin 4						DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|stomach(2)|urinary_tract(1)	33				GBM - Glioblastoma multiforme(265;0.0087)		GCCCAGCCACCCCCAAAAGCC	0.587																																					p.P372L		Atlas-SNP	.											.	REC8	47	.	0			c.C1115T						PASS	.						146.0	162.0	157.0					14																	24648037		1917	4120	6037	SO:0001628	intergenic_variant	9985	exon14			AGCCACCCCCAAA	AF411122	CCDS9616.1	14q11.2	2003-03-10			ENSG00000196497	ENSG00000196497		"""Importins"""	19426	protein-coding gene	gene with protein product						11823430	Standard	NR_051979		Approved	Imp4, FLJ23338	uc001wmv.1	Q8TEX9	OTTHUMG00000028801		chr14.hg19:g.24648037C>T		450.0	0.0	.		448.0	185.0	.	NM_001048205	B2RN95|Q2NL96|Q86TZ9|Q8NCG8|Q96SJ3|Q9BTI4|Q9H5L0	Missense_Mutation	SNP	ENST00000354464.6	hg19	CCDS9616.1	.	.	.	.	.	.	.	.	.	.	C	17.63	3.436138	0.62955	.	.	ENSG00000100918	ENST00000311457;ENST00000447460	T	0.25085	1.82	5.18	4.29	0.51040	.	0.233366	0.37348	N	0.002138	T	0.19248	0.0462	L	0.34521	1.04	0.35201	D	0.774243	B;B	0.20887	0.049;0.029	B;B	0.20577	0.03;0.013	T	0.15178	-1.0446	10	0.40728	T	0.16	-11.8468	9.8882	0.41274	0.0:0.9069:0.0:0.0931	.	356;373	O95072-2;O95072	.;REC8_HUMAN	L	372;355	ENSP00000308699:P372L	ENSP00000308699:P372L	P	+	2	0	REC8	23717877	0.253000	0.23982	0.233000	0.24025	0.042000	0.13812	1.235000	0.32671	1.403000	0.46800	0.462000	0.41574	CCC	.	.	.	none		0.587	IPO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071931.4	NM_024658	
AKAP6	9472	hgsc.bcm.edu	37	14	33291241	33291241	+	Missense_Mutation	SNP	G	G	A	rs376840822		TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr14:33291241G>A	ENST00000280979.4	+	13	4392	c.4222G>A	c.(4222-4224)Gtg>Atg	p.V1408M	AKAP6_ENST00000557272.1_Intron	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	1408					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		TGCAGTTAACGTGTTAAAGCA	0.438																																					p.V1408M	Melanoma(49;821 1200 7288 13647 42351)	Atlas-SNP	.											.	AKAP6	308	.	0			c.G4222A						PASS	.						72.0	70.0	71.0					14																	33291241		2203	4300	6503	SO:0001583	missense	9472	exon13			GTTAACGTGTTAA	AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.4222G>A	chr14.hg19:g.33291241G>A	ENSP00000280979:p.Val1408Met	127.0	0.0	.		121.0	50.0	.	NM_004274	A7E242|A7E2D4|O15028	Missense_Mutation	SNP	ENST00000280979.4	hg19	CCDS9644.1	.	.	.	.	.	.	.	.	.	.	G	4.459	0.084949	0.08583	.	.	ENSG00000151320	ENST00000280979	T	0.07327	3.2	5.6	-2.53	0.06326	.	1.038410	0.07611	N	0.925352	T	0.06645	0.0170	L	0.27053	0.805	0.09310	N	1	B	0.23735	0.09	B	0.15870	0.014	T	0.39440	-0.9614	10	0.45353	T	0.12	0.19	11.7736	0.51972	0.494:0.0:0.506:0.0	.	1408	Q13023	AKAP6_HUMAN	M	1408	ENSP00000280979:V1408M	ENSP00000280979:V1408M	V	+	1	0	AKAP6	32360992	0.022000	0.18835	0.000000	0.03702	0.813000	0.45954	0.177000	0.16801	-0.393000	0.07739	-0.253000	0.11424	GTG	.	.	.	alt		0.438	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276617.2	NM_004274	
ZC3H7A	29066	hgsc.bcm.edu	37	16	11859408	11859408	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr16:11859408C>A	ENST00000396516.2	-	13	1853	c.1656G>T	c.(1654-1656)aaG>aaT	p.K552N	ZC3H7A_ENST00000355758.4_Missense_Mutation_p.K552N			Q8IWR0	Z3H7A_HUMAN	zinc finger CCCH-type containing 7A	552						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(3)|kidney(5)|large_intestine(2)|liver(1)|lung(3)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(2)	25						TAAGGTTAATCTTTCCATTGC	0.453																																					p.K552N		Atlas-SNP	.											.	ZC3H7A	72	.	0			c.G1656T						PASS	.						95.0	95.0	95.0					16																	11859408		2197	4300	6497	SO:0001583	missense	29066	exon14			GTTAATCTTTCCA	AF161540	CCDS10550.1	16p13-p12	2013-01-11	2005-06-02	2005-06-08	ENSG00000122299	ENSG00000122299		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30959	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 7"", ""zinc finger CCCH-type containing 7"""	ZC3HDC7, ZC3H7		11042152	Standard	NM_014153		Approved	HSPC055, FLJ20318	uc002dbl.3	Q8IWR0	OTTHUMG00000129825	ENST00000396516.2:c.1656G>T	chr16.hg19:g.11859408C>A	ENSP00000379773:p.Lys552Asn	186.0	0.0	.		246.0	72.0	.	NM_014153	D3DUG5|Q9NPE9	Missense_Mutation	SNP	ENST00000396516.2	hg19	CCDS10550.1	.	.	.	.	.	.	.	.	.	.	C	12.82	2.052633	0.36181	.	.	ENSG00000122299	ENST00000355758;ENST00000396516	T;T	0.11063	2.81;2.81	5.81	4.85	0.62838	.	0.088461	0.85682	D	0.000000	T	0.11665	0.0284	L	0.49126	1.545	0.80722	D	1	B;B	0.19445	0.036;0.001	B;B	0.20577	0.03;0.003	T	0.02933	-1.1092	10	0.49607	T	0.09	.	10.5495	0.45079	0.0:0.8534:0.0:0.1466	.	273;552	Q9NXC8;Q8IWR0	.;Z3H7A_HUMAN	N	552	ENSP00000347999:K552N;ENSP00000379773:K552N	ENSP00000347999:K552N	K	-	3	2	ZC3H7A	11766909	0.997000	0.39634	0.962000	0.40283	0.488000	0.33401	1.255000	0.32909	2.736000	0.93811	0.655000	0.94253	AAG	.	.	.	none		0.453	ZC3H7A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437066.1	NM_014153	
ABCC12	94160	hgsc.bcm.edu	37	16	48173154	48173154	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr16:48173154A>G	ENST00000311303.3	-	5	1096	c.751T>C	c.(751-753)Tgt>Cgt	p.C251R	ABCC12_ENST00000448542.1_Missense_Mutation_p.C251R|ABCC12_ENST00000416054.1_Missense_Mutation_p.C251R	NM_033226.2	NP_150229.2	Q96J65	MRP9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 12	251	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.					integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|liver(1)|lung(43)|ovary(2)|prostate(3)|skin(7)|urinary_tract(1)	90		all_cancers(37;0.0474)|all_lung(18;0.047)				TACGCCGCACAAAAGACCATT	0.483																																					p.C251R		Atlas-SNP	.											.	ABCC12	190	.	0			c.T751C						PASS	.						122.0	111.0	115.0					16																	48173154		2201	4300	6501	SO:0001583	missense	94160	exon5			CCGCACAAAAGAC	AY040220	CCDS10730.1	16q12.1	2012-03-14			ENSG00000140798	ENSG00000140798		"""ATP binding cassette transporters / subfamily C"""	14640	protein-coding gene	gene with protein product		607041				11435397, 11483364	Standard	NM_033226		Approved	MRP9	uc002efc.1	Q96J65	OTTHUMG00000133143	ENST00000311303.3:c.751T>C	chr16.hg19:g.48173154A>G	ENSP00000311030:p.Cys251Arg	174.0	0.0	.		238.0	67.0	.	NM_033226	Q49AL2|Q8TAF0|Q8TEY2	Missense_Mutation	SNP	ENST00000311303.3	hg19	CCDS10730.1	.	.	.	.	.	.	.	.	.	.	A	13.91	2.376652	0.42105	.	.	ENSG00000140798	ENST00000311303;ENST00000448542;ENST00000416054	D;D;D	0.90004	-2.6;-2.6;-2.6	5.88	5.88	0.94601	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.93161	0.7822	M	0.71581	2.175	0.80722	D	1	D;P	0.76494	0.999;0.942	D;P	0.80764	0.994;0.82	D	0.93294	0.6671	10	0.59425	D	0.04	.	11.3056	0.49334	0.8477:0.1522:0.0:0.0	.	251;251	Q96J65-2;Q96J65	.;MRP9_HUMAN	R	251	ENSP00000311030:C251R;ENSP00000401855:C251R;ENSP00000413046:C251R	ENSP00000311030:C251R	C	-	1	0	ABCC12	46730655	0.999000	0.42202	0.890000	0.34922	0.048000	0.14542	4.352000	0.59404	2.239000	0.73571	0.533000	0.62120	TGT	.	.	.	none		0.483	ABCC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256837.1	NM_033226	
DNAAF1	123872	hgsc.bcm.edu	37	16	84203896	84203896	+	Missense_Mutation	SNP	C	C	G	rs375641621		TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr16:84203896C>G	ENST00000378553.5	+	8	1586	c.1462C>G	c.(1462-1464)Cga>Gga	p.R488G	DNAAF1_ENST00000563818.1_3'UTR	NM_178452.4	NP_848547.4	Q8NEP3	DAAF1_HUMAN	dynein, axonemal, assembly factor 1	488	Pro-rich.				axonemal dynein complex assembly (GO:0070286)|cilium morphogenesis (GO:0060271)|cilium movement (GO:0003341)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|inner dynein arm assembly (GO:0036159)|left/right pattern formation (GO:0060972)|lung development (GO:0030324)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)|regulation of cilium beat frequency (GO:0003356)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dynein binding (GO:0045502)			NS(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(4)|urinary_tract(1)	41						GGATGGAGATCGAGAGCCAGA	0.597																																					p.R488G		Atlas-SNP	.											.	DNAAF1	81	.	0			c.C1462G						PASS	.						41.0	40.0	40.0					16																	84203896		2200	4300	6500	SO:0001583	missense	123872	exon8			GGAGATCGAGAGC	BC024009	CCDS10943.2	16q24.1	2012-05-03	2011-06-09	2011-06-09	ENSG00000154099	ENSG00000154099			30539	protein-coding gene	gene with protein product	"""outer row dynein assembly 7 homolog (Chlamydomonas)"""	613190	"""leucine rich repeat containing 50"""	LRRC50		19944405	Standard	NM_178452		Approved	FLJ25330, ODA7, CILD13	uc002fhl.4	Q8NEP3	OTTHUMG00000128517	ENST00000378553.5:c.1462C>G	chr16.hg19:g.84203896C>G	ENSP00000367815:p.Arg488Gly	85.0	0.0	.		139.0	6.0	.	NM_178452	B4DJA3|Q69YI8|Q69YJ0|Q69YW5|Q96LP3|Q96MB6	Missense_Mutation	SNP	ENST00000378553.5	hg19	CCDS10943.2	.	.	.	.	.	.	.	.	.	.	C	1.384	-0.582571	0.03827	.	.	ENSG00000154099	ENST00000378553	T	0.26957	1.7	1.35	-0.756	0.11057	.	.	.	.	.	T	0.07683	0.0193	N	0.01352	-0.895	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.38373	-0.9664	9	0.22109	T	0.4	.	7.0593	0.25117	0.0:0.4357:0.5643:0.0	.	252;488	Q8NEP3-2;Q8NEP3	.;DAAF1_HUMAN	G	488	ENSP00000367815:R488G	ENSP00000367815:R488G	R	+	1	2	DNAAF1	82761397	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.340000	0.19892	-0.207000	0.10187	-1.719000	0.00708	CGA	.	.	.	alt		0.597	DNAAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250328.3	NM_178452	
RNMTL1	55178	hgsc.bcm.edu	37	17	694912	694912	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr17:694912A>T	ENST00000304478.4	+	4	972	c.866A>T	c.(865-867)aAc>aTc	p.N289I	RP11-676J12.8_ENST00000574560.1_RNA	NM_018146.2	NP_060616.1			RNA methyltransferase like 1											breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (25;0.0219)		GTGGCTGACAACTGTGGCCTT	0.498																																					p.N289I		Atlas-SNP	.											.	RNMTL1	25	.	0			c.A866T						PASS	.						115.0	105.0	108.0					17																	694912		2203	4300	6503	SO:0001583	missense	55178	exon4			CTGACAACTGTGG	AF177344	CCDS10997.1	17p13.3	2008-02-05			ENSG00000171861	ENSG00000171861			18485	protein-coding gene	gene with protein product		612600				12296377	Standard	NM_018146		Approved	FLJ10581, HC90	uc002frw.3	Q9HC36	OTTHUMG00000090285	ENST00000304478.4:c.866A>T	chr17.hg19:g.694912A>T	ENSP00000306080:p.Asn289Ile	349.0	1.0	.		365.0	202.0	.	NM_018146		Missense_Mutation	SNP	ENST00000304478.4	hg19	CCDS10997.1	.	.	.	.	.	.	.	.	.	.	A	19.72	3.879315	0.72294	.	.	ENSG00000171861	ENST00000304478	T	0.28255	1.62	5.59	5.59	0.84812	tRNA/rRNA methyltransferase, SpoU (1);	0.131490	0.64402	D	0.000001	T	0.51839	0.1698	M	0.67625	2.065	0.58432	D	0.999999	D	0.71674	0.998	D	0.75484	0.986	T	0.45789	-0.9237	10	0.25106	T	0.35	-36.3731	14.5694	0.68202	1.0:0.0:0.0:0.0	.	289	Q9HC36	RMTL1_HUMAN	I	289	ENSP00000306080:N289I	ENSP00000306080:N289I	N	+	2	0	RNMTL1	641662	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	3.177000	0.50871	2.120000	0.65058	0.482000	0.46254	AAC	.	.	.	none		0.498	RNMTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206611.1	NM_018146	
NEURL4	84461	hgsc.bcm.edu	37	17	7230249	7230249	+	Silent	SNP	G	G	A			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr17:7230249G>A	ENST00000399464.2	-	4	888	c.873C>T	c.(871-873)aaC>aaT	p.N291N	NEURL4_ENST00000570460.1_Silent_p.N269N|NEURL4_ENST00000315614.7_Silent_p.N291N	NM_032442.2	NP_115818.2	Q96JN8	NEUL4_HUMAN	neuralized E3 ubiquitin protein ligase 4	291						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GGGAGCTCAGGTTCACATTCA	0.562																																					p.N291N		Atlas-SNP	.											.	NEURL4	192	.	0			c.C873T						PASS	.						77.0	81.0	80.0					17																	7230249		2036	4185	6221	SO:0001819	synonymous_variant	84461	exon4			GCTCAGGTTCACA		CCDS42251.1, CCDS42252.1	17p13	2013-10-24	2013-10-24		ENSG00000215041	ENSG00000215041			34410	protein-coding gene	gene with protein product		615865	"""neuralized homolog 4 (Drosophila)"""			22261722, 22441691	Standard	NM_001005408		Approved	KIAA1787	uc002gga.1	Q96JN8	OTTHUMG00000132319	ENST00000399464.2:c.873C>T	chr17.hg19:g.7230249G>A		154.0	0.0	.		210.0	116.0	.	NM_001005408	Q6GPI8|Q96IU9|Q9H0B0	Silent	SNP	ENST00000399464.2	hg19	CCDS42251.1																																																																																			.	.	.	none		0.562	NEURL4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255434.2	NM_032442	
CDC27	996	hgsc.bcm.edu	37	17	45214623	45214623	+	Missense_Mutation	SNP	G	G	A	rs75637741		TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr17:45214623G>A	ENST00000066544.3	-	14	1901	c.1808C>T	c.(1807-1809)gCc>gTc	p.A603V	CDC27_ENST00000531206.1_Missense_Mutation_p.A609V|CDC27_ENST00000446365.2_Missense_Mutation_p.A542V|CDC27_ENST00000527547.1_Missense_Mutation_p.A602V	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	603					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TAGAGTATAGGCATAAGCGTA	0.383																																					p.A609V		Atlas-SNP	.											CDC27_ENST00000531206,rectum,carcinoma,0,2	CDC27	337	.	0			c.C1826T						PASS	.																																			SO:0001583	missense	996	exon14			GTATAGGCATAAG	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.1808C>T	chr17.hg19:g.45214623G>A	ENSP00000066544:p.Ala603Val	144.0	1.0	.		166.0	12.0	.	NM_001114091	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	hg19	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	G	36	5.873394	0.97049	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	5.81	5.81	0.92471	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.74382	0.3709	M	0.93594	3.435	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.997;0.993;0.993;0.994	T	0.80863	-0.1192	10	0.87932	D	0	-9.797	17.5633	0.87913	0.0:0.0:1.0:0.0	.	542;602;609;603	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	V	603;609;542;602	ENSP00000066544:A603V;ENSP00000434614:A609V;ENSP00000392802:A542V;ENSP00000437339:A602V	ENSP00000066544:A603V	A	-	2	0	CDC27	42569622	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.869000	0.99810	2.761000	0.94854	0.585000	0.79938	GCC	.	.	.	weak		0.383	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
HLF	3131	hgsc.bcm.edu	37	17	53398135	53398135	+	Silent	SNP	G	G	A			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr17:53398135G>A	ENST00000226067.5	+	4	1256	c.783G>A	c.(781-783)gaG>gaA	p.E261E	HLF_ENST00000573945.1_Silent_p.E176E|HLF_ENST00000430986.2_Silent_p.E176E|HLF_ENST00000575307.1_3'UTR|HLF_ENST00000575345.1_Silent_p.E176E	NM_002126.4	NP_002117.1	Q16534	HLF_HUMAN	hepatic leukemia factor	261	bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				multicellular organismal development (GO:0007275)|rhythmic process (GO:0048511)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(1)|ovary(2)	3						CGTTCCTGGAGAAGGAGAACT	0.617			T	TCF3	ALL																																p.E261E		Atlas-SNP	.		Dom	yes		17	17q22	3131	hepatic leukemia factor		L	.	HLF	39	.	0			c.G783A						PASS	.						28.0	32.0	31.0					17																	53398135		2202	4298	6500	SO:0001819	synonymous_variant	3131	exon4			CCTGGAGAAGGAG		CCDS11585.1	17q22	2011-05-19			ENSG00000108924	ENSG00000108924			4977	protein-coding gene	gene with protein product		142385				1386162	Standard	XM_005257269		Approved	MGC33822	uc002iug.1	Q16534		ENST00000226067.5:c.783G>A	chr17.hg19:g.53398135G>A		61.0	0.0	.		82.0	26.0	.	NM_002126	A8K1X8|Q6FHS9	Silent	SNP	ENST00000226067.5	hg19	CCDS11585.1																																																																																			.	.	.	none		0.617	HLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439185.1	NM_002126	
GNA13	10672	hgsc.bcm.edu	37	17	63049838	63049838	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr17:63049838C>A	ENST00000439174.2	-	2	537	c.292G>T	c.(292-294)Gtg>Ttg	p.V98L	RP11-583F2.5_ENST00000581796.1_RNA|GNA13_ENST00000541118.1_Missense_Mutation_p.V3L	NM_006572.4	NP_006563.2	Q14344	GNA13_HUMAN	guanine nucleotide binding protein (G protein), alpha 13	98					activation of phospholipase D activity (GO:0031584)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular component movement (GO:0006928)|in utero embryonic development (GO:0001701)|patterning of blood vessels (GO:0001569)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of cell migration (GO:0030334)|regulation of cell shape (GO:0008360)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)	brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	D5 dopamine receptor binding (GO:0031752)|G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 1 angiotensin receptor binding (GO:0031702)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(14)|kidney(2)|large_intestine(4)|lung(6)|urinary_tract(1)	34						TCAACCAGCACCCTCATACCT	0.383																																					p.V98L		Atlas-SNP	.											.	GNA13	69	.	0			c.G292T						PASS	.						115.0	115.0	115.0					17																	63049838		2203	4300	6503	SO:0001583	missense	10672	exon2			CCAGCACCCTCAT	L22075	CCDS11661.1, CCDS62302.1	17q24.1	2014-09-04			ENSG00000120063	ENSG00000120063			4381	protein-coding gene	gene with protein product		604406				7791744	Standard	NM_006572		Approved	G13, MGC46138	uc002jfc.3	Q14344	OTTHUMG00000179316	ENST00000439174.2:c.292G>T	chr17.hg19:g.63049838C>A	ENSP00000400717:p.Val98Leu	301.0	0.0	.		361.0	195.0	.	NM_006572	B2R977|B7Z7R0|F5H1G8|Q8TD70	Missense_Mutation	SNP	ENST00000439174.2	hg19	CCDS11661.1	.	.	.	.	.	.	.	.	.	.	C	32	5.149213	0.94645	.	.	ENSG00000120063	ENST00000439174;ENST00000541118;ENST00000239138	D;D	0.87729	-2.29;-2.29	5.28	5.28	0.74379	G protein alpha subunit, helical insertion (2);	0.059604	0.64402	D	0.000003	D	0.86176	0.5870	L	0.59436	1.845	0.80722	D	1	P	0.36125	0.538	B	0.34590	0.186	D	0.87418	0.2380	10	0.87932	D	0	.	18.9394	0.92600	0.0:1.0:0.0:0.0	.	98	Q14344	GNA13_HUMAN	L	98;3;73	ENSP00000400717:V98L;ENSP00000439647:V3L	ENSP00000239138:V73L	V	-	1	0	GNA13	60480300	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.487000	0.81328	2.455000	0.83008	0.655000	0.94253	GTG	.	.	.	none		0.383	GNA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445720.1	NM_006572	
MTCL1	23255	hgsc.bcm.edu	37	18	8825493	8825493	+	Silent	SNP	T	T	C			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr18:8825493T>C	ENST00000306329.11	+	13	4942	c.4942T>C	c.(4942-4944)Ttg>Ctg	p.L1648L	SOGA2_ENST00000518815.1_Silent_p.L654L|SOGA2_ENST00000400050.3_Silent_p.L1288L|SOGA2_ENST00000306285.7_Silent_p.L654L|SOGA2_ENST00000359865.3_Silent_p.L1329L|SOGA2_ENST00000517570.1_Silent_p.L1288L																							CAGTGTGGGCTTGCAGACTGA	0.637																																					p.L1329L		Atlas-SNP	.											CCDC165,NS,carcinoma,0,1	.	.	.	0			c.T3985C						PASS	.						33.0	33.0	33.0					18																	8825493		2203	4300	6503	SO:0001819	synonymous_variant	23255	exon15			GTGGGCTTGCAGA																												ENST00000306329.11:c.4942T>C	chr18.hg19:g.8825493T>C		75.0	0.0	.		66.0	3.0	.	NM_015210		Silent	SNP	ENST00000306329.11	hg19																																																																																				.	.	.	none		0.637	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000444141.1		
CSNK2A1	1457	hgsc.bcm.edu	37	20	467041	467041	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr20:467041T>C	ENST00000217244.3	-	13	1414	c.1039A>G	c.(1039-1041)Agc>Ggc	p.S347G	CSNK2A1_ENST00000400227.3_Missense_Mutation_p.S347G|CSNK2A1_ENST00000349736.5_Missense_Mutation_p.S347G|CSNK2A1_ENST00000400217.2_Missense_Mutation_p.S211G	NM_177559.2	NP_808227.1	P68400	CSK21_HUMAN	casein kinase 2, alpha 1 polypeptide	347					axon guidance (GO:0007411)|chaperone-mediated protein folding (GO:0061077)|mitotic cell cycle (GO:0000278)|mitotic spindle checkpoint (GO:0071174)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway (GO:0030177)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|plasma membrane (GO:0005886)|Sin3 complex (GO:0016580)	ATP binding (GO:0005524)|Hsp90 protein binding (GO:0051879)|protein N-terminus binding (GO:0047485)|protein phosphatase regulator activity (GO:0019888)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|urinary_tract(1)	17		Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.0969)			TTGGCGCTGCTGACGGGCGTA	0.428																																					p.S347G		Atlas-SNP	.											.	CSNK2A1	36	.	0			c.A1039G						PASS	.						87.0	84.0	85.0					20																	467041		2203	4300	6503	SO:0001583	missense	1457	exon12			CGCTGCTGACGGG	M55265	CCDS13003.1, CCDS13004.1	20p13	2013-01-17			ENSG00000101266	ENSG00000101266			2457	protein-coding gene	gene with protein product		115440				2174700, 1766873	Standard	NM_177559		Approved		uc002wdx.1	P68400	OTTHUMG00000031636	ENST00000217244.3:c.1039A>G	chr20.hg19:g.467041T>C	ENSP00000217244:p.Ser347Gly	165.0	0.0	.		143.0	34.0	.	NM_001895	B4DYS6|D3DVV8|P19138|P20426|Q14013|Q5U065	Missense_Mutation	SNP	ENST00000217244.3	hg19	CCDS13003.1	.	.	.	.	.	.	.	.	.	.	t	16.92	3.254163	0.59212	.	.	ENSG00000101266	ENST00000400227;ENST00000349736;ENST00000217244;ENST00000381973;ENST00000400217	T;T;T;T	0.63417	0.35;0.34;0.34;-0.04	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	T	0.46756	0.1409	N	0.19112	0.55	0.58432	D	0.999999	B	0.06786	0.001	B	0.04013	0.001	T	0.36939	-0.9727	10	0.27785	T	0.31	-15.3796	14.2224	0.65836	0.0:0.0:0.0:1.0	.	347	P68400	CSK21_HUMAN	G	347;347;347;347;211	ENSP00000383086:S347G;ENSP00000339247:S347G;ENSP00000217244:S347G;ENSP00000383076:S211G	ENSP00000217244:S347G	S	-	1	0	CSNK2A1	415041	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.400000	0.79949	2.207000	0.71202	0.478000	0.44815	AGC	.	.	.	none		0.428	CSNK2A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077466.1	NM_001895	
MAGEB4	4115	hgsc.bcm.edu	37	X	30261219	30261219	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chrX:30261219G>T	ENST00000378982.2	+	1	1163	c.967G>T	c.(967-969)Gcc>Tcc	p.A323S	MAGEB1_ENST00000397550.1_5'Flank|MAGEB1_ENST00000378981.3_5'Flank	NM_002367.3	NP_002358.1	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	323										breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27						CAGAGTTGCAGCCAGGCGTGG	0.522																																					p.A323S		Atlas-SNP	.											.	MAGEB4	75	.	0			c.G967T						PASS	.						48.0	44.0	45.0					X																	30261219		2202	4300	6502	SO:0001583	missense	4115	exon1			GTTGCAGCCAGGC		CCDS14221.1	Xp21.3	2009-03-17			ENSG00000120289	ENSG00000120289			6811	protein-coding gene	gene with protein product	"""melanoma-associated antigen B4"", ""cancer/testis antigen family 3, member 6"""	300153				9441743	Standard	NM_002367		Approved	MGC33144, CT3.6	uc004dcb.3	O15481	OTTHUMG00000021321	ENST00000378982.2:c.967G>T	chrX.hg19:g.30261219G>T	ENSP00000368266:p.Ala323Ser	57.0	0.0	.		26.0	23.0	.	NM_002367	B2R9G0|Q6FHH4|Q8IZ00	Missense_Mutation	SNP	ENST00000378982.2	hg19	CCDS14221.1	.	.	.	.	.	.	.	.	.	.	G	11.79	1.743265	0.30865	.	.	ENSG00000120289	ENST00000378982	T	0.01821	4.62	2.95	1.12	0.20585	.	1.311600	0.06398	U	0.718346	T	0.02888	0.0086	M	0.61703	1.905	0.09310	N	1	P	0.48834	0.916	B	0.42522	0.39	T	0.43032	-0.9416	10	0.51188	T	0.08	.	3.6067	0.08045	0.1562:0.2589:0.5849:0.0	.	323	O15481	MAGB4_HUMAN	S	323	ENSP00000368266:A323S	ENSP00000368266:A323S	A	+	1	0	MAGEB4	30171140	0.000000	0.05858	0.001000	0.08648	0.373000	0.29922	-0.156000	0.10100	0.167000	0.19631	0.600000	0.82982	GCC	.	.	.	none		0.522	MAGEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056159.1	NM_002367	
DMD	1756	hgsc.bcm.edu	37	X	32867885	32867885	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chrX:32867885C>T	ENST00000357033.4	-	3	352	c.146G>A	c.(145-147)cGc>cAc	p.R49H	DMD_ENST00000288447.4_Missense_Mutation_p.R41H|snoU13_ENST00000459244.1_RNA|DMD_ENST00000378677.2_Missense_Mutation_p.R45H	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	49	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.		Missing (in BMD).		cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GTCTAGGAGGCGCCTCCCATC	0.393																																					p.R49H		Atlas-SNP	.											.	DMD	2127	.	0			c.G146A						PASS	.						89.0	85.0	86.0					X																	32867885		2202	4300	6502	SO:0001583	missense	1756	exon3			AGGAGGCGCCTCC	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.146G>A	chrX.hg19:g.32867885C>T	ENSP00000354923:p.Arg49His	118.0	0.0	.		98.0	8.0	.	NM_004006	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	hg19	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.580687	0.86748	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000288447;ENST00000447523	D;D;D;D	0.94931	-3.56;-3.56;-3.56;-3.56	5.63	4.76	0.60689	Calponin homology domain (5);	0.490245	0.13997	U	0.348381	D	0.95856	0.8651	M	0.62266	1.93	0.80722	D	1	D;D;P;D	0.71674	0.998;0.994;0.884;0.995	P;P;B;P	0.61874	0.895;0.78;0.439;0.86	D	0.94777	0.7950	10	0.54805	T	0.06	.	11.8557	0.52435	0.0:0.9123:0.0:0.0877	.	41;41;49;45	Q4G0X0;P11532-4;P11532;E9PDN5	.;.;DMD_HUMAN;.	H	41;45;49;49;41;12	ENSP00000367948:R45H;ENSP00000354923:R49H;ENSP00000288447:R41H;ENSP00000395904:R12H	ENSP00000288447:R41H	R	-	2	0	DMD	32777806	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.592000	0.46171	2.346000	0.79739	0.600000	0.82982	CGC	.	.	.	none		0.393	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
WDFY3	23001	hgsc.bcm.edu	37	4	85630153	85630153	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr4:85630153delA	ENST00000295888.4	-	53	8533	c.8126delT	c.(8125-8127)ttgfs	p.L2709fs	WDFY3_ENST00000322366.6_Frame_Shift_Del_p.L2692fs	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	2709	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.|Interaction with SQSTM1.|Sufficient for translocalization to p62 bodies/ALIS.				aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CAAATGCATCAAATATTGGAA	0.343																																					p.L2709fs		Atlas-INDEL	.											.	WDFY3	314	.	0			c.8127delG						PASS	.						111.0	114.0	113.0					4																	85630153		2203	4300	6503	SO:0001589	frameshift_variant	23001	exon53			.	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.8126delT	chr4.hg19:g.85630153delA	ENSP00000295888:p.Leu2709fs	233.0	0.0	0		210.0	92.0	0.438095	NM_014991	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Frame_Shift_Del	DEL	ENST00000295888.4	hg19	CCDS3609.1																																																																																			.	.	.	none		0.343	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991	
XPNPEP2	7512	hgsc.bcm.edu	37	X	128885748	128885749	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	TC	TC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chrX:128885748_128885749delTC	ENST00000371106.3	+	9	959_960	c.767_768delTC	c.(766-768)atcfs	p.I256fs		NM_003399.5	NP_003390.4	O43895	XPP2_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound	256						anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(3)|kidney(3)|large_intestine(5)|liver(1)|lung(20)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	37						GCCAGTGACATCCCCTATAACC	0.441																																					p.256_256del		Atlas-INDEL	.											.	XPNPEP2	84	.	0			c.766_767del						PASS	.																																			SO:0001589	frameshift_variant	7512	exon9			.	U90724	CCDS14613.1	Xq25	2008-02-05			ENSG00000122121	ENSG00000122121	3.4.11.9		12823	protein-coding gene	gene with protein product		300145				9375790, 9628831	Standard	NM_003399		Approved		uc004eut.1	O43895	OTTHUMG00000022373	ENST00000371106.3:c.767_768delTC	chrX.hg19:g.128885748_128885749delTC	ENSP00000360147:p.Ile256fs	377.0	0.0	0		282.0	234.0	0.829787	NM_003399	A0AV16|O75994	Frame_Shift_Del	DEL	ENST00000371106.3	hg19	CCDS14613.1																																																																																			.	.	.	none		0.441	XPNPEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058210.1	NM_003399	
ALDOB	229	hgsc.bcm.edu	37	9	104190767	104190770	+	Frame_Shift_Del	DEL	TTTG	TTTG	-	rs387906225		TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	TTTG	TTTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr9:104190767_104190770delTTTG	ENST00000374855.4	-	4	484_487	c.360_363delCAAA	c.(358-363)aacaaafs	p.NK120fs	ALDOB_ENST00000468981.3_Intron	NM_000035.3	NP_000026.2	P05062	ALDOB_HUMAN	aldolase B, fructose-bisphosphate	120			Missing (in HFI). {ECO:0000269|PubMed:15532022}.		carbohydrate metabolic process (GO:0005975)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose catabolic process (GO:0006001)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|NADH oxidation (GO:0006116)|positive regulation of ATPase activity (GO:0032781)|small molecule metabolic process (GO:0044281)|vacuolar proton-transporting V-type ATPase complex assembly (GO:0070072)	centriolar satellite (GO:0034451)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)	ATPase binding (GO:0051117)|cytoskeletal protein binding (GO:0008092)|fructose binding (GO:0070061)|fructose-1-phosphate aldolase activity (GO:0061609)|fructose-bisphosphate aldolase activity (GO:0004332)|identical protein binding (GO:0042802)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(5)|prostate(2)|skin(4)|urinary_tract(1)	24		Acute lymphoblastic leukemia(62;0.0559)				TGGTGGTTTCTTTGTTTGTTCCTG	0.402																																					p.121_122del		Atlas-INDEL	.											.	ALDOB	69	.	0			c.361_364del	GRCh37	CD900270	ALDOB	D		PASS	.			0,4264		0,0,2132						5.9	1.0			251	1,8253		0,1,4126	no	frameshift	ALDOB	NM_000035.3		0,1,6258	A1A1,A1R,RR		0.0121,0.0,0.0080				1,12517				SO:0001589	frameshift_variant	229	exon4			.	X01098	CCDS6756.1	9q21.3-q22.2	2008-02-05			ENSG00000136872	ENSG00000136872	4.1.2.13		417	protein-coding gene	gene with protein product		612724					Standard	NM_000035		Approved		uc004bbk.2	P05062	OTTHUMG00000020378	ENST00000374855.4:c.360_363delCAAA	chr9.hg19:g.104190771_104190774delTTTG	ENSP00000363988:p.Asn120fs	335.0	0.0	0		283.0	104.0	0.367491	NM_000035	Q13741|Q13742|Q5T7D6	Frame_Shift_Del	DEL	ENST00000374855.4	hg19	CCDS6756.1																																																																																			.	.	.	none		0.402	ALDOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053434.2		
MCCC2	64087	hgsc.bcm.edu	37	5	70931074	70931075	+	Splice_Site	INS	-	-	TA			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr5:70931074_70931075insTA	ENST00000340941.6	+	10	1128		c.e10+1		MCCC2_ENST00000510895.2_3'UTR|MCCC2_ENST00000323375.8_Splice_Site|MCCC2_ENST00000509358.2_Splice_Site	NM_022132.4	NP_071415.1	Q9HCC0	MCCB_HUMAN	methylcrotonoyl-CoA carboxylase 2 (beta)						biotin metabolic process (GO:0006768)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|coenzyme A metabolic process (GO:0015936)|leucine catabolic process (GO:0006552)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methylcrotonoyl-CoA carboxylase activity (GO:0004485)			endometrium(2)|kidney(15)|large_intestine(2)|lung(9)|ovary(1)|urinary_tract(1)	30		Lung NSC(167;0.000697)|Prostate(74;0.0107)|Ovarian(174;0.0175)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.04e-54)	Biotin(DB00121)	TGTCCGAGAGGTATGTGAAAGT	0.406																																					.		Atlas-INDEL	.											.	MCCC2	47	.	0			c.999+1->TA						PASS	.																																			SO:0001630	splice_region_variant	64087	exon10			.	AF310971	CCDS34184.1	5q12-q13	2010-04-30	2010-04-30		ENSG00000131844	ENSG00000131844	6.4.1.4		6937	protein-coding gene	gene with protein product		609014	"""methylcrotonoyl-Coenzyme A carboxylase 2 (beta)"""				Standard	NM_022132		Approved	MCCB	uc003kbs.4	Q9HCC0	OTTHUMG00000162505	ENST00000340941.6:c.999+1->TA	chr5.hg19:g.70931075_70931076dupTA		175.0	0.0	0		115.0	48.0	0.417391	NM_022132	A6NIY9|Q96C27|Q9Y4L7	Splice_Site	INS	ENST00000340941.6	hg19	CCDS34184.1																																																																																			.	.	.	none		0.406	MCCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369243.4		Intron
SLIT3	6586	hgsc.bcm.edu	37	5	168135045	168135045	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B9-4617-01A-01D-1252-08	TCGA-B9-4617-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aed3977e-c899-4a95-b26a-957bdbd865a6	513c77a4-6151-4d55-9b91-4b9923b7d895	g.chr5:168135045delT	ENST00000519560.1	-	26	3199	c.2780delA	c.(2779-2781)aatfs	p.N928fs	SLIT3_ENST00000404867.3_Frame_Shift_Del_p.N928fs|CTC-558O2.1_ENST00000522615.1_RNA|CTC-558O2.1_ENST00000521870.1_RNA|SLIT3_ENST00000332966.8_Frame_Shift_Del_p.N935fs	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	928	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGTCCCGTTATTCTTGCACGG	0.592																																					p.N934fs	Ovarian(29;311 847 10864 17279 24903)	Atlas-INDEL	.											.	SLIT3	224	.	0			c.2802delT						PASS	.						157.0	113.0	128.0					5																	168135045		2203	4300	6503	SO:0001589	frameshift_variant	6586	exon26			.	AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.2780delA	chr5.hg19:g.168135045delT	ENSP00000430333:p.Asn928fs	117.0	0.0	0		100.0	48.0	0.48	NM_001271946	A6H8U9|J3KNP3|O95804|Q9UFH5	Frame_Shift_Del	DEL	ENST00000519560.1	hg19	CCDS4369.1																																																																																			.	.	.	none		0.592	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252792.4	NM_003062	
