#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PABPC4	8761	hgsc.bcm.edu	37	1	40029530	40029530	+	Silent	SNP	C	C	T			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr1:40029530C>T	ENST00000372857.3	-	11	2262	c.1470G>A	c.(1468-1470)ctG>ctA	p.L490L	PABPC4_ENST00000372858.3_Silent_p.L506L|RP11-69E11.8_ENST00000415255.1_RNA|PABPC4_ENST00000372862.3_Intron|PABPC4_ENST00000372856.3_Intron	NM_003819.3	NP_003810.1	Q13310	PABP4_HUMAN	poly(A) binding protein, cytoplasmic 4 (inducible form)	490					blood coagulation (GO:0007596)|RNA catabolic process (GO:0006401)|RNA processing (GO:0006396)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(6)|prostate(1)|skin(3)	21	Lung NSC(20;1.55e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.89e-18)|Epithelial(16;6.17e-17)|all cancers(16;1.18e-15)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			AGCTGTCAGTCAGCCCTTGCT	0.557																																					p.L506L		Atlas-SNP	.											.	PABPC4	56	.	0			c.G1518A						PASS	.						60.0	61.0	61.0					1																	40029530		2203	4300	6503	SO:0001819	synonymous_variant	8761	exon11			GTCAGTCAGCCCT	U33818	CCDS438.1, CCDS44114.1, CCDS44115.1	1p34.2	2013-02-12	2001-11-28		ENSG00000090621	ENSG00000090621		"""RNA binding motif (RRM) containing"""	8557	protein-coding gene	gene with protein product		603407	"""poly(A)-binding protein, cytoplasmic 4 (inducible form)"""			10543404	Standard	NM_001135653		Approved	iPABP, APP-1	uc001cdl.2	Q13310	OTTHUMG00000009097	ENST00000372857.3:c.1470G>A	chr1.hg19:g.40029530C>T		97.0	0.0	.		116.0	51.0	.	NM_001135653	B1ANQ8|Q4VC03|Q6P0N3	Silent	SNP	ENST00000372857.3	hg19	CCDS438.1																																																																																			.	.	.	none		0.557	PABPC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025220.1	NM_001135653	
BEST4	266675	hgsc.bcm.edu	37	1	45250593	45250593	+	Missense_Mutation	SNP	A	A	G	rs377207881		TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr1:45250593A>G	ENST00000372207.3	-	7	976	c.977T>C	c.(976-978)aTa>aCa	p.I326T		NM_153274.2	NP_695006.1	Q8NFU0	BEST4_HUMAN	bestrophin 4	326						chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			large_intestine(1)|lung(4)|ovary(1)|skin(1)	7	Acute lymphoblastic leukemia(166;0.155)					GTTGCGGTCTATGAGCTGATT	0.562																																					p.I326T		Atlas-SNP	.											.	BEST4	20	.	0			c.T977C						PASS	.						76.0	81.0	79.0					1																	45250593		2203	4300	6503	SO:0001583	missense	266675	exon7			CGGTCTATGAGCT	AF440757	CCDS514.1	1p33-p32.3	2012-09-26	2006-10-18	2006-10-18	ENSG00000142959	ENSG00000142959		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17106	protein-coding gene	gene with protein product		607336	"""vitelliform macular dystrophy 2-like 2"""	VMD2L2		12032738, 16702355	Standard	NM_153274		Approved		uc001cmm.3	Q8NFU0	OTTHUMG00000008488	ENST00000372207.3:c.977T>C	chr1.hg19:g.45250593A>G	ENSP00000361281:p.Ile326Thr	117.0	0.0	.		135.0	11.0	.	NM_153274	Q5JR93	Missense_Mutation	SNP	ENST00000372207.3	hg19	CCDS514.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.072846	0.76415	.	.	ENSG00000142959	ENST00000372207	D	0.99270	-5.66	5.19	4.07	0.47477	.	0.051148	0.85682	D	0.000000	D	0.99518	0.9828	H	0.96269	3.795	0.51767	D	0.999939	D	0.71674	0.998	D	0.74348	0.983	D	0.98708	1.0703	10	0.87932	D	0	-16.684	9.7184	0.40289	0.9183:0.0:0.0816:0.0	.	326	Q8NFU0	BEST4_HUMAN	T	326	ENSP00000361281:I326T	ENSP00000361281:I326T	I	-	2	0	BEST4	45023180	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.946000	0.70234	0.998000	0.38996	0.533000	0.62120	ATA	.	.	.	none		0.562	BEST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023425.1	NM_153274	
STXBP3	6814	hgsc.bcm.edu	37	1	109302625	109302625	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr1:109302625T>G	ENST00000370008.3	+	6	406	c.356T>G	c.(355-357)tTt>tGt	p.F119C		NM_007269.2	NP_009200.2	O00186	STXB3_HUMAN	syntaxin binding protein 3	119	Mediates interaction with DOC2B. {ECO:0000250}.				blood coagulation (GO:0007596)|membrane organization (GO:0061024)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|neutrophil degranulation (GO:0043312)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein heterooligomerization (GO:0051291)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin binding (GO:0019905)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(3)|urinary_tract(1)	13		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0386)|Lung(183;0.104)|COAD - Colon adenocarcinoma(174;0.137)|Epithelial(280;0.231)		GATAATCTCTTTAACAAAATT	0.289																																					p.F119C		Atlas-SNP	.											.	STXBP3	44	.	0			c.T356G						PASS	.						92.0	106.0	101.0					1																	109302625		2203	4288	6491	SO:0001583	missense	6814	exon6			ATCTCTTTAACAA	D63506	CCDS790.1	1p13.3	2008-02-05			ENSG00000116266	ENSG00000116266			11446	protein-coding gene	gene with protein product		608339				10194441	Standard	NM_007269		Approved	UNC-18C	uc001dvy.3	O00186	OTTHUMG00000011122	ENST00000370008.3:c.356T>G	chr1.hg19:g.109302625T>G	ENSP00000359025:p.Phe119Cys	172.0	0.0	.		216.0	94.0	.	NM_007269	A8K269|A8K5K7|Q53FW1|Q86YJ3|Q9UPD7	Missense_Mutation	SNP	ENST00000370008.3	hg19	CCDS790.1	.	.	.	.	.	.	.	.	.	.	T	19.62	3.861971	0.71949	.	.	ENSG00000116266	ENST00000370008	T	0.77098	-1.07	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.87083	0.6089	M	0.84846	2.72	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	D	0.89069	0.3468	10	0.62326	D	0.03	-18.7523	15.3518	0.74396	0.0:0.0:0.0:1.0	.	119	O00186	STXB3_HUMAN	C	119	ENSP00000359025:F119C	ENSP00000359025:F119C	F	+	2	0	STXBP3	109104148	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.164000	0.71885	2.110000	0.64415	0.477000	0.44152	TTT	.	.	.	none		0.289	STXBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030591.1	NM_007269	
ZNF687	57592	hgsc.bcm.edu	37	1	151259373	151259373	+	Silent	SNP	C	C	G			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr1:151259373C>G	ENST00000368879.2	+	2	704	c.606C>G	c.(604-606)gcC>gcG	p.A202A		NM_020832.1	NP_065883.1	Q8N1G0	ZN687_HUMAN	zinc finger protein 687	202	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|ovary(1)|upper_aerodigestive_tract(2)	32	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			TTGAGCTGGCCCAGGAGAATG	0.652																																					p.A202A		Atlas-SNP	.											.	ZNF687	94	.	0			c.C606G						PASS	.						44.0	49.0	47.0					1																	151259373		2203	4300	6503	SO:0001819	synonymous_variant	57592	exon2			GCTGGCCCAGGAG		CCDS992.1	1q21.2	2008-05-02			ENSG00000143373	ENSG00000143373			29277	protein-coding gene	gene with protein product		610568				10718198	Standard	NM_020832		Approved	KIAA1441	uc001exq.3	Q8N1G0	OTTHUMG00000012347	ENST00000368879.2:c.606C>G	chr1.hg19:g.151259373C>G		115.0	0.0	.		122.0	59.0	.	NM_020832	D3DV17|Q68DQ8|Q9H937|Q9P2A7	Silent	SNP	ENST00000368879.2	hg19																																																																																				.	.	.	none		0.652	ZNF687-201	KNOWN	basic	protein_coding	protein_coding		NM_020832	
SPRR1B	6699	hgsc.bcm.edu	37	1	153004965	153004965	+	Silent	SNP	C	C	T			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr1:153004965C>T	ENST00000307098.4	+	2	209	c.144C>T	c.(142-144)ccC>ccT	p.P48P	SPRR1B_ENST00000392661.3_Silent_p.P48P	NM_003125.2	NP_003116.2	P22528	SPR1B_HUMAN	small proline-rich protein 1B	48	6 X 8 AA approximate tandem repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)	p.C41_P64delCHPKVPEPCHPKVPEPCQPKVPEP(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|ovary(2)|skin(2)	9	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			TGCCTGAGCCCTGCCACCCCA	0.627																																					p.P48P		Atlas-SNP	.											.	SPRR1B	18	.	1	Deletion - In frame(1)	ovary(1)	c.C144T						PASS	.						123.0	123.0	123.0					1																	153004965		2203	4300	6503	SO:0001819	synonymous_variant	6699	exon2			TGAGCCCTGCCAC	M84757	CCDS30863.1	1q21-q22	2010-06-25	2010-06-25		ENSG00000169469	ENSG00000169469			11260	protein-coding gene	gene with protein product	"""cornifin"""	182266		SPRR1		8325635, 1438308	Standard	NM_003125		Approved	GADD33	uc001fba.3	P22528	OTTHUMG00000013869	ENST00000307098.4:c.144C>T	chr1.hg19:g.153004965C>T		274.0	0.0	.		264.0	105.0	.	NM_003125	B2R5H7|P22529|P22530|Q5T524	Silent	SNP	ENST00000307098.4	hg19	CCDS30863.1																																																																																			.	.	.	none		0.627	SPRR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038906.1	NM_003125	
LTBP1	4052	hgsc.bcm.edu	37	2	33412006	33412006	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr2:33412006C>A	ENST00000404816.2	+	6	1638	c.1285C>A	c.(1285-1287)Ctt>Att	p.L429I	LTBP1_ENST00000404525.1_Missense_Mutation_p.L103I|LTBP1_ENST00000402934.1_Missense_Mutation_p.L103I|LTBP1_ENST00000390003.4_Missense_Mutation_p.L103I|LTBP1_ENST00000407925.1_Missense_Mutation_p.L103I|LTBP1_ENST00000418533.2_Missense_Mutation_p.L103I|LTBP1_ENST00000354476.3_Missense_Mutation_p.L429I			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	429	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				CACAGGAAAACTTTGTCAGAT	0.478																																					p.L429I		Atlas-SNP	.											.	LTBP1	317	.	0			c.C1285A						PASS	.						116.0	108.0	110.0					2																	33412006		2203	4300	6503	SO:0001583	missense	4052	exon6			GGAAAACTTTGTC		CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.1285C>A	chr2.hg19:g.33412006C>A	ENSP00000386043:p.Leu429Ile	68.0	0.0	.		57.0	20.0	.	NM_206943	A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Missense_Mutation	SNP	ENST00000404816.2	hg19	CCDS33177.2	.	.	.	.	.	.	.	.	.	.	C	15.88	2.962600	0.53400	.	.	ENSG00000049323	ENST00000404816;ENST00000354476;ENST00000432635;ENST00000390003;ENST00000418533;ENST00000402934;ENST00000404525;ENST00000407925	D;D;D;D;D;D;D	0.91996	-2.95;-2.95;-2.95;-2.95;-2.95;-2.95;-2.95	5.3	5.3	0.74995	Epidermal growth factor-like (1);EGF-like region, conserved site (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.87849	0.6281	L	0.32530	0.975	0.80722	D	1	B;B;B;B;B;B	0.25441	0.077;0.028;0.016;0.033;0.096;0.126	B;B;B;B;B;B	0.28709	0.043;0.016;0.017;0.027;0.05;0.093	D	0.85678	0.1299	9	0.66056	D	0.02	.	12.3249	0.55005	0.0:0.9228:0.0:0.0772	.	429;103;103;103;103;429	Q14766;E7EV71;Q14766-3;Q14766-2;Q14766-5;Q14766-4	LTBP1_HUMAN;.;.;.;.;.	I	429;429;118;103;103;103;103;103	ENSP00000386043:L429I;ENSP00000346467:L429I;ENSP00000374653:L103I;ENSP00000393057:L103I;ENSP00000384373:L103I;ENSP00000385359:L103I;ENSP00000384091:L103I	ENSP00000346467:L429I	L	+	1	0	LTBP1	33265510	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	4.239000	0.58694	2.468000	0.83385	0.655000	0.94253	CTT	.	.	.	none		0.478	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	NM_206943	
GGCX	2677	hgsc.bcm.edu	37	2	85777685	85777685	+	Missense_Mutation	SNP	G	G	T	rs372492949		TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr2:85777685G>T	ENST00000233838.4	-	14	2157	c.2077C>A	c.(2077-2079)Cgc>Agc	p.R693S	GGCX_ENST00000473665.1_5'Flank|GGCX_ENST00000430215.3_Missense_Mutation_p.R636S	NM_000821.5	NP_000812.2	P38435	VKGC_HUMAN	gamma-glutamyl carboxylase	693					blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	gamma-glutamyl carboxylase activity (GO:0008488)			endometrium(3)|large_intestine(5)|lung(3)|ovary(1)|stomach(1)|urinary_tract(2)	15					Anisindione(DB01125)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Drotrecogin alfa(DB00055)|Menadione(DB00170)|Phylloquinone(DB01022)	TACCTGCGGCGAAAGACATAG	0.468																																					p.R693S		Atlas-SNP	.											.	GGCX	44	.	0			c.C2077A						PASS	.						53.0	56.0	55.0					2																	85777685		2203	4300	6503	SO:0001583	missense	2677	exon14			TGCGGCGAAAGAC		CCDS1978.1, CCDS46353.1	2p12	2008-05-21			ENSG00000115486	ENSG00000115486			4247	protein-coding gene	gene with protein product	"""vitamin K-dependent gamma-carboxylase"""	137167				1749935	Standard	NM_000821		Approved	VKCFD1	uc002sps.3	P38435	OTTHUMG00000130173	ENST00000233838.4:c.2077C>A	chr2.hg19:g.85777685G>T	ENSP00000233838:p.Arg693Ser	85.0	0.0	.		92.0	42.0	.	NM_000821	B4DMC5|E9PEE1|Q14415|Q6GU45	Missense_Mutation	SNP	ENST00000233838.4	hg19	CCDS1978.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.395574	0.83011	.	.	ENSG00000115486	ENST00000233838;ENST00000430215	T;T	0.28895	1.59;1.59	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.56673	0.2001	M	0.72118	2.19	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.995;0.998	T	0.55302	-0.8162	10	0.54805	T	0.06	-15.286	17.5141	0.87768	0.0:0.0:1.0:0.0	.	636;509;693	E9PEE1;B4DQW4;P38435	.;.;VKGC_HUMAN	S	693;636	ENSP00000233838:R693S;ENSP00000408045:R636S	ENSP00000233838:R693S	R	-	1	0	GGCX	85631196	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.029000	0.57253	2.730000	0.93505	0.655000	0.94253	CGC	.	.	.	alt		0.468	GGCX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252490.3	NM_000821	
NEB	4703	hgsc.bcm.edu	37	2	152507333	152507333	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr2:152507333C>T	ENST00000172853.10	-	53	7129	c.6982G>A	c.(6982-6984)Gac>Aac	p.D2328N	NEB_ENST00000603639.1_Missense_Mutation_p.D2328N|NEB_ENST00000397345.3_Missense_Mutation_p.D2328N|NEB_ENST00000409198.1_Missense_Mutation_p.D2328N|NEB_ENST00000604864.1_Missense_Mutation_p.D2328N|NEB_ENST00000427231.2_Missense_Mutation_p.D2328N			P20929	NEBU_HUMAN	nebulin	2328					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		AGTTTTGGGTCATCTTGCAGA	0.413																																					p.D2328N		Atlas-SNP	.											.	NEB	1697	.	0			c.G6982A						PASS	.						187.0	191.0	190.0					2																	152507333		1983	4164	6147	SO:0001583	missense	4703	exon53			TTGGGTCATCTTG	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.6982G>A	chr2.hg19:g.152507333C>T	ENSP00000172853:p.Asp2328Asn	231.0	0.0	.		287.0	142.0	.	NM_004543	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	hg19		.	.	.	.	.	.	.	.	.	.	C	34	5.297627	0.95574	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.50277	0.75;0.75;0.75;0.75	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.75903	0.3913	M	0.91249	3.19	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.77461	-0.2579	10	0.34782	T	0.22	.	19.3325	0.94297	0.0:1.0:0.0:0.0	.	2328	P20929	NEBU_HUMAN	N	2328	ENSP00000386259:D2328N;ENSP00000380505:D2328N;ENSP00000416578:D2328N;ENSP00000172853:D2328N	ENSP00000172853:D2328N	D	-	1	0	NEB	152215579	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.770000	0.85390	2.583000	0.87209	0.650000	0.86243	GAC	.	.	.	none		0.413	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
RAPGEF4	11069	hgsc.bcm.edu	37	2	173832042	173832042	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr2:173832042G>A	ENST00000397081.3	+	10	1017	c.874G>A	c.(874-876)Gat>Aat	p.D292N	RAPGEF4_ENST00000409036.1_Missense_Mutation_p.D292N|RAPGEF4_ENST00000535187.1_Missense_Mutation_p.D72N|RAPGEF4_ENST00000473043.1_3'UTR|RAPGEF4_ENST00000538974.1_Missense_Mutation_p.D121N|RAPGEF4_ENST00000397087.3_Missense_Mutation_p.D148N|RAPGEF4_ENST00000540783.1_Missense_Mutation_p.D139N|RAPGEF4_ENST00000264111.6_Missense_Mutation_p.D291N|RAPGEF4_ENST00000539331.1_Missense_Mutation_p.D139N	NM_007023.3	NP_008954.2	Q8WZA2	RPGF4_HUMAN	Rap guanine nucleotide exchange factor (GEF) 4	292					blood coagulation (GO:0007596)|calcium ion-dependent exocytosis (GO:0017156)|cAMP-mediated signaling (GO:0019933)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|insulin secretion (GO:0030073)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of exocytosis (GO:0017157)|regulation of insulin secretion (GO:0050796)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cAMP-dependent protein kinase complex (GO:0005952)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase regulator activity (GO:0008603)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(14)|lung(13)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47			OV - Ovarian serous cystadenocarcinoma(117;0.194)			ATTTCTGGATGATGAGCACGA	0.527																																					p.D292N		Atlas-SNP	.											.	RAPGEF4	103	.	0			c.G874A						PASS	.						51.0	53.0	52.0					2																	173832042		2072	4228	6300	SO:0001583	missense	11069	exon10			CTGGATGATGAGC	U78516	CCDS42775.1, CCDS42776.1, CCDS63060.1, CCDS63061.1, CCDS74604.1	2q31-q32	2008-02-05	2004-03-26		ENSG00000091428	ENSG00000091428			16626	protein-coding gene	gene with protein product	"""cAMP-regulated guanine nucleotide exchange factor II"", "" exchange protein directly activated by cAMP 2"""	606058	"""RAP guanine-nucleotide-exchange factor (GEF) 4"""			10777494, 9856955	Standard	NM_007023		Approved	cAMP-GEFII, CGEF2	uc002uhv.4	Q8WZA2	OTTHUMG00000133677	ENST00000397081.3:c.874G>A	chr2.hg19:g.173832042G>A	ENSP00000380271:p.Asp292Asn	23.0	0.0	.		33.0	18.0	.	NM_007023	B2R7R3|B7Z283|B7Z3T6|B7Z912|O95636|Q8IXK6|Q8TAA4	Missense_Mutation	SNP	ENST00000397081.3	hg19	CCDS42775.1	.	.	.	.	.	.	.	.	.	.	G	35	5.453522	0.96223	.	.	ENSG00000091428	ENST00000264111;ENST00000397081;ENST00000409036;ENST00000397087;ENST00000538974;ENST00000540783;ENST00000539331;ENST00000539767;ENST00000535187	T;T;T;T;T;T;T;T	0.14516	2.5;2.5;2.5;2.5;2.5;2.5;2.5;2.5	5.31	5.31	0.75309	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.40862	0.1134	M	0.74258	2.255	0.80722	D	1	D;D;D;D;D	0.89917	0.993;1.0;0.996;0.992;1.0	P;D;D;P;D	0.87578	0.897;0.998;0.948;0.889;0.996	T	0.28681	-1.0036	10	0.72032	D	0.01	.	18.9765	0.92738	0.0:0.0:1.0:0.0	.	119;121;148;292;292	B7Z805;B7Z2R0;Q8WZA2-3;Q8WZA2;E9PB94	.;.;.;RPGF4_HUMAN;.	N	291;292;292;148;121;139;139;119;72	ENSP00000264111:D291N;ENSP00000380271:D292N;ENSP00000387104:D292N;ENSP00000380276:D148N;ENSP00000440135:D121N;ENSP00000440250:D139N;ENSP00000437384:D139N;ENSP00000438011:D72N	ENSP00000264111:D291N	D	+	1	0	RAPGEF4	173540288	1.000000	0.71417	0.999000	0.59377	0.885000	0.51271	9.822000	0.99363	2.478000	0.83669	0.561000	0.74099	GAT	.	.	.	none		0.527	RAPGEF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257864.2	NM_007023	
TNS1	7145	hgsc.bcm.edu	37	2	218712984	218712984	+	Silent	SNP	G	G	C			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr2:218712984G>C	ENST00000171887.4	-	17	2333	c.1881C>G	c.(1879-1881)ccC>ccG	p.P627P	TNS1_ENST00000430930.1_Silent_p.P627P|TNS1_ENST00000480665.1_5'Flank|TNS1_ENST00000419504.1_Silent_p.P627P	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	627					cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		GGGGCAGCTGGGGTTCAGCTT	0.652																																					p.P627P		Atlas-SNP	.											.	TNS1	251	.	0			c.C1881G						PASS	.						45.0	38.0	40.0					2																	218712984		2203	4299	6502	SO:0001819	synonymous_variant	7145	exon17			CAGCTGGGGTTCA	AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.1881C>G	chr2.hg19:g.218712984G>C		59.0	0.0	.		79.0	37.0	.	NM_022648	Q4ZG71|Q6IPI5	Silent	SNP	ENST00000171887.4	hg19	CCDS2407.1																																																																																			.	.	.	none		0.652	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256672.2	NM_022648	
MYEOV2	150678	hgsc.bcm.edu	37	2	241073371	241073371	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr2:241073371C>G	ENST00000607357.1	-	2	133	c.115G>C	c.(115-117)Gtt>Ctt	p.V39L	MYEOV2_ENST00000489698.1_5'UTR|MYEOV2_ENST00000307266.3_Missense_Mutation_p.V70L	NM_001163424.1	NP_001156896.1	Q8WXC6	MYOV2_HUMAN	myeloma overexpressed 2	39								p.V70F(1)		breast(1)|lung(5)|pancreas(1)	7		all_epithelial(40;1.56e-11)|Breast(86;0.0002)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)		Epithelial(121;3.81e-30)|all cancers(36;1.1e-27)|OV - Ovarian serous cystadenocarcinoma(60;2.74e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;8.54e-06)|Lung(119;0.00361)|LUSC - Lung squamous cell carcinoma(224;0.0153)|Colorectal(34;0.0202)|COAD - Colon adenocarcinoma(134;0.143)		TCTGCATGAACGGCCTTTTCA	0.483																																					p.V70L		Atlas-SNP	.											MYEOV2,NS,carcinoma,0,1	MYEOV2	20	.	1	Substitution - Missense(1)	lung(1)	c.G208C						PASS	.						127.0	130.0	129.0					2																	241073371		2203	4300	6503	SO:0001583	missense	150678	exon2			CATGAACGGCCTT	AF453951	CCDS2532.1, CCDS63183.1	2q37.3	2008-02-05			ENSG00000172428	ENSG00000172428			21314	protein-coding gene	gene with protein product							Standard	NM_138336		Approved		uc002vyu.1	Q8WXC6	OTTHUMG00000133352	ENST00000607357.1:c.115G>C	chr2.hg19:g.241073371C>G	ENSP00000475979:p.Val39Leu	132.0	0.0	.		168.0	65.0	.	NM_138336	Q8N110	Missense_Mutation	SNP	ENST00000607357.1	hg19		.	.	.	.	.	.	.	.	.	.	C	21.1	4.096434	0.76870	.	.	ENSG00000172428	ENST00000307266;ENST00000403160	.	.	.	4.55	3.67	0.42095	.	0.000000	0.64402	U	0.000001	T	0.74137	0.3677	.	.	.	0.58432	D	0.999999	B;D	0.57899	0.04;0.981	B;P	0.62382	0.041;0.901	T	0.76203	-0.3045	8	0.72032	D	0.01	-4.0557	10.5952	0.45333	0.0:0.9036:0.0:0.0963	.	39;70	Q8WXC6;Q8WXC6-1	MYOV2_HUMAN;.	L	70;60	.	ENSP00000304147:V70L	V	-	1	0	MYEOV2	240722044	1.000000	0.71417	0.472000	0.27241	0.971000	0.66376	6.092000	0.71414	1.042000	0.40150	0.650000	0.86243	GTT	.	.	.	none		0.483	MYEOV2-005	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470698.1	NM_138336	
TTLL3	26140	hgsc.bcm.edu	37	3	9877081	9877081	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr3:9877081G>A	ENST00000547186.1	+	13	2443	c.2227G>A	c.(2227-2229)Gtg>Atg	p.V743M	ARPC4-TTLL3_ENST00000397256.1_3'UTR|TTLL3_ENST00000426895.4_Missense_Mutation_p.V886M|TTLL3_ENST00000455274.1_Intron|TTLL3_ENST00000383827.1_3'UTR|TTLL3_ENST00000397241.1_3'UTR	NM_001025930.3	NP_001021100.3	Q9Y4R7	TTLL3_HUMAN	tubulin tyrosine ligase-like family, member 3	743					axoneme assembly (GO:0035082)|cilium assembly (GO:0042384)|protein polyglycylation (GO:0018094)	axoneme (GO:0005930)|cilium (GO:0005929)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	protein-glycine ligase activity (GO:0070735)|protein-glycine ligase activity, initiating (GO:0070736)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(2)|skin(1)	26	Medulloblastoma(99;0.227)					AAAGAAACAAGTGAAGTATTT	0.567																																					p.V886M		Atlas-SNP	.											.	TTLL3	51	.	0			c.G2656A						PASS	.						122.0	128.0	126.0					3																	9877081		1906	4123	6029	SO:0001583	missense	26140	exon13			AAACAAGTGAAGT		CCDS43048.1, CCDS43048.2	3p25.3	2013-02-14			ENSG00000214021	ENSG00000214021		"""Tubulin tyrosine ligase-like family"""	24483	protein-coding gene	gene with protein product						11054573	Standard	NR_037162		Approved	DKFZP434B103, HOTTL	uc003btg.4	Q9Y4R7	OTTHUMG00000128439	ENST00000547186.1:c.2227G>A	chr3.hg19:g.9877081G>A	ENSP00000446659:p.Val743Met	160.0	0.0	.		311.0	108.0	.	NM_001025930	Q4KMS8|Q6AWA3|Q6ZU95|Q8NDN8|Q96GG8|Q9H876|Q9UI99	Missense_Mutation	SNP	ENST00000547186.1	hg19		.	.	.	.	.	.	.	.	.	.	G	9.673	1.147353	0.21288	.	.	ENSG00000214021	ENST00000426895;ENST00000547186	T;T	0.06294	3.32;3.44	3.94	-1.13	0.09775	.	.	.	.	.	T	0.02970	0.0088	N	0.08118	0	0.09310	N	1	B	0.19200	0.034	B	0.14023	0.01	T	0.42275	-0.9461	9	0.87932	D	0	.	3.4181	0.07382	0.437:0.0:0.3814:0.1815	.	743	Q9Y4R7	TTLL3_HUMAN	M	886;743	ENSP00000392549:V886M;ENSP00000446659:V743M	ENSP00000392549:V886M	V	+	1	0	TTLL3	9852081	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.357000	0.07651	-0.239000	0.09710	-0.314000	0.08810	GTG	.	.	.	none		0.567	TTLL3-203	KNOWN	basic	protein_coding	protein_coding		NM_001025930.2	
NISCH	11188	hgsc.bcm.edu	37	3	52526307	52526307	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr3:52526307C>A	ENST00000479054.1	+	22	4396	c.4324C>A	c.(4324-4326)Ctc>Atc	p.L1442I	NISCH_ENST00000345716.4_Missense_Mutation_p.L1442I			Q9Y2I1	NISCH_HUMAN	nischarin	1442					actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|glucose metabolic process (GO:0006006)|negative regulation of cell migration (GO:0030336)|norepinephrine secretion (GO:0048243)|Rac protein signal transduction (GO:0016601)|regulation of blood pressure (GO:0008217)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)|plasma membrane (GO:0005886)	G-protein coupled amine receptor activity (GO:0008227)|identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	33				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)	Tizanidine(DB00697)	AGGTCATGACCTCATGGGCAG	0.657																																					p.L1442I		Atlas-SNP	.											.	NISCH	97	.	0			c.C4324A						PASS	.						154.0	153.0	153.0					3																	52526307		2203	4300	6503	SO:0001583	missense	11188	exon21			CATGACCTCATGG	AF082516	CCDS33767.1, CCDS63651.1, CCDS63652.1	3p21.1	2008-07-18			ENSG00000010322	ENSG00000010322			18006	protein-coding gene	gene with protein product	"""imidazoline receptor candidate"", ""I-1 receptor candidate protein"", ""imidazoline receptor antisera selected"""	615507				11912194, 10882231	Standard	NM_007184		Approved	KIAA0975, I-1, IRAS	uc003ded.4	Q9Y2I1	OTTHUMG00000158571	ENST00000479054.1:c.4324C>A	chr3.hg19:g.52526307C>A	ENSP00000418232:p.Leu1442Ile	309.0	0.0	.		441.0	133.0	.	NM_007184	C9J245|Q6PGP3|Q6PIB4|Q7L8M3|Q7Z2X6|Q9UES6|Q9UEU4|Q9UFW3	Missense_Mutation	SNP	ENST00000479054.1	hg19	CCDS33767.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.107084	0.77096	.	.	ENSG00000010322	ENST00000479054;ENST00000345716;ENST00000433196;ENST00000414197	T;T	0.13089	2.62;2.62	5.37	4.3	0.51218	.	0.078630	0.51477	D	0.000098	T	0.18800	0.0451	L	0.27053	0.805	0.37589	D	0.920105	D	0.67145	0.996	P	0.58210	0.835	T	0.02307	-1.1179	10	0.72032	D	0.01	-30.3479	11.4769	0.50304	0.0:0.8448:0.0:0.1552	.	1442	Q9Y2I1	NISCH_HUMAN	I	1442;1442;366;786	ENSP00000418232:L1442I;ENSP00000339958:L1442I	ENSP00000339958:L1442I	L	+	1	0	NISCH	52501347	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	2.763000	0.47605	2.535000	0.85469	0.561000	0.74099	CTC	.	.	.	none		0.657	NISCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351357.1	NM_007184	
KIAA2018	205717	hgsc.bcm.edu	37	3	113376680	113376680	+	Silent	SNP	G	G	T			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr3:113376680G>T	ENST00000478658.1	-	5	3866	c.3849C>A	c.(3847-3849)ggC>ggA	p.G1283G	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Silent_p.G1283G			Q68DE3	K2018_HUMAN	KIAA2018	1283						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						GAGGTTGACTGCCATAGGAGC	0.468																																					p.G1283G		Atlas-SNP	.											.	KIAA2018	180	.	0			c.C3849A						PASS	.						109.0	105.0	106.0					3																	113376680		1947	4151	6098	SO:0001819	synonymous_variant	205717	exon7			TTGACTGCCATAG	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.3849C>A	chr3.hg19:g.113376680G>T		165.0	0.0	.		222.0	140.0	.	NM_001009899	Q7Z3L9|Q8IVF3|Q9H8T4	Silent	SNP	ENST00000478658.1	hg19	CCDS43133.1																																																																																			.	.	.	none		0.468	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899	
KIAA1109	84162	hgsc.bcm.edu	37	4	123254840	123254840	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr4:123254840A>G	ENST00000264501.4	+	68	11895	c.11522A>G	c.(11521-11523)aAg>aGg	p.K3841R	KIAA1109_ENST00000388738.3_Missense_Mutation_p.K3841R			Q2LD37	K1109_HUMAN	KIAA1109	3841	Poly-Lys.				regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						AAAAAGAAGAAGTTTCAAACT	0.348																																					p.K3841R		Atlas-SNP	.											.	KIAA1109	424	.	0			c.A11522G						PASS	.						80.0	72.0	74.0					4																	123254840		1827	4081	5908	SO:0001583	missense	84162	exon66			AGAAGAAGTTTCA	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.11522A>G	chr4.hg19:g.123254840A>G	ENSP00000264501:p.Lys3841Arg	37.0	0.0	.		46.0	23.0	.	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	hg19	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.9|24.9	4.586223|4.586223	0.86851|0.86851	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000438707|ENST00000306802	T;T;T|.	0.35421|.	2.32;2.32;1.31|.	5.63|5.63	5.63|5.63	0.86233|0.86233	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.72120|0.72120	0.3421|0.3421	M|M	0.63843|0.63843	1.955|1.955	0.80722|0.80722	D|D	1|1	D;D|.	0.69078|.	0.974;0.997|.	D;D|.	0.73380|.	0.969;0.98|.	T|T	0.70941|0.70941	-0.4735|-0.4735	10|5	0.45353|.	T|.	0.12|.	.|.	16.1413|16.1413	0.81528|0.81528	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	3840;3841|.	Q2LD37-4;Q2LD37|.	.;K1109_HUMAN|.	R|G	3841;3841;545|252	ENSP00000264501:K3841R;ENSP00000373390:K3841R;ENSP00000410874:K545R|.	ENSP00000264501:K3841R|.	K|S	+|+	2|1	0|0	KIAA1109|KIAA1109	123474290|123474290	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	8.910000|8.910000	0.92685|0.92685	2.270000|2.270000	0.75569|0.75569	0.482000|0.482000	0.46254|0.46254	AAG|AGT	.	.	.	none		0.348	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
CBR4	84869	hgsc.bcm.edu	37	4	169931208	169931208	+	Silent	SNP	G	G	T			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr4:169931208G>T	ENST00000306193.3	-	1	201	c.33C>A	c.(31-33)tcC>tcA	p.S11S	CBR4_ENST00000504480.1_Silent_p.S11S|RP11-483A20.3_ENST00000506933.1_RNA	NM_032783.4	NP_116172.2	Q8N4T8	CBR4_HUMAN	carbonyl reductase 4	11					daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)|fatty acid biosynthetic process (GO:0006633)|protein homotetramerization (GO:0051289)	mitochondrial matrix (GO:0005759)	NAD(P)H dehydrogenase (quinone) activity (GO:0003955)|NADPH binding (GO:0070402)|NADPH dehydrogenase (quinone) activity (GO:0008753)|quinone binding (GO:0048038)			kidney(1)|large_intestine(2)|lung(2)	5		Prostate(90;0.00263)|Renal(120;0.0183)|Melanoma(52;0.123)		GBM - Glioblastoma multiforme(119;0.0321)		CAATGCCTCGGGAGCCTCCAA	0.602											OREG0016397	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S11S		Atlas-SNP	.											.	CBR4	15	.	0			c.C33A						PASS	.						50.0	54.0	52.0					4																	169931208		2203	4300	6503	SO:0001819	synonymous_variant	84869	exon1			GCCTCGGGAGCCT	BC021973	CCDS3812.1	4q32.3	2013-10-11			ENSG00000145439	ENSG00000145439	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	25891	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 45C, member 1"""					19027726	Standard	NM_032783		Approved	FLJ14431, SDR45C1	uc003iry.3	Q8N4T8	OTTHUMG00000161025	ENST00000306193.3:c.33C>A	chr4.hg19:g.169931208G>T		49.0	0.0	.	1881	44.0	22.0	.	NM_032783	Q8WTW8|Q96K93	Silent	SNP	ENST00000306193.3	hg19	CCDS3812.1																																																																																			.	.	.	none		0.602	CBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363441.2	NM_032783	
FAT1	2195	hgsc.bcm.edu	37	4	187540602	187540602	+	Missense_Mutation	SNP	C	C	T	rs201352448		TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr4:187540602C>T	ENST00000441802.2	-	10	7347	c.7138G>A	c.(7138-7140)Gtt>Att	p.V2380I		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	2380	Cadherin 21. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						AGGTCGGTAACGTCCACCGTG	0.502										HNSCC(5;0.00058)																											p.V2380I	Colon(197;1040 2055 4143 4984 49344)	Atlas-SNP	.											.	FAT1	500	.	0			c.G7138A						PASS	.						67.0	68.0	67.0					4																	187540602		2106	4223	6329	SO:0001583	missense	2195	exon10			CGGTAACGTCCAC	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.7138G>A	chr4.hg19:g.187540602C>T	ENSP00000406229:p.Val2380Ile	52.0	0.0	.		67.0	35.0	.	NM_005245		Missense_Mutation	SNP	ENST00000441802.2	hg19	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	C	12.95	2.092207	0.36952	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.61510	0.1	5.14	4.3	0.51218	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	0.121633	0.56097	N	0.000035	T	0.38799	0.1054	N	0.26130	0.795	0.58432	D	0.999996	B	0.30851	0.297	B	0.25614	0.062	T	0.20306	-1.0279	10	0.22109	T	0.4	.	9.4366	0.38643	0.0:0.8376:0.0:0.1624	.	2380	Q14517	FAT1_HUMAN	I	2380;2382	ENSP00000406229:V2380I	ENSP00000260147:V2382I	V	-	1	0	FAT1	187777596	0.992000	0.36948	0.999000	0.59377	0.398000	0.30690	1.481000	0.35476	1.527000	0.49086	0.650000	0.86243	GTT	.	C|0.999;T|0.001	0.001	weak		0.502	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
ARHGEF28	64283	hgsc.bcm.edu	37	5	73136427	73136427	+	Silent	SNP	T	T	C			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr5:73136427T>C	ENST00000426542.2	+	10	1289	c.1269T>C	c.(1267-1269)agT>agC	p.S423S	ARHGEF28_ENST00000513042.2_Silent_p.S423S|ARHGEF28_ENST00000513841.1_3'UTR|ARHGEF28_ENST00000287898.5_Silent_p.S423S|ARHGEF28_ENST00000296799.4_Silent_p.S110S|ARHGEF28_ENST00000296794.6_Silent_p.S423S|ARHGEF28_ENST00000545377.1_Silent_p.S423S|ARHGEF28_ENST00000437974.1_Silent_p.S423S			Q8N1W1	ARG28_HUMAN	Rho guanine nucleotide exchange factor (GEF) 28	423					central nervous system neuron axonogenesis (GO:0021955)|intracellular signal transduction (GO:0035556)|neurofilament cytoskeleton organization (GO:0060052)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|RNA binding (GO:0003723)										CAGAAACCAGTCCCAGTGTGT	0.493																																					p.S423S		Atlas-SNP	.											.	.	.	.	0			c.T1269C						PASS	.						69.0	68.0	68.0					5																	73136427		2002	4162	6164	SO:0001819	synonymous_variant	64283	exon11			AACCAGTCCCAGT		CCDS47231.1, CCDS47231.2, CCDS54870.1, CCDS58957.1	5q13.2	2012-08-08			ENSG00000214944	ENSG00000214944			30322	protein-coding gene	gene with protein product		612790				9199174, 11058585	Standard	NM_001177693		Approved	RGNEF, p190RhoGEF, RIP2	uc010izf.3	Q8N1W1	OTTHUMG00000162454	ENST00000426542.2:c.1269T>C	chr5.hg19:g.73136427T>C		54.0	0.0	.		57.0	27.0	.	NM_001080479	B2RXG7|B4E3K4|B5MDA3|B7ZW32|E9PC75|Q8NCM7|Q96E37|Q9H6L3|Q9H6W0	Silent	SNP	ENST00000426542.2	hg19	CCDS54870.1																																																																																			.	.	.	none		0.493	ARHGEF28-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000368975.1		
CDKL3	51265	hgsc.bcm.edu	37	5	133695635	133695635	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr5:133695635A>C	ENST00000265334.4	-	3	431	c.313T>G	c.(313-315)Tac>Gac	p.Y105D	CDKL3_ENST00000435211.1_Missense_Mutation_p.Y105D|CDKL3_ENST00000536186.1_Intron|CDKL3_ENST00000521118.1_Missense_Mutation_p.Y105D|CDKL3_ENST00000523832.1_Missense_Mutation_p.Y105D|CTD-2410N18.4_ENST00000518409.1_RNA|CDKL3_ENST00000521755.1_Intron|CDKL3_ENST00000523054.1_5'UTR|CDKL3_ENST00000609654.1_Intron|CDKL3_ENST00000609383.1_Intron|CDKL3_ENST00000522501.1_Intron|CDKL3_ENST00000435240.2_Intron	NM_001113575.1	NP_001107047.1	Q8IVW4	CDKL3_HUMAN	cyclin-dependent kinase-like 3	105	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular protein modification process (GO:0006464)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|prostate(3)	11			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TGGAAGAGGTATTTTCTAAGT	0.328																																					p.Y105D		Atlas-SNP	.											.	CDKL3	76	.	0			c.T313G						PASS	.						99.0	90.0	93.0					5																	133695635		1826	4085	5911	SO:0001583	missense	51265	exon3			AGAGGTATTTTCT	AF130372	CCDS47264.1, CCDS47265.1, CCDS75303.1	5q31.1	2014-09-09			ENSG00000006837	ENSG00000006837	2.7.11.22	"""Cyclin-dependent kinases"""	15483	protein-coding gene	gene with protein product	"""serine-threonine protein kinase NKIAMRE"""	608459				10463609	Standard	NM_016508		Approved	NKIAMRE	uc003kzf.4	Q8IVW4	OTTHUMG00000186341	ENST00000265334.4:c.313T>G	chr5.hg19:g.133695635A>C	ENSP00000265334:p.Tyr105Asp	6.0	0.0	.		17.0	8.0	.	NM_001113575	D3DQA0|D3DQA1|Q9P114	Missense_Mutation	SNP	ENST00000265334.4	hg19	CCDS47264.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.106870	0.77096	.	.	ENSG00000006837	ENST00000265334;ENST00000521118;ENST00000523832;ENST00000435211	T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27	5.33	5.33	0.75918	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.56097	D	0.000039	T	0.82171	0.4979	M	0.81614	2.55	0.45733	D	0.998634	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.84940	0.0865	10	0.87932	D	0	-6.1958	14.5773	0.68258	1.0:0.0:0.0:0.0	.	105;105	E7ET86;Q8IVW4	.;CDKL3_HUMAN	D	105	ENSP00000265334:Y105D;ENSP00000428689:Y105D;ENSP00000430496:Y105D;ENSP00000395559:Y105D	ENSP00000265334:Y105D	Y	-	1	0	CDKL3	133723534	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.231000	0.72307	2.141000	0.66446	0.482000	0.46254	TAC	.	.	.	none		0.328	CDKL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377697.1	NM_001113575	
DNAH8	1769	hgsc.bcm.edu	37	6	38704982	38704982	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr6:38704982A>T	ENST00000359357.3	+	4	505	c.251A>T	c.(250-252)gAa>gTa	p.E84V	DNAH8_ENST00000441566.1_Missense_Mutation_p.E84V|DNAH8_ENST00000449981.2_Missense_Mutation_p.E301V			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	84					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						GGAGAATCTGAAAAACATATT	0.313																																					p.E301V		Atlas-SNP	.											.	DNAH8	1239	.	0			c.A902T						PASS	.						74.0	77.0	76.0					6																	38704982		2203	4300	6503	SO:0001583	missense	1769	exon6			AATCTGAAAAACA	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.251A>T	chr6.hg19:g.38704982A>T	ENSP00000352312:p.Glu84Val	70.0	0.0	.		108.0	50.0	.	NM_001206927	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	hg19		.	.	.	.	.	.	.	.	.	.	A	6.965	0.548009	0.13312	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.23950	1.91;1.9;1.88	5.2	5.2	0.72013	.	0.348200	0.29980	N	0.010705	T	0.08268	0.0206	L	0.41236	1.265	0.32224	N	0.57484	B	0.02656	0.0	B	0.04013	0.001	T	0.17868	-1.0355	10	0.14252	T	0.57	.	11.237	0.48946	0.8476:0.1523:0.0:0.0	.	84	Q96JB1	DYH8_HUMAN	V	289;289;84;84	ENSP00000333363:E289V;ENSP00000352312:E84V;ENSP00000402294:E84V	ENSP00000333363:E289V	E	+	2	0	DNAH8	38812960	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.440000	0.44855	2.073000	0.62155	0.482000	0.46254	GAA	.	.	.	none		0.313	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
DFNA5	1687	hgsc.bcm.edu	37	7	24745817	24745817	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr7:24745817A>T	ENST00000342947.3	-	8	1594	c.1169T>A	c.(1168-1170)gTc>gAc	p.V390D	DFNA5_ENST00000545231.1_Missense_Mutation_p.V226D|DFNA5_ENST00000409970.1_Missense_Mutation_p.V226D|DFNA5_ENST00000419307.1_Missense_Mutation_p.V226D|DFNA5_ENST00000409775.3_Missense_Mutation_p.V390D	NM_004403.2	NP_004394.1	O60443	DFNA5_HUMAN	deafness, autosomal dominant 5	390					apoptotic process (GO:0006915)|inner ear receptor cell differentiation (GO:0060113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(3)|stomach(1)	19						GAGGGCACTGACCAAGAAGTA	0.537																																					p.V390D	GBM(78;184 1250 20134 20900 23600)	Atlas-SNP	.											.	DFNA5	51	.	0			c.T1169A						PASS	.						75.0	76.0	76.0					7																	24745817		2203	4300	6503	SO:0001583	missense	1687	exon8			GCACTGACCAAGA	AF007790	CCDS5389.1, CCDS47563.1	7p15	2011-07-01			ENSG00000105928	ENSG00000105928			2810	protein-coding gene	gene with protein product		608798				8589696, 9450185	Standard	NM_004403		Approved	ICERE-1	uc010kus.1	O60443	OTTHUMG00000023237	ENST00000342947.3:c.1169T>A	chr7.hg19:g.24745817A>T	ENSP00000339587:p.Val390Asp	100.0	0.0	.		164.0	95.0	.	NM_001127453	A4D156|B2RAX9|B3KT05|O14590|Q08AQ8|Q9UBV3	Missense_Mutation	SNP	ENST00000342947.3	hg19	CCDS5389.1	.	.	.	.	.	.	.	.	.	.	A	15.16	2.752032	0.49362	.	.	ENSG00000105928	ENST00000342947;ENST00000419307;ENST00000545231;ENST00000409970;ENST00000409775;ENST00000430096	T;T;T;T;T;T	0.26957	1.7;1.7;1.7;1.7;1.7;1.7	5.0	5.0	0.66597	.	0.415630	0.25613	N	0.029475	T	0.44074	0.1276	M	0.68317	2.08	0.80722	D	1	D	0.60575	0.988	P	0.59357	0.856	T	0.43048	-0.9415	10	0.87932	D	0	-18.5588	12.3301	0.55035	1.0:0.0:0.0:0.0	.	390	O60443	DFNA5_HUMAN	D	390;226;226;226;390;10	ENSP00000339587:V390D;ENSP00000401332:V226D;ENSP00000442661:V226D;ENSP00000387119:V226D;ENSP00000386670:V390D;ENSP00000395540:V10D	ENSP00000339587:V390D	V	-	2	0	DFNA5	24712342	1.000000	0.71417	1.000000	0.80357	0.119000	0.20118	5.025000	0.64097	2.091000	0.63221	0.460000	0.39030	GTC	.	.	.	none		0.537	DFNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214060.2	NM_004403	
AEBP1	165	hgsc.bcm.edu	37	7	44146299	44146299	+	Silent	SNP	T	T	C	rs539867334		TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr7:44146299T>C	ENST00000223357.3	+	2	713	c.408T>C	c.(406-408)ccT>ccC	p.P136P		NM_001129.3	NP_001120.3	Q8IUX7	AEBP1_HUMAN	AE binding protein 1	136	Pro-rich.				cell adhesion (GO:0007155)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(13)|upper_aerodigestive_tract(2)	33						AGAAGCCACCTAAGGCCACCA	0.627													T|||	1	0.000199681	0.0	0.0	5008	,	,		12431	0.0		0.001	False		,,,				2504	0.0				p.P136P		Atlas-SNP	.											AEBP1,NS,carcinoma,0,2	AEBP1	102	.	0			c.T408C						PASS	.						102.0	108.0	106.0					7																	44146299		2199	4296	6495	SO:0001819	synonymous_variant	165	exon2			GCCACCTAAGGCC	D86479	CCDS5476.1	7p	2008-07-18	2001-11-28		ENSG00000106624	ENSG00000106624			303	protein-coding gene	gene with protein product	"""aortic carboxypeptidase-like protein"", ""adipocyte enhancer binding protein 1"""	602981	"""AE-binding protein 1"""			8920928	Standard	NM_001129		Approved	ACLP	uc003tkb.4	Q8IUX7	OTTHUMG00000023362	ENST00000223357.3:c.408T>C	chr7.hg19:g.44146299T>C		31.0	0.0	.		41.0	3.0	.	NM_001129	Q14113|Q59ER7|Q6ZSC7|Q7KZ79	Silent	SNP	ENST00000223357.3	hg19	CCDS5476.1	.	.	.	.	.	.	.	.	.	.	T	9.564	1.119220	0.20877	.	.	ENSG00000106624	ENST00000455443	.	.	.	5.02	-4.0	0.04057	.	.	.	.	.	.	.	.	.	.	.	0.48901	D	0.999723	.	.	.	.	.	.	.	.	.	.	.	.	.	-13.6441	1.8939	0.03253	0.1952:0.3376:0.0967:0.3705	.	.	.	.	Q	94	.	.	X	+	1	0	AEBP1	44112824	0.000000	0.05858	0.758000	0.31321	0.945000	0.59286	-4.524000	0.00221	-0.739000	0.04809	-0.464000	0.05259	TAA	.	.	.	none		0.627	AEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250993.2	NM_001129	
TYW1	55253	hgsc.bcm.edu	37	7	66532281	66532281	+	Silent	SNP	C	C	A			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr7:66532281C>A	ENST00000359626.5	+	10	1329	c.1165C>A	c.(1165-1167)Cga>Aga	p.R389R		NM_018264.2	NP_060734.2	Q9NV66	TYW1_HUMAN	tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)	389					tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(8)|kidney(10)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(3)|stomach(2)|urinary_tract(2)	46		Lung NSC(55;0.0846)|all_lung(88;0.183)				GTCCATGCTCCGAGGGAGAGG	0.413																																					p.R389R		Atlas-SNP	.											.	TYW1	71	.	0			c.C1165A						PASS	.						161.0	141.0	148.0					7																	66532281		2203	4300	6503	SO:0001819	synonymous_variant	55253	exon10			ATGCTCCGAGGGA	AK001762	CCDS5538.1	7q11.21	2007-11-29	2007-11-29	2007-11-29	ENSG00000198874	ENSG00000198874			25598	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 1 homolog A (S. cerevisiae)"""	611243	"""radical S-adenosyl methionine and flavodoxin domains 1"""	RSAFD1		16162496, 17150819	Standard	NM_018264		Approved	FLJ10900, MGC23001, MGC60291, YPL207W, TYW1A	uc003tvn.4	Q9NV66	OTTHUMG00000129723	ENST00000359626.5:c.1165C>A	chr7.hg19:g.66532281C>A		114.0	0.0	.		162.0	7.0	.	NM_018264	Q6PJG8|Q75MG8|Q75MN3|Q86V12|Q8IVS7|Q9H9C4	Silent	SNP	ENST00000359626.5	hg19	CCDS5538.1																																																																																			.	.	.	none		0.413	TYW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251932.2	NM_018264	
SGK223	157285	hgsc.bcm.edu	37	8	8235103	8235103	+	Silent	SNP	A	A	T			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr8:8235103A>T	ENST00000520004.1	-	3	1080	c.816T>A	c.(814-816)acT>acA	p.T272T	SGK223_ENST00000330777.4_Silent_p.T272T			Q86YV5	SG223_HUMAN		272							ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										GGGAACCTGCAGTCTGGGAGG	0.677																																					p.T272T	GBM(34;731 755 10259 33573 33867)	Atlas-SNP	.											.	.	.	.	0			c.T816A						PASS	.						22.0	27.0	25.0					8																	8235103		1995	4154	6149	SO:0001819	synonymous_variant	0	exon2			ACCTGCAGTCTGG																												ENST00000520004.1:c.816T>A	chr8.hg19:g.8235103A>T		32.0	0.0	.		34.0	22.0	.	NM_001080826	Q8N3N5	Silent	SNP	ENST00000520004.1	hg19	CCDS43706.1																																																																																			.	.	.	none		0.677	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374864.1		
ZBTB10	65986	hgsc.bcm.edu	37	8	81411997	81411997	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr8:81411997T>G	ENST00000430430.1	+	3	2020	c.1241T>G	c.(1240-1242)gTt>gGt	p.V414G	ZBTB10_ENST00000426744.2_Missense_Mutation_p.V414G|ZBTB10_ENST00000455036.3_Missense_Mutation_p.V414G|ZBTB10_ENST00000379091.4_Missense_Mutation_p.V122G	NM_001277145.1	NP_001264074.1	Q96DT7	ZBT10_HUMAN	zinc finger and BTB domain containing 10	414	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(4)	20	all_cancers(3;1.68e-09)|all_epithelial(4;5.13e-11)|Lung NSC(7;1.75e-07)|all_lung(9;7.38e-07)|Breast(3;2.96e-06)		BRCA - Breast invasive adenocarcinoma(6;0.000434)|Epithelial(68;0.00486)|all cancers(69;0.0296)			ATTGCTGCAGTTCAAGGTTTT	0.408																																					p.V414G		Atlas-SNP	.											.	ZBTB10	51	.	0			c.T1241G						PASS	.						124.0	118.0	120.0					8																	81411997		1835	4102	5937	SO:0001583	missense	65986	exon2			CTGCAGTTCAAGG	AK022814	CCDS47880.1, CCDS64920.1	8q13-q21.1	2013-01-09			ENSG00000205189	ENSG00000205189		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	30953	protein-coding gene	gene with protein product						12477932	Standard	NM_001105539		Approved	RINZF, FLJ12752	uc003ybx.5	Q96DT7	OTTHUMG00000155016	ENST00000430430.1:c.1241T>G	chr8.hg19:g.81411997T>G	ENSP00000387462:p.Val414Gly	106.0	0.0	.		96.0	4.0	.	NM_023929	A4FVD0|Q86W96|Q8IXI9|Q96MH9	Missense_Mutation	SNP	ENST00000430430.1	hg19	CCDS47880.1	.	.	.	.	.	.	.	.	.	.	T	16.00	2.997599	0.54147	.	.	ENSG00000205189	ENST00000379091;ENST00000430430;ENST00000455036;ENST00000426744;ENST00000519370	T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31	5.54	5.54	0.83059	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.142348	0.44902	D	0.000418	T	0.79106	0.4390	L	0.58510	1.815	0.80722	D	1	B;D;D;D	0.89917	0.387;1.0;1.0;1.0	P;D;D;D	0.91635	0.512;0.998;0.998;0.999	T	0.79783	-0.1658	10	0.51188	T	0.08	.	15.6913	0.77457	0.0:0.0:0.0:1.0	.	270;414;414;122	A8E4L4;Q96DT7;Q96DT7-2;Q96DT7-4	.;ZBT10_HUMAN;.;.	G	122;414;414;414;242	ENSP00000368384:V122G;ENSP00000387462:V414G;ENSP00000412036:V414G;ENSP00000416134:V414G	ENSP00000368384:V122G	V	+	2	0	ZBTB10	81574552	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.698000	0.84413	2.113000	0.64589	0.528000	0.53228	GTT	.	.	.	none		0.408	ZBTB10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338055.2	NM_023929	
NIPAL2	79815	hgsc.bcm.edu	37	8	99215364	99215364	+	Silent	SNP	A	A	T			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr8:99215364A>T	ENST00000341166.3	-	8	1107	c.852T>A	c.(850-852)atT>atA	p.I284I	NIPAL2_ENST00000430223.2_Silent_p.I284I|NIPAL2_ENST00000520545.1_5'UTR	NM_024759.1	NP_079035.1	Q9H841	NPAL2_HUMAN	NIPA-like domain containing 2	284						integral component of membrane (GO:0016021)	magnesium ion transmembrane transporter activity (GO:0015095)			cervix(3)|kidney(1)|large_intestine(2)|lung(5)|stomach(1)	12						TTGTAAAGAAAATATGATTAA	0.408																																					p.I284I		Atlas-SNP	.											.	NIPAL2	23	.	0			c.T852A						PASS	.						185.0	162.0	170.0					8																	99215364		2203	4300	6503	SO:0001819	synonymous_variant	79815	exon8			AAAGAAAATATGA	AK024017	CCDS6278.1	8q22.2	2009-03-24		2009-03-24	ENSG00000104361	ENSG00000104361			25854	protein-coding gene	gene with protein product				NPAL2		14702039	Standard	NM_024759		Approved	FLJ13955	uc003yil.1	Q9H841	OTTHUMG00000164668	ENST00000341166.3:c.852T>A	chr8.hg19:g.99215364A>T		99.0	0.0	.		122.0	58.0	.	NM_024759	A2RTY8	Silent	SNP	ENST00000341166.3	hg19	CCDS6278.1																																																																																			.	.	.	none		0.408	NIPAL2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000379677.1	NM_024759	
C9orf91	203197	hgsc.bcm.edu	37	9	117400851	117400851	+	Silent	SNP	T	T	C			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr9:117400851T>C	ENST00000288502.4	+	8	1131	c.694T>C	c.(694-696)Ttg>Ctg	p.L232L	C9orf91_ENST00000374049.4_Silent_p.L233L			Q5VZI3	CI091_HUMAN	chromosome 9 open reading frame 91	232						integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(3)|lung(5)|pancreas(1)|skin(1)|urinary_tract(1)	13						ATTGAGCCAGTTGTGTGTTGT	0.562																																					p.L232L		Atlas-SNP	.											.	C9orf91	32	.	0			c.T694C						PASS	.						149.0	136.0	140.0					9																	117400851		2203	4300	6503	SO:0001819	synonymous_variant	203197	exon8			AGCCAGTTGTGTG	BX649023	CCDS6808.1	9q33.1	2008-02-05			ENSG00000157693	ENSG00000157693			24513	protein-coding gene	gene with protein product						14702039	Standard	NM_153045		Approved	DKFZp547P234, FLJ38045	uc004bjd.4	Q5VZI3	OTTHUMG00000020541	ENST00000288502.4:c.694T>C	chr9.hg19:g.117400851T>C		168.0	0.0	.		175.0	76.0	.	NM_153045	A0PJA3|Q3KNS4|Q5VZI2|Q6P5Z7|Q8N1P3|Q8ND43	Silent	SNP	ENST00000288502.4	hg19	CCDS6808.1																																																																																			.	.	.	none		0.562	C9orf91-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000053780.1	NM_153045	
PPA1	5464	hgsc.bcm.edu	37	10	71969401	71969401	+	Silent	SNP	T	T	C	rs150430650		TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr10:71969401T>C	ENST00000373232.3	-	7	651	c.552A>G	c.(550-552)gaA>gaG	p.E184E		NM_021129.3	NP_066952.1	Q15181	IPYR_HUMAN	pyrophosphatase (inorganic) 1	184					diphosphate metabolic process (GO:0071344)|gene expression (GO:0010467)|phosphate-containing compound metabolic process (GO:0006796)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	inorganic diphosphatase activity (GO:0004427)|magnesium ion binding (GO:0000287)			breast(2)|endometrium(1)|large_intestine(2)|lung(3)|skin(2)	10						CCACAGTAGCTTCTAAGTAGC	0.343																																					p.E184E		Atlas-SNP	.											.	PPA1	24	.	0			c.A552G						PASS	.						108.0	111.0	110.0					10																	71969401		2203	4300	6503	SO:0001819	synonymous_variant	5464	exon7			AGTAGCTTCTAAG	AF154065	CCDS7299.1	10q11.1-q24	2012-10-02	2005-10-07	2005-10-07	ENSG00000180817	ENSG00000180817	3.6.1.1		9226	protein-coding gene	gene with protein product	"""cytosolic inorganic pyrophosphatase"", ""inorganic pyrophosphatase 1"", ""pyrophosphate phospho-hydrolase"""	179030	"""pyrophosphatase (inorganic)"""	PP		10542310, 975879	Standard	NM_021129		Approved	SID6-8061, Ppase, IOPPP, PP1	uc001jqv.1	Q15181	OTTHUMG00000018399	ENST00000373232.3:c.552A>G	chr10.hg19:g.71969401T>C		124.0	0.0	.		170.0	10.0	.	NM_021129	Q2M348|Q5SQT7|Q6P7P4|Q9UQJ5|Q9Y5B1	Silent	SNP	ENST00000373232.3	hg19	CCDS7299.1																																																																																			.	.	.	weak		0.343	PPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048490.2	NM_021129	
CUTC	51076	hgsc.bcm.edu	37	10	101507060	101507060	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr10:101507060A>C	ENST00000370476.5	+	6	615	c.486A>C	c.(484-486)ttA>ttC	p.L162F		NM_015960.2	NP_057044.2	Q9NTM9	CUTC_HUMAN	cutC copper transporter	162					copper ion homeostasis (GO:0055070)|copper ion transport (GO:0006825)|protein tetramerization (GO:0051262)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	copper ion binding (GO:0005507)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14		Colorectal(252;0.234)		Epithelial(162;3e-10)|all cancers(201;2.37e-08)		AGACCCTCTTAACCTTGGGAT	0.438																																					p.L162F		Atlas-SNP	.											.	CUTC	32	.	0			c.A486C						PASS	.						178.0	165.0	170.0					10																	101507060		2203	4300	6503	SO:0001583	missense	51076	exon6			CCTCTTAACCTTG	AF132966	CCDS7483.1	10q24.31	2013-07-31	2013-07-31		ENSG00000119929	ENSG00000119929			24271	protein-coding gene	gene with protein product		610101	"""cutC copper transporter homolog (E. coli)"""			16182249	Standard	NM_015960		Approved	CGI-32	uc001kqd.4	Q9NTM9	OTTHUMG00000018889	ENST00000370476.5:c.486A>C	chr10.hg19:g.101507060A>C	ENSP00000359507:p.Leu162Phe	122.0	0.0	.		179.0	42.0	.	NM_015960	Q5TCZ8|Q9Y321	Missense_Mutation	SNP	ENST00000370476.5	hg19	CCDS7483.1	.	.	.	.	.	.	.	.	.	.	A	15.54	2.863855	0.51482	.	.	ENSG00000119929	ENST00000370476;ENST00000370472	.	.	.	5.75	1.83	0.25207	Copper homeostasis CutC domain (2);	0.362596	0.26478	N	0.024153	T	0.47097	0.1427	M	0.66439	2.03	0.40178	D	0.977255	P;B	0.35844	0.524;0.358	B;B	0.40940	0.241;0.344	T	0.52003	-0.8633	9	0.87932	D	0	-2.0266	1.2816	0.02042	0.5158:0.1141:0.1618:0.2083	.	162;162	B4DYM2;Q9NTM9	.;CUTC_HUMAN	F	162;99	.	ENSP00000359503:L99F	L	+	3	2	CUTC	101497050	0.287000	0.24315	0.936000	0.37596	0.989000	0.77384	-0.314000	0.08092	0.960000	0.38005	0.460000	0.39030	TTA	.	.	.	none		0.438	CUTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049811.1	NM_015960	
MCMBP	79892	hgsc.bcm.edu	37	10	121598084	121598084	+	Silent	SNP	A	A	G			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr10:121598084A>G	ENST00000360003.3	-	12	1546	c.1377T>C	c.(1375-1377)gaT>gaC	p.D459D	MCMBP_ENST00000369077.3_Silent_p.D457D|MCMBP_ENST00000466047.1_5'UTR	NM_001256378.1|NM_001256379.1|NM_024834.3	NP_001243307.1|NP_001243308.1|NP_079110.1	Q9BTE3	MCMBP_HUMAN	minichromosome maintenance complex binding protein	459					DNA-dependent DNA replication (GO:0006261)|mitotic nuclear division (GO:0007067)|sister chromatid cohesion (GO:0007062)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(2)|skin(2)	21						GGAGAGTCTCATCGATTACAA	0.483																																					p.D459D		Atlas-SNP	.											.	MCMBP	49	.	0			c.T1377C						PASS	.						75.0	73.0	74.0					10																	121598084		2203	4300	6503	SO:0001819	synonymous_variant	79892	exon12			AGTCTCATCGATT	BC007219	CCDS7617.1, CCDS58099.1	10q26.13	2013-10-11	2011-01-05	2011-01-05	ENSG00000197771	ENSG00000197771			25782	protein-coding gene	gene with protein product		610909	"""chromosome 10 open reading frame 119"""	C10orf119		17296731	Standard	NM_024834		Approved	FLJ13081, MCM-BP	uc001ler.3	Q9BTE3	OTTHUMG00000019159	ENST00000360003.3:c.1377T>C	chr10.hg19:g.121598084A>G		60.0	0.0	.		80.0	29.0	.	NM_024834	B3KSP7|Q6IA56|Q9BVT9|Q9H916	Silent	SNP	ENST00000360003.3	hg19	CCDS7617.1																																																																																			.	.	.	none		0.483	MCMBP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000050684.1	NM_024834	
ENDOD1	23052	hgsc.bcm.edu	37	11	94862157	94862157	+	Missense_Mutation	SNP	C	C	G	rs61734147	byFrequency	TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr11:94862157C>G	ENST00000278505.4	+	2	1035	c.917C>G	c.(916-918)tCt>tGt	p.S306C		NM_015036.2	NP_055851.1	O94919	ENDD1_HUMAN	endonuclease domain containing 1	306						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.S306C(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.00824)				AGTCCCCTTTCTAGCACCAGG	0.448																																					p.S306C		Atlas-SNP	.											ENDOD1,mouth,carcinoma,0,1	ENDOD1	26	.	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.C917G						PASS	.						85.0	82.0	83.0					11																	94862157		1855	4087	5942	SO:0001583	missense	23052	exon2			CCCTTTCTAGCAC	BC026191	CCDS41699.1	11q21	2010-03-19			ENSG00000149218	ENSG00000149218			29129	protein-coding gene	gene with protein product						10048485	Standard	NM_015036		Approved	KIAA0830	uc001pfh.3	O94919	OTTHUMG00000167835	ENST00000278505.4:c.917C>G	chr11.hg19:g.94862157C>G	ENSP00000278505:p.Ser306Cys	121.0	0.0	.		116.0	47.0	.	NM_015036	A8K6K8|Q6GQY5|Q8TAQ8	Missense_Mutation	SNP	ENST00000278505.4	hg19	CCDS41699.1	.	.	.	.	.	.	.	.	.	.	C	14.15	2.450542	0.43531	.	.	ENSG00000149218	ENST00000278505	T	0.35973	1.28	5.79	5.79	0.91817	.	0.494397	0.18919	N	0.127530	T	0.44767	0.1309	M	0.62723	1.935	0.28948	N	0.890571	P	0.45283	0.855	B	0.44163	0.443	T	0.50171	-0.8859	10	0.87932	D	0	-0.6278	17.5334	0.87820	0.0:1.0:0.0:0.0	.	306	O94919	ENDD1_HUMAN	C	306	ENSP00000278505:S306C	ENSP00000278505:S306C	S	+	2	0	ENDOD1	94501805	0.020000	0.18652	0.551000	0.28230	0.151000	0.21798	2.730000	0.47335	2.742000	0.94016	0.455000	0.32223	TCT	.	C|0.998;T|0.002	.	alt		0.448	ENDOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396545.1	NM_015036	
UBE4A	9354	hgsc.bcm.edu	37	11	118243839	118243839	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr11:118243839G>A	ENST00000431736.2	+	7	853	c.781G>A	c.(781-783)Gaa>Aaa	p.E261K	UBE4A_ENST00000252108.3_Missense_Mutation_p.E254K					ubiquitination factor E4A											autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(7)|liver(2)|lung(14)|ovary(3)|prostate(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	56	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		AGAGGTCATTGAAGCCTTGAT	0.368																																					p.E261K		Atlas-SNP	.											.	UBE4A	97	.	0			c.G781A						PASS	.						117.0	113.0	115.0					11																	118243839		2200	4296	6496	SO:0001583	missense	9354	exon7			GTCATTGAAGCCT	D50916	CCDS8396.1, CCDS55790.1	11q23.3	2013-01-28	2011-05-19					"""U-box domain containing"""	12499	protein-coding gene	gene with protein product		603753	"""ubiquitination factor E4A (homologous to yeast UFD2)"", ""ubiquitination factor E4A (UFD2 homolog, yeast)"""			10089879	Standard	NM_004788		Approved	UBOX2, UFD2, KIAA0126, E4	uc001psv.3	Q14139	OTTHUMG00000168100	ENST00000431736.2:c.781G>A	chr11.hg19:g.118243839G>A	ENSP00000387362:p.Glu261Lys	94.0	0.0	.		89.0	42.0	.	NM_004788		Missense_Mutation	SNP	ENST00000431736.2	hg19	CCDS8396.1	.	.	.	.	.	.	.	.	.	.	g	14.87	2.663910	0.47572	.	.	ENSG00000110344	ENST00000252108;ENST00000431736	T;T	0.46063	0.88;0.88	6.04	1.95	0.26073	.	0.407974	0.28815	N	0.014059	T	0.23766	0.0575	N	0.24115	0.695	0.80722	D	1	B;B	0.19200	0.02;0.034	B;B	0.21708	0.016;0.036	T	0.05903	-1.0857	10	0.08837	T	0.75	-0.6425	8.9731	0.35919	0.1267:0.245:0.6283:0.0	.	254;261	Q14139;Q14139-2	UBE4A_HUMAN;.	K	254;261	ENSP00000252108:E254K;ENSP00000387362:E261K	ENSP00000252108:E254K	E	+	1	0	UBE4A	117749049	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.805000	0.55575	0.437000	0.26423	-0.213000	0.12676	GAA	.	.	.	none		0.368	UBE4A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398143.1	NM_004788	
MCAM	4162	hgsc.bcm.edu	37	11	119183001	119183001	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr11:119183001A>C	ENST00000264036.4	-	8	1013	c.999T>G	c.(997-999)agT>agG	p.S333R	MCAM_ENST00000530144.2_5'Flank|MCAM_ENST00000392814.1_Missense_Mutation_p.S282R	NM_006500.2	NP_006491.2	P43121	MUC18_HUMAN	melanoma cell adhesion molecule	333					anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|glomerular filtration (GO:0003094)|vascular wound healing (GO:0061042)	external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|skin(1)	22		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.78e-05)		CCTGTGGTTCACTCAGCAGCG	0.622																																					p.S333R		Atlas-SNP	.											.	MCAM	57	.	0			c.T999G						PASS	.						96.0	92.0	94.0					11																	119183001		2199	4295	6494	SO:0001583	missense	4162	exon8			TGGTTCACTCAGC	X68264	CCDS31690.1	11q23.3	2013-01-29				ENSG00000076706		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6934	protein-coding gene	gene with protein product	"""Gicerin"""	155735				2602381, 10702685	Standard	XM_005271552		Approved	MUC18, CD146	uc001pwf.3	P43121		ENST00000264036.4:c.999T>G	chr11.hg19:g.119183001A>C	ENSP00000264036:p.Ser333Arg	110.0	0.0	.		107.0	38.0	.	NM_006500	O95812|Q59E86|Q6PHR3|Q6ZTR2	Missense_Mutation	SNP	ENST00000264036.4	hg19	CCDS31690.1	.	.	.	.	.	.	.	.	.	.	A	10.61	1.399560	0.25291	.	.	ENSG00000076706	ENST00000264036;ENST00000392814	T;T	0.06849	3.25;3.25	5.53	-3.57	0.04612	Immunoglobulin-like fold (1);	.	.	.	.	T	0.03739	0.0106	N	0.19112	0.55	0.09310	N	1	B	0.19331	0.035	B	0.15484	0.013	T	0.45614	-0.9249	9	0.18276	T	0.48	-16.5141	2.4635	0.04547	0.3729:0.2069:0.3187:0.1015	.	333	P43121	MUC18_HUMAN	R	333;282	ENSP00000264036:S333R;ENSP00000376561:S282R	ENSP00000264036:S333R	S	-	3	2	MCAM	118688211	0.000000	0.05858	0.024000	0.17045	0.080000	0.17528	-0.422000	0.07043	-0.700000	0.05070	-0.411000	0.06167	AGT	.	.	.	none		0.622	MCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388332.2		
APOLD1	81575	hgsc.bcm.edu	37	12	12940182	12940182	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr12:12940182C>T	ENST00000326765.6	+	2	506	c.436C>T	c.(436-438)Cgg>Tgg	p.R146W	APOLD1_ENST00000356591.4_Missense_Mutation_p.R115W	NM_001130415.1	NP_001123887.1	Q96LR9	APLD1_HUMAN	apolipoprotein L domain containing 1	146					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|endothelial cell activation (GO:0042118)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|regulation of endothelial cell differentiation (GO:0045601)|response to hypoxia (GO:0001666)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			breast(1)|endometrium(1)|large_intestine(1)|lung(1)|ovary(1)	5		Prostate(47;0.0632)		BRCA - Breast invasive adenocarcinoma(232;0.0338)|GBM - Glioblastoma multiforme(207;0.149)		CTGCAACTCCCGGGAGCTGCG	0.682																																					p.R146W		Atlas-SNP	.											.	APOLD1	10	.	0			c.C436T						PASS	.						27.0	31.0	30.0					12																	12940182		2203	4300	6503	SO:0001583	missense	81575	exon2			AACTCCCGGGAGC	AL136783	CCDS8654.1, CCDS44833.1	12p13.2	2006-02-03	2006-01-23		ENSG00000178878	ENSG00000178878			25268	protein-coding gene	gene with protein product		612456				11230166	Standard	NM_030817		Approved	FLJ25138, DKFZP434F0318	uc001rau.4	Q96LR9	OTTHUMG00000153561	ENST00000326765.6:c.436C>T	chr12.hg19:g.12940182C>T	ENSP00000324277:p.Arg146Trp	65.0	0.0	.		93.0	23.0	.	NM_001130415	Q8IVR2|Q9H0I5	Missense_Mutation	SNP	ENST00000326765.6	hg19	CCDS44833.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.040822	0.75732	.	.	ENSG00000178878	ENST00000326765;ENST00000356591	T;T	0.03386	3.95;3.95	4.91	4.01	0.46588	.	0.395551	0.24623	U	0.036942	T	0.09730	0.0239	L	0.43152	1.355	0.31300	N	0.688457	D;D	0.76494	0.999;0.999	D;D	0.65987	0.94;0.94	T	0.02758	-1.1114	10	0.44086	T	0.13	-18.6983	9.3604	0.38192	0.2848:0.5756:0.1396:0.0	.	115;146	A0AVN6;Q96LR9	.;APLD1_HUMAN	W	146;115	ENSP00000324277:R146W;ENSP00000348998:R115W	ENSP00000324277:R146W	R	+	1	2	APOLD1	12831449	0.938000	0.31826	1.000000	0.80357	0.994000	0.84299	0.853000	0.27777	1.179000	0.42884	0.478000	0.44815	CGG	.	.	.	none		0.682	APOLD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331627.1	NM_030817	
ANP32D	23519	hgsc.bcm.edu	37	12	48866497	48866497	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr12:48866497C>A	ENST00000266594.1	+	1	50	c.50C>A	c.(49-51)tCc>tAc	p.S17Y		NM_012404.2	NP_036536.2	O95626	AN32D_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32 family, member D	17						nuclear matrix (GO:0016363)				central_nervous_system(1)|large_intestine(2)|lung(3)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	9						AGGACGCCCTCCGATGTGAAA	0.448																																					p.S17Y		Atlas-SNP	.											.	ANP32D	15	.	0			c.C50A						PASS	.						115.0	117.0	117.0					12																	48866497		2203	4300	6503	SO:0001583	missense	23519	exon1			CGCCCTCCGATGT	U71084	CCDS31788.1	12q13.12	2008-08-04			ENSG00000139223	ENSG00000139223		"""ANP32 acidic nuclear phosphoproteins"""	16676	protein-coding gene	gene with protein product	"""pp32 related 2"""	606878				10086381, 10400610	Standard	NM_012404		Approved	PP32R2	uc010slt.2	O95626	OTTHUMG00000162681	ENST00000266594.1:c.50C>A	chr12.hg19:g.48866497C>A	ENSP00000266594:p.Ser17Tyr	167.0	0.0	.		258.0	135.0	.	NM_012404	Q6NTC4	Missense_Mutation	SNP	ENST00000266594.1	hg19	CCDS31788.1	.	.	.	.	.	.	.	.	.	.	C	14.73	2.624087	0.46840	.	.	ENSG00000139223	ENST00000266594	T	0.00468	7.22	1.48	0.203	0.15195	.	0.288521	0.34986	N	0.003527	T	0.00552	0.0018	M	0.86343	2.81	0.38870	D	0.95666	P	0.47106	0.89	B	0.41088	0.347	T	0.68458	-0.5403	10	0.72032	D	0.01	.	4.9765	0.14144	0.0:0.6111:0.3889:0.0	.	17	O95626	AN32D_HUMAN	Y	17	ENSP00000266594:S17Y	ENSP00000266594:S17Y	S	+	2	0	ANP32D	47152764	0.897000	0.30589	0.027000	0.17364	0.572000	0.35998	-0.183000	0.09712	0.856000	0.35383	0.289000	0.19496	TCC	.	.	.	none		0.448	ANP32D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370058.1	NM_012404	
KRT4	3851	hgsc.bcm.edu	37	12	53205646	53205646	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr12:53205646C>G	ENST00000551956.1	-	2	1070	c.578G>C	c.(577-579)aGt>aCt	p.S193T	KRT4_ENST00000293774.4_Missense_Mutation_p.S267T|KRT4_ENST00000458244.2_Missense_Mutation_p.S173T			P19013	K2C4_HUMAN	keratin 4	207	Linker 1.|Rod.				cytoskeleton organization (GO:0007010)|epithelial cell differentiation (GO:0030855)|negative regulation of epithelial cell proliferation (GO:0050680)	cell surface (GO:0009986)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|prostate(2)|skin(2)	29						CCTCAGGACACTGAGGTAGGT	0.537																																					p.S193T	Pancreas(190;284 2995 41444 45903)	Atlas-SNP	.											.	KRT4	110	.	0			c.G578C						PASS	.						114.0	119.0	117.0					12																	53205646		2030	4201	6231	SO:0001583	missense	3851	exon2			AGGACACTGAGGT		CCDS41787.1, CCDS41787.2	12q13.13	2013-01-16			ENSG00000170477	ENSG00000170477		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6441	protein-coding gene	gene with protein product	"""cytokeratin 4"", ""keratin, type II cytoskeletal 4"""	123940		CYK4		16831889	Standard	NM_002272		Approved	CK4, K4	uc031qhk.1	P19013		ENST00000551956.1:c.578G>C	chr12.hg19:g.53205646C>G	ENSP00000448220:p.Ser193Thr	71.0	0.0	.		124.0	44.0	.	NM_002272	F8VS64|Q6GTR8|Q96LA7|Q9BTL1	Missense_Mutation	SNP	ENST00000551956.1	hg19	CCDS41787.2	.	.	.	.	.	.	.	.	.	.	C	4.151	0.026479	0.08054	.	.	ENSG00000170477	ENST00000551956;ENST00000293774;ENST00000458244	T;T;T	0.76316	-1.01;-1.01;-1.01	4.54	-1.88	0.07713	Filament (1);	0.363501	0.23947	N	0.042986	T	0.65291	0.2677	L	0.61218	1.895	0.19945	N	0.999941	B	0.21452	0.056	B	0.25614	0.062	T	0.51818	-0.8657	10	0.34782	T	0.22	.	0.9077	0.01288	0.2253:0.3089:0.1121:0.3537	.	207	P19013	K2C4_HUMAN	T	193;267;173	ENSP00000448220:S193T;ENSP00000293774:S267T;ENSP00000387904:S173T	ENSP00000293774:S267T	S	-	2	0	KRT4	51491913	0.000000	0.05858	0.000000	0.03702	0.121000	0.20230	-1.038000	0.03553	-0.350000	0.08262	-0.137000	0.14449	AGT	.	.	.	none		0.537	KRT4-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405931.1	NM_002272	
LRRIQ1	84125	hgsc.bcm.edu	37	12	85449852	85449852	+	Silent	SNP	G	G	T			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr12:85449852G>T	ENST00000393217.2	+	8	1342	c.1281G>T	c.(1279-1281)gtG>gtT	p.V427V		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	427										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		AAAATCTAGTGGATGAAAATT	0.294																																					p.V427V		Atlas-SNP	.											.	LRRIQ1	512	.	0			c.G1281T						PASS	.						83.0	95.0	91.0					12																	85449852		2200	4297	6497	SO:0001819	synonymous_variant	84125	exon8			TCTAGTGGATGAA	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.1281G>T	chr12.hg19:g.85449852G>T		160.0	0.0	.		279.0	34.0	.	NM_001079910	Q567P4|Q9BS17|Q9HA36	Silent	SNP	ENST00000393217.2	hg19	CCDS41816.1																																																																																			.	.	.	none		0.294	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165	
SYCP3	50511	hgsc.bcm.edu	37	12	102125409	102125409	+	Silent	SNP	T	T	C			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr12:102125409T>C	ENST00000392927.3	-	7	620	c.489A>G	c.(487-489)caA>caG	p.Q163Q	SYCP3_ENST00000392924.1_Silent_p.Q163Q|SYCP3_ENST00000266743.2_Silent_p.Q163Q	NM_001177948.1|NM_001177949.1|NM_153694.4	NP_001171419.1|NP_001171420.1|NP_710161.1	Q8IZU3	SYCP3_HUMAN	synaptonemal complex protein 3	163	Gln-rich.				male meiosis I (GO:0007141)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|skin(1)	11						CAATTCTAGATTGTTGAAGAA	0.264																																					p.Q163Q		Atlas-SNP	.											.	SYCP3	19	.	0			c.A489G						PASS	.						61.0	59.0	60.0					12																	102125409		2202	4281	6483	SO:0001819	synonymous_variant	50511	exon7			TCTAGATTGTTGA	AF492003, AI075991	CCDS9087.1	12q23.2	2007-02-05			ENSG00000139351	ENSG00000139351			18130	protein-coding gene	gene with protein product		604759				12213195, 10854409	Standard	NM_153694		Approved		uc001tis.3	Q8IZU3	OTTHUMG00000150132	ENST00000392927.3:c.489A>G	chr12.hg19:g.102125409T>C		29.0	0.0	.		41.0	24.0	.	NM_001177949		Silent	SNP	ENST00000392927.3	hg19	CCDS9087.1																																																																																			.	.	.	none		0.264	SYCP3-001	KNOWN	alternative_5_UTR|upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316478.2	NM_153694	
PTPN11	5781	hgsc.bcm.edu	37	12	112892407	112892407	+	Missense_Mutation	SNP	T	T	G	rs79068130		TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr12:112892407T>G	ENST00000351677.2	+	5	763	c.565T>G	c.(565-567)Tct>Gct	p.S189A	PTPN11_ENST00000392597.1_Missense_Mutation_p.S189A	NM_002834.3	NP_002825.3	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type 11	189	SH2 2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				abortive mitotic cell cycle (GO:0033277)|activation of MAPK activity (GO:0000187)|atrioventricular canal development (GO:0036302)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage checkpoint (GO:0000077)|ephrin receptor signaling pathway (GO:0048013)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|genitalia development (GO:0048806)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|multicellular organismal reproductive process (GO:0048609)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cortisol secretion (GO:0051463)|negative regulation of growth hormone secretion (GO:0060125)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ growth (GO:0035265)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of hormone secretion (GO:0046887)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of multicellular organism growth (GO:0040014)|regulation of protein export from nucleus (GO:0046825)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	insulin receptor binding (GO:0005158)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|SH3/SH2 adaptor activity (GO:0005070)	p.S189A(1)		NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(406)|kidney(2)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(3)|stomach(3)	451						ACGGTTTGATTCTTTGACAGA	0.368			Mis		"""JMML, AML, MDS"""		Noonan Syndrome		Noonan syndrome																												p.S189A		Atlas-SNP	.		Dom	yes		12	12q24.1	5781	"""protein tyrosine phosphatase, non-receptor type 11"""	yes	L	PTPN11,NS,carcinoma,0,1	PTPN11	623	.	1	Substitution - Missense(1)	stomach(1)	c.T565G						PASS	.						112.0	105.0	108.0					12																	112892407		2203	4300	6503	SO:0001583	missense	5781	exon5	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	TTTGATTCTTTGA	D13540	CCDS9163.1, CCDS58280.1	12q24.1	2014-09-17	2008-07-31		ENSG00000179295	ENSG00000179295		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9644	protein-coding gene	gene with protein product		176876	"""Noonan syndrome 1"""	NS1		7894486, 1280823	Standard	NM_080601		Approved	BPTP3, SH-PTP2, SHP-2, PTP2C, SHP2	uc001ttx.3	Q06124	OTTHUMG00000134334	ENST00000351677.2:c.565T>G	chr12.hg19:g.112892407T>G	ENSP00000340944:p.Ser189Ala	42.0	0.0	.		112.0	5.0	.	NM_080601	A8K1D9|Q96HD7	Missense_Mutation	SNP	ENST00000351677.2	hg19	CCDS9163.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.87|17.87	3.494925|3.494925	0.64186|0.64186	.|.	.|.	ENSG00000179295|ENSG00000179295	ENST00000530818|ENST00000392597;ENST00000351677;ENST00000392596	.|T;T	.|0.80824	.|-1.42;-1.42	5.65|5.65	5.65|5.65	0.86999|0.86999	.|.	.|0.051687	.|0.85682	.|D	.|0.000000	D|D	0.86151|0.86151	0.5864|0.5864	M|M	0.90977|0.90977	3.165|3.165	0.53005|0.53005	D|D	0.99996|0.99996	.|B;B	.|0.22480	.|0.07;0.07	.|B;B	.|0.36845	.|0.234;0.234	D|D	0.84453|0.84453	0.0589|0.0589	5|10	.|0.44086	.|T	.|0.13	.|.	11.0193|11.0193	0.47709|0.47709	0.1389:0.0:0.0:0.8611|0.1389:0.0:0.0:0.8611	.|.	.|189;189	.|Q06124-2;Q06124-3	.|.;.	M|A	33|189	.|ENSP00000376376:S189A;ENSP00000340944:S189A	.|ENSP00000340944:S189A	I|S	+|+	3|1	3|0	PTPN11|PTPN11	111376790|111376790	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.954000|0.954000	0.61252|0.61252	4.663000|4.663000	0.61532|0.61532	2.144000|2.144000	0.66660|0.66660	0.397000|0.397000	0.26171|0.26171	ATT|TCT	.	T|0.500;G|0.500	0.500	weak		0.368	PTPN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259496.2		
PTPN11	5781	hgsc.bcm.edu	37	12	112892458	112892458	+	Silent	SNP	T	T	C	rs78376169		TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr12:112892458T>C	ENST00000351677.2	+	5	814	c.616T>C	c.(616-618)Ttg>Ctg	p.L206L	PTPN11_ENST00000392597.1_Silent_p.L206L	NM_002834.3	NP_002825.3	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type 11	206	SH2 2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				abortive mitotic cell cycle (GO:0033277)|activation of MAPK activity (GO:0000187)|atrioventricular canal development (GO:0036302)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage checkpoint (GO:0000077)|ephrin receptor signaling pathway (GO:0048013)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|genitalia development (GO:0048806)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|multicellular organismal reproductive process (GO:0048609)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cortisol secretion (GO:0051463)|negative regulation of growth hormone secretion (GO:0060125)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ growth (GO:0035265)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of hormone secretion (GO:0046887)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of multicellular organism growth (GO:0040014)|regulation of protein export from nucleus (GO:0046825)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	insulin receptor binding (GO:0005158)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|SH3/SH2 adaptor activity (GO:0005070)	p.L206L(1)		NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(406)|kidney(2)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(3)|stomach(3)	451						GGTGGAAACATTGGGTACAGT	0.373			Mis		"""JMML, AML, MDS"""		Noonan Syndrome		Noonan syndrome																												p.L206L		Atlas-SNP	.		Dom	yes		12	12q24.1	5781	"""protein tyrosine phosphatase, non-receptor type 11"""	yes	L	PTPN11,NS,carcinoma,0,2	PTPN11	623	.	1	Substitution - coding silent(1)	stomach(1)	c.T616C						PASS	.						87.0	82.0	84.0					12																	112892458		2203	4300	6503	SO:0001819	synonymous_variant	5781	exon5	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	GAAACATTGGGTA	D13540	CCDS9163.1, CCDS58280.1	12q24.1	2014-09-17	2008-07-31		ENSG00000179295	ENSG00000179295		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9644	protein-coding gene	gene with protein product		176876	"""Noonan syndrome 1"""	NS1		7894486, 1280823	Standard	NM_080601		Approved	BPTP3, SH-PTP2, SHP-2, PTP2C, SHP2	uc001ttx.3	Q06124	OTTHUMG00000134334	ENST00000351677.2:c.616T>C	chr12.hg19:g.112892458T>C		42.0	0.0	.		81.0	4.0	.	NM_080601	A8K1D9|Q96HD7	Silent	SNP	ENST00000351677.2	hg19	CCDS9163.1																																																																																			.	.	.	weak		0.373	PTPN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259496.2		
TRIAP1	51499	hgsc.bcm.edu	37	12	120884511	120884511	+	5'Flank	SNP	C	C	T			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr12:120884511C>T	ENST00000546954.1	-	0	0				GATC_ENST00000551765.1_Missense_Mutation_p.L45F|TRIAP1_ENST00000302432.3_5'Flank|AL021546.6_ENST00000551806.1_Missense_Mutation_p.A76V	NM_016399.2	NP_057483.1	O43715	TRIA1_HUMAN	TP53 regulated inhibitor of apoptosis 1						cellular response to UV (GO:0034644)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|phospholipid transport (GO:0015914)|positive regulation of phospholipid transport (GO:2001140)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of membrane lipid distribution (GO:0097035)	mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	p53 binding (GO:0002039)					all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GCGTCTAGCGCTTGTGGACTT	0.682																																					p.L45F		Atlas-SNP	.											.	GATC	12	.	0			c.C133T						PASS	.						29.0	33.0	32.0					12																	120884511		2202	4295	6497	SO:0001631	upstream_gene_variant	283459	exon2			CTAGCGCTTGTGG		CCDS9198.1	12q24.31	2012-10-15			ENSG00000170855	ENSG00000170855			26937	protein-coding gene	gene with protein product	"""p53-inducible cell-survival factor"", ""mitochondrial distribution and morphology 35 homolog (S. cerevisiae)"""	614943				11042152, 15735003	Standard	NM_016399		Approved	P53CSV, WF-1, HSPC132, p53CSV, MDM35	uc001tyg.3	O43715	OTTHUMG00000047787		chr12.hg19:g.120884511C>T	Exception_encountered	58.0	0.0	.		121.0	34.0	.	NM_176818	B2R4Z7|Q5RKS5|Q6LCA7	Missense_Mutation	SNP	ENST00000546954.1	hg19	CCDS9198.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.7|23.7	4.450683|4.450683	0.84101|0.84101	.|.	.|.	ENSG00000111780|ENSG00000257218	ENST00000551806|ENST00000551765	.|T	.|0.55413	.|0.52	5.08|5.08	5.08|5.08	0.68730|0.68730	.|.	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.46483|0.46483	0.1395|0.1395	L|L	0.55213|0.55213	1.73|1.73	0.58432|0.58432	D|D	0.999996|0.999996	.|P	.|0.35456	.|0.502	.|B	.|0.31337	.|0.128	T|T	0.53272|0.53272	-0.8462|-0.8462	6|10	0.72032|0.87932	D|D	0.01|0	-15.3352|-15.3352	12.1028|12.1028	0.53794|0.53794	0.0:0.9221:0.0:0.0779|0.0:0.9221:0.0:0.0779	.|.	.|45	.|O43716	.|GATC_HUMAN	V|F	76|45	.|ENSP00000446872:L45F	ENSP00000450281:A76V|ENSP00000448397:L45F	A|L	+|+	2|1	0|0	GATC|AL021546.1	119368894|119368894	0.992000|0.992000	0.36948|0.36948	0.685000|0.685000	0.30070|0.30070	0.991000|0.991000	0.79684|0.79684	2.195000|2.195000	0.42677|0.42677	2.646000|2.646000	0.89796|0.89796	0.644000|0.644000	0.83932|0.83932	GCT|CTT	.	.	.	none		0.682	TRIAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000108980.3	NM_016399	
PSME2	5721	hgsc.bcm.edu	37	14	24615760	24615760	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr14:24615760C>A	ENST00000216802.5	-	1	670	c.31G>T	c.(31-33)Ggg>Tgg	p.G11W	RNF31_ENST00000559275.1_5'Flank|PSME2_ENST00000471700.2_5'UTR|PSME2_ENST00000560410.1_Missense_Mutation_p.G11W|RNF31_ENST00000382687.3_5'Flank|RNF31_ENST00000324103.6_5'Flank	NM_002818.2	NP_002809.2	Q9UL46	PSME2_HUMAN	proteasome (prosome, macropain) activator subunit 2 (PA28 beta)	11					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome activator complex (GO:0008537)|proteasome complex (GO:0000502)				endometrium(1)|lung(3)|prostate(2)	6				GBM - Glioblastoma multiforme(265;0.00839)		CGGGCTTCCCCGCTCAGGCGC	0.632																																					p.G11W		Atlas-SNP	.											.	PSME2	21	.	0			c.G31T						PASS	.						67.0	66.0	66.0					14																	24615760		2203	4300	6503	SO:0001583	missense	5721	exon1			CTTCCCCGCTCAG		CCDS9614.1	14q11.2	2010-03-10			ENSG00000100911	ENSG00000100911		"""Proteasome (prosome, macropain) subunits"""	9569	protein-coding gene	gene with protein product		602161				7789512	Standard	NM_002818		Approved	PA28beta	uc001wmj.3	Q9UL46	OTTHUMG00000028797	ENST00000216802.5:c.31G>T	chr14.hg19:g.24615760C>A	ENSP00000216802:p.Gly11Trp	101.0	0.0	.		109.0	5.0	.	NM_002818	Q15129	Missense_Mutation	SNP	ENST00000216802.5	hg19	CCDS9614.1	.	.	.	.	.	.	.	.	.	.	C	14.23	2.473208	0.43942	.	.	ENSG00000100911	ENST00000216802	T	0.43294	0.95	5.22	4.32	0.51571	Proteasome activator pa28, REG alpha subunit (2);	0.926255	0.09349	N	0.814471	T	0.42404	0.1201	N	0.08118	0	0.30656	N	0.754954	D	0.58620	0.983	P	0.60609	0.877	T	0.47586	-0.9106	10	0.72032	D	0.01	0.1857	11.5808	0.50889	0.0:0.8208:0.1792:0.0	.	11	Q9UL46	PSME2_HUMAN	W	11	ENSP00000216802:G11W	ENSP00000216802:G11W	G	-	1	0	PSME2	23685600	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	2.201000	0.42734	1.391000	0.46566	0.561000	0.74099	GGG	.	.	.	none		0.632	PSME2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071918.3	NM_002818	
MNAT1	4331	hgsc.bcm.edu	37	14	61434959	61434959	+	Silent	SNP	T	T	C			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr14:61434959T>C	ENST00000261245.4	+	8	923	c.822T>C	c.(820-822)caT>caC	p.H274H	MNAT1_ENST00000539616.2_Silent_p.H232H|RP11-193F5.1_ENST00000553946.1_RNA	NM_002431.3	NP_002422.1	P51948	MAT1_HUMAN	MNAT CDK-activating kinase assembly factor 1	274					7-methylguanosine mRNA capping (GO:0006370)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|cell proliferation (GO:0008283)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to calcium ion (GO:0051592)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|ventricular system development (GO:0021591)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	11				OV - Ovarian serous cystadenocarcinoma(108;0.0174)		ATTTAAACCATGTCAGAGCTG	0.388								Direct reversal of damage;Direct reversal of damage;Nucleotide excision repair (NER)																													p.H274H		Atlas-SNP	.											.	MNAT1	24	.	0			c.T822C						PASS	.						128.0	116.0	120.0					14																	61434959		2203	4300	6503	SO:0001819	synonymous_variant	4331	exon8			AAACCATGTCAGA	X87843	CCDS9750.1, CCDS53899.1	14q23	2013-07-31	2013-07-31		ENSG00000020426	ENSG00000020426		"""RING-type (C3HC4) zinc fingers"", ""General transcription factor IIH complex subunits"""	7181	protein-coding gene	gene with protein product	"""CDK-activating kinase assembly factor"""	602659	"""menage a trois 1 (CAK assembly factor)"", ""menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis)"""			9465303	Standard	NM_002431		Approved	MAT1, RNF66	uc001xfd.3	P51948	OTTHUMG00000152340	ENST00000261245.4:c.822T>C	chr14.hg19:g.61434959T>C		110.0	0.0	.		102.0	33.0	.	NM_002431	G3V1U8|Q15817|Q6ICQ7	Silent	SNP	ENST00000261245.4	hg19	CCDS9750.1																																																																																			.	.	.	none		0.388	MNAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276956.1	NM_002431	
MARK3	4140	hgsc.bcm.edu	37	14	103894758	103894758	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr14:103894758A>G	ENST00000429436.2	+	3	788	c.278A>G	c.(277-279)aAt>aGt	p.N93S	MARK3_ENST00000553942.1_Missense_Mutation_p.N93S|MARK3_ENST00000303622.9_Missense_Mutation_p.N93S|MARK3_ENST00000335102.5_Missense_Mutation_p.N93S|MARK3_ENST00000216288.7_Missense_Mutation_p.N93S|MARK3_ENST00000440884.3_Missense_Mutation_p.N93S|MARK3_ENST00000561071.1_3'UTR|MARK3_ENST00000416682.2_Missense_Mutation_p.N93S	NM_001128918.1|NM_001128919.1	NP_001122390.1|NP_001122391.1	P27448	MARK3_HUMAN	MAP/microtubule affinity-regulating kinase 3	93	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30		Melanoma(154;0.155)	Epithelial(46;0.241)			ACTCAGTTGAATCCAACAAGT	0.284																																					p.N93S		Atlas-SNP	.											.	MARK3	86	.	0			c.A278G						PASS	.						21.0	19.0	20.0					14																	103894758		1762	4021	5783	SO:0001583	missense	4140	exon3			AGTTGAATCCAAC	M80359	CCDS41993.1, CCDS45165.1, CCDS45166.1, CCDS45167.1, CCDS55947.1	14q32.32	2014-04-07			ENSG00000075413	ENSG00000075413			6897	protein-coding gene	gene with protein product		602678				9533022	Standard	NM_002376		Approved	CTAK1, KP78, PAR-1A	uc001ymz.4	P27448	OTTHUMG00000171789	ENST00000429436.2:c.278A>G	chr14.hg19:g.103894758A>G	ENSP00000411397:p.Asn93Ser	3.0	0.0	.		12.0	8.0	.	NM_001128921	O60219|Q86TT8|Q8TB41|Q8WX83|Q96RG1|Q9UMY9|Q9UN34	Missense_Mutation	SNP	ENST00000429436.2	hg19	CCDS45165.1	.	.	.	.	.	.	.	.	.	.	A	8.139	0.784865	0.16189	.	.	ENSG00000075413	ENST00000335102;ENST00000440884;ENST00000416682;ENST00000429436;ENST00000303622;ENST00000216288;ENST00000553942	T;T;T;T;T;T;T	0.64618	-0.11;3.26;-0.11;-0.11;-0.11;-0.11;-0.11	5.27	4.12	0.48240	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.093621	0.64402	D	0.000001	T	0.40694	0.1127	N	0.10685	0.025	0.54753	D	0.99998	B;P;B;B;B;B	0.36183	0.164;0.542;0.026;0.04;0.366;0.021	B;B;B;B;B;B	0.34180	0.127;0.177;0.038;0.043;0.136;0.009	T	0.40683	-0.9550	10	0.54805	T	0.06	.	11.4976	0.50417	0.8493:0.1507:0.0:0.0	.	93;93;93;93;93;93	P27448-2;P27448-6;P27448;Q86TT8;P27448-4;P27448-3	.;.;MARK3_HUMAN;.;.;.	S	93	ENSP00000335347:N93S;ENSP00000402104:N93S;ENSP00000408092:N93S;ENSP00000411397:N93S;ENSP00000303698:N93S;ENSP00000216288:N93S;ENSP00000450772:N93S	ENSP00000216288:N93S	N	+	2	0	MARK3	102964511	1.000000	0.71417	1.000000	0.80357	0.001000	0.01503	6.709000	0.74665	0.836000	0.34901	-0.313000	0.08912	AAT	.	.	.	none		0.284	MARK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415144.1	NM_001128918	
SLTM	79811	hgsc.bcm.edu	37	15	59172211	59172211	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr15:59172211G>T	ENST00000380516.2	-	21	3179	c.3092C>A	c.(3091-3093)cCg>cAg	p.P1031Q	SLTM_ENST00000536328.1_Missense_Mutation_p.P600Q	NM_001013843.1|NM_024755.2	NP_001013865.1|NP_079031.2	Q9NWH9	SLTM_HUMAN	SAFB-like, transcription modulator	1031					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						GAATCGTCGCGGAGGTCCACC	0.408																																					p.P1031Q		Atlas-SNP	.											.	SLTM	90	.	0			c.C3092A						PASS	.						65.0	68.0	67.0					15																	59172211		2192	4292	6484	SO:0001583	missense	79811	exon21			CGTCGCGGAGGTC	BC046119	CCDS10168.2	15q21.3	2013-02-12			ENSG00000137776	ENSG00000137776		"""RNA binding motif (RRM) containing"""	20709	protein-coding gene	gene with protein product							Standard	XR_243128		Approved	Met, FLJ13213	uc002afp.3	Q9NWH9	OTTHUMG00000074033	ENST00000380516.2:c.3092C>A	chr15.hg19:g.59172211G>T	ENSP00000369887:p.Pro1031Gln	64.0	0.0	.		95.0	4.0	.	NM_024755	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000380516.2	hg19	CCDS10168.2	.	.	.	.	.	.	.	.	.	.	G	12.17	1.858179	0.32791	.	.	ENSG00000137776	ENST00000380516;ENST00000432750;ENST00000536328	T	0.13901	2.55	5.66	5.66	0.87406	.	0.000000	0.53938	D	0.000057	T	0.11495	0.0280	L	0.34521	1.04	0.45342	D	0.998331	P;P	0.41624	0.644;0.757	B;B	0.36378	0.159;0.223	T	0.05354	-1.0890	10	0.39692	T	0.17	.	14.5794	0.68274	0.0:0.0:0.854:0.146	.	1031;600	Q9NWH9;A8K5V8	SLTM_HUMAN;.	Q	1031;597;600	ENSP00000369887:P1031Q	ENSP00000369887:P1031Q	P	-	2	0	SLTM	56959503	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	6.125000	0.71627	2.665000	0.90641	0.563000	0.77884	CCG	.	.	.	none		0.408	SLTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157124.1	NM_024755	
TERF2	7014	hgsc.bcm.edu	37	16	69402345	69402345	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr16:69402345C>G	ENST00000254942.3	-	6	897	c.881G>C	c.(880-882)aGt>aCt	p.S294T	TERF2_ENST00000603068.1_Missense_Mutation_p.S252T|TERF2_ENST00000569611.2_5'Flank	NM_005652.3	NP_005643.2	Q15554	TERF2_HUMAN	telomeric repeat binding factor 2	294					age-dependent telomere shortening (GO:0001309)|cell cycle (GO:0007049)|cellular senescence (GO:0090398)|in utero embryonic development (GO:0001701)|negative regulation of telomere maintenance (GO:0032205)|negative regulation of telomere maintenance via semi-conservative replication (GO:0032214)|positive regulation of telomere maintenance (GO:0032206)|protection from non-homologous end joining at telomere (GO:0031848)|protein localization to chromosome, telomeric region (GO:0070198)|telomere capping (GO:0016233)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)|telomere maintenance via telomere shortening (GO:0010834)|telomeric loop formation (GO:0031627)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|male germ cell nucleus (GO:0001673)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|double-stranded telomeric DNA binding (GO:0003691)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|telomeric DNA binding (GO:0042162)			NS(2)|breast(1)|large_intestine(3)|lung(1)	7		Ovarian(137;0.101)				CTTCCCTGTACTTGAGGCAGC	0.478																																					p.S294T	Ovarian(13;63 524 30420 31710 34037)	Atlas-SNP	.											.	TERF2	24	.	0			c.G881C						PASS	.						133.0	121.0	125.0					16																	69402345		2198	4300	6498	SO:0001583	missense	7014	exon6			CCTGTACTTGAGG		CCDS10879.1, CCDS10879.2	16q22.1	2008-02-05			ENSG00000132604	ENSG00000132604			11729	protein-coding gene	gene with protein product		602027		TRBF2		9326950, 10226653	Standard	NM_005652		Approved	TRF2	uc002exd.4	Q15554	OTTHUMG00000137566	ENST00000254942.3:c.881G>C	chr16.hg19:g.69402345C>G	ENSP00000254942:p.Ser294Thr	67.0	0.0	.		160.0	61.0	.	NM_005652		Missense_Mutation	SNP	ENST00000254942.3	hg19		.	.	.	.	.	.	.	.	.	.	C	4.457	0.084724	0.08583	.	.	ENSG00000132604	ENST00000254942	.	.	.	4.95	0.394	0.16299	.	0.964177	0.08668	N	0.911414	T	0.36826	0.0981	L	0.43152	1.355	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.31024	-0.9958	9	0.15066	T	0.55	0.7302	9.5105	0.39074	0.0:0.5756:0.3285:0.0959	.	252	Q15554	TERF2_HUMAN	T	252	.	ENSP00000254942:S252T	S	-	2	0	TERF2	67959846	.	.	0.002000	0.10522	0.255000	0.26057	.	.	0.218000	0.20820	0.555000	0.69702	AGT	.	.	.	none		0.478	TERF2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000268944.2		
GINS2	51659	hgsc.bcm.edu	37	16	85715212	85715212	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr16:85715212T>C	ENST00000253462.3	-	3	381	c.281A>G	c.(280-282)gAa>gGa	p.E94G		NM_016095.2	NP_057179.1	Q9Y248	PSF2_HUMAN	GINS complex subunit 2 (Psf2 homolog)	94					DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)	nucleoplasm (GO:0005654)				endometrium(2)|large_intestine(2)|lung(2)	6						CTTCGTAAGTTCCATGTAGTA	0.448																																					p.E94G		Atlas-SNP	.											.,1	GINS2	15	.	0			c.A281G						PASS	.						183.0	164.0	170.0					16																	85715212		2198	4300	6498	SO:0001583	missense	51659	exon3			GTAAGTTCCATGT	BC003186	CCDS10953.1	16q24.1	2008-02-05			ENSG00000131153	ENSG00000131153			24575	protein-coding gene	gene with protein product		610609				11042152, 10810093	Standard	NM_016095		Approved	PSF2, Pfs2	uc002fja.3	Q9Y248	OTTHUMG00000137646	ENST00000253462.3:c.281A>G	chr16.hg19:g.85715212T>C	ENSP00000253462:p.Glu94Gly	50.0	0.0	.		130.0	66.0	.	NM_016095	D3DUM5|Q6IAG9	Missense_Mutation	SNP	ENST00000253462.3	hg19	CCDS10953.1	.	.	.	.	.	.	.	.	.	.	T	25.5	4.643560	0.87859	.	.	ENSG00000131153	ENST00000253462	.	.	.	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.81259	0.4785	M	0.86420	2.815	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.84916	0.0851	9	0.72032	D	0.01	-30.9692	14.3362	0.66592	0.0:0.0:0.0:1.0	.	94;94	Q53G08;Q9Y248	.;PSF2_HUMAN	G	94	.	ENSP00000253462:E94G	E	-	2	0	GINS2	84272713	1.000000	0.71417	0.970000	0.41538	0.939000	0.58152	7.531000	0.81973	1.874000	0.54306	0.459000	0.35465	GAA	.	.	.	none		0.448	GINS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269098.1	NM_016095	
COX10	1352	hgsc.bcm.edu	37	17	14005508	14005508	+	Silent	SNP	T	T	A			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr17:14005508T>A	ENST00000261643.3	+	4	650	c.573T>A	c.(571-573)ctT>ctA	p.L191L	COX10_ENST00000536205.1_Intron|COX10_ENST00000537334.1_5'UTR	NM_001303.3	NP_001294.2	Q12887	COX10_HUMAN	cytochrome c oxidase assembly homolog 10 (yeast)	191					aerobic respiration (GO:0009060)|cellular respiration (GO:0045333)|heme a biosynthetic process (GO:0006784)|heme biosynthetic process (GO:0006783)|heme O biosynthetic process (GO:0048034)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|mitochondrial fission (GO:0000266)|porphyrin-containing compound metabolic process (GO:0006778)|respiratory chain complex IV assembly (GO:0008535)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	farnesyltranstransferase activity (GO:0004311)|protoheme IX farnesyltransferase activity (GO:0008495)			cervix(1)|endometrium(3)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14		all_lung(20;0.06)|Lung SC(565;0.168)		UCEC - Uterine corpus endometrioid carcinoma (92;0.106)		GTTTCCTGCTTACTTCTGTTG	0.473																																					p.L191L		Atlas-SNP	.											.	COX10	36	.	0			c.T573A						PASS	.						174.0	152.0	160.0					17																	14005508		2203	4300	6503	SO:0001819	synonymous_variant	1352	exon4			CCTGCTTACTTCT	U09466	CCDS11166.1	17p12	2013-05-24	2012-10-15		ENSG00000006695	ENSG00000006695		"""Mitochondrial respiratory chain complex assembly factors"""	2260	protein-coding gene	gene with protein product	"""heme A: farnesyltransferase"", ""protoheme IX farnesyltransferase, mitochondrial"", ""heme O synthase"""	602125	"""COX10 (yeast) homolog, cytochrome c oxidase assembly protein (heme A: farnesyltransferase)"", ""COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast)"""			9177788, 12928484	Standard	NM_001303		Approved		uc002gof.4	Q12887	OTTHUMG00000058814	ENST00000261643.3:c.573T>A	chr17.hg19:g.14005508T>A		164.0	0.0	.		300.0	190.0	.	NM_001303	B2R6U5|B4DJ50|O15334|Q969F7	Silent	SNP	ENST00000261643.3	hg19	CCDS11166.1																																																																																			.	.	.	none		0.473	COX10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130003.1	NM_001303	
ZNF99	7652	hgsc.bcm.edu	37	19	22940373	22940373	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr19:22940373T>C	ENST00000596209.1	-	4	2428	c.2338A>G	c.(2338-2340)Aag>Gag	p.K780E	CTC-451A6.4_ENST00000442497.2_lincRNA|ZNF99_ENST00000397104.3_Missense_Mutation_p.K689E	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	780					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K689E(3)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				TGAATTATCTTATGTTTTCTA	0.343																																					p.K780E		Atlas-SNP	.											ZNF99,NS,carcinoma,0,4	ZNF99	273	.	3	Substitution - Missense(3)	prostate(1)|lung(1)|kidney(1)	c.A2338G						PASS	.						32.0	34.0	34.0					19																	22940373		1947	4138	6085	SO:0001583	missense	7652	exon4			TTATCTTATGTTT	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.2338A>G	chr19.hg19:g.22940373T>C	ENSP00000472969:p.Lys780Glu	48.0	0.0	.		74.0	3.0	.	NM_001080409	M0R335	Missense_Mutation	SNP	ENST00000596209.1	hg19	CCDS59369.1	.	.	.	.	.	.	.	.	.	.	t	9.727	1.161345	0.21538	.	.	ENSG00000213973	ENST00000397104	T	0.18016	2.24	1.26	-2.52	0.06346	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.20495	0.0493	L	0.28400	0.85	0.09310	N	1	D	0.65815	0.995	D	0.65233	0.933	T	0.12837	-1.0532	9	0.54805	T	0.06	.	4.187	0.10402	0.1821:0.0:0.5141:0.3038	.	689	A8MXY4	ZNF99_HUMAN	E	689	ENSP00000380293:K689E	ENSP00000380293:K689E	K	-	1	0	ZNF99	22732213	0.000000	0.05858	0.002000	0.10522	0.007000	0.05969	-0.737000	0.04877	-0.939000	0.03709	0.313000	0.20887	AAG	.	.	.	none		0.343	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124	
FAM187B	148109	hgsc.bcm.edu	37	19	35718874	35718874	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr19:35718874C>T	ENST00000324675.3	-	1	758	c.710G>A	c.(709-711)gGa>gAa	p.G237E		NM_152481.1	NP_689694.1	Q17R55	F187B_HUMAN	family with sequence similarity 187, member B	237						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	9						GTACATGGATCCTAAGGGACA	0.507																																					p.G237E		Atlas-SNP	.											.	FAM187B	28	.	0			c.G710A						PASS	.						67.0	57.0	60.0					19																	35718874		2203	4300	6503	SO:0001583	missense	148109	exon1			ATGGATCCTAAGG	AK098526	CCDS12448.1	19q13.12	2008-10-16	2008-10-16	2008-10-16	ENSG00000177558	ENSG00000177558			26366	protein-coding gene	gene with protein product			"""transmembrane protein 162"""	TMEM162			Standard	NM_152481		Approved	FLJ25660	uc002nyk.1	Q17R55	OTTHUMG00000164450	ENST00000324675.3:c.710G>A	chr19.hg19:g.35718874C>T	ENSP00000323355:p.Gly237Glu	26.0	0.0	.		37.0	13.0	.	NM_152481	Q8N7G6	Missense_Mutation	SNP	ENST00000324675.3	hg19	CCDS12448.1	.	.	.	.	.	.	.	.	.	.	C	11.60	1.687642	0.29962	.	.	ENSG00000177558	ENST00000324675	T	0.39592	1.07	4.91	1.25	0.21368	.	0.519698	0.15947	N	0.236896	T	0.50274	0.1606	L	0.57536	1.79	0.09310	N	1	D	0.57899	0.981	P	0.53401	0.725	T	0.49041	-0.8980	10	0.72032	D	0.01	-2.2526	13.4884	0.61379	0.0:0.4094:0.5906:0.0	.	237	Q17R55	F187B_HUMAN	E	237	ENSP00000323355:G237E	ENSP00000323355:G237E	G	-	2	0	FAM187B	40410714	0.319000	0.24607	0.289000	0.24876	0.145000	0.21501	0.869000	0.27996	0.564000	0.29238	-0.175000	0.13238	GGA	.	.	.	none		0.507	FAM187B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378854.1	NM_152481	
ATP1A3	478	hgsc.bcm.edu	37	19	42492245	42492245	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr19:42492245G>A	ENST00000302102.5	-	4	350	c.200C>T	c.(199-201)cCt>cTt	p.P67L	ATP1A3_ENST00000602133.1_Missense_Mutation_p.P37L|ATP1A3_ENST00000543770.1_Missense_Mutation_p.P78L|ATP1A3_ENST00000545399.1_Missense_Mutation_p.P80L|ATP1A3_ENST00000468774.2_5'UTR	NM_152296.4	NP_689509.1	P13637	AT1A3_HUMAN	ATPase, Na+/K+ transporting, alpha 3 polypeptide	67					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|memory (GO:0007613)|potassium ion import (GO:0010107)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	axon (GO:0030424)|dendritic spine head (GO:0044327)|dendritic spine neck (GO:0044326)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(19)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	52						GAGTGCGTTAGGCCCATCCCG	0.637																																					p.P80L		Atlas-SNP	.											.	ATP1A3	117	.	0			c.C239T						PASS	.						103.0	107.0	106.0					19																	42492245		2203	4300	6503	SO:0001583	missense	478	exon4			GCGTTAGGCCCAT		CCDS12594.1, CCDS58663.1, CCDS58664.1	19q13.2	2012-10-22			ENSG00000105409	ENSG00000105409	3.6.3.9	"""ATPases / P-type"""	801	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-3"", ""sodium pump subunit alpha-3"", ""sodium-potassium ATPase catalytic subunit alpha-3"""	182350	"""dystonia 12"""	DYT12		17282997	Standard	NM_152296		Approved		uc002osh.4	P13637	OTTHUMG00000137384	ENST00000302102.5:c.200C>T	chr19.hg19:g.42492245G>A	ENSP00000302397:p.Pro67Leu	118.0	0.0	.		133.0	16.0	.	NM_001256214	B7Z2T0|B7Z401|F5H6J6|Q16732|Q16735|Q969K5	Missense_Mutation	SNP	ENST00000302102.5	hg19	CCDS12594.1	.	.	.	.	.	.	.	.	.	.	G	16.34	3.095660	0.56075	.	.	ENSG00000105409	ENST00000302102;ENST00000441343;ENST00000545399;ENST00000368080;ENST00000543770;ENST00000448429	T;T;T;T	0.80909	-1.43;-1.43;-1.43;-1.43	4.09	4.09	0.47781	ATPase, P-type cation-transporter, N-terminal (2);	0.185108	0.46758	D	0.000274	D	0.89065	0.6609	M	0.80616	2.505	0.80722	D	1	B;D;D;D	0.76494	0.383;0.998;0.999;0.997	B;D;D;D	0.75484	0.126;0.965;0.986;0.979	D	0.90107	0.4189	10	0.54805	T	0.06	.	14.1703	0.65506	0.0:0.0:1.0:0.0	.	80;78;67;67	B7Z2T0;F5H6J6;E9PC51;P13637	.;.;.;AT1A3_HUMAN	L	67;67;80;37;78;80	ENSP00000302397:P67L;ENSP00000411503:P67L;ENSP00000444688:P80L;ENSP00000437577:P78L	ENSP00000302397:P67L	P	-	2	0	ATP1A3	47184085	1.000000	0.71417	0.945000	0.38365	0.021000	0.10359	9.808000	0.99193	2.010000	0.58986	0.491000	0.48974	CCT	.	.	.	none		0.637	ATP1A3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268107.1	NM_152296	
ZNF836	162962	hgsc.bcm.edu	37	19	52660096	52660096	+	Silent	SNP	G	G	A			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr19:52660096G>A	ENST00000322146.8	-	5	1361	c.840C>T	c.(838-840)ggC>ggT	p.G280G	ZNF836_ENST00000597252.1_Silent_p.G280G|CTC-471J1.8_ENST00000594362.1_RNA	NM_001102657.1	NP_001096127.1	Q6ZNA1	ZN836_HUMAN	zinc finger protein 836	280					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						TGAAGATCTTGCCACATACAC	0.413																																					p.G280G		Atlas-SNP	.											.	ZNF836	158	.	0			c.C840T						PASS	.						85.0	90.0	88.0					19																	52660096		2176	4286	6462	SO:0001819	synonymous_variant	162962	exon5			GATCTTGCCACAT	BC011784	CCDS46162.1	19q13.33	2013-01-08			ENSG00000196267	ENSG00000196267		"""Zinc fingers, C2H2-type"", ""-"""	34333	protein-coding gene	gene with protein product							Standard	NM_001102657		Approved	FLJ16287	uc010ydj.2	Q6ZNA1		ENST00000322146.8:c.840C>T	chr19.hg19:g.52660096G>A		69.0	0.0	.		114.0	46.0	.	NM_001102657		Silent	SNP	ENST00000322146.8	hg19	CCDS46162.1																																																																																			.	.	.	none		0.413	ZNF836-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462456.1	NM_001102657	
ZNF264	9422	hgsc.bcm.edu	37	19	57724137	57724137	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr19:57724137C>G	ENST00000263095.6	+	4	2086	c.1672C>G	c.(1672-1674)Caa>Gaa	p.Q558E	ZNF264_ENST00000536056.1_Missense_Mutation_p.Q558E	NM_003417.4	NP_003408.1	O43296	ZN264_HUMAN	zinc finger protein 264	558					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(8)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	27		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0135)		CACTCAGCATCAAAGGATGCA	0.453																																					p.Q558E		Atlas-SNP	.											.	ZNF264	65	.	0			c.C1672G						PASS	.						100.0	97.0	98.0					19																	57724137		2203	4300	6503	SO:0001583	missense	9422	exon4			CAGCATCAAAGGA	AB007872	CCDS33127.1	19q13.4	2013-01-08				ENSG00000083844		"""Zinc fingers, C2H2-type"", ""-"""	13057	protein-coding gene	gene with protein product		604668				9455477	Standard	NM_003417		Approved	KIAA0412	uc002qob.3	O43296		ENST00000263095.6:c.1672C>G	chr19.hg19:g.57724137C>G	ENSP00000263095:p.Gln558Glu	91.0	0.0	.		114.0	5.0	.	NM_003417	A8K8Y9|Q9P1V0	Missense_Mutation	SNP	ENST00000263095.6	hg19	CCDS33127.1	.	.	.	.	.	.	.	.	.	.	C	10.04	1.241123	0.22711	.	.	ENSG00000083844	ENST00000263095;ENST00000536056	T;T	0.07327	3.2;3.2	2.35	2.35	0.29111	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06234	0.0161	L	0.28014	0.82	0.21553	N	0.999646	B	0.27853	0.191	B	0.18263	0.021	T	0.27226	-1.0080	9	0.59425	D	0.04	.	8.9199	0.35605	0.0:0.7681:0.2319:0.0	.	558	O43296	ZN264_HUMAN	E	558	ENSP00000263095:Q558E;ENSP00000440376:Q558E	ENSP00000263095:Q558E	Q	+	1	0	ZNF264	62415949	0.000000	0.05858	0.624000	0.29186	0.955000	0.61496	0.743000	0.26231	1.644000	0.50603	0.491000	0.48974	CAA	.	.	.	none		0.453	ZNF264-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465080.1		
PHKA1	5255	hgsc.bcm.edu	37	X	71822085	71822085	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chrX:71822085T>C	ENST00000373542.4	-	27	3115	c.2956A>G	c.(2956-2958)Atc>Gtc	p.I986V	PHKA1_ENST00000541944.1_Missense_Mutation_p.I927V|PHKA1_ENST00000373539.3_Missense_Mutation_p.I986V|PHKA1_ENST00000373545.3_Missense_Mutation_p.I927V|PHKA1_ENST00000339490.3_Missense_Mutation_p.I986V	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	986					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					ATCTCGTGGATAGAAATAGCA	0.403																																					p.I986V		Atlas-SNP	.											.	PHKA1	129	.	0			c.A2956G						PASS	.						120.0	96.0	104.0					X																	71822085		2203	4300	6503	SO:0001583	missense	5255	exon27			CGTGGATAGAAAT		CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.2956A>G	chrX.hg19:g.71822085T>C	ENSP00000362643:p.Ile986Val	21.0	0.0	.		39.0	4.0	.	NM_002637	B7ZL05|B7ZL07|Q2M3D7	Missense_Mutation	SNP	ENST00000373542.4	hg19	CCDS14421.1	.	.	.	.	.	.	.	.	.	.	T	15.77	2.931761	0.52866	.	.	ENSG00000067177	ENST00000373545;ENST00000373542;ENST00000541944;ENST00000339490;ENST00000373539	D;D;D;D;D	0.91295	-2.77;-2.79;-2.82;-2.78;-2.76	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	D	0.89884	0.6844	M	0.73372	2.23	0.52099	D	0.999948	B;B;B	0.19200	0.025;0.016;0.034	B;B;B	0.27608	0.038;0.073;0.081	D	0.86249	0.1648	10	0.34782	T	0.22	-12.1844	12.9234	0.58245	0.0:0.0:0.0:1.0	.	927;986;986	B7ZL07;P46020-2;P46020	.;.;KPB1_HUMAN	V	927;986;927;986;986	ENSP00000362646:I927V;ENSP00000362643:I986V;ENSP00000441251:I927V;ENSP00000342469:I986V;ENSP00000362640:I986V	ENSP00000342469:I986V	I	-	1	0	PHKA1	71738810	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	5.818000	0.69236	1.960000	0.56953	0.417000	0.27973	ATC	.	.	.	none		0.403	PHKA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058896.1		
LIPA	3988	hgsc.bcm.edu	37	10	90974746	90974746	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr10:90974746delG	ENST00000336233.5	-	10	1361	c.1039delC	c.(1039-1041)cttfs	p.L347fs	LIPA_ENST00000371837.1_Frame_Shift_Del_p.L291fs|LIPA_ENST00000456827.1_Frame_Shift_Del_p.L347fs			P38571	LICH_HUMAN	lipase A, lysosomal acid, cholesterol esterase	347					cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cytokine production (GO:0001816)|homeostasis of number of cells within a tissue (GO:0048873)|inflammatory response (GO:0006954)|lipid catabolic process (GO:0016042)|lung development (GO:0030324)|tissue remodeling (GO:0048771)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	lipase activity (GO:0016298)|sterol esterase activity (GO:0004771)			endometrium(1)|large_intestine(2)|lung(3)	6		Colorectal(252;0.0162)		GBM - Glioblastoma multiforme(2;0.00406)		ACATCTGCAAGCCAGTCGTGA	0.493																																					p.L347fs		Atlas-INDEL	.											.	LIPA	29	.	0			c.1040delT						PASS	.						93.0	84.0	87.0					10																	90974746		2203	4300	6503	SO:0001589	frameshift_variant	3988	exon10			.	M74775	CCDS7401.1, CCDS73160.1	10q23.2-q23.3	2012-07-13	2008-08-01		ENSG00000107798	ENSG00000107798	3.1.1.13		6617	protein-coding gene	gene with protein product	"""Wolman disease"""	613497				8432549	Standard	NM_000235		Approved	LAL, CESD	uc009xtq.3	P38571	OTTHUMG00000018716	ENST00000336233.5:c.1039delC	chr10.hg19:g.90974746delG	ENSP00000337354:p.Leu347fs	131.0	0.0	0		156.0	63.0	0.403846	NM_000235	B2RBH5|D3DR29|Q16529|Q53H21|Q5T074|Q5T771|Q96EJ0	Frame_Shift_Del	DEL	ENST00000336233.5	hg19	CCDS7401.1																																																																																			.	.	.	none		0.493	LIPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049308.1	NM_000235	
REPIN1	29803	hgsc.bcm.edu	37	7	150068863	150068864	+	Frame_Shift_Ins	INS	-	-	A			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr7:150068863_150068864insA	ENST00000425389.2	+	1	611_612	c.533_534insA	c.(532-537)atatgcfs	p.C179fs	REPIN1_ENST00000479668.1_3'UTR|RP4-584D14.5_ENST00000488310.1_RNA|REPIN1_ENST00000397281.2_Frame_Shift_Ins_p.C179fs|REPIN1_ENST00000466559.1_3'UTR|REPIN1_ENST00000489432.2_Frame_Shift_Ins_p.C236fs|REPIN1_ENST00000540729.1_Frame_Shift_Ins_p.C179fs|REPIN1_ENST00000444957.1_Frame_Shift_Ins_p.C179fs|REPIN1_ENST00000482680.1_3'UTR	NM_014374.3	NP_055189.2	Q9BWE0	REPI1_HUMAN	replication initiator 1	179					DNA replication (GO:0006260)|regulation of fatty acid transport (GO:2000191)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cytosolic ribosome (GO:0022626)|lipid particle (GO:0005811)|nuclear membrane (GO:0031965)|nuclear origin of replication recognition complex (GO:0005664)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	14	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.011)			CGGCCCTTCATATGCGGCAACT	0.658																																					p.I235fs		Atlas-INDEL	.											.	REPIN1	74	.	0			c.704_705insA						PASS	.																																			SO:0001589	frameshift_variant	29803	exon3			.	AF201303	CCDS43677.1, CCDS47745.1	7q36.1	2013-01-08	2003-08-07	2003-08-08				"""Zinc fingers, C2H2-type"""	17922	protein-coding gene	gene with protein product	"""replication initiation region protein (60kD)"", ""zinc finger protein AP4"", ""zinc finger protein 464 (RIP60)"""		"""zinc finger protein 464 (RIP60)"""	ZNF464		10606657	Standard	NM_013400		Approved	RIP60, AP4, H_DJ0584D14.12, Zfp464	uc010lpr.1	Q9BWE0		ENST00000425389.2:c.534dupA	chr7.hg19:g.150068864_150068864dupA	ENSP00000388287:p.Cys179fs	38.0	0.0	0		41.0	10.0	0.243902	NM_001099695	C9J3L7|D3DWZ1|Q7LE03|Q9BUZ6|Q9NZH2|Q9UMP5	Frame_Shift_Ins	INS	ENST00000425389.2	hg19	CCDS43677.1																																																																																			.	.	.	none		0.658	REPIN1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376940.1	NM_014374	
C1orf54	79630	hgsc.bcm.edu	37	1	150248209	150248212	+	Splice_Site	DEL	GTGA	GTGA	-			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	GTGA	GTGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr1:150248209_150248212delGTGA	ENST00000369102.1	+	5	959		c.e5+1		C1orf54_ENST00000369098.3_Splice_Site|C1orf54_ENST00000369099.3_Splice_Site			Q8WWF1	CA054_HUMAN	chromosome 1 open reading frame 54							extracellular region (GO:0005576)				breast(1)|endometrium(1)|large_intestine(2)|lung(2)|urinary_tract(1)	7	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			GGACAGGCTGGTGAGTGAACTCTA	0.407																																					p.63_63del		Atlas-INDEL	.											.	C1orf54	20	.	0			c.189_189del						PASS	.																																			SO:0001630	splice_region_variant	79630	exon3			.	BC017761	CCDS948.1, CCDS72905.1	1q21.2	2012-06-25			ENSG00000118292	ENSG00000118292			26258	protein-coding gene	gene with protein product						12477932	Standard	NM_024579		Approved	FLJ23221	uc001eud.3	Q8WWF1	OTTHUMG00000012546	ENST00000369102.1:c.189+1GTGA>-	chr1.hg19:g.150248213_150248216delGTGA		48.0	0.0	0		75.0	17.0	0.226667	NM_024579	Q9H5P3	Frame_Shift_Del	DEL	ENST00000369102.1	hg19	CCDS948.1																																																																																			.	.	.	none		0.407	C1orf54-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035055.1	NM_024579	Intron
CSPP1	79848	hgsc.bcm.edu	37	8	68070755	68070755	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr8:68070755delG	ENST00000262210.5	+	18	2331	c.2300delG	c.(2299-2301)cggfs	p.R767fs	CSPP1_ENST00000521168.1_3'UTR|CSPP1_ENST00000412460.1_Frame_Shift_Del_p.R422fs	NM_024790.6	NP_079066.5	Q1MSJ5	CSPP1_HUMAN	centrosome and spindle pole associated protein 1	802					positive regulation of cell division (GO:0051781)|positive regulation of cytokinesis (GO:0032467)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|spindle (GO:0005819)|spindle pole (GO:0000922)				NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|prostate(3)|skin(1)|urinary_tract(1)	49	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			GAAGAAAGACGGCTTGCAGAA	0.388																																					p.R767fs		Atlas-INDEL	.											CSPP1,colon,carcinoma,0,1	CSPP1	129	.	0			c.2299delC						PASS	.						68.0	67.0	67.0					8																	68070755		1860	4092	5952	SO:0001589	frameshift_variant	79848	exon18			.	AJ583433	CCDS43744.1	8q13.2	2014-02-24			ENSG00000104218	ENSG00000104218			26193	protein-coding gene	gene with protein product		611654				15580290, 24360807	Standard	NM_024790		Approved	FLJ22490, CSPP, JBTS21	uc003xxj.3	Q1MSJ5	OTTHUMG00000164564	ENST00000262210.5:c.2300delG	chr8.hg19:g.68070755delG	ENSP00000262210:p.Arg767fs	49.0	0.0	0		47.0	13.0	0.276596	NM_024790	A6ND63|Q70F00|Q8TBC1	Frame_Shift_Del	DEL	ENST00000262210.5	hg19	CCDS43744.1																																																																																			.	.	.	none		0.388	CSPP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379254.1	NM_024790	
LTBP1	4052	hgsc.bcm.edu	37	2	33412000	33412000	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr2:33412000delG	ENST00000404816.2	+	6	1632	c.1279delG	c.(1279-1281)ggafs	p.G427fs	LTBP1_ENST00000404525.1_Frame_Shift_Del_p.G101fs|LTBP1_ENST00000402934.1_Frame_Shift_Del_p.G101fs|LTBP1_ENST00000390003.4_Frame_Shift_Del_p.G101fs|LTBP1_ENST00000407925.1_Frame_Shift_Del_p.G101fs|LTBP1_ENST00000418533.2_Frame_Shift_Del_p.G101fs|LTBP1_ENST00000354476.3_Frame_Shift_Del_p.G427fs			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	427	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				AAATTTCACAGGAAAACTTTG	0.473																																					p.T426fs		Atlas-INDEL	.											.	LTBP1	317	.	0			c.1278delA						PASS	.						115.0	107.0	110.0					2																	33412000		2203	4300	6503	SO:0001589	frameshift_variant	4052	exon6			.		CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.1279delG	chr2.hg19:g.33412000delG	ENSP00000386043:p.Gly427fs	64.0	0.0	0		57.0	20.0	0.350877	NM_206943	A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Frame_Shift_Del	DEL	ENST00000404816.2	hg19	CCDS33177.2																																																																																			.	.	.	none		0.473	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	NM_206943	
BCLAF1	9774	hgsc.bcm.edu	37	6	136582550	136582550	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B9-7268-01A-11D-2136-08	TCGA-B9-7268-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	23d1496c-de52-4d78-ba63-f8f751d546d5	d08b6d62-3120-49a5-9cd5-c671278e2eb8	g.chr6:136582550delT	ENST00000531224.1	-	12	2862	c.2610delA	c.(2608-2610)caafs	p.Q870fs	BCLAF1_ENST00000031135.9_Frame_Shift_Del_p.Q88fs|BCLAF1_ENST00000353331.4_Frame_Shift_Del_p.Q819fs|BCLAF1_ENST00000530767.1_Frame_Shift_Del_p.Q697fs|BCLAF1_ENST00000392348.2_Frame_Shift_Del_p.Q819fs|BCLAF1_ENST00000529917.1_5'UTR|BCLAF1_ENST00000527536.1_Frame_Shift_Del_p.Q821fs|BCLAF1_ENST00000527759.1_Frame_Shift_Del_p.Q868fs	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	870					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		CTCTGCCACGTTGAAAAGTAC	0.418																																					p.R871fs	Colon(142;1534 1789 5427 7063 28491)	Atlas-INDEL	.											.	BCLAF1	203	.	0			c.2611delC						PASS	.						218.0	218.0	218.0					6																	136582550		2203	4300	6503	SO:0001589	frameshift_variant	9774	exon12			.	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.2610delA	chr6.hg19:g.136582550delT	ENSP00000435210:p.Gln870fs	379.0	0.0	0		614.0	103.0	0.167752	NM_014739	A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Frame_Shift_Del	DEL	ENST00000531224.1	hg19	CCDS5177.1																																																																																			.	.	.	none		0.418	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739	
