#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ARHGEF10L	55160	hgsc.bcm.edu	37	1	18023596	18023596	+	Silent	SNP	G	G	A			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr1:18023596G>A	ENST00000361221.3	+	29	3720	c.3561G>A	c.(3559-3561)ctG>ctA	p.L1187L	ARHGEF10L_ENST00000452522.1_Silent_p.L1148L|ARHGEF10L_ENST00000469726.1_3'UTR|ARHGEF10L_ENST00000375408.3_Silent_p.L960L|ARHGEF10L_ENST00000167825.4_Silent_p.L890L|ARHGEF10L_ENST00000375415.1_Silent_p.L1148L	NM_018125.3	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10-like	1187						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	43		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)		CGGGCCCGCTGCTCTCCATGC	0.677																																					p.L1187L		Atlas-SNP	.											.	ARHGEF10L	219	.	0			c.G3561A						PASS	.						13.0	14.0	14.0					1																	18023596		2189	4283	6472	SO:0001819	synonymous_variant	55160	exon29			CCCGCTGCTCTCC	AB046846	CCDS182.1, CCDS30617.1	1p36.13	2011-11-16			ENSG00000074964	ENSG00000074964		"""Rho guanine nucleotide exchange factors"""	25540	protein-coding gene	gene with protein product	"""GrinchGEF"""	612494				10997877, 16112081	Standard	XM_005245923		Approved	FLJ10521, KIAA1626	uc001ban.3	Q9HCE6	OTTHUMG00000002514	ENST00000361221.3:c.3561G>A	chr1.hg19:g.18023596G>A		25.0	0.0	.		25.0	12.0	.	NM_018125	B7ZKS1|Q17RW1|Q3YFJ4|Q5VXI5|Q5VXI6|Q66K51|Q6P0L7|Q8NAV5|Q9NVT3	Silent	SNP	ENST00000361221.3	hg19	CCDS182.1																																																																																			.	.	.	none		0.677	ARHGEF10L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000007147.1	NM_018125	
TMCO4	255104	hgsc.bcm.edu	37	1	20063898	20063898	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr1:20063898A>G	ENST00000294543.6	-	13	1472	c.1231T>C	c.(1231-1233)Tac>Cac	p.Y411H	TMCO4_ENST00000489814.1_5'UTR|TMCO4_ENST00000375122.2_Missense_Mutation_p.Y371H|TMCO4_ENST00000375127.1_Missense_Mutation_p.Y411H	NM_181719.4	NP_859070.3	Q5TGY1	TMCO4_HUMAN	transmembrane and coiled-coil domains 4	411						integral component of membrane (GO:0016021)				biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|lung(11)|skin(1)|upper_aerodigestive_tract(1)	19		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00519)|Breast(348;0.00526)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00708)|COAD - Colon adenocarcinoma(152;2.28e-05)|BRCA - Breast invasive adenocarcinoma(304;5.8e-05)|Kidney(64;0.000367)|GBM - Glioblastoma multiforme(114;0.000377)|KIRC - Kidney renal clear cell carcinoma(64;0.00459)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0862)|Lung(427;0.223)		AGACAGAAGTAGATGACTCTG	0.512																																					p.Y411H		Atlas-SNP	.											.	TMCO4	46	.	0			c.T1231C						PASS	.						122.0	116.0	118.0					1																	20063898		2203	4300	6503	SO:0001583	missense	255104	exon13			AGAAGTAGATGAC		CCDS198.1	1p36.13	2008-02-05			ENSG00000162542	ENSG00000162542			27393	protein-coding gene	gene with protein product							Standard	NM_181719		Approved	DKFZp686C23231	uc001bcn.3	Q5TGY1	OTTHUMG00000002697	ENST00000294543.6:c.1231T>C	chr1.hg19:g.20063898A>G	ENSP00000294543:p.Tyr411His	113.0	0.0	.		160.0	91.0	.	NM_181719	Q5TGY2|Q6MZN5|Q7Z6K6|Q9UQP4|Q9Y3K1	Missense_Mutation	SNP	ENST00000294543.6	hg19	CCDS198.1	.	.	.	.	.	.	.	.	.	.	A	25.8	4.679476	0.88542	.	.	ENSG00000162542	ENST00000294543;ENST00000375127;ENST00000375122	T;T;T	0.55588	0.51;0.51;0.51	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.70422	0.3222	M	0.70903	2.155	0.52501	D	0.999959	D	0.65815	0.995	D	0.73708	0.981	T	0.74124	-0.3766	10	0.87932	D	0	-10.3943	13.6373	0.62229	1.0:0.0:0.0:0.0	.	411	Q5TGY1	TMCO4_HUMAN	H	411;411;371	ENSP00000294543:Y411H;ENSP00000364269:Y411H;ENSP00000364264:Y371H	ENSP00000294543:Y411H	Y	-	1	0	TMCO4	19936485	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.389000	0.90172	2.172000	0.68678	0.533000	0.62120	TAC	.	.	.	none		0.512	TMCO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007658.1	NM_181719	
TAL1	6886	hgsc.bcm.edu	37	1	47685450	47685450	+	Missense_Mutation	SNP	G	G	T	rs536520955	byFrequency	TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr1:47685450G>T	ENST00000294339.3	-	4	1514	c.938C>A	c.(937-939)aCg>aAg	p.T313K	TAL1_ENST00000371884.2_Missense_Mutation_p.T313K|TAL1_ENST00000459729.1_5'UTR|TAL1_ENST00000371883.3_Missense_Mutation_p.T315K	NM_003189.2	NP_003180.1	P17542	TAL1_HUMAN	T-cell acute lymphocytic leukemia 1	313					angiogenesis (GO:0001525)|astrocyte fate commitment (GO:0060018)|basophil differentiation (GO:0030221)|cell fate commitment (GO:0045165)|definitive hemopoiesis (GO:0060216)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|erythrocyte maturation (GO:0043249)|hemangioblast cell differentiation (GO:0060217)|hematopoietic stem cell differentiation (GO:0060218)|hemopoiesis (GO:0030097)|locomotory behavior (GO:0007626)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|platelet formation (GO:0030220)|positive regulation of cell division (GO:0051781)|positive regulation of chromatin assembly or disassembly (GO:0045799)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell proliferation (GO:0042127)|regulation of mast cell differentiation (GO:0060375)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spinal cord association neuron differentiation (GO:0021527)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|E-box binding (GO:0070888)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			haematopoietic_and_lymphoid_tissue(1)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	15						GCTGCGGGCCGTGTGTTTGGG	0.687			T	"""TRD@, SIL"""	lymphoblastic leukemia/biphasic																																p.T313K		Atlas-SNP	.		Dom	yes		1	1p32	6886	T-cell acute lymphocytic leukemia 1 (SCL)		L	.	TAL1	31	.	0			c.C938A						PASS	.						24.0	29.0	27.0					1																	47685450		2193	4294	6487	SO:0001583	missense	6886	exon4			CGGGCCGTGTGTT	M29038	CCDS547.1	1p32	2013-05-21	2001-12-04		ENSG00000162367	ENSG00000162367		"""Basic helix-loop-helix proteins"""	11556	protein-coding gene	gene with protein product		187040		TCL5		2740341	Standard	NM_001287347		Approved	SCL, bHLHa17	uc009vyq.2	P17542	OTTHUMG00000007847	ENST00000294339.3:c.938C>A	chr1.hg19:g.47685450G>T	ENSP00000294339:p.Thr313Lys	53.0	0.0	.		74.0	38.0	.	NM_003189	D3DQ24	Missense_Mutation	SNP	ENST00000294339.3	hg19	CCDS547.1	.	.	.	.	.	.	.	.	.	.	G	16.31	3.086069	0.55861	.	.	ENSG00000162367	ENST00000371884;ENST00000371883;ENST00000294339	D;D;D	0.97404	-4.37;-4.37;-4.37	5.05	5.05	0.67936	.	0.348037	0.26518	N	0.023921	D	0.91583	0.7341	N	0.14661	0.345	0.30052	N	0.811637	P	0.38827	0.649	B	0.32090	0.14	D	0.89725	0.3922	10	0.39692	T	0.17	.	14.0701	0.64854	0.0:0.1508:0.8492:0.0	.	313	P17542	TAL1_HUMAN	K	313;315;313	ENSP00000360951:T313K;ENSP00000360950:T315K;ENSP00000294339:T313K	ENSP00000294339:T313K	T	-	2	0	TAL1	47458037	0.955000	0.32602	0.909000	0.35828	0.555000	0.35460	4.030000	0.57260	2.363000	0.80096	0.478000	0.44815	ACG	.	.	.	none		0.687	TAL1-002	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021640.1	NM_003189	
SYDE2	84144	hgsc.bcm.edu	37	1	85656155	85656155	+	Silent	SNP	T	T	C			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr1:85656155T>C	ENST00000341460.5	-	2	1075	c.1026A>G	c.(1024-1026)gtA>gtG	p.V342V		NM_032184.1	NP_115560.1	Q5VT97	SYDE2_HUMAN	synapse defective 1, Rho GTPase, homolog 2 (C. elegans)	342					activation of Rho GTPase activity (GO:0032862)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)	20				all cancers(265;0.0126)|Epithelial(280;0.0336)		TAGCGTTACATACCACATATG	0.353																																					p.V342V		Atlas-SNP	.											.	SYDE2	135	.	0			c.A1026G						PASS	.						153.0	141.0	145.0					1																	85656155		1928	4133	6061	SO:0001819	synonymous_variant	84144	exon2			GTTACATACCACA	AL834286	CCDS44169.1	1p22.3	2008-02-05		2005-08-09	ENSG00000097096	ENSG00000097096			25841	protein-coding gene	gene with protein product							Standard	NM_032184		Approved	FLJ13815	uc009wcm.3	Q5VT97	OTTHUMG00000009956	ENST00000341460.5:c.1026A>G	chr1.hg19:g.85656155T>C		63.0	0.0	.		74.0	35.0	.	NM_032184	Q5VT96|Q8NDB8|Q9H8A6	Silent	SNP	ENST00000341460.5	hg19	CCDS44169.1																																																																																			.	.	.	none		0.353	SYDE2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127989.2		
HS2ST1	9653	hgsc.bcm.edu	37	1	87569257	87569257	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr1:87569257G>A	ENST00000370550.5	+	6	1192	c.829G>A	c.(829-831)Gaa>Aaa	p.E277K	RP5-1052I5.2_ENST00000370548.2_Missense_Mutation_p.E251K|HS2ST1_ENST00000356813.4_Missense_Mutation_p.E251K	NM_012262.3	NP_036394.1	Q7LGA3	HS2ST_HUMAN	heparan sulfate 2-O-sulfotransferase 1	277					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	sulfotransferase activity (GO:0008146)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)	9		Lung NSC(277;0.153)		all cancers(265;0.00699)|Epithelial(280;0.0261)		GGGTGCTACTGAACTCTATCG	0.363																																					p.E277K		Atlas-SNP	.											.	HS2ST1	43	.	0			c.G829A						PASS	.						102.0	102.0	102.0					1																	87569257		2203	4300	6503	SO:0001583	missense	9653	exon6			GCTACTGAACTCT	AB007917	CCDS711.1, CCDS44171.1	1p22.3	2008-02-05			ENSG00000153936	ENSG00000153936		"""Sulfotransferases, membrane-bound"""	5193	protein-coding gene	gene with protein product		604844				9455484	Standard	NM_012262		Approved	KIAA0448	uc010osk.2	Q7LGA3	OTTHUMG00000010255	ENST00000370550.5:c.829G>A	chr1.hg19:g.87569257G>A	ENSP00000359581:p.Glu277Lys	239.0	1.0	.		239.0	106.0	.	NM_012262	D3DT22|O75036|Q32NB5|Q8TAC5|Q9H441|Q9NUJ9	Missense_Mutation	SNP	ENST00000370550.5	hg19	CCDS711.1	.	.	.	.	.	.	.	.	.	.	G	18.73	3.686327	0.68157	.	.	ENSG00000153936	ENST00000370550;ENST00000370548;ENST00000356813	T;T;T	0.73789	-0.78;-0.78;-0.78	5.55	5.55	0.83447	.	0.045925	0.85682	D	0.000000	T	0.44932	0.1317	N	0.13272	0.32	0.80722	D	1	B;B	0.20887	0.007;0.049	B;B	0.15484	0.013;0.011	T	0.47222	-0.9134	10	0.14252	T	0.57	-17.3525	19.5161	0.95165	0.0:0.0:1.0:0.0	.	277;251	Q7LGA3;Q7LGA3-2	HS2ST_HUMAN;.	K	277;251;251	ENSP00000359581:E277K;ENSP00000359579:E251K;ENSP00000349268:E251K	ENSP00000349268:E251K	E	+	1	0	HS2ST1	87341845	1.000000	0.71417	0.863000	0.33907	0.974000	0.67602	9.869000	0.99810	2.605000	0.88082	0.467000	0.42956	GAA	.	.	.	none		0.363	HS2ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028279.2	NM_012262	
LRRC8C	84230	hgsc.bcm.edu	37	1	90179254	90179254	+	Silent	SNP	T	T	C			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr1:90179254T>C	ENST00000370454.4	+	3	1380	c.1125T>C	c.(1123-1125)caT>caC	p.H375H	RP11-302M6.4_ENST00000370453.5_Intron|LRRC8C_ENST00000479252.1_Intron	NM_032270.4	NP_115646	Q8TDW0	LRC8C_HUMAN	leucine rich repeat containing 8 family, member C	375					fat cell differentiation (GO:0045444)|ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	28		all_lung(203;0.126)		all cancers(265;0.00756)|Epithelial(280;0.0313)		TTATGCTTCATATGATAGATC	0.373																																					p.H375H		Atlas-SNP	.											.	LRRC8C	73	.	0			c.T1125C						PASS	.						52.0	53.0	52.0					1																	90179254		2203	4300	6503	SO:0001819	synonymous_variant	84230	exon3			GCTTCATATGATA		CCDS725.1	1p22.2	2011-02-10			ENSG00000171488	ENSG00000171488			25075	protein-coding gene	gene with protein product	"""hypothetical protein AD158"""	612889				11230166	Standard	NM_032270		Approved	AD158	uc001dnl.4	Q8TDW0	OTTHUMG00000010305	ENST00000370454.4:c.1125T>C	chr1.hg19:g.90179254T>C		93.0	0.0	.		102.0	36.0	.	NM_032270	B3KXS9|Q29RV6|Q9H075	Silent	SNP	ENST00000370454.4	hg19	CCDS725.1																																																																																			.	.	.	none		0.373	LRRC8C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028435.2	NM_032270	
BTBD8	284697	hgsc.bcm.edu	37	1	92612759	92612759	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr1:92612759C>G	ENST00000342818.3	+	8	1189	c.953C>G	c.(952-954)tCt>tGt	p.S318C	BTBD8_ENST00000540648.1_3'UTR	NM_183242.3	NP_899065.2	Q5XKL5	BTBD8_HUMAN	BTB (POZ) domain containing 8	318						nucleus (GO:0005634)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)	16		all_lung(203;0.0484)|Lung NSC(277;0.126)|Glioma(108;0.222)		all cancers(265;0.0153)|Epithelial(280;0.0982)		ACATTGACGTCTATACTAGAA	0.323																																					p.S318C		Atlas-SNP	.											.	BTBD8	32	.	0			c.C953G						PASS	.						172.0	167.0	168.0					1																	92612759		2203	4300	6503	SO:0001583	missense	284697	exon8			TGACGTCTATACT	AY346333	CCDS737.1	1p22.1	2013-01-08			ENSG00000189195	ENSG00000189195		"""BTB/POZ domain containing"""	21019	protein-coding gene	gene with protein product						14654994	Standard	NM_183242		Approved		uc001doo.3	Q5XKL5	OTTHUMG00000010289	ENST00000342818.3:c.953C>G	chr1.hg19:g.92612759C>G	ENSP00000343686:p.Ser318Cys	146.0	0.0	.		163.0	70.0	.	NM_183242	Q6V9S5	Missense_Mutation	SNP	ENST00000342818.3	hg19	CCDS737.1	.	.	.	.	.	.	.	.	.	.	C	14.43	2.533918	0.45073	.	.	ENSG00000189195	ENST00000342818	T	0.66099	-0.19	5.49	5.49	0.81192	.	0.352773	0.24511	N	0.037898	T	0.58104	0.2099	L	0.43152	1.355	0.80722	D	1	D	0.57257	0.979	P	0.50231	0.635	T	0.61387	-0.7073	10	0.59425	D	0.04	-6.2864	18.5235	0.90962	0.0:1.0:0.0:0.0	.	318	Q5XKL5	BTBD8_HUMAN	C	318	ENSP00000343686:S318C	ENSP00000343686:S318C	S	+	2	0	BTBD8	92385347	0.230000	0.23740	0.025000	0.17156	0.257000	0.26127	2.777000	0.47717	2.753000	0.94483	0.557000	0.71058	TCT	.	.	.	none		0.323	BTBD8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028372.1	NM_183242	
CFAP45	25790	hgsc.bcm.edu	37	1	159846354	159846354	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr1:159846354C>A	ENST00000368099.4	-	10	1408	c.1344G>T	c.(1342-1344)agG>agT	p.R448S	CCDC19_ENST00000426543.2_Missense_Mutation_p.R363S|CCDC19_ENST00000476696.1_5'UTR	NM_012337.2	NP_036469.2														endometrium(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	26	all_hematologic(112;0.0597)		BRCA - Breast invasive adenocarcinoma(70;0.151)			ACCGAAGAATCCTCTCGAACT	0.527																																					p.R448S		Atlas-SNP	.											.	CCDC19	79	.	0			c.G1344T						PASS	.						81.0	77.0	79.0					1																	159846354		2203	4300	6503	SO:0001583	missense	25790	exon10			AAGAATCCTCTCG																												ENST00000368099.4:c.1344G>T	chr1.hg19:g.159846354C>A	ENSP00000357079:p.Arg448Ser	36.0	0.0	.		36.0	19.0	.	NM_012337		Missense_Mutation	SNP	ENST00000368099.4	hg19	CCDS30914.1	.	.	.	.	.	.	.	.	.	.	c	19.82	3.899092	0.72754	.	.	ENSG00000213085	ENST00000368099;ENST00000426543	T;T	0.11385	2.78;2.78	5.16	5.16	0.70880	.	0.148017	0.64402	D	0.000016	T	0.11239	0.0274	M	0.82823	2.61	0.47905	D	0.999549	B	0.31752	0.338	B	0.39617	0.305	T	0.01583	-1.1319	9	.	.	.	-16.358	10.0537	0.42233	0.0:0.9081:0.0:0.0919	.	448	Q9UL16	CCD19_HUMAN	S	448;363	ENSP00000357079:R448S;ENSP00000403044:R363S	.	R	-	3	2	CCDC19	158112978	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.145000	0.31577	2.571000	0.86741	0.486000	0.48141	AGG	.	.	.	none		0.527	CCDC19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085979.1		
USF1	7391	hgsc.bcm.edu	37	1	161011449	161011449	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr1:161011449G>A	ENST00000368021.3	-	6	668	c.464C>T	c.(463-465)cCt>cTt	p.P155L	USF1_ENST00000435396.1_Missense_Mutation_p.P96L|F11R_ENST00000289779.3_5'Flank|TSTD1_ENST00000318289.10_5'Flank|TSTD1_ENST00000368024.1_5'Flank|USF1_ENST00000368019.1_Intron|USF1_ENST00000368020.1_Missense_Mutation_p.P155L|TSTD1_ENST00000466967.1_5'Flank|TSTD1_ENST00000368023.3_5'Flank|TSTD1_ENST00000423014.2_5'Flank	NM_007122.3	NP_009053.1	P22415	USF1_HUMAN	upstream transcription factor 1	155					carbon catabolite regulation of transcription (GO:0045990)|cellular response to insulin stimulus (GO:0032869)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|late viral transcription (GO:0019086)|lipid homeostasis (GO:0055088)|negative regulation of fibrinolysis (GO:0051918)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by glucose (GO:0000432)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter by glucose (GO:0000430)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|large_intestine(3)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9	all_cancers(52;6.73e-18)|Breast(13;0.012)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			ACCAGTGCCAGGAGGGGTCGC	0.582											OREG0013936	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P155L		Atlas-SNP	.											.	USF1	29	.	0			c.C464T						PASS	.						52.0	51.0	52.0					1																	161011449		2203	4300	6503	SO:0001583	missense	7391	exon6			GTGCCAGGAGGGG	BC035505	CCDS1214.1	1q22-q23	2013-05-21			ENSG00000158773	ENSG00000158773		"""Basic helix-loop-helix proteins"""	12593	protein-coding gene	gene with protein product		191523				8486371	Standard	NM_007122		Approved	UEF, MLTFI, bHLHb11	uc031pqv.1	P22415	OTTHUMG00000031472	ENST00000368021.3:c.464C>T	chr1.hg19:g.161011449G>A	ENSP00000357000:p.Pro155Leu	67.0	0.0	.	1813	77.0	25.0	.	NM_001276373	B2RBZ4|Q5SY46|Q7Z5Y1	Missense_Mutation	SNP	ENST00000368021.3	hg19	CCDS1214.1	.	.	.	.	.	.	.	.	.	.	G	15.30	2.792171	0.50102	.	.	ENSG00000158773	ENST00000368020;ENST00000368021;ENST00000435396;ENST00000534633	D;D;D	0.92911	-3.11;-3.11;-3.13	5.02	4.11	0.48088	.	0.265359	0.39020	N	0.001485	T	0.73289	0.3568	N	0.08118	0	0.48135	D	0.99959	B	0.02656	0.0	B	0.01281	0.0	T	0.71133	-0.4681	10	0.44086	T	0.13	-11.2539	11.3156	0.49390	0.088:0.0:0.912:0.0	.	155	P22415	USF1_HUMAN	L	155;155;96;96	ENSP00000356999:P155L;ENSP00000357000:P155L;ENSP00000390109:P96L	ENSP00000356999:P155L	P	-	2	0	USF1	159278073	1.000000	0.71417	0.978000	0.43139	0.995000	0.86356	6.370000	0.73114	1.345000	0.45676	0.655000	0.94253	CCT	.	.	.	none		0.582	USF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077050.1	NM_007122	
NIT1	4817	hgsc.bcm.edu	37	1	161090529	161090529	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr1:161090529G>C	ENST00000368009.2	+	7	1034	c.958G>C	c.(958-960)Ggc>Cgc	p.G320R	DEDD_ENST00000489249.1_5'Flank|NIT1_ENST00000368008.1_Intron|PFDN2_ENST00000468311.1_5'Flank|NIT1_ENST00000392190.5_Missense_Mutation_p.G284R|NIT1_ENST00000368007.4_Missense_Mutation_p.G305R|PFDN2_ENST00000368010.3_5'Flank	NM_005600.2	NP_005591.1	Q86X76	NIT1_HUMAN	nitrilase 1	320	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				nitrogen compound metabolic process (GO:0006807)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	nitrilase activity (GO:0000257)			NS(1)|breast(2)|endometrium(2)|large_intestine(3)|lung(3)|prostate(1)	12	all_cancers(52;3.39e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			TGACCTCTATGGCAATCTGGG	0.577																																					p.G320R		Atlas-SNP	.											.	NIT1	41	.	0			c.G958C						PASS	.						53.0	47.0	49.0					1																	161090529		2203	4300	6503	SO:0001583	missense	4817	exon7			CTCTATGGCAATC	AF069984	CCDS1218.1, CCDS53401.1, CCDS53402.1, CCDS53403.1	1q21-q22	2008-05-14			ENSG00000158793	ENSG00000158793			7828	protein-coding gene	gene with protein product		604618				9671749	Standard	NM_005600		Approved		uc001fxv.2	Q86X76	OTTHUMG00000031473	ENST00000368009.2:c.958G>C	chr1.hg19:g.161090529G>C	ENSP00000356988:p.Gly320Arg	75.0	0.0	.		81.0	30.0	.	NM_005600	B1AQP3|D3DVF4|O76091	Missense_Mutation	SNP	ENST00000368009.2	hg19	CCDS1218.1	.	.	.	.	.	.	.	.	.	.	G	14.99	2.700065	0.48307	.	.	ENSG00000158793	ENST00000368009;ENST00000368007;ENST00000392190	D;D;D	0.85629	-2.01;-2.01;-2.01	4.9	4.9	0.64082	Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (2);	0.180864	0.48767	D	0.000178	D	0.85383	0.5684	L	0.37697	1.125	0.35101	D	0.765216	D;D	0.67145	0.995;0.996	D;D	0.67900	0.954;0.926	D	0.86846	0.2020	10	0.54805	T	0.06	-6.5407	15.6362	0.76953	0.0:0.0:1.0:0.0	.	305;320	Q86X76-4;Q86X76	.;NIT1_HUMAN	R	320;305;284	ENSP00000356988:G320R;ENSP00000356986:G305R;ENSP00000376028:G284R	ENSP00000356986:G305R	G	+	1	0	NIT1	159357153	0.997000	0.39634	0.996000	0.52242	0.646000	0.38490	2.400000	0.44504	2.551000	0.86045	0.563000	0.77884	GGC	.	.	.	none		0.577	NIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077060.1		
PRRC2C	23215	hgsc.bcm.edu	37	1	171553267	171553267	+	Nonsense_Mutation	SNP	C	C	T			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr1:171553267C>T	ENST00000338920.4	+	29	7813	c.7576C>T	c.(7576-7578)Caa>Taa	p.Q2526*	PRRC2C_ENST00000426496.2_Nonsense_Mutation_p.Q2461*|PRRC2C_ENST00000367742.3_Nonsense_Mutation_p.Q2528*|PRRC2C_ENST00000392078.3_Nonsense_Mutation_p.Q2528*	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	2526	Gln-rich.				hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										GTATGAACATCAACTGGGGCA	0.478																																					p.Q2526X		Atlas-SNP	.											.	.	.	.	0			c.C7576T						PASS	.						199.0	195.0	197.0					1																	171553267		2203	4300	6503	SO:0001587	stop_gained	23215	exon29			GAACATCAACTGG	AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.7576C>T	chr1.hg19:g.171553267C>T	ENSP00000343629:p.Gln2526*	266.0	0.0	.		339.0	150.0	.	NM_015172	Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Nonsense_Mutation	SNP	ENST00000338920.4	hg19	CCDS1296.2	.	.	.	.	.	.	.	.	.	.	C	50	16.839304	0.99873	.	.	ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080	.	.	.	6.16	6.16	0.99307	.	0.000000	0.43260	D	0.000582	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	.	.	.	X	2528;2480;2461;2528;2526;2283	.	ENSP00000343629:Q2526X	Q	+	1	0	PRRC2C	169819891	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.356000	0.79445	2.937000	0.99478	0.650000	0.86243	CAA	.	.	.	none		0.478	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314826.4	NM_015172	
AXDND1	126859	hgsc.bcm.edu	37	1	179503894	179503894	+	Missense_Mutation	SNP	A	A	T	rs531976426	byFrequency	TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr1:179503894A>T	ENST00000367618.3	+	25	3215	c.2828A>T	c.(2827-2829)gAg>gTg	p.E943V		NM_144696.4	NP_653297.3	Q5T1B0	AXDN1_HUMAN	axonemal dynein light chain domain containing 1	943	Glu-rich.									NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(27)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	59						AGACAGGCAGAGGAGAAGTTT	0.338																																					p.E943V		Atlas-SNP	.											.	AXDND1	142	.	0			c.A2828T						PASS	.						68.0	70.0	69.0					1																	179503894		2203	4300	6503	SO:0001583	missense	126859	exon25			AGGCAGAGGAGAA	BX647935	CCDS30948.1	1q25.2	2011-02-18	2011-02-18	2011-02-18	ENSG00000162779	ENSG00000162779			26564	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 125"""	C1orf125		14702039	Standard	NM_144696		Approved	FLJ32940	uc001gmo.3	Q5T1B0	OTTHUMG00000035266	ENST00000367618.3:c.2828A>T	chr1.hg19:g.179503894A>T	ENSP00000356590:p.Glu943Val	140.0	0.0	.		128.0	52.0	.	NM_144696	Q6AWB2|Q96LJ3|Q96M01	Missense_Mutation	SNP	ENST00000367618.3	hg19	CCDS30948.1	.	.	.	.	.	.	.	.	.	.	A	13.11	2.139365	0.37728	.	.	ENSG00000162779	ENST00000367618;ENST00000360322;ENST00000434088	T;T	0.34275	1.37;1.37	4.89	4.89	0.63831	.	0.000000	0.64402	D	0.000001	T	0.47838	0.1467	L	0.32530	0.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.49532	-0.8930	10	0.87932	D	0	-4.2767	12.2781	0.54749	1.0:0.0:0.0:0.0	.	827;943	E9PCJ4;Q5T1B0	.;AXDN1_HUMAN	V	943;827;803	ENSP00000356590:E943V;ENSP00000391716:E803V	ENSP00000353471:E827V	E	+	2	0	AXDND1	177770517	1.000000	0.71417	1.000000	0.80357	0.510000	0.34073	3.729000	0.54999	2.179000	0.69175	0.482000	0.46254	GAG	.	.	.	none		0.338	AXDND1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085312.1	NM_144696	
CAPN9	10753	hgsc.bcm.edu	37	1	230907780	230907780	+	Silent	SNP	A	A	G			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr1:230907780A>G	ENST00000271971.2	+	7	923	c.810A>G	c.(808-810)agA>agG	p.R270R	CAPN9_ENST00000366666.2_Silent_p.R207R|RP11-99J16__A.2_ENST00000412344.1_RNA|CAPN9_ENST00000354537.1_Silent_p.R270R	NM_006615.2	NP_006606.1	O14815	CAN9_HUMAN	calpain 9	270	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				digestion (GO:0007586)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	25	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)				GAGGCCAGAGAATCGAGCTCA	0.537																																					p.R270R		Atlas-SNP	.											.	CAPN9	116	.	0			c.A810G						PASS	.						88.0	84.0	85.0					1																	230907780		2203	4300	6503	SO:0001819	synonymous_variant	10753	exon7			CCAGAGAATCGAG	AF022799	CCDS1586.1, CCDS31053.1	1q42.11-q42.3	2013-01-10	2004-11-11		ENSG00000135773	ENSG00000135773		"""EF-hand domain containing"""	1486	protein-coding gene	gene with protein product	"""novel calpain large subunit-4"""	606401	"""calpain 9 (nCL-4)"""			9524069, 10835488	Standard	XM_005273010		Approved	nCL-4, GC36	uc001htz.1	O14815	OTTHUMG00000037779	ENST00000271971.2:c.810A>G	chr1.hg19:g.230907780A>G		145.0	0.0	.		133.0	57.0	.	NM_006615	B1APS1|B1AQI0|Q9NS74	Silent	SNP	ENST00000271971.2	hg19	CCDS1586.1																																																																																			.	.	.	none		0.537	CAPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092179.1	NM_006615	
ATAD2B	54454	hgsc.bcm.edu	37	2	24046400	24046400	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr2:24046400G>C	ENST00000238789.5	-	16	2202	c.1859C>G	c.(1858-1860)gCc>gGc	p.A620G	ATAD2B_ENST00000474583.1_5'UTR	NM_001242338.1|NM_017552.2	NP_001229267.1|NP_060022.1	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B	620						nucleus (GO:0005634)	ATP binding (GO:0005524)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AATCAGGGCGGCTTCAGTGCA	0.468																																					p.A620G		Atlas-SNP	.											.	ATAD2B	110	.	0			c.C1859G						PASS	.						77.0	74.0	75.0					2																	24046400		1978	4160	6138	SO:0001583	missense	54454	exon16			AGGGCGGCTTCAG	AB033066	CCDS46227.1	2p24.1-p23.3	2010-04-21		2007-02-08	ENSG00000119778	ENSG00000119778		"""ATPases / AAA-type"""	29230	protein-coding gene	gene with protein product		615347					Standard	XM_005264372		Approved	KIAA1240	uc002rek.4	Q9ULI0	OTTHUMG00000151902	ENST00000238789.5:c.1859C>G	chr2.hg19:g.24046400G>C	ENSP00000238789:p.Ala620Gly	64.0	0.0	.		67.0	31.0	.	NM_001242338	B9ZVQ5|Q6ZNA6|Q8N9E7	Missense_Mutation	SNP	ENST00000238789.5	hg19	CCDS46227.1	.	.	.	.	.	.	.	.	.	.	G	31	5.060927	0.93846	.	.	ENSG00000119778	ENST00000238789;ENST00000458510	D;D	0.96396	-4.0;-3.74	5.21	5.21	0.72293	.	.	.	.	.	D	0.98280	0.9430	M	0.85099	2.735	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.99150	1.0858	9	0.87932	D	0	.	19.1413	0.93446	0.0:0.0:1.0:0.0	.	620	Q9ULI0	ATD2B_HUMAN	G	620;58	ENSP00000238789:A620G;ENSP00000392764:A58G	ENSP00000238789:A620G	A	-	2	0	ATAD2B	23899904	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.790000	0.99075	2.609000	0.88269	0.655000	0.94253	GCC	.	.	.	none		0.468	ATAD2B-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324333.1	NM_017552	
C2orf44	80304	hgsc.bcm.edu	37	2	24262142	24262142	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr2:24262142C>A	ENST00000295148.4	-	2	280	c.223G>T	c.(223-225)Gtt>Ttt	p.V75F	C2orf44_ENST00000406895.3_Missense_Mutation_p.V75F	NM_025203.2	NP_079479.1	Q9H6R7	CB044_HUMAN	chromosome 2 open reading frame 44	75									C2orf44/ALK(2)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCGAGTAGAACAGGTGTATCA	0.517			T	ALK	NSCLC																																p.V75F		Atlas-SNP	.		Dom	yes		2	2p23.3	80304	chromosome 2 open reading frame 44		E	.	C2orf44	56	.	0			c.G223T						PASS	.						113.0	100.0	104.0					2																	24262142		2203	4300	6503	SO:0001583	missense	80304	exon2			GTAGAACAGGTGT	AK025598	CCDS1705.1, CCDS46229.1	2p23.3	2012-07-30			ENSG00000163026	ENSG00000163026			26157	protein-coding gene	gene with protein product						22327622	Standard	NM_025203		Approved	FLJ21945	uc002rep.2	Q9H6R7	OTTHUMG00000125498	ENST00000295148.4:c.223G>T	chr2.hg19:g.24262142C>A	ENSP00000295148:p.Val75Phe	49.0	0.0	.		66.0	30.0	.	NM_025203	D6W532|Q8IYK0|Q9HBP5	Missense_Mutation	SNP	ENST00000295148.4	hg19	CCDS1705.1	.	.	.	.	.	.	.	.	.	.	C	7.466	0.645750	0.14451	.	.	ENSG00000163026	ENST00000295148;ENST00000406895;ENST00000443232	T;T;T	0.51071	3.45;3.45;0.72	5.24	-5.89	0.02282	.	0.374860	0.32218	N	0.006412	T	0.16428	0.0395	N	0.08118	0	0.09310	N	0.999998	P;P	0.34546	0.456;0.456	B;B	0.27076	0.076;0.076	T	0.11060	-1.0603	10	0.87932	D	0	-0.5627	4.2048	0.10483	0.0901:0.4263:0.0883:0.3952	.	75;75	Q9H6R7-2;Q9H6R7	.;CB044_HUMAN	F	75	ENSP00000295148:V75F;ENSP00000385816:V75F;ENSP00000413426:V75F	ENSP00000295148:V75F	V	-	1	0	C2orf44	24115646	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.157000	0.16402	-1.253000	0.02488	-0.890000	0.02929	GTT	.	.	.	none		0.517	C2orf44-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246825.1	NM_025203	
ASPRV1	151516	hgsc.bcm.edu	37	2	70188627	70188627	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr2:70188627A>G	ENST00000320256.4	-	1	770	c.194T>C	c.(193-195)cTc>cCc	p.L65P	PCBP1-AS1_ENST00000457076.1_RNA|PCBP1-AS1_ENST00000418564.1_RNA|PCBP1-AS1_ENST00000596259.1_RNA|PCBP1-AS1_ENST00000415222.1_RNA|PCBP1-AS1_ENST00000413436.1_RNA|PCBP1-AS1_ENST00000419542.1_RNA|PCBP1-AS1_ENST00000435880.2_RNA	NM_152792.2	NP_690005.2			aspartic peptidase, retroviral-like 1											endometrium(3)|large_intestine(4)|lung(6)|ovary(1)	14						AAACCCACAGAGCAGTGTCGG	0.657																																					p.L65P		Atlas-SNP	.											.	ASPRV1	41	.	0			c.T194C						PASS	.						41.0	39.0	39.0					2																	70188627		2203	4300	6503	SO:0001583	missense	151516	exon1			CCACAGAGCAGTG	AK055994	CCDS1897.1	2p13.3	2008-02-20			ENSG00000244617	ENSG00000244617			26321	protein-coding gene	gene with protein product	"""Skin ASpartic Protease"""	611765				16098038, 16565508	Standard	NM_152792		Approved	Taps, SASPase, FLJ25084	uc002sfz.4	Q53RT3	OTTHUMG00000129647	ENST00000320256.4:c.194T>C	chr2.hg19:g.70188627A>G	ENSP00000315383:p.Leu65Pro	60.0	0.0	.		58.0	24.0	.	NM_152792		Missense_Mutation	SNP	ENST00000320256.4	hg19	CCDS1897.1	.	.	.	.	.	.	.	.	.	.	A	15.92	2.974023	0.53720	.	.	ENSG00000244617	ENST00000320256	T	0.57273	0.41	5.79	4.57	0.56435	.	0.521020	0.14392	N	0.322440	T	0.52008	0.1708	N	0.24115	0.695	0.50813	D	0.999891	D	0.58970	0.984	P	0.57371	0.819	T	0.53472	-0.8434	10	0.87932	D	0	-8.9663	9.3054	0.37872	0.819:0.181:0.0:0.0	.	65	Q53RT3	APRV1_HUMAN	P	65	ENSP00000315383:L65P	ENSP00000315383:L65P	L	-	2	0	ASPRV1	70042131	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.247000	0.58750	2.207000	0.71202	0.533000	0.62120	CTC	.	.	.	none		0.657	ASPRV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334161.1	NM_152792	
SPOPL	339745	hgsc.bcm.edu	37	2	139318408	139318408	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr2:139318408G>A	ENST00000280098.4	+	8	1127	c.748G>A	c.(748-750)Gtt>Att	p.V250I		NM_001001664.2	NP_001001664.1	Q6IQ16	SPOPL_HUMAN	speckle-type POZ protein-like	250	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				negative regulation of protein ubiquitination (GO:0031397)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nucleus (GO:0005634)				breast(2)|cervix(2)|endometrium(2)|large_intestine(2)|lung(11)|skin(2)	21				BRCA - Breast invasive adenocarcinoma(221;0.0296)		AGACCCTGAAGTTTTTAAAGA	0.328																																					p.V250I		Atlas-SNP	.											.	SPOPL	54	.	0			c.G748A						PASS	.						72.0	76.0	75.0					2																	139318408		2203	4300	6503	SO:0001583	missense	339745	exon8			CCTGAAGTTTTTA		CCDS33298.1	2q22.1	2013-01-09			ENSG00000144228	ENSG00000144228		"""BTB/POZ domain containing"""	27934	protein-coding gene	gene with protein product	"""HIB homolog 2"", ""roadkill homolog 2"""						Standard	NM_001001664		Approved	BTBD33	uc002tvh.3	Q6IQ16	OTTHUMG00000153635	ENST00000280098.4:c.748G>A	chr2.hg19:g.139318408G>A	ENSP00000280098:p.Val250Ile	101.0	0.0	.		118.0	58.0	.	NM_001001664		Missense_Mutation	SNP	ENST00000280098.4	hg19	CCDS33298.1	.	.	.	.	.	.	.	.	.	.	G	34	5.402843	0.96030	.	.	ENSG00000144228	ENST00000280098	T	0.68331	-0.32	5.24	5.24	0.73138	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.77705	0.4170	L	0.59912	1.85	0.80722	D	1	D	0.56968	0.978	P	0.60682	0.878	T	0.76165	-0.3059	9	.	.	.	-16.2686	19.1816	0.93625	0.0:0.0:1.0:0.0	.	250	Q6IQ16	SPOPL_HUMAN	I	250	ENSP00000280098:V250I	.	V	+	1	0	SPOPL	139034878	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.813000	0.99286	2.601000	0.87937	0.655000	0.94253	GTT	.	.	.	none		0.328	SPOPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331897.1		
CCDC141	285025	hgsc.bcm.edu	37	2	179701991	179701991	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr2:179701991G>A	ENST00000420890.2	-	23	4072	c.3955C>T	c.(3955-3957)Cat>Tat	p.H1319Y	CCDC141_ENST00000480419.1_5'UTR|CCDC141_ENST00000295723.5_Missense_Mutation_p.H744Y	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	1319										NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			CTCTCTGGATGTTCAGCACTG	0.493																																					p.H1319Y		Atlas-SNP	.											.	CCDC141	362	.	0			c.C3955T						PASS	.						121.0	105.0	110.0					2																	179701991		2203	4300	6503	SO:0001583	missense	285025	exon23			CTGGATGTTCAGC	AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.3955C>T	chr2.hg19:g.179701991G>A	ENSP00000395995:p.His1319Tyr	77.0	0.0	.		91.0	37.0	.	NM_173648	H7C0P1|J3KNW6|Q8N8H3	Missense_Mutation	SNP	ENST00000420890.2	hg19		.	.	.	.	.	.	.	.	.	.	G	0.081	-1.183772	0.01620	.	.	ENSG00000163492	ENST00000420890;ENST00000343876;ENST00000295723	T;T;T	0.44083	0.93;1.53;1.53	5.71	4.83	0.62350	.	1.233450	0.05438	N	0.547098	T	0.31167	0.0788	N	0.22421	0.69	0.09310	N	1	P;P	0.48503	0.61;0.911	B;B	0.41813	0.26;0.367	T	0.03306	-1.1050	10	0.07482	T	0.82	0.9855	10.9382	0.47257	0.1512:0.0:0.8488:0.0	.	744;744	Q6ZP82;Q6ZP82-2	CC141_HUMAN;.	Y	1319;763;744	ENSP00000395995:H1319Y;ENSP00000344627:H763Y;ENSP00000295723:H744Y	ENSP00000295723:H744Y	H	-	1	0	CCDC141	179410236	0.771000	0.28555	0.016000	0.15963	0.438000	0.31896	2.406000	0.44557	1.387000	0.46486	0.655000	0.94253	CAT	.	.	.	none		0.493	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_173648	
DOCK10	55619	hgsc.bcm.edu	37	2	225670917	225670917	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr2:225670917T>C	ENST00000258390.7	-	34	3807	c.3740A>G	c.(3739-3741)cAa>cGa	p.Q1247R	DOCK10_ENST00000409592.3_Missense_Mutation_p.Q1241R	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1247					regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		TGTCTGGCTTTGAAATCCTCC	0.363																																					p.Q1247R		Atlas-SNP	.											.	DOCK10	308	.	0			c.A3740G						PASS	.						142.0	140.0	140.0					2																	225670917		1854	4089	5943	SO:0001583	missense	55619	exon34			TGGCTTTGAAATC	AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.3740A>G	chr2.hg19:g.225670917T>C	ENSP00000258390:p.Gln1247Arg	52.0	0.0	.		58.0	28.0	.	NM_014689	B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	ENST00000258390.7	hg19	CCDS46528.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	1.613|1.613	-0.523497|-0.523497	0.04141|0.04141	.|.	.|.	ENSG00000135905|ENSG00000135905	ENST00000422684|ENST00000409592;ENST00000258390	.|T;T	.|0.21361	.|2.01;2.01	5.85|5.85	1.96|1.96	0.26148|0.26148	.|.	.|0.628162	.|0.17934	.|N	.|0.157066	T|T	0.18215|0.18215	0.0437|0.0437	L|L	0.54323|0.54323	1.7|1.7	0.28864|0.28864	N|N	0.895366|0.895366	.|B;B	.|0.25955	.|0.112;0.138	.|B;B	.|0.18561	.|0.022;0.013	T|T	0.25293|0.25293	-1.0136|-1.0136	5|10	.|0.10902	.|T	.|0.67	.|.	13.4531|13.4531	0.61182|0.61182	0.0:0.0:0.3725:0.6275|0.0:0.0:0.3725:0.6275	.|.	.|1247;1241	.|Q96BY6;B3FL70	.|DOC10_HUMAN;.	E|R	138|1241;1247	.|ENSP00000386694:Q1241R;ENSP00000258390:Q1247R	.|ENSP00000258390:Q1247R	K|Q	-|-	1|2	0|0	DOCK10|DOCK10	225379161|225379161	0.680000|0.680000	0.27605|0.27605	0.279000|0.279000	0.24732|0.24732	0.344000|0.344000	0.29017|0.29017	0.810000|0.810000	0.27183|0.27183	0.089000|0.089000	0.17243|0.17243	-0.291000|-0.291000	0.09656|0.09656	AAA|CAA	.	.	.	none		0.363	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331246.1		
COL6A3	1293	hgsc.bcm.edu	37	2	238262001	238262001	+	Missense_Mutation	SNP	C	C	G	rs138588234		TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr2:238262001C>G	ENST00000295550.4	-	25	7125	c.6673G>C	c.(6673-6675)Ggg>Cgg	p.G2225R	COL6A3_ENST00000346358.4_Missense_Mutation_p.G2025R|COL6A3_ENST00000353578.4_Missense_Mutation_p.G2019R|COL6A3_ENST00000347401.3_Missense_Mutation_p.G2024R|COL6A3_ENST00000472056.1_Missense_Mutation_p.G1618R|COL6A3_ENST00000409809.1_Missense_Mutation_p.G2019R	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2225	Collagen-like 3.|Triple-helical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.G2225R(1)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CCTCTGGTCCCCTGCTCTCCC	0.507																																					p.G2225R		Atlas-SNP	.											COL6A3,arm,malignant_melanoma,0,1	COL6A3	608	.	1	Substitution - Missense(1)	skin(1)	c.G6673C						PASS	.						71.0	63.0	66.0					2																	238262001		2203	4300	6503	SO:0001583	missense	1293	exon25			TGGTCCCCTGCTC	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.6673G>C	chr2.hg19:g.238262001C>G	ENSP00000295550:p.Gly2225Arg	52.0	0.0	.		81.0	0.0	.	NM_004369	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	hg19	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	C	12.84	2.058734	0.36277	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	D;D;D;D;D;D	0.99637	-6.29;-6.29;-6.29;-6.29;-6.29;-6.29	5.21	5.21	0.72293	.	0.000000	0.51477	D	0.000089	D	0.99796	0.9913	H	0.97315	3.98	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.999;1.0;0.999	D	0.96877	0.9643	10	0.87932	D	0	.	16.9555	0.86258	0.0:1.0:0.0:0.0	.	1618;1618;2019;2225	E9PFQ6;B7ZMJ7;P12111-2;P12111	.;.;.;CO6A3_HUMAN	R	2225;2024;2019;1618;2019;2025	ENSP00000295550:G2225R;ENSP00000315609:G2024R;ENSP00000315873:G2019R;ENSP00000418285:G1618R;ENSP00000386844:G2019R;ENSP00000295546:G2025R	ENSP00000295550:G2225R	G	-	1	0	COL6A3	237926740	1.000000	0.71417	1.000000	0.80357	0.724000	0.41520	5.391000	0.66266	2.429000	0.82318	0.655000	0.94253	GGG	.	.	.	alt		0.507	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
GADL1	339896	hgsc.bcm.edu	37	3	30819676	30819676	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr3:30819676T>C	ENST00000282538.5	-	14	1537	c.1387A>G	c.(1387-1389)Aat>Gat	p.N463D	GADL1_ENST00000498387.1_5'UTR	NM_207359.2	NP_997242.2	Q6ZQY3	GADL1_HUMAN	glutamate decarboxylase-like 1	463					carboxylic acid metabolic process (GO:0019752)		aspartate 1-decarboxylase activity (GO:0004068)|pyridoxal phosphate binding (GO:0030170)|sulfinoalanine decarboxylase activity (GO:0004782)			breast(2)|endometrium(3)|kidney(2)|lung(17)|upper_aerodigestive_tract(1)	25						CTTACCAAATTAAGTTTTGCC	0.368																																					p.N463D		Atlas-SNP	.											.	GADL1	91	.	0			c.A1387G						PASS	.						69.0	74.0	72.0					3																	30819676		2203	4300	6503	SO:0001583	missense	339896	exon14			CCAAATTAAGTTT	AK128643	CCDS2649.2	3p23-p22	2009-01-14			ENSG00000144644	ENSG00000144644			27949	protein-coding gene	gene with protein product		615601					Standard	NM_207359		Approved		uc003cep.2	Q6ZQY3	OTTHUMG00000130621	ENST00000282538.5:c.1387A>G	chr3.hg19:g.30819676T>C	ENSP00000282538:p.Asn463Asp	107.0	0.0	.		173.0	45.0	.	NM_207359		Missense_Mutation	SNP	ENST00000282538.5	hg19	CCDS2649.2	.	.	.	.	.	.	.	.	.	.	T	10.90	1.481092	0.26598	.	.	ENSG00000144644	ENST00000282538	T	0.35973	1.28	6.02	-3.37	0.04898	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.641607	0.16112	N	0.229060	T	0.17704	0.0425	N	0.05230	-0.09	0.09310	N	0.999995	B	0.02656	0.0	B	0.04013	0.001	T	0.20672	-1.0268	10	0.07990	T	0.79	-15.4742	21.8233	0.99961	0.0:0.0:0.7797:0.2203	.	463	Q6ZQY3	GADL1_HUMAN	D	463	ENSP00000282538:N463D	ENSP00000282538:N463D	N	-	1	0	GADL1	30794680	0.310000	0.24527	0.388000	0.26195	0.995000	0.86356	0.409000	0.21082	-0.824000	0.04295	0.533000	0.62120	AAT	.	.	.	none		0.368	GADL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253106.2	NM_207359	
SETD2	29072	hgsc.bcm.edu	37	3	47158197	47158197	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr3:47158197C>G	ENST00000409792.3	-	4	4544	c.4502G>C	c.(4501-4503)tGt>tCt	p.C1501S		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1501	AWS. {ECO:0000255|PROSITE- ProRule:PRU00562}.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		AAGAGGTGTACACTCACACTG	0.318			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.C1501S		Atlas-SNP	.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	SETD2_ENST00000409792,NS,carcinoma,-1,6	SETD2	721	.	0			c.G4502C						PASS	.						114.0	110.0	111.0					3																	47158197		2203	4300	6503	SO:0001583	missense	29072	exon4			GGTGTACACTCAC	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.4502G>C	chr3.hg19:g.47158197C>G	ENSP00000386759:p.Cys1501Ser	113.0	0.0	.		188.0	106.0	.	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	hg19	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	C	29.1	4.973314	0.92919	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792	D	0.85411	-1.98	5.93	5.93	0.95920	AWS (2);	0.000000	0.64402	D	0.000007	D	0.95538	0.8550	H	0.96691	3.865	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.77004	0.989;0.989	D	0.96291	0.9214	10	0.87932	D	0	.	20.3495	0.98807	0.0:1.0:0.0:0.0	.	1501;1501	F2Z317;Q9BYW2	.;SETD2_HUMAN	S	1501	ENSP00000386759:C1501S	ENSP00000386759:C1501S	C	-	2	0	SETD2	47133201	1.000000	0.71417	0.994000	0.49952	0.997000	0.91878	7.794000	0.85869	2.814000	0.96858	0.591000	0.81541	TGT	.	.	.	none		0.318	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
USP19	10869	hgsc.bcm.edu	37	3	49149414	49149414	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr3:49149414A>G	ENST00000398888.2	-	19	2842	c.2524T>C	c.(2524-2526)Ttc>Ctc	p.F842L	USP19_ENST00000398892.3_Missense_Mutation_p.F882L|USP19_ENST00000417901.1_Missense_Mutation_p.F945L|USP19_ENST00000434032.2_Missense_Mutation_p.F943L|USP19_ENST00000398896.1_Missense_Mutation_p.F650L|USP19_ENST00000398898.2_Missense_Mutation_p.F882L|USP19_ENST00000453664.1_Missense_Mutation_p.F933L	NM_006677.2	NP_006668.1	O94966	UBP19_HUMAN	ubiquitin specific peptidase 19	842	USP.				ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of skeletal muscle tissue development (GO:0048642)|positive regulation of cell cycle process (GO:0090068)|protein deubiquitination (GO:0016579)|regulation of cellular response to hypoxia (GO:1900037)|regulation of protein stability (GO:0031647)|response to endoplasmic reticulum stress (GO:0034976)|skeletal muscle atrophy (GO:0014732)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|ubiquitin-specific protease activity (GO:0004843)			NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(10)|lung(5)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CTGACCAGGAAGGGGTAGCCA	0.587																																					p.F945L		Atlas-SNP	.											.	USP19	158	.	0			c.T2833C						PASS	.						81.0	87.0	85.0					3																	49149414		2103	4217	6320	SO:0001583	missense	10869	exon20			CCAGGAAGGGGTA	AB020698	CCDS43090.1, CCDS56254.1, CCDS56255.1, CCDS56256.1	3p21.31	2005-10-13	2005-08-08		ENSG00000172046	ENSG00000172046		"""Zinc fingers, MYND-type"", ""Ubiquitin-specific peptidases"""	12617	protein-coding gene	gene with protein product		614471	"""ubiquitin specific protease 19"""			12838346	Standard	NM_001199160		Approved	KIAA0891, ZMYND9	uc011bch.2	O94966	OTTHUMG00000133611	ENST00000398888.2:c.2524T>C	chr3.hg19:g.49149414A>G	ENSP00000381863:p.Phe842Leu	47.0	0.0	.		97.0	39.0	.	NM_001199161	A5PKX8|A6H8U2|B4DGT3|B4DTZ0|E7EN22|E7ETS0|E9PEG8|Q3KQW4|Q641Q9|Q6NZY8|Q86XV9	Missense_Mutation	SNP	ENST00000398888.2	hg19	CCDS43090.1	.	.	.	.	.	.	.	.	.	.	A	23.0	4.360831	0.82353	.	.	ENSG00000172046	ENST00000398896;ENST00000398898;ENST00000417901;ENST00000453664;ENST00000398892;ENST00000398888;ENST00000434032	T;T;T;T;T;T;T	0.21031	2.07;2.04;2.14;2.13;2.03;2.17;2.12	5.94	5.94	0.96194	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.407146	0.28895	N	0.013785	T	0.34571	0.0902	L	0.35593	1.075	0.80722	D	1	P;P;P;D;B	0.63046	0.767;0.767;0.602;0.992;0.149	B;B;B;D;B	0.76071	0.34;0.34;0.25;0.987;0.093	T	0.03922	-1.0992	10	0.18276	T	0.48	-26.8203	16.3979	0.83621	1.0:0.0:0.0:0.0	.	943;933;842;882;650	E9PEG8;E7EN22;O94966;B5MEG5;E7ESU0	.;.;UBP19_HUMAN;.;.	L	650;882;945;933;882;842;943	ENSP00000381870:F650L;ENSP00000381872:F882L;ENSP00000395260:F945L;ENSP00000400090:F933L;ENSP00000381867:F882L;ENSP00000381863:F842L;ENSP00000401197:F943L	ENSP00000381863:F842L	F	-	1	0	USP19	49124418	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.978000	0.93450	2.279000	0.76181	0.459000	0.35465	TTC	.	.	.	none		0.587	USP19-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257721.1	NM_006677	
ACOX2	8309	hgsc.bcm.edu	37	3	58514651	58514651	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr3:58514651G>A	ENST00000302819.5	-	9	1316	c.1025C>T	c.(1024-1026)aCa>aTa	p.T342I	ACOX2_ENST00000459701.2_Missense_Mutation_p.T328I	NM_003500.3	NP_003491.1	Q99424	ACOX2_HUMAN	acyl-CoA oxidase 2, branched chain	342					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	3alpha,7alpha,12alpha-trihydroxy-5beta-cholestanoyl-CoA 24-hydroxylase activity (GO:0033791)|acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)|flavin adenine dinucleotide binding (GO:0050660)|pristanoyl-CoA oxidase activity (GO:0016402)|receptor binding (GO:0005102)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|prostate(1)|skin(3)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(55;0.000194)|Kidney(10;0.00255)|KIRC - Kidney renal clear cell carcinoma(10;0.00268)|OV - Ovarian serous cystadenocarcinoma(275;0.156)		CTGCTGTTGTGTCTGGTAGTC	0.507																																					p.T342I		Atlas-SNP	.											.	ACOX2	53	.	0			c.C1025T						PASS	.						138.0	131.0	133.0					3																	58514651		2203	4300	6503	SO:0001583	missense	8309	exon9			TGTTGTGTCTGGT	X95190	CCDS33775.1	3p14.3	2012-07-13	2010-04-30		ENSG00000168306	ENSG00000168306	1.17.99.3		120	protein-coding gene	gene with protein product	"""trihydroxycoprostanoyl-CoA oxidase"", ""3-alpha,7-alpha,12-alpha-trihydroxy-5-beta-cholestanoyl-CoA 24-hydroxylase"""	601641	"""acyl-Coenzyme A oxidase 2, branched chain"""			8943006, 9070889	Standard	NM_003500		Approved	BRCACOX, BRCOX, THCCox	uc003dkl.3	Q99424	OTTHUMG00000159154	ENST00000302819.5:c.1025C>T	chr3.hg19:g.58514651G>A	ENSP00000307697:p.Thr342Ile	66.0	0.0	.		115.0	48.0	.	NM_003500	A6NF16|B2R8U5	Missense_Mutation	SNP	ENST00000302819.5	hg19	CCDS33775.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.376899	0.82682	.	.	ENSG00000168306	ENST00000459701;ENST00000302819	T;T	0.70869	-0.52;-0.52	4.94	4.94	0.65067	Acyl-CoA dehydrogenase/oxidase C-terminal (2);	0.000000	0.64402	D	0.000001	D	0.85927	0.5811	M	0.85197	2.74	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	D	0.87969	0.2735	10	0.87932	D	0	-28.2004	18.3225	0.90243	0.0:0.0:1.0:0.0	.	342	Q99424	ACOX2_HUMAN	I	328;342	ENSP00000418562:T328I;ENSP00000307697:T342I	ENSP00000307697:T342I	T	-	2	0	ACOX2	58489691	1.000000	0.71417	0.965000	0.40720	0.808000	0.45660	8.509000	0.90529	2.728000	0.93425	0.561000	0.74099	ACA	.	.	.	none		0.507	ACOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353541.1		
IQCB1	9657	hgsc.bcm.edu	37	3	121500645	121500645	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr3:121500645T>C	ENST00000310864.6	-	13	1569	c.1355A>G	c.(1354-1356)gAt>gGt	p.D452G	IQCB1_ENST00000349820.6_Missense_Mutation_p.D319G	NM_001023570.2	NP_001018864.2	Q15051	IQCB1_HUMAN	IQ motif containing B1	452					cilium assembly (GO:0042384)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)	calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)			NS(1)|biliary_tract(1)|breast(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(11)|prostate(1)|skin(1)	30				GBM - Glioblastoma multiforme(114;0.0983)		TCGGCGTGCATCAGTGAGTTC	0.408																																					p.D452G		Atlas-SNP	.											.	IQCB1	50	.	0			c.A1355G						PASS	.						151.0	141.0	145.0					3																	121500645		2203	4300	6503	SO:0001583	missense	9657	exon13			CGTGCATCAGTGA	D25278	CCDS33836.1, CCDS33837.1	3q21.1	2014-01-28	2004-09-02		ENSG00000173226	ENSG00000173226			28949	protein-coding gene	gene with protein product	"""nephrocystin-5"""	609237	"""IQ calmodulin-binding motif containing 1"""			15723066	Standard	NM_001023571		Approved	KIAA0036, NPHP5, SLSN5	uc010hre.1	Q15051	OTTHUMG00000128677	ENST00000310864.6:c.1355A>G	chr3.hg19:g.121500645T>C	ENSP00000311505:p.Asp452Gly	165.0	0.0	.		259.0	153.0	.	NM_001023570	Q3KS08|Q3KS09|Q5DKQ7|Q8NI79|Q9BS08	Missense_Mutation	SNP	ENST00000310864.6	hg19	CCDS33837.1	.	.	.	.	.	.	.	.	.	.	T	18.84	3.710100	0.68730	.	.	ENSG00000173226	ENST00000310864;ENST00000349820	T;T	0.79141	-1.24;-1.24	4.61	4.61	0.57282	.	0.000000	0.85682	D	0.000000	D	0.85204	0.5643	M	0.66939	2.045	0.52501	D	0.999953	D;D	0.89917	0.993;1.0	D;D	0.87578	0.971;0.998	D	0.86234	0.1639	10	0.72032	D	0.01	-13.185	10.5952	0.45333	0.0:0.0:0.0:1.0	.	452;319	Q15051;Q15051-2	IQCB1_HUMAN;.	G	452;319	ENSP00000311505:D452G;ENSP00000323756:D319G	ENSP00000311505:D452G	D	-	2	0	IQCB1	122983335	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	3.446000	0.52928	2.062000	0.61559	0.482000	0.46254	GAT	.	.	.	none		0.408	IQCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250573.1	NM_014642	
MBNL1	4154	hgsc.bcm.edu	37	3	152165476	152165476	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr3:152165476C>A	ENST00000463374.1	+	6	1440	c.929C>A	c.(928-930)aCc>aAc	p.T310N	Y_RNA_ENST00000364347.1_RNA|MBNL1_ENST00000357472.3_Missense_Mutation_p.T292N|MBNL1_ENST00000282488.7_Missense_Mutation_p.T224N|MBNL1_ENST00000282486.6_Missense_Mutation_p.T310N|MBNL1_ENST00000492948.1_Missense_Mutation_p.T292N|MBNL1_ENST00000498502.1_Missense_Mutation_p.T310N|MBNL1_ENST00000493459.1_Missense_Mutation_p.T253N|MBNL1_ENST00000485910.1_Missense_Mutation_p.T224N|MBNL1_ENST00000545754.1_Missense_Mutation_p.T224N|MBNL1_ENST00000324210.5_Missense_Mutation_p.T292N|MBNL1_ENST00000485509.1_Intron|MBNL1_ENST00000355460.2_Missense_Mutation_p.T292N|MBNL1_ENST00000324196.5_Intron	NM_207293.1	NP_997176.1	Q9NR56	MBNL1_HUMAN	muscleblind-like splicing regulator 1	310					alternative mRNA splicing, via spliceosome (GO:0000380)|embryonic limb morphogenesis (GO:0030326)|in utero embryonic development (GO:0001701)|mRNA splice site selection (GO:0006376)|myoblast differentiation (GO:0045445)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|skeletal muscle tissue development (GO:0007519)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			AACGGTGCCACCGCAGTCTTT	0.453																																					p.T310N		Atlas-SNP	.											.	MBNL1	100	.	0			c.C929A						PASS	.						97.0	95.0	95.0					3																	152165476		2203	4300	6503	SO:0001583	missense	4154	exon6			GTGCCACCGCAGT	Y13829	CCDS3163.1, CCDS3164.1, CCDS3165.1, CCDS3166.1, CCDS3167.1, CCDS3168.1, CCDS54656.1	3q25	2013-01-18	2012-02-23	2003-03-14	ENSG00000152601	ENSG00000152601		"""Zinc fingers, CCCH-type domain containing"""	6923	protein-coding gene	gene with protein product		606516	"""muscleblind (Drosophila)-like"", ""muscleblind-like (Drosophila)"""	MBNL			Standard	NM_021038		Approved	KIAA0428, EXP42, EXP40, EXP35, EXP	uc003ezm.3	Q9NR56	OTTHUMG00000159163	ENST00000463374.1:c.929C>A	chr3.hg19:g.152165476C>A	ENSP00000418108:p.Thr310Asn	160.0	0.0	.		146.0	6.0	.	NM_207293	E9PBW7|O43311|O43797|Q86UV8|Q86UV9|Q96P92|Q96RE3	Missense_Mutation	SNP	ENST00000463374.1	hg19	CCDS3165.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.64|17.64	3.440834|3.440834	0.63067|0.63067	.|.	.|.	ENSG00000152601|ENSG00000152601	ENST00000464596|ENST00000282486;ENST00000282488;ENST00000355460;ENST00000493459;ENST00000324210;ENST00000498502;ENST00000545754;ENST00000357472;ENST00000485910;ENST00000463374;ENST00000465907;ENST00000492948	.|.	.|.	.|.	5.5|5.5	5.5|5.5	0.81552|0.81552	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.75072|0.75072	0.3800|0.3800	M|M	0.62723|0.62723	1.935|1.935	0.80722|0.80722	D|D	1|1	.|D;B;P;P;P;P;P	.|0.58970	.|0.984;0.371;0.57;0.923;0.612;0.954;0.847	.|P;B;B;P;B;P;P	.|0.59703	.|0.862;0.149;0.36;0.461;0.197;0.662;0.662	T|T	0.73701|0.73701	-0.3900|-0.3900	5|9	.|0.41790	.|T	.|0.15	.|.	19.4004|19.4004	0.94627|0.94627	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|224;224;310;292;253;292;292	.|Q9NR56-3;Q96RE3;Q9NR56;Q86UV8;Q86VM6;Q9NR56-2;Q96P92	.|.;.;MBNL1_HUMAN;.;.;.;.	T|N	291|310;224;292;253;292;310;224;292;224;310;224;292	.|.	.|ENSP00000282486:T310N	P|T	+|+	1|2	0|0	MBNL1|MBNL1	153648166|153648166	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.518000|7.518000	0.81795|0.81795	2.577000|2.577000	0.86979|0.86979	0.655000|0.655000	0.94253|0.94253	CCG|ACC	.	.	.	none		0.453	MBNL1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353604.1	NM_021038	
WDR19	57728	hgsc.bcm.edu	37	4	39196261	39196261	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr4:39196261C>G	ENST00000399820.3	+	5	542	c.388C>G	c.(388-390)Cga>Gga	p.R130G	WDR19_ENST00000288634.7_Intron|WDR19_ENST00000506503.1_Missense_Mutation_p.R130G	NM_025132.3	NP_079408.3	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19	130					ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium assembly (GO:0042384)|digestive system development (GO:0055123)|ear morphogenesis (GO:0042471)|embryonic camera-type eye development (GO:0031076)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic limb morphogenesis (GO:0030326)|in utero embryonic development (GO:0001701)|intraciliary retrograde transport (GO:0035721)|myotome development (GO:0061055)|neurological system process (GO:0050877)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|motile cilium (GO:0031514)|nonmotile primary cilium (GO:0031513)|photoreceptor connecting cilium (GO:0032391)				large_intestine(1)	1						TCAGACATCTCGAAAGATTCC	0.403																																					p.R130G		Atlas-SNP	.											.	WDR19	96	.	0			c.C388G						PASS	.						94.0	86.0	88.0					4																	39196261		1834	4094	5928	SO:0001583	missense	57728	exon5			ACATCTCGAAAGA	AB046858, AY029257	CCDS47042.1	4p14	2014-02-21			ENSG00000157796	ENSG00000157796		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	18340	protein-coding gene	gene with protein product	"""intraflagellar transport 144 homolog (Chlamydomonas)"""	608151				12906858, 22019273	Standard	XM_005262658		Approved	Pwdmp, KIAA1638, FLJ23127, ORF26, DYF-2, Oseg6, IFT144, NPHP13	uc003gtv.3	Q8NEZ3	OTTHUMG00000160466	ENST00000399820.3:c.388C>G	chr4.hg19:g.39196261C>G	ENSP00000382717:p.Arg130Gly	34.0	0.0	.		35.0	5.0	.	NM_025132	B5MEF2|Q8N5B4|Q9H5S0|Q9HCD4	Missense_Mutation	SNP	ENST00000399820.3	hg19	CCDS47042.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.986458	0.74589	.	.	ENSG00000157796	ENST00000399820;ENST00000509560;ENST00000506503;ENST00000399836	T;T;T	0.30714	3.42;1.52;3.42	5.58	4.66	0.58398	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.62780	0.2456	M	0.89785	3.06	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.74348	0.983;0.979	T	0.69720	-0.5069	10	0.51188	T	0.08	-8.1952	17.1715	0.86832	0.1347:0.8653:0.0:0.0	.	130;130	Q8NEZ3;D6R9P6	WDR19_HUMAN;.	G	130;71;130;129	ENSP00000382717:R130G;ENSP00000426918:R71G;ENSP00000423491:R130G	ENSP00000382717:R130G	R	+	1	2	WDR19	38872656	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.725000	0.68507	2.604000	0.88044	0.655000	0.94253	CGA	.	.	.	none		0.403	WDR19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360689.1		
ARSJ	79642	hgsc.bcm.edu	37	4	114823444	114823444	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr4:114823444C>T	ENST00000315366.7	-	2	2652	c.1786G>A	c.(1786-1788)Gtt>Att	p.V596I	ARSJ_ENST00000541197.1_Intron	NM_024590.3	NP_078866.3	Q5FYB0	ARSJ_HUMAN	arylsulfatase family, member J	596				STCHSGVTCG -> KPANLAR (in Ref. 2; CAJ18095 and 3; AAQ89010). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	21		Ovarian(17;0.0035)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00194)		CCACAAGTAACACCTGAATGG	0.363																																					p.V596I		Atlas-SNP	.											.	ARSJ	55	.	0			c.G1786A						PASS	.						73.0	68.0	69.0					4																	114823444		1876	4106	5982	SO:0001583	missense	79642	exon2			AAGTAACACCTGA		CCDS43264.1	4q26	2013-02-14	2006-03-07		ENSG00000180801	ENSG00000180801		"""Arylsulfatase family"""	26286	protein-coding gene	gene with protein product		610010	"""arylsulfatase J"""			12975309, 16174644	Standard	NM_024590		Approved	FLJ23548	uc003ibq.1	Q5FYB0	OTTHUMG00000161067	ENST00000315366.7:c.1786G>A	chr4.hg19:g.114823444C>T	ENSP00000320219:p.Val596Ile	68.0	0.0	.		78.0	33.0	.	NM_024590	A2RUG0|B7ZM45|Q1HA39|Q5FWE4|Q6UWT9	Missense_Mutation	SNP	ENST00000315366.7	hg19	CCDS43264.1	.	.	.	.	.	.	.	.	.	.	C	10.17	1.275258	0.23307	.	.	ENSG00000180801	ENST00000315366;ENST00000545965	D	0.96967	-4.19	5.4	-1.33	0.09172	.	9.916930	0.00447	U	0.000097	D	0.89424	0.6711	N	0.08118	0	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.82550	-0.0401	10	0.33141	T	0.24	.	4.2183	0.10545	0.1145:0.2273:0.4949:0.1632	.	596	Q5FYB0	ARSJ_HUMAN	I	596;165	ENSP00000320219:V596I	ENSP00000320219:V596I	V	-	1	0	ARSJ	115042893	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.114000	0.15520	0.004000	0.14682	-0.165000	0.13383	GTT	.	.	.	none		0.363	ARSJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363650.1	NM_024590	
SLC45A2	51151	hgsc.bcm.edu	37	5	33982376	33982376	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr5:33982376T>C	ENST00000296589.4	-	2	673	c.527A>G	c.(526-528)aAg>aGg	p.K176R	SLC45A2_ENST00000382102.3_Missense_Mutation_p.K176R|SLC45A2_ENST00000342059.3_Intron|SLC45A2_ENST00000509381.1_Missense_Mutation_p.K176R|SLC45A2_ENST00000345083.5_Missense_Mutation_p.K176R	NM_016180.3	NP_057264	Q9UMX9	S45A2_HUMAN	solute carrier family 45, member 2	176					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(25)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48						GCCCTTCTCCTTGTCCTGATG	0.493																																					p.K176R	Ovarian(31;380 859 8490 22203 49048)	Atlas-SNP	.											.	SLC45A2	100	.	0			c.A527G						PASS	.						107.0	103.0	104.0					5																	33982376		2203	4300	6503	SO:0001583	missense	51151	exon2			TTCTCCTTGTCCT	AF172849	CCDS3901.1, CCDS43308.1, CCDS75232.1	5p13.3	2013-08-06	2005-10-06	2005-10-06	ENSG00000164175	ENSG00000164175		"""Solute carriers"""	16472	protein-coding gene	gene with protein product		606202	"""membrane associated transporter"""	MATP		11916009, 11574907	Standard	NM_001012509		Approved	AIM-1, OCA4	uc003jid.3	Q9UMX9	OTTHUMG00000090719	ENST00000296589.4:c.527A>G	chr5.hg19:g.33982376T>C	ENSP00000296589:p.Lys176Arg	67.0	0.0	.		72.0	22.0	.	NM_016180	Q6P2P0|Q9BTM3	Missense_Mutation	SNP	ENST00000296589.4	hg19	CCDS3901.1	.	.	.	.	.	.	.	.	.	.	T	19.40	3.821212	0.71028	.	.	ENSG00000164175	ENST00000296589;ENST00000382102;ENST00000509381;ENST00000345083	T;T;D;T	0.91521	-0.69;-0.69;-2.86;-0.69	5.2	4.0	0.46444	Major facilitator superfamily domain, general substrate transporter (1);	0.072278	0.85682	D	0.000000	D	0.86176	0.5870	L	0.60067	1.865	0.58432	D	0.999997	P;B;B	0.41498	0.752;0.198;0.096	B;B;B	0.40659	0.336;0.155;0.115	T	0.82741	-0.0307	10	0.02654	T	1	-13.0181	11.4541	0.50171	0.1351:0.0:0.0:0.8649	.	176;176;176	D6RGY6;Q9UMX9-4;Q9UMX9	.;.;S45A2_HUMAN	R	176	ENSP00000296589:K176R;ENSP00000371534:K176R;ENSP00000421100:K176R;ENSP00000340444:K176R	ENSP00000296589:K176R	K	-	2	0	SLC45A2	34018133	1.000000	0.71417	0.998000	0.56505	0.952000	0.60782	4.064000	0.57506	0.888000	0.36160	0.450000	0.29827	AAG	.	.	.	none		0.493	SLC45A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207443.2	NM_016180	
PPIP5K2	23262	hgsc.bcm.edu	37	5	102503901	102503901	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr5:102503901A>G	ENST00000358359.3	+	19	2697	c.2188A>G	c.(2188-2190)Ata>Gta	p.I730V	PPIP5K2_ENST00000414217.1_Missense_Mutation_p.I730V|PPIP5K2_ENST00000513500.1_3'UTR|PPIP5K2_ENST00000321521.9_Missense_Mutation_p.I730V	NM_001276277.1	NP_001263206.1	O43314	VIP2_HUMAN	diphosphoinositol pentakisphosphate kinase 2	730					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						ATATGACTGTATAAAATATGA	0.333																																					p.I730V		Atlas-SNP	.											.	PPIP5K2	98	.	0			c.A2188G						PASS	.						102.0	112.0	109.0					5																	102503901		2202	4289	6491	SO:0001583	missense	23262	exon18			GACTGTATAAAAT	AB007893	CCDS34207.1, CCDS64212.1, CCDS75283.1	5q21.1	2014-05-06	2010-01-26	2010-01-26	ENSG00000145725	ENSG00000145725	2.7.4.24		29035	protein-coding gene	gene with protein product		611648	"""histidine acid phosphatase domain containing 1"""	HISPPD1		9455477, 17690096, 18981179	Standard	NM_001276277		Approved	KIAA0433, VIP2	uc003koe.4	O43314	OTTHUMG00000181461	ENST00000358359.3:c.2188A>G	chr5.hg19:g.102503901A>G	ENSP00000351126:p.Ile730Val	229.0	0.0	.		257.0	117.0	.	NM_015216	A1NI53|A6NGS8|Q8TB50	Missense_Mutation	SNP	ENST00000358359.3	hg19		.	.	.	.	.	.	.	.	.	.	A	10.45	1.354908	0.24512	.	.	ENSG00000145725	ENST00000321521;ENST00000358359;ENST00000451606;ENST00000414217;ENST00000509597	T;T;T;T	0.30182	1.54;1.54;1.54;1.54	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.19485	0.0468	N	0.10972	0.075	0.52501	D	0.999953	B;B;B	0.23185	0.062;0.029;0.081	B;B;B	0.33960	0.173;0.06;0.1	T	0.14337	-1.0476	10	0.27082	T	0.32	.	10.3029	0.43663	0.9261:0.0:0.0739:0.0	.	730;730;730	E9PGM8;O43314-2;O43314	.;.;VIP2_HUMAN	V	730;730;730;730;4	ENSP00000313070:I730V;ENSP00000351126:I730V;ENSP00000416016:I730V;ENSP00000424948:I4V	ENSP00000313070:I730V	I	+	1	0	PPIP5K2	102531800	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.118000	0.64673	2.218000	0.71995	0.377000	0.23210	ATA	.	.	.	none		0.333	PPIP5K2-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370487.1	NM_015216	
SRP19	6728	hgsc.bcm.edu	37	5	112200371	112200371	+	Silent	SNP	A	A	G			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr5:112200371A>G	ENST00000505459.1	+	4	398	c.243A>G	c.(241-243)agA>agG	p.R81R	CTC-487M23.8_ENST00000506997.1_Intron|SRP19_ENST00000515463.1_Missense_Mutation_p.E56G|CTC-487M23.8_ENST00000512790.1_3'UTR|CTC-554D6.1_ENST00000520401.1_3'UTR|SRP19_ENST00000282999.3_Silent_p.R81R	NM_001204193.1|NM_003135.2	NP_001191122.1|NP_003126.1	P09132	SRP19_HUMAN	signal recognition particle 19kDa	81					cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|gene expression (GO:0010467)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|large_intestine(1)	3		all_cancers(142;0.00328)|all_epithelial(76;6.39e-05)|Prostate(80;0.00174)|Colorectal(10;0.00372)|Ovarian(225;0.156)		Epithelial(69;1.7e-09)|OV - Ovarian serous cystadenocarcinoma(64;1.17e-08)|all cancers(49;3.96e-07)|Colorectal(14;0.0056)|COAD - Colon adenocarcinoma(37;0.0104)		ACAGAGGCAGAGTCCGGGTCC	0.408																																					p.E56G		Atlas-SNP	.											.	SRP19	12	.	0			c.A167G						PASS	.						94.0	96.0	95.0					5																	112200371		2202	4300	6502	SO:0001819	synonymous_variant	6728	exon3			AGGCAGAGTCCGG		CCDS4108.1, CCDS56375.1, CCDS56376.1, CCDS75286.1	5q21-q22	2008-07-18	2002-08-29		ENSG00000153037	ENSG00000153037			11300	protein-coding gene	gene with protein product		182175	"""signal recognition particle 19kD"""			2460823	Standard	NM_003135		Approved		uc011cvu.2	P09132	OTTHUMG00000128805	ENST00000505459.1:c.243A>G	chr5.hg19:g.112200371A>G		99.0	0.0	.		105.0	46.0	.	NM_001204196	B2R4E9|D6RCQ5|Q05D77|Q96FG6	Missense_Mutation	SNP	ENST00000505459.1	hg19	CCDS4108.1	.	.	.	.	.	.	.	.	.	.	A	12.12	1.841718	0.32513	.	.	ENSG00000153037	ENST00000515463	.	.	.	5.81	2.02	0.26589	.	.	.	.	.	T	0.38585	0.1046	.	.	.	0.22511	N	0.999035	.	.	.	.	.	.	T	0.36383	-0.9750	5	0.87932	D	0	3.1809	4.3944	0.11356	0.6417:0.0:0.2229:0.1354	.	.	.	.	G	56	.	ENSP00000425562:E56G	E	+	2	0	SRP19	112228270	0.997000	0.39634	1.000000	0.80357	0.994000	0.84299	0.495000	0.22483	0.107000	0.17824	0.454000	0.30748	GAG	.	.	.	none		0.408	SRP19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250737.3	NM_003135	
FOXF2	2295	hgsc.bcm.edu	37	6	1390675	1390675	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr6:1390675C>G	ENST00000259806.1	+	1	607	c.493C>G	c.(493-495)Ctc>Gtc	p.L165V		NM_001452.1	NP_001443.1	Q12947	FOXF2_HUMAN	forkhead box F2	165					embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digestive tract development (GO:0048566)|epithelial to mesenchymal transition (GO:0001837)|establishment of planar polarity of embryonic epithelium (GO:0042249)|extracellular matrix organization (GO:0030198)|genitalia development (GO:0048806)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			large_intestine(2)|lung(5)|prostate(1)	8	Ovarian(93;0.0733)	all_lung(73;0.0713)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.095)		GCCTAAGGGCCTCGGGCGGCC	0.682																																					p.L165V		Atlas-SNP	.											.	FOXF2	28	.	0			c.C493G						PASS	.						47.0	56.0	53.0					6																	1390675		2202	4300	6502	SO:0001583	missense	2295	exon1			AAGGGCCTCGGGC	U13220	CCDS4472.1	6p25.3	2008-04-10			ENSG00000137273	ENSG00000137273		"""Forkhead boxes"""	3810	protein-coding gene	gene with protein product		603250		FKHL6		9799607, 7957066	Standard	NM_001452		Approved	FREAC2	uc003mtm.3	Q12947	OTTHUMG00000016243	ENST00000259806.1:c.493C>G	chr6.hg19:g.1390675C>G	ENSP00000259806:p.Leu165Val	155.0	0.0	.		162.0	66.0	.	NM_001452	Q5TGJ1|Q9UQ85	Missense_Mutation	SNP	ENST00000259806.1	hg19	CCDS4472.1	.	.	.	.	.	.	.	.	.	.	C	18.65	3.669525	0.67814	.	.	ENSG00000137273	ENST00000259806	D	0.95377	-3.69	4.53	2.67	0.31697	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.000000	0.64402	D	0.000003	D	0.85767	0.5773	N	0.10916	0.065	0.50632	D	0.999889	P	0.46064	0.872	P	0.51918	0.684	T	0.82733	-0.0311	10	0.17832	T	0.49	.	7.1657	0.25689	0.2936:0.6205:0.0:0.0859	.	165	Q12947	FOXF2_HUMAN	V	165	ENSP00000259806:L165V	ENSP00000259806:L165V	L	+	1	0	FOXF2	1335674	0.998000	0.40836	0.997000	0.53966	0.974000	0.67602	3.613000	0.54152	0.901000	0.36495	0.536000	0.68110	CTC	.	.	.	none		0.682	FOXF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043558.1		
GMPR	2766	hgsc.bcm.edu	37	6	16254914	16254914	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr6:16254914T>A	ENST00000259727.4	+	4	527	c.413T>A	c.(412-414)tTt>tAt	p.F138Y		NM_006877.3	NP_006868.3	P36959	GMPR1_HUMAN	guanosine monophosphate reductase	138					nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide metabolic process (GO:0009117)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to cold (GO:0009409)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|GMP reductase complex (GO:1902560)	GMP reductase activity (GO:0003920)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)	20	Breast(50;0.0427)|Ovarian(93;0.103)	all_hematologic(90;0.0895)				TCAGAACATTTTGTGGAATTC	0.443																																					p.F138Y		Atlas-SNP	.											.	GMPR	44	.	0			c.T413A						PASS	.						198.0	185.0	190.0					6																	16254914		2203	4300	6503	SO:0001583	missense	2766	exon4			AACATTTTGTGGA		CCDS4537.1	6p23	2009-07-10			ENSG00000137198	ENSG00000137198	1.7.1.7		4376	protein-coding gene	gene with protein product		139265				2194676	Standard	NM_006877		Approved		uc003nbs.3	P36959	OTTHUMG00000014302	ENST00000259727.4:c.413T>A	chr6.hg19:g.16254914T>A	ENSP00000259727:p.Phe138Tyr	169.0	0.0	.		199.0	94.0	.	NM_006877	Q96HQ6	Missense_Mutation	SNP	ENST00000259727.4	hg19	CCDS4537.1	.	.	.	.	.	.	.	.	.	.	T	33	5.251862	0.95336	.	.	ENSG00000137198	ENST00000259727	T	0.78595	-1.19	5.65	5.65	0.86999	Aldolase-type TIM barrel (1);IMP dehydrogenase/GMP reductase (1);	0.000000	0.85682	D	0.000000	D	0.89125	0.6626	H	0.95611	3.695	0.80722	D	1	P	0.46784	0.884	P	0.58391	0.838	D	0.92062	0.5657	10	0.87932	D	0	5.8785	15.8909	0.79296	0.0:0.0:0.0:1.0	.	138	P36959	GMPR1_HUMAN	Y	138	ENSP00000259727:F138Y	ENSP00000259727:F138Y	F	+	2	0	GMPR	16362893	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.680000	0.84062	2.146000	0.66826	0.533000	0.62120	TTT	.	.	.	none		0.443	GMPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039942.2		
RBM24	221662	hgsc.bcm.edu	37	6	17292212	17292212	+	Silent	SNP	G	G	A			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr6:17292212G>A	ENST00000379052.5	+	4	809	c.573G>A	c.(571-573)ggG>ggA	p.G191G	RBM24_ENST00000425446.2_Silent_p.G133G|RBM24_ENST00000318204.5_Silent_p.G146G|RBM24_ENST00000508508.1_3'UTR	NM_001143942.1	NP_001137414.1	Q9BX46	RBM24_HUMAN	RNA binding motif protein 24	191	Ala-rich.				cell differentiation (GO:0030154)|regulation of mRNA stability (GO:0043488)|regulation of myotube differentiation (GO:0010830)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)			endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(1)	13	Breast(50;0.0615)|Ovarian(93;0.0733)	all_hematologic(90;0.062)	all cancers(50;0.131)|Epithelial(50;0.15)			TTACTGCTGGGGGCTATGGCT	0.642																																					p.G191G		Atlas-SNP	.											.	RBM24	40	.	0			c.G573A						PASS	.						16.0	17.0	16.0					6																	17292212		2195	4295	6490	SO:0001819	synonymous_variant	221662	exon4			TGCTGGGGGCTAT	BC040928	CCDS4538.1, CCDS47378.1, CCDS47379.1	6p22.3	2013-02-12	2004-04-23	2004-04-23	ENSG00000112183	ENSG00000112183		"""RNA binding motif (RRM) containing"""	21539	protein-coding gene	gene with protein product			"""RNA-binding region (RNP1, RRM) containing 6"""	RNPC6			Standard	NM_153020		Approved	FLJ30829, dJ259A10.1	uc003nbz.4	Q9BX46	OTTHUMG00000014306	ENST00000379052.5:c.573G>A	chr6.hg19:g.17292212G>A		31.0	0.0	.		30.0	10.0	.	NM_001143942	E9PAY4|Q6QDA4|Q8N9D3|Q96NI3	Silent	SNP	ENST00000379052.5	hg19	CCDS47378.1	.	.	.	.	.	.	.	.	.	.	G	1.218	-0.627857	0.03610	.	.	ENSG00000112183	ENST00000503965	T	0.24723	1.84	5.66	1.6	0.23607	.	0.052843	0.64402	D	0.000001	T	0.08537	0.0212	.	.	.	0.80722	D	1	B;B	0.17667	0.023;0.023	B;B	0.18871	0.023;0.023	T	0.09862	-1.0655	9	0.32370	T	0.25	-31.6851	11.5655	0.50802	0.0677:0.4891:0.4432:0.0	.	90;105	B7Z6B4;B7Z6B7	.;.	E	156	ENSP00000421971:G156E	ENSP00000421971:G156E	G	+	2	0	RBM24	17400191	0.982000	0.34865	0.998000	0.56505	0.622000	0.37654	0.135000	0.15952	0.303000	0.22785	0.655000	0.94253	GGG	.	.	.	none		0.642	RBM24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039946.2	NM_153020	
DDX43	55510	hgsc.bcm.edu	37	6	74119027	74119027	+	Silent	SNP	G	G	A			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr6:74119027G>A	ENST00000370336.4	+	10	1394	c.1236G>A	c.(1234-1236)aaG>aaA	p.K412K	DDX43_ENST00000479773.1_3'UTR	NM_018665.2	NP_061135.2	Q9NXZ2	DDX43_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 43	412	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			NS(1)|breast(2)|central_nervous_system(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	24						AGATAATGAAGATTTTGTTAG	0.393																																					p.K412K		Atlas-SNP	.											.	DDX43	69	.	0			c.G1236A						PASS	.						216.0	203.0	207.0					6																	74119027		2203	4300	6503	SO:0001819	synonymous_variant	55510	exon10			AATGAAGATTTTG		CCDS4977.1	6q13	2014-01-21			ENSG00000080007	ENSG00000080007		"""DEAD-boxes"""	18677	protein-coding gene	gene with protein product	"""cancer/testis antigen 13"""	606286				10919659	Standard	NM_018665		Approved	HAGE, DKFZp434H2114, CT13	uc003pgw.3	Q9NXZ2	OTTHUMG00000015033	ENST00000370336.4:c.1236G>A	chr6.hg19:g.74119027G>A		203.0	0.0	.		204.0	102.0	.	NM_018665	B4E0C8|Q6NXR1	Silent	SNP	ENST00000370336.4	hg19	CCDS4977.1																																																																																			.	.	.	none		0.393	DDX43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041219.3	NM_018665	
AMD1	262	hgsc.bcm.edu	37	6	111213404	111213404	+	Silent	SNP	T	T	C			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr6:111213404T>C	ENST00000368885.3	+	5	804	c.468T>C	c.(466-468)tgT>tgC	p.C156C	AMD1_ENST00000451850.2_Intron|AMD1_ENST00000368882.3_Silent_p.C8C|AMD1_ENST00000368876.1_Silent_p.C87C|AMD1_ENST00000368877.5_Silent_p.C127C	NM_001634.4	NP_001625.2	P17707	DCAM_HUMAN	adenosylmethionine decarboxylase 1	156					cellular nitrogen compound metabolic process (GO:0034641)|polyamine metabolic process (GO:0006595)|S-adenosylmethioninamine biosynthetic process (GO:0006557)|small molecule metabolic process (GO:0044281)|spermidine biosynthetic process (GO:0008295)|spermine biosynthetic process (GO:0006597)	cytosol (GO:0005829)	adenosylmethionine decarboxylase activity (GO:0004014)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(2)	8		all_cancers(87;3.83e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0209)		OV - Ovarian serous cystadenocarcinoma(136;0.0522)|Epithelial(106;0.111)|all cancers(137;0.143)	S-Adenosylmethionine(DB00118)	ATTCTGACTGTTGGTATGTTT	0.308																																					p.C156C		Atlas-SNP	.											.	AMD1	23	.	0			c.T468C						PASS	.						309.0	287.0	294.0					6																	111213404		2203	4300	6503	SO:0001819	synonymous_variant	262	exon5			TGACTGTTGGTAT	M88006	CCDS5086.1, CCDS75504.1, CCDS75505.1	6q21	2014-05-13			ENSG00000123505	ENSG00000123505	4.1.1.50		457	protein-coding gene	gene with protein product		180980	"""S-adenosylmethionine decarboxylase 1"""				Standard	NM_001634		Approved	SAMDC	uc003puk.1	P17707	OTTHUMG00000015369	ENST00000368885.3:c.468T>C	chr6.hg19:g.111213404T>C		308.0	0.0	.		337.0	170.0	.	NM_001634	E1P5F7|Q5VXN4|Q5VXN6|Q9BWK4	Silent	SNP	ENST00000368885.3	hg19	CCDS5086.1																																																																																			.	.	.	none		0.308	AMD1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041816.1		
SLC2A12	154091	hgsc.bcm.edu	37	6	134350343	134350343	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr6:134350343C>A	ENST00000275230.5	-	2	775	c.620G>T	c.(619-621)gGa>gTa	p.G207V		NM_145176.2	NP_660159.1	Q8TD20	GTR12_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 12	207					glucose transport (GO:0015758)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			NS(1)|breast(1)|large_intestine(6)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	17	Breast(56;0.214)|Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0101)|GBM - Glioblastoma multiforme(68;0.0123)		TTGCAAAACTCCCAAGGGAAT	0.428																																					p.G207V	Melanoma(122;1663 1672 14489 35294 41228)	Atlas-SNP	.											.	SLC2A12	43	.	0			c.G620T						PASS	.						88.0	89.0	89.0					6																	134350343		2203	4300	6503	SO:0001583	missense	154091	exon2			AAAACTCCCAAGG	AL035699	CCDS5169.1	6q23.2	2013-05-22			ENSG00000146411	ENSG00000146411		"""Solute carriers"""	18067	protein-coding gene	gene with protein product		610372				11780753, 11832379	Standard	XM_006715349		Approved	GLUT12, GLUT8	uc003qem.1	Q8TD20	OTTHUMG00000015611	ENST00000275230.5:c.620G>T	chr6.hg19:g.134350343C>A	ENSP00000275230:p.Gly207Val	119.0	0.0	.		155.0	9.0	.	NM_145176	B3KV17|Q7Z6U3|Q96MR8	Missense_Mutation	SNP	ENST00000275230.5	hg19	CCDS5169.1	.	.	.	.	.	.	.	.	.	.	C	17.59	3.427056	0.62733	.	.	ENSG00000146411	ENST00000275230	T	0.74315	-0.83	5.4	5.4	0.78164	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.054326	0.85682	D	0.000000	T	0.75295	0.3830	L	0.52011	1.625	0.80722	D	1	D	0.52996	0.957	P	0.58172	0.834	T	0.77621	-0.2519	10	0.59425	D	0.04	-13.7225	14.7476	0.69499	0.0:0.8556:0.1444:0.0	.	207	Q8TD20	GTR12_HUMAN	V	207	ENSP00000275230:G207V	ENSP00000275230:G207V	G	-	2	0	SLC2A12	134392036	1.000000	0.71417	0.991000	0.47740	0.961000	0.63080	6.163000	0.71880	2.542000	0.85734	0.467000	0.42956	GGA	.	.	.	none		0.428	SLC2A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042302.1		
DYNC1I1	1780	hgsc.bcm.edu	37	7	95668696	95668696	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr7:95668696C>T	ENST00000324972.6	+	14	1716	c.1523C>T	c.(1522-1524)tCa>tTa	p.S508L	DYNC1I1_ENST00000497626.1_3'UTR|DYNC1I1_ENST00000359388.4_Missense_Mutation_p.S471L|DYNC1I1_ENST00000457059.1_Missense_Mutation_p.S491L|DYNC1I1_ENST00000537881.1_Missense_Mutation_p.S471L|DYNC1I1_ENST00000437599.1_Missense_Mutation_p.S488L|DYNC1I1_ENST00000447467.2_Missense_Mutation_p.S491L	NM_004411.4	NP_004402.1	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	508					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|metabolic process (GO:0008152)|vesicle transport along microtubule (GO:0047496)	cytoplasmic dynein complex (GO:0005868)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)|spectrin binding (GO:0030507)			NS(2)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(27)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	54	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			TTTGTCACATCATCATTTGAC	0.448																																					p.S508L		Atlas-SNP	.											.	DYNC1I1	111	.	0			c.C1523T						PASS	.						127.0	114.0	118.0					7																	95668696		2203	4300	6503	SO:0001583	missense	1780	exon14			TCACATCATCATT	AF063228	CCDS5644.1, CCDS47645.1, CCDS47646.1, CCDS64718.1	7q21.3-q22.1	2013-01-18	2005-11-24	2005-11-24	ENSG00000158560	ENSG00000158560		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2963	protein-coding gene	gene with protein product		603772	"""dynein, cytoplasmic, intermediate polypeptide 1"""	DNCI1		10049579, 16260502	Standard	NM_004411		Approved	DNCIC1	uc003uoc.4	O14576	OTTHUMG00000153983	ENST00000324972.6:c.1523C>T	chr7.hg19:g.95668696C>T	ENSP00000320130:p.Ser508Leu	118.0	0.0	.		184.0	123.0	.	NM_004411	B4DME3|F5H050|G5E9K1|Q8TBF7|Q9Y2X1	Missense_Mutation	SNP	ENST00000324972.6	hg19	CCDS5644.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.849383	0.91277	.	.	ENSG00000158560	ENST00000447467;ENST00000324972;ENST00000537881;ENST00000437599;ENST00000359388;ENST00000457059	T;T;T;T;T;T	0.62105	0.05;0.05;0.05;0.05;0.05;0.05	4.27	4.27	0.50696	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.85936	0.5813	H	0.96805	3.885	0.80722	D	1	D;D;D;D;D	0.76494	0.998;0.998;0.998;0.998;0.999	D;D;D;D;D	0.79784	0.993;0.988;0.988;0.993;0.988	D	0.90105	0.4187	10	0.54805	T	0.06	-8.2427	18.0108	0.89222	0.0:1.0:0.0:0.0	.	491;488;491;508;471	Q7Z6M0;G5E9K1;O14576-2;O14576;O14576-3	.;.;.;DC1I1_HUMAN;.	L	491;508;471;488;471;491	ENSP00000392337:S491L;ENSP00000320130:S508L;ENSP00000438377:S471L;ENSP00000398118:S488L;ENSP00000352348:S471L;ENSP00000412444:S491L	ENSP00000320130:S508L	S	+	2	0	DYNC1I1	95506632	1.000000	0.71417	0.936000	0.37596	0.939000	0.58152	7.609000	0.82925	2.666000	0.90696	0.557000	0.71058	TCA	.	.	.	none		0.448	DYNC1I1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333432.1	NM_004411	
DLX5	1749	hgsc.bcm.edu	37	7	96651541	96651541	+	Missense_Mutation	SNP	C	C	G	rs376488297		TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr7:96651541C>G	ENST00000222598.4	-	2	969	c.496G>C	c.(496-498)Gaa>Caa	p.E166Q	DLX5_ENST00000486603.2_Missense_Mutation_p.E166Q|DLX5_ENST00000493764.1_5'UTR	NM_005221.5	NP_005212.1	P56178	DLX5_HUMAN	distal-less homeobox 5	166					anatomical structure formation involved in morphogenesis (GO:0048646)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell proliferation (GO:0008283)|cellular response to BMP stimulus (GO:0071773)|embryonic limb morphogenesis (GO:0030326)|endochondral ossification (GO:0001958)|epithelial cell differentiation (GO:0030855)|face morphogenesis (GO:0060325)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|olfactory pit development (GO:0060166)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)	20	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					TCGGCGCGTTCCGGCAAGGCG	0.542																																					p.E166Q		Atlas-SNP	.											.	DLX5	52	.	0			c.G496C						PASS	.						101.0	102.0	101.0					7																	96651541		2203	4300	6503	SO:0001583	missense	1749	exon2			CGCGTTCCGGCAA		CCDS5647.1	7q21.3	2011-06-20	2005-12-22		ENSG00000105880	ENSG00000105880		"""Homeoboxes / ANTP class : NKL subclass"""	2918	protein-coding gene	gene with protein product		600028	"""distal-less homeo box 5"""			7907794	Standard	XM_005250185		Approved		uc003uon.3	P56178	OTTHUMG00000154200	ENST00000222598.4:c.496G>C	chr7.hg19:g.96651541C>G	ENSP00000222598:p.Glu166Gln	231.0	0.0	.		296.0	59.0	.	NM_005221	B7Z4P3|Q9UPL1	Missense_Mutation	SNP	ENST00000222598.4	hg19	CCDS5647.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.931253	0.92389	.	.	ENSG00000105880	ENST00000222598	D	0.96200	-3.94	5.41	5.41	0.78517	Homeobox, eukaryotic (1);Homeodomain-related (1);Helix-turn-helix motif, lambda-like repressor (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.96815	0.8960	L	0.47078	1.49	0.80722	D	1	D;D	0.71674	0.966;0.998	P;D	0.76575	0.789;0.988	D	0.97186	0.9854	10	0.87932	D	0	-9.535	18.9868	0.92773	0.0:1.0:0.0:0.0	.	166;166	B7Z4P3;P56178	.;DLX5_HUMAN	Q	166	ENSP00000222598:E166Q	ENSP00000222598:E166Q	E	-	1	0	DLX5	96489477	1.000000	0.71417	0.968000	0.41197	0.708000	0.40852	7.582000	0.82546	2.816000	0.96949	0.563000	0.77884	GAA	.	.	.	alt		0.542	DLX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334371.2		
STAG3	10734	hgsc.bcm.edu	37	7	99800113	99800113	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr7:99800113T>C	ENST00000426455.1	+	25	3007	c.2600T>C	c.(2599-2601)cTa>cCa	p.L867P	GATS_ENST00000436886.2_3'UTR|GATS_ENST00000543273.1_RNA|STAG3_ENST00000317296.5_Missense_Mutation_p.L867P|STAG3_ENST00000394018.2_Missense_Mutation_p.L809P|STAG3_ENST00000440830.1_3'UTR	NM_001282716.1	NP_001269645.1	Q9UJ98	STAG3_HUMAN	stromal antigen 3	867					chromosome segregation (GO:0007059)|synaptonemal complex assembly (GO:0007130)	chromosome, centromeric region (GO:0000775)|extracellular space (GO:0005615)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleolus (GO:0005730)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)|transverse filament (GO:0000802)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(11)|lung(30)|ovary(5)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	66	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					ATAGAGCGGCTACACCAGCGG	0.512																																					p.L867P		Atlas-SNP	.											.	STAG3	121	.	0			c.T2600C						PASS	.						106.0	113.0	110.0					7																	99800113		2203	4300	6503	SO:0001583	missense	10734	exon25			AGCGGCTACACCA	AJ007798	CCDS34703.1, CCDS64730.1, CCDS75642.1	7q22	2008-02-01			ENSG00000066923	ENSG00000066923			11356	protein-coding gene	gene with protein product		608489				10698974	Standard	XM_005250116		Approved		uc003utx.1	Q9UJ98	OTTHUMG00000155183	ENST00000426455.1:c.2600T>C	chr7.hg19:g.99800113T>C	ENSP00000400359:p.Leu867Pro	254.0	0.0	.		382.0	242.0	.	NM_012447	A6H8Z1|B4DZ10|D6W5U8|H7BYK9|Q8NDP3	Missense_Mutation	SNP	ENST00000426455.1	hg19	CCDS34703.1	.	.	.	.	.	.	.	.	.	.	.	20.4	3.986379	0.74589	.	.	ENSG00000066923	ENST00000426455;ENST00000394018;ENST00000317296	T;T;T	0.33865	1.39;1.42;1.39	5.03	5.03	0.67393	.	0.000000	0.39544	N	0.001333	T	0.61148	0.2324	M	0.81497	2.545	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.87578	0.997;0.998;0.976	T	0.66658	-0.5868	10	0.87932	D	0	-8.8042	12.7629	0.57374	0.0:0.0:0.0:1.0	.	809;867;867	B4DZ10;D6W5U7;Q9UJ98	.;.;STAG3_HUMAN	P	867;809;867	ENSP00000400359:L867P;ENSP00000377586:L809P;ENSP00000319318:L867P	ENSP00000319318:L867P	L	+	2	0	STAG3	99638049	0.998000	0.40836	0.999000	0.59377	0.806000	0.45545	7.178000	0.77657	2.122000	0.65172	0.460000	0.39030	CTA	.	.	.	none		0.512	STAG3-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338734.2	NM_012447	
PSMC2	5701	hgsc.bcm.edu	37	7	103002482	103002482	+	Silent	SNP	G	G	T			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr7:103002482G>T	ENST00000435765.1	+	6	780	c.369G>T	c.(367-369)gtG>gtT	p.V123V	SLC26A5_ENST00000356767.4_Intron|PSMC2_ENST00000292644.3_Silent_p.V123V|PSMC2_ENST00000544811.1_5'UTR|SLC26A5_ENST00000339444.6_Intron|SLC26A5_ENST00000393735.2_Intron	NM_002803.3	NP_002794.1	P35998	PRS7_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 2	123					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|osteoblast differentiation (GO:0001649)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	21						AGTTTGTGGTGGACCTTAGTG	0.383																																					p.V123V		Atlas-SNP	.											.	PSMC2	38	.	0			c.G369T						PASS	.						156.0	143.0	148.0					7																	103002482		2203	4300	6503	SO:0001819	synonymous_variant	5701	exon5			TGTGGTGGACCTT	D11094	CCDS5731.1	7q22.1-q22.3	2010-04-21			ENSG00000161057	ENSG00000161057		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9548	protein-coding gene	gene with protein product	"""proteasome 26S subunit, ATPase, 2"", ""mammalian suppressor of sgv-1 of yeast"", ""protease 26S subunit 7"", ""putative protein product of Nbla10058"""	154365				9473509, 1377363	Standard	NM_002803		Approved	MSS1, S7, Nbla10058	uc003vbs.3	P35998	OTTHUMG00000157206	ENST00000435765.1:c.369G>T	chr7.hg19:g.103002482G>T		102.0	0.0	.		170.0	60.0	.	NM_001204453	A4D0Q1|B7Z5E2|Q3LIA5|Q9UDI3	Silent	SNP	ENST00000435765.1	hg19	CCDS5731.1																																																																																			.	.	.	none		0.383	PSMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347922.1	NM_002803	
WEE2	494551	hgsc.bcm.edu	37	7	141408685	141408685	+	Nonsense_Mutation	SNP	A	A	T			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr7:141408685A>T	ENST00000397541.2	+	1	533	c.127A>T	c.(127-129)Aag>Tag	p.K43*	WEE2-AS1_ENST00000459753.1_RNA|WEE2-AS1_ENST00000465110.1_RNA|WEE2-AS1_ENST00000462383.1_RNA|WEE2-AS1_ENST00000478332.1_RNA|WEE2-AS1_ENST00000488785.1_RNA|WEE2-AS1_ENST00000471512.1_RNA|WEE2-AS1_ENST00000495800.1_RNA	NM_001105558.1	NP_001099028.1	P0C1S8	WEE2_HUMAN	WEE1 homolog 2 (S. pombe)	43					female meiotic division (GO:0007143)|female pronucleus assembly (GO:0035038)|mitotic nuclear division (GO:0007067)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of oocyte maturation (GO:1900194)|regulation of meiosis I (GO:0060631)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(2)|stomach(1)	31	Melanoma(164;0.0171)					AACCCCAGAGAAGGGTGAAGT	0.473																																					p.K43X		Atlas-SNP	.											.	WEE2	59	.	0			c.A127T						PASS	.						167.0	168.0	167.0					7																	141408685		1953	4139	6092	SO:0001587	stop_gained	494551	exon1			CCAGAGAAGGGTG	AK131218	CCDS43660.1	7q32	2008-07-02			ENSG00000214102	ENSG00000214102			19684	protein-coding gene	gene with protein product		614084					Standard	NM_001105558		Approved	FLJ16107	uc003vwn.2	P0C1S8	OTTHUMG00000157536	ENST00000397541.2:c.127A>T	chr7.hg19:g.141408685A>T	ENSP00000380675:p.Lys43*	265.0	0.0	.		341.0	193.0	.	NM_001105558		Nonsense_Mutation	SNP	ENST00000397541.2	hg19	CCDS43660.1	.	.	.	.	.	.	.	.	.	.	a	36	5.620662	0.96660	.	.	ENSG00000214102	ENST00000397541	.	.	.	4.78	-2.3	0.06785	.	1.588760	0.04251	U	0.338596	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.0729	2.105	0.03688	0.4246:0.2574:0.07:0.2479	.	.	.	.	X	43	.	ENSP00000380675:K43X	K	+	1	0	WEE2	141055154	0.000000	0.05858	0.000000	0.03702	0.044000	0.14063	0.169000	0.16641	-0.353000	0.08224	-0.255000	0.11280	AAG	.	.	.	none		0.473	WEE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349091.1	NM_001105558	
KAT6A	7994	hgsc.bcm.edu	37	8	41794928	41794928	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr8:41794928C>A	ENST00000396930.3	-	17	3741	c.3198G>T	c.(3196-3198)gaG>gaT	p.E1066D	KAT6A_ENST00000265713.2_Missense_Mutation_p.E1066D|KAT6A_ENST00000406337.1_Missense_Mutation_p.E1066D	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	1066					aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										CTTCATCGATCTCAAACGTGG	0.433																																					p.E1066D		Atlas-SNP	.											.	.	.	.	0			c.G3198T						PASS	.						125.0	120.0	122.0					8																	41794928		2203	4300	6503	SO:0001583	missense	7994	exon17			ATCGATCTCAAAC	U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.3198G>T	chr8.hg19:g.41794928C>A	ENSP00000380136:p.Glu1066Asp	175.0	0.0	.		157.0	64.0	.	NM_001099412	Q76L81	Missense_Mutation	SNP	ENST00000396930.3	hg19	CCDS6124.1	.	.	.	.	.	.	.	.	.	.	C	13.09	2.132187	0.37630	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930;ENST00000418721	T;T;T	0.62105	0.05;0.05;0.05	5.63	-1.75	0.08031	.	0.000000	0.64402	D	0.000004	T	0.64271	0.2583	M	0.63843	1.955	0.26390	N	0.976585	D	0.67145	0.996	P	0.54759	0.76	T	0.62812	-0.6775	10	0.24483	T	0.36	-25.1078	12.5465	0.56203	0.0:0.464:0.0:0.536	.	1066	Q92794	KAT6A_HUMAN	D	1066;1066;1066;646	ENSP00000265713:E1066D;ENSP00000385888:E1066D;ENSP00000380136:E1066D	ENSP00000265713:E1066D	E	-	3	2	KAT6A	41914085	0.998000	0.40836	0.955000	0.39395	0.909000	0.53808	0.458000	0.21892	-0.247000	0.09597	0.650000	0.86243	GAG	.	.	.	none		0.433	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318163.1	NM_006766	
SLURP1	57152	hgsc.bcm.edu	37	8	143822661	143822661	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr8:143822661C>A	ENST00000246515.1	-	3	237	c.212G>T	c.(211-213)cGc>cTc	p.R71L		NM_020427.2	NP_065160.1	P55000	SLUR1_HUMAN	secreted LY6/PLAUR domain containing 1	71	UPAR/Ly6.		R -> H (in MDM; reduced expression of the protein). {ECO:0000269|PubMed:17008884}.		cell activation (GO:0001775)|cell adhesion (GO:0007155)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cytokine activity (GO:0005125)			breast(1)|lung(7)|ovary(1)	9	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					GGAGCAGGAGCGGGTCACCAC	0.657																																					p.R71L		Atlas-SNP	.											SLURP1,NS,carcinoma,0,1	SLURP1	16	.	0			c.G212T	GRCh37	CM070268	SLURP1	M		PASS	.						55.0	53.0	54.0					8																	143822661		2202	4296	6498	SO:0001583	missense	57152	exon3			CAGGAGCGGGTCA	AY579080	CCDS6387.1	8q24.3	2004-11-16			ENSG00000126233	ENSG00000126233			18746	protein-coding gene	gene with protein product	"""lymphocyte antigen 6-like secreted"", ""ARS component B"""	606119				11285253, 10211827	Standard	NM_020427		Approved	ARS, ANUP, MDM, ArsB, LY6LS	uc003ywy.3	P55000	OTTHUMG00000164685	ENST00000246515.1:c.212G>T	chr8.hg19:g.143822661C>A	ENSP00000246515:p.Arg71Leu	23.0	0.0	.		36.0	2.0	.	NM_020427	Q53YJ6|Q6PUA6|Q92483	Missense_Mutation	SNP	ENST00000246515.1	hg19	CCDS6387.1	.	.	.	.	.	.	.	.	.	.	C	17.36	3.370708	0.61624	.	.	ENSG00000126233	ENST00000246515	T	0.73897	-0.79	3.76	1.84	0.25277	Ly-6 antigen / uPA receptor -like (1);CD59 antigen (1);	0.390066	0.17436	N	0.174313	T	0.73536	0.3599	M	0.67953	2.075	0.29005	N	0.887223	P	0.49090	0.919	P	0.49421	0.61	T	0.67945	-0.5539	10	0.72032	D	0.01	.	4.8794	0.13672	0.0:0.6546:0.2207:0.1247	.	71	P55000	SLUR1_HUMAN	L	71	ENSP00000246515:R71L	ENSP00000246515:R71L	R	-	2	0	SLURP1	143819663	0.028000	0.19301	0.813000	0.32504	0.624000	0.37722	0.103000	0.15292	0.321000	0.23259	0.448000	0.29417	CGC	.	.	.	none		0.657	SLURP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379741.1	NM_020427	
PRSS3	5646	hgsc.bcm.edu	37	9	33797829	33797829	+	Missense_Mutation	SNP	G	G	A	rs138654302		TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr9:33797829G>A	ENST00000361005.5	+	3	374	c.374G>A	c.(373-375)cGc>cAc	p.R125H	PRSS3_ENST00000429677.3_Missense_Mutation_p.R61H|RP11-133O22.6_ENST00000454429.2_RNA|PRSS3_ENST00000342836.4_Missense_Mutation_p.R82H|PRSS3_ENST00000379405.3_Missense_Mutation_p.R68H	NM_007343.3	NP_031369	P35030	TRY3_HUMAN	protease, serine, 3	125	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|endothelial cell migration (GO:0043542)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	13			LUSC - Lung squamous cell carcinoma(29;0.0176)			CCCATCAGCCGCATCCAGGTG	0.577																																					p.R125H		Atlas-SNP	.											PRSS3_ENST00000361005,NS,carcinoma,0,2	PRSS3	79	.	0			c.G374A						PASS	.	G	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	109.0	100.0	103.0		245,182,203,374	-1.0	0.9	9	dbSNP_134	103	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	PRSS3	NM_001197097.2,NM_001197098.1,NM_002771.3,NM_007343.3	29,29,29,29	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	benign,benign,benign,benign	82/262,61/241,68/248,125/305	33797829	2,13004	2203	4300	6503	SO:0001583	missense	5646	exon3			TCAGCCGCATCCA		CCDS6545.1, CCDS47958.1, CCDS56570.1, CCDS56571.1	9p13	2010-05-07	2008-03-11		ENSG00000010438	ENSG00000010438	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9486	protein-coding gene	gene with protein product	"""mesotrypsin"""	613578	"""protease, serine, 4 (trypsin 4, brain)"", ""protease, serine, 3 (mesotrypsin)"""	PRSS4		2326201, 8294000	Standard	NM_002771		Approved	TRY3, TRY4	uc003ztj.4	P35030	OTTHUMG00000019798	ENST00000361005.5:c.374G>A	chr9.hg19:g.33797829G>A	ENSP00000354280:p.Arg125His	94.0	1.0	.		131.0	41.0	.	NM_007343	A8CED1|A8CED3|A9Z1Y4|E7ES07|F8W7P3|P15951|Q15665|Q5VXV0|Q6ISJ4|Q9UQV3	Missense_Mutation	SNP	ENST00000361005.5	hg19	CCDS47958.1	.	.	.	.	.	.	.	.	.	.	G	8.689	0.906916	0.17833	2.27E-4	1.16E-4	ENSG00000010438	ENST00000361005;ENST00000457896;ENST00000342836;ENST00000429677;ENST00000379405	D;D;D;D;D	0.88896	-2.44;-2.44;-2.44;-2.44;-2.44	3.38	-1.0	0.10196	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.193106	0.56097	N	0.000021	T	0.80210	0.4581	L	0.35644	1.08	0.39352	D	0.965773	B;B;B	0.21520	0.006;0.057;0.006	B;B;B	0.20184	0.009;0.028;0.007	T	0.66532	-0.5900	10	0.40728	T	0.16	.	8.2506	0.31715	0.4318:0.0:0.5682:0.0	.	68;125;82	P35030-3;P35030;P35030-4	.;TRY3_HUMAN;.	H	125;80;82;61;68	ENSP00000354280:R125H;ENSP00000401249:R80H;ENSP00000340889:R82H;ENSP00000401828:R61H;ENSP00000368715:R68H	ENSP00000340889:R82H	R	+	2	0	PRSS3	33787829	0.962000	0.33011	0.872000	0.34217	0.074000	0.17049	2.182000	0.42556	-0.172000	0.10779	-0.671000	0.03813	CGC	.	G|1.000;A|0.000	0.000	weak		0.577	PRSS3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052121.1	NM_002771	
CCIN	881	hgsc.bcm.edu	37	9	36169599	36169599	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr9:36169599G>A	ENST00000335119.2	+	1	211	c.100G>A	c.(100-102)Gtg>Atg	p.V34M		NM_005893.2	NP_005884.2	Q13939	CALI_HUMAN	calicin	34	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				breast(3)|endometrium(2)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(4)	21			STAD - Stomach adenocarcinoma(86;0.228)			GGCCCTGAGTGTGGACAACCA	0.502																																					p.V34M		Atlas-SNP	.											.	CCIN	56	.	0			c.G100A						PASS	.						164.0	154.0	157.0					9																	36169599		2203	4300	6503	SO:0001583	missense	881	exon1			CTGAGTGTGGACA	Z46967	CCDS6599.1	9p13.1	2013-10-02			ENSG00000185972	ENSG00000185972		"""BTB/POZ domain containing"""	1568	protein-coding gene	gene with protein product		603960				7641791	Standard	NM_005893		Approved	KBTBD14, BTBD20	uc003zzb.4	Q13939	OTTHUMG00000019901	ENST00000335119.2:c.100G>A	chr9.hg19:g.36169599G>A	ENSP00000334996:p.Val34Met	67.0	0.0	.		101.0	10.0	.	NM_005893	Q9BXG7	Missense_Mutation	SNP	ENST00000335119.2	hg19	CCDS6599.1	.	.	.	.	.	.	.	.	.	.	G	15.93	2.977645	0.53720	.	.	ENSG00000185972	ENST00000335119	T	0.77750	-1.12	5.69	5.69	0.88448	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.50627	D	0.000116	D	0.90508	0.7026	M	0.92367	3.3	0.36717	D	0.880964	D	0.67145	0.996	D	0.81914	0.995	D	0.94029	0.7299	10	0.87932	D	0	.	15.3016	0.73955	0.0:0.0:1.0:0.0	.	34	Q13939	CALI_HUMAN	M	34	ENSP00000334996:V34M	ENSP00000334996:V34M	V	+	1	0	CCIN	36159599	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	5.496000	0.66918	2.690000	0.91761	0.561000	0.74099	GTG	.	.	.	none		0.502	CCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052418.1	NM_005893	
PTCH1	5727	hgsc.bcm.edu	37	9	98229471	98229471	+	Silent	SNP	C	C	A			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr9:98229471C>A	ENST00000331920.6	-	15	2786	c.2487G>T	c.(2485-2487)gtG>gtT	p.V829V	PTCH1_ENST00000375274.2_Silent_p.V828V|PTCH1_ENST00000418258.1_Silent_p.V678V|PTCH1_ENST00000429896.2_Silent_p.V678V|PTCH1_ENST00000421141.1_Silent_p.V678V|PTCH1_ENST00000430669.2_Silent_p.V763V|PTCH1_ENST00000437951.1_Silent_p.V763V	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	829			V -> M (in squamous cell carcinoma). {ECO:0000269|PubMed:11286632}.		brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)			NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				TGACATACTTCACGTTACTGA	0.448																																					p.V829V		Atlas-SNP	.											.	PTCH1	1850	.	0			c.G2487T						PASS	.						168.0	154.0	159.0					9																	98229471		2203	4300	6503	SO:0001819	synonymous_variant	5727	exon15			ATACTTCACGTTA	AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.2487G>T	chr9.hg19:g.98229471C>A		118.0	0.0	.		152.0	64.0	.	NM_000264	A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Silent	SNP	ENST00000331920.6	hg19	CCDS6714.1																																																																																			.	.	.	none		0.448	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053229.2	NM_000264	
TMEM246	84302	hgsc.bcm.edu	37	9	104238602	104238602	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr9:104238602T>C	ENST00000374851.1	-	4	1920	c.773A>G	c.(772-774)gAg>gGg	p.E258G	RP11-490D19.6_ENST00000450109.1_RNA|TMEM246_ENST00000374847.1_Missense_Mutation_p.E258G|RP11-490D19.6_ENST00000424154.1_RNA|RP11-490D19.6_ENST00000425734.1_RNA|TMEM246_ENST00000374848.3_Missense_Mutation_p.E258G|RP11-490D19.6_ENST00000431507.1_RNA			Q9BRR3	TM246_HUMAN	transmembrane protein 246	258						integral component of membrane (GO:0016021)											CCGCATGGGCTCTGGATTGAT	0.557																																					p.E258G		Atlas-SNP	.											.	.	.	.	0			c.A773G						PASS	.						88.0	89.0	89.0					9																	104238602		2203	4300	6503	SO:0001583	missense	84302	exon2			ATGGGCTCTGGAT	BC006115	CCDS6757.1	9q31.1	2012-04-02	2012-04-02	2012-04-02	ENSG00000165152	ENSG00000165152			28180	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 125"""	C9orf125		12477932	Standard	NM_032342		Approved	MGC12992	uc004bbm.3	Q9BRR3	OTTHUMG00000020381	ENST00000374851.1:c.773A>G	chr9.hg19:g.104238602T>C	ENSP00000363984:p.Glu258Gly	152.0	0.0	.		159.0	72.0	.	NM_032342	Q49AQ4	Missense_Mutation	SNP	ENST00000374851.1	hg19	CCDS6757.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.277935	0.80692	.	.	ENSG00000165152	ENST00000374848;ENST00000374847;ENST00000374851	.	.	.	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.76849	0.4045	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.78863	-0.2036	9	0.66056	D	0.02	-17.5086	15.1322	0.72533	0.0:0.0:0.0:1.0	.	258	Q9BRR3	CI125_HUMAN	G	258	.	ENSP00000363980:E258G	E	-	2	0	C9orf125	103278423	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.770000	0.85390	2.177000	0.69029	0.455000	0.32223	GAG	.	.	.	none		0.557	TMEM246-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053444.1	NM_032342	
C5	727	hgsc.bcm.edu	37	9	123742457	123742457	+	Silent	SNP	A	A	G			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr9:123742457A>G	ENST00000223642.1	-	28	3591	c.3562T>C	c.(3562-3564)Ttg>Ctg	p.L1188L		NM_001735.2	NP_001726.2	P01031	CO5_HUMAN	complement component 5	1188					activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of macrophage chemotaxis (GO:0010760)|negative regulation of norepinephrine secretion (GO:0010700)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of chemotaxis (GO:0050921)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	chemokine activity (GO:0008009)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(14)|lung(5)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)|Intravenous Immunoglobulin(DB00028)	GAAATGGCCAATGTAAAGGTG	0.413																																					p.L1188L		Atlas-SNP	.											.	C5	124	.	0			c.T3562C						PASS	.						141.0	139.0	140.0					9																	123742457		2203	4300	6503	SO:0001819	synonymous_variant	727	exon28			TGGCCAATGTAAA	M57729	CCDS6826.1	9q33-q34	2014-09-17			ENSG00000106804	ENSG00000106804		"""Complement system"", ""Endogenous ligands"""	1331	protein-coding gene	gene with protein product	"""prepro-C5"", ""C5a anaphylatoxin"""	120900					Standard	NM_001735		Approved	CPAMD4, C5a, C5b	uc004bkv.3	P01031	OTTHUMG00000020579	ENST00000223642.1:c.3562T>C	chr9.hg19:g.123742457A>G		93.0	0.0	.		103.0	42.0	.	NM_001735	Q14CJ0|Q27I61	Silent	SNP	ENST00000223642.1	hg19	CCDS6826.1																																																																																			.	.	.	none		0.413	C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053844.1	NM_001735	
BRD3	8019	hgsc.bcm.edu	37	9	136915699	136915699	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr9:136915699C>G	ENST00000303407.7	-	5	696	c.511G>C	c.(511-513)Gtg>Ctg	p.V171L	BRD3_ENST00000357885.2_Missense_Mutation_p.V171L|BRD3_ENST00000371834.2_Missense_Mutation_p.V171L	NM_007371.3	NP_031397.1	Q15059	BRD3_HUMAN	bromodomain containing 3	171					chromatin modification (GO:0016568)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|lysine-acetylated histone binding (GO:0070577)		BRD3/C15orf55(3)	kidney(1)|skin(1)|stomach(4)	6				OV - Ovarian serous cystadenocarcinoma(145;1.43e-08)|Epithelial(140;8.41e-08)|all cancers(34;5.21e-07)		ACGGCCGCCACTTGCTGTGTA	0.607			T	C15orf55	lethal midline carcinoma of young people																																p.V171L		Atlas-SNP	.		Dom	yes		9	9q34	8019	bromodomain containing 3		E	.	BRD3	82	.	0			c.G511C						PASS	.						29.0	37.0	34.0					9																	136915699		2202	4299	6501	SO:0001583	missense	8019	exon5			CCGCCACTTGCTG		CCDS6980.1	9q34	2010-12-23	2002-01-14		ENSG00000169925	ENSG00000169925			1104	protein-coding gene	gene with protein product	"""RING3-like"""	601541	"""bromodomain-containing 3"""			7584044, 8781126	Standard	NM_007371		Approved	RING3L, ORFX, KIAA0043	uc004cew.3	Q15059	OTTHUMG00000021004	ENST00000303407.7:c.511G>C	chr9.hg19:g.136915699C>G	ENSP00000305918:p.Val171Leu	76.0	0.0	.		69.0	34.0	.	NM_007371	B1APD9|Q4G5Y3|Q5T1R7|Q8N5M3|Q92645	Missense_Mutation	SNP	ENST00000303407.7	hg19	CCDS6980.1	.	.	.	.	.	.	.	.	.	.	C	15.02	2.710248	0.48517	.	.	ENSG00000169925	ENST00000303407;ENST00000371834;ENST00000357885	T;T;T	0.46451	0.87;0.87;0.87	4.97	4.06	0.47325	.	0.269386	0.30528	N	0.009440	T	0.40791	0.1131	M	0.68952	2.095	0.31270	N	0.691828	B;B	0.12013	0.005;0.0	B;B	0.12837	0.008;0.001	T	0.43861	-0.9365	10	0.25106	T	0.35	-32.3956	13.0826	0.59121	0.0:0.9204:0.0:0.0796	.	171;171	Q15059-2;Q15059	.;BRD3_HUMAN	L	171	ENSP00000305918:V171L;ENSP00000360900:V171L;ENSP00000350557:V171L	ENSP00000305918:V171L	V	-	1	0	BRD3	135905520	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	3.505000	0.53356	1.182000	0.42928	0.561000	0.74099	GTG	.	.	.	none		0.607	BRD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055390.4	NM_007371	
KLF6	1316	hgsc.bcm.edu	37	10	3823844	3823844	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr10:3823844C>A	ENST00000497571.1	-	2	925	c.665G>T	c.(664-666)cGg>cTg	p.R222L	KLF6_ENST00000542957.1_Missense_Mutation_p.R222L|KLF6_ENST00000469435.1_Missense_Mutation_p.R222L|KLF6_ENST00000173785.4_Intron	NM_001160124.1|NM_001300.5	NP_001153596.1|NP_001291.3	Q99612	KLF6_HUMAN	Kruppel-like factor 6	222					B cell differentiation (GO:0030183)|cytokine-mediated signaling pathway (GO:0019221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|endometrium(1)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16				Colorectal(1;0.238)		TGTGTGCGTCCGCTGGTGTGC	0.677											OREG0019980	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R222L		Atlas-SNP	.											.	KLF6	38	.	0			c.G665T						PASS	.						45.0	39.0	41.0					10																	3823844		2203	4300	6503	SO:0001583	missense	1316	exon2			TGCGTCCGCTGGT	U51869	CCDS7060.1, CCDS53490.1	10p15	2013-01-08	2004-11-29	2004-12-01	ENSG00000067082	ENSG00000067082		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	2235	protein-coding gene	gene with protein product	"""GC-rich binding factor"""	602053	"""core promoter element binding protein"""	BCD1, ST12, COPEB		9503030, 9685731	Standard	NM_001300		Approved	CPBP, GBF, Zf9, PAC1	uc001iha.3	Q99612	OTTHUMG00000017567	ENST00000497571.1:c.665G>T	chr10.hg19:g.3823844C>A	ENSP00000419923:p.Arg222Leu	38.0	0.0	.	614	35.0	20.0	.	NM_001160125	B2RE86|B4DDN0|D3DRR1|F5H3M5|Q5VUT7|Q5VUT8|Q9BT79	Missense_Mutation	SNP	ENST00000497571.1	hg19	CCDS7060.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.729162	0.89390	.	.	ENSG00000067082	ENST00000497571;ENST00000542957;ENST00000469435	T;T;T	0.78595	1.82;-1.19;-1.19	4.88	4.88	0.63580	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.85745	0.5768	L	0.54908	1.71	0.80722	D	1	D;D;P	0.89917	1.0;1.0;0.738	D;D;B	0.91635	0.999;0.999;0.359	D	0.87437	0.2392	10	0.87932	D	0	.	17.05	0.86516	0.0:1.0:0.0:0.0	.	222;222;222	F5H3M5;Q99612-2;Q99612	.;.;KLF6_HUMAN	L	222	ENSP00000419923:R222L;ENSP00000445301:R222L;ENSP00000419079:R222L	ENSP00000419079:R222L	R	-	2	0	KLF6	3813844	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.711000	0.84669	2.253000	0.74438	0.462000	0.41574	CGG	.	.	.	none		0.677	KLF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046495.1		
SKIDA1	387640	hgsc.bcm.edu	37	10	21804183	21804183	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr10:21804183T>C	ENST00000449193.2	-	4	4821	c.2569A>G	c.(2569-2571)Att>Gtt	p.I857V	SKIDA1_ENST00000444772.3_Missense_Mutation_p.I778V	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	776						nucleus (GO:0005634)											CTCCCAATAATGAGTGATGGT	0.438																																					p.I857V		Atlas-SNP	.											.	.	.	.	0			c.A2569G						PASS	.						114.0	105.0	108.0					10																	21804183		1886	4112	5998	SO:0001583	missense	387640	exon4			CAATAATGAGTGA	AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.2569A>G	chr10.hg19:g.21804183T>C	ENSP00000410041:p.Ile857Val	47.0	0.0	.		54.0	27.0	.	NM_207371	B1ANA5|Q6ZMX4|Q8N3C3	Missense_Mutation	SNP	ENST00000449193.2	hg19	CCDS44363.1	.	.	.	.	.	.	.	.	.	.	T	1.949	-0.441669	0.04604	.	.	ENSG00000180592	ENST00000449193;ENST00000444772	.	.	.	5.64	4.51	0.55191	.	0.181152	0.48286	D	0.000183	T	0.21761	0.0524	N	0.12182	0.205	0.28344	N	0.9212	B	0.18741	0.03	B	0.13407	0.009	T	0.18053	-1.0349	9	0.11485	T	0.65	-2.0894	9.6526	0.39906	0.0:0.1404:0.0:0.8596	.	857	E9PAX1	.	V	857;778	.	ENSP00000442432:I778V	I	-	1	0	C10orf140	21844189	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.252000	0.43196	1.081000	0.41110	0.533000	0.62120	ATT	.	.	.	none		0.438	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286950.2	NM_207371	
SKIDA1	387640	hgsc.bcm.edu	37	10	21805486	21805486	+	Silent	SNP	C	C	T			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr10:21805486C>T	ENST00000449193.2	-	4	3518	c.1266G>A	c.(1264-1266)gaG>gaA	p.E422E	SKIDA1_ENST00000487107.1_5'Flank|SKIDA1_ENST00000444772.3_Silent_p.E343E	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	341						nucleus (GO:0005634)		p.E422E(2)									cctcttcctcctcctcctcct	0.632																																					p.E422E		Atlas-SNP	.											C10orf140_ENST00000449193,rectum,carcinoma,0,4	.	.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1266A						PASS	.						5.0	6.0	6.0					10																	21805486		1988	4108	6096	SO:0001819	synonymous_variant	387640	exon4			TTCCTCCTCCTCC	AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1266G>A	chr10.hg19:g.21805486C>T		2.0	2.0	.		9.0	6.0	.	NM_207371	B1ANA5|Q6ZMX4|Q8N3C3	Silent	SNP	ENST00000449193.2	hg19	CCDS44363.1																																																																																			.	.	.	none		0.632	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286950.2	NM_207371	
KIAA1217	56243	hgsc.bcm.edu	37	10	24762791	24762791	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr10:24762791G>C	ENST00000376454.3	+	6	1511	c.1481G>C	c.(1480-1482)gGc>gCc	p.G494A	KIAA1217_ENST00000376451.2_Missense_Mutation_p.G212A|KIAA1217_ENST00000430453.2_Missense_Mutation_p.G415A|KIAA1217_ENST00000458595.1_Missense_Mutation_p.G494A|KIAA1217_ENST00000376452.3_Missense_Mutation_p.G494A|KIAA1217_ENST00000396446.1_Missense_Mutation_p.G212A|KIAA1217_ENST00000376462.1_Missense_Mutation_p.G414A|KIAA1217_ENST00000396445.1_Missense_Mutation_p.G212A|KIAA1217_ENST00000307544.6_Missense_Mutation_p.G212A	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	494					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						AATGCCCACGGCCCCCCTCAC	0.577																																					p.G494A		Atlas-SNP	.											.	KIAA1217	235	.	0			c.G1481C						PASS	.						91.0	81.0	84.0					10																	24762791		2203	4300	6503	SO:0001583	missense	56243	exon6			CCCACGGCCCCCC	BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.1481G>C	chr10.hg19:g.24762791G>C	ENSP00000365637:p.Gly494Ala	143.0	0.0	.		132.0	55.0	.	NM_019590	A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Missense_Mutation	SNP	ENST00000376454.3	hg19	CCDS31165.1	.	.	.	.	.	.	.	.	.	.	G	3.550	-0.091916	0.07053	.	.	ENSG00000120549	ENST00000376462;ENST00000376456;ENST00000458595;ENST00000442879;ENST00000376454;ENST00000376452;ENST00000438429;ENST00000430453;ENST00000307544;ENST00000450158;ENST00000396445;ENST00000376451;ENST00000396446	T;T;T;T;T;T;T;T;T;T;T	0.52057	0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68	5.44	4.46	0.54185	.	0.426273	0.28312	N	0.015814	T	0.57286	0.2043	L	0.55481	1.735	0.30862	N	0.733437	B;B;P;B;P;P;D;B	0.89917	0.418;0.349;0.787;0.168;0.787;0.787;1.0;0.417	B;B;B;B;B;B;D;B	0.76071	0.107;0.05;0.228;0.107;0.228;0.228;0.987;0.124	T	0.52162	-0.8612	10	0.12103	T	0.63	.	10.9169	0.47142	0.0:0.0:0.5812:0.4187	.	494;494;212;212;212;212;494;494	Q5T5P2-7;A6NLF3;Q5T5P2-4;Q5T5P2-8;Q5T5P2-3;Q5T5P2-6;Q5T5P2;Q5T5P2-2	.;.;.;.;.;.;SKT_HUMAN;.	A	414;494;494;212;494;494;344;415;212;212;212;212;212	ENSP00000365645:G414A;ENSP00000365639:G494A;ENSP00000392625:G494A;ENSP00000365637:G494A;ENSP00000365635:G494A;ENSP00000404798:G344A;ENSP00000389680:G415A;ENSP00000302343:G212A;ENSP00000379722:G212A;ENSP00000365634:G212A;ENSP00000379723:G212A	ENSP00000302343:G212A	G	+	2	0	KIAA1217	24802797	0.645000	0.27286	0.447000	0.26932	0.176000	0.22953	3.691000	0.54720	2.561000	0.86390	0.655000	0.94253	GGC	.	.	.	none		0.577	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047223.2	NM_019590	
HERC4	26091	hgsc.bcm.edu	37	10	69714847	69714847	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr10:69714847A>G	ENST00000395198.3	-	19	2337	c.2090T>C	c.(2089-2091)cTt>cCt	p.L697P	HERC4_ENST00000412272.2_Missense_Mutation_p.L697P|HERC4_ENST00000395187.2_3'UTR|HERC4_ENST00000480158.1_5'UTR|HERC4_ENST00000277817.6_Missense_Mutation_p.L587P|HERC4_ENST00000373700.4_Missense_Mutation_p.L689P	NM_022079.2	NP_071362.1	Q5GLZ8	HERC4_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 4	697					cell differentiation (GO:0030154)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	27						TGGGAGAAAAAGAGAGGAGAC	0.393																																					p.L697P		Atlas-SNP	.											.	HERC4	78	.	0			c.T2090C						PASS	.						102.0	97.0	99.0					10																	69714847		2203	4300	6503	SO:0001583	missense	26091	exon19			AGAAAAAGAGAGG	AY221963	CCDS7274.1, CCDS41533.1, CCDS60541.1, CCDS60542.1	10q21.3	2013-09-20	2012-02-23		ENSG00000148634	ENSG00000148634			24521	protein-coding gene	gene with protein product		609248	"""hect domain and RLD 4"""			10997877	Standard	NM_022079		Approved	DKFZP564G092, KIAA1593	uc001jng.4	Q5GLZ8	OTTHUMG00000018343	ENST00000395198.3:c.2090T>C	chr10.hg19:g.69714847A>G	ENSP00000378624:p.Leu697Pro	91.0	0.0	.		98.0	28.0	.	NM_022079	Q5GC98|Q5GC99|Q5GCA0|Q8IXP9|Q9HCH9	Missense_Mutation	SNP	ENST00000395198.3	hg19	CCDS41533.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.155772	0.78114	.	.	ENSG00000148634	ENST00000277817;ENST00000412272;ENST00000395198;ENST00000373700	T;T;T;T	0.54279	0.84;0.58;0.6;0.62	5.69	5.69	0.88448	.	0.200034	0.41294	D	0.000909	T	0.61999	0.2392	L	0.45352	1.415	0.80722	D	1	P;D;P;P;P	0.54397	0.955;0.966;0.885;0.937;0.897	P;P;P;P;P	0.62649	0.66;0.905;0.571;0.771;0.594	T	0.64715	-0.6342	10	0.72032	D	0.01	.	11.8771	0.52554	0.8544:0.1456:0.0:0.0	.	697;587;547;689;697	Q5GLZ8-3;Q5GLZ8-6;Q5VXS9;Q5GLZ8-2;Q5GLZ8	.;.;.;.;HERC4_HUMAN	P	587;697;697;689	ENSP00000277817:L587P;ENSP00000416504:L697P;ENSP00000378624:L697P;ENSP00000362804:L689P	ENSP00000277817:L587P	L	-	2	0	HERC4	69384853	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.194000	0.77789	2.168000	0.68352	0.533000	0.62120	CTT	.	.	.	none		0.393	HERC4-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359262.1	NM_015601	
CCAR1	55749	hgsc.bcm.edu	37	10	70513756	70513756	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr10:70513756G>A	ENST00000265872.6	+	11	1385	c.1266G>A	c.(1264-1266)atG>atA	p.M422I	SNORD98_ENST00000408255.1_RNA|CCAR1_ENST00000535016.1_Missense_Mutation_p.M407I|CCAR1_ENST00000543719.1_Missense_Mutation_p.M407I	NM_001282959.1|NM_001282960.1|NM_018237.2	NP_001269888.1|NP_001269889.1|NP_060707.2	Q8IX12	CCAR1_HUMAN	cell division cycle and apoptosis regulator 1	422					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(7)|skin(3)	56						TTTATGTAATGCACAGAGAAG	0.378																																					p.M422I		Atlas-SNP	.											.	CCAR1	118	.	0			c.G1266A						PASS	.						137.0	138.0	138.0					10																	70513756		2203	4300	6503	SO:0001583	missense	55749	exon11			TGTAATGCACAGA	AY249140	CCDS7282.1, CCDS60547.1	10q22.1	2004-02-19			ENSG00000060339	ENSG00000060339			24236	protein-coding gene	gene with protein product		612569				12816952	Standard	NM_018237		Approved	FLJ10590, CARP-1, CARP1	uc001joo.3	Q8IX12	OTTHUMG00000018361	ENST00000265872.6:c.1266G>A	chr10.hg19:g.70513756G>A	ENSP00000265872:p.Met422Ile	171.0	0.0	.		183.0	82.0	.	NM_018237	A0JLT7|A1L4P7|A8K9D4|B4DNP8|B4DRK8|Q32NE3|Q5EBM3|Q5VUP6|Q6PIZ0|Q6X935|Q9H8N4|Q9NVA7|Q9NVQ0|Q9NWM6	Missense_Mutation	SNP	ENST00000265872.6	hg19	CCDS7282.1	.	.	.	.	.	.	.	.	.	.	G	17.95	3.514342	0.64522	.	.	ENSG00000060339	ENST00000265872;ENST00000535016;ENST00000543719;ENST00000539539;ENST00000543225;ENST00000536012	T;T;T;T;T;T	0.23348	1.91;1.91;1.91;1.92;1.93;1.92	5.95	5.95	0.96441	.	0.041894	0.85682	D	0.000000	T	0.26011	0.0634	L	0.50333	1.59	0.50467	D	0.999877	B;P;B	0.35844	0.048;0.524;0.088	B;B;B	0.28849	0.025;0.095;0.05	T	0.02167	-1.1202	10	0.25751	T	0.34	-13.4805	20.3886	0.98946	0.0:0.0:1.0:0.0	.	407;422;396	Q8IX12-2;Q8IX12;F5H2E6	.;CCAR1_HUMAN;.	I	422;407;407;407;396;227	ENSP00000265872:M422I;ENSP00000441820:M407I;ENSP00000445254:M407I;ENSP00000439252:M407I;ENSP00000438610:M396I;ENSP00000439642:M227I	ENSP00000265872:M422I	M	+	3	0	CCAR1	70183762	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.600000	0.74132	2.810000	0.96702	0.650000	0.86243	ATG	.	.	.	none		0.378	CCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048356.2	NM_018237	
POLR3A	11128	hgsc.bcm.edu	37	10	79745045	79745045	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr10:79745045C>T	ENST00000372371.3	-	24	3262	c.3125G>A	c.(3124-3126)gGt>gAt	p.G1042D		NM_007055.3	NP_008986.2	O14802	RPC1_HUMAN	polymerase (RNA) III (DNA directed) polypeptide A, 155kDa	1042					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|ribonucleoside binding (GO:0032549)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)			GCCTGGCTCACCAATGCTCTG	0.537																																					p.G1042D		Atlas-SNP	.											.	POLR3A	104	.	0			c.G3125A						PASS	.						124.0	122.0	123.0					10																	79745045		2203	4300	6503	SO:0001583	missense	11128	exon24			GGCTCACCAATGC	AF021351	CCDS7354.1	10q22-q23	2013-01-21			ENSG00000148606	ENSG00000148606		"""RNA polymerase subunits"""	30074	protein-coding gene	gene with protein product		614258				9331371, 12391170	Standard	NM_007055		Approved	RPC1, RPC155, hRPC155	uc001jzn.3	O14802	OTTHUMG00000018550	ENST00000372371.3:c.3125G>A	chr10.hg19:g.79745045C>T	ENSP00000361446:p.Gly1042Asp	196.0	0.0	.		200.0	75.0	.	NM_007055	Q8IW34|Q8TCW5	Missense_Mutation	SNP	ENST00000372371.3	hg19	CCDS7354.1	.	.	.	.	.	.	.	.	.	.	C	33	5.197516	0.94960	.	.	ENSG00000148606	ENST00000372371	D	0.87491	-2.26	5.95	5.95	0.96441	RNA polymerase Rpb1, domain 5 (1);	0.000000	0.85682	D	0.000000	D	0.96405	0.8827	H	0.97516	4.02	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97111	0.9804	9	.	.	.	-13.79	20.3802	0.98930	0.0:1.0:0.0:0.0	.	1042	O14802	RPC1_HUMAN	D	1042	ENSP00000361446:G1042D	.	G	-	2	0	POLR3A	79415051	1.000000	0.71417	0.942000	0.38095	0.985000	0.73830	7.336000	0.79245	2.822000	0.97130	0.563000	0.77884	GGT	.	.	.	none		0.537	POLR3A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048923.1	NM_007055	
GRK5	2869	hgsc.bcm.edu	37	10	120967430	120967430	+	Start_Codon_SNP	SNP	A	A	T			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr10:120967430A>T	ENST00000392870.2	+	1	330	c.1A>T	c.(1-3)Atg>Ttg	p.M1L	RP11-567J24.4_ENST00000421206.1_RNA	NM_005308.2	NP_005299.1	P34947	GRK5_HUMAN	G protein-coupled receptor kinase 5	1	N-terminal.				adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|protein autophosphorylation (GO:0046777)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|tachykinin receptor signaling pathway (GO:0007217)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|phospholipid binding (GO:0005543)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)			endometrium(2)|large_intestine(5)|lung(15)|skin(3)|stomach(1)|urinary_tract(1)	27		Lung NSC(174;0.0971)|all_lung(145;0.127)|Ovarian(717;0.249)		all cancers(201;0.0227)		CCGACTGTCAATGGAGCTGGA	0.716																																					p.M1L		Atlas-SNP	.											.	GRK5	58	.	0			c.A1T						PASS	.						22.0	20.0	20.0					10																	120967430		2194	4294	6488	SO:0001582	initiator_codon_variant	2869	exon1			CTGTCAATGGAGC	L15388	CCDS7612.1	10q26.11	2013-09-19	2004-02-04	2004-02-06	ENSG00000198873	ENSG00000198873			4544	protein-coding gene	gene with protein product		600870		GPRK5		7685906	Standard	NM_005308		Approved		uc001led.3	P34947	OTTHUMG00000019149	ENST00000392870.2:c.1A>T	chr10.hg19:g.120967430A>T	ENSP00000376609:p.Met1Leu	21.0	0.0	.		29.0	16.0	.	NM_005308	D3DRD0|Q5T059	Missense_Mutation	SNP	ENST00000392870.2	hg19	CCDS7612.1	.	.	.	.	.	.	.	.	.	.	A	13.48	2.250140	0.39797	.	.	ENSG00000198873	ENST00000369106;ENST00000392870	T	0.69685	-0.42	4.61	4.61	0.57282	.	0.000000	0.52532	U	0.000075	T	0.60222	0.2252	.	.	.	0.80722	D	1	B	0.26081	0.141	B	0.20767	0.031	T	0.63065	-0.6720	9	0.87932	D	0	-18.4005	14.3171	0.66460	1.0:0.0:0.0:0.0	.	1	P34947	GRK5_HUMAN	L	1	ENSP00000376609:M1L	ENSP00000358102:M1L	M	+	1	0	GRK5	120957420	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.522000	0.81844	1.853000	0.53794	0.402000	0.26972	ATG	.	.	.	none		0.716	GRK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050652.2	NM_005308	Missense_Mutation
SLC5A12	159963	hgsc.bcm.edu	37	11	26720065	26720065	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr11:26720065A>G	ENST00000396005.3	-	7	1148	c.839T>C	c.(838-840)tTg>tCg	p.L280S	SLC5A12_ENST00000280467.6_Missense_Mutation_p.L280S	NM_178498.3	NP_848593.2	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12	280					sodium ion transport (GO:0006814)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)	35						GAGACCCAGCAAGTTAAAATA	0.438																																					p.L280S		Atlas-SNP	.											.	SLC5A12	134	.	0			c.T839C						PASS	.						113.0	103.0	106.0					11																	26720065		2203	4299	6502	SO:0001583	missense	159963	exon7			CCCAGCAAGTTAA	BC049207	CCDS7860.2	11p14.2	2013-07-19	2013-07-19		ENSG00000148942	ENSG00000148942		"""Solute carriers"""	28750	protein-coding gene	gene with protein product		612455	"""solute carrier family 5 (sodium/glucose cotransporter), member 12"""			12477932	Standard	NM_178498		Approved	MGC52019, SMCT2	uc001mra.2	Q1EHB4	OTTHUMG00000150706	ENST00000396005.3:c.839T>C	chr11.hg19:g.26720065A>G	ENSP00000379326:p.Leu280Ser	43.0	0.0	.		57.0	35.0	.	NM_178498	Q86UC7	Missense_Mutation	SNP	ENST00000396005.3	hg19	CCDS7860.2	.	.	.	.	.	.	.	.	.	.	A	17.57	3.423743	0.62733	.	.	ENSG00000148942	ENST00000396005;ENST00000280467;ENST00000533617	D;D;D	0.89415	-2.51;-2.51;-2.51	6.07	6.07	0.98685	.	0.000000	0.64402	D	0.000002	D	0.94059	0.8096	M	0.75150	2.29	0.54753	D	0.999984	B;D	0.89917	0.22;1.0	B;D	0.87578	0.217;0.998	D	0.93413	0.6770	10	0.40728	T	0.16	.	16.6277	0.84984	1.0:0.0:0.0:0.0	.	280;280	Q1EHB4-2;Q1EHB4	.;SC5AC_HUMAN	S	280;280;92	ENSP00000379326:L280S;ENSP00000280467:L280S;ENSP00000435053:L92S	ENSP00000280467:L280S	L	-	2	0	SLC5A12	26676641	1.000000	0.71417	0.914000	0.36105	0.771000	0.43674	9.154000	0.94694	2.330000	0.79161	0.528000	0.53228	TTG	.	.	.	none		0.438	SLC5A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319681.1	NM_178498	
CAPRIN1	4076	hgsc.bcm.edu	37	11	34118752	34118752	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr11:34118752A>G	ENST00000341394.4	+	17	2099	c.1910A>G	c.(1909-1911)gAt>gGt	p.D637G	CAPRIN1_ENST00000530820.1_Missense_Mutation_p.D637G|CAPRIN1_ENST00000533657.1_3'UTR|CAPRIN1_ENST00000389645.3_Missense_Mutation_p.D637G|CAPRIN1_ENST00000529307.1_Missense_Mutation_p.D556G|CAPRIN1_ENST00000532820.1_Missense_Mutation_p.D637G	NM_005898.4	NP_005889.3	Q14444	CAPR1_HUMAN	cell cycle associated protein 1	637					negative regulation of translation (GO:0017148)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	18		Acute lymphoblastic leukemia(5;0.00045)|all_hematologic(20;0.0016)				GGAGGATATGATGGTTACCGC	0.368																																					p.D637G		Atlas-SNP	.											.	CAPRIN1	110	.	0			c.A1910G						PASS	.						93.0	92.0	92.0					11																	34118752		2202	4298	6500	SO:0001583	missense	4076	exon17			GATATGATGGTTA	BC001731	CCDS31453.1, CCDS31454.1	11p13	2010-08-03	2007-03-27	2007-03-27	ENSG00000135387	ENSG00000135387			6743	protein-coding gene	gene with protein product	"""cytoplasmic activation/proliferation-associated protein-1"""	601178	"""membrane component, chromosome 11, surface marker 1"", ""GPI-anchored membrane protein 1"""	M11S1, GPIAP1		7657653, 16177067, 17210633, 14764709, 15471883	Standard	NM_005898		Approved	caprin-1, RNG105	uc001mvh.1	Q14444	OTTHUMG00000166248	ENST00000341394.4:c.1910A>G	chr11.hg19:g.34118752A>G	ENSP00000340329:p.Asp637Gly	105.0	0.0	.		97.0	45.0	.	NM_203364	A6NMY7|D3DR06|Q15074|Q6IMN4|Q6IMN7|Q9BV09	Missense_Mutation	SNP	ENST00000341394.4	hg19	CCDS31453.1	.	.	.	.	.	.	.	.	.	.	A	28.8	4.954141	0.92726	.	.	ENSG00000135387	ENST00000341394;ENST00000389645;ENST00000532820;ENST00000530820;ENST00000529307	T;T;T;T;T	0.30182	1.54;1.54;1.54;1.54;1.54	6.17	6.17	0.99709	.	0.090003	0.85682	D	0.000000	T	0.56659	0.2000	M	0.74258	2.255	0.58432	D	0.999993	D;D	0.71674	0.998;0.996	D;D	0.71870	0.975;0.924	T	0.57087	-0.7871	10	0.51188	T	0.08	-10.4721	16.8222	0.85835	1.0:0.0:0.0:0.0	.	637;637	Q14444;Q14444-2	CAPR1_HUMAN;.	G	637;637;637;637;556	ENSP00000340329:D637G;ENSP00000374296:D637G;ENSP00000434150:D637G;ENSP00000434204:D637G;ENSP00000431581:D556G	ENSP00000340329:D637G	D	+	2	0	CAPRIN1	34075328	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.962000	0.93254	2.371000	0.80710	0.533000	0.62120	GAT	.	.	.	none		0.368	CAPRIN1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000388680.2	NM_005898	
DDIAS	220042	hgsc.bcm.edu	37	11	82642927	82642927	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr11:82642927C>A	ENST00000533655.1	+	6	759	c.547C>A	c.(547-549)Caa>Aaa	p.Q183K	C11orf82_ENST00000528759.1_3'UTR|C11orf82_ENST00000525361.1_Intron|C11orf82_ENST00000430323.2_Missense_Mutation_p.Q183K|C11orf82_ENST00000533750.1_3'UTR|C11orf82_ENST00000525388.1_3'UTR|C11orf82_ENST00000329143.3_5'UTR	NM_145018.3	NP_659455.3	Q8IXT1	DDIAS_HUMAN		183					apoptotic process (GO:0006915)|cellular response to cytokine stimulus (GO:0071345)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to hydroperoxide (GO:0071447)|cellular response to UV (GO:0034644)|hemopoiesis (GO:0030097)|mitotic cell cycle arrest (GO:0071850)|negative regulation of fibroblast apoptotic process (GO:2000270)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.Q183E(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(17)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	33						CTACTTCCATCAACTTTTGCA	0.418																																					p.Q183K		Atlas-SNP	.											C11orf82,NS,carcinoma,0,1	C11orf82	71	.	1	Substitution - Missense(1)	lung(1)	c.C547A						PASS	.						177.0	179.0	178.0					11																	82642927		2203	4300	6503	SO:0001583	missense	220042	exon6			TTCCATCAACTTT																												ENST00000533655.1:c.547C>A	chr11.hg19:g.82642927C>A	ENSP00000435421:p.Gln183Lys	284.0	1.0	.		257.0	95.0	.	NM_145018	Q96LK6|Q9H856	Missense_Mutation	SNP	ENST00000533655.1	hg19	CCDS8263.1	.	.	.	.	.	.	.	.	.	.	C	6.456	0.452276	0.12283	.	.	ENSG00000165490	ENST00000430323;ENST00000533655	T;T	0.14640	2.49;2.49	5.45	5.45	0.79879	.	0.357786	0.25127	N	0.032927	T	0.16599	0.0399	L	0.56769	1.78	0.80722	D	1	P	0.39282	0.666	B	0.33339	0.162	T	0.03103	-1.1072	9	.	.	.	.	19.289	0.94090	0.0:1.0:0.0:0.0	.	183	Q8IXT1	NOXIN_HUMAN	K	183	ENSP00000414687:Q183K;ENSP00000435421:Q183K	.	Q	+	1	0	C11orf82	82320575	0.908000	0.30866	0.511000	0.27724	0.134000	0.20937	3.767000	0.55288	2.567000	0.86603	0.563000	0.77884	CAA	.	.	.	none		0.418	C11orf82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391936.1		
MRE11A	4361	hgsc.bcm.edu	37	11	94224022	94224022	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr11:94224022A>C	ENST00000323929.3	-	3	352	c.130T>G	c.(130-132)Tta>Gta	p.L44V	MRE11A_ENST00000536144.1_5'UTR|MRE11A_ENST00000540013.1_Missense_Mutation_p.L44V|MRE11A_ENST00000393241.4_Missense_Mutation_p.L44V|ANKRD49_ENST00000544612.1_5'Flank|MRE11A_ENST00000323977.3_Missense_Mutation_p.L44V|MRE11A_ENST00000407439.3_Missense_Mutation_p.L47V	NM_005591.3	NP_005582.1	P49959	MRE11_HUMAN	MRE11 meiotic recombination 11 homolog A (S. cerevisiae)	44					base-excision repair (GO:0006284)|cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|double-strand break repair via nonhomologous end joining (GO:0006303)|innate immune response (GO:0045087)|intra-S DNA damage checkpoint (GO:0031573)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of DNA endoreduplication (GO:0032876)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair (GO:0006289)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of type I interferon production (GO:0032481)|reciprocal meiotic recombination (GO:0007131)|regulation of mitotic recombination (GO:0000019)|sister chromatid cohesion (GO:0007062)|synapsis (GO:0007129)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromatin (GO:0000785)|cytosol (GO:0005829)|Mre11 complex (GO:0030870)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	3'-5' exonuclease activity (GO:0008408)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|manganese ion binding (GO:0030145)|nuclease activity (GO:0004518)|protein C-terminus binding (GO:0008022)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			breast(5)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	29		Acute lymphoblastic leukemia(157;2.37e-05)|all_hematologic(158;0.00824)				GCAAGTCTTAAAATTTCATCG	0.333								Homologous recombination	Ataxia-Telangiectasia-Like Disorder																												p.L44V		Atlas-SNP	.											.	MRE11A	145	.	0			c.T130G						PASS	.						140.0	138.0	139.0					11																	94224022		2201	4298	6499	SO:0001583	missense	4361	exon3	Familial Cancer Database	ATLD	GTCTTAAAATTTC	BC063458	CCDS8298.1, CCDS8299.1	11q21	2014-09-17	2001-11-28		ENSG00000020922	ENSG00000020922			7230	protein-coding gene	gene with protein product	"""AT-like disease"""	600814	"""meiotic recombination (S. cerevisiae) 11 homolog A"""	MRE11		8530104	Standard	XM_005274007		Approved	ATLD	uc001peu.2	P49959	OTTHUMG00000167780	ENST00000323929.3:c.130T>G	chr11.hg19:g.94224022A>C	ENSP00000325863:p.Leu44Val	154.0	0.0	.		174.0	65.0	.	NM_005591	O43475	Missense_Mutation	SNP	ENST00000323929.3	hg19	CCDS8299.1	.	.	.	.	.	.	.	.	.	.	A	17.80	3.477531	0.63849	.	.	ENSG00000020922	ENST00000323929;ENST00000407439;ENST00000323977;ENST00000393241;ENST00000540013;ENST00000536754;ENST00000538923	D;D;D;D;D;D;D	0.82893	-1.66;-1.66;-1.66;-1.66;-1.66;-1.66;-1.66	4.46	3.34	0.38264	Metallophosphoesterase domain (1);	0.075606	0.53938	D	0.000060	D	0.86674	0.5989	M	0.63843	1.955	0.54753	D	0.999985	D;D;D	0.58268	0.982;0.957;0.981	D;P;D	0.69654	0.965;0.904;0.925	D	0.85303	0.1074	10	0.46703	T	0.11	-6.346	7.1552	0.25632	0.7509:0.0:0.2491:0.0	.	47;44;44	B3KTC7;P49959-2;P49959	.;.;MRE11_HUMAN	V	44;47;44;44;44;44;44	ENSP00000325863:L44V;ENSP00000385614:L47V;ENSP00000326094:L44V;ENSP00000376933:L44V;ENSP00000440986:L44V;ENSP00000439511:L44V;ENSP00000442809:L44V	ENSP00000325863:L44V	L	-	1	2	MRE11A	93863670	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	3.003000	0.49505	1.651000	0.50673	0.379000	0.24179	TTA	.	.	.	none		0.333	MRE11A-001	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396237.3	NM_005591	
DYNC2H1	79659	hgsc.bcm.edu	37	11	103124155	103124155	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr11:103124155C>T	ENST00000375735.2	+	66	10328	c.10184C>T	c.(10183-10185)aCa>aTa	p.T3395I	DYNC2H1_ENST00000334267.7_Intron|DYNC2H1_ENST00000398093.3_Missense_Mutation_p.T3402I	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	3395	AAA 5. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		TTTACTACAACAAGAAGTGGA	0.363																																					p.T3402I		Atlas-SNP	.											.	DYNC2H1	246	.	0			c.C10205T						PASS	.						103.0	98.0	100.0					11																	103124155		1815	4086	5901	SO:0001583	missense	79659	exon67			CTACAACAAGAAG	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.10184C>T	chr11.hg19:g.103124155C>T	ENSP00000364887:p.Thr3395Ile	95.0	0.0	.		116.0	35.0	.	NM_001080463	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	hg19	CCDS53701.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.945803	0.92593	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.29142	1.58;1.58	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.72771	0.3502	H	0.97611	4.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.995;0.996	T	0.82168	-0.0591	10	0.87932	D	0	.	20.3334	0.98727	0.0:1.0:0.0:0.0	.	3395;3402	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	I	3395;3402	ENSP00000364887:T3395I;ENSP00000381167:T3402I	ENSP00000364887:T3395I	T	+	2	0	DYNC2H1	102629365	1.000000	0.71417	0.990000	0.47175	0.992000	0.81027	6.057000	0.71119	2.818000	0.97014	0.591000	0.81541	ACA	.	.	.	none		0.363	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652	
IL10RA	3587	hgsc.bcm.edu	37	11	117869597	117869597	+	Silent	SNP	A	A	T			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr11:117869597A>T	ENST00000227752.3	+	7	1098	c.978A>T	c.(976-978)ccA>ccT	p.P326P	IL10RA_ENST00000541785.1_Silent_p.P306P|IL10RA_ENST00000533700.1_3'UTR|IL10RA_ENST00000545409.1_Silent_p.P177P	NM_001558.3	NP_001549.2	Q13651	I10R1_HUMAN	interleukin 10 receptor, alpha	326					cytokine-mediated signaling pathway (GO:0019221)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-10 receptor activity (GO:0004920)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(2)|prostate(1)	19	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.07e-05)|Epithelial(105;0.00108)		GCACCAAGCCATCCCTGCAGA	0.612																																					p.P326P		Atlas-SNP	.											.	IL10RA	46	.	0			c.A978T						PASS	.						89.0	75.0	80.0					11																	117869597		2200	4296	6496	SO:0001819	synonymous_variant	3587	exon7			CAAGCCATCCCTG	U00672	CCDS8388.1	11q23	2014-09-17			ENSG00000110324	ENSG00000110324		"""Interleukins and interleukin receptors"", ""CD molecules"""	5964	protein-coding gene	gene with protein product		146933		IL10R		8120391	Standard	NR_026691		Approved	HIL-10R, CDW210A, CD210a, CD210	uc001prv.3	Q13651	OTTHUMG00000166523	ENST00000227752.3:c.978A>T	chr11.hg19:g.117869597A>T		96.0	0.0	.		86.0	31.0	.	NM_001558	A8K6I0|B0YJ27	Silent	SNP	ENST00000227752.3	hg19	CCDS8388.1																																																																																			.	.	.	none		0.612	IL10RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390167.1		
HSPA8	3312	hgsc.bcm.edu	37	11	122930940	122930940	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr11:122930940A>G	ENST00000532636.1	-	4	567	c.448T>C	c.(448-450)Ttt>Ctt	p.F150L	HSPA8_ENST00000227378.3_Missense_Mutation_p.F150L|HSPA8_ENST00000526110.1_Intron|SNORD14C_ENST00000365382.1_RNA|HSPA8_ENST00000534319.1_5'UTR|SNORD14D_ENST00000384390.1_RNA|HSPA8_ENST00000453788.2_Missense_Mutation_p.F150L|HSPA8_ENST00000526862.1_5'Flank|HSPA8_ENST00000533540.1_Intron|SNORD14E_ENST00000364009.1_RNA|HSPA8_ENST00000534624.1_Missense_Mutation_p.F150L			P11142	HSP7C_HUMAN	heat shock 70kDa protein 8	150					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|chaperone mediated protein folding requiring cofactor (GO:0051085)|clathrin coat disassembly (GO:0072318)|gene expression (GO:0010467)|membrane organization (GO:0061024)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|negative regulation of fibril organization (GO:1902904)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotransmitter secretion (GO:0007269)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|protein refolding (GO:0042026)|regulation of cell cycle (GO:0051726)|response to unfolded protein (GO:0006986)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	blood microparticle (GO:0072562)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Prp19 complex (GO:0000974)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|enzyme binding (GO:0019899)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|MHC class II protein complex binding (GO:0023026)|poly(A) RNA binding (GO:0044822)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)			breast(1)|central_nervous_system(7)|endometrium(1)|kidney(9)|large_intestine(4)|lung(13)|upper_aerodigestive_tract(1)	36		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		GAGTCATTAAAGTAAGCTGGC	0.403																																					p.F150L	Colon(21;486 594 5900 6733 14272)	Atlas-SNP	.											.	HSPA8	168	.	0			c.T448C						PASS	.						71.0	68.0	69.0					11																	122930940		2202	4299	6501	SO:0001583	missense	3312	exon4			CATTAAAGTAAGC	Y00371	CCDS8440.1, CCDS44754.1	11q24.1	2011-09-02	2002-08-29		ENSG00000109971	ENSG00000109971		"""Heat shock proteins / HSP70"""	5241	protein-coding gene	gene with protein product		600816	"""heat shock 70kD protein 8"""	HSPA10		8530083, 3037489	Standard	NM_006597		Approved	HSC71, HSC70, HSP73	uc001pyo.3	P11142	OTTHUMG00000166030	ENST00000532636.1:c.448T>C	chr11.hg19:g.122930940A>G	ENSP00000437125:p.Phe150Leu	109.0	0.0	.		109.0	47.0	.	NM_006597	Q9H3R6	Missense_Mutation	SNP	ENST00000532636.1	hg19	CCDS8440.1	.	.	.	.	.	.	.	.	.	.	A	20.1	3.939342	0.73557	.	.	ENSG00000109971	ENST00000532636;ENST00000534624;ENST00000453788;ENST00000227378;ENST00000528292;ENST00000525463;ENST00000525624;ENST00000534567;ENST00000527387;ENST00000532182	T;T;T;T;T;T;T;T;T;T	0.01947	4.54;4.54;4.54;4.54;4.54;4.54;4.54;4.54;4.54;4.54	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	T	0.13884	0.0336	H	0.99783	4.775	0.80722	D	1	B;B;P;P;B	0.35923	0.014;0.106;0.528;0.472;0.106	B;B;B;B;B	0.35413	0.06;0.202;0.128;0.078;0.202	T	0.21348	-1.0248	10	0.72032	D	0.01	-23.667	14.7286	0.69362	1.0:0.0:0.0:0.0	.	150;150;150;150;150	B4DTX2;Q53GZ6;E7ET08;P11142-2;P11142	.;.;.;.;HSP7C_HUMAN	L	150;150;150;150;90;109;150;150;150;150	ENSP00000437125:F150L;ENSP00000432083:F150L;ENSP00000404372:F150L;ENSP00000227378:F150L;ENSP00000432884:F90L;ENSP00000436762:F109L;ENSP00000435154:F150L;ENSP00000431641:F150L;ENSP00000436183:F150L;ENSP00000434415:F150L	ENSP00000227378:F150L	F	-	1	0	HSPA8	122436150	1.000000	0.71417	0.668000	0.29813	0.342000	0.28953	9.203000	0.95033	1.919000	0.55581	0.459000	0.35465	TTT	.	.	.	none		0.403	HSPA8-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387515.1		
ERC1	23085	hgsc.bcm.edu	37	12	1219488	1219488	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr12:1219488G>A	ENST00000397203.2	+	5	1698	c.1292G>A	c.(1291-1293)aGc>aAc	p.S431N	ERC1_ENST00000355446.5_Missense_Mutation_p.S431N|ERC1_ENST00000546231.2_Missense_Mutation_p.S431N|ERC1_ENST00000589028.1_Missense_Mutation_p.S431N|ERC1_ENST00000536573.2_3'UTR|ERC1_ENST00000543086.3_Missense_Mutation_p.S431N|ERC1_ENST00000360905.4_Missense_Mutation_p.S431N			Q8IUD2	RB6I2_HUMAN	ELKS/RAB6-interacting/CAST family member 1	431					I-kappaB phosphorylation (GO:0007252)|multicellular organismal development (GO:0007275)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|IkappaB kinase complex (GO:0008385)|presynaptic membrane (GO:0042734)	leucine zipper domain binding (GO:0043522)			NS(1)|breast(2)|cervix(2)|endometrium(2)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)			GTGTATCGGAGCCATTCTAAA	0.353																																					p.S431N		Atlas-SNP	.											.	ERC1	95	.	0			c.G1292A						PASS	.						102.0	105.0	104.0					12																	1219488		2203	4300	6503	SO:0001583	missense	23085	exon5			ATCGGAGCCATTC	AB015617	CCDS8508.1, CCDS53732.1	12p13.3	2008-02-05	2006-08-14	2006-08-14	ENSG00000082805	ENSG00000082805			17072	protein-coding gene	gene with protein product		607127	"""RAB6 interacting protein 2"""	RAB6IP2		10697956, 11929610	Standard	NM_178040		Approved	ELKS, KIAA1081, CAST2, MGC12974	uc001qjb.2	Q8IUD2	OTTHUMG00000130138	ENST00000397203.2:c.1292G>A	chr12.hg19:g.1219488G>A	ENSP00000380386:p.Ser431Asn	71.0	0.0	.		110.0	50.0	.	NM_178039	A2RU77|A7E295|D3DUP7|D3DUP8|Q6NVK2|Q8IUD3|Q8IUD4|Q8IUD5|Q8NAS1|Q9NXN5|Q9UIK7|Q9UPS1	Missense_Mutation	SNP	ENST00000397203.2	hg19	CCDS8508.1	.	.	.	.	.	.	.	.	.	.	G	15.77	2.931718	0.52866	.	.	ENSG00000082805	ENST00000347735;ENST00000397203;ENST00000454194;ENST00000537890;ENST00000543086;ENST00000542302;ENST00000546231;ENST00000355446;ENST00000360905;ENST00000440394;ENST00000538971;ENST00000536573	T;T;T;T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67	5.93	5.93	0.95920	.	0.037884	0.85682	D	0.000000	T	0.43545	0.1252	L	0.28400	0.85	0.52099	D	0.999949	B;B;B;B;B	0.24721	0.016;0.032;0.027;0.035;0.11	B;B;B;B;B	0.33392	0.017;0.073;0.018;0.025;0.163	T	0.18935	-1.0321	10	0.20046	T	0.44	-11.7406	20.3938	0.98981	0.0:0.0:1.0:0.0	.	207;68;431;431;431	F5H327;F5GZU8;Q8IUD2-2;Q8IUD2-3;Q8IUD2	.;.;.;.;RB6I2_HUMAN	N	431;431;431;431;431;431;431;431;431;431;207;68	ENSP00000340054:S431N;ENSP00000380386:S431N;ENSP00000438546:S431N;ENSP00000445336:S431N;ENSP00000442739:S431N;ENSP00000347621:S431N;ENSP00000354158:S431N;ENSP00000410064:S431N	ENSP00000340054:S431N	S	+	2	0	ERC1	1089749	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.536000	0.60636	2.831000	0.97527	0.585000	0.79938	AGC	.	.	.	none		0.353	ERC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398380.2	NM_015064	
CASC1	55259	hgsc.bcm.edu	37	12	25308273	25308273	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr12:25308273A>G	ENST00000320267.9	-	4	335	c.254T>C	c.(253-255)tTg>tCg	p.L85S	CASC1_ENST00000545133.1_Missense_Mutation_p.L26S|CASC1_ENST00000354189.5_Missense_Mutation_p.L149S|CASC1_ENST00000395990.2_Missense_Mutation_p.L45S|CASC1_ENST00000557684.1_5'UTR|CASC1_ENST00000537577.1_5'UTR|CASC1_ENST00000395987.3_Missense_Mutation_p.L91S	NM_001082973.1	NP_001076442	Q6TDU7	CASC1_HUMAN	cancer susceptibility candidate 1	85	Glu-rich.									breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(3)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Melanoma(3;0.0301)|Colorectal(261;0.11)		OV - Ovarian serous cystadenocarcinoma(3;7.42e-20)|Epithelial(3;7.58e-16)|all cancers(3;1.07e-13)			TTCCTGTTTCAATTTCTCTGC	0.368																																					p.L149S		Atlas-SNP	.											.	CASC1	146	.	0			c.T446C						PASS	.						109.0	110.0	109.0					12																	25308273		2203	4296	6499	SO:0001583	missense	55259	exon5			TGTTTCAATTTCT	AK093102	CCDS31759.2, CCDS41762.1, CCDS41763.1, CCDS55810.1, CCDS55811.1	12p12.1	2012-04-17			ENSG00000118307	ENSG00000118307		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 54"""					14583591	Standard	NM_018272		Approved	LAS1, FLJ10921, PPP1R54	uc001rgk.3	Q6TDU7	OTTHUMG00000150195	ENST00000320267.9:c.254T>C	chr12.hg19:g.25308273A>G	ENSP00000313141:p.Leu85Ser	71.0	0.0	.		78.0	31.0	.	NM_001082972	B4DNP2|F5H6T6|Q17RL2|Q4G171|Q5U5K5|Q9NV50	Missense_Mutation	SNP	ENST00000320267.9	hg19	CCDS41762.1	.	.	.	.	.	.	.	.	.	.	A	12.00	1.805347	0.31961	.	.	ENSG00000118307	ENST00000354189;ENST00000395987;ENST00000320267;ENST00000395990;ENST00000395992;ENST00000545133;ENST00000389246;ENST00000554347	T;T;T;T;T;T	0.26518	1.73;2.24;2.24;2.24;2.24;2.24	5.23	2.62	0.31277	.	0.255560	0.34223	N	0.004152	T	0.15912	0.0383	L	0.40543	1.245	0.80722	D	1	B;P;P;P	0.43352	0.418;0.804;0.483;0.763	B;B;B;B	0.38225	0.121;0.268;0.084;0.173	T	0.05068	-1.0908	10	0.25751	T	0.34	-7.1998	4.8547	0.13554	0.5806:0.2448:0.0:0.1745	.	26;149;85;91	F5H6T6;Q6TDU7-3;Q6TDU7;F8W8F9	.;.;CASC1_HUMAN;.	S	149;91;85;45;91;26;45;45	ENSP00000346126:L149S;ENSP00000379310:L91S;ENSP00000313141:L85S;ENSP00000379313:L45S;ENSP00000437373:L26S;ENSP00000451232:L45S	ENSP00000313141:L85S	L	-	2	0	CASC1	25199540	1.000000	0.71417	0.706000	0.30403	0.919000	0.55068	2.273000	0.43381	0.896000	0.36366	0.523000	0.50628	TTG	.	.	.	none		0.368	CASC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316761.1	NM_018272	
DIP2B	57609	hgsc.bcm.edu	37	12	51138542	51138542	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr12:51138542G>T	ENST00000301180.5	+	38	4685	c.4651G>T	c.(4651-4653)Gga>Tga	p.G1551*	Y_RNA_ENST00000363558.1_RNA	NM_173602.2	NP_775873.2	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B (Drosophila)	1551						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(15)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	60						CAACTCCAGAGGAGAGAAGCA	0.537																																					p.G1551X		Atlas-SNP	.											.	DIP2B	167	.	0			c.G4651T						PASS	.						138.0	112.0	121.0					12																	51138542		2203	4300	6503	SO:0001587	stop_gained	57609	exon38			TCCAGAGGAGAGA	AB040896	CCDS31799.1	12q13.12	2012-10-02	2006-01-13		ENSG00000066084	ENSG00000066084			29284	protein-coding gene	gene with protein product		611379					Standard	XM_005269044		Approved	KIAA1463, FLJ34278	uc001rwv.3	Q9P265	OTTHUMG00000169475	ENST00000301180.5:c.4651G>T	chr12.hg19:g.51138542G>T	ENSP00000301180:p.Gly1551*	58.0	0.0	.		89.0	50.0	.	NM_173602	Q6B011|Q8N1L5|Q8NB38	Nonsense_Mutation	SNP	ENST00000301180.5	hg19	CCDS31799.1	.	.	.	.	.	.	.	.	.	.	G	42	9.552953	0.99202	.	.	ENSG00000066084	ENST00000301180	.	.	.	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-14.1606	19.7069	0.96076	0.0:0.0:1.0:0.0	.	.	.	.	X	1551	.	ENSP00000301180:G1551X	G	+	1	0	DIP2B	49424809	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.601000	0.98297	2.894000	0.99253	0.591000	0.81541	GGA	.	.	.	none		0.537	DIP2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404243.1	NM_173602	
LRCH1	23143	hgsc.bcm.edu	37	13	47269134	47269134	+	Silent	SNP	G	G	A	rs201892262		TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr13:47269134G>A	ENST00000389798.3	+	9	1424	c.1227G>A	c.(1225-1227)tcG>tcA	p.S409S	LRCH1_ENST00000311191.6_Silent_p.S409S|LRCH1_ENST00000389797.3_Silent_p.S409S	NM_015116.2	NP_055931	Q9Y2L9	LRCH1_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 1	409										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)		GTCTCCATTCGGAATTTATGA	0.403																																					p.S409S		Atlas-SNP	.											.	LRCH1	104	.	0			c.G1227A						PASS	.	G	,,	0,4406		0,0,2203	153.0	161.0	158.0		1227,1227,1227	-10.2	0.0	13		158	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	LRCH1	NM_001164211.1,NM_001164213.1,NM_015116.2	,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,	409/764,409/697,409/729	47269134	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	23143	exon9			CCATTCGGAATTT	AB023233	CCDS31972.1, CCDS53865.1, CCDS53866.1	13q14.11	2008-02-05	2004-05-27	2004-05-28	ENSG00000136141	ENSG00000136141			20309	protein-coding gene	gene with protein product		610368	"""calponin homology (CH) domain containing 1"""	CHDC1		10231032	Standard	NM_015116		Approved	KIAA1016	uc001vbk.3	Q9Y2L9	OTTHUMG00000016877	ENST00000389798.3:c.1227G>A	chr13.hg19:g.47269134G>A		211.0	0.0	.		177.0	86.0	.	NM_015116	B7ZLL5|F8W6F0|Q17R43|Q2KHR1|Q5TBU9|Q7Z5F6|Q7Z5F7	Silent	SNP	ENST00000389798.3	hg19	CCDS31972.1																																																																																			.	G|0.999;A|0.001	0.001	weak		0.403	LRCH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044824.2	NM_015116	
COCH	1690	hgsc.bcm.edu	37	14	31348144	31348144	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr14:31348144G>T	ENST00000396618.3	+	5	423	c.367G>T	c.(367-369)Gta>Tta	p.V123L	COCH_ENST00000216361.4_Missense_Mutation_p.V123L|COCH_ENST00000460581.2_Missense_Mutation_p.V11L|RP11-829H16.3_ENST00000555108.1_RNA|COCH_ENST00000475087.1_Missense_Mutation_p.V123L|COCH_ENST00000382493.4_5'Flank	NM_004086.2	NP_004077.1	O43405	COCH_HUMAN	cochlin	123					defense response to bacterium (GO:0042742)|positive regulation of innate immune response (GO:0045089)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|pancreas(1)|skin(3)	19	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.00645)		TTCTTTCACAGTAACTAGTAG	0.403																																					p.V123L		Atlas-SNP	.											.	COCH	54	.	0			c.G367T						PASS	.						153.0	144.0	147.0					14																	31348144		2203	4300	6503	SO:0001583	missense	1690	exon5			TTCACAGTAACTA		CCDS9640.1	14q11.2-q13	2013-05-01	2013-05-01		ENSG00000100473	ENSG00000100473			2180	protein-coding gene	gene with protein product		603196	"""coagulation factor C (Limulus polyphemus homolog); cochlin"", ""coagulation factor C homolog, cochlin (Limulus polyphemus)"""	DFNA31, DFNA9		9806553	Standard	NM_004086		Approved	COCH-5B2	uc001wqp.2	O43405	OTTHUMG00000029432	ENST00000396618.3:c.367G>T	chr14.hg19:g.31348144G>T	ENSP00000379862:p.Val123Leu	171.0	0.0	.		171.0	77.0	.	NM_004086	A8K9K9|D3DS84|Q96IU6	Missense_Mutation	SNP	ENST00000396618.3	hg19	CCDS9640.1	.	.	.	.	.	.	.	.	.	.	G	15.49	2.849750	0.51270	.	.	ENSG00000100473	ENST00000216361;ENST00000396618;ENST00000475087;ENST00000556908;ENST00000460581;ENST00000542225	D;D;D;D;T	0.88818	-2.43;-2.43;-2.43;-2.43;-0.19	5.87	4.97	0.65823	LCCL (2);	0.117297	0.56097	D	0.000021	T	0.81861	0.4912	L	0.27053	0.805	0.80722	D	1	B;B	0.12013	0.005;0.005	B;B	0.10450	0.005;0.005	T	0.76735	-0.2850	10	0.42905	T	0.14	-12.1146	12.3896	0.55350	0.0779:0.0:0.9221:0.0	.	123;123	Q96IU6;O43405	.;COCH_HUMAN	L	123;123;123;107;11;11	ENSP00000216361:V123L;ENSP00000379862:V123L;ENSP00000451528:V123L;ENSP00000452541:V107L;ENSP00000451713:V11L	ENSP00000216361:V123L	V	+	1	0	COCH	30417895	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.223000	0.51231	2.785000	0.95823	0.655000	0.94253	GTA	.	.	.	none		0.403	COCH-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276608.1	NM_004086	
C14orf105	55195	hgsc.bcm.edu	37	14	57938247	57938247	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr14:57938247T>G	ENST00000216445.3	-	6	853	c.717A>C	c.(715-717)aaA>aaC	p.K239N	C14orf105_ENST00000422976.2_Missense_Mutation_p.K279N|C14orf105_ENST00000534126.1_Missense_Mutation_p.K238N	NM_001283057.1|NM_018168.2	NP_001269986.1|NP_060638.2	Q9NVL8	CN105_HUMAN	chromosome 14 open reading frame 105	239										breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)	11						TTTTGCCAATTTTCCAGGGAC	0.393																																					p.K239N		Atlas-SNP	.											.	C14orf105	26	.	0			c.A717C						PASS	.						80.0	70.0	74.0					14																	57938247		2203	4300	6503	SO:0001583	missense	55195	exon6			GCCAATTTTCCAG	AK001512	CCDS9730.1, CCDS61458.1, CCDS61459.1	14q22.2	2012-09-25			ENSG00000100557	ENSG00000100557			20189	protein-coding gene	gene with protein product							Standard	XM_005267806		Approved	FLJ10650	uc001xcy.2	Q9NVL8	OTTHUMG00000140317	ENST00000216445.3:c.717A>C	chr14.hg19:g.57938247T>G	ENSP00000216445:p.Lys239Asn	60.0	0.0	.		54.0	27.0	.	NM_018168	Q53G04	Missense_Mutation	SNP	ENST00000216445.3	hg19	CCDS9730.1	.	.	.	.	.	.	.	.	.	.	T	15.71	2.914840	0.52546	.	.	ENSG00000100557	ENST00000216445;ENST00000422976;ENST00000534126	T;T;T	0.52057	0.68;0.68;0.68	5.29	2.57	0.30868	.	0.316033	0.28453	N	0.015295	T	0.48978	0.1530	M	0.63428	1.95	0.09310	N	0.999998	P;P;P;P	0.51351	0.703;0.703;0.944;0.944	B;B;P;P	0.52957	0.136;0.136;0.714;0.714	T	0.34825	-0.9813	10	0.40728	T	0.16	-18.2156	3.672	0.08277	0.0:0.1387:0.2192:0.6421	.	279;279;238;239	B7ZL43;F5GWJ3;E9PSE9;Q9NVL8	.;.;.;CN105_HUMAN	N	239;279;238	ENSP00000216445:K239N;ENSP00000392368:K279N;ENSP00000434003:K238N	ENSP00000216445:K239N	K	-	3	2	C14orf105	57008000	0.946000	0.32159	0.071000	0.20095	0.052000	0.14988	0.795000	0.26972	0.916000	0.36871	0.528000	0.53228	AAA	.	.	.	none		0.393	C14orf105-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276921.2	NM_018168	
DPF3	8110	hgsc.bcm.edu	37	14	73137911	73137911	+	Intron	SNP	G	G	C			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr14:73137911G>C	ENST00000556509.1	-	8	871				DPF3_ENST00000546183.1_Missense_Mutation_p.P346R|DPF3_ENST00000557704.1_5'UTR|DPF3_ENST00000541685.1_Missense_Mutation_p.P336R	NM_001280542.1	NP_001267471.1	Q92784	DPF3_HUMAN	D4, zinc and double PHD fingers, family 3						chromatin modification (GO:0016568)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)	zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)	22				BRCA - Breast invasive adenocarcinoma(234;0.00649)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		ACAGGAGCGAGGCTCTTCCAA	0.572																																					p.P336R		Atlas-SNP	.											.	DPF3	117	.	0			c.C1007G						PASS	.						68.0	73.0	71.0					14																	73137911		2163	4247	6410	SO:0001627	intron_variant	8110	exon9			GAGCGAGGCTCTT	U43919	CCDS45133.1, CCDS61495.1, CCDS61496.1, CCDS61497.1	14q24.2	2014-05-13			ENSG00000205683	ENSG00000205683		"""Zinc fingers, PHD-type"""	17427	protein-coding gene	gene with protein product		601672				11845289, 8812431	Standard	NM_012074		Approved	cer-d4, Cerd4, FLJ14079, BAF45c	uc010ari.1	Q92784		ENST00000556509.1:c.871+3036C>G	chr14.hg19:g.73137911G>C		43.0	0.0	.		64.0	19.0	.	NM_012074	A8MSI3|B7Z276|F5H575|Q32UJ0|Q6P9E6|Q6ZT41|Q9H7Y5	Missense_Mutation	SNP	ENST00000556509.1	hg19		.	.	.	.	.	.	.	.	.	.	G	18.64	3.667377	0.67814	.	.	ENSG00000205683	ENST00000541685;ENST00000546183	T;T	0.69926	-0.41;-0.44	5.79	5.79	0.91817	.	.	.	.	.	T	0.60130	0.2245	N	0.19112	0.55	0.32437	N	0.547203	P;P	0.43701	0.815;0.815	B;B	0.42522	0.39;0.39	T	0.69910	-0.5017	9	0.87932	D	0	.	20.04	0.97581	0.0:0.0:1.0:0.0	.	346;336	F5H575;Q92784-2	.;.	R	336;346	ENSP00000441640:P336R;ENSP00000444662:P346R	ENSP00000381791:P391R	P	-	2	0	DPF3	72207664	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.568000	0.60857	2.733000	0.93635	0.655000	0.94253	CCT	.	.	.	none		0.572	DPF3-004	NOVEL	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000413152.2		
SERPINA3	12	hgsc.bcm.edu	37	14	95081284	95081284	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr14:95081284A>G	ENST00000467132.1	+	2	1654	c.506A>G	c.(505-507)gAc>gGc	p.D169G	RP11-986E7.7_ENST00000553947.1_3'UTR|SERPINA3_ENST00000482740.1_5'Flank|SERPINA3_ENST00000393080.4_Missense_Mutation_p.D169G|SERPINA3_ENST00000393078.3_Missense_Mutation_p.D169G			P01011	AACT_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3	169					acute-phase response (GO:0006953)|inflammatory response (GO:0006954)|maintenance of gastrointestinal epithelium (GO:0030277)|negative regulation of endopeptidase activity (GO:0010951)|regulation of lipid metabolic process (GO:0019216)|regulation of proteolysis (GO:0030162)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)	DNA binding (GO:0003677)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(17)|ovary(2)|pancreas(1)|skin(3)|stomach(1)	40		all_cancers(154;0.0525)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.212)|Epithelial(152;0.228)		TTTGCCACTGACTTTCAGGAC	0.502																																					p.D169G		Atlas-SNP	.											.	SERPINA3	78	.	0			c.A506G						PASS	.						92.0	86.0	88.0					14																	95081284		2203	4300	6503	SO:0001583	missense	12	exon2			CCACTGACTTTCA	K01500	CCDS32150.1	14q32.1	2014-06-03	2005-08-18		ENSG00000196136	ENSG00000196136		"""Serine (or cysteine) peptidase inhibitors"""	16	protein-coding gene	gene with protein product		107280	"""alpha-1-antichymotrypsin"", ""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3"""	AACT		3260956, 24172014	Standard	NM_001085		Approved	ACT, alpha-1-antichymotrypsin	uc001ydp.3	P01011	OTTHUMG00000029851	ENST00000467132.1:c.506A>G	chr14.hg19:g.95081284A>G	ENSP00000450540:p.Asp169Gly	61.0	0.0	.		79.0	39.0	.	NM_001085	B3KVQ7|Q13703|Q2TU87|Q2TU88|Q59GP9|Q6LBY8|Q6LDT7|Q6NSC9|Q8N177|Q96DW8|Q9UC47|Q9UNU9	Missense_Mutation	SNP	ENST00000467132.1	hg19	CCDS32150.1	.	.	.	.	.	.	.	.	.	.	A	16.28	3.077587	0.55753	.	.	ENSG00000196136	ENST00000553947;ENST00000393078;ENST00000393080;ENST00000555820;ENST00000467132	D;D;D;D	0.88975	-2.45;-2.45;-2.45;-2.45	5.13	5.13	0.70059	Serpin domain (3);	0.523027	0.19106	N	0.122568	D	0.94568	0.8250	M	0.89287	3.02	0.45676	D	0.99859	D;D	0.63880	0.984;0.993	P;P	0.62089	0.896;0.898	D	0.95248	0.8357	10	0.72032	D	0.01	.	14.4161	0.67151	1.0:0.0:0.0:0.0	.	169;194	P01011;G3V5I3	AACT_HUMAN;.	G	194;169;169;169;169	ENSP00000452367:D194G;ENSP00000376793:D169G;ENSP00000376795:D169G;ENSP00000450540:D169G	ENSP00000376793:D169G	D	+	2	0	SERPINA3	94151037	0.969000	0.33509	0.201000	0.23476	0.040000	0.13550	3.607000	0.54102	2.046000	0.60703	0.459000	0.35465	GAC	.	.	.	none		0.502	SERPINA3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268080.3	NM_001085	
JAG2	3714	hgsc.bcm.edu	37	14	105621904	105621904	+	Silent	SNP	C	C	T			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr14:105621904C>T	ENST00000331782.3	-	5	1186	c.783G>A	c.(781-783)gaG>gaA	p.E261E	RP11-44N21.4_ENST00000548203.1_RNA|JAG2_ENST00000347004.2_Silent_p.E261E	NM_002226.4	NP_002217.3	Q9Y219	JAG2_HUMAN	jagged 2	261	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				auditory receptor cell fate commitment (GO:0009912)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|epithelial cell apoptotic process involved in palatal shelf morphogenesis (GO:1990134)|gamma-delta T cell differentiation (GO:0042492)|in utero embryonic development (GO:0001701)|morphogenesis of embryonic epithelium (GO:0016331)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|respiratory system process (GO:0003016)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|T cell differentiation (GO:0030217)|thymic T cell selection (GO:0045061)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)			breast(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(7)|prostate(2)|skin(5)	22		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		CTCACCTGCACTCCCCAGGCA	0.632																																					p.E261E		Atlas-SNP	.											.	JAG2	69	.	0			c.G783A						PASS	.						99.0	103.0	101.0					14																	105621904		2203	4300	6503	SO:0001819	synonymous_variant	3714	exon5			CCTGCACTCCCCA	AF020201	CCDS9998.1, CCDS9999.1	14q32	2008-08-01			ENSG00000184916	ENSG00000184916			6189	protein-coding gene	gene with protein product		602570				9315665, 10662552	Standard	NM_002226		Approved		uc001yqg.4	Q9Y219	OTTHUMG00000140172	ENST00000331782.3:c.783G>A	chr14.hg19:g.105621904C>T		123.0	0.0	.		155.0	78.0	.	NM_145159	Q9UE17|Q9UE99|Q9UNK8|Q9Y6P9|Q9Y6Q0	Silent	SNP	ENST00000331782.3	hg19	CCDS9998.1																																																																																			.	.	.	none		0.632	JAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276506.2		
RAB8B	51762	hgsc.bcm.edu	37	15	63548782	63548782	+	Nonsense_Mutation	SNP	A	A	T	rs202115341		TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr15:63548782A>T	ENST00000321437.4	+	5	559	c.403A>T	c.(403-405)Aga>Tga	p.R135*	RAB8B_ENST00000448330.2_Nonsense_Mutation_p.R135*	NM_016530.2	NP_057614.1	Q92930	RAB8B_HUMAN	RAB8B, member RAS oncogene family	135					adherens junction organization (GO:0034332)|antigen processing and presentation (GO:0019882)|GTP catabolic process (GO:0006184)|positive regulation of cell projection organization (GO:0031346)|positive regulation of corticotropin secretion (GO:0051461)|protein import into peroxisome membrane (GO:0045046)|small GTPase mediated signal transduction (GO:0007264)	cell tip (GO:0051286)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|receptor binding (GO:0005102)			kidney(3)|large_intestine(2)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	9						GTCAAAAGAAAGAGGGGAGAA	0.343																																					p.R135X		Atlas-SNP	.											.	RAB8B	23	.	0			c.A403T						PASS	.						100.0	95.0	97.0					15																	63548782		2203	4300	6503	SO:0001587	stop_gained	51762	exon5			AAAGAAAGAGGGG	AL833365	CCDS10183.1	15q22	2008-11-18			ENSG00000166128	ENSG00000166128		"""RAB, member RAS oncogene"""	30273	protein-coding gene	gene with protein product		613532				9030196, 18772196	Standard	XM_006720569		Approved		uc002alz.3	Q92930	OTTHUMG00000132862	ENST00000321437.4:c.403A>T	chr15.hg19:g.63548782A>T	ENSP00000312734:p.Arg135*	86.0	0.0	.		84.0	42.0	.	NM_016530	Q5JPC4|Q9P293	Nonsense_Mutation	SNP	ENST00000321437.4	hg19	CCDS10183.1	.	.	.	.	.	.	.	.	.	.	A	20.5	3.996156	0.74703	.	.	ENSG00000166128	ENST00000321437;ENST00000448330	.	.	.	5.61	5.61	0.85477	.	0.079005	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	.	14.9901	0.71381	1.0:0.0:0.0:0.0	.	.	.	.	X	135	.	ENSP00000312734:R135X	R	+	1	2	RAB8B	61335835	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.066000	0.71185	2.131000	0.65755	0.533000	0.62120	AGA	.	A|1.000;G|0.000	.	alt		0.343	RAB8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256336.1	NM_016530	
HERC1	8925	hgsc.bcm.edu	37	15	63953965	63953965	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr15:63953965T>G	ENST00000443617.2	-	45	9244	c.9157A>C	c.(9157-9159)Aca>Cca	p.T3053P		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	3053					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						TCAGAACTTGTTGACTTAGAT	0.448																																					p.T3053P		Atlas-SNP	.											.	HERC1	624	.	0			c.A9157C						PASS	.						158.0	146.0	150.0					15																	63953965		1961	4150	6111	SO:0001583	missense	8925	exon45			AACTTGTTGACTT	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.9157A>C	chr15.hg19:g.63953965T>G	ENSP00000390158:p.Thr3053Pro	120.0	0.0	.		134.0	53.0	.	NM_003922	Q8IW65	Missense_Mutation	SNP	ENST00000443617.2	hg19	CCDS45277.1	.	.	.	.	.	.	.	.	.	.	T	11.66	1.706292	0.30232	.	.	ENSG00000103657	ENST00000443617	T	0.24538	1.85	5.92	0.624	0.17659	.	0.249806	0.33631	U	0.004712	T	0.11024	0.0269	N	0.10809	0.05	0.41003	D	0.984949	B	0.02656	0.0	B	0.01281	0.0	T	0.09487	-1.0672	10	0.48119	T	0.1	.	5.1239	0.14875	0.1861:0.2447:0.0:0.5692	.	3053	Q15751	HERC1_HUMAN	P	3053	ENSP00000390158:T3053P	ENSP00000390158:T3053P	T	-	1	0	HERC1	61741018	0.938000	0.31826	0.970000	0.41538	0.987000	0.75469	1.624000	0.37018	0.136000	0.18733	0.528000	0.53228	ACA	.	.	.	none		0.448	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922	
BNC1	646	hgsc.bcm.edu	37	15	83935687	83935687	+	Silent	SNP	C	C	A			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr15:83935687C>A	ENST00000345382.2	-	3	421	c.336G>T	c.(334-336)ctG>ctT	p.L112L	RP11-382A20.4_ENST00000565495.1_RNA|BNC1_ENST00000569704.1_Silent_p.L105L	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	112					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						AGAGCCGGTCCAGTAGGATTT	0.507																																					p.L112L		Atlas-SNP	.											.	BNC1	149	.	0			c.G336T						PASS	.						121.0	113.0	115.0					15																	83935687		2203	4300	6503	SO:0001819	synonymous_variant	646	exon3			CCGGTCCAGTAGG	L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.336G>T	chr15.hg19:g.83935687C>A		115.0	0.0	.		155.0	78.0	.	NM_001717	Q15840	Silent	SNP	ENST00000345382.2	hg19	CCDS10324.1																																																																																			.	.	.	none		0.507	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304006.1	NM_001717	
SMCR8	140775	hgsc.bcm.edu	37	17	18220177	18220177	+	Silent	SNP	T	T	C			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr17:18220177T>C	ENST00000406438.3	+	1	1554	c.1074T>C	c.(1072-1074)gaT>gaC	p.D358D	TOP3A_ENST00000321105.5_5'Flank|TOP3A_ENST00000542570.1_5'Flank|TOP3A_ENST00000582230.1_5'Flank	NM_144775.2	NP_658988.2	Q8TEV9	SMCR8_HUMAN	Smith-Magenis syndrome chromosome region, candidate 8	358						nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	21						GTCAGATTGATAGAGCACTTC	0.443																																					p.D358D		Atlas-SNP	.											.	SMCR8	62	.	0			c.T1074C						PASS	.						93.0	90.0	91.0					17																	18220177		2203	4300	6503	SO:0001819	synonymous_variant	140775	exon1			GATTGATAGAGCA	AF467440	CCDS11195.2	17p11.2	2014-06-12			ENSG00000176994	ENSG00000176994			17921	protein-coding gene	gene with protein product						11997338, 23248642	Standard	NM_144775		Approved	FLJ34716	uc002gsy.4	Q8TEV9	OTTHUMG00000059394	ENST00000406438.3:c.1074T>C	chr17.hg19:g.18220177T>C		90.0	0.0	.		158.0	50.0	.	NM_144775	A5PKZ5|Q3ZCN0|Q6PJL3	Silent	SNP	ENST00000406438.3	hg19	CCDS11195.2																																																																																			.	.	.	none		0.443	SMCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132065.2	NM_144775	
KIAA0100	9703	hgsc.bcm.edu	37	17	26943748	26943748	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr17:26943748G>C	ENST00000528896.2	-	35	6119	c.6045C>G	c.(6043-6045)atC>atG	p.I2015M	SPAG5-AS1_ENST00000554154.1_RNA|SGK494_ENST00000301037.5_5'Flank|SPAG5-AS1_ENST00000414744.1_RNA|SPAG5-AS1_ENST00000424210.1_RNA|RP11-192H23.4_ENST00000577790.1_5'Flank|KIAA0100_ENST00000544884.1_Missense_Mutation_p.I1872M|RP11-192H23.4_ENST00000534850.1_5'Flank|SGK494_ENST00000469832.3_5'Flank|KIAA0100_ENST00000579924.2_5'UTR|KIAA0100_ENST00000389003.3_Missense_Mutation_p.I1872M	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	2015						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					GTGTCAGCTGGATGGTGAGAG	0.418																																					p.I2015M		Atlas-SNP	.											.	KIAA0100	175	.	0			c.C6045G						PASS	.						91.0	90.0	90.0					17																	26943748		2203	4300	6503	SO:0001583	missense	9703	exon35			CAGCTGGATGGTG	D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.6045C>G	chr17.hg19:g.26943748G>C	ENSP00000436773:p.Ile2015Met	89.0	0.0	.		157.0	98.0	.	NM_014680	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	ENST00000528896.2	hg19	CCDS32595.1	.	.	.	.	.	.	.	.	.	.	G	16.14	3.038680	0.55003	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896;ENST00000544884	T;T	0.56611	0.45;0.45	5.87	4.9	0.64082	FMP27,  C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.71126	0.3303	M	0.75615	2.305	0.58432	D	0.999996	D	0.89917	1.0	D	0.91635	0.999	T	0.74968	-0.3483	10	0.87932	D	0	.	12.8127	0.57649	0.1357:0.0:0.8643:0.0	.	2015	Q14667	K0100_HUMAN	M	2015;1985;2015;1872	ENSP00000436773:I2015M;ENSP00000446443:I1872M	ENSP00000005905:I2015M	I	-	3	3	KIAA0100	23967875	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.779000	0.55379	1.482000	0.48325	0.561000	0.74099	ATC	.	.	.	none		0.418	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	NM_014680	
SSH2	85464	hgsc.bcm.edu	37	17	27959406	27959406	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr17:27959406C>G	ENST00000269033.3	-	15	2876	c.2725G>C	c.(2725-2727)Gca>Cca	p.A909P	SSH2_ENST00000540801.1_Missense_Mutation_p.A936P|RP11-68I3.2_ENST00000581474.1_RNA	NM_001282129.1|NM_033389.2	NP_001269058.1|NP_203747.2	Q76I76	SSH2_HUMAN	slingshot protein phosphatase 2	909					actin cytoskeleton organization (GO:0030036)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)		SSH2/SUZ12(2)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CCTTTTGGTGCTAGGTCTGCC	0.488																																					p.A909P		Atlas-SNP	.											.	SSH2	107	.	0			c.G2725C						PASS	.						198.0	211.0	206.0					17																	27959406		2203	4300	6503	SO:0001583	missense	85464	exon15			TTGGTGCTAGGTC	AB072359	CCDS11253.1, CCDS74024.1	17q11.2	2013-03-05	2013-03-05		ENSG00000141298	ENSG00000141298		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30580	protein-coding gene	gene with protein product		606779	"""slingshot homolog 2 (Drosophila)"""			11832213, 11214970	Standard	XM_005258059		Approved	KIAA1725	uc002heo.1	Q76I76	OTTHUMG00000132752	ENST00000269033.3:c.2725G>C	chr17.hg19:g.27959406C>G	ENSP00000269033:p.Ala909Pro	401.0	0.0	.		614.0	355.0	.	NM_033389	Q8TDB5|Q8WYL1|Q8WYL2|Q96F40|Q96H36|Q9C0D8	Missense_Mutation	SNP	ENST00000269033.3	hg19	CCDS11253.1	.	.	.	.	.	.	.	.	.	.	C	11.09	1.535294	0.27475	.	.	ENSG00000141298	ENST00000269033;ENST00000540801	T;T	0.10288	2.89;2.89	5.97	2.62	0.31277	.	1.241560	0.05233	N	0.510668	T	0.13415	0.0325	L	0.54323	1.7	0.09310	N	1	P;P	0.46220	0.874;0.8	P;B	0.44990	0.466;0.276	T	0.21075	-1.0256	10	0.34782	T	0.22	-0.0415	1.9181	0.03301	0.1384:0.4444:0.1353:0.2819	.	936;909	F5H527;Q76I76	.;SSH2_HUMAN	P	909;936	ENSP00000269033:A909P;ENSP00000444743:A936P	ENSP00000269033:A909P	A	-	1	0	SSH2	24983532	0.015000	0.18098	0.385000	0.26158	0.507000	0.33981	0.589000	0.23939	0.853000	0.35312	-0.245000	0.11935	GCA	.	.	.	none		0.488	SSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256116.1	NM_033389	
ZNF830	91603	hgsc.bcm.edu	37	17	33289325	33289325	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr17:33289325C>G	ENST00000361952.3	+	1	777	c.740C>G	c.(739-741)cCg>cGg	p.P247R	CCT6B_ENST00000436961.3_5'Flank|CCT6B_ENST00000421975.3_5'Flank|CCT6B_ENST00000314144.5_5'Flank	NM_052857.3	NP_443089.3	Q96NB3	ZN830_HUMAN	zinc finger protein 830	247					blastocyst growth (GO:0001832)|mitotic nuclear division (GO:0007067)|nuclear cell cycle DNA replication (GO:0033260)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|large_intestine(1)|liver(2)|lung(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		Ovarian(249;0.17)				GAAGCGTTACCGGAAGGTTTT	0.463																																					p.P247R		Atlas-SNP	.											.	ZNF830	26	.	0			c.C740G						PASS	.						60.0	58.0	59.0					17																	33289325		2203	4300	6503	SO:0001583	missense	91603	exon1			CGTTACCGGAAGG	AK055707	CCDS32618.1	17q12	2013-10-23	2008-03-25	2008-03-25	ENSG00000198783	ENSG00000198783			28291	protein-coding gene	gene with protein product	"""orphan maintenance of genome 1"""		"""coiled-coil domain containing 16"""	CCDC16		23066043	Standard	NM_052857		Approved	MGC20398, OMCG1	uc002hih.4	Q96NB3	OTTHUMG00000179771	ENST00000361952.3:c.740C>G	chr17.hg19:g.33289325C>G	ENSP00000354518:p.Pro247Arg	62.0	0.0	.		90.0	55.0	.	NM_052857	Q96F60|Q96GZ5|Q9BU38	Missense_Mutation	SNP	ENST00000361952.3	hg19	CCDS32618.1	.	.	.	.	.	.	.	.	.	.	C	19.09	3.760549	0.69763	.	.	ENSG00000198783	ENST00000361952	D	0.83837	-1.77	5.98	5.02	0.67125	.	0.000000	0.85682	D	0.000000	D	0.91233	0.7237	M	0.86502	2.82	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92053	0.5650	10	0.72032	D	0.01	-15.6542	11.0329	0.47783	0.0:0.9152:0.0:0.0848	.	247	Q96NB3	ZN830_HUMAN	R	247	ENSP00000354518:P247R	ENSP00000354518:P247R	P	+	2	0	ZNF830	30313438	1.000000	0.71417	0.991000	0.47740	0.997000	0.91878	6.618000	0.74214	1.552000	0.49463	0.591000	0.81541	CCG	.	.	.	none		0.463	ZNF830-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448018.1	NM_052857	
LIG3	3980	hgsc.bcm.edu	37	17	33310454	33310454	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr17:33310454T>C	ENST00000378526.4	+	2	563	c.430T>C	c.(430-432)Ttt>Ctt	p.F144L	LIG3_ENST00000586407.1_Intron|LIG3_ENST00000262327.5_Missense_Mutation_p.F144L	NM_013975.3	NP_039269.2	P49916	DNLI3_HUMAN	ligase III, DNA, ATP-dependent	144					base-excision repair (GO:0006284)|base-excision repair, DNA ligation (GO:0006288)|DNA biosynthetic process (GO:0071897)|DNA repair (GO:0006281)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitochondrial DNA repair (GO:0043504)|negative regulation of DNA recombination (GO:0045910)|nucleotide-excision repair (GO:0006289)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(8)|lung(9)|ovary(3)|pancreas(2)|prostate(1)|skin(3)|stomach(1)	31		Ovarian(249;0.17)			Bleomycin(DB00290)	TAAATGCATGTTTGAGAAACT	0.488								Other BER factors																													p.F144L		Atlas-SNP	.											.	LIG3	164	.	0			c.T430C						PASS	.						51.0	50.0	50.0					17																	33310454		2203	4300	6503	SO:0001583	missense	3980	exon2			TGCATGTTTGAGA		CCDS11284.2, CCDS11285.2	17q11.2-q12	2008-10-29			ENSG00000005156	ENSG00000005156			6600	protein-coding gene	gene with protein product		600940	"""ligase II, DNA, ATP-dependent"""	LIG2		7760816	Standard	NM_002311		Approved		uc002hik.2	P49916	OTTHUMG00000128519	ENST00000378526.4:c.430T>C	chr17.hg19:g.33310454T>C	ENSP00000367787:p.Phe144Leu	22.0	0.0	.		66.0	42.0	.	NM_013975	Q16714|Q6NVK3	Missense_Mutation	SNP	ENST00000378526.4	hg19	CCDS11284.2	.	.	.	.	.	.	.	.	.	.	T	35	5.433129	0.96150	.	.	ENSG00000005156	ENST00000378526;ENST00000262327	T;T	0.28255	1.62;1.62	5.84	5.84	0.93424	Zinc finger, PARP-type (3);	0.000000	0.85682	D	0.000000	T	0.53818	0.1820	M	0.62209	1.925	0.80722	D	1	D;D;D;D	0.89917	0.998;0.998;0.989;1.0	D;D;D;D	0.97110	0.99;0.99;0.984;1.0	T	0.55768	-0.8089	10	0.72032	D	0.01	-10.3188	15.397	0.74805	0.0:0.0:0.0:1.0	.	144;144;144;144	E5KLB5;P49916;E5KLB6;Q96DF0	.;DNLI3_HUMAN;.;.	L	144	ENSP00000367787:F144L;ENSP00000262327:F144L	ENSP00000262327:F144L	F	+	1	0	LIG3	30334567	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.845000	0.86875	2.243000	0.73865	0.533000	0.62120	TTT	.	.	.	none		0.488	LIG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250330.3	NM_013975	
SLC35G3	146861	hgsc.bcm.edu	37	17	33520712	33520712	+	Silent	SNP	C	C	T			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr17:33520712C>T	ENST00000297307.5	-	1	700	c.615G>A	c.(613-615)ctG>ctA	p.L205L	RP11-799D4.2_ENST00000590144.1_RNA	NM_152462.2	NP_689675.1	Q8N808	S35G3_HUMAN	solute carrier family 35, member G3	205						integral component of membrane (GO:0016021)											CCAGAAGCCTCAGGGACAGCG	0.627																																					p.L205L		Atlas-SNP	.											.	.	.	.	0			c.G615A						PASS	.						91.0	98.0	96.0					17																	33520712		2203	4300	6503	SO:0001819	synonymous_variant	146861	exon1			AAGCCTCAGGGAC	AK097473	CCDS11293.1	17q21.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000164729	ENSG00000164729		"""Solute carriers"""	26848	protein-coding gene	gene with protein product			"""transmembrane protein 21A"", ""acyl-malonyl condensing enzyme 1"""	TMEM21A, AMAC1			Standard	NM_152462		Approved	FLJ40154	uc002hjd.2	Q8N808	OTTHUMG00000132929	ENST00000297307.5:c.615G>A	chr17.hg19:g.33520712C>T		173.0	0.0	.		240.0	168.0	.	NM_152462	B9EGE9	Silent	SNP	ENST00000297307.5	hg19	CCDS11293.1																																																																																			.	.	.	none		0.627	SLC35G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256445.2	NM_152462	
STK11	6794	hgsc.bcm.edu	37	19	1220439	1220439	+	Nonsense_Mutation	SNP	A	A	T			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr19:1220439A>T	ENST00000326873.7	+	4	1705	c.532A>T	c.(532-534)Aag>Tag	p.K178*		NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11	178	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)|p.Y156fs*87(4)|p.?(4)|p.K178fs*86(1)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		CAAGGACATCAAGCCGGGGAA	0.662		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																											p.K178X		Atlas-SNP	.	yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	serine/threonine kinase 11 gene (LKB1)		"""E, M, O"""	.	STK11	410	.	29	Whole gene deletion(20)|Deletion - Frameshift(5)|Unknown(4)	cervix(15)|lung(9)|oesophagus(1)|ovary(1)|prostate(1)|kidney(1)|pancreas(1)	c.A532T						PASS	.						44.0	52.0	49.0					19																	1220439		2098	4239	6337	SO:0001587	stop_gained	6794	exon4	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	GACATCAAGCCGG	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		ENST00000326873.7:c.532A>T	chr19.hg19:g.1220439A>T	ENSP00000324856:p.Lys178*	21.0	0.0	.		18.0	9.0	.	NM_000455	B2RBX7|E7EW76	Nonsense_Mutation	SNP	ENST00000326873.7	hg19	CCDS45896.1	.	.	.	.	.	.	.	.	.	.	A	47	13.228355	0.99728	.	.	ENSG00000118046	ENST00000326873;ENST00000405031	.	.	.	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-49.8258	14.9586	0.71138	1.0:0.0:0.0:0.0	.	.	.	.	X	178	.	ENSP00000324856:K178X	K	+	1	0	STK11	1171439	1.000000	0.71417	1.000000	0.80357	0.416000	0.31233	9.209000	0.95087	2.135000	0.66039	0.459000	0.35465	AAG	.	.	.	none		0.662	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449839.3	NM_000455	
EPS15L1	58513	hgsc.bcm.edu	37	19	16513268	16513268	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr19:16513268T>C	ENST00000248070.6	-	16	1794	c.1655A>G	c.(1654-1656)gAa>gGa	p.E552G	EPS15L1_ENST00000594975.1_Missense_Mutation_p.E552G|EPS15L1_ENST00000455140.2_Missense_Mutation_p.E552G|EPS15L1_ENST00000597937.1_Missense_Mutation_p.E552G|EPS15L1_ENST00000602009.1_Missense_Mutation_p.E398G|EPS15L1_ENST00000535753.2_Missense_Mutation_p.E552G	NM_021235.2	NP_067058.1	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway substrate 15-like 1	552					endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	clathrin coat of coated pit (GO:0030132)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(4)|skin(2)	30						CTGGCGGCTTTCATGCAGCTG	0.537																																					p.E552G		Atlas-SNP	.											.	EPS15L1	81	.	0			c.A1655G						PASS	.						56.0	56.0	56.0					19																	16513268		2203	4300	6503	SO:0001583	missense	58513	exon16			CGGCTTTCATGCA	AF110265	CCDS32944.1, CCDS58653.1, CCDS58654.1, CCDS59363.1	19p13.12	2013-01-10				ENSG00000127527		"""EF-hand domain containing"""	24634	protein-coding gene	gene with protein product							Standard	NM_001258374		Approved	eps15R	uc002ndx.4	Q9UBC2		ENST00000248070.6:c.1655A>G	chr19.hg19:g.16513268T>C	ENSP00000248070:p.Glu552Gly	68.0	0.0	.		115.0	51.0	.	NM_021235	A2RRF3|A5PL29|B4DKA3	Missense_Mutation	SNP	ENST00000248070.6	hg19	CCDS32944.1	.	.	.	.	.	.	.	.	.	.	T	25.0	4.595745	0.86953	.	.	ENSG00000127527	ENST00000455140;ENST00000248070;ENST00000535753	D;T;T	0.87966	-2.32;1.65;1.24	5.5	5.5	0.81552	.	0.053238	0.64402	D	0.000001	D	0.89093	0.6617	L	0.52011	1.625	0.58432	D	0.999994	D;D;P;P;P;P	0.62365	0.991;0.975;0.952;0.952;0.955;0.913	P;P;P;P;P;P	0.58970	0.849;0.77;0.606;0.606;0.606;0.702	D	0.87153	0.2210	10	0.27785	T	0.31	.	12.9903	0.58614	0.0:0.0:0.0:1.0	.	552;552;551;552;552;552	A8K5P4;A5PL29;A5PKY0;A2RRF3;Q9UBC2;G3V0H2	.;.;.;.;EP15R_HUMAN;.	G	552	ENSP00000393313:E552G;ENSP00000248070:E552G;ENSP00000440103:E552G	ENSP00000248070:E552G	E	-	2	0	EPS15L1	16374268	1.000000	0.71417	0.763000	0.31416	0.892000	0.51952	7.218000	0.77991	2.096000	0.63516	0.533000	0.62120	GAA	.	.	.	none		0.537	EPS15L1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000461040.1	NM_021235	
ZNF676	163223	hgsc.bcm.edu	37	19	22363129	22363129	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr19:22363129A>C	ENST00000397121.2	-	3	1707	c.1390T>G	c.(1390-1392)Ttt>Gtt	p.F464V		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	464					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				TGTTTAGTAAAGCTTGAGGAC	0.413																																					p.F464V		Atlas-SNP	.											.	ZNF676	146	.	0			c.T1390G						PASS	.						126.0	131.0	129.0					19																	22363129		2157	4266	6423	SO:0001583	missense	163223	exon3			TAGTAAAGCTTGA	AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.1390T>G	chr19.hg19:g.22363129A>C	ENSP00000380310:p.Phe464Val	255.0	0.0	.		248.0	103.0	.	NM_001001411	A8MVX5	Missense_Mutation	SNP	ENST00000397121.2	hg19	CCDS42539.1	.	.	.	.	.	.	.	.	.	.	.	2.545	-0.305325	0.05495	.	.	ENSG00000196109	ENST00000397121	T	0.18338	2.22	0.149	-0.298	0.12814	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07908	0.0198	N	0.11673	0.155	0.09310	N	1	B	0.27951	0.195	B	0.24394	0.053	T	0.27262	-1.0079	9	0.72032	D	0.01	.	4.6797	0.12729	0.3583:0.0:0.6417:0.0	.	464	Q8N7Q3	ZN676_HUMAN	V	464	ENSP00000380310:F464V	ENSP00000380310:F464V	F	-	1	0	ZNF676	22154969	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.610000	0.05629	-1.346000	0.02211	-1.381000	0.01174	TTT	.	.	.	none		0.413	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464392.1	NM_001001411	
ZNF416	55659	hgsc.bcm.edu	37	19	58083736	58083736	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr19:58083736G>C	ENST00000196489.3	-	4	1758	c.1536C>G	c.(1534-1536)caC>caG	p.H512Q		NM_017879.1	NP_060349.1	Q9BWM5	ZN416_HUMAN	zinc finger protein 416	512					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|large_intestine(5)|lung(12)|prostate(1)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0259)		GAATTTTCTGGTGTTCAACGA	0.438																																					p.H512Q		Atlas-SNP	.											.	ZNF416	50	.	0			c.C1536G						PASS	.						99.0	99.0	99.0					19																	58083736		2203	4300	6503	SO:0001583	missense	55659	exon4			TTTCTGGTGTTCA	BC000130	CCDS12954.1	19q13.4	2013-01-08				ENSG00000083817		"""Zinc fingers, C2H2-type"", ""-"""	20645	protein-coding gene	gene with protein product							Standard	NM_017879		Approved	FLJ20557	uc002qpf.3	Q9BWM5		ENST00000196489.3:c.1536C>G	chr19.hg19:g.58083736G>C	ENSP00000196489:p.His512Gln	137.0	0.0	.		140.0	65.0	.	NM_017879	Q9NWW8	Missense_Mutation	SNP	ENST00000196489.3	hg19	CCDS12954.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.017774	0.75161	.	.	ENSG00000083817	ENST00000196489;ENST00000359489;ENST00000428052	D	0.86865	-2.18	3.58	1.43	0.22495	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.93776	0.8010	M	0.93808	3.46	0.29684	N	0.841443	D	0.89917	1.0	D	0.91635	0.999	D	0.86737	0.1952	9	0.72032	D	0.01	.	6.7993	0.23742	0.3194:0.0:0.6806:0.0	.	512	Q9BWM5	ZN416_HUMAN	Q	512;415;410	ENSP00000196489:H512Q	ENSP00000196489:H512Q	H	-	3	2	ZNF416	62775548	0.022000	0.18835	0.039000	0.18376	0.939000	0.58152	0.165000	0.16564	0.838000	0.34948	0.655000	0.94253	CAC	.	.	.	none		0.438	ZNF416-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466787.1	NM_017879	
ZNF416	55659	hgsc.bcm.edu	37	19	58083765	58083765	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr19:58083765A>G	ENST00000196489.3	-	4	1729	c.1507T>C	c.(1507-1509)Ttt>Ctt	p.F503L		NM_017879.1	NP_060349.1	Q9BWM5	ZN416_HUMAN	zinc finger protein 416	503					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|large_intestine(5)|lung(12)|prostate(1)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0259)		CTTTGTCTAAAAAATTTCCCA	0.418																																					p.F503L		Atlas-SNP	.											.	ZNF416	50	.	0			c.T1507C						PASS	.						80.0	81.0	81.0					19																	58083765		2203	4300	6503	SO:0001583	missense	55659	exon4			GTCTAAAAAATTT	BC000130	CCDS12954.1	19q13.4	2013-01-08				ENSG00000083817		"""Zinc fingers, C2H2-type"", ""-"""	20645	protein-coding gene	gene with protein product							Standard	NM_017879		Approved	FLJ20557	uc002qpf.3	Q9BWM5		ENST00000196489.3:c.1507T>C	chr19.hg19:g.58083765A>G	ENSP00000196489:p.Phe503Leu	124.0	0.0	.		138.0	64.0	.	NM_017879	Q9NWW8	Missense_Mutation	SNP	ENST00000196489.3	hg19	CCDS12954.1	.	.	.	.	.	.	.	.	.	.	A	35	5.419811	0.96111	.	.	ENSG00000083817	ENST00000196489;ENST00000359489;ENST00000428052	T	0.46063	0.88	3.48	3.48	0.39840	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.64594	0.2612	M	0.82517	2.595	0.41420	D	0.987799	D	0.89917	1.0	D	0.91635	0.999	T	0.70605	-0.4826	9	0.87932	D	0	.	11.3666	0.49675	1.0:0.0:0.0:0.0	.	503	Q9BWM5	ZN416_HUMAN	L	503;406;401	ENSP00000196489:F503L	ENSP00000196489:F503L	F	-	1	0	ZNF416	62775577	1.000000	0.71417	0.060000	0.19600	0.888000	0.51559	5.931000	0.70113	1.577000	0.49804	0.533000	0.62120	TTT	.	.	.	none		0.418	ZNF416-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466787.1	NM_017879	
REM1	28954	hgsc.bcm.edu	37	20	30064536	30064536	+	Silent	SNP	G	G	A			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr20:30064536G>A	ENST00000201979.2	+	2	581	c.288G>A	c.(286-288)ttG>ttA	p.L96L	DEFB124_ENST00000481595.1_5'UTR	NM_014012.4	NP_054731.2	O75628	REM1_HUMAN	RAS (RAD and GEM)-like GTP-binding 1	96					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)			kidney(3)|large_intestine(3)|lung(14)|pancreas(2)|upper_aerodigestive_tract(1)	23	all_cancers(5;0.000119)|Lung NSC(7;1.32e-05)|all_lung(7;2.14e-05)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			AGACCAGCTTGGCCAGCCTCT	0.582																																					p.L96L		Atlas-SNP	.											.	REM1	54	.	0			c.G288A						PASS	.						41.0	38.0	39.0					20																	30064536		2203	4300	6503	SO:0001819	synonymous_variant	28954	exon2			CAGCTTGGCCAGC	AF152863	CCDS13181.1	20q11.21	2014-05-09	2004-04-14	2004-04-16	ENSG00000088320	ENSG00000088320			15922	protein-coding gene	gene with protein product	"""GTPase GES"""	610388	"""RAS (RAD and GEM)-like GTP-binding"""	REM		10831614, 14623965	Standard	NM_014012		Approved	GES	uc002wwa.3	O75628	OTTHUMG00000032168	ENST00000201979.2:c.288G>A	chr20.hg19:g.30064536G>A		43.0	0.0	.		47.0	27.0	.	NM_014012	E1P5L1|Q5TZR7|Q5TZR8|Q9NP57	Silent	SNP	ENST00000201979.2	hg19	CCDS13181.1																																																																																			.	.	.	none		0.582	REM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078508.2	NM_014012	
PIGU	128869	hgsc.bcm.edu	37	20	33163023	33163023	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr20:33163023C>T	ENST00000374820.2	-	10	1039	c.1019G>A	c.(1018-1020)tGc>tAc	p.C340Y	PIGU_ENST00000452740.2_Missense_Mutation_p.C360Y			Q9H490	PIGU_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class U	360					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|regulation of JAK-STAT cascade (GO:0046425)	endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	9						GATGATGATGCAGGTGAGGAC	0.512																																					p.C360Y		Atlas-SNP	.											.	PIGU	35	.	0			c.G1079A						PASS	.						181.0	141.0	155.0					20																	33163023		2203	4300	6503	SO:0001583	missense	128869	exon11			ATGATGCAGGTGA	AL118520	CCDS13239.1	20q11.22	2013-02-26	2006-11-07	2006-11-07	ENSG00000101464	ENSG00000101464		"""Phosphatidylinositol glycan anchor biosynthesis"""	15791	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	608528	"""CDC91 (cell division cycle 91, S. cerevisiae, homolog)-like 1"", ""CDC91 cell division cycle 91-like 1 (S. cerevisiae)"""	CDC91L1		12802054, 15034568	Standard	NM_080476		Approved	bA346K17.2, GAB1	uc002xas.3	Q9H490	OTTHUMG00000032304	ENST00000374820.2:c.1019G>A	chr20.hg19:g.33163023C>T	ENSP00000363953:p.Cys340Tyr	59.0	0.0	.		47.0	19.0	.	NM_080476	Q7Z489|Q8N2F2	Missense_Mutation	SNP	ENST00000374820.2	hg19		.	.	.	.	.	.	.	.	.	.	C	24.8	4.572584	0.86542	.	.	ENSG00000101464	ENST00000217446;ENST00000374820;ENST00000452740;ENST00000438215	.	.	.	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.76695	0.4023	M	0.70595	2.14	0.80722	D	1	D;D;D	0.76494	0.999;0.997;0.997	D;D;D	0.87578	0.998;0.991;0.995	T	0.70121	-0.4959	9	0.09084	T	0.74	-16.1694	19.1929	0.93674	0.0:1.0:0.0:0.0	.	360;340;360	E7EVL4;Q9H490-2;Q9H490	.;.;PIGU_HUMAN	Y	360;340;360;106	.	ENSP00000217446:C360Y	C	-	2	0	PIGU	32626684	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	5.845000	0.69437	2.711000	0.92665	0.655000	0.94253	TGC	.	.	.	none		0.512	PIGU-201	KNOWN	basic	protein_coding	protein_coding		NM_080476	
CSTF1	1477	hgsc.bcm.edu	37	20	54974310	54974310	+	Silent	SNP	T	T	A			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr20:54974310T>A	ENST00000217109.4	+	5	1285	c.933T>A	c.(931-933)tcT>tcA	p.S311S	CSTF1_ENST00000493039.1_3'UTR	NM_001033521.1|NM_001324.2	NP_001028693.1|NP_001315.1	Q05048	CSTF1_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa	311					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	15			Colorectal(105;0.202)			AAGTTTGTTCTGCCATTTTTT	0.398																																					p.S311S		Atlas-SNP	.											.	CSTF1	29	.	0			c.T933A						PASS	.						123.0	113.0	117.0					20																	54974310		2203	4300	6503	SO:0001819	synonymous_variant	1477	exon5			TTGTTCTGCCATT		CCDS13452.1	20q13.31	2013-01-10	2002-08-29		ENSG00000101138	ENSG00000101138		"""WD repeat domain containing"""	2483	protein-coding gene	gene with protein product		600369	"""cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kD"""			1358884, 11257228	Standard	NM_001033521		Approved		uc002xxl.1	Q05048	OTTHUMG00000032791	ENST00000217109.4:c.933T>A	chr20.hg19:g.54974310T>A		137.0	0.0	.		134.0	61.0	.	NM_001033522	Q5QPD8	Silent	SNP	ENST00000217109.4	hg19	CCDS13452.1																																																																																			.	.	.	none		0.398	CSTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079794.2	NM_001033521	
KCNJ15	3772	hgsc.bcm.edu	37	21	39671714	39671714	+	Silent	SNP	C	C	T			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr21:39671714C>T	ENST00000328656.4	+	4	834	c.531C>T	c.(529-531)acC>acT	p.T177T	KCNJ15_ENST00000398938.2_Silent_p.T177T|KCNJ15_ENST00000398930.1_Silent_p.T177T|KCNJ15_ENST00000398934.1_Silent_p.T177T|KCNJ15_ENST00000398932.1_Silent_p.T177T	NM_001276437.1|NM_001276438.1|NM_001276439.1|NM_002243.3	NP_001263366.1|NP_001263367.1|NP_001263368.1|NP_002234.2	Q99712	KCJ15_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 15	177					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	24					Yohimbine(DB01392)	GGGCTGAGACCATCAAGTTCA	0.507																																					p.E177D		Atlas-SNP	.											.	KCNJ15	43	.	0			c.A531T						PASS	.						65.0	62.0	63.0					21																	39671714		2203	4300	6503	SO:0001819	synonymous_variant	3772	exon4			TGAGACCATCAAG	Y10745	CCDS13656.1	21q22.2	2011-07-05			ENSG00000157551	ENSG00000157551		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6261	protein-coding gene	gene with protein product		602106				9299242, 8995301, 16382105	Standard	NM_170736		Approved	Kir4.2, Kir1.3, IRKK	uc002ywx.4	Q99712	OTTHUMG00000090609	ENST00000328656.4:c.531C>T	chr21.hg19:g.39671714C>T		74.0	0.0	.		70.0	26.0	.	NM_002243	D3DSH5|O00564|Q96L28|Q99446	Missense_Mutation	SNP	ENST00000328656.4	hg19	CCDS13656.1																																																																																			.	.	.	none		0.507	KCNJ15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207181.2	NM_002243	
CCDC157	550631	hgsc.bcm.edu	37	22	30771620	30771620	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr22:30771620A>G	ENST00000405659.1	+	10	2534	c.1825A>G	c.(1825-1827)Atc>Gtc	p.I609V	CCDC157_ENST00000338306.3_Missense_Mutation_p.I609V|RP1-130H16.16_ENST00000332468.4_RNA			Q569K6	CC157_HUMAN	coiled-coil domain containing 157	609										central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(1)	15						GCTGTCCAAAATCCGGGAAGT	0.612																																					p.I609V		Atlas-SNP	.											.	CCDC157	86	.	0			c.A1825G						PASS	.						49.0	47.0	48.0					22																	30771620		2203	4300	6503	SO:0001583	missense	550631	exon10			TCCAAAATCCGGG	BC018040	CCDS33632.2	22q12.2	2009-03-05			ENSG00000187860	ENSG00000187860			33854	protein-coding gene	gene with protein product							Standard	NM_001017437		Approved		uc011aku.2	Q569K6	OTTHUMG00000151007	ENST00000405659.1:c.1825A>G	chr22.hg19:g.30771620A>G	ENSP00000385357:p.Ile609Val	40.0	0.0	.		50.0	4.0	.	NM_001017437	Q0VD76|Q9BYA4	Missense_Mutation	SNP	ENST00000405659.1	hg19	CCDS33632.2	.	.	.	.	.	.	.	.	.	.	A	15.73	2.921236	0.52653	.	.	ENSG00000187860	ENST00000405659;ENST00000338306	T;T	0.77098	-1.07;-1.07	5.24	2.99	0.34606	.	0.148034	0.46145	D	0.000309	T	0.59851	0.2224	L	0.41236	1.265	0.80722	D	1	P	0.37731	0.607	B	0.30782	0.12	T	0.56547	-0.7961	10	0.26408	T	0.33	-23.0767	5.0133	0.14324	0.6607:0.1879:0.1514:0.0	.	609	Q569K6	CC157_HUMAN	V	609	ENSP00000385357:I609V;ENSP00000343087:I609V	ENSP00000343087:I609V	I	+	1	0	CCDC157	29101620	0.715000	0.27946	0.993000	0.49108	0.936000	0.57629	0.528000	0.23002	1.981000	0.57761	0.533000	0.62120	ATC	.	.	.	none		0.612	CCDC157-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320936.1	NM_001017437	
MT-ND2	4536	hgsc.bcm.edu	37	M	4838	4838	+	Silent	SNP	T	T	C			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chrM:4838T>C	ENST00000361453.3	+	1	369	c.369T>C	c.(367-369)ccT>ccC	p.P123P	MT-TQ_ENST00000387372.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-CO1_ENST00000361624.2_5'Flank|MT-CO2_ENST00000361739.1_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TM_ENST00000387377.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TD_ENST00000387419.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2	123					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						CAAGGCACCCCTCTGACATCC	0.438																																					p.P123P		Atlas-SNP	.											.	.	.	.	0			c.T369C						PASS	.																																			SO:0001819	synonymous_variant	0	exon1			CACCCCTCTGACA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891		ENST00000361453.3:c.369T>C	chrM.hg19:g.4838T>C		2.0	0.0	.		11.0	11.0	.	ENST00000361453	Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	Silent	SNP	ENST00000361453.3	hg19																																																																																				.	.	.	none		0.438	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024027	
PGBD2	267002	hgsc.bcm.edu	37	1	249211266	249211267	+	Frame_Shift_Ins	INS	-	-	A			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr1:249211266_249211267insA	ENST00000329291.5	+	3	630_631	c.483_484insA	c.(484-486)aatfs	p.N162fs	PGBD2_ENST00000462488.1_Intron|PGBD2_ENST00000355360.4_Intron|PGBD2_ENST00000539153.1_Frame_Shift_Ins_p.N159fs	NM_170725.2	NP_733843.1	Q6P3X8	PGBD2_HUMAN	piggyBac transposable element derived 2	162										NS(1)|endometrium(3)|lung(6)|ovary(1)|skin(3)	14	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			TTAATGAAACCAATCGTTATGC	0.376																																					p.T161fs		Atlas-INDEL	.											.	PGBD2	103	.	0			c.483_484insA						PASS	.																																			SO:0001589	frameshift_variant	267002	exon3			.	AF229602	CCDS31128.1, CCDS31129.1	1q	2008-02-05			ENSG00000185220	ENSG00000185220			19399	protein-coding gene	gene with protein product							Standard	XM_005270333		Approved		uc001ifh.3	Q6P3X8	OTTHUMG00000040424	ENST00000329291.5:c.485dupA	chr1.hg19:g.249211268_249211268dupA	ENSP00000331643:p.Asn162fs	213.0	0.0	0		241.0	105.0	0.435685	NM_170725	B3KVR8|Q6MZF8	Frame_Shift_Ins	INS	ENST00000329291.5	hg19	CCDS31128.1																																																																																			.	.	.	none		0.376	PGBD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000097318.1		
TDRD5	163589	hgsc.bcm.edu	37	1	179609125	179609129	+	Frame_Shift_Del	DEL	GTGTT	GTGTT	-			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	GTGTT	GTGTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr1:179609125_179609129delGTGTT	ENST00000367614.1	+	10	2031_2035	c.1672_1676delGTGTT	c.(1672-1677)gtgttcfs	p.VF558fs	TDRD5_ENST00000444136.1_Frame_Shift_Del_p.VF558fs|TDRD5_ENST00000294848.8_Frame_Shift_Del_p.VF558fs	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	558	Tudor. {ECO:0000255|PROSITE- ProRule:PRU00211}.				DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)				NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						GGAAGTTGAAGTGTTCTACCCAGAC	0.395																																					p.557_559del		Atlas-INDEL	.											.	TDRD5	149	.	0			c.1671_1675del						PASS	.																																			SO:0001589	frameshift_variant	163589	exon10			.	AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.1672_1676delGTGTT	chr1.hg19:g.179609125_179609129delGTGTT	ENSP00000356586:p.Val558fs	306.0	0.0	0		268.0	75.0	0.279851	NM_001199085	A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Frame_Shift_Del	DEL	ENST00000367614.1	hg19	CCDS1332.1																																																																																			.	.	.	none		0.395	TDRD5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000085295.1	NM_173533	
PKP4	8502	hgsc.bcm.edu	37	2	159537000	159537001	+	Frame_Shift_Ins	INS	-	-	T			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr2:159537000_159537001insT	ENST00000389759.3	+	22	3502_3503	c.3390_3391insT	c.(3391-3393)ttgfs	p.L1131fs	PKP4_ENST00000389757.3_Frame_Shift_Ins_p.L1088fs|AC005042.4_ENST00000342892.4_RNA|AC005042.4_ENST00000442666.1_RNA	NM_003628.3	NP_003619.2	Q99569	PKP4_HUMAN	plakophilin 4	1131					cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|positive regulation of cytokinesis (GO:0032467)|positive regulation of gene expression (GO:0010628)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell adhesion (GO:0030155)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|desmosome (GO:0030057)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)				breast(2)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(21)|ovary(6)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	61						ATGCATACAGATTGTATTTGCA	0.351										HNSCC(62;0.18)																											p.R1130fs		Atlas-INDEL	.											.	PKP4	133	.	0			c.3390_3391insT						PASS	.																																			SO:0001589	frameshift_variant	8502	exon22			.	X81889	CCDS33305.1, CCDS33306.1	2q24.1	2013-02-14			ENSG00000144283	ENSG00000144283		"""Armadillo repeat containing"""	9026	protein-coding gene	gene with protein product		604276				9342840, 8937994	Standard	NM_003628		Approved	p0071	uc002tzv.3	Q99569	OTTHUMG00000153969	ENST00000389759.3:c.3392dupT	chr2.hg19:g.159537002_159537002dupT	ENSP00000374409:p.Leu1131fs	138.0	0.0	0		173.0	88.0	0.508671	NM_003628	Q86W91	Frame_Shift_Ins	INS	ENST00000389759.3	hg19	CCDS33305.1																																																																																			.	.	.	none		0.351	PKP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333250.1		
FOLH1	2346	hgsc.bcm.edu	37	11	49175458	49175458	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr11:49175458delT	ENST00000256999.2	-	17	2170	c.1910delA	c.(1909-1911)aagfs	p.K637fs	FOLH1_ENST00000340334.7_Frame_Shift_Del_p.K622fs|FOLH1_ENST00000356696.3_Frame_Shift_Del_p.K637fs|FOLH1_ENST00000533034.1_Frame_Shift_Del_p.K622fs|FOLH1_ENST00000343844.4_Frame_Shift_Del_p.K329fs	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	637					folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	TGTAAAATTCTTTACTGCAGA	0.338																																					p.K637fs		Atlas-INDEL	.											.	FOLH1	141	.	0			c.1911delG						PASS	.						84.0	86.0	85.0					11																	49175458		2200	4296	6496	SO:0001589	frameshift_variant	2346	exon17			.	M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.1910delA	chr11.hg19:g.49175458delT	ENSP00000256999:p.Lys637fs	95.0	0.0	0		108.0	44.0	0.407407	NM_004476	A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Frame_Shift_Del	DEL	ENST00000256999.2	hg19	CCDS7946.1																																																																																			.	.	.	none		0.338	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390896.1	NM_004476	
PARP4	143	hgsc.bcm.edu	37	13	25009395	25009395	+	Frame_Shift_Del	DEL	G	G	-	rs551694088		TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr13:25009395delG	ENST00000381989.3	-	31	3989	c.3884delC	c.(3883-3885)ccafs	p.P1295fs		NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	1295					cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		AGTTGCTGTTGGTTTACATGA	0.428																																					p.P1295fs		Atlas-INDEL	.											.	PARP4	142	.	0			c.3885delA						PASS	.						100.0	104.0	103.0					13																	25009395		2203	4300	6503	SO:0001589	frameshift_variant	143	exon31			.	AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.3884delC	chr13.hg19:g.25009395delG	ENSP00000371419:p.Pro1295fs	137.0	0.0	0		129.0	54.0	0.418605	NM_006437	O75903|Q14682|Q5QNZ9|Q9H1M6	Frame_Shift_Del	DEL	ENST00000381989.3	hg19	CCDS9307.1																																																																																			.	.	.	none		0.428	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044189.1	NM_006437	
MFGE8	4240	hgsc.bcm.edu	37	15	89449052	89449053	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr15:89449052_89449053insAA	ENST00000566497.1	-	5	681_682	c.620_621insTT	c.(619-621)ttgfs	p.L207fs	MFGE8_ENST00000539437.1_Frame_Shift_Ins_p.L199fs|MFGE8_ENST00000542878.1_Frame_Shift_Ins_p.L163fs|MFGE8_ENST00000268150.8_Frame_Shift_Ins_p.L207fs|MFGE8_ENST00000559997.1_Intron|MFGE8_ENST00000268151.7_Frame_Shift_Ins_p.L207fs			Q08431	MFGM_HUMAN	milk fat globule-EGF factor 8 protein	207	F5/8 type C 1. {ECO:0000255|PROSITE- ProRule:PRU00081}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|phagocytosis, engulfment (GO:0006911)|phagocytosis, recognition (GO:0006910)|positive regulation of apoptotic cell clearance (GO:2000427)|single fertilization (GO:0007338)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|vesicle (GO:0031982)	phosphatidylethanolamine binding (GO:0008429)|phosphatidylserine binding (GO:0001786)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	22	Lung NSC(78;0.0392)|all_lung(78;0.077)					TCGTGGGGTACAATCTCACGTA	0.584																																					p.L207fs		Atlas-INDEL	.											.	MFGE8	60	.	0			c.621_622insTT						PASS	.																																			SO:0001589	frameshift_variant	4240	exon5			.	U58516	CCDS10347.1, CCDS45345.1	15q25	2009-03-25			ENSG00000140545	ENSG00000140545			7036	protein-coding gene	gene with protein product	"""sperm surface protein hP47"""	602281	"""sperm associated antigen 10"""	SPAG10		9027496, 19204935	Standard	NM_005928		Approved	SED1, EDIL1, BA46, OAcGD3S, HsT19888, MFG-E8, hP47	uc002bng.4	Q08431	OTTHUMG00000148682	ENST00000566497.1:c.619_620dupTT	chr15.hg19:g.89449053_89449054dupAA	ENSP00000456281:p.Leu207fs	137.0	0.0	0		186.0	70.0	0.376344	NM_001114614	B2R6M7|Q53FU9|Q7Z3D2|Q9BTL9	Frame_Shift_Ins	INS	ENST00000566497.1	hg19	CCDS10347.1																																																																																			.	.	.	none		0.584	MFGE8-015	NOVEL	alternative_3_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000432804.1	NM_005928	
PAIP1	10605	hgsc.bcm.edu	37	5	43555937	43555937	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr5:43555937delA	ENST00000306846.3	-	2	662	c.430delT	c.(430-432)tacfs	p.Y144fs	PAIP1_ENST00000514514.1_Frame_Shift_Del_p.Y65fs|PAIP1_ENST00000436644.2_Frame_Shift_Del_p.Y65fs|PAIP1_ENST00000338972.4_Frame_Shift_Del_p.Y32fs	NM_006451.4|NM_182789.3	NP_006442.2|NP_877590.1	Q9H074	PAIP1_HUMAN	poly(A) binding protein interacting protein 1	144					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA stabilization (GO:0048255)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	RNA binding (GO:0003723)|translation activator activity (GO:0008494)			endometrium(2)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Lung NSC(6;2.07e-05)					CTTACTGTGTAACTGGAAGAA	0.403																																					p.Y144fs		Atlas-INDEL	.											.	PAIP1	46	.	0			c.431delA						PASS	.						115.0	125.0	121.0					5																	43555937		2203	4300	6503	SO:0001589	frameshift_variant	10605	exon2			.	AF013758	CCDS3947.1, CCDS3948.1, CCDS47204.1	5p12	2008-02-05			ENSG00000172239	ENSG00000172239			16945	protein-coding gene	gene with protein product		605184				9548260, 11230166	Standard	NM_006451		Approved		uc003job.3	Q9H074	OTTHUMG00000096960	ENST00000306846.3:c.430delT	chr5.hg19:g.43555937delA	ENSP00000302768:p.Tyr144fs	234.0	0.0	0		305.0	121.0	0.396721	NM_006451	A6NKV8|O60455|Q96B61|Q9BS63	Frame_Shift_Del	DEL	ENST00000306846.3	hg19	CCDS3947.1																																																																																			.	.	.	none		0.403	PAIP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214024.1	NM_006451	
LINS	55180	hgsc.bcm.edu	37	15	101114203	101114205	+	In_Frame_Del	DEL	TGA	TGA	-			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	TGA	TGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr15:101114203_101114205delTGA	ENST00000314742.8	-	5	1095_1097	c.873_875delTCA	c.(871-876)attcag>atg	p.291_292IQ>M	LINS_ENST00000560133.1_In_Frame_Del_p.172_173IQ>M|LINS_ENST00000559149.1_5'UTR|LINS_ENST00000561308.1_In_Frame_Del_p.291_292IQ>M	NM_001040616.2	NP_001035706	Q8NG48	LINES_HUMAN	lines homolog (Drosophila)	291										central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(1)|skin(1)|stomach(4)	21						AACAAAAGCCTGAATAGGCCAGG	0.429																																					p.292_292del		Atlas-INDEL	.											.	LINS	62	.	0			c.874_876del						PASS	.																																			SO:0001651	inframe_deletion	55180	exon5			.	AK095448	CCDS10385.1	15q26.3	2010-09-08	2010-09-08	2010-09-08	ENSG00000140471	ENSG00000140471			30922	protein-coding gene	gene with protein product		610350	"""lines homolog 1 (Drosophila)"""	LINS1		12119551, 8889548	Standard	NM_001040616		Approved	WINS1	uc002bwg.3	Q8NG48	OTTHUMG00000149865	ENST00000314742.8:c.873_875delTCA	chr15.hg19:g.101114203_101114205delTGA	ENSP00000318423:p.Ile291_Gln292delinsMet	59.0	0.0	0		67.0	27.0	0.402985	NM_001040616	Q96FW2|Q9NVQ3	In_Frame_Del	DEL	ENST00000314742.8	hg19	CCDS10385.1																																																																																			.	.	.	none		0.429	LINS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313592.1	NM_018148	
TSHZ2	128553	hgsc.bcm.edu	37	20	51871026	51871026	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr20:51871026delT	ENST00000371497.5	+	2	1916	c.1029delT	c.(1027-1029)tctfs	p.S343fs	TSHZ2_ENST00000603338.2_Frame_Shift_Del_p.S340fs|RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000329613.6_Frame_Shift_Del_p.S340fs	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	343					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			TTGCAGATTCTTTTTCTTCTC	0.493																																					p.S343fs		Atlas-INDEL	.											.	TSHZ2	209	.	0			c.1028delC						PASS	.						78.0	86.0	83.0					20																	51871026		2203	4300	6503	SO:0001589	frameshift_variant	128553	exon2			.	AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.1029delT	chr20.hg19:g.51871026delT	ENSP00000360552:p.Ser343fs	154.0	0.0	0		222.0	105.0	0.472973	NM_173485	B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Frame_Shift_Del	DEL	ENST00000371497.5	hg19	CCDS33490.1																																																																																			.	.	.	none		0.493	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6	NM_173485	
HAS2	3037	hgsc.bcm.edu	37	8	122627047	122627047	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr8:122627047delC	ENST00000303924.4	-	4	1498	c.961delG	c.(961-963)gtgfs	p.V321fs		NM_005328.2	NP_005319.1	Q92819	HYAS2_HUMAN	hyaluronan synthase 2	321					atrioventricular canal development (GO:0036302)|bone morphogenesis (GO:0060349)|cellular response to fluid shear stress (GO:0071498)|cellular response to interleukin-1 (GO:0071347)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|cellular response to tumor necrosis factor (GO:0071356)|endocardial cushion to mesenchymal transition (GO:0090500)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|hyaluronan biosynthetic process (GO:0030213)|kidney development (GO:0001822)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of urine volume (GO:0035810)|renal water absorption (GO:0070295)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	hyaluronan synthase activity (GO:0050501)		HAS2/PLAG1(10)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(19)|ovary(5)|skin(1)	38	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		STAD - Stomach adenocarcinoma(47;0.00503)			AGGCTCAGCACCCGGTTCGTG	0.453																																					p.V321fs		Atlas-INDEL	.											.	HAS2	87	.	0			c.962delT						PASS	.						143.0	136.0	138.0					8																	122627047		2203	4300	6503	SO:0001589	frameshift_variant	3037	exon4			.	U54804	CCDS6335.1	8q24.12	2013-02-22			ENSG00000170961	ENSG00000170961	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4819	protein-coding gene	gene with protein product		601636				9169154	Standard	NM_005328		Approved		uc003yph.2	Q92819	OTTHUMG00000164953	ENST00000303924.4:c.961delG	chr8.hg19:g.122627047delC	ENSP00000306991:p.Val321fs	196.0	0.0	0		241.0	116.0	0.481328	NM_005328	Q32MM3	Frame_Shift_Del	DEL	ENST00000303924.4	hg19	CCDS6335.1																																																																																			.	.	.	none		0.453	HAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381150.2	NM_005328	
RAB28	9364	hgsc.bcm.edu	37	4	13481115	13481115	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B9-5155-01A-01D-1589-08	TCGA-B9-5155-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9ca1b195-86fe-4597-933d-93903a61f676	d8826711-1c53-40c3-b444-2c9614f49b6f	g.chr4:13481115delA	ENST00000330852.5	-	2	325	c.111delT	c.(109-111)tttfs	p.F37fs	RAB28_ENST00000338176.4_Frame_Shift_Del_p.F37fs|RAB28_ENST00000288723.4_Frame_Shift_Del_p.F37fs	NM_001017979.2	NP_001017979.1	P51157	RAB28_HUMAN	RAB28, member RAS oncogene family	37					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	ciliary basal body (GO:0036064)|ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	8						ACTGTTTCCCAAAAGTTTCTT	0.308																																					p.G38fs		Atlas-INDEL	.											.	RAB28	56	.	0			c.112delG						PASS	.						69.0	70.0	70.0					4																	13481115		2203	4292	6495	SO:0001589	frameshift_variant	9364	exon2			.	X94703	CCDS3409.1, CCDS33961.1, CCDS54741.1	4p16.1	2014-04-24			ENSG00000157869	ENSG00000157869		"""RAB, member RAS oncogene"""	9768	protein-coding gene	gene with protein product		612994				8647132	Standard	NM_004249		Approved		uc003gmu.2	P51157	OTTHUMG00000090543	ENST00000330852.5:c.111delT	chr4.hg19:g.13481115delA	ENSP00000328551:p.Phe37fs	69.0	0.0	0		97.0	40.0	0.412371	NM_004249	G8JLC5|Q8IYR8|Q8NI05	Frame_Shift_Del	DEL	ENST00000330852.5	hg19	CCDS33961.1																																																																																			.	.	.	none		0.308	RAB28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207068.2	NM_001017979	
