#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
FAM132A	388581	hgsc.bcm.edu	37	1	1179848	1179848	+	Silent	SNP	G	G	C	rs200735866		TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr1:1179848G>C	ENST00000330388.2	-	2	238	c.207C>G	c.(205-207)tcC>tcG	p.S69S		NM_001014980.2	NP_001014980.1	Q5T7M4	ADIPL_HUMAN	family with sequence similarity 132, member A	69					negative regulation of gluconeogenesis (GO:0045721)|negative regulation of inflammatory response (GO:0050728)|positive regulation of glucose import (GO:0046326)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of glucose import (GO:0046324)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)			haematopoietic_and_lymphoid_tissue(1)|lung(1)	2	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;2.83e-35)|OV - Ovarian serous cystadenocarcinoma(86;2.22e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		TGTGGGCGTCGGAGAACTCAG	0.682																																					p.S69S		Atlas-SNP	.											.	FAM132A	12	.	0			c.C207G						PASS	.						44.0	49.0	47.0					1																	1179848		2190	4289	6479	SO:0001819	synonymous_variant	388581	exon2			GGCGTCGGAGAAC	BC089443	CCDS30554.1	1p36.33	2012-03-26	2007-03-27	2007-03-27	ENSG00000184163	ENSG00000184163			32308	protein-coding gene	gene with protein product	"""adipolin"", ""adipose-derived insulin-sensitizing factor"""		"""C1q domain containing 2"""	C1QDC2		21849507	Standard	NM_001014980		Approved	MGC105127, C1QTNF12, CTRP12	uc001adl.2	Q5T7M4	OTTHUMG00000001412	ENST00000330388.2:c.207C>G	chr1.hg19:g.1179848G>C		104.0	0.0	.		90.0	18.0	.	NM_001014980	Q5EBL5	Silent	SNP	ENST00000330388.2	hg19	CCDS30554.1																																																																																			.	G|1.000;A|0.000	.	alt		0.682	FAM132A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004080.4	XM_371208	
KCNAB2	8514	hgsc.bcm.edu	37	1	6142274	6142274	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr1:6142274C>A	ENST00000164247.1	+	6	785	c.221C>A	c.(220-222)aCc>aAc	p.T74N	KCNAB2_ENST00000378087.3_Missense_Mutation_p.T74N|KCNAB2_ENST00000378092.1_Missense_Mutation_p.T60N|KCNAB2_ENST00000352527.1_Missense_Mutation_p.T60N|KCNAB2_ENST00000378111.1_Missense_Mutation_p.T74N|KCNAB2_ENST00000602612.1_Missense_Mutation_p.T74N|KCNAB2_ENST00000458166.2_Missense_Mutation_p.T7N|KCNAB2_ENST00000378097.1_Missense_Mutation_p.T74N|KCNAB2_ENST00000378083.3_Missense_Mutation_p.T107N|KCNAB2_ENST00000341524.1_Missense_Mutation_p.T74N	NM_001199860.1	NP_001186789.1	Q13303	KCAB2_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 2	74					hematopoietic progenitor cell differentiation (GO:0002244)|protein heterooligomerization (GO:0051291)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			large_intestine(1)|lung(4)|skin(3)	8	Ovarian(185;0.0634)	all_cancers(23;5.85e-39)|all_epithelial(116;4.88e-22)|all_lung(118;4.21e-08)|Lung NSC(185;9.77e-07)|all_hematologic(16;2.78e-06)|all_neural(13;3.18e-06)|Acute lymphoblastic leukemia(12;0.000272)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00106)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)		Epithelial(90;6.9e-37)|GBM - Glioblastoma multiforme(13;8.8e-31)|OV - Ovarian serous cystadenocarcinoma(86;1.45e-19)|Colorectal(212;2.46e-07)|COAD - Colon adenocarcinoma(227;2.07e-05)|Kidney(185;7.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00131)|BRCA - Breast invasive adenocarcinoma(365;0.00133)|STAD - Stomach adenocarcinoma(132;0.00391)|READ - Rectum adenocarcinoma(331;0.0649)		CAGCTCATGACCTTGGCCTAT	0.562																																					p.T107N		Atlas-SNP	.											.	KCNAB2	23	.	0			c.C320A						PASS	.						138.0	123.0	129.0					1																	6142274		2203	4300	6503	SO:0001583	missense	8514	exon5			TCATGACCTTGGC	U33429	CCDS55.1, CCDS56.1, CCDS55570.1, CCDS55571.1	1p36.3	2008-02-05			ENSG00000069424	ENSG00000069424		"""Potassium channels"", ""Aldo-keto reductases"""	6229	protein-coding gene	gene with protein product		601142				8838324	Standard	NM_003636		Approved	AKR6A5, KCNA2B, HKvbeta2.1, HKvbeta2.2	uc001aly.2	Q13303	OTTHUMG00000000795	ENST00000164247.1:c.221C>A	chr1.hg19:g.6142274C>A	ENSP00000164247:p.Thr74Asn	97.0	0.0	.		80.0	29.0	.	NM_001199862	A0AVM9|A8K1A4|B0AZR7|O43659|Q5TG82|Q5TG83|Q6ZNE4|Q99411	Missense_Mutation	SNP	ENST00000164247.1	hg19	CCDS55.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.332367	0.81801	.	.	ENSG00000069424	ENST00000378111;ENST00000378097;ENST00000378092;ENST00000428161;ENST00000389632;ENST00000378087;ENST00000341524;ENST00000352527;ENST00000435937;ENST00000164247;ENST00000378083;ENST00000458166	T;T;T;T;T;T;T;T;T;T;T;T	0.21734	1.99;1.99;1.99;1.99;1.99;1.99;1.99;1.99;1.99;1.99;1.99;1.99	5.33	5.33	0.75918	NADP-dependent oxidoreductase domain (3);	0.095392	0.64402	D	0.000001	T	0.37019	0.0988	L	0.39467	1.215	0.58432	D	0.999997	D;D;D;D	0.65815	0.971;0.995;0.979;0.964	D;D;P;P	0.66979	0.948;0.936;0.88;0.766	T	0.02042	-1.1224	10	0.33940	T	0.23	-23.7432	17.5837	0.87974	0.0:1.0:0.0:0.0	.	107;60;74;74	Q13303-3;Q13303-2;Q13303;Q2YD85	.;.;KCAB2_HUMAN;.	N	74;74;60;60;74;74;74;60;60;74;107;7	ENSP00000367351:T74N;ENSP00000367337:T74N;ENSP00000367332:T60N;ENSP00000400285:T60N;ENSP00000374283:T74N;ENSP00000367327:T74N;ENSP00000340824:T74N;ENSP00000318772:T60N;ENSP00000389151:T60N;ENSP00000164247:T74N;ENSP00000367323:T107N;ENSP00000396167:T7N	ENSP00000164247:T74N	T	+	2	0	KCNAB2	6064861	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	6.706000	0.74649	2.482000	0.83794	0.563000	0.77884	ACC	.	.	.	none		0.562	KCNAB2-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000002114.3	NM_172130	
SPEN	23013	hgsc.bcm.edu	37	1	16258337	16258337	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr1:16258337T>G	ENST00000375759.3	+	11	5806	c.5602T>G	c.(5602-5604)Ttg>Gtg	p.L1868V		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	1868					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		GCTTTTGGAATTGAAGATGGA	0.498																																					p.L1868V		Atlas-SNP	.											.	SPEN	374	.	0			c.T5602G						PASS	.						67.0	73.0	71.0					1																	16258337		2203	4300	6503	SO:0001583	missense	23013	exon11			TTGGAATTGAAGA		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.5602T>G	chr1.hg19:g.16258337T>G	ENSP00000364912:p.Leu1868Val	81.0	0.0	.		67.0	48.0	.	NM_015001	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	ENST00000375759.3	hg19	CCDS164.1	.	.	.	.	.	.	.	.	.	.	T	8.066	0.769236	0.15983	.	.	ENSG00000065526	ENST00000375759	T	0.08807	3.05	5.27	-2.9	0.05648	.	.	.	.	.	T	0.06416	0.0165	L	0.36672	1.1	0.09310	N	1	B	0.22276	0.067	B	0.24155	0.051	T	0.40059	-0.9583	9	0.29301	T	0.29	-8.6361	7.649	0.28337	0.0:0.4283:0.1213:0.4504	.	1868	Q96T58	MINT_HUMAN	V	1868	ENSP00000364912:L1868V	ENSP00000364912:L1868V	L	+	1	2	SPEN	16130924	0.919000	0.31177	0.007000	0.13788	0.912000	0.54170	0.155000	0.16362	-0.878000	0.04007	0.383000	0.25322	TTG	.	.	.	none		0.498	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001	
SLC44A3	126969	hgsc.bcm.edu	37	1	95360468	95360468	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr1:95360468T>C	ENST00000271227.6	+	15	2054	c.1952T>C	c.(1951-1953)aTt>aCt	p.I651T	SLC44A3_ENST00000532427.1_Missense_Mutation_p.I571T|SLC44A3_ENST00000529450.1_Missense_Mutation_p.I618T|SLC44A3_ENST00000527077.1_Missense_Mutation_p.I583T|SLC44A3_ENST00000446120.2_Missense_Mutation_p.I615T|SLC44A3_ENST00000467909.1_Missense_Mutation_p.I603T	NM_001114106.2|NM_001258340.1|NM_001258341.1	NP_001107578.1|NP_001245269.1|NP_001245270.1	Q8N4M1	CTL3_HUMAN	solute carrier family 44, member 3	651					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(6)|prostate(2)|stomach(1)|urinary_tract(1)	23		all_lung(203;0.000712)|Lung NSC(277;0.00316)		all cancers(265;0.039)|Epithelial(280;0.124)	Choline(DB00122)	CTCCAGGCCATTGTGAGATAG	0.403																																					p.I651T		Atlas-SNP	.											.	SLC44A3	109	.	0			c.T1952C						PASS	.						93.0	83.0	87.0					1																	95360468		2203	4300	6503	SO:0001583	missense	126969	exon15			AGGCCATTGTGAG	BC033858	CCDS751.1, CCDS44176.1, CCDS58011.1, CCDS58012.1, CCDS58013.1, CCDS72827.1	1p22.1	2013-05-22	2005-09-06		ENSG00000143036	ENSG00000143036		"""Solute carriers"""	28689	protein-coding gene	gene with protein product			"""solute carrier family, member 3"""			15715662, 12975309	Standard	NM_001114106		Approved	MGC45474, CTL3	uc001dqv.5	Q8N4M1	OTTHUMG00000010700	ENST00000271227.6:c.1952T>C	chr1.hg19:g.95360468T>C	ENSP00000271227:p.Ile651Thr	295.0	0.0	.		294.0	58.0	.	NM_001114106	B4DVY4|B4E1M4|B7ZA08|E9PJH2|E9PJY8|Q6UWT1|Q7Z6C5|Q9BWY7	Missense_Mutation	SNP	ENST00000271227.6	hg19	CCDS44176.1	.	.	.	.	.	.	.	.	.	.	T	9.568	1.120299	0.20877	.	.	ENSG00000143036	ENST00000446120;ENST00000271227;ENST00000527077;ENST00000529450;ENST00000467909;ENST00000532427;ENST00000532670	T;T;T;T;T;T	0.20069	2.58;2.78;2.1;2.1;2.59;2.11	5.91	2.35	0.29111	.	1.131400	0.06831	N	0.793947	T	0.04861	0.0131	N	0.14661	0.345	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.001;0.0;0.001;0.0;0.001	T	0.44574	-0.9319	10	0.72032	D	0.01	-0.1874	9.3576	0.38175	0.0:0.1722:0.0:0.8278	.	571;615;583;618;651	E9PIC5;Q8N4M1-3;E9PJY8;E9PJH2;Q8N4M1	.;.;.;.;CTL3_HUMAN	T	615;651;583;618;603;571;107	ENSP00000389143:I615T;ENSP00000271227:I651T;ENSP00000433641:I583T;ENSP00000431836:I618T;ENSP00000432789:I603T;ENSP00000436661:I571T	ENSP00000271227:I651T	I	+	2	0	SLC44A3	95133056	0.132000	0.22450	0.000000	0.03702	0.004000	0.04260	1.121000	0.31283	0.153000	0.19213	0.454000	0.30748	ATT	.	.	.	none		0.403	SLC44A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029544.3	NM_152369	
ATXN7L2	127002	hgsc.bcm.edu	37	1	110029635	110029635	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr1:110029635G>C	ENST00000369870.3	+	4	320	c.305G>C	c.(304-306)aGa>aCa	p.R102T		NM_153340.4	NP_699171.3	Q5T6C5	AT7L2_HUMAN	ataxin 7-like 2	102										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)	17		all_epithelial(167;0.00197)|all_lung(203;0.00291)|Lung NSC(277;0.00453)		Colorectal(144;0.0129)|Lung(183;0.0426)|Epithelial(280;0.0675)|READ - Rectum adenocarcinoma(129;0.0693)|all cancers(265;0.071)|LUSC - Lung squamous cell carcinoma(189;0.228)		ACAGAAAGAAGACATGGGCCC	0.547																																					p.R102T		Atlas-SNP	.											.	ATXN7L2	60	.	0			c.G305C						PASS	.						28.0	34.0	32.0					1																	110029635		2203	4299	6502	SO:0001583	missense	127002	exon4			AAAGAAGACATGG	BC037582	CCDS30794.1	1p13.2	2008-02-05			ENSG00000162650	ENSG00000162650			28713	protein-coding gene	gene with protein product						12477932	Standard	NM_153340		Approved	MGC46534, FLJ00381	uc001dxr.3	Q5T6C5	OTTHUMG00000011027	ENST00000369870.3:c.305G>C	chr1.hg19:g.110029635G>C	ENSP00000358886:p.Arg102Thr	124.0	0.0	.		130.0	17.0	.	NM_153340		Missense_Mutation	SNP	ENST00000369870.3	hg19	CCDS30794.1	.	.	.	.	.	.	.	.	.	.	G	18.52	3.640777	0.67244	.	.	ENSG00000162650	ENST00000369870;ENST00000541125	T	0.29397	1.57	4.57	4.57	0.56435	.	0.000000	0.52532	D	0.000067	T	0.38931	0.1059	L	0.56199	1.76	0.80722	D	1	D	0.54601	0.967	D	0.63597	0.916	T	0.31251	-0.9950	10	0.72032	D	0.01	-7.5006	14.2772	0.66187	0.0:0.0:1.0:0.0	.	102	Q5T6C5	AT7L2_HUMAN	T	102	ENSP00000358886:R102T	ENSP00000358886:R102T	R	+	2	0	ATXN7L2	109831158	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.555000	0.73928	2.090000	0.63153	0.591000	0.81541	AGA	.	.	.	none		0.547	ATXN7L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030331.1	NM_153340	
AXDND1	126859	hgsc.bcm.edu	37	1	179460842	179460842	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr1:179460842A>C	ENST00000367618.3	+	19	2648	c.2261A>C	c.(2260-2262)aAg>aCg	p.K754T		NM_144696.4	NP_653297.3	Q5T1B0	AXDN1_HUMAN	axonemal dynein light chain domain containing 1	754										NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(27)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	59						CTGACAAGGAAGTTGTACCAA	0.423																																					p.K754T		Atlas-SNP	.											.	AXDND1	142	.	0			c.A2261C						PASS	.						162.0	155.0	158.0					1																	179460842		2203	4300	6503	SO:0001583	missense	126859	exon19			CAAGGAAGTTGTA	BX647935	CCDS30948.1	1q25.2	2011-02-18	2011-02-18	2011-02-18	ENSG00000162779	ENSG00000162779			26564	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 125"""	C1orf125		14702039	Standard	NM_144696		Approved	FLJ32940	uc001gmo.3	Q5T1B0	OTTHUMG00000035266	ENST00000367618.3:c.2261A>C	chr1.hg19:g.179460842A>C	ENSP00000356590:p.Lys754Thr	309.0	0.0	.		309.0	52.0	.	NM_144696	Q6AWB2|Q96LJ3|Q96M01	Missense_Mutation	SNP	ENST00000367618.3	hg19	CCDS30948.1	.	.	.	.	.	.	.	.	.	.	A	8.397	0.841178	0.16891	.	.	ENSG00000162779	ENST00000367618;ENST00000360322;ENST00000434088	T;T	0.27256	1.68;1.68	5.5	-3.94	0.04130	.	0.252664	0.37393	N	0.002104	T	0.15609	0.0376	L	0.60455	1.87	0.09310	N	1	B;B	0.22800	0.028;0.075	B;B	0.17098	0.01;0.017	T	0.11518	-1.0584	10	0.35671	T	0.21	-0.2597	1.2029	0.01889	0.2479:0.137:0.3481:0.2669	.	712;754	E9PCJ4;Q5T1B0	.;AXDN1_HUMAN	T	754;712;688	ENSP00000356590:K754T;ENSP00000391716:K688T	ENSP00000353471:K712T	K	+	2	0	AXDND1	177727465	0.109000	0.22037	0.000000	0.03702	0.156000	0.22039	-0.033000	0.12246	-0.147000	0.11254	-0.326000	0.08463	AAG	.	.	.	none		0.423	AXDND1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085312.1	NM_144696	
ZNF281	23528	hgsc.bcm.edu	37	1	200376815	200376815	+	Silent	SNP	T	T	C			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr1:200376815T>C	ENST00000294740.3	-	2	2143	c.2019A>G	c.(2017-2019)caA>caG	p.Q673Q	ZNF281_ENST00000367353.1_Silent_p.Q673Q|ZNF281_ENST00000367352.3_Silent_p.Q637Q	NM_001281293.1|NM_001281294.1|NM_012482.4	NP_001268222.1|NP_001268223.1|NP_036614.1	Q9Y2X9	ZN281_HUMAN	zinc finger protein 281	673					embryonic body morphogenesis (GO:0010172)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|endometrium(3)|kidney(3)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	27						CAAAAGCCTGTTGGAGGTATT	0.398																																					p.Q673Q		Atlas-SNP	.											.	ZNF281	74	.	0			c.A2019G						PASS	.						118.0	130.0	126.0					1																	200376815		2203	4300	6503	SO:0001819	synonymous_variant	23528	exon2			AGCCTGTTGGAGG	AF125158	CCDS1402.1, CCDS60384.1	1q32.1	2012-08-08			ENSG00000162702	ENSG00000162702		"""Zinc fingers, C2H2-type"""	13075	protein-coding gene	gene with protein product						10448078	Standard	NM_012482		Approved	ZBP-99	uc001gve.3	Q9Y2X9	OTTHUMG00000035724	ENST00000294740.3:c.2019A>G	chr1.hg19:g.200376815T>C		53.0	0.0	.		66.0	13.0	.	NM_012482	A6NF48|B3KMX2|Q5RKW5|Q9NY92	Silent	SNP	ENST00000294740.3	hg19	CCDS1402.1																																																																																			.	.	.	none		0.398	ZNF281-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086879.2	NM_012482	
HS1BP3	64342	hgsc.bcm.edu	37	2	20818857	20818857	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr2:20818857C>G	ENST00000304031.3	-	7	1094	c.1069G>C	c.(1069-1071)Gct>Cct	p.A357P		NM_022460.3	NP_071905.3	Q53T59	H1BP3_HUMAN	HCLS1 binding protein 3	357							phosphatidylinositol binding (GO:0035091)			endometrium(4)|large_intestine(1)|lung(7)|ovary(1)|skin(2)	15	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGCTGCCCAGCCACAGCTTCA	0.622																																					p.A357P		Atlas-SNP	.											.	HS1BP3	33	.	0			c.G1069C						PASS	.						86.0	96.0	93.0					2																	20818857		2203	4300	6503	SO:0001583	missense	64342	exon7			GCCCAGCCACAGC		CCDS1700.1	2p24.1	2006-08-15			ENSG00000118960	ENSG00000118960			24979	protein-coding gene	gene with protein product		609359				10590261, 15699368	Standard	NM_022460		Approved	HS1-BP3,FLJ14249	uc002rdw.1	Q53T59	OTTHUMG00000122099	ENST00000304031.3:c.1069G>C	chr2.hg19:g.20818857C>G	ENSP00000305193:p.Ala357Pro	153.0	0.0	.		210.0	93.0	.	NM_022460	B2RAW2|D6W529|Q86VC2|Q8N367	Missense_Mutation	SNP	ENST00000304031.3	hg19	CCDS1700.1	.	.	.	.	.	.	.	.	.	.	C	13.90	2.376332	0.42105	.	.	ENSG00000118960	ENST00000304031	T	0.19532	2.14	5.64	0.323	0.15893	.	1.521430	0.04126	N	0.317110	T	0.17280	0.0415	L	0.39898	1.24	0.09310	N	0.999997	B	0.10296	0.003	B	0.09377	0.004	T	0.29852	-0.9998	10	0.51188	T	0.08	-2.0508	3.1138	0.06367	0.2876:0.3492:0.2805:0.0827	.	357	Q53T59	H1BP3_HUMAN	P	357	ENSP00000305193:A357P	ENSP00000305193:A357P	A	-	1	0	HS1BP3	20682338	0.000000	0.05858	0.000000	0.03702	0.388000	0.30384	0.116000	0.15561	0.037000	0.15575	0.655000	0.94253	GCT	.	.	.	none		0.622	HS1BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242863.1	NM_022460	
CCDC121	79635	hgsc.bcm.edu	37	2	27850548	27850548	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr2:27850548A>G	ENST00000324364.3	-	2	299	c.119T>C	c.(118-120)cTg>cCg	p.L40P	GPN1_ENST00000424214.1_5'Flank|CCDC121_ENST00000394775.3_Missense_Mutation_p.L202P|ZNF512_ENST00000556601.1_Intron|GPN1_ENST00000503738.1_5'Flank|GPN1_ENST00000407583.3_5'Flank|GPN1_ENST00000610189.1_5'Flank|GPN1_ENST00000458167.2_5'Flank|GPN1_ENST00000264718.3_5'Flank|GPN1_ENST00000515877.1_5'Flank|RP11-158I13.2_ENST00000505973.1_RNA	NM_024584.4	NP_078860.2	Q6ZUS5	CC121_HUMAN	coiled-coil domain containing 121	40										breast(1)|endometrium(3)|large_intestine(2)|lung(6)|prostate(2)	14	Acute lymphoblastic leukemia(172;0.155)					CAGGTATTCCAGAAAGAATCT	0.418																																					p.L202P		Atlas-SNP	.											.	CCDC121	43	.	0			c.T605C						PASS	.						115.0	120.0	119.0					2																	27850548		2203	4300	6503	SO:0001583	missense	79635	exon2			TATTCCAGAAAGA	AK125354	CCDS1759.1, CCDS46247.1	2p23.2	2008-02-05			ENSG00000176714	ENSG00000176714			25833	protein-coding gene	gene with protein product							Standard	NM_024584		Approved	FLJ43364, FLJ13646	uc002rld.3	Q6ZUS5	OTTHUMG00000128427	ENST00000324364.3:c.119T>C	chr2.hg19:g.27850548A>G	ENSP00000339087:p.Leu40Pro	125.0	0.0	.		129.0	39.0	.	NM_001142683	B3KW66|J3KQZ8|Q9H8G6	Missense_Mutation	SNP	ENST00000324364.3	hg19	CCDS1759.1	.	.	.	.	.	.	.	.	.	.	A	16.62	3.174659	0.57692	.	.	ENSG00000176714	ENST00000324364;ENST00000394775	T;T	0.48201	0.82;0.82	5.09	1.14	0.20703	.	0.656444	0.13268	N	0.400745	T	0.62502	0.2433	M	0.70275	2.135	0.09310	N	0.999997	D	0.76494	0.999	D	0.70016	0.967	T	0.51663	-0.8677	10	0.72032	D	0.01	-22.9356	8.2278	0.31579	0.5274:0.0:0.0:0.4726	.	40	Q6ZUS5	CC121_HUMAN	P	40;202	ENSP00000339087:L40P;ENSP00000412150:L202P	ENSP00000339087:L40P	L	-	2	0	CCDC121	27704052	0.720000	0.27996	0.001000	0.08648	0.370000	0.29829	1.010000	0.29898	-0.057000	0.13199	0.482000	0.46254	CTG	.	.	.	none		0.418	CCDC121-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250215.1	NM_024584	
ALK	238	hgsc.bcm.edu	37	2	29420473	29420473	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr2:29420473C>A	ENST00000389048.3	-	27	4914	c.4008G>T	c.(4006-4008)caG>caT	p.Q1336H	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	1336	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	CCAGAACTTCCTGGTTGCTTT	0.507			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																												p.Q1336H		Atlas-SNP	.	yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	.	ALK	533	.	0			c.G4008T						PASS	.						92.0	96.0	95.0					2																	29420473		2203	4300	6503	SO:0001583	missense	238	exon27	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	AACTTCCTGGTTG	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.4008G>T	chr2.hg19:g.29420473C>A	ENSP00000373700:p.Gln1336His	74.0	0.0	.		82.0	37.0	.	NM_004304	Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Missense_Mutation	SNP	ENST00000389048.3	hg19	CCDS33172.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.093137	0.76756	.	.	ENSG00000171094	ENST00000389048	D	0.82984	-1.67	5.8	4.0	0.46444	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.44688	U	0.000424	D	0.84383	0.5460	L	0.31578	0.945	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.81876	-0.0731	9	.	.	.	.	12.0878	0.53708	0.0:0.8616:0.0:0.1384	.	1336	Q9UM73	ALK_HUMAN	H	1336	ENSP00000373700:Q1336H	.	Q	-	3	2	ALK	29273977	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	2.181000	0.42547	0.788000	0.33755	0.561000	0.74099	CAG	.	.	.	none		0.507	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324994.1	NM_004304	
RGPD3	653489	hgsc.bcm.edu	37	2	107073432	107073432	+	Silent	SNP	G	G	A			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr2:107073432G>A	ENST00000409886.3	-	4	487	c.400C>T	c.(400-402)Cta>Tta	p.L134L	RGPD3_ENST00000304514.7_Silent_p.L134L	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	134					protein targeting to Golgi (GO:0000042)					breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						TTTACCTTTAGTTTATAAATT	0.333																																					p.L134L		Atlas-SNP	.											.	RGPD3	316	.	0			c.C400T						PASS	.						9.0	21.0	17.0					2																	107073432		628	1473	2101	SO:0001819	synonymous_variant	653489	exon4			CCTTTAGTTTATA		CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.400C>T	chr2.hg19:g.107073432G>A		342.0	0.0	.		384.0	132.0	.	NM_001144013	B8ZZM4	Silent	SNP	ENST00000409886.3	hg19	CCDS46379.1																																																																																			.	.	.	none		0.333	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000329975.1	XM_929931	
SCN2A	6326	hgsc.bcm.edu	37	2	166153545	166153545	+	Nonsense_Mutation	SNP	A	A	T			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr2:166153545A>T	ENST00000375437.2	+	3	576	c.286A>T	c.(286-288)Aaa>Taa	p.K96*	SCN2A_ENST00000375427.2_Nonsense_Mutation_p.K96*|SCN2A_ENST00000357398.3_Nonsense_Mutation_p.K96*|SCN2A_ENST00000283256.6_Nonsense_Mutation_p.K96*	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	96					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AGTATTGAATAAAGGGAAAGC	0.289																																					p.K96X		Atlas-SNP	.											.	SCN2A	589	.	0			c.A286T						PASS	.						58.0	56.0	57.0					2																	166153545		2203	4298	6501	SO:0001587	stop_gained	6326	exon2			TTGAATAAAGGGA	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.286A>T	chr2.hg19:g.166153545A>T	ENSP00000364586:p.Lys96*	174.0	0.0	.		200.0	105.0	.	NM_001040143	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Nonsense_Mutation	SNP	ENST00000375437.2	hg19	CCDS33314.1	.	.	.	.	.	.	.	.	.	.	A	38	6.708516	0.97780	.	.	ENSG00000136531	ENST00000424833;ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	.	.	.	5.32	5.32	0.75619	.	0.077674	0.56097	D	0.000038	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.5789	0.76418	1.0:0.0:0.0:0.0	.	.	.	.	X	96	.	ENSP00000283256:K96X	K	+	1	0	SCN2A	165861791	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.801000	0.55545	2.151000	0.67156	0.482000	0.46254	AAA	.	.	.	none		0.289	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007	
LRP2	4036	hgsc.bcm.edu	37	2	170055306	170055306	+	Silent	SNP	A	A	G			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr2:170055306A>G	ENST00000263816.3	-	45	8853	c.8568T>C	c.(8566-8568)ccT>ccC	p.P2856P		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	2856	LDL-receptor class A 19. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	TGCAATAAGTAGGGTTTTCAT	0.383																																					p.P2856P		Atlas-SNP	.											.	LRP2	751	.	0			c.T8568C						PASS	.						155.0	142.0	147.0					2																	170055306		2203	4300	6503	SO:0001819	synonymous_variant	4036	exon45			ATAAGTAGGGTTT		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.8568T>C	chr2.hg19:g.170055306A>G		119.0	0.0	.		149.0	49.0	.	NM_004525	O00711|Q16215	Silent	SNP	ENST00000263816.3	hg19	CCDS2232.1																																																																																			.	.	.	none		0.383	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
PGAP1	80055	hgsc.bcm.edu	37	2	197784853	197784853	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr2:197784853G>T	ENST00000354764.4	-	2	283	c.169C>A	c.(169-171)Ctg>Atg	p.L57M	PGAP1_ENST00000485830.1_5'UTR|PGAP1_ENST00000409188.1_Missense_Mutation_p.L15M|PGAP1_ENST00000409475.1_Missense_Mutation_p.L57M	NM_024989.3	NP_079265.2	Q75T13	PGAP1_HUMAN	post-GPI attachment to proteins 1	57					anterior/posterior axis specification (GO:0009948)|attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|embryonic pattern specification (GO:0009880)|forebrain regionalization (GO:0021871)|head development (GO:0060322)|intracellular protein transport (GO:0006886)|myo-inositol transport (GO:0015798)|post-translational protein modification (GO:0043687)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	nuclease activity (GO:0004518)|phosphoric ester hydrolase activity (GO:0042578)			breast(4)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|ovary(6)|stomach(1)|urinary_tract(1)	40						CGTTTTGCCAGTTTCTTTGGA	0.343																																					p.L57M		Atlas-SNP	.											.	PGAP1	84	.	0			c.C169A						PASS	.						120.0	125.0	123.0					2																	197784853		2203	4300	6503	SO:0001583	missense	80055	exon2			TTGCCAGTTTCTT		CCDS2318.1	2q33.1	2014-03-03			ENSG00000197121	ENSG00000197121			25712	protein-coding gene	gene with protein product	"""GPI inositol-deacylase"""	611655				14734546, 17711852, 24482476	Standard	XM_005246866		Approved	FLJ12377, Bst1, SPG67	uc002utw.3	Q75T13	OTTHUMG00000132743	ENST00000354764.4:c.169C>A	chr2.hg19:g.197784853G>T	ENSP00000346809:p.Leu57Met	43.0	0.0	.		56.0	28.0	.	NM_024989	Q4G0R8|Q4ZG47|Q53SM0|Q6AW92|Q6UWV4|Q9HA24	Missense_Mutation	SNP	ENST00000354764.4	hg19	CCDS2318.1	.	.	.	.	.	.	.	.	.	.	G	16.93	3.258007	0.59321	.	.	ENSG00000197121	ENST00000354764;ENST00000409475;ENST00000409188	.	.	.	5.11	3.32	0.38043	.	0.237063	0.36519	N	0.002555	T	0.33847	0.0877	L	0.29908	0.895	0.27991	N	0.935656	D;D	0.71674	0.958;0.998	P;P	0.59221	0.66;0.854	T	0.13202	-1.0518	9	0.35671	T	0.21	-5.081	2.3431	0.04264	0.1595:0.2325:0.4637:0.1442	.	57;57	Q75T13-3;Q75T13	.;PGAP1_HUMAN	M	57;57;15	.	ENSP00000346809:L57M	L	-	1	2	PGAP1	197493098	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.666000	0.37460	0.852000	0.35287	0.655000	0.94253	CTG	.	.	.	none		0.343	PGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256103.5	NM_024989	
FARP2	9855	hgsc.bcm.edu	37	2	242407764	242407764	+	Silent	SNP	C	C	G	rs138469271		TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr2:242407764C>G	ENST00000264042.3	+	18	2273	c.2103C>G	c.(2101-2103)ccC>ccG	p.P701P		NM_014808.2	NP_055623.1	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	701	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton reorganization (GO:0031532)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|neuron remodeling (GO:0016322)|osteoclast differentiation (GO:0030316)|podosome assembly (GO:0071800)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of integrin activation (GO:0033623)|regulation of Rac GTPase activity (GO:0032314)|semaphorin-plexin signaling pathway (GO:0071526)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	43		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		ATTACAGCCCCGGGCACCATG	0.637																																					p.P701P		Atlas-SNP	.											.	FARP2	92	.	0			c.C2103G						PASS	.						42.0	36.0	38.0					2																	242407764		2203	4300	6503	SO:0001819	synonymous_variant	9855	exon18			CAGCCCCGGGCAC	AB018336	CCDS33424.1, CCDS63197.1	2q37.3	2013-01-10			ENSG00000006607	ENSG00000006607		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16460	protein-coding gene	gene with protein product						9872452, 12351724	Standard	NM_001282984		Approved	KIAA0793, FIR, PLEKHC3, FRG	uc002wbi.2	O94887	OTTHUMG00000151574	ENST00000264042.3:c.2103C>G	chr2.hg19:g.242407764C>G		89.0	0.0	.		93.0	36.0	.	NM_014808	B7Z6J8|F5GZ84|Q53QM5|Q8WU27|Q9UFE7	Silent	SNP	ENST00000264042.3	hg19	CCDS33424.1																																																																																			.	C|1.000;T|0.000	.	alt		0.637	FARP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323153.1		
MKRN2	23609	hgsc.bcm.edu	37	3	12611673	12611673	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr3:12611673G>A	ENST00000170447.7	+	3	396	c.259G>A	c.(259-261)Gtc>Atc	p.V87I	MKRN2_ENST00000411987.1_Missense_Mutation_p.V44I|MKRN2_ENST00000448482.1_Missense_Mutation_p.V85I	NM_001271707.1|NM_014160.3	NP_001258636.1|NP_054879.3	Q9H000	MKRN2_HUMAN	makorin ring finger protein 2	87					protein ubiquitination (GO:0016567)	intracellular (GO:0005622)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|prostate(3)	16						TCCTTCCGAGGTCACTGCATC	0.547																																					p.V87I		Atlas-SNP	.											.	MKRN2	32	.	0			c.G259A						PASS	.						97.0	82.0	87.0					3																	12611673		2203	4300	6503	SO:0001583	missense	23609	exon3			TCCGAGGTCACTG		CCDS33702.1, CCDS63545.1	3p25	2008-08-13	2008-08-13		ENSG00000075975	ENSG00000075975		"""RING-type (C3HC4) zinc fingers"""	7113	protein-coding gene	gene with protein product		608426				11597136	Standard	NM_014160		Approved	RNF62, HSPC070	uc003bxd.4	Q9H000	OTTHUMG00000155371	ENST00000170447.7:c.259G>A	chr3.hg19:g.12611673G>A	ENSP00000170447:p.Val87Ile	76.0	0.0	.		83.0	77.0	.	NM_014160	A6NIA2|B3KRC5|B4DPR4|Q8N391|Q96BD4|Q9BUY2|Q9NRY1	Missense_Mutation	SNP	ENST00000170447.7	hg19	CCDS33702.1	.	.	.	.	.	.	.	.	.	.	G	2.117	-0.402351	0.04865	.	.	ENSG00000075975	ENST00000170447;ENST00000411987;ENST00000448482	T;T;T	0.22539	2.79;1.96;1.95	5.53	-1.17	0.09648	.	0.892392	0.09710	N	0.765804	T	0.05686	0.0149	N	0.00926	-1.1	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.35773	-0.9775	10	0.33141	T	0.24	.	4.2105	0.10509	0.361:0.332:0.2385:0.0685	.	44;85;87	B4DPR4;C9J494;Q9H000	.;.;MKRN2_HUMAN	I	87;44;85	ENSP00000170447:V87I;ENSP00000396340:V44I;ENSP00000397983:V85I	ENSP00000170447:V87I	V	+	1	0	MKRN2	12586673	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.048000	0.14078	0.001000	0.14605	-0.311000	0.09066	GTC	.	.	.	none		0.547	MKRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339679.1	NM_014160	
POC1A	25886	hgsc.bcm.edu	37	3	52181040	52181040	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr3:52181040C>A	ENST00000296484.2	-	5	566	c.527G>T	c.(526-528)aGc>aTc	p.S176I	POC1A_ENST00000394970.2_Missense_Mutation_p.S176I|POC1A_ENST00000474012.1_Missense_Mutation_p.S138I	NM_015426.4	NP_056241.3	Q8NBT0	POC1A_HUMAN	POC1 centriolar protein A	176					cell projection organization (GO:0030030)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|spindle pole (GO:0000922)				endometrium(1)|large_intestine(4)|liver(1)|lung(4)|prostate(3)|skin(1)	14						ACATTCCCGGCTGCTCTTGTC	0.592																																					p.S176I		Atlas-SNP	.											.	POC1A	32	.	0			c.G527T						PASS	.						107.0	98.0	101.0					3																	52181040		2203	4300	6503	SO:0001583	missense	25886	exon5			TCCCGGCTGCTCT	AL117629	CCDS2846.1, CCDS54591.1, CCDS54592.1	3p21.2	2014-05-02	2013-08-21	2010-03-26	ENSG00000164087	ENSG00000164087		"""WD repeat domain containing"""	24488	protein-coding gene	gene with protein product		614783	"""WD repeat domain 51A"", ""POC1 centriolar protein homolog A (Chlamydomonas)"""	WDR51A		19109428, 22840364	Standard	NM_015426		Approved	DKFZP434C245	uc003dcu.3	Q8NBT0	OTTHUMG00000157817	ENST00000296484.2:c.527G>T	chr3.hg19:g.52181040C>A	ENSP00000296484:p.Ser176Ile	150.0	0.0	.		127.0	32.0	.	NM_015426	A4FUW4|E9PFC6|Q0VDF8|Q2TAK6|Q96IK6|Q9UFJ8	Missense_Mutation	SNP	ENST00000296484.2	hg19	CCDS2846.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.831256	0.91036	.	.	ENSG00000164087	ENST00000296484;ENST00000394970;ENST00000474012	D;D;D	0.82803	-1.65;-1.65;-1.65	5.13	4.19	0.49359	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.041315	0.85682	D	0.000000	D	0.89160	0.6636	M	0.84082	2.675	0.80722	D	1	D;D	0.62365	0.974;0.991	P;P	0.56163	0.767;0.793	D	0.91017	0.4854	10	0.87932	D	0	.	15.0503	0.71862	0.0:0.8574:0.1426:0.0	.	176;176	Q8NBT0-2;Q8NBT0	.;POC1A_HUMAN	I	176;176;138	ENSP00000296484:S176I;ENSP00000378421:S176I;ENSP00000418968:S138I	ENSP00000296484:S176I	S	-	2	0	POC1A	52156080	1.000000	0.71417	1.000000	0.80357	0.844000	0.47949	3.074000	0.50065	2.555000	0.86185	0.563000	0.77884	AGC	.	.	.	none		0.592	POC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349685.1	NM_015426	
PBRM1	55193	hgsc.bcm.edu	37	3	52637647	52637647	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr3:52637647G>T	ENST00000296302.7	-	17	2670	c.2669C>A	c.(2668-2670)gCa>gAa	p.A890E	PBRM1_ENST00000409114.3_Missense_Mutation_p.A905E|PBRM1_ENST00000394830.3_Missense_Mutation_p.A890E|PBRM1_ENST00000337303.4_Missense_Mutation_p.A890E|PBRM1_ENST00000410007.1_Missense_Mutation_p.A890E|PBRM1_ENST00000356770.4_Missense_Mutation_p.A858E|PBRM1_ENST00000409057.1_Missense_Mutation_p.A890E|PBRM1_ENST00000409767.1_Missense_Mutation_p.A905E			Q86U86	PB1_HUMAN	polybromo 1	890					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		ATAGCTGAGTGCCGGTGAAAG	0.338			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																p.A890E		Atlas-SNP	.		Rec	yes		3	3p21	55193	polybromo 1		E	.	PBRM1	1252	.	0			c.C2669A						PASS	.						82.0	78.0	79.0					3																	52637647		2203	4299	6502	SO:0001583	missense	55193	exon18			CTGAGTGCCGGTG	BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.2669C>A	chr3.hg19:g.52637647G>T	ENSP00000296302:p.Ala890Glu	23.0	0.0	.		32.0	28.0	.	NM_018313	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Missense_Mutation	SNP	ENST00000296302.7	hg19		.	.	.	.	.	.	.	.	.	.	G	33	5.240611	0.95240	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	T;T;T;T;T;T;T;T;T;T	0.54675	0.67;0.59;0.71;0.66;0.68;0.56;1.14;0.67;0.69;0.97	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.76018	0.3929	M	0.80422	2.495	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D	0.97110	0.999;0.999;1.0;0.999;1.0;1.0;0.999;0.999;1.0	T	0.78237	-0.2282	10	0.87932	D	0	.	19.9278	0.97110	0.0:0.0:1.0:0.0	.	890;890;890;890;905;905;890;858;890	Q86U86-9;E7EVG2;Q86U86-4;Q86U86-2;Q86U86-8;Q86U86-7;Q86U86;Q86U86-3;Q86U86-5	.;.;.;.;.;.;PB1_HUMAN;.;.	E	858;890;890;890;890;890;905;905;890;849	ENSP00000349213:A858E;ENSP00000378307:A890E;ENSP00000296302:A890E;ENSP00000338302:A890E;ENSP00000386593:A890E;ENSP00000386529:A890E;ENSP00000386643:A905E;ENSP00000386601:A905E;ENSP00000387775:A890E;ENSP00000397662:A849E	ENSP00000296302:A890E	A	-	2	0	PBRM1	52612687	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.779000	0.99018	2.770000	0.95276	0.650000	0.86243	GCA	.	.	.	none		0.338	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1	NM_018165	
SLMAP	7871	hgsc.bcm.edu	37	3	57743531	57743531	+	Silent	SNP	A	A	G	rs147270008		TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr3:57743531A>G	ENST00000428312.1	+	1	247	c.153A>G	c.(151-153)ctA>ctG	p.L51L	SLMAP_ENST00000295951.3_Silent_p.L51L|SLMAP_ENST00000295952.3_Silent_p.L51L|SLMAP_ENST00000449503.2_Silent_p.L51L|SLMAP_ENST00000416870.1_5'UTR|SLMAP_ENST00000383718.3_Silent_p.L51L			Q14BN4	SLMAP_HUMAN	sarcolemma associated protein	51	FHA. {ECO:0000255|PROSITE- ProRule:PRU00086}.|Necessary for targeting to centrosomes. {ECO:0000250}.				muscle contraction (GO:0006936)	cytoskeleton (GO:0005856)|integral component of plasma membrane (GO:0005887)|smooth endoplasmic reticulum (GO:0005790)				endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|urinary_tract(2)	18				BRCA - Breast invasive adenocarcinoma(55;0.000271)|KIRC - Kidney renal clear cell carcinoma(284;0.0602)|Kidney(284;0.0754)|OV - Ovarian serous cystadenocarcinoma(275;0.182)		GCAAAGTGCTATCAAGGAACC	0.498																																					p.L51L		Atlas-SNP	.											.	SLMAP	46	.	0			c.A153G						PASS	.	A		1,4405		0,1,2202	78.0	70.0	73.0		153	1.8	1.0	3	dbSNP_134	73	0,8600		0,0,4300	no	coding-synonymous	SLMAP	NM_007159.2		0,1,6502	GG,GA,AA		0.0,0.0227,0.0077		51/812	57743531	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	7871	exon1			AGTGCTATCAAGG	AF100750	CCDS33774.1	3p21.2-p14.3	2008-07-18			ENSG00000163681	ENSG00000163681			16643	protein-coding gene	gene with protein product	"""Sarcolemmal-associated protein"""	602701				9405447, 11042152	Standard	NM_007159		Approved	SLAP, KIAA1601	uc003djd.1	Q14BN4	OTTHUMG00000133764	ENST00000428312.1:c.153A>G	chr3.hg19:g.57743531A>G		317.0	2.0	.		282.0	236.0	.	NM_007159	Q14C95|Q6AI54|Q6UXC9|Q6ZVQ8|Q8NCW9|Q9H297|Q9HCH1|Q9Y681	Silent	SNP	ENST00000428312.1	hg19																																																																																				.	A|1.000;G|0.000	0.000	weak		0.498	SLMAP-013	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351584.1	NM_007159	
THPO	7066	hgsc.bcm.edu	37	3	184090635	184090635	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr3:184090635A>C	ENST00000204615.7	-	6	942	c.728T>G	c.(727-729)aTc>aGc	p.I243S	THPO_ENST00000421442.2_Missense_Mutation_p.N204K|EIF2B5_ENST00000444495.1_Intron|THPO_ENST00000477594.1_5'Flank|THPO_ENST00000445696.2_Missense_Mutation_p.I239S	NM_000460.2|NM_001177597.1|NM_001177598.1	NP_000451.1|NP_001171068.1|NP_001171069.1	P40225	TPO_HUMAN	thrombopoietin	243					blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|myeloid cell differentiation (GO:0030099)|platelet activation (GO:0030168)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|thrombopoietin-mediated signaling pathway (GO:0038163)	extracellular space (GO:0005615)	growth factor activity (GO:0008083)			NS(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)	16	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GTATCCGGGGATTTGGTCCAG	0.552																																					p.I243S		Atlas-SNP	.											.	THPO	37	.	0			c.T728G						PASS	.						88.0	86.0	87.0					3																	184090635		2203	4300	6503	SO:0001583	missense	7066	exon6			CCGGGGATTTGGT		CCDS3265.1, CCDS54693.1	3q27	2014-01-30	2008-07-31		ENSG00000090534	ENSG00000090534		"""Endogenous ligands"""	11795	protein-coding gene	gene with protein product	"""prepro-thrombopoietin"", ""megakaryocyte stimulating factor"", ""myeloproliferative leukemia virus oncogene ligand"", ""megakaryocyte growth and development factor"", ""MPL ligand"", ""megakaryocyte colony-stimulating factor"", ""c-mpl ligand"", ""thrombopoietin nirs variant 1"""	600044		MGDF		8202154	Standard	XM_006713738		Approved	TPO, MPLLG	uc003fol.1	P40225	OTTHUMG00000156745	ENST00000204615.7:c.728T>G	chr3.hg19:g.184090635A>C	ENSP00000204615:p.Ile243Ser	126.0	0.0	.		150.0	49.0	.	NM_000460	A1L3Y0|B7ZLR8|B9EGA8|Q13020|Q15790|Q15791|Q15792	Missense_Mutation	SNP	ENST00000204615.7	hg19	CCDS3265.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	0.184|0.184	-1.059924|-1.059924	0.01950|0.01950	.|.	.|.	ENSG00000090534|ENSG00000090534	ENST00000204615;ENST00000445696;ENST00000353488|ENST00000421442	T;T|T	0.34859|0.36157	1.34;1.35|1.27	4.34|4.34	-1.07|-1.07	0.09968|0.09968	Four-helical cytokine, core (1);|.	1.174950|.	0.06383|.	N|.	0.715527|.	T|T	0.21718|0.21718	0.0523|0.0523	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	1|1	B;B|B	0.24426|0.28291	0.103;0.063|0.206	B;B|B	0.25140|0.28139	0.058;0.026|0.086	T|T	0.23547|0.23547	-1.0185|-1.0185	10|9	0.66056|0.42905	D|T	0.02|0.14	-23.2862|-23.2862	3.8944|3.8944	0.09133|0.09133	0.3909:0.3883:0.2208:0.0|0.3909:0.3883:0.2208:0.0	.|.	239;243|204	P40225-2;P40225|F8W6L1	.;TPO_HUMAN|.	S|K	243;239;204|204	ENSP00000204615:I243S;ENSP00000410763:I239S|ENSP00000411704:N204K	ENSP00000204615:I243S|ENSP00000411704:N204K	I|N	-|-	2|3	0|2	THPO|THPO	185573329|185573329	0.002000|0.002000	0.14202|0.14202	0.093000|0.093000	0.20910|0.20910	0.720000|0.720000	0.41350|0.41350	-0.313000|-0.313000	0.08103|0.08103	0.205000|0.205000	0.20568|0.20568	0.378000|0.378000	0.23410|0.23410	ATC|AAT	.	.	.	none		0.552	THPO-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345554.1	NM_000460	
EIF4A2	1974	hgsc.bcm.edu	37	3	186503770	186503770	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr3:186503770G>T	ENST00000323963.5	+	5	511	c.447G>T	c.(445-447)caG>caT	p.Q149H	SNORA81_ENST00000408493.2_RNA|SNORA63_ENST00000363548.1_RNA|SNORD2_ENST00000459163.1_RNA|EIF4A2_ENST00000440191.2_Missense_Mutation_p.Q150H|EIF4A2_ENST00000356531.5_Missense_Mutation_p.Q54H|RP11-573D15.9_ENST00000577781.1_RNA|SNORA63_ENST00000363450.1_RNA|SNORA4_ENST00000584302.1_RNA			Q14240	IF4A2_HUMAN	eukaryotic translation initiation factor 4A2	149	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|urinary_tract(1)	28	all_cancers(143;2.68e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.07e-20)	GBM - Glioblastoma multiforme(93;0.0704)		AAAAACTGCAGGCTGAAGCAC	0.393			T	BCL6	NHL																																p.Q149H		Atlas-SNP	.		Dom	yes		3	3q27.3	1974	"""eukaryotic translation initiation factor 4A, isoform 2"""		L	.	EIF4A2	55	.	0			c.G447T						PASS	.						94.0	87.0	90.0					3																	186503770		2203	4300	6503	SO:0001583	missense	1974	exon5			ACTGCAGGCTGAA	D30655	CCDS3282.1	3q28	2012-02-23	2010-02-10		ENSG00000156976	ENSG00000156976	3.6.1.1	"""DEAD-boxes"""	3284	protein-coding gene	gene with protein product		601102	"""eukaryotic translation initiation factor 4A, isoform 2"""	EIF4F		8521730	Standard	NM_001967		Approved	DDX2B, EIF4A, BM-010	uc003fqs.3	Q14240	OTTHUMG00000156564	ENST00000323963.5:c.447G>T	chr3.hg19:g.186503770G>T	ENSP00000326381:p.Gln149His	121.0	0.0	.		149.0	34.0	.	NM_001967	D3DNU9|Q53XJ6|Q96B90|Q96EA8	Missense_Mutation	SNP	ENST00000323963.5	hg19	CCDS3282.1	.	.	.	.	.	.	.	.	.	.	G	19.10	3.761816	0.69763	.	.	ENSG00000156976	ENST00000323963;ENST00000440191;ENST00000356531	T;T;T	0.04917	3.53;3.53;3.53	4.51	4.51	0.55191	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.40818	U	0.001006	T	0.15089	0.0364	L	0.45051	1.395	0.80722	D	1	D;P;P;P	0.67145	0.996;0.913;0.836;0.865	P;P;B;P	0.59115	0.852;0.71;0.382;0.516	T	0.00389	-1.1770	10	0.87932	D	0	-9.8507	15.0932	0.72211	0.0:0.0:1.0:0.0	.	5;54;150;149	B4DJX6;Q9NZE6;Q14240-2;Q14240	.;.;.;IF4A2_HUMAN	H	149;150;54	ENSP00000326381:Q149H;ENSP00000398370:Q150H;ENSP00000348925:Q54H	ENSP00000326381:Q149H	Q	+	3	2	EIF4A2	187986464	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	5.890000	0.69774	2.497000	0.84241	0.650000	0.86243	CAG	.	.	.	none		0.393	EIF4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344609.1	NM_001967	
ZNF622	90441	hgsc.bcm.edu	37	5	16465479	16465479	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr5:16465479A>G	ENST00000308683.2	-	1	422	c.296T>C	c.(295-297)gTg>gCg	p.V99A		NM_033414.2	NP_219482.1	Q969S3	ZN622_HUMAN	zinc finger protein 622	99					intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of kinase activity (GO:0033674)|positive regulation of MAPK cascade (GO:0043410)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|prostate(2)|urinary_tract(1)	25						CACTGCCTGCACGGCCTTCTT	0.537																																					p.V99A		Atlas-SNP	.											.	ZNF622	49	.	0			c.T296C						PASS	.						155.0	139.0	145.0					5																	16465479		2203	4300	6503	SO:0001583	missense	90441	exon1			GCCTGCACGGCCT	AY046059	CCDS3886.1	5p15.1	2012-10-05			ENSG00000173545	ENSG00000173545			30958	protein-coding gene	gene with protein product		608694				11802789, 12645566	Standard	NM_033414		Approved	MGC2485, MGC17552, ZPR9	uc003jfq.3	Q969S3	OTTHUMG00000090567	ENST00000308683.2:c.296T>C	chr5.hg19:g.16465479A>G	ENSP00000310042:p.Val99Ala	148.0	0.0	.		155.0	31.0	.	NM_033414		Missense_Mutation	SNP	ENST00000308683.2	hg19	CCDS3886.1	.	.	.	.	.	.	.	.	.	.	A	15.37	2.814522	0.50527	.	.	ENSG00000173545	ENST00000308683	.	.	.	4.81	3.65	0.41850	.	0.199006	0.45126	D	0.000388	T	0.46639	0.1403	M	0.65975	2.015	0.41784	D	0.989838	B	0.15141	0.012	B	0.09377	0.004	T	0.36432	-0.9748	9	0.02654	T	1	-37.7849	7.9359	0.29929	0.8407:0.0:0.1593:0.0	.	99	Q969S3	ZN622_HUMAN	A	99	.	ENSP00000310042:V99A	V	-	2	0	ZNF622	16518479	1.000000	0.71417	0.995000	0.50966	0.983000	0.72400	5.190000	0.65104	0.855000	0.35359	0.528000	0.53228	GTG	.	.	.	none		0.537	ZNF622-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207105.1	NM_033414	
MYO10	4651	hgsc.bcm.edu	37	5	16685914	16685914	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr5:16685914A>C	ENST00000513610.1	-	29	4377	c.3923T>G	c.(3922-3924)gTc>gGc	p.V1308G	MYO10_ENST00000427430.2_Missense_Mutation_p.V665G|MYO10_ENST00000274203.9_Missense_Mutation_p.V665G|MYO10_ENST00000505695.1_Missense_Mutation_p.V647G|MYO10_ENST00000515803.1_Missense_Mutation_p.V647G	NM_012334.2	NP_036466.2	Q9HD67	MYO10_HUMAN	myosin X	1308	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|plus-end directed microfilament motor activity (GO:0060002)|spectrin binding (GO:0030507)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	86						GGACGCGTGGACCTGACTCAG	0.592																																					p.V1308G		Atlas-SNP	.											.	MYO10	198	.	0			c.T3923G						PASS	.						61.0	61.0	61.0					5																	16685914		2160	4271	6431	SO:0001583	missense	4651	exon29			GCGTGGACCTGAC	AF247457	CCDS54834.1	5p15.1-p14.3	2013-01-10				ENSG00000145555		"""Myosins / Myosin superfamily : Class X"", ""Pleckstrin homology (PH) domain containing"""	7593	protein-coding gene	gene with protein product		601481				8884266	Standard	NM_012334		Approved	KIAA0799	uc003jft.4	Q9HD67		ENST00000513610.1:c.3923T>G	chr5.hg19:g.16685914A>C	ENSP00000421280:p.Val1308Gly	60.0	0.0	.		56.0	24.0	.	NM_012334	A7E2D1|O94893|Q8IVX5|Q9NYM7|Q9P110|Q9P111|Q9UHF6	Missense_Mutation	SNP	ENST00000513610.1	hg19	CCDS54834.1	.	.	.	.	.	.	.	.	.	.	A	28.1	4.889699	0.91889	.	.	ENSG00000145555	ENST00000513610;ENST00000515803;ENST00000274203;ENST00000505695;ENST00000427430	T;T;T;T;T	0.14391	2.51;2.51;2.51;2.51;2.51	5.51	5.51	0.81932	Pleckstrin homology domain (3);	.	.	.	.	T	0.46151	0.1378	M	0.90542	3.125	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	T	0.57057	-0.7876	9	0.87932	D	0	.	15.6429	0.77020	1.0:0.0:0.0:0.0	.	187;949;1308	B4DIJ5;Q69YP8;Q9HD67	.;.;MYO10_HUMAN	G	1308;647;665;647;665	ENSP00000421280:V1308G;ENSP00000425051:V647G;ENSP00000274203:V665G;ENSP00000421170:V647G;ENSP00000391106:V665G	ENSP00000274203:V665G	V	-	2	0	MYO10	16738914	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.331000	0.96430	2.092000	0.63282	0.523000	0.50628	GTC	.	.	.	none		0.592	MYO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366167.1	NM_012334	
CDH9	1007	hgsc.bcm.edu	37	5	26915851	26915851	+	Missense_Mutation	SNP	C	C	T	rs150604531		TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr5:26915851C>T	ENST00000231021.4	-	3	582	c.410G>A	c.(409-411)cGg>cAg	p.R137Q		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	137	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						TTCCACCTGCCGCCCAGTTTT	0.383																																					p.R137Q	Melanoma(8;187 585 15745 40864 52829)	Atlas-SNP	.											CDH9,NS,carcinoma,-1,1	CDH9	305	.	0			c.G410A						PASS	.	C	GLN/ARG	0,4406		0,0,2203	136.0	136.0	136.0		410	4.6	0.5	5	dbSNP_134	136	3,8595	3.0+/-9.4	0,3,4296	no	missense	CDH9	NM_016279.3	43	0,3,6499	TT,TC,CC		0.0349,0.0,0.0231	benign	137/790	26915851	3,13001	2203	4299	6502	SO:0001583	missense	1007	exon3			ACCTGCCGCCCAG	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.410G>A	chr5.hg19:g.26915851C>T	ENSP00000231021:p.Arg137Gln	112.0	1.0	.		112.0	37.0	.	NM_016279	Q3B7I5	Missense_Mutation	SNP	ENST00000231021.4	hg19	CCDS3893.1	.	.	.	.	.	.	.	.	.	.	C	14.41	2.525965	0.44969	0.0	3.49E-4	ENSG00000113100	ENST00000231021	T	0.50548	0.74	4.62	4.62	0.57501	Cadherin (4);Cadherin-like (1);	0.353060	0.31031	N	0.008396	T	0.35595	0.0937	L	0.39514	1.22	0.09310	N	1	B	0.28512	0.214	B	0.25405	0.06	T	0.16424	-1.0403	9	.	.	.	.	10.1395	0.42728	0.0:0.9063:0.0:0.0937	.	137	Q9ULB4	CADH9_HUMAN	Q	137	ENSP00000231021:R137Q	.	R	-	2	0	CDH9	26951608	0.001000	0.12720	0.540000	0.28089	0.988000	0.76386	1.388000	0.34442	2.275000	0.75901	0.650000	0.86243	CGG	.	C|1.000;T|0.000	0.000	weak		0.383	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279	
GDNF	2668	hgsc.bcm.edu	37	5	37834925	37834925	+	Splice_Site	SNP	C	C	A	rs13169425		TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr5:37834925C>A	ENST00000326524.2	-	2	174		c.e2-1		GDNF_ENST00000427982.1_Splice_Site|GDNF_ENST00000381826.4_Splice_Site|GDNF_ENST00000515058.1_Splice_Site|GDNF_ENST00000344622.4_Splice_Site	NM_000514.3	NP_000505.1	P39905	GDNF_HUMAN	glial cell derived neurotrophic factor						adult locomotory behavior (GO:0008344)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|enteric nervous system development (GO:0048484)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|metanephros development (GO:0001656)|mRNA stabilization (GO:0048255)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neuron projection development (GO:0031175)|organ induction (GO:0001759)|peristalsis (GO:0030432)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0072108)|positive regulation of monooxygenase activity (GO:0032770)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of ureteric bud formation (GO:0072107)|postganglionic parasympathetic nervous system development (GO:0021784)|postsynaptic membrane organization (GO:0001941)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of morphogenesis of a branching structure (GO:0060688)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|ureteric bud formation (GO:0060676)	extracellular region (GO:0005576)	protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			NS(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(8)|skin(2)	15	all_lung(31;0.00118)					GCGGCGGCACCTGCGCGGGCA	0.692																																					.		Atlas-SNP	.											.	GDNF	56	.	0			c.26-1G>T						PASS	.						21.0	23.0	23.0					5																	37834925		2192	4281	6473	SO:0001630	splice_region_variant	2668	exon3			CGGCACCTGCGCG		CCDS3922.1, CCDS3923.1, CCDS54845.1, CCDS54846.1, CCDS75237.1	5p13.1-p12	2014-01-30			ENSG00000168621	ENSG00000168621		"""Endogenous ligands"""	4232	protein-coding gene	gene with protein product	"""astrocyte-derived trophic factor"", ""glial cell line derived neurotrophic factor"", ""glial derived neurotrophic factor"""	600837				8493557	Standard	NM_199231		Approved	ATF1, ATF2, HFB1-GDNF	uc011cpg.2	P39905	OTTHUMG00000090809	ENST00000326524.2:c.26-1G>T	chr5.hg19:g.37834925C>A		82.0	0.0	.		48.0	19.0	.	NM_001190469	B7WPK7|O95448|O95449|O95986|Q6FH33|Q96L44|Q9UD32|Q9UD33|Q9UMV2|Q9UP67|Q9UP97	Splice_Site	SNP	ENST00000326524.2	hg19	CCDS3922.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.135134	0.77662	.	.	ENSG00000168621	ENST00000427982;ENST00000381826	.	.	.	5.7	5.7	0.88788	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.6148	0.88064	0.0:1.0:0.0:0.0	rs13169425;rs13169425	.	.	.	.	-1	.	.	.	-	.	.	GDNF	37870682	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.889000	0.63171	2.691000	0.91804	0.561000	0.74099	.	.	C|1.000;|0.000	.	weak		0.692	GDNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207606.1	NM_000514	Intron
PRRC1	133619	hgsc.bcm.edu	37	5	126860514	126860514	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr5:126860514G>C	ENST00000296666.8	+	3	583	c.395G>C	c.(394-396)gGa>gCa	p.G132A	PRRC1_ENST00000512635.2_Missense_Mutation_p.G132A|PRRC1_ENST00000442138.2_Missense_Mutation_p.G132A	NM_130809.3	NP_570721.1	Q96M27	PRRC1_HUMAN	proline-rich coiled-coil 1	132						Golgi apparatus (GO:0005794)				endometrium(1)|large_intestine(1)|lung(4)	6		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0851)|Epithelial(69;0.113)		CCTATATCAGGATTTTCTGTT	0.507																																					p.G132A		Atlas-SNP	.											.	PRRC1	22	.	0			c.G395C						PASS	.						145.0	149.0	148.0					5																	126860514		2203	4300	6503	SO:0001583	missense	133619	exon3			TATCAGGATTTTC	AJ515429	CCDS4143.1, CCDS68943.1	5q23.2	2008-02-05			ENSG00000164244	ENSG00000164244			28164	protein-coding gene	gene with protein product						15541471	Standard	NM_130809		Approved	FLJ32875	uc003kuk.3	Q96M27	OTTHUMG00000128982	ENST00000296666.8:c.395G>C	chr5.hg19:g.126860514G>C	ENSP00000296666:p.Gly132Ala	145.0	0.0	.		182.0	83.0	.	NM_130809	Q69YM8|Q7L2U7|Q86Y42|Q8IVJ4|Q8IVL4|Q8NEZ7|Q96AJ3	Missense_Mutation	SNP	ENST00000296666.8	hg19	CCDS4143.1	.	.	.	.	.	.	.	.	.	.	G	16.96	3.265327	0.59431	.	.	ENSG00000164244	ENST00000296666;ENST00000442138;ENST00000330542;ENST00000414018;ENST00000512635;ENST00000512535	.	.	.	5.06	5.06	0.68205	.	0.174179	0.49916	D	0.000122	T	0.41926	0.1180	L	0.31207	0.915	0.53005	D	0.999966	B;P	0.42375	0.214;0.778	B;B	0.37989	0.052;0.262	T	0.29971	-0.9994	9	0.30078	T	0.28	-20.0859	17.5874	0.87986	0.0:0.0:1.0:0.0	.	132;132	Q96M27;Q96M27-5	PRRC1_HUMAN;.	A	132	.	ENSP00000296666:G132A	G	+	2	0	PRRC1	126888413	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.592000	0.67543	2.632000	0.89209	0.655000	0.94253	GGA	.	.	.	none		0.507	PRRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250971.3	NM_130809	
MATR3	9782	hgsc.bcm.edu	37	5	138643239	138643239	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr5:138643239G>A	ENST00000394805.3	+	2	470	c.135G>A	c.(133-135)atG>atA	p.M45I	MATR3_ENST00000361059.2_Missense_Mutation_p.M45I|MATR3_ENST00000503811.1_Intron|MATR3_ENST00000509990.1_Missense_Mutation_p.M45I|MATR3_ENST00000510056.1_Missense_Mutation_p.M45I|MATR3_ENST00000502929.1_Missense_Mutation_p.M45I|MATR3_ENST00000502499.1_Intron|MATR3_ENST00000504203.1_Intron|MATR3_ENST00000394800.2_Missense_Mutation_p.M45I	NM_001194955.1|NM_018834.5	NP_001181884.1|NP_061322.2	P43243	MATR3_HUMAN	matrin 3	45					cell death (GO:0008219)	membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|kidney(4)|large_intestine(6)|lung(9)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	29			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TTGGAAGGATGAACCAGGGTA	0.488																																					p.M45I		Atlas-SNP	.											.	MATR3	85	.	0			c.G135A						PASS	.						144.0	135.0	138.0					5																	138643239		2203	4300	6503	SO:0001583	missense	9782	exon2			AAGGATGAACCAG	M63483	CCDS4210.1, CCDS54908.1, CCDS75316.1	5q31.3	2010-08-12			ENSG00000015479	ENSG00000015479			6912	protein-coding gene	gene with protein product		164015	"""myopathy, distal 2"""	MPD2		2033075, 19344878	Standard	NM_018834		Approved	KIAA0723, MGC9105, VCPDM	uc003ldx.3	P43243	OTTHUMG00000129229	ENST00000394805.3:c.135G>A	chr5.hg19:g.138643239G>A	ENSP00000378284:p.Met45Ile	210.0	0.0	.		198.0	84.0	.	NM_018834	B7ZAV5|D3DQC3|Q9UHW0|Q9UQ27	Missense_Mutation	SNP	ENST00000394805.3	hg19	CCDS4210.1	.	.	.	.	.	.	.	.	.	.	G	14.19	2.461853	0.43736	.	.	ENSG00000015479	ENST00000509990;ENST00000361059;ENST00000514694;ENST00000502929;ENST00000394800;ENST00000505016;ENST00000502394;ENST00000394805;ENST00000504045;ENST00000510056;ENST00000508689;ENST00000514488;ENST00000503340;ENST00000504023	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.80480	-1.38;-1.38;-1.38;-1.38;-1.38;-1.38;-1.38;-1.38;-1.38;-1.38;-1.38;-1.38;-1.38;-1.38	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	T	0.81044	0.4741	N	0.14661	0.345	0.51233	D	0.999917	P;B;P	0.45126	0.851;0.018;0.851	P;B;P	0.55391	0.775;0.131;0.775	T	0.83121	-0.0118	10	0.72032	D	0.01	-7.6365	20.4366	0.99092	0.0:0.0:1.0:0.0	.	45;45;45	D6REM6;A8MXP9;P43243	.;.;MATR3_HUMAN	I	45	ENSP00000423533:M45I;ENSP00000354346:M45I;ENSP00000422233:M45I;ENSP00000422319:M45I;ENSP00000378279:M45I;ENSP00000424431:M45I;ENSP00000427168:M45I;ENSP00000378284:M45I;ENSP00000423290:M45I;ENSP00000426743:M45I;ENSP00000422137:M45I;ENSP00000426801:M45I;ENSP00000422590:M45I;ENSP00000421145:M45I	ENSP00000354346:M45I	M	+	3	0	MATR3	138671138	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.685000	0.74543	2.843000	0.97960	0.585000	0.79938	ATG	.	.	.	none		0.488	MATR3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251324.2	NM_018834	
GRPEL2	134266	hgsc.bcm.edu	37	5	148730494	148730494	+	Silent	SNP	C	C	T			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr5:148730494C>T	ENST00000329271.3	+	4	437	c.327C>T	c.(325-327)ttC>ttT	p.F109F	GRPEL2-AS1_ENST00000521295.1_RNA|GRPEL2_ENST00000416916.2_Missense_Mutation_p.S82F|GRPEL2_ENST00000507562.1_3'UTR	NM_152407.3	NP_689620.2	Q8TAA5	GRPE2_HUMAN	GrpE-like 2, mitochondrial (E. coli)	109					cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)	adenyl-nucleotide exchange factor activity (GO:0000774)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCAGAGTTTCTGTAAGGACT	0.478																																					p.F109F		Atlas-SNP	.											.	GRPEL2	18	.	0			c.C327T						PASS	.						90.0	99.0	96.0					5																	148730494		2203	4300	6503	SO:0001819	synonymous_variant	134266	exon4			GAGTTTCTGTAAG	AL832325	CCDS4295.1	5q33.1	2008-02-05			ENSG00000164284	ENSG00000164284			21060	protein-coding gene	gene with protein product							Standard	NM_152407		Approved	DKFZp451C205, Mt-GrpE#2, FLJ23713	uc003lqj.3	Q8TAA5	OTTHUMG00000130048	ENST00000329271.3:c.327C>T	chr5.hg19:g.148730494C>T		69.0	0.0	.		81.0	20.0	.	NM_152407	B4DFA6|Q49AJ6	Silent	SNP	ENST00000329271.3	hg19	CCDS4295.1	.	.	.	.	.	.	.	.	.	.	C	19.97	3.925419	0.73213	.	.	ENSG00000164284	ENST00000416916	.	.	.	6.06	4.27	0.50696	.	.	.	.	.	T	0.26882	0.0658	.	.	.	0.29129	N	0.879743	B	0.23249	0.082	B	0.22386	0.039	T	0.20739	-1.0266	6	.	.	.	-1.559	7.4128	0.27027	0.1374:0.7272:0.0:0.1354	.	82	B4DFA6	.	F	82	.	.	S	+	2	0	GRPEL2	148710687	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.587000	0.36622	0.866000	0.35629	0.655000	0.94253	TCT	.	.	.	none		0.478	GRPEL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252327.1	NM_152407	
MDC1	9656	hgsc.bcm.edu	37	6	30681013	30681013	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr6:30681013C>A	ENST00000376406.3	-	5	1353	c.706G>T	c.(706-708)Gct>Tct	p.A236S	MDC1-AS1_ENST00000442150.1_RNA|MDC1_ENST00000494654.1_5'Flank|MDC1_ENST00000376405.2_Missense_Mutation_p.A236S	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	236	Required for nuclear localization (NLS1).				DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)			breast(2)|kidney(1)|ovary(1)	4						CTTCTGGCAGCTGAGGAGGCC	0.537								Other conserved DNA damage response genes																													p.A236S		Atlas-SNP	.											.	MDC1	218	.	0			c.G706T						PASS	.						90.0	99.0	96.0					6																	30681013		1509	2708	4217	SO:0001583	missense	9656	exon5			TGGCAGCTGAGGA	D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.706G>T	chr6.hg19:g.30681013C>A	ENSP00000365588:p.Ala236Ser	126.0	0.0	.		126.0	7.0	.	NM_014641	A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Missense_Mutation	SNP	ENST00000376406.3	hg19	CCDS34384.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.58|10.58	1.390558|1.390558	0.25118|0.25118	.|.	.|.	ENSG00000137337|ENSG00000137337	ENST00000376406;ENST00000376405;ENST00000429610;ENST00000422104;ENST00000435797|ENST00000452213	T;T|.	0.04119|.	3.79;3.7|.	5.31|5.31	-0.775|-0.775	0.10988|0.10988	.|.	0.429453|.	0.17269|.	N|.	0.180468|.	T|T	0.08802|0.08802	0.0218|0.0218	L|L	0.35723|0.35723	1.085|1.085	0.09310|0.09310	N|N	1|1	P;B;B|.	0.36392|.	0.551;0.129;0.261|.	B;B;B|.	0.31751|.	0.135;0.082;0.063|.	T|T	0.35624|0.35624	-0.9781|-0.9781	10|6	0.41790|0.30854	T|T	0.15|0.27	-1.711|-1.711	0.5485|0.5485	0.00658|0.00658	0.2846:0.3351:0.1383:0.242|0.2846:0.3351:0.1383:0.242	.|.	236;108;236|.	Q14676-2;B4DYH4;Q14676|.	.;.;MDC1_HUMAN|.	S|I	236;236;236;108;236|235	ENSP00000365588:A236S;ENSP00000365587:A236S|.	ENSP00000365587:A236S|ENSP00000404936:S235I	A|S	-|-	1|2	0|0	MDC1|MDC1	30788992|30788992	0.001000|0.001000	0.12720|0.12720	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	0.005000|0.005000	0.13129|0.13129	-0.368000|-0.368000	0.08040|0.08040	-0.844000|-0.844000	0.03045|0.03045	GCT|AGC	.	.	.	none		0.537	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076103.1	NM_014641	
TCP11	6954	hgsc.bcm.edu	37	6	35086064	35086064	+	Silent	SNP	T	T	G			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr6:35086064T>G	ENST00000512012.1	-	9	1650	c.1494A>C	c.(1492-1494)acA>acC	p.T498T	TCP11_ENST00000244645.3_Silent_p.T436T|TCP11_ENST00000373974.4_Silent_p.T465T|TCP11_ENST00000412155.2_Silent_p.T460T|TCP11_ENST00000418521.2_Silent_p.T435T|TCP11_ENST00000373979.2_Silent_p.T436T|TCP11_ENST00000444780.2_Silent_p.T506T|TCP11_ENST00000311875.5_Silent_p.T511T			Q8WWU5	TCP11_HUMAN	t-complex 11, testis-specific	498					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)				breast(1)|kidney(5)|large_intestine(3)|lung(10)|ovary(3)|prostate(1)|skin(4)	27						ACTCCACTTTTGTTTCCAGTG	0.498																																					p.T511T		Atlas-SNP	.											.	TCP11	94	.	0			c.A1533C						PASS	.						133.0	135.0	134.0					6																	35086064		2203	4300	6503	SO:0001819	synonymous_variant	6954	exon10			CACTTTTGTTTCC		CCDS4799.1, CCDS47413.1, CCDS59015.1, CCDS59016.1, CCDS59017.1, CCDS59018.1	6p21.31	2012-09-20	2012-09-20		ENSG00000124678	ENSG00000124678			11658	protein-coding gene	gene with protein product	"""fertilization-promoting peptide receptor"""	186982	"""t-complex 11 (a murine tcp homolog)"", ""t-complex 11 homolog (mouse)"""	D6S230E		1427894, 11756566, 21597245	Standard	NM_001093728		Approved	KIAA0229, FPPR	uc003okd.2	Q8WWU5	OTTHUMG00000014560	ENST00000512012.1:c.1494A>C	chr6.hg19:g.35086064T>G		179.0	0.0	.		202.0	87.0	.	NM_001093728	B2RCE9|B3KQ27|B7Z7B5|B7Z7G1|B7Z7H4|B7Z7S8|E7EP29|J3KNG1|Q8NF85|Q9NQZ9|Q9NR39	Silent	SNP	ENST00000512012.1	hg19		.	.	.	.	.	.	.	.	.	.	T	11.91	1.779912	0.31502	.	.	ENSG00000124678	ENST00000502480	.	.	.	5.32	-1.75	0.08031	.	.	.	.	.	T	0.28200	0.0696	.	.	.	0.38093	D	0.937032	.	.	.	.	.	.	T	0.22765	-1.0207	4	.	.	.	-4.2485	6.0586	0.19824	0.0:0.1544:0.2928:0.5527	.	.	.	.	Q	240	.	.	K	-	1	0	TCP11	35194042	0.000000	0.05858	0.064000	0.19789	0.809000	0.45718	-1.209000	0.03002	-0.281000	0.09141	0.460000	0.39030	AAA	.	.	.	none		0.498	TCP11-014	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000370354.1	NM_001093728	
KLC4	89953	hgsc.bcm.edu	37	6	43041648	43041648	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr6:43041648T>C	ENST00000394056.2	+	16	2249	c.1754T>C	c.(1753-1755)aTg>aCg	p.M585T	PTK7_ENST00000230419.4_5'Flank|KLC4_ENST00000453940.2_Missense_Mutation_p.M508T|KLC4_ENST00000479388.1_Missense_Mutation_p.M585T|PTK7_ENST00000349241.2_5'Flank|RP11-387M24.5_ENST00000606123.1_RNA|PTK7_ENST00000352931.2_5'Flank|KLC4_ENST00000347162.5_Missense_Mutation_p.M585T|PTK7_ENST00000481273.1_5'Flank|KLC4_ENST00000394058.1_Missense_Mutation_p.M585T|PTK7_ENST00000345201.2_5'Flank|PTK7_ENST00000471863.1_5'Flank|PTK7_ENST00000476760.1_5'Flank|KLC4_ENST00000259708.3_Missense_Mutation_p.M603T			Q9NSK0	KLC4_HUMAN	kinesin light chain 4	585						cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)			endometrium(2)|large_intestine(7)|lung(5)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(4)	23			all cancers(41;0.00169)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0376)|KIRC - Kidney renal clear cell carcinoma(2;0.0453)			AGCAGCAACATGAAGCGAGCA	0.537																																					p.M603T		Atlas-SNP	.											.	KLC4	89	.	0			c.T1808C						PASS	.						138.0	119.0	125.0					6																	43041648		2203	4300	6503	SO:0001583	missense	89953	exon15			GCAACATGAAGCG	AK055293	CCDS4882.1, CCDS4883.1, CCDS47429.1, CCDS75459.1	6p21.1	2013-01-10	2005-09-13	2005-09-13	ENSG00000137171	ENSG00000137171		"""Tetratricopeptide (TTC) repeat domain containing"""	21624	protein-coding gene	gene with protein product			"""kinesin-like 8"""	KNSL8			Standard	NM_001289034		Approved	bA387M24.3	uc003otw.1	Q9NSK0	OTTHUMG00000014720	ENST00000394056.2:c.1754T>C	chr6.hg19:g.43041648T>C	ENSP00000377620:p.Met585Thr	149.0	0.0	.		128.0	40.0	.	NM_201523	B3KNY4|B3KPI3|B3KSQ3|B4DME9|Q66K28|Q96EG6	Missense_Mutation	SNP	ENST00000394056.2	hg19	CCDS4883.1	.	.	.	.	.	.	.	.	.	.	T	15.14	2.745697	0.49151	.	.	ENSG00000137171	ENST00000347162;ENST00000453940;ENST00000259708;ENST00000479388;ENST00000394056;ENST00000394058	D;D;D;D;D;D	0.85088	-1.86;-1.94;-1.87;-1.86;-1.86;-1.86	5.44	5.44	0.79542	.	0.000000	0.64402	D	0.000001	D	0.85141	0.5629	M	0.73217	2.22	0.53688	D	0.999979	P;D;P	0.53462	0.791;0.96;0.717	B;P;P	0.61397	0.212;0.888;0.599	D	0.83770	0.0219	10	0.11794	T	0.64	-11.1696	11.8821	0.52581	0.0:0.0:0.0:1.0	.	508;603;585	B4DME9;Q9NSK0-3;Q9NSK0	.;.;KLC4_HUMAN	T	585;508;603;585;585;585	ENSP00000340221:M585T;ENSP00000395806:M508T;ENSP00000259708:M603T;ENSP00000418031:M585T;ENSP00000377620:M585T;ENSP00000377622:M585T	ENSP00000259708:M603T	M	+	2	0	KLC4	43149626	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.911000	0.69939	2.054000	0.61138	0.459000	0.35465	ATG	.	.	.	none		0.537	KLC4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040579.2	NM_138343	
YIPF3	25844	hgsc.bcm.edu	37	6	43480515	43480515	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr6:43480515A>G	ENST00000372422.2	-	7	946	c.764T>C	c.(763-765)cTg>cCg	p.L255P	YIPF3_ENST00000506469.1_Missense_Mutation_p.L261P|LRRC73_ENST00000372441.1_5'Flank	NM_015388.3	NP_056203.2	Q9GZM5	YIPF3_HUMAN	Yip1 domain family, member 3	255					cell differentiation (GO:0030154)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|transport vesicle (GO:0030133)				large_intestine(2)|lung(4)|pancreas(1)|prostate(1)|skin(1)	9	all_cancers(18;3.79e-05)|Lung NSC(15;0.00217)|all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00736)|OV - Ovarian serous cystadenocarcinoma(102;0.0711)			CAGTGTGGACAGTCCACCCAC	0.567																																					p.L255P		Atlas-SNP	.											.	YIPF3	20	.	0			c.T764C						PASS	.						89.0	76.0	81.0					6																	43480515		2203	4300	6503	SO:0001583	missense	25844	exon7			GTGGACAGTCCAC	AK000946	CCDS4899.1	6p21.1	2009-10-06	2005-07-04	2005-07-04	ENSG00000137207	ENSG00000137207		"""Yip1 domain family"""	21023	protein-coding gene	gene with protein product		609775	"""chromosome 6 open reading frame 109"""	C6orf109			Standard	NM_015388		Approved	DKFZp566C243, KLIP1, dJ337H4.3, FinGER3	uc003ovl.2	Q9GZM5	OTTHUMG00000014738	ENST00000372422.2:c.764T>C	chr6.hg19:g.43480515A>G	ENSP00000361499:p.Leu255Pro	165.0	0.0	.		189.0	75.0	.	NM_015388	Q5JTD2|Q6FI85|Q8NI57|Q9NWE3|Q9Y3U9	Missense_Mutation	SNP	ENST00000372422.2	hg19	CCDS4899.1	.	.	.	.	.	.	.	.	.	.	A	17.50	3.404720	0.62288	.	.	ENSG00000137207	ENST00000372422;ENST00000506469;ENST00000503972	T;T;T	0.53857	0.61;0.6;0.71	5.27	5.27	0.74061	.	0.000000	0.64402	D	0.000001	T	0.58680	0.2139	L	0.49126	1.545	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.87578	0.998;0.997;0.998	T	0.59653	-0.7414	10	0.41790	T	0.15	-11.2654	15.19	0.73035	1.0:0.0:0.0:0.0	.	261;220;255	E7EQR8;Q5JTD5;Q9GZM5	.;.;YIPF3_HUMAN	P	255;261;221	ENSP00000361499:L255P;ENSP00000425494:L261P;ENSP00000421461:L221P	ENSP00000361499:L255P	L	-	2	0	YIPF3	43588493	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	8.982000	0.93471	1.996000	0.58369	0.460000	0.39030	CTG	.	.	.	none		0.567	YIPF3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040639.2	NM_015388	
SNAP91	9892	hgsc.bcm.edu	37	6	84371294	84371294	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr6:84371294A>T	ENST00000439399.2	-	5	695	c.379T>A	c.(379-381)Tat>Aat	p.Y127N	SNAP91_ENST00000195649.6_Missense_Mutation_p.Y127N|SNAP91_ENST00000520302.1_Missense_Mutation_p.Y127N|SNAP91_ENST00000369694.2_Missense_Mutation_p.Y127N|SNAP91_ENST00000521485.1_Missense_Mutation_p.Y127N|SNAP91_ENST00000428679.2_Missense_Mutation_p.Y127N|SNAP91_ENST00000437520.1_Missense_Mutation_p.Y127N|SNAP91_ENST00000521743.1_Missense_Mutation_p.Y127N|SNAP91_ENST00000520213.1_Missense_Mutation_p.Y127N	NM_014841.2	NP_055656.1	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa	127	ENTH. {ECO:0000255|PROSITE- ProRule:PRU00243}.				clathrin coat assembly (GO:0048268)|protein transport (GO:0015031)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(22)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		TATCTACTATAGCGCCTTATG	0.328																																					p.Y127N		Atlas-SNP	.											.	SNAP91	199	.	0			c.T379A						PASS	.						56.0	54.0	54.0					6																	84371294		1805	4074	5879	SO:0001583	missense	9892	exon5			TACTATAGCGCCT	AB014556	CCDS47455.1, CCDS56437.1, CCDS56438.1	6q15	2012-12-07	2012-12-07		ENSG00000065609	ENSG00000065609			14986	protein-coding gene	gene with protein product		607923	"""synaptosomal-associated protein, 91 kDa (mouse) homolog"", ""synaptosomal-associated protein, 91kDa homolog (mouse)"""			9734811, 12493563, 10436022	Standard	NM_014841		Approved	KIAA0656, AP180, CALM	uc003pka.3	O60641	OTTHUMG00000015114	ENST00000439399.2:c.379T>A	chr6.hg19:g.84371294A>T	ENSP00000400459:p.Tyr127Asn	95.0	0.0	.		100.0	59.0	.	NM_001242794	A8K0L7|E5RI02|Q5JX13|Q68DL9|Q6P9D3|Q9NTY7	Missense_Mutation	SNP	ENST00000439399.2	hg19	CCDS47455.1	.	.	.	.	.	.	.	.	.	.	A	24.6	4.551977	0.86127	.	.	ENSG00000065609	ENST00000521485;ENST00000369694;ENST00000439399;ENST00000195649;ENST00000428679;ENST00000437520;ENST00000520302;ENST00000521743;ENST00000520213;ENST00000521931;ENST00000519779;ENST00000518309;ENST00000369690	T;T;T;T;T;T;T;T;T;T;T;T;T	0.72725	-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68	5.13	5.13	0.70059	ENTH/VHS (2);ANTH (1);Epsin-like, N-terminal (2);	0.000000	0.85682	D	0.000000	D	0.87358	0.6157	H	0.96547	3.84	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.999;0.996;0.999	D	0.91513	0.5228	10	0.87932	D	0	-8.3087	15.2297	0.73378	1.0:0.0:0.0:0.0	.	127;127;127;127	O60641-3;E5RI02;O60641;E1P549	.;.;AP180_HUMAN;.	N	127	ENSP00000429776:Y127N;ENSP00000358708:Y127N;ENSP00000400459:Y127N;ENSP00000195649:Y127N;ENSP00000412492:Y127N;ENSP00000413277:Y127N;ENSP00000428511:Y127N;ENSP00000428215:Y127N;ENSP00000428026:Y127N;ENSP00000430071:Y127N;ENSP00000429429:Y127N;ENSP00000430441:Y127N;ENSP00000358704:Y127N	ENSP00000195649:Y127N	Y	-	1	0	SNAP91	84428013	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.210000	0.95106	2.056000	0.61249	0.460000	0.39030	TAT	.	.	.	none		0.328	SNAP91-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000375296.1		
SPACA1	81833	hgsc.bcm.edu	37	6	88775941	88775941	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr6:88775941C>A	ENST00000237201.1	+	7	890	c.773C>A	c.(772-774)cCt>cAt	p.P258H	SPACA1_ENST00000462690.1_3'UTR	NM_030960.2	NP_112222.1	Q9HBV2	SACA1_HUMAN	sperm acrosome associated 1	258					acrosome assembly (GO:0001675)	acrosomal membrane (GO:0002080)|integral component of membrane (GO:0016021)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(12)|skin(1)|upper_aerodigestive_tract(2)	20		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.11)		GCCTCTACACCTGAGGTACAA	0.413																																					p.P258H		Atlas-SNP	.											.	SPACA1	49	.	0			c.C773A						PASS	.						100.0	109.0	106.0					6																	88775941		2203	4300	6503	SO:0001583	missense	81833	exon7			CTACACCTGAGGT	AF203447	CCDS5014.1	6q15	2012-09-20			ENSG00000118434	ENSG00000118434			14967	protein-coding gene	gene with protein product		612739					Standard	NM_030960		Approved	SAMP32	uc003pmn.3	Q9HBV2	OTTHUMG00000015183	ENST00000237201.1:c.773C>A	chr6.hg19:g.88775941C>A	ENSP00000237201:p.Pro258His	67.0	0.0	.		39.0	14.0	.	NM_030960		Missense_Mutation	SNP	ENST00000237201.1	hg19	CCDS5014.1	.	.	.	.	.	.	.	.	.	.	C	11.76	1.734402	0.30774	.	.	ENSG00000118434	ENST00000237201	T	0.30448	1.53	4.81	4.81	0.61882	.	0.410909	0.23356	N	0.049061	T	0.16171	0.0389	N	0.22421	0.69	0.09310	N	0.999999	P	0.49447	0.924	P	0.47941	0.562	T	0.03545	-1.1026	10	0.66056	D	0.02	-5.1836	13.254	0.60068	0.0:1.0:0.0:0.0	.	258	Q9HBV2	SACA1_HUMAN	H	258	ENSP00000237201:P258H	ENSP00000237201:P258H	P	+	2	0	SPACA1	88832660	0.530000	0.26330	0.533000	0.28001	0.013000	0.08279	1.999000	0.40806	2.507000	0.84556	0.467000	0.42956	CCT	.	.	.	none		0.413	SPACA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041459.1		
HACE1	57531	hgsc.bcm.edu	37	6	105298839	105298839	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr6:105298839A>T	ENST00000262903.4	-	3	440	c.164T>A	c.(163-165)tTt>tAt	p.F55Y	HACE1_ENST00000369125.2_Missense_Mutation_p.F55Y	NM_020771.3	NP_065822.2	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1	55					cell cycle (GO:0007049)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|Rac protein signal transduction (GO:0016601)|regulation of cell migration (GO:0030334)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Rab GTPase binding (GO:0017137)|Rac GTPase binding (GO:0048365)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	44		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		ATTGACATCAAATTTTGAATT	0.299																																					p.F55Y		Atlas-SNP	.											.	HACE1	96	.	0			c.T164A						PASS	.						152.0	157.0	156.0					6																	105298839		2203	4300	6503	SO:0001583	missense	57531	exon3			ACATCAAATTTTG	BC034982	CCDS5050.1	6q21	2013-01-10	2012-02-23		ENSG00000085382	ENSG00000085382		"""Ankyrin repeat domain containing"""	21033	protein-coding gene	gene with protein product		610876				10718198	Standard	NM_020771		Approved	KIAA1320	uc003pqu.1	Q8IYU2	OTTHUMG00000015287	ENST00000262903.4:c.164T>A	chr6.hg19:g.105298839A>T	ENSP00000262903:p.Phe55Tyr	128.0	0.0	.		105.0	61.0	.	NM_020771	A8K6U5|B3KY89|B4DFM6|B4DTQ4|B7Z9X6|E9PGP0|Q5VU99|Q5VUA0|Q8ND12|Q9P2M6	Missense_Mutation	SNP	ENST00000262903.4	hg19	CCDS5050.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.488630	0.84854	.	.	ENSG00000085382	ENST00000262903;ENST00000369125;ENST00000519645;ENST00000524020	T;T;T;T	0.72282	-0.64;-0.64;-0.09;1.51	5.97	5.97	0.96955	Ankyrin repeat-containing domain (2);	0.000000	0.85682	D	0.000000	T	0.68540	0.3012	N	0.21545	0.675	0.80722	D	1	D;D	0.53885	0.963;0.963	D;D	0.69824	0.966;0.966	T	0.73538	-0.3951	10	0.51188	T	0.08	.	15.4434	0.75208	1.0:0.0:0.0:0.0	.	55;55	E9PGP0;Q8IYU2	.;HACE1_HUMAN	Y	55;55;55;21	ENSP00000262903:F55Y;ENSP00000358121:F55Y;ENSP00000429765:F55Y;ENSP00000427901:F21Y	ENSP00000262903:F55Y	F	-	2	0	HACE1	105405532	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.328000	0.90014	2.288000	0.76882	0.533000	0.62120	TTT	.	.	.	none		0.299	HACE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041643.2	XM_045095	
SOBP	55084	hgsc.bcm.edu	37	6	107827527	107827527	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr6:107827527C>A	ENST00000317357.5	+	3	976	c.317C>A	c.(316-318)gCc>gAc	p.A106D		NM_018013.3	NP_060483.3			sine oculis binding protein homolog (Drosophila)											endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	26		all_cancers(87;5.26e-06)|Acute lymphoblastic leukemia(125;2.87e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.00193)|Colorectal(196;0.156)		BRCA - Breast invasive adenocarcinoma(108;0.026)|all cancers(137;0.087)|Epithelial(106;0.104)|OV - Ovarian serous cystadenocarcinoma(136;0.154)		TCAGGGCTTGCCACTGGAAAT	0.413																																					p.A106D		Atlas-SNP	.											.	SOBP	53	.	0			c.C317A						PASS	.						193.0	185.0	188.0					6																	107827527		1908	4136	6044	SO:0001583	missense	55084	exon3			GGCTTGCCACTGG	AK001021	CCDS43488.1	6q21	2007-03-15			ENSG00000112320	ENSG00000112320			29256	protein-coding gene	gene with protein product		613667					Standard	NM_018013		Approved	FLJ10159	uc003prx.3	A7XYQ1	OTTHUMG00000015312	ENST00000317357.5:c.317C>A	chr6.hg19:g.107827527C>A	ENSP00000318900:p.Ala106Asp	96.0	0.0	.		89.0	16.0	.	NM_018013		Missense_Mutation	SNP	ENST00000317357.5	hg19	CCDS43488.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.145200	0.77888	.	.	ENSG00000112320	ENST00000317357	T	0.11277	2.79	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.07413	0.0187	N	0.08118	0	0.58432	D	0.999996	D	0.53312	0.959	P	0.52957	0.714	T	0.40720	-0.9548	10	0.66056	D	0.02	-11.9919	19.1981	0.93698	0.0:1.0:0.0:0.0	.	106	A7XYQ1	SOBP_HUMAN	D	106	ENSP00000318900:A106D	ENSP00000318900:A106D	A	+	2	0	SOBP	107934220	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.422000	0.66453	2.615000	0.88500	0.655000	0.94253	GCC	.	.	.	none		0.413	SOBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041693.2	NM_018013	
NUS1	116150	hgsc.bcm.edu	37	6	118015319	118015319	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr6:118015319G>A	ENST00000368494.3	+	3	836	c.667G>A	c.(667-669)Gta>Ata	p.V223I		NM_138459.3	NP_612468.1	Q96E22	NGBR_HUMAN	nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae)	223					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|intracellular cholesterol transport (GO:0032367)|protein glycosylation (GO:0006486)|sterol homeostasis (GO:0055092)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity, transferring alkyl or aryl (other than methyl) groups (GO:0016765)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(1)|prostate(2)	8		all_cancers(87;0.0395)|all_epithelial(87;0.0301)		GBM - Glioblastoma multiforme(226;0.02)|OV - Ovarian serous cystadenocarcinoma(136;0.115)|all cancers(137;0.146)		AGATTTGGATGTAGATACGTT	0.373																																					p.V223I		Atlas-SNP	.											.	NUS1	15	.	0			c.G667A						PASS	.						89.0	91.0	90.0					6																	118015319		2203	4300	6503	SO:0001583	missense	116150	exon3			TTGGATGTAGATA	BC013026	CCDS5118.1	6q22.1	2012-12-13	2006-11-24	2006-11-24	ENSG00000153989	ENSG00000153989			21042	protein-coding gene	gene with protein product	"""Nogo-B receptor"", ""transport and golgi organization 14 homolog (Drosophila)"""	610463	"""chromosome 6 open reading frame 68"""	C6orf68			Standard	NM_138459		Approved	MGC7199, NgBR, TANGO14	uc003pxw.3	Q96E22	OTTHUMG00000015458	ENST00000368494.3:c.667G>A	chr6.hg19:g.118015319G>A	ENSP00000357480:p.Val223Ile	125.0	0.0	.		87.0	50.0	.	NM_138459	B2RWQ4|O00251	Missense_Mutation	SNP	ENST00000368494.3	hg19	CCDS5118.1	.	.	.	.	.	.	.	.	.	.	G	14.49	2.550972	0.45383	.	.	ENSG00000153989	ENST00000368494	T	0.29397	1.57	5.1	5.1	0.69264	.	0.115570	0.64402	D	0.000015	T	0.16128	0.0388	L	0.47078	1.49	0.58432	D	0.999992	P	0.36086	0.536	B	0.34873	0.191	T	0.02713	-1.1120	10	0.37606	T	0.19	-0.3662	13.2505	0.60050	0.0769:0.0:0.9231:0.0	.	223	Q96E22	NGBR_HUMAN	I	223	ENSP00000357480:V223I	ENSP00000357480:V223I	V	+	1	0	NUS1	118122012	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.487000	0.60293	2.537000	0.85549	0.650000	0.86243	GTA	.	.	.	none		0.373	NUS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041989.1	NM_138459	
GPR126	57211	hgsc.bcm.edu	37	6	142691578	142691578	+	Silent	SNP	C	C	T			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr6:142691578C>T	ENST00000230173.6	+	4	1193	c.717C>T	c.(715-717)gtC>gtT	p.V239V	GPR126_ENST00000367609.3_Silent_p.V239V|GPR126_ENST00000545477.1_Intron|GPR126_ENST00000367608.2_Silent_p.V239V|GPR126_ENST00000296932.8_Silent_p.V239V	NM_020455.5	NP_065188	Q86SQ4	GP126_HUMAN	G protein-coupled receptor 126	239	Pentaxin.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(12)|lung(10)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36	Breast(32;0.176)			OV - Ovarian serous cystadenocarcinoma(155;9.33e-06)|GBM - Glioblastoma multiforme(68;0.00121)		CATTACCTGTCAAAGAAAAAG	0.353																																					p.V239V		Atlas-SNP	.											.	GPR126	192	.	0			c.C717T						PASS	.						64.0	63.0	63.0					6																	142691578		1828	4081	5909	SO:0001819	synonymous_variant	57211	exon4			ACCTGTCAAAGAA	AK027843	CCDS47489.1, CCDS47490.1, CCDS47491.1, CCDS55064.1	6q23.1-q24.3	2014-08-08			ENSG00000112414	ENSG00000112414		"""-"", ""GPCR / Class B : Orphans"""	13841	protein-coding gene	gene with protein product		612243				12565841	Standard	NM_001032395		Approved	FLJ14937	uc010khe.3	Q86SQ4	OTTHUMG00000015709	ENST00000230173.6:c.717C>T	chr6.hg19:g.142691578C>T		65.0	0.0	.		38.0	8.0	.	NM_198569	Q5TGN7|Q6DHZ4|Q6F3F5|Q6F3F6|Q6F3F7|Q6F3F8|Q6MZU7|Q8IXA4|Q8NC14|Q96JW0	Silent	SNP	ENST00000230173.6	hg19	CCDS47490.1																																																																																			.	.	.	none		0.353	GPR126-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000042487.2		
IGF2R	3482	hgsc.bcm.edu	37	6	160445676	160445676	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr6:160445676T>C	ENST00000356956.1	+	5	734	c.586T>C	c.(586-588)Tac>Cac	p.Y196H		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	196					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	TAGTGGTGCCTACTTGGTGGA	0.473																																					p.Y196H		Atlas-SNP	.											.	IGF2R	251	.	0			c.T586C						PASS	.						277.0	241.0	253.0					6																	160445676		2203	4300	6503	SO:0001583	missense	3482	exon5			GGTGCCTACTTGG	J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.586T>C	chr6.hg19:g.160445676T>C	ENSP00000349437:p.Tyr196His	198.0	0.0	.		172.0	47.0	.	NM_000876	Q7Z7G9|Q96PT5	Missense_Mutation	SNP	ENST00000356956.1	hg19	CCDS5273.1	.	.	.	.	.	.	.	.	.	.	T	16.39	3.109386	0.56398	.	.	ENSG00000197081	ENST00000356956	T	0.02682	4.2	5.47	5.47	0.80525	Mannose-6-phosphate receptor, binding (1);	0.232876	0.45361	D	0.000378	T	0.08891	0.0220	M	0.77103	2.36	0.39897	D	0.97384	D	0.89917	1.0	D	0.91635	0.999	T	0.21109	-1.0255	10	0.30854	T	0.27	-3.4455	15.5981	0.76602	0.0:0.0:0.0:1.0	.	196	P11717	MPRI_HUMAN	H	196	ENSP00000349437:Y196H	ENSP00000349437:Y196H	Y	+	1	0	IGF2R	160365666	1.000000	0.71417	0.672000	0.29872	0.761000	0.43186	4.495000	0.60353	2.077000	0.62373	0.374000	0.22700	TAC	.	.	.	none		0.473	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042931.1	NM_000876	
NEUROD6	63974	hgsc.bcm.edu	37	7	31378439	31378439	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr7:31378439T>A	ENST00000297142.3	-	2	766	c.444A>T	c.(442-444)gaA>gaT	p.E148D		NM_022728.2	NP_073565.2	Q96NK8	NDF6_HUMAN	neuronal differentiation 6	148					cell differentiation (GO:0030154)|dentate gyrus development (GO:0021542)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	32						TTCTCAGAATTTCAGAAAGTG	0.438																																					p.E148D		Atlas-SNP	.											.	NEUROD6	84	.	0			c.A444T						PASS	.						70.0	72.0	71.0					7																	31378439		2203	4300	6503	SO:0001583	missense	63974	exon2			CAGAATTTCAGAA	AF248954	CCDS5434.1	7p15.1	2013-05-21	2012-02-22		ENSG00000164600	ENSG00000164600		"""Basic helix-loop-helix proteins"""	13804	protein-coding gene	gene with protein product		611513	"""neurogenic differentiation 6"""			12357074	Standard	NM_022728		Approved	Atoh2, NEX1M, Math-2, bHLHa2, Nex1	uc003tch.4	Q96NK8	OTTHUMG00000022865	ENST00000297142.3:c.444A>T	chr7.hg19:g.31378439T>A	ENSP00000297142:p.Glu148Asp	81.0	0.0	.		96.0	36.0	.	NM_022728	Q548T9|Q9H3H6	Missense_Mutation	SNP	ENST00000297142.3	hg19	CCDS5434.1	.	.	.	.	.	.	.	.	.	.	T	14.63	2.594250	0.46214	.	.	ENSG00000164600	ENST00000297142	D	0.88509	-2.39	5.25	2.52	0.30459	Helix-loop-helix DNA-binding (3);	0.000000	0.85682	D	0.000000	D	0.85383	0.5684	N	0.05467	-0.045	0.53005	D	0.999961	D	0.58970	0.984	D	0.65443	0.935	D	0.83701	0.0182	10	0.39692	T	0.17	-17.2321	10.2375	0.43292	0.0:0.1596:0.0:0.8404	.	148	Q96NK8	NDF6_HUMAN	D	148	ENSP00000297142:E148D	ENSP00000297142:E148D	E	-	3	2	NEUROD6	31344964	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.915000	0.39976	0.841000	0.35020	0.528000	0.53228	GAA	.	.	.	none		0.438	NEUROD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215050.1	NM_022728	
CCDC129	223075	hgsc.bcm.edu	37	7	31682718	31682718	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr7:31682718C>A	ENST00000407970.3	+	11	1772	c.1734C>A	c.(1732-1734)gaC>gaA	p.D578E	CCDC129_ENST00000451887.2_Missense_Mutation_p.D604E|CCDC129_ENST00000319386.3_Missense_Mutation_p.D430E|CCDC129_ENST00000409210.1_Missense_Mutation_p.D486E	NM_001257967.1|NM_194300.3	NP_001244896.1|NP_919276.2	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	578										cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(31)	44						AAATGCAGGACAGTTTTGTGA	0.488																																					p.D604E		Atlas-SNP	.											.	CCDC129	127	.	0			c.C1812A						PASS	.						173.0	173.0	173.0					7																	31682718		2203	4300	6503	SO:0001583	missense	223075	exon11			GCAGGACAGTTTT	AK128026	CCDS5435.2, CCDS59050.1, CCDS75577.1	7p14.3	2006-08-21			ENSG00000180347	ENSG00000180347			27363	protein-coding gene	gene with protein product						14702039	Standard	NM_001257967		Approved	FLJ38344	uc011kad.1	Q6ZRS4	OTTHUMG00000128611	ENST00000407970.3:c.1734C>A	chr7.hg19:g.31682718C>A	ENSP00000384416:p.Asp578Glu	136.0	0.0	.		138.0	61.0	.	NM_001257968	A2RU17|B3KTI9|B4DHB0|B4E2R1|F5H3V5	Missense_Mutation	SNP	ENST00000407970.3	hg19	CCDS5435.2	.	.	.	.	.	.	.	.	.	.	C	14.17	2.456804	0.43634	.	.	ENSG00000180347	ENST00000319386;ENST00000407970;ENST00000451887;ENST00000538406;ENST00000409210	T;T;T;T	0.25414	1.8;2.12;2.1;1.86	5.93	-11.6	0.00059	.	0.467692	0.20346	N	0.094142	T	0.15219	0.0367	M	0.69823	2.125	0.09310	N	1	P;P;P;P	0.41450	0.75;0.565;0.565;0.734	B;B;B;B	0.39503	0.168;0.107;0.107;0.301	T	0.00216	-1.1910	10	0.38643	T	0.18	-37.2348	1.7051	0.02880	0.2799:0.2778:0.079:0.3633	.	604;588;578;430	F5H3V5;F5H2J8;Q6ZRS4;Q6ZRS4-2	.;.;CC129_HUMAN;.	E	430;578;604;588;486	ENSP00000313062:D430E;ENSP00000384416:D578E;ENSP00000395835:D604E;ENSP00000387214:D486E	ENSP00000313062:D430E	D	+	3	2	CCDC129	31649243	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.334000	0.02665	-2.216000	0.00732	-1.094000	0.02160	GAC	.	.	.	none		0.488	CCDC129-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318975.1	NM_194300	
HERPUD2	64224	hgsc.bcm.edu	37	7	35733937	35733937	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr7:35733937C>T	ENST00000396081.1	-	1	808	c.4G>A	c.(4-6)Gac>Aac	p.D2N	HERPUD2_ENST00000311350.3_Missense_Mutation_p.D2N|RP11-379H18.1_ENST00000605778.1_RNA	NM_022373.4	NP_071768.3	Q9BSE4	HERP2_HUMAN	HERPUD family member 2	2					response to unfolded protein (GO:0006986)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)				kidney(3)|large_intestine(5)|lung(6)|ovary(3)|prostate(1)	18						CCACTTTGGTCCATGGTGCCC	0.537																																					p.D2N		Atlas-SNP	.											.	HERPUD2	47	.	0			c.G4A						PASS	.						106.0	108.0	107.0					7																	35733937		2203	4300	6503	SO:0001583	missense	64224	exon2			TTTGGTCCATGGT	BC020264	CCDS5446.1	7p14.2	2006-03-20	2006-03-20		ENSG00000122557	ENSG00000122557			21915	protein-coding gene	gene with protein product	"""homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 2"""						Standard	NM_022373		Approved	FLJ22313	uc003tes.4	Q9BSE4	OTTHUMG00000128687	ENST00000396081.1:c.4G>A	chr7.hg19:g.35733937C>T	ENSP00000379390:p.Asp2Asn	156.0	0.0	.		166.0	62.0	.	NM_022373	A4D1Y8|Q9H6F9	Missense_Mutation	SNP	ENST00000396081.1	hg19	CCDS5446.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.779789	0.90195	.	.	ENSG00000122557	ENST00000396081;ENST00000311350;ENST00000438224;ENST00000413517;ENST00000427455	T;T;T;T;T	0.57436	1.52;1.52;1.21;1.55;0.4	3.53	3.53	0.40419	.	0.275735	0.39985	N	0.001216	T	0.57504	0.2058	L	0.50333	1.59	0.38724	D	0.953506	D	0.59767	0.986	P	0.55615	0.78	T	0.64275	-0.6446	10	0.72032	D	0.01	-3.5396	10.7536	0.46223	0.1906:0.8094:0.0:0.0	.	2	Q9BSE4	HERP2_HUMAN	N	2	ENSP00000379390:D2N;ENSP00000310729:D2N;ENSP00000415475:D2N;ENSP00000391015:D2N;ENSP00000412895:D2N	ENSP00000310729:D2N	D	-	1	0	HERPUD2	35700462	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	6.641000	0.74324	2.253000	0.74438	0.467000	0.42956	GAC	.	.	.	none		0.537	HERPUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250584.1	NM_022373	
PKD1L1	168507	hgsc.bcm.edu	37	7	47853600	47853600	+	Missense_Mutation	SNP	C	C	T	rs147316882		TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr7:47853600C>T	ENST00000289672.2	-	48	7152	c.7102G>A	c.(7102-7104)Gga>Aga	p.G2368R	C7orf69_ENST00000418326.2_Intron|C7orf69_ENST00000258776.4_Intron	NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	2368					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						CATTTTCCTCCAAGAGCTCCA	0.458																																					p.G2368R		Atlas-SNP	.											.	PKD1L1	328	.	0			c.G7102A						PASS	.	C	,ARG/GLY	0,4406		0,0,2203	73.0	68.0	70.0		,7102	3.5	0.6	7	dbSNP_134	70	1,8599	1.2+/-3.3	0,1,4299	no	intron,missense	C7orf69,PKD1L1	NM_025031.2,NM_138295.3	,125	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,probably-damaging	,2368/2850	47853600	1,13005	2203	4300	6503	SO:0001583	missense	168507	exon48			TTCCTCCAAGAGC	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.7102G>A	chr7.hg19:g.47853600C>T	ENSP00000289672:p.Gly2368Arg	39.0	0.0	.		51.0	26.0	.	NM_138295	Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	hg19	CCDS34633.1	.	.	.	.	.	.	.	.	.	.	C	15.23	2.772575	0.49680	0.0	1.16E-4	ENSG00000158683	ENST00000289672	T	0.19250	2.16	5.3	3.48	0.39840	.	0.260784	0.26903	N	0.021910	T	0.35393	0.0930	L	0.60455	1.87	0.80722	D	1	D	0.65815	0.995	P	0.62435	0.902	T	0.02813	-1.1107	10	0.49607	T	0.09	-7.9894	9.0941	0.36629	0.0:0.7697:0.148:0.0823	.	2368	Q8TDX9	PK1L1_HUMAN	R	2368	ENSP00000289672:G2368R	ENSP00000289672:G2368R	G	-	1	0	PKD1L1	47820125	0.492000	0.26027	0.605000	0.28930	0.632000	0.37999	1.534000	0.36051	0.604000	0.29930	-0.172000	0.13284	GGA	.	C|1.000;T|0.000	0.000	weak		0.458	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295	
VWC2	375567	hgsc.bcm.edu	37	7	49815193	49815193	+	Silent	SNP	C	C	T			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr7:49815193C>T	ENST00000340652.4	+	2	718	c.162C>T	c.(160-162)gaC>gaT	p.D54D		NM_198570.3	NP_940972.2	Q2TAL6	VWC2_HUMAN	von Willebrand factor C domain containing 2	54					negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of neuron differentiation (GO:0045666)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|basement membrane (GO:0005604)|cell junction (GO:0030054)|extracellular space (GO:0005615)|interstitial matrix (GO:0005614)|synapse (GO:0045202)				cervix(1)|endometrium(2)|large_intestine(1)|lung(3)|prostate(1)	8						CCTCTCGGGACGGCCCGGGGC	0.741																																					p.D54D		Atlas-SNP	.											.	VWC2	30	.	0			c.C162T						PASS	.						6.0	6.0	6.0					7																	49815193		2074	4046	6120	SO:0001819	synonymous_variant	375567	exon2			TCGGGACGGCCCG	AY358393	CCDS5508.1	7p12.3-p12.2	2007-07-19			ENSG00000188730	ENSG00000188730			30200	protein-coding gene	gene with protein product	"""brorin"", ""brain-specific chordin-like"""	611108				17400546	Standard	NM_198570		Approved	PSST739, UNQ739	uc003tot.1	Q2TAL6	OTTHUMG00000129265	ENST00000340652.4:c.162C>T	chr7.hg19:g.49815193C>T		5.0	0.0	.		8.0	7.0	.	NM_198570	Q6UXE2	Silent	SNP	ENST00000340652.4	hg19	CCDS5508.1																																																																																			.	.	.	none		0.741	VWC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251375.2	NM_198570	
POMZP3	22932	hgsc.bcm.edu	37	7	76240801	76240801	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr7:76240801G>T	ENST00000310842.4	-	6	1229	c.545C>A	c.(544-546)tCc>tAc	p.S182Y	UPK3B_ENST00000419923.2_Intron|AC004980.7_ENST00000418663.1_RNA|POMZP3_ENST00000275569.4_Intron|UPK3B_ENST00000443097.2_Intron	NM_012230.3	NP_036362.3	Q6PJE2	POZP3_HUMAN	POM121 and ZP3 fusion	182										kidney(3)|lung(2)	5		Myeloproliferative disorder(862;0.204)				AGCAGACGTGGACCACTGGCT	0.537																																					p.S182Y		Atlas-SNP	.											.	POMZP3	19	.	0			c.C545A						PASS	.						72.0	71.0	72.0					7																	76240801		2200	4279	6479	SO:0001583	missense	22932	exon6			GACGTGGACCACT	U10099	CCDS5590.1, CCDS43606.1	7q11.2	2010-06-24	2010-06-24		ENSG00000146707	ENSG00000146707			9203	protein-coding gene	gene with protein product	"""POM-ZP3 fusion protein"", ""POM121/ZP3 fusion protein"""	600587	"""POM (POM121 rat homolog) and ZP3 fusion"", ""POM (POM121 homolog, rat) and ZP3 fusion"""			7789967	Standard	NM_012230		Approved	POM-ZP3, POM121	uc003uft.3	Q6PJE2	OTTHUMG00000023514	ENST00000310842.4:c.545C>A	chr7.hg19:g.76240801G>T	ENSP00000309233:p.Ser182Tyr	373.0	1.0	.		382.0	118.0	.	NM_012230	F6STJ3|Q12903|Q9BWB4	Missense_Mutation	SNP	ENST00000310842.4	hg19	CCDS43606.1	.	.	.	.	.	.	.	.	.	.	N	8.381	0.837429	0.16891	.	.	ENSG00000146707	ENST00000310842	T	0.23950	1.88	0.786	-1.57	0.08506	.	3.392970	0.01303	U	0.010346	T	0.28134	0.0694	L	0.38175	1.15	0.09310	N	1	D	0.57257	0.979	P	0.50970	0.655	T	0.18241	-1.0343	10	0.87932	D	0	.	3.7228	0.08463	0.0:0.0:0.477:0.523	.	182	Q6PJE2	POZP3_HUMAN	Y	182	ENSP00000309233:S182Y	ENSP00000309233:S182Y	S	-	2	0	POMZP3	76078737	0.000000	0.05858	0.089000	0.20774	0.299000	0.27559	-0.671000	0.05250	-0.344000	0.08338	0.372000	0.22366	TCC	.	.	.	none		0.537	POMZP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341775.1	NM_012230	
PCLO	27445	hgsc.bcm.edu	37	7	82585266	82585266	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr7:82585266T>C	ENST00000333891.9	-	5	5340	c.5003A>G	c.(5002-5004)aAa>aGa	p.K1668R	PCLO_ENST00000423517.2_Missense_Mutation_p.K1668R	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CTCAATTGTTTTAAATCGGCG	0.368																																					p.K1668R		Atlas-SNP	.											.	PCLO	1506	.	0			c.A5003G						PASS	.						107.0	99.0	102.0					7																	82585266		1859	4098	5957	SO:0001583	missense	27445	exon5			ATTGTTTTAAATC	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.5003A>G	chr7.hg19:g.82585266T>C	ENSP00000334319:p.Lys1668Arg	92.0	0.0	.		99.0	44.0	.	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	hg19	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	T	7.727	0.698443	0.15106	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.26810	1.71;1.73	5.31	5.31	0.75309	.	.	.	.	.	T	0.35068	0.0919	M	0.74881	2.28	0.80722	D	1	P;P	0.45715	0.865;0.865	B;B	0.42555	0.391;0.391	T	0.36359	-0.9751	9	0.87932	D	0	.	15.2616	0.73628	0.0:0.0:0.0:1.0	.	1668;1668	Q9Y6V0-5;Q9Y6V0-6	.;.	R	1599;1668;1668	ENSP00000334319:K1668R;ENSP00000388393:K1668R	ENSP00000334319:K1668R	K	-	2	0	PCLO	82423202	1.000000	0.71417	0.847000	0.33407	0.907000	0.53573	5.048000	0.64238	2.005000	0.58758	0.528000	0.53228	AAA	.	.	.	none		0.368	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
PRKAR2B	5577	hgsc.bcm.edu	37	7	106799967	106799967	+	Nonsense_Mutation	SNP	T	T	A			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr7:106799967T>A	ENST00000265717.4	+	11	1456	c.1197T>A	c.(1195-1197)taT>taA	p.Y399*		NM_002736.2	NP_002727.2	P31323	KAP3_HUMAN	protein kinase, cAMP-dependent, regulatory, type II, beta	399					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fatty acid metabolic process (GO:0006631)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning (GO:0007612)|mitotic cell cycle (GO:0000278)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|ciliary base (GO:0097546)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|protein kinase A catalytic subunit binding (GO:0034236)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)	14						TCGCTACCTATGAAGAACAGT	0.388																																					p.Y399X		Atlas-SNP	.											.	PRKAR2B	34	.	0			c.T1197A						PASS	.						135.0	118.0	124.0					7																	106799967		2203	4300	6503	SO:0001587	stop_gained	5577	exon11			TACCTATGAAGAA		CCDS5740.1	7q22.3	2010-04-22			ENSG00000005249	ENSG00000005249	2.7.11.1		9392	protein-coding gene	gene with protein product		176912		PRKAR2		1358799	Standard	NM_002736		Approved		uc003vdx.3	P31323	OTTHUMG00000137418	ENST00000265717.4:c.1197T>A	chr7.hg19:g.106799967T>A	ENSP00000265717:p.Tyr399*	111.0	0.0	.		114.0	42.0	.	NM_002736	A4D0R9	Nonsense_Mutation	SNP	ENST00000265717.4	hg19	CCDS5740.1	.	.	.	.	.	.	.	.	.	.	T	19.41	3.821472	0.71028	.	.	ENSG00000005249	ENST00000265717;ENST00000543645;ENST00000539794	.	.	.	5.68	2.05	0.26809	.	0.110083	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.3785	9.0728	0.36502	0.0:0.277:0.0:0.723	.	.	.	.	X	399;399;386	.	ENSP00000265717:Y399X	Y	+	3	2	PRKAR2B	106587203	0.950000	0.32346	1.000000	0.80357	0.997000	0.91878	0.030000	0.13688	0.113000	0.18004	0.528000	0.53228	TAT	.	.	.	none		0.388	PRKAR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268386.1		
ADCK2	90956	hgsc.bcm.edu	37	7	140380887	140380887	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr7:140380887G>T	ENST00000072869.4	+	4	1433	c.1255G>T	c.(1255-1257)Gac>Tac	p.D419Y	ADCK2_ENST00000476491.1_Missense_Mutation_p.D419Y	NM_052853.3	NP_443085.2	Q7Z695	ADCK2_HUMAN	aarF domain containing kinase 2	419	Protein kinase.					integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			cervix(1)|kidney(2)|large_intestine(2)|lung(5)|prostate(1)|skin(4)	15	Melanoma(164;0.00956)					AATTCCCGTGGACTTGAAAAG	0.562																																					p.D419Y		Atlas-SNP	.											.	ADCK2	37	.	0			c.G1255T						PASS	.						137.0	114.0	122.0					7																	140380887		2203	4300	6503	SO:0001583	missense	90956	exon4			CCCGTGGACTTGA	AF131745	CCDS5861.1	7q34	2003-07-21			ENSG00000133597	ENSG00000133597			19039	protein-coding gene	gene with protein product							Standard	NM_052853		Approved	MGC20727	uc003vvy.1	Q7Z695	OTTHUMG00000157409	ENST00000072869.4:c.1255G>T	chr7.hg19:g.140380887G>T	ENSP00000072869:p.Asp419Tyr	278.0	0.0	.		287.0	122.0	.	NM_052853	Q96CN6|Q9Y6T5	Missense_Mutation	SNP	ENST00000072869.4	hg19	CCDS5861.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.78|14.78	2.638582|2.638582	0.47153|0.47153	.|.	.|.	ENSG00000133597|ENSG00000133597	ENST00000072869;ENST00000476491;ENST00000473512|ENST00000483369	T;T;T|.	0.12039|.	2.72;2.72;2.72|.	4.18|4.18	3.2|3.2	0.36748|0.36748	.|.	0.234009|.	0.34245|.	N|.	0.004140|.	T|T	0.55609|0.55609	0.1931|0.1931	M|M	0.70595|0.70595	2.14|2.14	0.19945|0.19945	N|N	0.999942|0.999942	D;D|.	0.54397|.	0.966;0.966|.	P;P|.	0.46718|.	0.525;0.525|.	T|T	0.46735|0.46735	-0.9170|-0.9170	10|5	0.66056|.	D|.	0.02|.	-50.6212|-50.6212	10.5732|10.5732	0.45212|0.45212	0.1074:0.0:0.8926:0.0|0.1074:0.0:0.8926:0.0	.|.	419;419|.	C9JE15;Q7Z695|.	.;ADCK2_HUMAN|.	Y|V	419;419;59|256	ENSP00000072869:D419Y;ENSP00000420512:D419Y;ENSP00000420288:D59Y|.	ENSP00000072869:D419Y|.	D|G	+|+	1|2	0|0	ADCK2|ADCK2	140027356|140027356	0.982000|0.982000	0.34865|0.34865	0.077000|0.077000	0.20336|0.20336	0.837000|0.837000	0.47467|0.47467	4.292000|4.292000	0.59031|0.59031	2.154000|2.154000	0.67381|0.67381	0.561000|0.561000	0.74099|0.74099	GAC|GGA	.	.	.	none		0.562	ADCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348734.1	NM_052853	
RNF19A	25897	hgsc.bcm.edu	37	8	101276971	101276971	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr8:101276971G>A	ENST00000519449.1	-	7	1550	c.1234C>T	c.(1234-1236)Cgg>Tgg	p.R412W	RNF19A_ENST00000341084.2_Missense_Mutation_p.R412W|RNF19A_ENST00000523255.1_5'UTR	NM_001280539.1|NM_015435.3	NP_001267468.1|NP_056250.3	Q9NV58	RN19A_HUMAN	ring finger protein 19A, RBR E3 ubiquitin protein ligase	412					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.R412W(1)		breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	30	all_cancers(14;3.5e-05)|all_epithelial(15;8.91e-08)|Lung NSC(17;0.000615)|all_lung(17;0.00166)		Epithelial(11;3.06e-11)|all cancers(13;5.78e-09)|OV - Ovarian serous cystadenocarcinoma(57;2.24e-05)|STAD - Stomach adenocarcinoma(118;0.0525)			GCCAAATTCCGTTTGTGCTTT	0.373																																					p.R412W		Atlas-SNP	.											RNF19A,NS,carcinoma,0,1	RNF19A	67	.	1	Substitution - Missense(1)	endometrium(1)	c.C1234T						PASS	.						239.0	211.0	220.0					8																	101276971		2203	4300	6503	SO:0001583	missense	25897	exon7			AATTCCGTTTGTG	AB029316	CCDS6286.1	8q22	2013-10-03	2013-10-03	2007-08-20		ENSG00000034677		"""RING-type (C3HC4) zinc fingers"""	13432	protein-coding gene	gene with protein product		607119	"""ring finger protein 19"", ""ring finger protein 19A"", ""ring finger protein 19A, E3 ubiquitin protein ligase"""	RNF19		11237715, 10976766	Standard	NM_183419		Approved	dorfin, DKFZp566B1346	uc003yjj.1	Q9NV58		ENST00000519449.1:c.1234C>T	chr8.hg19:g.101276971G>A	ENSP00000428968:p.Arg412Trp	100.0	0.0	.		98.0	23.0	.	NM_015435	A3KCU9|Q52LG1|Q9H5H9|Q9H8M8|Q9UFG0|Q9UFX6|Q9Y4Y1	Missense_Mutation	SNP	ENST00000519449.1	hg19	CCDS6286.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.012643	0.75161	.	.	ENSG00000034677	ENST00000519449;ENST00000341084	D;D	0.86297	-2.1;-2.1	5.17	4.28	0.50868	.	0.053565	0.64402	D	0.000002	D	0.92704	0.7681	M	0.79475	2.455	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.93259	0.6641	10	0.87932	D	0	.	12.7055	0.57058	0.0:0.0:0.5807:0.4193	.	412	Q9NV58	RN19A_HUMAN	W	412	ENSP00000428968:R412W;ENSP00000342667:R412W	ENSP00000342667:R412W	R	-	1	2	RNF19A	101346147	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.083000	0.41615	1.305000	0.44909	0.650000	0.86243	CGG	.	.	.	none		0.373	RNF19A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380004.1	NM_015435	
RSPO2	340419	hgsc.bcm.edu	37	8	108970372	108970372	+	Silent	SNP	T	T	C			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr8:108970372T>C	ENST00000276659.5	-	5	1172	c.552A>G	c.(550-552)acA>acG	p.T184T	RSPO2_ENST00000517781.1_Silent_p.T120T|RSPO2_ENST00000517939.1_Silent_p.T117T|RSPO2_ENST00000378439.2_Silent_p.T120T	NM_178565.4	NP_848660.3	Q6UXX9	RSPO2_HUMAN	R-spondin 2	184	TSP type-1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				bone mineralization (GO:0030282)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|lung growth (GO:0060437)|osteoblast differentiation (GO:0001649)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|extracellular region (GO:0005576)	heparin binding (GO:0008201)|receptor binding (GO:0005102)		EIF3E/RSPO2(6)	haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	28			OV - Ovarian serous cystadenocarcinoma(57;1.55e-09)			GACACAGTATTGTGTCTTTCA	0.443																																					p.T184T		Atlas-SNP	.											.	RSPO2	65	.	0			c.A552G						PASS	.						328.0	281.0	297.0					8																	108970372		2203	4300	6503	SO:0001819	synonymous_variant	340419	exon5			CAGTATTGTGTCT	AK123023	CCDS6307.1, CCDS64953.1	8q23.1	2014-01-30	2011-06-29		ENSG00000147655	ENSG00000147655		"""Endogenous ligands"""	28583	protein-coding gene	gene with protein product		610575	"""R-spondin 2 homolog (Xenopus laevis)"""			15469841	Standard	NM_178565		Approved	MGC35555	uc003yms.3	Q6UXX9	OTTHUMG00000164893	ENST00000276659.5:c.552A>G	chr8.hg19:g.108970372T>C		217.0	0.0	.		239.0	112.0	.	NM_178565	B3KVP0|Q4G0U4|Q8N6X6	Silent	SNP	ENST00000276659.5	hg19	CCDS6307.1																																																																																			.	.	.	none		0.443	RSPO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380830.1	NM_178565	
EEF1D	1936	hgsc.bcm.edu	37	8	144661995	144661995	+	Missense_Mutation	SNP	C	C	G	rs11548159		TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr8:144661995C>G	ENST00000529272.1	-	8	1213	c.813G>C	c.(811-813)caG>caC	p.Q271H	NAPRT1_ENST00000435154.3_5'Flank|EEF1D_ENST00000442189.2_Missense_Mutation_p.Q637H|EEF1D_ENST00000395119.3_Missense_Mutation_p.Q271H|NAPRT1_ENST00000449291.2_5'Flank|EEF1D_ENST00000524624.1_Missense_Mutation_p.Q247H|EEF1D_ENST00000423316.2_Missense_Mutation_p.Q637H|EEF1D_ENST00000317198.6_Missense_Mutation_p.Q271H|NAPRT1_ENST00000276844.7_5'Flank|RP11-661A12.7_ENST00000529247.1_RNA|EEF1D_ENST00000532400.1_Missense_Mutation_p.R87T|EEF1D_ENST00000531621.1_Missense_Mutation_p.Q228H|EEF1D_ENST00000526838.1_Missense_Mutation_p.Q252H|NAPRT1_ENST00000426292.3_5'Flank|EEF1D_ENST00000532741.1_Missense_Mutation_p.Q687H|EEF1D_ENST00000419152.2_Missense_Mutation_p.Q271H|EEF1D_ENST00000528610.1_Missense_Mutation_p.Q247H|RP11-661A12.9_ENST00000531730.1_RNA			P29692	EF1D_HUMAN	eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)	271	Catalytic (GEF).				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)|translation elongation factor activity (GO:0003746)|translation factor activity, nucleic acid binding (GO:0008135)			breast(2)|cervix(1)|endometrium(1)|kidney(4)|lung(2)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			TATCGACACTCTGCACCTGAG	0.612																																					p.Q637H		Atlas-SNP	.											.	EEF1D	48	.	0			c.G1911C						PASS	.						116.0	108.0	111.0					8																	144661995		2203	4300	6503	SO:0001583	missense	1936	exon10			GACACTCTGCACC	AK024550	CCDS6404.1, CCDS6405.1, CCDS47930.1, CCDS56559.1	8q24	2011-09-15			ENSG00000104529	ENSG00000104529			3211	protein-coding gene	gene with protein product		130592				8334168	Standard	NM_001960		Approved	EF-1D, FLJ20897	uc003yyt.3	P29692	OTTHUMG00000165191	ENST00000529272.1:c.813G>C	chr8.hg19:g.144661995C>G	ENSP00000434872:p.Gln271His	99.0	0.0	.		112.0	42.0	.	NM_001130053	B4DDU4|D3DWK3|E9PBQ9|Q4VBZ6|Q969J1|Q96I38	Missense_Mutation	SNP	ENST00000529272.1	hg19	CCDS6405.1	.|.|.|.	.|.|.|.	.|.|.|.	.|.|.|.	.|.|.|.	.|.|.|.	.|.|.|.	.|.|.|.	.|.|.|.	.|.|.|.	.|C|C|C	16.30|16.30|16.30|16.30	3.083562|3.083562|3.083562|3.083562	0.55861|0.55861|0.55861|0.55861	.|.|.|.	.|.|.|.	ENSG00000104529|ENSG00000104529|ENSG00000104529|ENSG00000104529	ENST00000529576|ENST00000530109|ENST00000419152;ENST00000532741;ENST00000526838;ENST00000442189;ENST00000528610;ENST00000395119;ENST00000529272;ENST00000423316;ENST00000356793;ENST00000317198;ENST00000531621;ENST00000524624|ENST00000532400	.|.|.|.	.|.|.|.	.|.|.|.	4.94|4.94|4.94|4.94	2.14|2.14|2.14|2.14	0.27477|0.27477|0.27477|0.27477	.|.|Translation elongation factor EF1B/ribosomal protein S6 (1);Translation elongation factor EF1B, beta/delta chains, conserved site (1);Translation elongation factor EF1B, beta/delta subunit, guanine nucleotide exchange (3);|.	.|.|0.121518|.	.|.|0.64402|.	.|.|D|.	.|.|0.000014|.	.|D|D|D	.|0.87525|0.87525|0.87525	.|0.6199|0.6199|0.6199	H|H|H|H	0.99182|0.99182|0.99182|0.99182	4.46|4.46|4.46|4.46	0.58432|0.58432|0.58432|0.58432	D|D|D|D	0.999996|0.999996|0.999996|0.999996	.|.|D;D;D;D;D;D|.	.|.|0.89917|.	.|.|1.0;0.999;1.0;0.999;1.0;1.0|.	.|.|D;D;D;D;D;D|.	.|.|0.97110|.	.|.|0.998;0.998;0.999;0.99;1.0;0.996|.	.|D|D|D	.|0.87780|0.87780|0.87780	.|0.2611|0.2611|0.2611	.|5|9|6	.|.|0.87932|0.87932	.|.|D|D	.|.|0|0	.|.|.|.	9.1243|9.1243|9.1243|9.1243	0.36805|0.36805|0.36805|0.36805	0.0:0.6883:0.0:0.3117|0.0:0.6883:0.0:0.3117|0.0:0.6883:0.0:0.3117|0.0:0.6883:0.0:0.3117	.|.|.|.	.|.|252;637;565;271;687;637|.	.|.|E9PBQ9;D3DWK1;F8W934;P29692;E9PRY8;P29692-2|.	.|.|.;.;.;EF1D_HUMAN;.;.|.	.|Q|H|T	-1|146|271;687;252;637;247;271;271;637;565;271;228;247|87	.|.|.|.	.|.|ENSP00000317399:Q271H|ENSP00000433784:R87T	.|E|Q|R	-|-|-|-	.|1|3|2	.|0|2|0	EEF1D|EEF1D|EEF1D|EEF1D	144733138|144733138|144733138|144733138	1.000000|1.000000|1.000000|1.000000	0.71417|0.71417|0.71417|0.71417	1.000000|1.000000|1.000000|1.000000	0.80357|0.80357|0.80357|0.80357	0.953000|0.953000|0.953000|0.953000	0.61014|0.61014|0.61014|0.61014	2.428000|2.428000|2.428000|2.428000	0.44749|0.44749|0.44749|0.44749	0.622000|0.622000|0.622000|0.622000	0.30249|0.30249|0.30249|0.30249	-0.136000|-0.136000|-0.136000|-0.136000	0.14681|0.14681|0.14681|0.14681	.|GAG|CAG|AGA	.	.	.	none		0.612	EEF1D-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382592.2	NM_032378	
MELK	9833	hgsc.bcm.edu	37	9	36583634	36583634	+	Silent	SNP	A	A	G			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr9:36583634A>G	ENST00000298048.2	+	3	253	c.69A>G	c.(67-69)gcA>gcG	p.A23A	MELK_ENST00000545008.1_Silent_p.A23A|MELK_ENST00000536987.1_Intron|MELK_ENST00000543751.1_Intron|MELK_ENST00000536329.1_Intron|MELK_ENST00000487398.1_Intron|MELK_ENST00000536860.1_Silent_p.A23A|MELK_ENST00000541717.1_Silent_p.A23A|MELK_ENST00000538311.1_Intron	NM_014791.3	NP_055606.1	Q14680	MELK_HUMAN	maternal embryonic leucine zipper kinase	23	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|neural precursor cell proliferation (GO:0061351)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)	cell cortex (GO:0005938)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)	29		Acute lymphoblastic leukemia(2;1.09e-08)|all_hematologic(2;8.15e-06)	STAD - Stomach adenocarcinoma(86;0.228)			GTGGCTTTGCAAAGGTCAAAC	0.323																																					p.A23A	Ovarian(82;980 1317 7225 14391 18624)	Atlas-SNP	.											.	MELK	74	.	0			c.A69G						PASS	.						66.0	65.0	65.0					9																	36583634		2203	4300	6503	SO:0001819	synonymous_variant	9833	exon3			CTTTGCAAAGGTC	D79997	CCDS6606.1, CCDS59123.1, CCDS59124.1, CCDS59125.1, CCDS59126.1, CCDS59127.1, CCDS59128.1	9p13.1	2008-02-05			ENSG00000165304	ENSG00000165304			16870	protein-coding gene	gene with protein product		607025				8724849, 9136115	Standard	NM_001256689		Approved	KIAA0175	uc003zzn.4	Q14680	OTTHUMG00000019906	ENST00000298048.2:c.69A>G	chr9.hg19:g.36583634A>G		34.0	0.0	.		31.0	13.0	.	NM_001256688	A6P3A7|A6P3A8|B1AMQ6|B7Z1E6|B7Z5M5|B7Z6Q7|B7Z6R8|B7Z6Y0|B7Z7Q1|D3DRP8|F5H0Y0|F5H2R4|F5H689|Q7L3C3	Silent	SNP	ENST00000298048.2	hg19	CCDS6606.1																																																																																			.	.	.	none		0.323	MELK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052428.3	NM_014791	
MSS51	118490	hgsc.bcm.edu	37	10	75187422	75187422	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr10:75187422C>A	ENST00000372912.1	-	2	328	c.326G>T	c.(325-327)aGa>aTa	p.R109I	AL353731.1_ENST00000584907.1_RNA|MSS51_ENST00000299432.2_Missense_Mutation_p.R109I			Q4VC12	MSS51_HUMAN	MSS51 mitochondrial translational activator	109					social behavior (GO:0035176)		metal ion binding (GO:0046872)										AGGGAGTGCTCTACAGTGAGC	0.488																																					p.R109I		Atlas-SNP	.											.	.	.	.	0			c.G326T						PASS	.						150.0	152.0	151.0					10																	75187422		2203	4300	6503	SO:0001583	missense	118490	exon3			AGTGCTCTACAGT	AK096884	CCDS31221.1	10q22.3	2013-01-10	2013-01-10	2012-02-24	ENSG00000166343	ENSG00000166343		"""Zinc fingers, MYND-type"""	21000	protein-coding gene	gene with protein product		614773	"""zinc finger, MYND-type containing 17"", ""MSS51 mitochondrial translational activator homolog (S. cerevisiae)"""	ZMYND17		19710419	Standard	NM_001024593		Approved	FLJ39565	uc001jud.3	Q4VC12	OTTHUMG00000018464	ENST00000372912.1:c.326G>T	chr10.hg19:g.75187422C>A	ENSP00000362003:p.Arg109Ile	110.0	0.0	.		83.0	43.0	.	NM_001024593	A6NGH6|Q2VP95|Q5F2H5|Q7Z3M9|Q8N8G0	Missense_Mutation	SNP	ENST00000372912.1	hg19	CCDS31221.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.006937	0.74932	.	.	ENSG00000166343	ENST00000299432;ENST00000372912	T;T	0.47528	0.84;0.84	5.93	1.82	0.25136	Zinc finger, MYND-type (3);	0.272901	0.39985	N	0.001207	T	0.45915	0.1366	L	0.46157	1.445	0.28419	N	0.917817	P;P	0.42941	0.794;0.755	P;P	0.49192	0.602;0.466	T	0.37957	-0.9683	10	0.52906	T	0.07	-1.0575	7.4501	0.27234	0.0:0.5461:0.0:0.4539	.	109;109	Q4VC12;F6VAV3	ZMY17_HUMAN;.	I	109	ENSP00000299432:R109I;ENSP00000362003:R109I	ENSP00000299432:R109I	R	-	2	0	ZMYND17	74857428	0.998000	0.40836	0.944000	0.38274	0.974000	0.67602	0.901000	0.28445	0.332000	0.23536	0.591000	0.81541	AGA	.	.	.	none		0.488	MSS51-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048652.3	NM_178451	
FUT11	170384	hgsc.bcm.edu	37	10	75533456	75533456	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr10:75533456C>T	ENST00000372841.3	+	2	1260	c.1217C>T	c.(1216-1218)gCg>gTg	p.A406V	FUT11_ENST00000465695.1_3'UTR|AC022400.2_ENST00000595757.1_5'Flank|FUT11_ENST00000394790.1_Missense_Mutation_p.A406V|RMRPP1_ENST00000517236.1_RNA	NM_173540.2	NP_775811.2	Q495W5	FUT11_HUMAN	fucosyltransferase 11 (alpha (1,3) fucosyltransferase)	406					protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)	7	Prostate(51;0.0112)					AAAGCCCACGCGGCCTCTCCC	0.597																																					p.A406V		Atlas-SNP	.											.	FUT11	30	.	0			c.C1217T						PASS	.						70.0	73.0	72.0					10																	75533456		2203	4300	6503	SO:0001583	missense	170384	exon2			CCCACGCGGCCTC	BC036037	CCDS7333.1, CCDS60558.1	10q22.3	2014-01-02			ENSG00000196968	ENSG00000196968		"""Fucosyltransferases"""	19233	protein-coding gene	gene with protein product						11698403, 24318988	Standard	NM_173540		Approved	MGC33202	uc001jva.3	Q495W5	OTTHUMG00000018483	ENST00000372841.3:c.1217C>T	chr10.hg19:g.75533456C>T	ENSP00000361932:p.Ala406Val	128.0	0.0	.		98.0	50.0	.	NM_173540	Q495W7|Q8IYE4	Missense_Mutation	SNP	ENST00000372841.3	hg19	CCDS7333.1	.	.	.	.	.	.	.	.	.	.	C	14.02	2.411217	0.42817	.	.	ENSG00000196968	ENST00000372841;ENST00000394790	T;T	0.35605	1.32;1.3	5.68	-3.31	0.04988	.	0.603818	0.19087	N	0.123083	T	0.12263	0.0298	N	0.14661	0.345	0.09310	N	1	B;B	0.34349	0.156;0.45	B;B	0.27500	0.061;0.08	T	0.33085	-0.9882	10	0.13853	T	0.58	-31.9131	4.6888	0.12771	0.5766:0.2067:0.0844:0.1324	.	406;406	Q495W5;Q495W5-2	FUT11_HUMAN;.	V	406	ENSP00000361932:A406V;ENSP00000378270:A406V	ENSP00000361932:A406V	A	+	2	0	FUT11	75203462	0.000000	0.05858	0.000000	0.03702	0.968000	0.65278	0.215000	0.17562	-0.197000	0.10350	0.563000	0.77884	GCG	.	.	.	none		0.597	FUT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048689.1	NM_173540	
FBXO3	26273	hgsc.bcm.edu	37	11	33770331	33770331	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr11:33770331C>T	ENST00000265651.3	-	9	1058	c.1040G>A	c.(1039-1041)gGa>gAa	p.G347E	FBXO3_ENST00000531080.1_Missense_Mutation_p.G34E|FBXO3_ENST00000532057.1_Missense_Mutation_p.G34E|FBXO3_ENST00000448981.2_Missense_Mutation_p.G347E|FBXO3_ENST00000526785.1_Missense_Mutation_p.G234E|FBXO3_ENST00000534136.1_Missense_Mutation_p.G347E|FBXO3_ENST00000530401.1_Missense_Mutation_p.G342E	NM_012175.3	NP_036307.2	Q9UK99	FBX3_HUMAN	F-box protein 3	347	ApaG. {ECO:0000255|PROSITE- ProRule:PRU00412}.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|pancreas(1)|stomach(1)	13		Lung NSC(402;0.0804)		BRCA - Breast invasive adenocarcinoma(625;0.00315)|Lung(977;0.00488)|LUSC - Lung squamous cell carcinoma(625;0.008)		ACCAACTACTCCAGGTCCTTG	0.373																																					p.G347E		Atlas-SNP	.											.	FBXO3	37	.	0			c.G1040A						PASS	.						99.0	99.0	99.0					11																	33770331		2202	4298	6500	SO:0001583	missense	26273	exon9			ACTACTCCAGGTC	AK001943	CCDS7887.1, CCDS44566.1	11p13	2006-07-07	2004-06-15		ENSG00000110429	ENSG00000110429		"""F-boxes /  ""other"""""	13582	protein-coding gene	gene with protein product		609089	"""F-box only protein 3"""			10531037	Standard	NM_033406		Approved	FBX3, FBA	uc001muz.3	Q9UK99	OTTHUMG00000166244	ENST00000265651.3:c.1040G>A	chr11.hg19:g.33770331C>T	ENSP00000265651:p.Gly347Glu	50.0	0.0	.		51.0	14.0	.	NM_012175	B3KY16|D3DR05|Q86X90|Q9H0V2|Q9NUX2	Missense_Mutation	SNP	ENST00000265651.3	hg19	CCDS7887.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.567786	0.86439	.	.	ENSG00000110429	ENST00000526785;ENST00000265651;ENST00000530401;ENST00000531080;ENST00000532057;ENST00000534136;ENST00000448981	T;T;T;T;T	0.71934	-0.51;-0.61;-0.5;-0.54;-0.51	5.61	4.68	0.58851	ApaG domain (4);	0.000000	0.85682	D	0.000000	D	0.89518	0.6738	H	0.96633	3.855	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.993;0.993;0.999	D	0.93248	0.6632	10	0.87932	D	0	-21.1763	16.4024	0.83644	0.0:0.8681:0.1319:0.0	.	342;347;347	Q9UK99-3;Q9UK99-2;Q9UK99	.;.;FBX3_HUMAN	E	234;347;342;34;34;347;347	ENSP00000435680:G234E;ENSP00000265651:G347E;ENSP00000433781:G342E;ENSP00000431745:G347E;ENSP00000408836:G347E	ENSP00000265651:G347E	G	-	2	0	FBXO3	33726907	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.294000	0.78760	1.355000	0.45865	0.491000	0.48974	GGA	.	.	.	none		0.373	FBXO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388665.1	NM_012175	
PPP2R5B	5526	hgsc.bcm.edu	37	11	64694184	64694184	+	Splice_Site	SNP	A	A	G			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr11:64694184A>G	ENST00000164133.2	+	3	822	c.200A>G	c.(199-201)gAt>gGt	p.D67G		NM_006244.3	NP_006235.1	Q15173	2A5B_HUMAN	protein phosphatase 2, regulatory subunit B', beta	67					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(2)	21						TCCTCCCCAGATGTGCCGGCT	0.662																																					p.D67G		Atlas-SNP	.											.	PPP2R5B	47	.	0			c.A200G						PASS	.						55.0	61.0	59.0					11																	64694184		2201	4297	6498	SO:0001630	splice_region_variant	5526	exon3			CCCCAGATGTGCC	L42374	CCDS8085.1	11q12	2010-06-18	2010-04-14		ENSG00000068971	ENSG00000068971		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9310	protein-coding gene	gene with protein product	"""PP2A, B subunit, B' beta isoform"", ""PP2A, B subunit, B56 beta isoform"", ""PP2A, B subunit, PR61 beta isoform"", ""PP2A, B subunit, R5 beta isoform"", ""serine/threonine protein phosphatase 2A, 56 kDa regulatory subunit, beta isoform"""	601644	"""protein phosphatase 2, regulatory subunit B (B56), beta isoform"", ""protein phosphatase 2, regulatory subunit B', beta isoform"""			7592815	Standard	NM_006244		Approved	FLJ35411, B56B, PR61B	uc001oby.3	Q15173	OTTHUMG00000150043	ENST00000164133.2:c.200-1A>G	chr11.hg19:g.64694184A>G		44.0	0.0	.		35.0	6.0	.	NM_006244	Q13853	Missense_Mutation	SNP	ENST00000164133.2	hg19	CCDS8085.1	.	.	.	.	.	.	.	.	.	.	A	14.84	2.654294	0.47467	.	.	ENSG00000068971	ENST00000526559;ENST00000164133;ENST00000359279;ENST00000527441	.	.	.	4.6	4.6	0.57074	.	0.000000	0.85682	D	0.000000	T	0.68650	0.3024	M	0.82517	2.595	0.80722	D	1	B	0.14012	0.009	B	0.24974	0.057	T	0.66748	-0.5845	8	.	.	.	.	12.2855	0.54789	1.0:0.0:0.0:0.0	.	67	Q15173	2A5B_HUMAN	G	67;67;94;67	.	.	D	+	2	0	PPP2R5B	64450760	1.000000	0.71417	1.000000	0.80357	0.343000	0.28985	8.597000	0.90847	2.077000	0.62373	0.528000	0.53228	GAT	.	.	.	none		0.662	PPP2R5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385465.1	NM_006244	Missense_Mutation
MYO7A	4647	hgsc.bcm.edu	37	11	76925728	76925728	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr11:76925728G>T	ENST00000409709.3	+	49	6907	c.6635G>T	c.(6634-6636)aGg>aTg	p.R2212M	MYO7A_ENST00000458637.2_Missense_Mutation_p.R2172M|MYO7A_ENST00000605744.1_3'UTR|MYO7A_ENST00000409619.2_Missense_Mutation_p.R2163M	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	2212					actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						CGGGGCTCCAGGAGCGGCAAG	0.582																																					p.R2212M		Atlas-SNP	.											.	MYO7A	164	.	0			c.G6635T						PASS	.						28.0	31.0	30.0					11																	76925728		2034	4166	6200	SO:0001583	missense	4647	exon49			GCTCCAGGAGCGG	U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.6635G>T	chr11.hg19:g.76925728G>T	ENSP00000386331:p.Arg2212Met	107.0	0.0	.		84.0	8.0	.	NM_000260	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Missense_Mutation	SNP	ENST00000409709.3	hg19	CCDS53683.1	.	.	.	.	.	.	.	.	.	.	G	12.66	2.004181	0.35320	.	.	ENSG00000137474	ENST00000409709;ENST00000458637;ENST00000409619;ENST00000545136;ENST00000358342;ENST00000343356;ENST00000341717;ENST00000458169	D;D;D;D	0.88664	-2.39;-2.39;-2.41;-2.2	5.47	4.55	0.56014	.	0.125567	0.64402	D	0.000013	D	0.91382	0.7281	M	0.73598	2.24	0.38514	D	0.948547	D;D	0.64830	0.991;0.994	P;P	0.60682	0.878;0.759	D	0.91720	0.5388	10	0.87932	D	0	.	5.1745	0.15127	0.2814:0.0:0.7186:0.0	.	2172;2212	F8VUN5;Q13402	.;MYO7A_HUMAN	M	2212;2172;2163;1385;2211;2181;2088;1354	ENSP00000386331:R2212M;ENSP00000392185:R2172M;ENSP00000386635:R2163M;ENSP00000417017:R1354M	ENSP00000345075:R2088M	R	+	2	0	MYO7A	76603376	1.000000	0.71417	0.998000	0.56505	0.371000	0.29859	4.530000	0.60595	2.558000	0.86282	0.467000	0.42956	AGG	.	.	.	none		0.582	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328133.1	NM_000260	
COLCA2	120376	hgsc.bcm.edu	37	11	111179020	111179020	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr11:111179020C>G	ENST00000398035.2	+	5	1081	c.323C>G	c.(322-324)tCg>tGg	p.S108W	COLCA2_ENST00000526216.1_Missense_Mutation_p.S108W	NM_001136105.2	NP_001129577.1	A8K830	COLC2_HUMAN	colorectal cancer associated 2	108						cytoplasm (GO:0005737)											TACTGCGCATCGTGTGAGGCA	0.587																																					p.S205W		Atlas-SNP	.											.	C11orf93	10	.	0			c.C614G						PASS	.						101.0	89.0	92.0					11																	111179020		692	1591	2283	SO:0001583	missense	120376	exon5			GCGCATCGTGTGA	BC042557	CCDS44728.1, CCDS73378.1	11q23.1	2013-10-11	2013-08-22	2013-08-22	ENSG00000214290	ENSG00000214290			26978	protein-coding gene	gene with protein product	"""cancer susceptibility candidate 13"""	615694	"""chromosome 11 open reading frame 93"""	C11orf93		21071539	Standard	NM_001271457		Approved	CASC13	uc031qea.1	A8K830	OTTHUMG00000166657	ENST00000398035.2:c.323C>G	chr11.hg19:g.111179020C>G	ENSP00000381115:p.Ser108Trp	125.0	0.0	.		62.0	5.0	.	NM_001271458	E9PMJ8|Q2TBJ3|V5LD62|V5LDI3|V5LDV1|V5LE09|V5LEU3	Missense_Mutation	SNP	ENST00000398035.2	hg19	CCDS44728.1	.	.	.	.	.	.	.	.	.	.	C	15.14	2.743752	0.49151	.	.	ENSG00000214290	ENST00000398035;ENST00000526216	.	.	.	5.96	5.96	0.96718	.	0.000000	0.30269	U	0.010001	T	0.67344	0.2883	L	0.34521	1.04	0.58432	D	0.999991	D	0.89917	1.0	D	0.97110	1.0	T	0.62969	-0.6741	8	.	.	.	-9.6502	17.3388	0.87289	0.0:1.0:0.0:0.0	.	108	A8K830	CK093_HUMAN	W	108	.	.	S	+	2	0	C11orf93	110684230	0.847000	0.29606	0.807000	0.32361	0.013000	0.08279	3.071000	0.50041	2.832000	0.97577	0.655000	0.94253	TCG	.	.	.	none		0.587	COLCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390991.1	NM_001136105	
PHLDB1	23187	hgsc.bcm.edu	37	11	118509935	118509935	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr11:118509935G>A	ENST00000361417.2	+	13	3113	c.2702G>A	c.(2701-2703)aGg>aAg	p.R901K	PHLDB1_ENST00000527898.1_5'UTR|PHLDB1_ENST00000356063.5_Missense_Mutation_p.R901K|PHLDB1_ENST00000534672.1_3'UTR|PHLDB1_ENST00000524713.1_5'Flank|AP002954.3_ENST00000530198.1_RNA	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	901										breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		ACAGGGGGCAGGCCTTTCCCG	0.562																																					p.R901K		Atlas-SNP	.											.	PHLDB1	103	.	0			c.G2702A						PASS	.						97.0	84.0	88.0					11																	118509935		2200	4295	6495	SO:0001583	missense	23187	exon12			GGGGCAGGCCTTT		CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.2702G>A	chr11.hg19:g.118509935G>A	ENSP00000354498:p.Arg901Lys	169.0	1.0	.		95.0	77.0	.	NM_001144758	B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Missense_Mutation	SNP	ENST00000361417.2	hg19	CCDS8401.1	.	.	.	.	.	.	.	.	.	.	G	15.63	2.890173	0.52014	.	.	ENSG00000019144	ENST00000361417;ENST00000361465;ENST00000358191;ENST00000356063	T;T	0.41065	1.01;1.01	4.39	4.39	0.52855	.	0.120998	0.49916	D	0.000123	T	0.28067	0.0692	L	0.31065	0.9	0.80722	D	1	B;B;B;B	0.30482	0.002;0.281;0.062;0.003	B;B;B;B	0.34093	0.004;0.175;0.025;0.005	T	0.05954	-1.0854	10	0.02654	T	1	-25.2439	12.056	0.53536	0.0:0.1734:0.8266:0.0	.	645;901;901;901	Q5W9G0;Q86UU1-3;Q86UU1-2;Q86UU1	.;.;.;PHLB1_HUMAN	K	901;660;265;901	ENSP00000354498:R901K;ENSP00000348359:R901K	ENSP00000348359:R901K	R	+	2	0	PHLDB1	118015145	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	3.292000	0.51772	2.010000	0.58986	0.456000	0.33151	AGG	.	.	.	none		0.562	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389279.1	NM_015157	
C2CD5	9847	hgsc.bcm.edu	37	12	22670928	22670928	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr12:22670928G>T	ENST00000333957.4	-	8	1199	c.944C>A	c.(943-945)cCc>cAc	p.P315H	C2CD5_ENST00000544930.1_Intron|C2CD5_ENST00000446597.1_Missense_Mutation_p.P315H|C2CD5_ENST00000542676.1_Missense_Mutation_p.P315H|C2CD5_ENST00000536386.1_Intron|C2CD5_ENST00000396028.2_Intron|C2CD5_ENST00000545552.1_Intron|C2CD5_ENST00000540703.1_5'Flank	NM_014802.1	NP_055617.1	Q86YS7	C2CD5_HUMAN	C2 calcium-dependent domain containing 5	315					cellular response to insulin stimulus (GO:0032869)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|intracellular protein transmembrane transport (GO:0065002)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)										ACCAGTTTTGGGTGTCAAACT	0.383																																					p.P315H		Atlas-SNP	.											.	.	.	.	0			c.C944A						PASS	.						177.0	174.0	175.0					12																	22670928		2203	4300	6503	SO:0001583	missense	9847	exon8			GTTTTGGGTGTCA	AB011100	CCDS31758.1, CCDS66337.1, CCDS66338.1, CCDS66339.1, CCDS66340.1	12p12.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000111731	ENSG00000111731			29062	protein-coding gene	gene with protein product	"""138 kDa C2 domain-containing phosphoprotein"""		"""KIAA0528"""	KIAA0528		21907143	Standard	XM_005253538		Approved	CDP138	uc001rfq.3	Q86YS7	OTTHUMG00000169100	ENST00000333957.4:c.944C>A	chr12.hg19:g.22670928G>T	ENSP00000334229:p.Pro315His	70.0	0.0	.		85.0	36.0	.	NM_014802	B4DJ03|B4DRN7|B7ZLL0|F5H2A1|F5H5R1|O60280|Q17RY7|Q7Z619|Q86SU3	Missense_Mutation	SNP	ENST00000333957.4	hg19	CCDS31758.1	.	.	.	.	.	.	.	.	.	.	G	18.05	3.536609	0.65085	.	.	ENSG00000111731	ENST00000333957;ENST00000446597;ENST00000542676	T;T;T	0.50001	0.76;0.76;0.76	6.04	5.14	0.70334	.	.	.	.	.	T	0.66268	0.2772	M	0.75777	2.31	0.80722	D	1	D;D	0.65815	0.995;0.957	P;P	0.59288	0.855;0.58	T	0.71758	-0.4496	9	0.72032	D	0.01	-3.34	17.3582	0.87342	0.0:0.125:0.875:0.0	.	315;315	B4DRN7;Q86YS7	.;K0528_HUMAN	H	315	ENSP00000334229:P315H;ENSP00000388756:P315H;ENSP00000441951:P315H	ENSP00000334229:P315H	P	-	2	0	KIAA0528	22562195	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.606000	0.98325	1.538000	0.49270	0.561000	0.74099	CCC	.	.	.	none		0.383	C2CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402257.1	NM_014802	
PRPH	5630	hgsc.bcm.edu	37	12	49690229	49690229	+	Silent	SNP	C	C	T			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr12:49690229C>T	ENST00000257860.4	+	3	2120	c.621C>T	c.(619-621)gcC>gcT	p.A207A	RP11-161H23.9_ENST00000553259.1_RNA	NM_006262.3	NP_006253.2	P23942	PRPH2_HUMAN	peripherin	0					cell adhesion (GO:0007155)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(8)|skin(1)	12						TGGACGATGCCACTCTGTCCC	0.567																																					p.A207A		Atlas-SNP	.											.	PRPH	26	.	0			c.C621T						PASS	.						86.0	77.0	80.0					12																	49690229		2203	4300	6503	SO:0001819	synonymous_variant	5630	exon3			CGATGCCACTCTG		CCDS8783.1	12q12-q13	2013-01-16						"""Intermediate filaments type III"""	9461	protein-coding gene	gene with protein product		170710		NEF4		1378416	Standard	XM_005269025		Approved	PRPH1	uc001rtu.3	P41219		ENST00000257860.4:c.621C>T	chr12.hg19:g.49690229C>T		168.0	0.0	.		151.0	9.0	.	NM_006262	Q5TFH5|Q6DK65	Silent	SNP	ENST00000257860.4	hg19	CCDS8783.1																																																																																			.	.	.	none		0.567	PRPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393381.1	NM_006262	
KRT85	3891	hgsc.bcm.edu	37	12	52754642	52754642	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr12:52754642C>T	ENST00000257901.3	-	9	1594	c.1519G>A	c.(1519-1521)Gcc>Acc	p.A507T	KRT85_ENST00000544265.1_Missense_Mutation_p.A295T	NM_002283.3	NP_002274.1	P78386	KRT85_HUMAN	keratin 85	507	Tail.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(7)|liver(1)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	36	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		CTCTACTAGGCAAAGCGGACC	0.607																																					p.A507T		Atlas-SNP	.											.	KRT85	78	.	0			c.G1519A						PASS	.						44.0	52.0	49.0					12																	52754642		2201	4300	6501	SO:0001583	missense	3891	exon9			ACTAGGCAAAGCG	X99140	CCDS8824.1, CCDS73472.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000135443	ENSG00000135443		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6462	protein-coding gene	gene with protein product	"""hard keratin type II"""	602767	"""keratin, hair, basic, 5"""	KRTHB5		9084137, 16831889	Standard	NM_002283		Approved	Hb-5	uc001sag.3	P78386	OTTHUMG00000169633	ENST00000257901.3:c.1519G>A	chr12.hg19:g.52754642C>T	ENSP00000257901:p.Ala507Thr	77.0	0.0	.		68.0	29.0	.	NM_002283	Q9NSB1	Missense_Mutation	SNP	ENST00000257901.3	hg19	CCDS8824.1	.	.	.	.	.	.	.	.	.	.	C	11.80	1.746175	0.30955	.	.	ENSG00000135443	ENST00000257901;ENST00000544265	D;D	0.82255	-1.59;-1.5	5.22	3.31	0.37934	.	0.000000	0.44097	D	0.000485	T	0.72104	0.3419	N	0.22421	0.69	0.09310	N	1	B	0.27498	0.18	B	0.26517	0.07	T	0.67952	-0.5537	10	0.87932	D	0	.	12.1399	0.53993	0.0:0.6712:0.3288:0.0	.	507	P78386	KRT85_HUMAN	T	507;295	ENSP00000257901:A507T;ENSP00000440240:A295T	ENSP00000257901:A507T	A	-	1	0	KRT85	51040909	0.619000	0.27059	0.841000	0.33234	0.099000	0.18886	0.941000	0.29005	1.427000	0.47276	0.609000	0.83330	GCC	.	.	.	none		0.607	KRT85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405184.1	NM_002283	
LRP1	4035	hgsc.bcm.edu	37	12	57587701	57587701	+	Silent	SNP	C	C	T	rs367824154		TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr12:57587701C>T	ENST00000243077.3	+	48	8290	c.7824C>T	c.(7822-7824)ggC>ggT	p.G2608G	MIR1228_ENST00000408438.1_RNA	NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	2608	LDL-receptor class A 13. {ECO:0000255|PROSITE-ProRule:PRU00124}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GTGGTGTGGGCGAGTTCCGCT	0.612																																					p.G2608G		Atlas-SNP	.											.	LRP1	428	.	0			c.C7824T						PASS	.	C		1,4405	2.1+/-5.4	0,1,2202	95.0	86.0	89.0		7824	-5.7	0.2	12		89	0,8600		0,0,4300	no	coding-synonymous	LRP1	NM_002332.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		2608/4545	57587701	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	4035	exon48			TGTGGGCGAGTTC	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.7824C>T	chr12.hg19:g.57587701C>T		127.0	0.0	.		140.0	6.0	.	NM_002332	Q2PP12|Q86SW0|Q8IVG8	Silent	SNP	ENST00000243077.3	hg19	CCDS8932.1																																																																																			.	.	.	weak		0.612	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
PTPRB	5787	hgsc.bcm.edu	37	12	70932007	70932007	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr12:70932007A>T	ENST00000261266.5	-	26	5249	c.5220T>A	c.(5218-5220)gaT>gaA	p.D1740E	PTPRB_ENST00000550358.1_Missense_Mutation_p.D1870E|RP11-588H23.3_ENST00000548687.1_RNA|RP11-588H23.3_ENST00000551438.1_RNA|PTPRB_ENST00000334414.6_Missense_Mutation_p.D1958E|PTPRB_ENST00000538708.1_Missense_Mutation_p.D1650E|RP11-588H23.3_ENST00000546836.1_RNA|RP11-588H23.3_ENST00000547656.1_RNA|RP11-588H23.3_ENST00000549460.1_RNA|PTPRB_ENST00000451516.2_Missense_Mutation_p.D1650E|PTPRB_ENST00000550857.1_Missense_Mutation_p.D1650E	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	1740	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			CTCGCGTGGCATCATCTGGAA	0.478																																					p.D1958E		Atlas-SNP	.											.	PTPRB	676	.	0			c.T5874A						PASS	.						162.0	159.0	160.0					12																	70932007		2102	4245	6347	SO:0001583	missense	5787	exon28			CGTGGCATCATCT	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.5220T>A	chr12.hg19:g.70932007A>T	ENSP00000261266:p.Asp1740Glu	145.0	0.0	.		184.0	74.0	.	NM_001109754	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Missense_Mutation	SNP	ENST00000261266.5	hg19	CCDS44944.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.952571	0.73787	.	.	ENSG00000127329	ENST00000334414;ENST00000451516;ENST00000550358;ENST00000538708;ENST00000550857;ENST00000261266	D;D;D;D;D;D	0.87029	-2.2;-2.2;-2.2;-2.2;-2.2;-2.2	5.67	0.844	0.18943	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.85682	D	0.000000	D	0.91623	0.7353	M	0.78801	2.425	0.53688	D	0.999979	D;D;D;D;D	0.89917	0.999;0.999;1.0;1.0;0.999	D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.999	D	0.89983	0.4102	10	0.87932	D	0	.	9.5604	0.39366	0.6532:0.0:0.3468:0.0	.	1650;1650;1958;1740;1870	P23467-2;F5H3G6;P23467-3;P23467;F8VU56	.;.;.;PTPRB_HUMAN;.	E	1958;1650;1870;1650;1650;1740	ENSP00000334928:D1958E;ENSP00000393028:D1650E;ENSP00000448058:D1870E;ENSP00000438927:D1650E;ENSP00000447302:D1650E;ENSP00000261266:D1740E	ENSP00000261266:D1740E	D	-	3	2	PTPRB	69218274	1.000000	0.71417	0.996000	0.52242	0.783000	0.44284	1.253000	0.32886	0.122000	0.18314	-0.371000	0.07208	GAT	.	.	.	none		0.478	PTPRB-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404439.1		
TMCC3	57458	hgsc.bcm.edu	37	12	94965249	94965249	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr12:94965249T>C	ENST00000261226.4	-	4	1527	c.1396A>G	c.(1396-1398)Atc>Gtc	p.I466V	TMCC3_ENST00000551457.1_Missense_Mutation_p.I435V	NM_020698.2	NP_065749	Q9ULS5	TMCC3_HUMAN	transmembrane and coiled-coil domain family 3	466						integral component of membrane (GO:0016021)				NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	29						GCACACAGGATATGGTCCCAG	0.418																																					p.I466V		Atlas-SNP	.											.	TMCC3	63	.	0			c.A1396G						PASS	.						113.0	108.0	110.0					12																	94965249		2203	4300	6503	SO:0001583	missense	57458	exon4			ACAGGATATGGTC	AB032971	CCDS31877.1, CCDS73506.1	12q22	2005-01-21	2005-07-13			ENSG00000057704		"""Transmembrane and coiled-coil domain containing"""	29199	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 3"""			10574461	Standard	XM_005269039		Approved	KIAA1145	uc001tdj.2	Q9ULS5	OTTHUMG00000170225	ENST00000261226.4:c.1396A>G	chr12.hg19:g.94965249T>C	ENSP00000261226:p.Ile466Val	176.0	0.0	.		139.0	66.0	.	NM_020698	Q8IWB2	Missense_Mutation	SNP	ENST00000261226.4	hg19	CCDS31877.1	.	.	.	.	.	.	.	.	.	.	T	10.54	1.378687	0.24944	.	.	ENSG00000057704	ENST00000261226;ENST00000551457	T;T	0.40756	1.02;1.02	5.33	5.33	0.75918	.	0.057274	0.64402	D	0.000001	T	0.49847	0.1581	L	0.32530	0.975	0.48185	D	0.999604	D	0.61697	0.99	D	0.68192	0.956	T	0.36212	-0.9757	10	0.13470	T	0.59	-18.6633	15.2998	0.73940	0.0:0.0:0.0:1.0	.	466	Q9ULS5	TMCC3_HUMAN	V	466;435	ENSP00000261226:I466V;ENSP00000449888:I435V	ENSP00000261226:I466V	I	-	1	0	TMCC3	93489380	1.000000	0.71417	0.950000	0.38849	0.986000	0.74619	2.358000	0.44134	2.019000	0.59389	0.459000	0.35465	ATC	.	.	.	none		0.418	TMCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408113.1	NM_020698	
PABPC3	5042	hgsc.bcm.edu	37	13	25671122	25671122	+	Silent	SNP	C	C	T	rs79072440		TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr13:25671122C>T	ENST00000281589.3	+	1	823	c.786C>T	c.(784-786)taC>taT	p.Y262Y		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	262	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		AACAAATTTACGTTGGTCGAG	0.408																																					p.Y262Y		Atlas-SNP	.											.	PABPC3	129	.	0			c.C786T						PASS	.																																			SO:0001819	synonymous_variant	5042	exon1			AATTTACGTTGGT	AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.786C>T	chr13.hg19:g.25671122C>T		159.0	0.0	.		153.0	13.0	.	NM_030979	Q8NHV0|Q9H086	Silent	SNP	ENST00000281589.3	hg19	CCDS9311.1																																																																																			.	C|0.500;T|0.500	0.500	weak		0.408	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2	NM_030979	
ABCC4	10257	hgsc.bcm.edu	37	13	95840715	95840715	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr13:95840715C>A	ENST00000376887.4	-	10	1459	c.1345G>T	c.(1345-1347)Gca>Tca	p.A449S	ABCC4_ENST00000536256.1_Missense_Mutation_p.A374S|ABCC4_ENST00000412704.1_Missense_Mutation_p.A449S|ABCC4_ENST00000431522.1_Missense_Mutation_p.A449S|ABCC4_ENST00000538287.1_3'UTR	NM_005845.3	NP_005836.2	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 4	449	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				blood coagulation (GO:0007596)|oxidation-reduction process (GO:0055114)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of smooth muscle cell proliferation (GO:0048661)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|response to organonitrogen compound (GO:0010243)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)	15-hydroxyprostaglandin dehydrogenase (NAD+) activity (GO:0016404)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(1)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cefazolin(DB01327)|Celecoxib(DB00482)|Conjugated Estrogens(DB00286)|Diclofenac(DB00586)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Flurbiprofen(DB00712)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Lamivudine(DB00709)|Leucovorin(DB00650)|Meloxicam(DB00814)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Probenecid(DB01032)|Rosuvastatin(DB01098)|Sildenafil(DB00203)|Sorafenib(DB00398)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tenofovir(DB00300)|Tioguanine(DB00352)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Zidovudine(DB00495)	ACCTTCCCTGCTCCCACGGGG	0.468																																					p.A449S		Atlas-SNP	.											.	ABCC4	248	.	0			c.G1345T						PASS	.						120.0	109.0	113.0					13																	95840715		2203	4300	6503	SO:0001583	missense	10257	exon10			TCCCTGCTCCCAC	U66682	CCDS9474.1	13q31	2012-03-14			ENSG00000125257	ENSG00000125257		"""ATP binding cassette transporters / subfamily C"""	55	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter (ABC superfamily)"", ""bA464I2.1 (ATP-binding cassette, sub-family C (CFTR/MRP), member 4)"", ""multidrug resistance-associated protein 4"", ""multispecific organic anion transporter B"""	605250				8894702, 9661885	Standard	NM_005845		Approved	MRP4, EST170205, MOAT-B, MOATB	uc001vmd.4	O15439	OTTHUMG00000017216	ENST00000376887.4:c.1345G>T	chr13.hg19:g.95840715C>A	ENSP00000366084:p.Ala449Ser	140.0	0.0	.		112.0	23.0	.	NM_005845	A9Z1Z7|Q8IVZ4|Q8IZN6|Q8NEW8|Q9Y6J2	Missense_Mutation	SNP	ENST00000376887.4	hg19	CCDS9474.1	.	.	.	.	.	.	.	.	.	.	C	14.90	2.673351	0.47781	.	.	ENSG00000125257	ENST00000412704;ENST00000376887;ENST00000536256;ENST00000431522	D;D;D;D	0.94687	-3.49;-3.49;-3.49;-3.49	5.22	4.29	0.51040	ABC transporter, transmembrane domain, type 1 (1);ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.050917	0.85682	D	0.000000	D	0.84316	0.5445	N	0.02751	-0.505	0.80722	D	1	B;B;B;B;B	0.27117	0.032;0.068;0.028;0.168;0.038	B;B;B;B;B	0.27262	0.039;0.05;0.076;0.078;0.034	T	0.81959	-0.0694	10	0.07175	T	0.84	.	16.4591	0.84031	0.1401:0.8598:0.0:0.0	.	374;449;449;449;449	B7Z3Q7;A8K2Q2;O15439-2;Q8IVZ4;O15439	.;.;.;.;MRP4_HUMAN	S	449;449;374;449	ENSP00000388657:A449S;ENSP00000366084:A449S;ENSP00000442024:A374S;ENSP00000398562:A449S	ENSP00000366084:A449S	A	-	1	0	ABCC4	94638716	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	3.665000	0.54532	2.447000	0.82792	0.637000	0.83480	GCA	.	.	.	none		0.468	ABCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045478.2	NM_005845	
ACIN1	22985	hgsc.bcm.edu	37	14	23549484	23549484	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr14:23549484C>G	ENST00000262710.1	-	6	1561	c.1234G>C	c.(1234-1236)Gag>Cag	p.E412Q	ACIN1_ENST00000605057.1_Missense_Mutation_p.E354Q|ACIN1_ENST00000457657.1_Missense_Mutation_p.E372Q|ACIN1_ENST00000555352.1_5'Flank|ACIN1_ENST00000555053.1_Missense_Mutation_p.E412Q	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	412	Glu-rich.				apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		GGAGTCTCCTCCTCGCTGGCA	0.517																																					p.E412Q		Atlas-SNP	.											.	ACIN1	147	.	0			c.G1234C						PASS	.						59.0	61.0	61.0					14																	23549484		2203	4300	6503	SO:0001583	missense	22985	exon6			TCTCCTCCTCGCT	AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.1234G>C	chr14.hg19:g.23549484C>G	ENSP00000262710:p.Glu412Gln	222.0	0.0	.		239.0	111.0	.	NM_001164814	B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Missense_Mutation	SNP	ENST00000262710.1	hg19	CCDS9587.1	.	.	.	.	.	.	.	.	.	.	C	19.19	3.780380	0.70222	.	.	ENSG00000100813	ENST00000262710;ENST00000457657;ENST00000555053	T;T;T	0.30448	1.53;1.53;1.53	5.27	5.27	0.74061	.	0.000000	0.41605	D	0.000851	T	0.40886	0.1135	L	0.27053	0.805	0.34634	D	0.719933	D;D;D	0.67145	0.996;0.993;0.993	D;D;D	0.75484	0.986;0.968;0.968	T	0.43605	-0.9381	10	0.32370	T	0.25	-13.6658	14.2703	0.66147	0.0:1.0:0.0:0.0	.	412;412;372	G3V3M7;Q9UKV3;E7EQT4	.;ACINU_HUMAN;.	Q	412;372;412	ENSP00000262710:E412Q;ENSP00000405677:E372Q;ENSP00000451328:E412Q	ENSP00000262710:E412Q	E	-	1	0	ACIN1	22619324	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.347000	0.52200	2.752000	0.94435	0.650000	0.86243	GAG	.	.	.	none		0.517	ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071707.3	NM_014977	
SAMD4A	23034	hgsc.bcm.edu	37	14	55203876	55203876	+	Missense_Mutation	SNP	C	C	T	rs138744574	byFrequency	TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr14:55203876C>T	ENST00000554335.1	+	4	1513	c.850C>T	c.(850-852)Ctc>Ttc	p.L284F	SAMD4A_ENST00000357634.3_Missense_Mutation_p.L283F|SAMD4A_ENST00000251091.5_Intron|SAMD4A_ENST00000392067.3_Missense_Mutation_p.L284F			Q9UPU9	SMAG1_HUMAN	sterile alpha motif domain containing 4A	284					negative regulation of translation (GO:0017148)|positive regulation of translation (GO:0045727)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|synapse (GO:0045202)	poly(A) RNA binding (GO:0044822)|translation repressor activity (GO:0030371)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)	29						ACCCCAGTGCCTCCCATCCGA	0.537																																					p.L284F		Atlas-SNP	.											.	SAMD4A	68	.	0			c.C850T						PASS	.						226.0	210.0	215.0					14																	55203876		2203	4300	6503	SO:0001583	missense	23034	exon3			CAGTGCCTCCCAT	AB028976	CCDS32084.1, CCDS55917.1, CCDS55918.1, CCDS32084.2, CCDS55917.2	14q22.2	2013-01-10	2006-01-27	2006-01-27	ENSG00000020577	ENSG00000020577		"""Sterile alpha motif (SAM) domain containing"""	23023	protein-coding gene	gene with protein product	"""smaug homolog (Drosophila)"""	610747	"""sterile alpha motif domain containing 4"""	SAMD4		16221671	Standard	NM_001161577		Approved	KIAA1053, DKFZP434H0350, Smaug, SMG, SMGA, hSmaug1	uc001xbb.4	Q9UPU9	OTTHUMG00000170999	ENST00000554335.1:c.850C>T	chr14.hg19:g.55203876C>T	ENSP00000452535:p.Leu284Phe	140.0	0.0	.		130.0	52.0	.	NM_015589	A8MPZ5|Q0VA96|Q6PEW4	Missense_Mutation	SNP	ENST00000554335.1	hg19	CCDS32084.2	.	.	.	.	.	.	.	.	.	.	C	13.83	2.354282	0.41700	.	.	ENSG00000020577	ENST00000554335;ENST00000392067;ENST00000357634	.	.	.	5.15	4.19	0.49359	.	0.203527	0.35615	N	0.003096	T	0.39410	0.1077	N	0.19112	0.55	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.33317	-0.9873	9	0.56958	D	0.05	-16.9697	8.4253	0.32725	0.1972:0.7168:0.0:0.086	.	284	Q9UPU9	SMAG1_HUMAN	F	284;284;283	.	ENSP00000350261:L283F	L	+	1	0	SAMD4A	54273626	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.201000	0.32259	2.673000	0.90976	0.655000	0.94253	CTC	.	C|0.999;A|0.001	.	alt		0.537	SAMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000411186.1	NM_015589	
SYNE2	23224	hgsc.bcm.edu	37	14	64610587	64610587	+	Missense_Mutation	SNP	A	A	G	rs556819169		TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr14:64610587A>G	ENST00000344113.4	+	83	15616	c.15404A>G	c.(15403-15405)tAt>tGt	p.Y5135C	SYNE2_ENST00000555002.1_Missense_Mutation_p.Y1769C|SYNE2_ENST00000358025.3_Missense_Mutation_p.Y5135C|SYNE2_ENST00000357395.3_Missense_Mutation_p.Y1520C|SYNE2_ENST00000394768.2_Missense_Mutation_p.Y1520C|SYNE2_ENST00000554584.1_Missense_Mutation_p.Y5052C|ESR2_ENST00000542956.1_Intron	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	5135					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AGCAAGCGCTATGAAAGAACG	0.458													A|||	1	0.000199681	0.0008	0.0	5008	,	,		19135	0.0		0.0	False		,,,				2504	0.0				p.Y5135C		Atlas-SNP	.											.	SYNE2	577	.	0			c.A15404G						PASS	.						276.0	278.0	277.0					14																	64610587		2203	4300	6503	SO:0001583	missense	23224	exon83			AGCGCTATGAAAG	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.15404A>G	chr14.hg19:g.64610587A>G	ENSP00000341781:p.Tyr5135Cys	216.0	1.0	.		169.0	88.0	.	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	hg19	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	A	16.34	3.096384	0.56075	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768	T;T;T;T;T;T	0.52754	1.32;0.65;1.32;1.32;0.67;0.65	5.33	5.33	0.75918	.	0.000000	0.48286	D	0.000190	T	0.67979	0.2951	M	0.73598	2.24	0.80722	D	1	B;D;B;P	0.89917	0.081;1.0;0.382;0.644	B;D;B;B	0.73380	0.094;0.98;0.146;0.307	T	0.70633	-0.4818	10	0.51188	T	0.08	.	15.2733	0.73723	1.0:0.0:0.0:0.0	.	1520;5052;5135;5135	Q8WXH0-7;G3V5X4;Q8WXH0;Q8WXH0-2	.;.;SYNE2_HUMAN;.	C	5135;1520;5135;5052;5058;1769;1520	ENSP00000350719:Y5135C;ENSP00000349969:Y1520C;ENSP00000341781:Y5135C;ENSP00000452570:Y5052C;ENSP00000450831:Y1769C;ENSP00000378249:Y1520C	ENSP00000261678:Y5058C	Y	+	2	0	SYNE2	63680340	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.285000	0.65633	2.004000	0.58718	0.528000	0.53228	TAT	.	.	.	none		0.458	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
MTHFD1	4522	hgsc.bcm.edu	37	14	64924942	64924942	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr14:64924942T>C	ENST00000216605.8	+	27	2807	c.2729T>C	c.(2728-2730)aTg>aCg	p.M910T	MTHFD1_ENST00000545908.1_Intron|ZBTB25_ENST00000555220.1_Intron|ZBTB25_ENST00000555424.1_Intron|MTHFD1_ENST00000556284.1_3'UTR	NM_005956.3	NP_005947.3	P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase	910	Formyltetrahydrofolate synthetase.				folic acid metabolic process (GO:0046655)|folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)|methylenetetrahydrofolate dehydrogenase [NAD(P)+] activity (GO:0004486)			endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	30				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	Tetrahydrofolic acid(DB00116)	ATGAGCACAATGCCTGGACTC	0.448																																					p.M910T	Colon(18;220 581 13419 18191 31512)|GBM(126;343 1658 28700 44425 52519)	Atlas-SNP	.											.	MTHFD1	61	.	0			c.T2729C						PASS	.						141.0	140.0	141.0					14																	64924942		2203	4300	6503	SO:0001583	missense	4522	exon27			GCACAATGCCTGG	J04031	CCDS9763.1	14q24	2004-12-13			ENSG00000100714	ENSG00000100714	1.5.1.15, 3.5.4.-		7432	protein-coding gene	gene with protein product		172460		MTHFC, MTHFD		3053686, 2786332	Standard	NM_005956		Approved		uc001xhb.3	P11586	OTTHUMG00000141309	ENST00000216605.8:c.2729T>C	chr14.hg19:g.64924942T>C	ENSP00000216605:p.Met910Thr	67.0	0.0	.		57.0	24.0	.	NM_005956	B2R5Y2|G3V2B8|Q86VC9|Q9BVP5	Missense_Mutation	SNP	ENST00000216605.8	hg19	CCDS9763.1	.	.	.	.	.	.	.	.	.	.	T	19.87	3.906782	0.72868	.	.	ENSG00000100714	ENST00000555709;ENST00000216605	T;T	0.29142	1.58;1.58	5.27	5.27	0.74061	.	0.179769	0.64402	D	0.000011	T	0.65831	0.2729	H	0.98199	4.17	0.80722	D	1	P	0.43909	0.821	P	0.54140	0.743	T	0.78607	-0.2138	10	0.87932	D	0	-32.6795	14.6571	0.68841	0.0:0.0:0.0:1.0	.	910	G3V2B8	.	T	910;966	ENSP00000450560:M910T;ENSP00000216605:M966T	ENSP00000216605:M910T	M	+	2	0	MTHFD1	63994695	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.503000	0.81632	2.117000	0.64856	0.482000	0.46254	ATG	.	.	.	none		0.448	MTHFD1-019	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000471593.1		
RDH11	51109	hgsc.bcm.edu	37	14	68159767	68159767	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr14:68159767T>G	ENST00000381346.4	-	2	187	c.77A>C	c.(76-78)aAa>aCa	p.K26T	RDH11_ENST00000553384.1_Missense_Mutation_p.K26T|RP11-1012A1.4_ENST00000554493.1_5'Flank|RP11-1012A1.4_ENST00000553306.1_5'Flank|RDH11_ENST00000428130.2_Missense_Mutation_p.K26T	NM_001252650.1|NM_016026.3	NP_001239579.1|NP_057110.3	Q8TC12	RDH11_HUMAN	retinol dehydrogenase 11 (all-trans/9-cis/11-cis)	26					adaptation of rhodopsin mediated signaling (GO:0016062)|phototransduction, visible light (GO:0007603)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|photoreceptor inner segment (GO:0001917)	NADP-retinol dehydrogenase activity (GO:0052650)|retinol dehydrogenase activity (GO:0004745)			breast(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(3)|ovary(1)	12				all cancers(60;0.00047)|OV - Ovarian serous cystadenocarcinoma(108;0.00206)|BRCA - Breast invasive adenocarcinoma(234;0.00924)	Vitamin A(DB00162)	GGACAGCATTTTCCTGCAGAC	0.483																																					p.K26T		Atlas-SNP	.											.	RDH11	21	.	0			c.A77C						PASS	.						94.0	86.0	89.0					14																	68159767		2203	4300	6503	SO:0001583	missense	51109	exon2			AGCATTTTCCTGC	AF151840	CCDS32104.1, CCDS58326.1	14q24.1	2013-10-15	2006-05-09		ENSG00000072042	ENSG00000072042	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	17964	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 1"", ""androgen-regulated short-chain dehydrogenase/reductase 1"""	607849	"""retinol dehydrogenase 11 (all-trans and 9-cis)"""			12226107, 8018917, 19027726	Standard	NM_016026		Approved	MDT1, SDR7C1, ARSDR1	uc001xjv.4	Q8TC12	OTTHUMG00000171196	ENST00000381346.4:c.77A>C	chr14.hg19:g.68159767T>G	ENSP00000370750:p.Lys26Thr	96.0	0.0	.		93.0	35.0	.	NM_001252650	A6NDK3|A8K062|B2RB26|B4DDW0|Q0QD40|Q6IAH5|Q9NRW0|Q9Y391	Missense_Mutation	SNP	ENST00000381346.4	hg19	CCDS32104.1	.	.	.	.	.	.	.	.	.	.	T	14.89	2.669280	0.47677	.	.	ENSG00000072042	ENST00000381346;ENST00000553384;ENST00000428130;ENST00000557273;ENST00000557726	D;D;D;D;D	0.90133	-1.78;-1.5;-1.91;-2.34;-2.62	5.31	4.17	0.49024	.	0.298500	0.36234	N	0.002701	D	0.83459	0.5259	N	0.19112	0.55	0.38302	D	0.943	P;P;P	0.47910	0.902;0.716;0.594	P;P;B	0.45681	0.476;0.49;0.295	T	0.81688	-0.0819	10	0.34782	T	0.22	.	7.5042	0.27534	0.0:0.1787:0.0:0.8213	.	26;26;26	B4DDW0;Q8TC12-2;Q8TC12	.;.;RDH11_HUMAN	T	26	ENSP00000370750:K26T;ENSP00000452079:K26T;ENSP00000416395:K26T;ENSP00000450651:K26T;ENSP00000450435:K26T	ENSP00000370750:K26T	K	-	2	0	RDH11	67229520	0.987000	0.35691	0.999000	0.59377	0.943000	0.58893	1.910000	0.39927	1.044000	0.40200	0.533000	0.62120	AAA	.	.	.	none		0.483	RDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412257.3		
NUSAP1	51203	hgsc.bcm.edu	37	15	41657726	41657726	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr15:41657726A>G	ENST00000559596.1	+	7	874	c.787A>G	c.(787-789)Acc>Gcc	p.T263A	NUSAP1_ENST00000558123.1_3'UTR|NUSAP1_ENST00000560747.1_Missense_Mutation_p.T261A|NUSAP1_ENST00000450318.1_Missense_Mutation_p.T263A|NUSAP1_ENST00000414849.2_Missense_Mutation_p.T262A|NUSAP1_ENST00000260359.6_Missense_Mutation_p.T248A|NUSAP1_ENST00000450592.2_Missense_Mutation_p.T239A|NUSAP1_ENST00000560177.1_Missense_Mutation_p.T262A			Q9BXS6	NUSAP_HUMAN	nucleolar and spindle associated protein 1	263	Interaction with microtubules. {ECO:0000250}.				establishment of mitotic spindle localization (GO:0040001)|mitotic chromosome condensation (GO:0007076)|mitotic cytokinesis (GO:0000281)|mitotic sister chromatid segregation (GO:0000070)|positive regulation of mitosis (GO:0045840)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(3)|ovary(1)|prostate(2)|urinary_tract(2)	13		all_cancers(109;5.07e-19)|all_epithelial(112;2.43e-16)|Lung NSC(122;1.81e-11)|all_lung(180;4.81e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;9.63e-17)|GBM - Glioblastoma multiforme(113;1.59e-06)|BRCA - Breast invasive adenocarcinoma(123;0.168)		AAGTCAGAGTACCTTGGGTCT	0.512																																					p.T263A		Atlas-SNP	.											.	NUSAP1	32	.	0			c.A787G						PASS	.						35.0	34.0	34.0					15																	41657726		1905	4133	6038	SO:0001583	missense	51203	exon7			CAGAGTACCTTGG	AF290612	CCDS45234.1, CCDS45236.1, CCDS58356.1, CCDS58357.1, CCDS58358.1, CCDS73708.1	15q14	2008-02-05				ENSG00000137804			18538	protein-coding gene	gene with protein product		612818				12963707	Standard	NM_016359		Approved	FLJ13421, LNP, ANKT, NuSAP1, SAPL, BM037, PRO0310p1, Q0310	uc001zns.4	Q9BXS6		ENST00000559596.1:c.787A>G	chr15.hg19:g.41657726A>G	ENSP00000453403:p.Thr263Ala	72.0	0.0	.		88.0	32.0	.	NM_016359	B4DDF1|E7ERR5|J3KN21|Q53GW2|Q8TBT4|Q96E58|Q96FJ1|Q9GZM9|Q9NZ85|Q9UI70	Missense_Mutation	SNP	ENST00000559596.1	hg19	CCDS45234.1	.	.	.	.	.	.	.	.	.	.	A	10.68	1.417901	0.25552	.	.	ENSG00000137804	ENST00000260359;ENST00000414849;ENST00000450318;ENST00000450592	T;T;T	0.33438	1.41;1.41;1.41	4.64	0.0292	0.14161	.	0.492803	0.22030	N	0.065603	T	0.18383	0.0441	L	0.45137	1.4	0.09310	N	1	B;B;B;B;B;B;B	0.20671	0.018;0.018;0.047;0.037;0.023;0.047;0.047	B;B;B;B;B;B;B	0.20767	0.007;0.016;0.031;0.022;0.007;0.031;0.031	T	0.22800	-1.0206	10	0.15499	T	0.54	.	3.8119	0.08801	0.5416:0.1864:0.272:0.0	.	239;263;261;262;263;263;262	E7ERR5;E9PB35;Q9BXS6-3;Q9BXS6-5;A8K4B4;Q9BXS6;Q9BXS6-2	.;.;.;.;.;NUSAP_HUMAN;.	A	263;262;263;239	ENSP00000400746:T262A;ENSP00000401351:T263A;ENSP00000401014:T239A	ENSP00000260359:T263A	T	+	1	0	NUSAP1	39445018	0.167000	0.22975	0.004000	0.12327	0.008000	0.06430	1.620000	0.36976	-0.153000	0.11137	-0.438000	0.05819	ACC	.	.	.	none		0.512	NUSAP1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000419427.1	NM_016359	
TP53BP1	7158	hgsc.bcm.edu	37	15	43771711	43771711	+	Silent	SNP	T	T	C			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr15:43771711T>C	ENST00000263801.3	-	7	909	c.657A>G	c.(655-657)gaA>gaG	p.E219E	TP53BP1_ENST00000450115.2_Silent_p.E224E|TP53BP1_ENST00000382039.3_Silent_p.E224E|TP53BP1_ENST00000382044.4_Silent_p.E224E	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	219					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)			breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		TGGACTGTTCTTCATGCTTAA	0.378								Other conserved DNA damage response genes																													p.E224E		Atlas-SNP	.											.	TP53BP1	157	.	0			c.A672G						PASS	.						233.0	184.0	201.0					15																	43771711		2201	4298	6499	SO:0001819	synonymous_variant	7158	exon7			CTGTTCTTCATGC	U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.657A>G	chr15.hg19:g.43771711T>C		270.0	0.0	.		287.0	103.0	.	NM_001141980	F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Silent	SNP	ENST00000263801.3	hg19	CCDS10096.1																																																																																			.	.	.	none		0.378	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132897.3		
CATSPER2	117155	hgsc.bcm.edu	37	15	43940128	43940128	+	Silent	SNP	G	G	A			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr15:43940128G>A	ENST00000321596.5	-	2	331	c.132C>T	c.(130-132)atC>atT	p.I44I	STRC_ENST00000541030.1_Intron|CATSPER2_ENST00000396879.1_Silent_p.I44I|CATSPER2_ENST00000464721.1_Intron|CATSPER2_ENST00000354127.4_Silent_p.I44I|CATSPER2_ENST00000381761.1_Silent_p.I50I|CATSPER2_ENST00000355438.2_Silent_p.I44I			Q96P56	CTSR2_HUMAN	cation channel, sperm associated 2	44					calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)		GTAACTCCCTGATAGTGTGCC	0.453																																					p.I44I		Atlas-SNP	.											CATSPER2,right_upper_lobe,carcinoma,0,1	CATSPER2	49	.	0			c.C132T						PASS	.						118.0	123.0	122.0					15																	43940128		2199	4296	6495	SO:0001819	synonymous_variant	117155	exon2			CTCCCTGATAGTG	AF411817	CCDS10099.1, CCDS32216.1, CCDS73714.1	15q15.3	2011-07-05			ENSG00000166762	ENSG00000166762		"""Voltage-gated ion channels / Cation channels, sperm associated"""	18810	protein-coding gene	gene with protein product		607249				11675491, 16382101	Standard	NM_172095		Approved		uc001zsh.3	Q96P56	OTTHUMG00000059902	ENST00000321596.5:c.132C>T	chr15.hg19:g.43940128G>A		486.0	2.0	.		454.0	184.0	.	NM_172097	Q8NHT9|Q96P54|Q96P55	Silent	SNP	ENST00000321596.5	hg19	CCDS10099.1																																																																																			.	.	.	none		0.453	CATSPER2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000133151.2	NM_054020	
DAPK2	23604	hgsc.bcm.edu	37	15	64204316	64204316	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr15:64204316C>G	ENST00000457488.1	-	10	969	c.939G>C	c.(937-939)agG>agC	p.R313S	DAPK2_ENST00000261891.3_Missense_Mutation_p.R313S	NM_014326.3	NP_055141.2	Q9UIK4	DAPK2_HUMAN	death-associated protein kinase 2	313	Calmodulin-binding.				anoikis (GO:0043276)|apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of intrinsic apoptotic signaling pathway (GO:2001242)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	11				LUAD - Lung adenocarcinoma(2;0.215)		CCTTCCACCGCCTGCGGACAT	0.622																																					p.R313S		Atlas-SNP	.											.	DAPK2	31	.	0			c.G939C						PASS	.						59.0	48.0	52.0					15																	64204316		2203	4300	6503	SO:0001583	missense	23604	exon10			CCACCGCCTGCGG	AB018001	CCDS10188.1	15q22.1	2008-07-18			ENSG00000035664	ENSG00000035664			2675	protein-coding gene	gene with protein product						10376525	Standard	XM_005254265		Approved	DRP-1, MGC119312	uc002amr.3	Q9UIK4	OTTHUMG00000132947	ENST00000457488.1:c.939G>C	chr15.hg19:g.64204316C>G	ENSP00000408277:p.Arg313Ser	47.0	0.0	.		64.0	38.0	.	NM_014326	E9JGM7|O75892|Q24JS1	Missense_Mutation	SNP	ENST00000457488.1	hg19	CCDS10188.1	.	.	.	.	.	.	.	.	.	.	C	19.18	3.777111	0.70107	.	.	ENSG00000035664	ENST00000261891;ENST00000457488	T;T	0.68025	-0.3;-0.3	5.15	3.28	0.37604	Protein kinase-like domain (1);	0.000000	0.64402	D	0.000011	T	0.74191	0.3684	M	0.70275	2.135	0.43054	D	0.994667	D	0.67145	0.996	P	0.58454	0.839	T	0.74213	-0.3738	10	0.62326	D	0.03	.	8.8262	0.35057	0.0:0.8244:0.0:0.1756	.	313	Q9UIK4	DAPK2_HUMAN	S	313	ENSP00000261891:R313S;ENSP00000408277:R313S	ENSP00000261891:R313S	R	-	3	2	DAPK2	61991369	1.000000	0.71417	0.982000	0.44146	0.974000	0.67602	1.554000	0.36266	0.573000	0.29400	-0.192000	0.12808	AGG	.	.	.	none		0.622	DAPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256479.1	NM_014326	
SENP8	123228	hgsc.bcm.edu	37	15	72432461	72432461	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr15:72432461A>T	ENST00000542035.2	+	2	830	c.497A>T	c.(496-498)tAc>tTc	p.Y166F	SENP8_ENST00000544171.1_Missense_Mutation_p.Y166F|SENP8_ENST00000544411.1_Missense_Mutation_p.Y166F|RP11-2I17.4_ENST00000568984.1_RNA|SENP8_ENST00000340912.4_Missense_Mutation_p.Y166F	NM_001166340.1	NP_001159812.1	Q96LD8	SENP8_HUMAN	SUMO/sentrin specific peptidase family member 8	166	Protease.						cysteine-type peptidase activity (GO:0008234)			breast(1)|kidney(2)|lung(1)|ovary(1)|skin(1)	6						TGTGGGATGTACGTGATATGT	0.478																																					p.Y166F		Atlas-SNP	.											.	SENP8	18	.	0			c.A497T						PASS	.						117.0	113.0	114.0					15																	72432461		2199	4297	6496	SO:0001583	missense	123228	exon2			GGATGTACGTGAT	BC031411	CCDS10240.1	15q22.33	2005-08-17	2005-08-17	2004-01-30	ENSG00000166192	ENSG00000166192			22992	protein-coding gene	gene with protein product	"""NEDD8-specific protease 1"", ""sentrin/SUMO-specific protease SENP8"", ""deneddylase 1"""	608659	"""protease, cysteine, 2 (NEDD8 specific)"", ""SUMO/sentrin specific protease family member 8"""	PRSC2		12730221, 12759362	Standard	NM_145204		Approved	NEDP1, DEN1, HsT17512	uc021spt.1	Q96LD8	OTTHUMG00000133441	ENST00000542035.2:c.497A>T	chr15.hg19:g.72432461A>T	ENSP00000446057:p.Tyr166Phe	33.0	0.0	.		33.0	10.0	.	NM_001166340	Q96QA4	Missense_Mutation	SNP	ENST00000542035.2	hg19	CCDS10240.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.150452	0.78001	.	.	ENSG00000166192	ENST00000542035;ENST00000544411;ENST00000340912;ENST00000544171	T;T;T;T	0.36699	1.24;1.24;1.24;1.24	5.86	4.72	0.59763	.	0.000000	0.85682	D	0.000000	T	0.46151	0.1378	L	0.51853	1.615	0.58432	D	0.999999	D	0.56521	0.976	P	0.56751	0.805	T	0.24657	-1.0154	10	0.25106	T	0.35	-15.1718	13.2186	0.59875	0.867:0.133:0.0:0.0	.	166	Q96LD8	SENP8_HUMAN	F	166	ENSP00000446057:Y166F;ENSP00000441753:Y166F;ENSP00000340505:Y166F;ENSP00000439415:Y166F	ENSP00000340505:Y166F	Y	+	2	0	SENP8	70219515	1.000000	0.71417	0.921000	0.36526	0.907000	0.53573	9.228000	0.95250	1.018000	0.39521	-0.323000	0.08544	TAC	.	.	.	none		0.478	SENP8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420036.1	NM_145204	
PARP6	56965	hgsc.bcm.edu	37	15	72543559	72543559	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr15:72543559G>A	ENST00000569795.1	-	17	1984	c.1297C>T	c.(1297-1299)Cct>Tct	p.P433S	PARP6_ENST00000260376.7_Missense_Mutation_p.P433S|PARP6_ENST00000413097.2_5'UTR|PARP6_ENST00000287196.9_Missense_Mutation_p.P433S			Q2NL67	PARP6_HUMAN	poly (ADP-ribose) polymerase family, member 6	433	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.						NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(8)|skin(1)|urinary_tract(1)	18						CTGCTGAGAGGTAGTTTGACA	0.413																																					p.P433S		Atlas-SNP	.											.	PARP6	44	.	0			c.C1297T						PASS	.						104.0	99.0	101.0					15																	72543559		1869	4113	5982	SO:0001583	missense	56965	exon16			TGAGAGGTAGTTT	AL390093	CCDS10241.2	15q22	2010-02-16			ENSG00000137817	ENSG00000137817		"""Poly (ADP-ribose) polymerases"""	26921	protein-coding gene	gene with protein product						15273990	Standard	XM_005254557		Approved	pART17	uc002auc.3	Q2NL67	OTTHUMG00000133443	ENST00000569795.1:c.1297C>T	chr15.hg19:g.72543559G>A	ENSP00000456348:p.Pro433Ser	90.0	0.0	.		100.0	48.0	.	NM_020214	Q9H7C5|Q9H9X6|Q9HAF3|Q9NPS6|Q9UFG4	Missense_Mutation	SNP	ENST00000569795.1	hg19	CCDS10241.2	.	.	.	.	.	.	.	.	.	.	G	23.1	4.378759	0.82682	.	.	ENSG00000137817	ENST00000419739;ENST00000287196;ENST00000260376;ENST00000413097	.	.	.	5.14	4.22	0.49857	Poly(ADP-ribose) polymerase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.66317	0.2777	L	0.41824	1.3	0.80722	D	1	B;D;D	0.89917	0.374;0.993;1.0	B;D;D	0.80764	0.117;0.979;0.994	T	0.66586	-0.5886	9	0.46703	T	0.11	-4.7079	12.9482	0.58384	0.0779:0.0:0.9221:0.0	.	433;433;365	Q0VDG0;Q2NL67;A0PJ50	.;PARP6_HUMAN;.	S	433;433;433;278	.	ENSP00000260376:P433S	P	-	1	0	PARP6	70330613	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.539000	0.98076	1.386000	0.46466	0.655000	0.94253	CCT	.	.	.	none		0.413	PARP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257315.2	NM_020214	
OR4F6	390648	hgsc.bcm.edu	37	15	102346642	102346642	+	Silent	SNP	G	G	T			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr15:102346642G>T	ENST00000328882.4	+	1	741	c.720G>T	c.(718-720)ctG>ctT	p.L240L		NM_001005326.1	NP_001005326.1	Q8NGB9	OR4F6_HUMAN	olfactory receptor, family 4, subfamily F, member 6	240						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(1)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			TCTCTATGCTGTCAGCTCATG	0.353																																					p.L240L		Atlas-SNP	.											.	OR4F6	45	.	0			c.G720T						PASS	.						172.0	165.0	167.0					15																	102346642		2202	4300	6502	SO:0001819	synonymous_variant	390648	exon1			TATGCTGTCAGCT	AC025234	CCDS32341.1	15q26.3	2014-02-19	2002-02-28		ENSG00000184140	ENSG00000184140		"""GPCR / Class A : Olfactory receptors"""	15372	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily F, member 12"""	OR4F12			Standard	NM_001005326		Approved		uc010utr.2	Q8NGB9	OTTHUMG00000172267	ENST00000328882.4:c.720G>T	chr15.hg19:g.102346642G>T		180.0	0.0	.		124.0	42.0	.	NM_001005326	B9EH28|Q6IF95	Silent	SNP	ENST00000328882.4	hg19	CCDS32341.1																																																																																			.	.	.	none		0.353	OR4F6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417593.1		
PLK1	5347	hgsc.bcm.edu	37	16	23690422	23690422	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr16:23690422C>A	ENST00000300093.4	+	1	280	c.169C>A	c.(169-171)Cgc>Agc	p.R57S	PLK1_ENST00000564202.1_3'UTR	NM_005030.3	NP_005021.2	P53350	PLK1_HUMAN	polo-like kinase 1	57	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|centrosome organization (GO:0051297)|cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|G2 DNA damage checkpoint (GO:0031572)|G2/M transition of mitotic cell cycle (GO:0000086)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-serine phosphorylation (GO:0018105)|polar body extrusion after meiotic divisions (GO:0040038)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of proteolysis (GO:0045862)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein destabilization (GO:0031648)|protein localization to chromatin (GO:0071168)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of mitotic cell cycle (GO:0007346)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of protein binding (GO:0043393)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to antibiotic (GO:0046677)	centrosome (GO:0005813)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	anaphase-promoting complex binding (GO:0010997)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|microtubule binding (GO:0008017)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				GBM - Glioblastoma multiforme(48;0.0156)		TGTGCGGGGCCGCTTTTTGGG	0.657																																					p.R57S	Colon(12;240 564 27038 33155)	Atlas-SNP	.											.	PLK1	67	.	0			c.C169A						PASS	.						16.0	19.0	18.0					16																	23690422		2197	4300	6497	SO:0001583	missense	5347	exon1			CGGGGCCGCTTTT		CCDS10616.1	16p	2013-01-17	2010-06-24	2004-01-28	ENSG00000166851	ENSG00000166851			9077	protein-coding gene	gene with protein product		602098	"""polo-like kinase (Drosophila)"""	PLK		8127874	Standard	NM_005030		Approved		uc002dlz.1	P53350	OTTHUMG00000096984	ENST00000300093.4:c.169C>A	chr16.hg19:g.23690422C>A	ENSP00000300093:p.Arg57Ser	98.0	0.0	.		157.0	60.0	.	NM_005030	Q15153|Q99746	Missense_Mutation	SNP	ENST00000300093.4	hg19	CCDS10616.1	.	.	.	.	.	.	.	.	.	.	C	19.62	3.861173	0.71949	.	.	ENSG00000166851	ENST00000300093;ENST00000330792	T	0.25579	1.79	4.08	3.09	0.35607	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.24699	0.0599	L	0.37630	1.12	0.80722	D	1	P	0.49090	0.919	P	0.49752	0.621	T	0.01600	-1.1315	10	0.44086	T	0.13	-18.3883	7.0374	0.25000	0.198:0.6098:0.1921:0.0	.	57	P53350	PLK1_HUMAN	S	57	ENSP00000300093:R57S	ENSP00000300093:R57S	R	+	1	0	PLK1	23597923	0.986000	0.35501	0.991000	0.47740	0.995000	0.86356	2.740000	0.47418	1.026000	0.39733	0.561000	0.74099	CGC	.	.	.	none		0.657	PLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214057.2	NM_005030	
LONP2	83752	hgsc.bcm.edu	37	16	48311386	48311386	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr16:48311386T>G	ENST00000285737.4	+	8	1472	c.1379T>G	c.(1378-1380)cTt>cGt	p.L460R	LONP2_ENST00000535754.1_Missense_Mutation_p.L416R	NM_031490.2	NP_113678.2			lon peptidase 2, peroxisomal											breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						GCAGCTCTGCTTGAGGTAAGA	0.438																																					p.L460R		Atlas-SNP	.											.	LONP2	63	.	0			c.T1379G						PASS	.						81.0	73.0	76.0					16																	48311386		2200	4300	6500	SO:0001583	missense	83752	exon8			CTCTGCTTGAGGT	AJ548761	CCDS10734.1, CCDS73880.1	16q12.1	2010-04-21			ENSG00000102910	ENSG00000102910		"""ATPases / AAA-type"""	20598	protein-coding gene	gene with protein product						14561759	Standard	XM_005256191		Approved	MGC4840, LONP, LONPL	uc002efi.1	Q86WA8	OTTHUMG00000133144	ENST00000285737.4:c.1379T>G	chr16.hg19:g.48311386T>G	ENSP00000285737:p.Leu460Arg	123.0	0.0	.		188.0	63.0	.	NM_031490		Missense_Mutation	SNP	ENST00000285737.4	hg19	CCDS10734.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.426428	0.83667	.	.	ENSG00000102910	ENST00000285737;ENST00000544734;ENST00000535754;ENST00000416006	T;T;T	0.55760	0.5;0.5;0.5	5.96	5.96	0.96718	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.85592	0.5732	H	0.99705	4.715	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.92181	0.5751	10	0.87932	D	0	-17.8825	16.4277	0.83824	0.0:0.0:0.0:1.0	.	416;460	B7ZKL7;Q86WA8	.;LONP2_HUMAN	R	460;189;416;416	ENSP00000285737:L460R;ENSP00000445426:L416R;ENSP00000415983:L416R	ENSP00000285737:L460R	L	+	2	0	LONP2	46868887	1.000000	0.71417	0.992000	0.48379	0.761000	0.43186	7.996000	0.88334	2.279000	0.76181	0.533000	0.62120	CTT	.	.	.	none		0.438	LONP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256839.2	NM_031490	
GUCY2D	3000	hgsc.bcm.edu	37	17	7910749	7910749	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr17:7910749G>A	ENST00000254854.4	+	6	1619	c.1469G>A	c.(1468-1470)cGg>cAg	p.R490Q		NM_000180.3	NP_000171.1	Q02846	GUC2D_HUMAN	guanylate cyclase 2D, membrane (retina-specific)	490					intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)	p.R490Q(1)		skin(1)	1		Prostate(122;0.157)				ACCAGGCACCGGCTACTTCAC	0.592																																					p.R490Q		Atlas-SNP	.											GUCY2D_ENST00000254854,NS,carcinoma,0,1	GUCY2D	82	.	1	Substitution - Missense(1)	lung(1)	c.G1469A						PASS	.						105.0	102.0	103.0					17																	7910749		2203	4300	6503	SO:0001583	missense	3000	exon6			GGCACCGGCTACT	L26921	CCDS11127.1	17p13.1	2013-06-06			ENSG00000132518	ENSG00000132518			4689	protein-coding gene	gene with protein product		600179	"""cone rod dystrophy 6"""	CORD6, LCA, GUC2D, GUC1A4		1356371, 12552567	Standard	NM_000180		Approved	retGC, RETGC-1, ROS-GC1, CYGD, LCA1	uc002gjt.2	Q02846	OTTHUMG00000108169	ENST00000254854.4:c.1469G>A	chr17.hg19:g.7910749G>A	ENSP00000254854:p.Arg490Gln	90.0	0.0	.		88.0	6.0	.	NM_000180	Q6LEA7	Missense_Mutation	SNP	ENST00000254854.4	hg19	CCDS11127.1	.	.	.	.	.	.	.	.	.	.	G	13.95	2.388655	0.42308	.	.	ENSG00000132518	ENST00000254854	D	0.83591	-1.74	5.52	0.753	0.18404	.	0.440036	0.19338	N	0.116724	T	0.74261	0.3693	L	0.41710	1.295	0.18873	N	0.999989	B	0.22146	0.065	B	0.11329	0.006	T	0.59768	-0.7392	10	0.28530	T	0.3	.	14.1923	0.65646	0.2084:0.0:0.7916:0.0	.	490	Q02846	GUC2D_HUMAN	Q	490	ENSP00000254854:R490Q	ENSP00000254854:R490Q	R	+	2	0	GUCY2D	7851474	0.946000	0.32159	0.998000	0.56505	0.972000	0.66771	2.884000	0.48562	0.309000	0.22966	-1.267000	0.01435	CGG	.	.	.	none		0.592	GUCY2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226973.2		
KIAA0100	9703	hgsc.bcm.edu	37	17	26938587	26938587	+	IGR	SNP	A	A	G			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr17:26938587A>G	ENST00000528896.2	-	0	7407				RP11-192H23.4_ENST00000534850.1_3'UTR|SGK494_ENST00000301037.5_Missense_Mutation_p.M270T|RP11-192H23.6_ENST00000579019.2_RNA|SPAG5-AS1_ENST00000414744.1_RNA|SPAG5-AS1_ENST00000554154.1_RNA|RP11-192H23.4_ENST00000577790.1_Intron|SGK494_ENST00000469832.3_5'Flank|SPAG5-AS1_ENST00000424210.1_RNA	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100							extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					TCTCTCACCCATGTACTGAAG	0.502																																					p.M270T		Atlas-SNP	.											.	.	.	.	0			c.T809C						PASS	.						184.0	156.0	165.0					17																	26938587		2203	4300	6503	SO:0001628	intergenic_variant	0	exon9			TCACCCATGTACT	D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587		chr17.hg19:g.26938587A>G		89.0	0.0	.		116.0	39.0	.	NM_001174103	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	ENST00000528896.2	hg19	CCDS32595.1	.	.	.	.	.	.	.	.	.	.	A	16.88	3.245285	0.59103	.	.	ENSG00000167524	ENST00000301037	T	0.09817	2.94	5.45	5.45	0.79879	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.41766	0.1173	M	0.91972	3.26	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.53229	-0.8468	10	0.87932	D	0	-18.3153	14.6957	0.69121	1.0:0.0:0.0:0.0	.	270	Q96LW2	SG494_HUMAN	T	270	ENSP00000301037:M270T	ENSP00000301037:M270T	M	-	2	0	AC005726.6	23962714	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.546000	0.73887	2.074000	0.62210	0.383000	0.25322	ATG	.	.	.	none		0.502	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	NM_014680	
EFCAB5	374786	hgsc.bcm.edu	37	17	28296149	28296149	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr17:28296149A>T	ENST00000394835.3	+	4	723	c.531A>T	c.(529-531)aaA>aaT	p.K177N	EFCAB5_ENST00000541045.1_Intron|EFCAB5_ENST00000536908.2_Missense_Mutation_p.K121N|EFCAB5_ENST00000320856.5_Missense_Mutation_p.K177N|EFCAB5_ENST00000534836.2_Intron|EFCAB5_ENST00000378738.3_Missense_Mutation_p.K177N|EFCAB5_ENST00000394832.2_Missense_Mutation_p.K177N	NM_198529.3	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5	177							calcium ion binding (GO:0005509)			breast(7)|endometrium(2)|kidney(4)|large_intestine(11)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						TGCTTGACAAACTTCTACCCA	0.373																																					p.K177N		Atlas-SNP	.											.	EFCAB5	122	.	0			c.A531T						PASS	.						45.0	43.0	44.0					17																	28296149		1839	4090	5929	SO:0001583	missense	374786	exon4			TGACAAACTTCTA	AL833911	CCDS11254.2, CCDS54103.1	17q11.2	2013-01-10			ENSG00000176927	ENSG00000176927		"""EF-hand domain containing"""	24801	protein-coding gene	gene with protein product							Standard	NM_198529		Approved	FLJ46247	uc002het.3	A4FU69	OTTHUMG00000132753	ENST00000394835.3:c.531A>T	chr17.hg19:g.28296149A>T	ENSP00000378312:p.Lys177Asn	162.0	0.0	.		118.0	52.0	.	NM_198529	B2RPN0|B4DS75|B4DZR5|F5GYL2|Q0VD68|Q6ZRM6|Q8NDG9	Missense_Mutation	SNP	ENST00000394835.3	hg19	CCDS11254.2	.	.	.	.	.	.	.	.	.	.	A	11.59	1.682704	0.29872	.	.	ENSG00000176927	ENST00000536908;ENST00000421238;ENST00000394835;ENST00000320856;ENST00000394832;ENST00000378738;ENST00000423598	T;T;T;T;T	0.32023	1.51;2.55;2.51;1.81;1.47	5.57	-0.614	0.11590	.	.	.	.	.	T	0.36771	0.0979	L	0.33485	1.01	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.995;0.995	D;D;D;D	0.91635	0.999;0.999;0.909;0.909	T	0.10177	-1.0641	8	.	.	.	-14.4895	8.1332	0.31039	0.4603:0.1168:0.4229:0.0	.	121;177;177;177	F5GYL2;B5MEA3;E7EVS9;A4FU69	.;.;.;EFCB5_HUMAN	N	121;121;177;177;177;177;121	ENSP00000440619:K121N;ENSP00000378312:K177N;ENSP00000322003:K177N;ENSP00000378309:K177N;ENSP00000368012:K177N	.	K	+	3	2	EFCAB5	25320275	1.000000	0.71417	0.998000	0.56505	0.492000	0.33523	0.654000	0.24918	-0.080000	0.12685	-0.290000	0.09829	AAA	.	.	.	none		0.373	EFCAB5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256120.4	NM_198529	
PTRF	284119	hgsc.bcm.edu	37	17	40557359	40557359	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr17:40557359T>A	ENST00000357037.5	-	2	938	c.519A>T	c.(517-519)aaA>aaT	p.K173N		NM_012232.5	NP_036364.2			polymerase I and transcript release factor											breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|urinary_tract(1)	17		all_cancers(22;0.00146)|Breast(137;0.00116)|all_epithelial(22;0.0134)		BRCA - Breast invasive adenocarcinoma(366;0.193)		CCTCCGACTCTTTCAGCGATT	0.652																																					p.K173N		Atlas-SNP	.											.	PTRF	48	.	0			c.A519T						PASS	.						79.0	86.0	83.0					17																	40557359		2202	4300	6502	SO:0001583	missense	284119	exon2			CGACTCTTTCAGC	AF000421	CCDS11425.1	17q21.31	2011-04-20				ENSG00000177469			9688	protein-coding gene	gene with protein product		603198				9582279	Standard	NM_012232		Approved	cavin-1, CAVIN1	uc002hzo.3	Q6NZI2		ENST00000357037.5:c.519A>T	chr17.hg19:g.40557359T>A	ENSP00000349541:p.Lys173Asn	16.0	0.0	.		20.0	4.0	.	NM_012232		Missense_Mutation	SNP	ENST00000357037.5	hg19	CCDS11425.1	.	.	.	.	.	.	.	.	.	.	T	16.67	3.186520	0.57909	.	.	ENSG00000177469	ENST00000357037;ENST00000357684	T	0.60171	0.21	5.35	-3.31	0.04988	.	0.183494	0.47455	D	0.000233	T	0.61924	0.2386	M	0.72353	2.195	0.50813	D	0.999894	D;D	0.56035	0.974;0.974	P;P	0.53146	0.719;0.719	T	0.65352	-0.6189	10	0.30078	T	0.28	-16.9364	14.7183	0.69286	0.0:0.6953:0.0:0.3047	.	155;173	B4DNU9;Q6NZI2	.;PTRF_HUMAN	N	173;128	ENSP00000349541:K173N	ENSP00000349541:K173N	K	-	3	2	PTRF	37810885	0.929000	0.31497	0.985000	0.45067	0.776000	0.43924	0.061000	0.14366	-0.544000	0.06232	-0.490000	0.04691	AAA	.	.	.	none		0.652	PTRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449938.1	NM_012232	
MBTD1	54799	hgsc.bcm.edu	37	17	49302371	49302371	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr17:49302371A>C	ENST00000586178.1	-	3	495	c.152T>G	c.(151-153)aTg>aGg	p.M51R	MBTD1_ENST00000415868.1_Missense_Mutation_p.M51R|MBTD1_ENST00000376381.2_Missense_Mutation_p.M51R|MBTD1_ENST00000593259.1_5'Flank	NM_017643.2	NP_060113.2	Q05BQ5	MBTD1_HUMAN	mbt domain containing 1	51					chromatin modification (GO:0016568)|embryonic skeletal system development (GO:0048706)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)			ATACTCACCCATGCCAGATTT	0.393																																					p.M51R		Atlas-SNP	.											.	MBTD1	44	.	0			c.T152G						PASS	.						145.0	135.0	138.0					17																	49302371		692	1591	2283	SO:0001583	missense	54799	exon3			TCACCCATGCCAG	AK000062	CCDS11581.2	17q24.1	2003-01-15			ENSG00000011258	ENSG00000011258			19866	protein-coding gene	gene with protein product							Standard	NM_017643		Approved	SA49P01, FLJ20055	uc002itr.4	Q05BQ5	OTTHUMG00000150442	ENST00000586178.1:c.152T>G	chr17.hg19:g.49302371A>C	ENSP00000468304:p.Met51Arg	100.0	0.0	.		86.0	26.0	.	NM_017643	Q6ZVU7|Q9NXU1	Missense_Mutation	SNP	ENST00000586178.1	hg19	CCDS11581.2	.	.	.	.	.	.	.	.	.	.	A	23.1	4.377416	0.82682	.	.	ENSG00000011258	ENST00000405860;ENST00000415868;ENST00000376381	T;T	0.23950	1.9;1.88	5.21	5.21	0.72293	Zinc finger, FCS-type (1);	0.073350	0.85682	D	0.000000	T	0.39759	0.1090	L	0.40543	1.245	0.80722	D	1	D;D	0.60575	0.988;0.96	P;D	0.69142	0.701;0.962	T	0.06789	-1.0807	10	0.23891	T	0.37	.	15.3505	0.74380	1.0:0.0:0.0:0.0	.	51;51	Q05BQ5;Q05BQ5-2	MBTD1_HUMAN;.	R	51	ENSP00000403946:M51R;ENSP00000365561:M51R	ENSP00000365561:M51R	M	-	2	0	MBTD1	46657370	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.248000	0.95456	2.089000	0.63090	0.482000	0.46254	ATG	.	.	.	none		0.393	MBTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318124.1		
NAT9	26151	hgsc.bcm.edu	37	17	72768142	72768142	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr17:72768142T>G	ENST00000357814.3	-	6	519	c.446A>C	c.(445-447)aAt>aCt	p.N149T	NAT9_ENST00000583476.1_Intron|NAT9_ENST00000581136.1_Missense_Mutation_p.N144T|NAT9_ENST00000578822.1_Missense_Mutation_p.N154T|NAT9_ENST00000580216.1_5'Flank|NAT9_ENST00000580301.1_Missense_Mutation_p.N148T|NAT9_ENST00000583757.1_Intron|NAT9_ENST00000582870.1_Missense_Mutation_p.N153T|NAT9_ENST00000580632.1_Missense_Mutation_p.N149T|NAT9_ENST00000582524.1_Intron	NM_015654.3	NP_056469.2	Q9BTE0	NAT9_HUMAN	N-acetyltransferase 9 (GCN5-related, putative)	149	N-acetyltransferase.					protein complex (GO:0043234)	N-acetyltransferase activity (GO:0008080)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)	8						GCTTGGTTCATTTCCTTGCCC	0.567																																					p.N149T		Atlas-SNP	.											.	NAT9	16	.	0			c.A446C						PASS	.						168.0	164.0	165.0					17																	72768142		2203	4300	6503	SO:0001583	missense	26151	exon6			GGTTCATTTCCTT	AK123115	CCDS11706.1	17q25.2	2011-11-25	2008-09-24		ENSG00000109065	ENSG00000109065			23133	protein-coding gene	gene with protein product			"""N-acetyltransferase 9"""			14608357	Standard	NM_015654		Approved	DKFZP564C103	uc002jlq.3	Q9BTE0		ENST00000357814.3:c.446A>C	chr17.hg19:g.72768142T>G	ENSP00000350467:p.Asn149Thr	108.0	0.0	.		126.0	54.0	.	NM_015654	B2R7F0|Q9BTD0|Q9Y3T3	Missense_Mutation	SNP	ENST00000357814.3	hg19	CCDS11706.1	.	.	.	.	.	.	.	.	.	.	T	14.32	2.499275	0.44455	.	.	ENSG00000109065	ENST00000357814	T	0.78364	-1.17	5.09	5.09	0.68999	GCN5-related N-acetyltransferase (GNAT) domain (1);Acyl-CoA N-acyltransferase (2);	0.000000	0.85682	D	0.000000	D	0.92704	0.7681	H	0.98295	4.195	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95440	0.8524	10	0.87932	D	0	-19.1654	15.1669	0.72837	0.0:0.0:0.0:1.0	.	148;149	Q9BTE0-2;Q9BTE0	.;NAT9_HUMAN	T	149	ENSP00000350467:N149T	ENSP00000350467:N149T	N	-	2	0	NAT9	70279737	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.519000	0.81809	2.055000	0.61198	0.459000	0.35465	AAT	.	.	.	none		0.567	NAT9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000443700.1	NM_015654	
CARD14	79092	hgsc.bcm.edu	37	17	78166392	78166392	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr17:78166392G>A	ENST00000573882.1	+	11	1866	c.1330G>A	c.(1330-1332)Gac>Aac	p.D444N	CARD14_ENST00000344227.2_Missense_Mutation_p.D444N|CARD14_ENST00000392434.2_Missense_Mutation_p.D207N|CARD14_ENST00000573754.1_3'UTR|CARD14_ENST00000570421.1_Missense_Mutation_p.D444N			Q9BXL6	CAR14_HUMAN	caspase recruitment domain family, member 14	444					activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)			NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(5)|prostate(1)|skin(1)	23	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.017)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			AGACGACAGCGACTGCAGCCT	0.662																																					p.D444N		Atlas-SNP	.											.	CARD14	98	.	0			c.G1330A						PASS	.						50.0	51.0	51.0					17																	78166392		2203	4300	6503	SO:0001583	missense	79092	exon9			GACAGCGACTGCA	AF322642	CCDS11768.1, CCDS58605.1	17q25.3	2014-09-04			ENSG00000141527	ENSG00000141527			16446	protein-coding gene	gene with protein product		607211	"""psoriasis susceptibility 2"""	PSORS2		11278692, 11356195, 22521418	Standard	NM_052819		Approved	CARMA2, BIMP2	uc031res.1	Q9BXL6	OTTHUMG00000177549	ENST00000573882.1:c.1330G>A	chr17.hg19:g.78166392G>A	ENSP00000458715:p.Asp444Asn	210.0	0.0	.		203.0	43.0	.	NM_024110	B8QQJ3|Q9BVB5	Missense_Mutation	SNP	ENST00000573882.1	hg19	CCDS11768.1	.	.	.	.	.	.	.	.	.	.	G	2.678	-0.275943	0.05679	.	.	ENSG00000141527	ENST00000344227;ENST00000392434;ENST00000309710	T;T	0.32515	1.45;1.45	3.64	0.451	0.16629	.	1.109330	0.06805	N	0.789318	T	0.16938	0.0407	L	0.27053	0.805	0.09310	N	1	B;B;B	0.14438	0.002;0.01;0.0	B;B;B	0.09377	0.001;0.004;0.001	T	0.29088	-1.0023	10	0.08599	T	0.76	-9.737	3.7718	0.08645	0.3225:0.1839:0.4936:0.0	.	444;207;444	B8QQJ3;E7ETJ2;Q9BXL6	.;.;CAR14_HUMAN	N	444;207;207	ENSP00000344549:D444N;ENSP00000376229:D207N	ENSP00000308507:D207N	D	+	1	0	CARD14	75780987	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	-0.205000	0.09411	-0.044000	0.13491	-1.162000	0.01777	GAC	.	.	.	none		0.662	CARD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437507.1		
DSG3	1830	hgsc.bcm.edu	37	18	29038453	29038453	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr18:29038453T>G	ENST00000257189.4	+	4	345	c.262T>G	c.(262-264)Tct>Gct	p.S88A		NM_001944.2	NP_001935.2	P32926	DSG3_HUMAN	desmoglein 3	88	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(28)|ovary(4)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			CTACCGAATCTCTGGAGTGGG	0.448																																					p.S88A		Atlas-SNP	.											.	DSG3	172	.	0			c.T262G						PASS	.						103.0	102.0	102.0					18																	29038453		2203	4300	6503	SO:0001583	missense	1830	exon4			CGAATCTCTGGAG	M76482	CCDS11898.1	18q12.1	2010-06-24	2010-06-24		ENSG00000134757	ENSG00000134757		"""Cadherins / Major cadherins"""	3050	protein-coding gene	gene with protein product	"""pemphigus vulgaris antigen"""	169615	"""desmoglein 3 (pemphigus vulgaris antigen)"""			1601426	Standard	NM_001944		Approved	CDHF6	uc002kws.3	P32926	OTTHUMG00000131985	ENST00000257189.4:c.262T>G	chr18.hg19:g.29038453T>G	ENSP00000257189:p.Ser88Ala	102.0	0.0	.		108.0	56.0	.	NM_001944	A8K2V2	Missense_Mutation	SNP	ENST00000257189.4	hg19	CCDS11898.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.280611	0.80692	.	.	ENSG00000134757	ENST00000257189	T	0.52057	0.68	5.76	3.2	0.36748	Cadherin (4);Cadherin-like (1);	0.141448	0.32563	N	0.005937	T	0.69360	0.3102	M	0.91920	3.255	0.35383	D	0.790079	D	0.55385	0.971	P	0.60068	0.868	T	0.81453	-0.0926	10	0.87932	D	0	.	11.3024	0.49314	0.2412:0.0:0.0:0.7588	.	88	P32926	DSG3_HUMAN	A	88	ENSP00000257189:S88A	ENSP00000257189:S88A	S	+	1	0	DSG3	27292451	0.993000	0.37304	0.857000	0.33713	0.922000	0.55478	2.362000	0.44169	1.080000	0.41073	0.528000	0.53228	TCT	.	.	.	none		0.448	DSG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254949.1	NM_001944	
ABCA7	10347	hgsc.bcm.edu	37	19	1059069	1059069	+	Silent	SNP	G	G	T			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr19:1059069G>T	ENST00000263094.6	+	40	5679	c.5448G>T	c.(5446-5448)ggG>ggT	p.G1816G	ABCA7_ENST00000433129.1_Silent_p.G1816G|ABCA7_ENST00000435683.2_Silent_p.G1678G	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	1816	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGTGCCTGGGGATTCCCCCTG	0.617																																					p.G1816G		Atlas-SNP	.											.	ABCA7	174	.	0			c.G5448T						PASS	.						81.0	68.0	73.0					19																	1059069		2202	4300	6502	SO:0001819	synonymous_variant	10347	exon40			CCTGGGGATTCCC	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.5448G>T	chr19.hg19:g.1059069G>T		116.0	0.0	.		118.0	28.0	.	NM_019112	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Silent	SNP	ENST00000263094.6	hg19	CCDS12055.1																																																																																			.	.	.	none		0.617	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
ZNF799	90576	hgsc.bcm.edu	37	19	12502558	12502558	+	Silent	SNP	C	C	T			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr19:12502558C>T	ENST00000430385.3	-	4	854	c.654G>A	c.(652-654)acG>acA	p.T218T	CTD-3105H18.14_ENST00000435033.1_Intron|ZNF799_ENST00000419318.1_Silent_p.T186T	NM_001080821.2	NP_001074290.1	Q96GE5	ZN799_HUMAN	zinc finger protein 799	218					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T218T(2)|p.T5T(2)		breast(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(2)	19						CTCCAGTGTGCGTTCTCTCAT	0.403																																					p.T218T		Atlas-SNP	.											ZNF799_ENST00000430385,NS,carcinoma,0,2	ZNF799	111	.	4	Substitution - coding silent(4)	lung(4)	c.G654A						PASS	.						105.0	109.0	108.0					19																	12502558		2202	4298	6500	SO:0001819	synonymous_variant	90576	exon4			AGTGTGCGTTCTC	BC009517	CCDS45989.1	19p13.2	2013-01-08			ENSG00000196466	ENSG00000196466		"""Zinc fingers, C2H2-type"", ""-"""	28071	protein-coding gene	gene with protein product			"""zinc finger protein 842"""	ZNF842			Standard	NM_001080821		Approved	HIT-40, MGC71805	uc002mts.4	Q96GE5	OTTHUMG00000156408	ENST00000430385.3:c.654G>A	chr19.hg19:g.12502558C>T		160.0	1.0	.		99.0	39.0	.	NM_001080821		Silent	SNP	ENST00000430385.3	hg19	CCDS45989.1																																																																																			.	.	.	none		0.403	ZNF799-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344099.2	NM_001080821	
CD97	976	hgsc.bcm.edu	37	19	14517156	14517156	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr19:14517156G>T	ENST00000242786.5	+	15	1915	c.1835G>T	c.(1834-1836)tGc>tTc	p.C612F	CTC-548K16.5_ENST00000590626.1_RNA|CD97_ENST00000357355.3_Missense_Mutation_p.C563F|CD97_ENST00000358600.3_Missense_Mutation_p.C519F	NM_078481.3	NP_510966.1	P48960	CD97_HUMAN	CD97 molecule	612					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						GGGCTGCGCTGCCGCCTGGTG	0.706											OREG0025312	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.C612F		Atlas-SNP	.											.	CD97	86	.	0			c.G1835T						PASS	.						30.0	24.0	26.0					19																	14517156		2190	4280	6470	SO:0001583	missense	976	exon15			TGCGCTGCCGCCT		CCDS32929.1, CCDS32930.1, CCDS32931.1	19p13	2014-08-08	2006-03-28			ENSG00000123146		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	1711	protein-coding gene	gene with protein product	"""leukocyte antigen CD97"", ""seven-span transmembrane protein"", ""seven-transmembrane, heterodimeric receptor associated with inflammation"", ""seven transmembrane helix receptor"""	601211	"""CD97 antigen"""			7636245, 8786105	Standard	NM_078481		Approved	TM7LN1	uc002myl.3	P48960		ENST00000242786.5:c.1835G>T	chr19.hg19:g.14517156G>T	ENSP00000242786:p.Cys612Phe	18.0	0.0	.	695	28.0	15.0	.	NM_078481	A8K7Z4|B2RBJ9|O00718|O76101|Q8NG72|Q8TBQ7	Missense_Mutation	SNP	ENST00000242786.5	hg19	CCDS32929.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.158116	0.78114	.	.	ENSG00000123146	ENST00000242786;ENST00000357355;ENST00000358600;ENST00000393059	D;D;D	0.82433	-1.61;-1.61;-1.61	4.42	3.33	0.38152	GPCR, family 2-like (1);	0.000000	0.36303	N	0.002674	D	0.93517	0.7931	H	0.97291	3.975	0.48236	D	0.999613	D;D;D	0.71674	0.959;0.976;0.998	D;D;D	0.87578	0.91;0.938;0.998	D	0.93810	0.7109	10	0.87932	D	0	.	11.004	0.47622	0.0:0.0:0.8118:0.1882	.	519;563;612	P48960-2;P48960-3;P48960	.;.;CD97_HUMAN	F	612;563;519;562	ENSP00000242786:C612F;ENSP00000349918:C563F;ENSP00000351413:C519F	ENSP00000242786:C612F	C	+	2	0	CD97	14378156	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.174000	0.89682	0.778000	0.33520	0.505000	0.49811	TGC	.	.	.	none		0.706	CD97-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459821.2	NM_078481	
IFI30	10437	hgsc.bcm.edu	37	19	18288015	18288015	+	Silent	SNP	C	C	T			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr19:18288015C>T	ENST00000407280.3	+	5	724	c.549C>T	c.(547-549)cgC>cgT	p.R183R	PIK3R2_ENST00000593731.1_3'UTR	NM_006332.3	NP_006323.2	P13284	GILT_HUMAN	interferon, gamma-inducible protein 30	183					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of fibroblast proliferation (GO:0048147)|protein stabilization (GO:0050821)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	oxidoreductase activity, acting on a sulfur group of donors (GO:0016667)			endometrium(1)|kidney(2)|large_intestine(1)|stomach(1)	5						TGGGGGACCGCGGCATGCAGC	0.617																																					p.R183R		Atlas-SNP	.											.	IFI30	12	.	0			c.C549T						PASS	.						32.0	34.0	33.0					19																	18288015		2111	4231	6342	SO:0001819	synonymous_variant	10437	exon5			GGACCGCGGCATG	J03909	CCDS46015.1	19p13.1	2008-07-16				ENSG00000216490			5398	protein-coding gene	gene with protein product	"""gamma-interferon-inducible lysosomal thiol reductase"", ""interferon gamma-inducible protein 30 preproprotein"""	604664				3136170, 10639150	Standard	NM_006332		Approved	IFI-30, GILT, IP30, MGC32056	uc002nic.1	P13284		ENST00000407280.3:c.549C>T	chr19.hg19:g.18288015C>T		215.0	0.0	.		160.0	34.0	.	NM_006332	Q76MF9|Q8NEI4|Q8WU77|Q9UL08	Silent	SNP	ENST00000407280.3	hg19	CCDS46015.1																																																																																			.	.	.	none		0.617	IFI30-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466396.3	NM_006332	
ZNF814	730051	hgsc.bcm.edu	37	19	58385790	58385790	+	Missense_Mutation	SNP	G	G	T	rs111727691		TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr19:58385790G>T	ENST00000435989.2	-	3	1202	c.968C>A	c.(967-969)cCt>cAt	p.P323H	ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000600634.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	323					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						ACATTCATAAGGTCTTTTCCC	0.358																																					p.P323H		Atlas-SNP	.											.	ZNF814	93	.	0			c.C968A						PASS	.						15.0	12.0	13.0					19																	58385790		688	1563	2251	SO:0001583	missense	730051	exon3			TCATAAGGTCTTT		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.968C>A	chr19.hg19:g.58385790G>T	ENSP00000410545:p.Pro323His	108.0	0.0	.		131.0	13.0	.	NM_001144989	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	hg19	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	8.139	0.784825	0.16189	.	.	ENSG00000204514	ENST00000435989	T	0.29397	1.57	2.27	1.18	0.20946	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.57080	0.2029	M	0.90019	3.08	0.20764	N	0.999853	D	0.89917	1.0	D	0.67231	0.95	T	0.46247	-0.9205	9	0.66056	D	0.02	.	9.258	0.37595	0.0:0.0:0.7811:0.2189	.	323	B7Z6K7	ZN814_HUMAN	H	323	ENSP00000410545:P323H	ENSP00000410545:P323H	P	-	2	0	ZNF814	63077602	0.000000	0.05858	0.028000	0.17463	0.016000	0.09150	-0.439000	0.06897	0.330000	0.23485	-1.407000	0.01130	CCT	.	G|0.500;T|0.500	0.500	weak		0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
ZNF814	730051	hgsc.bcm.edu	37	19	58385793	58385793	+	Missense_Mutation	SNP	C	C	T	rs113623532		TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr19:58385793C>T	ENST00000435989.2	-	3	1199	c.965G>A	c.(964-966)aGa>aAa	p.R322K	ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000600634.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	322					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						TTCATAAGGTCTTTTCCCAGT	0.358																																					p.R322K		Atlas-SNP	.											.	ZNF814	93	.	0			c.G965A						PASS	.						15.0	12.0	13.0					19																	58385793		687	1562	2249	SO:0001583	missense	730051	exon3			TAAGGTCTTTTCC		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.965G>A	chr19.hg19:g.58385793C>T	ENSP00000410545:p.Arg322Lys	103.0	0.0	.		122.0	12.0	.	NM_001144989	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	hg19	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	0.023	-1.395361	0.01175	.	.	ENSG00000204514	ENST00000435989	T	0.12361	2.69	2.27	9.47E-4	0.14044	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03608	0.0103	N	0.02225	-0.63	0.09310	N	0.999999	B	0.29301	0.241	B	0.28916	0.096	T	0.40534	-0.9558	9	0.02654	T	1	.	4.6969	0.12808	0.0:0.4166:0.0:0.5834	.	322	B7Z6K7	ZN814_HUMAN	K	322	ENSP00000410545:R322K	ENSP00000410545:R322K	R	-	2	0	ZNF814	63077605	0.000000	0.05858	0.024000	0.17045	0.009000	0.06853	-1.883000	0.01623	0.331000	0.23511	-1.381000	0.01174	AGA	.	C|0.500;T|0.500	0.500	weak		0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
CHD6	84181	hgsc.bcm.edu	37	20	40143495	40143495	+	Silent	SNP	C	C	A			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr20:40143495C>A	ENST00000373233.3	-	4	828	c.651G>T	c.(649-651)acG>acT	p.T217T	CHD6_ENST00000309279.7_Silent_p.T217T|CHD6_ENST00000373222.3_Silent_p.T252T	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	217	Required for DNA-dependent ATPase activity.				ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				GAGATGGGTTCGTCAGGCCCT	0.537																																					p.T217T		Atlas-SNP	.											.	CHD6	312	.	0			c.G651T						PASS	.						131.0	122.0	125.0					20																	40143495		2203	4300	6503	SO:0001819	synonymous_variant	84181	exon4			TGGGTTCGTCAGG	AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.651G>T	chr20.hg19:g.40143495C>A		92.0	0.0	.		99.0	38.0	.	NM_032221	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Silent	SNP	ENST00000373233.3	hg19	CCDS13317.1																																																																																			.	.	.	none		0.537	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1		
MYBL2	4605	hgsc.bcm.edu	37	20	42328636	42328636	+	Silent	SNP	C	C	T			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr20:42328636C>T	ENST00000217026.4	+	7	1030	c.903C>T	c.(901-903)atC>atT	p.I301I	MYBL2_ENST00000396863.4_Silent_p.I277I	NM_002466.2	NP_002457.1	P10244	MYBB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 2	301					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|spindle assembly involved in mitosis (GO:0090307)	Myb complex (GO:0031523)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	46		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			ACCTCCTCATCCCTGCTGTGG	0.572																																					p.I301I		Atlas-SNP	.											.	MYBL2	82	.	0			c.C903T						PASS	.						78.0	56.0	63.0					20																	42328636		2203	4300	6503	SO:0001819	synonymous_variant	4605	exon7			CCTCATCCCTGCT		CCDS13322.1, CCDS63276.1	20q13.1	2013-07-09	2013-07-09		ENSG00000101057	ENSG00000101057			7548	protein-coding gene	gene with protein product		601415				8812502	Standard	NM_002466		Approved	BMYB, B-MYB	uc002xlb.1	P10244	OTTHUMG00000033062	ENST00000217026.4:c.903C>T	chr20.hg19:g.42328636C>T		92.0	0.0	.		82.0	34.0	.	NM_002466	B2RBS5|B7Z8D9|F8W6N6|Q53F07	Silent	SNP	ENST00000217026.4	hg19	CCDS13322.1																																																																																			.	.	.	none		0.572	MYBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080408.1	NM_002466	
WFDC8	90199	hgsc.bcm.edu	37	20	44181865	44181865	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr20:44181865G>T	ENST00000357199.4	-	5	574	c.496C>A	c.(496-498)Cca>Aca	p.P166T	WFDC8_ENST00000289953.2_Missense_Mutation_p.P166T	NM_181510.2	NP_852611.2	Q8IUA0	WFDC8_HUMAN	WAP four-disulfide core domain 8	166	WAP 2. {ECO:0000255|PROSITE- ProRule:PRU00722}.					extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(4)|stomach(1)|upper_aerodigestive_tract(1)	15		Myeloproliferative disorder(115;0.0122)				CATGAAGGTGGACACTCCTTA	0.488																																					p.P166T		Atlas-SNP	.											.	WFDC8	28	.	0			c.C496A						PASS	.						139.0	111.0	121.0					20																	44181865		2203	4300	6503	SO:0001583	missense	90199	exon5			AAGGTGGACACTC	AL031663	CCDS13361.1	20q13.11	2013-01-21	2003-02-21	2003-02-21	ENSG00000158901	ENSG00000158901		"""WAP four-disulfide core domain containing"""	16163	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 170"""	C20orf170		12206714	Standard	NM_130896		Approved	dJ461P17.1, WAP8	uc002xow.3	Q8IUA0	OTTHUMG00000046342	ENST00000357199.4:c.496C>A	chr20.hg19:g.44181865G>T	ENSP00000361735:p.Pro166Thr	147.0	0.0	.		131.0	51.0	.	NM_181510	E1P623|Q5TDV2|Q96A34	Missense_Mutation	SNP	ENST00000357199.4	hg19	CCDS13361.1	.	.	.	.	.	.	.	.	.	.	G	13.37	2.218036	0.39201	.	.	ENSG00000158901	ENST00000357199;ENST00000289953	T;T	0.71934	-0.61;-0.61	4.91	0.245	0.15512	Whey acidic protein, 4-disulphide core (5);	0.596324	0.15342	N	0.267433	T	0.59074	0.2167	L	0.48986	1.54	0.26237	N	0.978939	P	0.36412	0.552	B	0.42462	0.388	T	0.49597	-0.8923	10	0.07175	T	0.84	.	4.7744	0.13171	0.2342:0.0:0.5927:0.1732	.	166	Q8IUA0	WFDC8_HUMAN	T	166	ENSP00000361735:P166T;ENSP00000289953:P166T	ENSP00000289953:P166T	P	-	1	0	WFDC8	43615279	0.501000	0.26099	0.751000	0.31187	0.050000	0.14768	-0.083000	0.11286	0.202000	0.20498	0.655000	0.94253	CCA	.	.	.	none		0.488	WFDC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106958.1		
BCAS4	55653	hgsc.bcm.edu	37	20	49458324	49458324	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr20:49458324C>T	ENST00000358791.5	+	4	476	c.376C>T	c.(376-378)Cac>Tac	p.H126Y	BCAS4_ENST00000262591.5_Intron|BCAS4_ENST00000371608.2_Missense_Mutation_p.H126Y|BCAS4_ENST00000609336.1_Missense_Mutation_p.H96Y	NM_017843.3	NP_060313.3	Q8TDM0	BCAS4_HUMAN	breast carcinoma amplified sequence 4	126						cytoplasm (GO:0005737)				large_intestine(2)|lung(2)|pancreas(1)|upper_aerodigestive_tract(1)	6						GATGGTTGGACACCACGTCGC	0.657																																					p.H126Y		Atlas-SNP	.											.	BCAS4	41	.	0			c.C376T						PASS	.						76.0	59.0	65.0					20																	49458324		2203	4300	6503	SO:0001583	missense	55653	exon4			GTTGGACACCACG	AK000502	CCDS13432.2, CCDS33487.1	20q13	2008-07-03			ENSG00000124243	ENSG00000124243			14367	protein-coding gene	gene with protein product		607471				12378525	Standard	NM_001010974		Approved	FLJ20495, CNOL	uc002xvq.3	Q8TDM0	OTTHUMG00000032735	ENST00000358791.5:c.376C>T	chr20.hg19:g.49458324C>T	ENSP00000351642:p.His126Tyr	333.0	0.0	.		250.0	109.0	.	NM_198799	Q5TD52|Q5TD53|Q5TD54|Q5U5K7|Q5XKE8|Q8IXI7|Q8NEZ6|Q8TDL9|Q9NX13|Q9Y511	Missense_Mutation	SNP	ENST00000358791.5	hg19	CCDS33487.1	.	.	.	.	.	.	.	.	.	.	C	1.847	-0.465944	0.04476	.	.	ENSG00000124243	ENST00000358791;ENST00000355583;ENST00000371608	T;T	0.45276	1.9;0.9	4.48	3.5	0.40072	.	0.340201	0.30593	N	0.009290	T	0.37919	0.1021	L	0.51422	1.61	0.50632	D	0.999888	P;P	0.50528	0.763;0.936	B;P	0.44359	0.181;0.447	T	0.11941	-1.0567	10	0.39692	T	0.17	-17.6017	9.5663	0.39400	0.2101:0.7899:0.0:0.0	.	126;126	Q8TDM0-3;Q8TDM0	.;BCAS4_HUMAN	Y	126	ENSP00000351642:H126Y;ENSP00000360669:H126Y	ENSP00000347789:H126Y	H	+	1	0	BCAS4	48891731	0.746000	0.28272	0.137000	0.22149	0.014000	0.08584	1.544000	0.36158	0.837000	0.34925	0.561000	0.74099	CAC	.	.	.	none		0.657	BCAS4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079700.1	NM_017843	
ZDHHC8	29801	hgsc.bcm.edu	37	22	20128194	20128194	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr22:20128194A>T	ENST00000334554.7	+	6	856	c.715A>T	c.(715-717)Aat>Tat	p.N239Y	ZDHHC8_ENST00000320602.7_Missense_Mutation_p.N147Y|ZDHHC8_ENST00000405930.3_Missense_Mutation_p.N239Y|ZDHHC8_ENST00000468112.1_3'UTR	NM_013373.3	NP_037505.1	Q9ULC8	ZDHC8_HUMAN	zinc finger, DHHC-type containing 8	239					locomotory behavior (GO:0007626)|protein palmitoylation (GO:0018345)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(3)|endometrium(1)|kidney(3)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	20	Colorectal(54;0.0993)					CTGCTGTGGGAATGTGGAGCA	0.697																																					p.N239Y		Atlas-SNP	.											.	ZDHHC8	77	.	0			c.A715T						PASS	.						39.0	35.0	36.0					22																	20128194		2198	4299	6497	SO:0001583	missense	29801	exon6			TGTGGGAATGTGG	AB033118	CCDS13776.1, CCDS54502.1	22q11.21	2009-10-06		2003-02-28	ENSG00000099904	ENSG00000099904		"""Zinc fingers, DHHC-type"""	18474	protein-coding gene	gene with protein product		608784				10574462, 15184899	Standard	NM_013373		Approved	ZNF378, KIAA1292	uc002zrr.2	Q9ULC8	OTTHUMG00000150499	ENST00000334554.7:c.715A>T	chr22.hg19:g.20128194A>T	ENSP00000334490:p.Asn239Tyr	40.0	0.0	.		32.0	16.0	.	NM_001185024	Q2TGE9|Q6ICL1|Q6ZNF5|Q7Z6L9	Missense_Mutation	SNP	ENST00000334554.7	hg19	CCDS13776.1	.	.	.	.	.	.	.	.	.	.	A	25.3	4.624495	0.87560	.	.	ENSG00000099904	ENST00000334554;ENST00000320602;ENST00000405930	T;T;T	0.79845	-0.2;-1.31;-0.32	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	D	0.88377	0.6420	M	0.67397	2.05	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	D	0.89618	0.3846	10	0.72032	D	0.01	.	15.1958	0.73088	1.0:0.0:0.0:0.0	.	147;239;239	Q9ULC8-2;Q9ULC8-3;Q9ULC8	.;.;ZDHC8_HUMAN	Y	239;147;239	ENSP00000334490:N239Y;ENSP00000317804:N147Y;ENSP00000384716:N239Y	ENSP00000317804:N147Y	N	+	1	0	ZDHHC8	18508194	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.875000	0.92372	2.035000	0.60131	0.533000	0.62120	AAT	.	.	.	none		0.697	ZDHHC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318564.1	NM_013373	
POLA1	5422	hgsc.bcm.edu	37	X	24744126	24744126	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chrX:24744126T>A	ENST00000379059.3	+	13	1343	c.1328T>A	c.(1327-1329)aTa>aAa	p.I443K	POLA1_ENST00000379068.3_Missense_Mutation_p.I449K	NM_016937.3	NP_058633.2	P09884	DPOLA_HUMAN	polymerase (DNA directed), alpha 1, catalytic subunit	443					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|lagging strand elongation (GO:0006273)|leading strand elongation (GO:0006272)|mitotic cell cycle (GO:0000278)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|translesion synthesis (GO:0019985)|viral process (GO:0016032)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleoside binding (GO:0001882)|nucleotide binding (GO:0000166)|protein kinase binding (GO:0019901)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|skin(2)	11					Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Nelarabine(DB01280)	GCTTTTGAGATACCTGATGTT	0.328																																					p.I443K		Atlas-SNP	.											.	POLA1	117	.	0			c.T1328A						PASS	.						71.0	69.0	70.0					X																	24744126		2203	4300	6503	SO:0001583	missense	5422	exon13			TTGAGATACCTGA		CCDS14214.1	Xp22.1-p21.3	2014-01-30	2008-08-07	2006-09-26	ENSG00000101868	ENSG00000101868	2.7.7.7	"""DNA polymerases"""	9173	protein-coding gene	gene with protein product		312040	"""polymerase (DNA directed), alpha"", ""polymerase (DNA directed), alpha 1"", ""N syndrome (mental retardation, malformations, chromosome breakage)"""	POLA, NSX		1689958	Standard	NM_016937		Approved	p180	uc004dbl.3	P09884	OTTHUMG00000021277	ENST00000379059.3:c.1328T>A	chrX.hg19:g.24744126T>A	ENSP00000368349:p.Ile443Lys	99.0	0.0	.		34.0	26.0	.	NM_016937	Q86UQ7	Missense_Mutation	SNP	ENST00000379059.3	hg19	CCDS14214.1	.	.	.	.	.	.	.	.	.	.	t	11.79	1.743738	0.30865	.	.	ENSG00000101868	ENST00000379068;ENST00000379059	T;T	0.42900	0.96;0.96	5.36	4.2	0.49525	DNA-directed DNA polymerase, family B, exonuclease domain (1);Ribonuclease H-like (1);	0.046811	0.85682	D	0.000000	T	0.30479	0.0766	L	0.42744	1.35	0.80722	D	1	B;B	0.14438	0.001;0.01	B;B	0.20384	0.016;0.029	T	0.08534	-1.0717	10	0.05959	T	0.93	-6.4004	10.4411	0.44466	0.0:0.0769:0.0:0.9231	.	449;443	A6NMQ1;P09884	.;DPOLA_HUMAN	K	449;443	ENSP00000368358:I449K;ENSP00000368349:I443K	ENSP00000368349:I443K	I	+	2	0	POLA1	24654047	1.000000	0.71417	1.000000	0.80357	0.765000	0.43378	7.333000	0.79214	0.832000	0.34804	-0.392000	0.06488	ATA	.	.	.	none		0.328	POLA1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056111.1	NM_016937	
SLC25A53	401612	hgsc.bcm.edu	37	X	103349337	103349337	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chrX:103349337C>T	ENST00000357421.4	-	2	784	c.604G>A	c.(604-606)Ggc>Agc	p.G202S		NM_001012755.3	NP_001012773.2	Q5H9E4	S2553_HUMAN	solute carrier family 25, member 53	202					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)											TCTGCCAGGCCATCCTGGATG	0.552																																					p.G202S		Atlas-SNP	.											.	.	.	.	0			c.G604A						PASS	.						62.0	65.0	64.0					X																	103349337		2202	4300	6502	SO:0001583	missense	401612	exon2			CCAGGCCATCCTG		CCDS35363.1	Xq22.2	2013-05-22	2012-03-29	2012-03-29	ENSG00000176274	ENSG00000269743		"""Solute carriers"""	31894	protein-coding gene	gene with protein product			"""mitochondrial carrier triple repeat 6"""	MCART6			Standard	NM_001012755		Approved		uc004elu.3	Q5H9E4	OTTHUMG00000022124	ENST00000357421.4:c.604G>A	chrX.hg19:g.103349337C>T	ENSP00000361681:p.Gly202Ser	66.0	0.0	.		84.0	12.0	.	NM_001012755	B2RTT9	Missense_Mutation	SNP	ENST00000357421.4	hg19	CCDS35363.1	.	.	.	.	.	.	.	.	.	.	c	9.080	0.999007	0.19121	.	.	ENSG00000176274	ENST00000357421	T	0.77620	-1.11	4.18	2.25	0.28309	Mitochondrial carrier domain (2);	0.586966	0.16485	N	0.212372	T	0.48259	0.1490	N	0.01751	-0.74	0.29543	N	0.85193	B	0.02656	0.0	B	0.06405	0.002	T	0.39881	-0.9592	10	0.22109	T	0.4	-18.0741	7.4625	0.27304	0.0:0.7591:0.0:0.2409	.	202	Q5H9E4	MCAR6_HUMAN	S	202	ENSP00000361681:G202S	ENSP00000361681:G202S	G	-	1	0	MCART6	103235993	0.000000	0.05858	0.980000	0.43619	0.966000	0.64601	-0.866000	0.04245	0.295000	0.22570	0.594000	0.82650	GGC	.	.	.	none		0.552	SLC25A53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057761.1	NM_001012755	
COL4A5	1287	hgsc.bcm.edu	37	X	107938134	107938134	+	Missense_Mutation	SNP	G	G	A	rs104886424		TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chrX:107938134G>A	ENST00000361603.2	+	49	5030	c.4786G>A	c.(4786-4788)Ggt>Agt	p.G1596S	COL4A5_ENST00000328300.6_Missense_Mutation_p.G1602S	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	1596	Collagen IV NC1. {ECO:0000255|PROSITE- ProRule:PRU00736}.		G -> D (in APSX). {ECO:0000269|PubMed:9452056}.		axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						TCTGTGGATTGGTTATTCCTT	0.453									Alport syndrome with Diffuse Leiomyomatosis																												p.G1596S		Atlas-SNP	.											.	COL4A5	262	.	0			c.G4786A						PASS	.						321.0	202.0	242.0					X																	107938134		2203	4300	6503	SO:0001583	missense	1287	exon49	Familial Cancer Database		TGGATTGGTTATT	M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.4786G>A	chrX.hg19:g.107938134G>A	ENSP00000354505:p.Gly1596Ser	184.0	0.0	.		219.0	9.0	.	NM_000495	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	ENST00000361603.2	hg19	CCDS14543.1	.	.	.	.	.	.	.	.	.	.	G	34	5.313598	0.95655	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186;ENST00000504541	D;D;D	0.99557	-6.16;-6.16;-4.07	5.57	5.57	0.84162	C-type lectin fold (1);	0.000000	0.85682	D	0.000000	D	0.99813	0.9918	H	0.97265	3.97	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96778	0.9573	10	0.87932	D	0	.	18.5959	0.91229	0.0:0.0:1.0:0.0	.	1599;1596	E7EVY4;P29400	.;CO4A5_HUMAN	S	1602;1596;1602;68	ENSP00000331902:G1602S;ENSP00000354505:G1596S;ENSP00000424845:G68S	ENSP00000331902:G1602S	G	+	1	0	COL4A5	107824790	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.335000	0.79485	0.594000	0.82650	GGT	.	.	.	weak		0.453	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2		
FUT10	84750	hgsc.bcm.edu	37	8	33246682	33246683	+	Frame_Shift_Ins	INS	-	-	A			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr8:33246682_33246683insA	ENST00000327671.5	-	4	1641_1642	c.1010_1011insT	c.(1009-1011)atcfs	p.I337fs	FUT10_ENST00000518076.1_5'UTR|FUT10_ENST00000524021.1_Frame_Shift_Ins_p.I309fs|FUT10_ENST00000335589.3_Frame_Shift_Ins_p.I275fs|FUT10_ENST00000518672.1_Frame_Shift_Ins_p.I309fs	NM_032664.3	NP_116053.3	Q6P4F1	FUT10_HUMAN	fucosyltransferase 10 (alpha (1,3) fucosyltransferase)	337					embryo development (GO:0009790)|fertilization (GO:0009566)|fucosylation (GO:0036065)|hemopoiesis (GO:0030097)|L-fucose catabolic process (GO:0042355)|nervous system development (GO:0007399)|protein folding (GO:0006457)|protein glycosylation (GO:0006486)|protein targeting (GO:0006605)|wound healing (GO:0042060)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)			cervix(1)|endometrium(1)|large_intestine(7)|liver(1)|lung(9)|ovary(1)|pancreas(1)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	29				KIRC - Kidney renal clear cell carcinoma(67;0.129)|Kidney(114;0.154)		CCAGTCGTCTGATGTAACTTGC	0.46																																					p.I337fs		Atlas-Indel,Pindel	.											.	FUT10	62	.	0			c.1011_1012insT						PASS	.																																			SO:0001589	frameshift_variant	84750	exon4			.	AJ512465	CCDS6088.1	8p12	2013-02-26			ENSG00000172728	ENSG00000172728		"""Fucosyltransferases"""	19234	protein-coding gene	gene with protein product							Standard	NM_032664		Approved		uc003xje.3	Q6P4F1	OTTHUMG00000163954	ENST00000327671.5:c.1011dupT	chr8.hg19:g.33246683_33246683dupA	ENSP00000332757:p.Ile337fs	301.0	0.0	0		311.0	126.0	0.405145	NM_032664	A8KAC8|Q70GG3|Q8IVI6|Q8IVI7|Q8IVJ3|Q8TE43|Q9BSR3	Frame_Shift_Ins	INS	ENST00000327671.5	hg19	CCDS6088.1																																																																																			.	.	.	none		0.460	FUT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376540.1	NM_032664	
NPTX1	4884	hgsc.bcm.edu	37	17	78449367	78449367	+	Frame_Shift_Del	DEL	A	A	-	rs375303530		TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr17:78449367delA	ENST00000306773.4	-	2	753	c.596delT	c.(595-597)gtcfs	p.V199fs	NPTX1_ENST00000575212.1_5'UTR	NM_002522.3	NP_002513.2	Q15818	NPTX1_HUMAN	neuronal pentraxin I	199					axonogenesis involved in innervation (GO:0060385)|cellular response to glucose stimulus (GO:0071333)|cellular response to potassium ion (GO:0035865)|central nervous system development (GO:0007417)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial transport (GO:0006839)|synaptic transmission (GO:0007268)|transport (GO:0006810)	cytoplasmic vesicle (GO:0031410)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			kidney(1)|large_intestine(2)|liver(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(1)	11	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0487)			CTCGATCTTGACCCTCTCCTC	0.657																																					p.V199fs		Atlas-Indel,Pindel	.											.	NPTX1	28	.	0			c.597delC						PASS	.						55.0	41.0	46.0					17																	78449367		2202	4300	6502	SO:0001589	frameshift_variant	4884	exon2			.	U61849	CCDS32762.1	17q25.3	2008-05-14				ENSG00000171246			7952	protein-coding gene	gene with protein product		602367				8884281	Standard	NM_002522		Approved		uc002jyp.1	Q15818		ENST00000306773.4:c.596delT	chr17.hg19:g.78449367delA	ENSP00000307549:p.Val199fs	98.0	0.0	0		130.0	55.0	0.423077	NM_002522	B3KXH3|Q5FWE6	Frame_Shift_Del	DEL	ENST00000306773.4	hg19	CCDS32762.1																																																																																			.	.	.	none		0.657	NPTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438051.1		
RBM33	155435	hgsc.bcm.edu	37	7	155534581	155534582	+	Frame_Shift_Ins	INS	-	-	A			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr7:155534581_155534582insA	ENST00000401878.3	+	13	2316_2317	c.2118_2119insA	c.(2119-2121)aatfs	p.N707fs		NM_053043.2	NP_444271.2	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33	707							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	27	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)		CAAGGAACAGCAATTTGCGTGA	0.49																																					p.S706fs		Atlas-Indel,Pindel	.											.	RBM33	157	.	0			c.2118_2119insA						PASS	.																																			SO:0001589	frameshift_variant	155435	exon13			.	AL832196	CCDS5941.2	7q36.3	2013-02-12			ENSG00000184863	ENSG00000184863		"""RNA binding motif (RRM) containing"""	27223	protein-coding gene	gene with protein product			"""proline rich 8"""	PRR8			Standard	NM_053043		Approved	DKFZp686F102, MGC20460, DKFZp434D1319	uc010lqk.1	Q96EV2	OTTHUMG00000150260	ENST00000401878.3:c.2120dupA	chr7.hg19:g.155534583_155534583dupA	ENSP00000384160:p.Asn707fs	190.0	0.0	0		165.0	69.0	0.418182	NM_053043	A4D244|B5MC24|Q52LF5|Q75LN9|Q75ML5|Q9NSV0	Frame_Shift_Ins	INS	ENST00000401878.3	hg19	CCDS5941.2																																																																																			.	.	.	none		0.490	RBM33-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317225.3	NM_001008408	
RPSA	3921	hgsc.bcm.edu	37	3	39453553	39453556	+	Splice_Site	DEL	GTAT	GTAT	-			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	GTAT	GTAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr3:39453553_39453556delGTAT	ENST00000301821.6	+	6	902		c.e6+1		SNORA62_ENST00000365493.1_RNA|RPSA_ENST00000443003.1_Splice_Site|RPSA_ENST00000478027.1_Splice_Site	NM_001012321.1|NM_002295.4	NP_001012321.1|NP_002286.2			ribosomal protein SA											endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.0509)|Kidney(284;0.064)		TTCCCTACTGGTATGTATCAGGAT	0.431																																					p.265_265del		Atlas-Indel,Pindel	.											.	RPSA	15	.	0			c.793_793del						PASS	.																																			SO:0001630	splice_region_variant	3921	exon5			.	S37431	CCDS2686.1	3p21.3	2014-09-17	2002-08-29	2005-02-11	ENSG00000168028	ENSG00000168028			6502	protein-coding gene	gene with protein product		150370	"""laminin receptor 1 (67kD, ribosomal protein SA)"""	LAMR1		1534510, 8760291	Standard	NM_001012321		Approved	LRP, 37LRP, p40, SA	uc003cjp.3	P08865	OTTHUMG00000131296	ENST00000301821.6:c.793+1GTAT>-	chr3.hg19:g.39453557_39453560delGTAT		39.0	0.0	0		23.0	17.0	0.73913	NM_001012321		Frame_Shift_Del	DEL	ENST00000301821.6	hg19	CCDS2686.1																																																																																			.	.	.	none		0.431	RPSA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254064.3	NM_002295	Intron
CD6	923	hgsc.bcm.edu	37	11	60778597	60778605	+	In_Frame_Del	DEL	AGTCACTAT	AGTCACTAT	-	rs374328736		TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	AGTCACTAT	AGTCACTAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr11:60778597_60778605delAGTCACTAT	ENST00000313421.7	+	6	1326_1334	c.1140_1148delAGTCACTAT	c.(1138-1149)acagtcactata>aca	p.VTI381del	CD6_ENST00000545105.1_3'UTR|CD6_ENST00000344028.5_In_Frame_Del_p.VTI381del|CD6_ENST00000352009.5_In_Frame_Del_p.VTI381del|CD6_ENST00000452451.2_In_Frame_Del_p.VTI381del|CD6_ENST00000346437.4_In_Frame_Del_p.VTI381del	NM_006725.4	NP_006716.3	P30203	CD6_HUMAN	CD6 molecule	381					cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	scavenger receptor activity (GO:0005044)			endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)	18						GTGTTCAGACAGTCACTATAGGTAAGTGT	0.526																																					p.380_383del	Pancreas(169;904 2017 4767 38890 42505)	Atlas-Indel,Pindel	.											.	CD6	122	.	0			c.1139_1147del						PASS	.																																			SO:0001651	inframe_deletion	923	exon6			.		CCDS7999.1, CCDS58137.1, CCDS58138.1	11q12.2	2006-03-28	2006-03-28		ENSG00000013725	ENSG00000013725		"""CD molecules"""	1691	protein-coding gene	gene with protein product		186720	"""CD6 antigen"""			9013954	Standard	NM_006725		Approved	Tp120	uc001nqq.3	P30203	OTTHUMG00000167823	ENST00000313421.7:c.1140_1148delAGTCACTAT	chr11.hg19:g.60778597_60778605delAGTCACTAT	ENSP00000323280:p.Val381_Ile383del	230.0	0.0	0		171.0	38.0	0.222222	NM_006725	A4KAD4|A4KAD5|Q9UMF2|Q9Y4K7|Q9Y4K8|Q9Y4K9|Q9Y4L0	In_Frame_Del	DEL	ENST00000313421.7	hg19	CCDS7999.1																																																																																			.	.	.	none		0.526	CD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396449.1	NM_006725	
HEPHL1	341208	hgsc.bcm.edu	37	11	93797512	93797529	+	In_Frame_Del	DEL	ATTCAGGGACACGGAATG	ATTCAGGGACACGGAATG	-	rs200031155|rs368679862|rs556983825		TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	ATTCAGGGACACGGAATG	ATTCAGGGACACGGAATG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr11:93797512_93797529delATTCAGGGACACGGAATG	ENST00000315765.9	+	4	652_669	c.644_661delATTCAGGGACACGGAATG	c.(643-663)tattcagggacacggaatgat>tat	p.SGTRND216del		NM_001098672.1	NP_001092142.1	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1	216					copper ion transport (GO:0006825)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	61		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				CTGAATAGATATTCAGGGACACGGAATGATGTGGATCG	0.394																																					p.215_220del		Atlas-Indel,Pindel	.											.	HEPHL1	144	.	0			c.643_660del						PASS	.																																			SO:0001651	inframe_deletion	341208	exon4			.	BX641008	CCDS44710.1	11q21	2008-02-05			ENSG00000181333	ENSG00000181333			30477	protein-coding gene	gene with protein product							Standard	NM_001098672		Approved	DKFZp686F22190	uc001pep.2	Q6MZM0	OTTHUMG00000167751	ENST00000315765.9:c.644_661delATTCAGGGACACGGAATG	chr11.hg19:g.93797512_93797529delATTCAGGGACACGGAATG	ENSP00000313699:p.Ser216_Asp221del	130.0	0.0	0		68.0	15.0	0.220588	NM_001098672	Q3C1W7	In_Frame_Del	DEL	ENST00000315765.9	hg19	CCDS44710.1																																																																																			.	.	.	none		0.394	HEPHL1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396103.2	XM_291947	
KCNH3	23416	hgsc.bcm.edu	37	12	49951017	49951018	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	AC	AC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr12:49951017_49951018delAC	ENST00000257981.6	+	14	2887_2888	c.2627_2628delAC	c.(2626-2628)gacfs	p.D876fs	MCRS1_ENST00000547182.1_5'Flank	NM_012284.1	NP_036416.1	Q9ULD8	KCNH3_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 3	876					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36						AGGAACACAGACACACTGGACA	0.619																																					p.876_876del		Atlas-Indel,Pindel	.											.	KCNH3	88	.	0			c.2626_2627del						PASS	.																																			SO:0001589	frameshift_variant	23416	exon14			.	AB022696	CCDS8786.1	12q13	2012-07-05				ENSG00000135519		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6252	protein-coding gene	gene with protein product		604527				10455180, 16382104	Standard	NM_012284		Approved	Kv12.2, BEC1, elk2	uc001ruh.1	Q9ULD8	OTTHUMG00000169517	ENST00000257981.6:c.2627_2628delAC	chr12.hg19:g.49951021_49951022delAC	ENSP00000257981:p.Asp876fs	131.0	0.0	0		126.0	51.0	0.404762	NM_012284	Q9UQ06	Frame_Shift_Del	DEL	ENST00000257981.6	hg19	CCDS8786.1																																																																																			.	.	.	none		0.619	KCNH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404571.2	NM_012284	
HNRNPUL2	221092	hgsc.bcm.edu	37	11	62491416	62491416	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr11:62491416delC	ENST00000301785.5	-	3	913	c.721delG	c.(721-723)gagfs	p.E241fs	HNRNPUL2-BSCL2_ENST00000403734.2_Frame_Shift_Del_p.E241fs	NM_001079559.2	NP_001073027.1	Q1KMD3	HNRL2_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 2	241	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.|Glu-rich. {ECO:0000255}.					membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20						GTTTGATCCTCCTCCTCATCT	0.383																																					p.E241fs		Atlas-Indel,Pindel	.											.	HNRNPUL2	41	.	0			c.722delA						PASS	.						196.0	187.0	190.0					11																	62491416		1958	4148	6106	SO:0001589	frameshift_variant	221092	exon3			.		CCDS41659.1	11q12	2013-07-16		2008-04-18	ENSG00000214753	ENSG00000214753			25451	protein-coding gene	gene with protein product				HNRPUL2			Standard	NM_001079559		Approved	DKFZp762N1910	uc001nuw.3	Q1KMD3	OTTHUMG00000167773	ENST00000301785.5:c.721delG	chr11.hg19:g.62491416delC	ENSP00000301785:p.Glu241fs	215.0	0.0	0		157.0	95.0	0.605096	NM_001079559	Q8N3B3	Frame_Shift_Del	DEL	ENST00000301785.5	hg19	CCDS41659.1																																																																																			.	.	.	none		0.383	HNRNPUL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396208.2	XM_495877	
CCDC42B	387885	hgsc.bcm.edu	37	12	113593105	113593106	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr12:113593105_113593106delAG	ENST00000335621.6	+	6	731_732	c.731_732delAG	c.(730-732)aagfs	p.K244fs	Y_RNA_ENST00000363029.1_RNA	NM_001144872.1	NP_001138344.1	A6NFT4	CC42B_HUMAN	coiled-coil domain containing 42B	244																	GCAGCGGAGAAGACTCTGCTCC	0.609																																					p.244_244del		Atlas-Indel,Pindel	.											.	CCDC42B	3	.	0			c.730_731del						PASS	.																																			SO:0001589	frameshift_variant	387885	exon6			.		CCDS44983.1	12q24.13	2014-07-31			ENSG00000186710	ENSG00000186710			37100	protein-coding gene	gene with protein product						23569216	Standard	NM_001144872		Approved	MIA2	uc010sys.2	A6NFT4	OTTHUMG00000169655	ENST00000335621.6:c.731_732delAG	chr12.hg19:g.113593105_113593106delAG	ENSP00000333915:p.Lys244fs	62.0	0.0	0		80.0	35.0	0.4375	NM_001144872		Frame_Shift_Del	DEL	ENST00000335621.6	hg19	CCDS44983.1																																																																																			.	.	.	none		0.609	CCDC42B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405303.1	NM_001144872	
DNALI1	7802	hgsc.bcm.edu	37	1	38027791	38027793	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	AGA	AGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr1:38027791_38027793delAGA	ENST00000296218.7	+	5	762_764	c.752_754delAGA	c.(751-756)gagaag>gag	p.K253del	DNALI1_ENST00000541606.1_In_Frame_Del_p.K105del|DNALI1_ENST00000497858.1_3'UTR	NM_003462.3	NP_003453.2	O14645	IDLC_HUMAN	dynein, axonemal, light intermediate chain 1	231					cellular component movement (GO:0006928)|metabolic process (GO:0008152)|single fertilization (GO:0007338)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|filopodium (GO:0030175)	microtubule motor activity (GO:0003777)			breast(1)|kidney(1)|large_intestine(2)|ovary(1)	5		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CAGGTGGAGGAGAAGAAGCACAA	0.567																																					p.251_251del		Atlas-Indel,Pindel	.											.	DNALI1	25	.	0			c.751_753del						PASS	.			3,4263		0,3,2130						5.4	1.0			104	1,8253		0,1,4126	no	coding	DNALI1	NM_003462.3		0,4,6256	A1A1,A1R,RR		0.0121,0.0703,0.0319				4,12516				SO:0001651	inframe_deletion	7802	exon5			.	AF006386	CCDS420.1	1p35.1	2008-07-18	2006-09-04		ENSG00000163879	ENSG00000163879		"""Axonemal dyneins"""	14353	protein-coding gene	gene with protein product	"""inner dynein arm, homolog of clamydomonas"", ""dJ423B22.5 (axonemal dynein light chain (hp28))"""	602135	"""dynein, axonemal, light intermediate polypeptide 1"""			9284741	Standard	NM_003462		Approved	P28, hp28, dJ423B22.5	uc001cbj.3	O14645	OTTHUMG00000004222	ENST00000296218.7:c.752_754delAGA	chr1.hg19:g.38027794_38027796delAGA	ENSP00000296218:p.Lys253del	119.0	0.0	0		110.0	56.0	0.509091	NM_003462	A8K387|B4DHN6|Q05BL9|Q5HYE2|Q5TGH0|Q7L0I5	In_Frame_Del	DEL	ENST00000296218.7	hg19	CCDS420.1																																																																																			.	.	.	none		0.567	DNALI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012159.1	NM_003462	
TMPRSS11A	339967	hgsc.bcm.edu	37	4	68777111	68777111	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr4:68777111delG	ENST00000334830.7	-	10	1961	c.1215delC	c.(1213-1215)tacfs	p.Y405fs	TMPRSS11A_ENST00000396188.2_Frame_Shift_Del_p.Y402fs|UBA6-AS1_ENST00000500538.2_RNA|TMPRSS11A_ENST00000508048.1_Frame_Shift_Del_p.Y401fs			Q6ZMR5	TM11A_HUMAN	transmembrane protease, serine 11A	405	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cell cycle (GO:0007049)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			breast(1)|cervix(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	29						TCACTTGTGTGTAGACTCCAG	0.408																																					p.T406fs	NSCLC(26;2 894 10941 14480 22546)	Atlas-INDEL	.											.	TMPRSS11A	74	.	0			c.1216delA						PASS	.						192.0	181.0	185.0					4																	68777111		2203	4300	6503	SO:0001589	frameshift_variant	339967	exon10			.	AF071882	CCDS3519.1	4q13.2	2010-04-13			ENSG00000187054	ENSG00000187054		"""Serine peptidases / Transmembrane"""	27954	protein-coding gene	gene with protein product		611704				15328353	Standard	NM_182606		Approved	ECRG1	uc003hdr.1	Q6ZMR5	OTTHUMG00000129303	ENST00000334830.7:c.1215delC	chr4.hg19:g.68777111delG	ENSP00000334611:p.Tyr405fs	206.0	0.0	0		163.0	70.0	0.429448	NM_182606	J3KNQ8|Q2NKI9|Q6JE90|Q7RTY4|Q86TK8	Frame_Shift_Del	DEL	ENST00000334830.7	hg19	CCDS3519.1																																																																																			.	.	.	none		0.408	TMPRSS11A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251433.3	NM_182606	
EPS15L1	58513	hgsc.bcm.edu	37	19	16548668	16548669	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	AT	AT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr19:16548668_16548669delAT	ENST00000248070.6	-	5	360_361	c.221_222delAT	c.(220-222)tatfs	p.Y74fs	EPS15L1_ENST00000535753.2_Frame_Shift_Del_p.Y74fs|EPS15L1_ENST00000597937.1_Frame_Shift_Del_p.Y74fs|EPS15L1_ENST00000602009.1_5'Flank|EPS15L1_ENST00000455140.2_Frame_Shift_Del_p.Y74fs|EPS15L1_ENST00000594975.1_Frame_Shift_Del_p.Y74fs	NM_021235.2	NP_067058.1	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway substrate 15-like 1	74	EH 1. {ECO:0000255|PROSITE- ProRule:PRU00077}.|Interaction with DAB2. {ECO:0000250}.				endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	clathrin coat of coated pit (GO:0030132)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(4)|skin(2)	30						TCAGTGCAACATAGAAACCCTG	0.5																																					p.74_75del		Atlas-Indel,Pindel	.											.	EPS15L1	81	.	0			c.222_223del						PASS	.																																			SO:0001589	frameshift_variant	58513	exon5			.	AF110265	CCDS32944.1, CCDS58653.1, CCDS58654.1, CCDS59363.1	19p13.12	2013-01-10				ENSG00000127527		"""EF-hand domain containing"""	24634	protein-coding gene	gene with protein product							Standard	NM_001258374		Approved	eps15R	uc002ndx.4	Q9UBC2		ENST00000248070.6:c.221_222delAT	chr19.hg19:g.16548668_16548669delAT	ENSP00000248070:p.Tyr74fs	103.0	0.0	0		113.0	34.0	0.300885	NM_021235	A2RRF3|A5PL29|B4DKA3	Frame_Shift_Del	DEL	ENST00000248070.6	hg19	CCDS32944.1																																																																																			.	.	.	none		0.500	EPS15L1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000461040.1	NM_021235	
EFCAB14	9813	hgsc.bcm.edu	37	1	47144193	47144194	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	AA	AA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr1:47144193_47144194delAA	ENST00000371933.3	-	11	2403_2404	c.1427_1428delTT	c.(1426-1428)tttfs	p.F476fs	EFCAB14-AS1_ENST00000418985.1_RNA|EFCAB14-AS1_ENST00000442839.1_RNA|EFCAB14_ENST00000544071.1_Intron	NM_014774.2	NP_055589.1	O75071	EFC14_HUMAN	EF-hand calcium binding domain 14	476	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)										CATCGGAATCAAATGCTCTCAA	0.475																																					p.476_477del		Atlas-Indel,Pindel	.											.	.	.	.	0			c.1428_1429del						PASS	.																																			SO:0001589	frameshift_variant	9813	exon11			.	AB007963	CCDS30706.1	1p33	2013-01-10	2012-11-29	2012-11-29	ENSG00000159658	ENSG00000159658		"""EF-hand domain containing"""	29051	protein-coding gene	gene with protein product			"""KIAA0494"""	KIAA0494		9455484	Standard	NM_014774		Approved		uc001cqk.4	O75071	OTTHUMG00000007992	ENST00000371933.3:c.1427_1428delTT	chr1.hg19:g.47144193_47144194delAA	ENSP00000361001:p.Phe476fs	89.0	0.0	0		56.0	21.0	0.375	NM_014774	D3DQ23|Q5SXB8	Frame_Shift_Del	DEL	ENST00000371933.3	hg19	CCDS30706.1																																																																																			.	.	.	none		0.475	EFCAB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021931.1	NM_014774	
SETD2	29072	hgsc.bcm.edu	37	3	47163966	47163967	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr3:47163966_47163967insC	ENST00000409792.3	-	3	2201_2202	c.2159_2160insG	c.(2158-2160)ggafs	p.G720fs		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	720					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TATTCTGAAATCCATTTGATGA	0.391			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.G720fs		Atlas-Indel,Pindel	.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2	721	.	0			c.2160_2161insG						PASS	.																																			SO:0001589	frameshift_variant	29072	exon3			.	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.2160dupG	chr3.hg19:g.47163968_47163968dupC	ENSP00000386759:p.Gly720fs	71.0	0.0	0		49.0	37.0	0.755102	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Frame_Shift_Ins	INS	ENST00000409792.3	hg19	CCDS2749.2																																																																																			.	.	.	none		0.391	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
CTTNBP2NL	55917	hgsc.bcm.edu	37	1	112999419	112999419	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr1:112999419delG	ENST00000271277.6	+	6	1530	c.1305delG	c.(1303-1305)aagfs	p.K435fs		NM_018704.2	NP_061174.1	Q9P2B4	CT2NL_HUMAN	CTTNBP2 N-terminal like	435					negative regulation of transmembrane transport (GO:0034763)|negative regulation of transporter activity (GO:0032410)|protein dephosphorylation (GO:0006470)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	protein phosphatase 2A binding (GO:0051721)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	29		all_cancers(81;0.00064)|all_epithelial(167;0.000415)|all_lung(203;0.00045)|Lung NSC(69;0.000705)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TACTCACTAAGCGTTTATTGG	0.557																																					p.K435fs		Atlas-Indel,Pindel	.											.	CTTNBP2NL	65	.	0			c.1304delA						PASS	.						255.0	260.0	258.0					1																	112999419		2203	4300	6503	SO:0001589	frameshift_variant	55917	exon6			.	AB037854	CCDS845.1	1p13.2	2008-02-05			ENSG00000143079	ENSG00000143079			25330	protein-coding gene	gene with protein product		615100				10718198	Standard	NM_018704		Approved	DKFZp547A023	uc001ebx.3	Q9P2B4	OTTHUMG00000011154	ENST00000271277.6:c.1305delG	chr1.hg19:g.112999419delG	ENSP00000271277:p.Lys435fs	120.0	0.0	0		142.0	88.0	0.619718	NM_018704	B3KMS5|Q96B40	Frame_Shift_Del	DEL	ENST00000271277.6	hg19	CCDS845.1																																																																																			.	.	.	none		0.557	CTTNBP2NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030686.1	NM_018704	
ZNF648	127665	hgsc.bcm.edu	37	1	182026912	182026918	+	Frame_Shift_Del	DEL	TTCCTCT	TTCCTCT	-	rs145733361	byFrequency	TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	TTCCTCT	TTCCTCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr1:182026912_182026918delTTCCTCT	ENST00000339948.3	-	2	435_441	c.228_234delAGAGGAA	c.(226-234)aaagaggaafs	p.KEE76fs		NM_001009992.1	NP_001009992.1	Q5T619	ZN648_HUMAN	zinc finger protein 648	76					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E77D(1)		breast(1)|endometrium(7)|large_intestine(10)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	40						AGAATTTCTCTTCCTCTTTGCCCAGTG	0.56																																					p.77_79del	NSCLC(71;908 1374 5429 20458 35642)	Atlas-Indel,Pindel	.											.	ZNF648	111	.	1	Substitution - Missense(1)	large_intestine(1)	c.229_235del						PASS	.																																			SO:0001589	frameshift_variant	127665	exon2			.	AK128654	CCDS30952.1	1q25.3	2013-01-08			ENSG00000179930	ENSG00000179930		"""Zinc fingers, C2H2-type"""	18190	protein-coding gene	gene with protein product							Standard	NM_001009992		Approved	FLJ46813	uc001goz.3	Q5T619	OTTHUMG00000037302	ENST00000339948.3:c.228_234delAGAGGAA	chr1.hg19:g.182026912_182026918delTTCCTCT	ENSP00000344129:p.Lys76fs	121.0	0.0	0		160.0	31.0	0.19375	NM_001009992	B2RP16	Frame_Shift_Del	DEL	ENST00000339948.3	hg19	CCDS30952.1																																																																																			.	.	.	none		0.560	ZNF648-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090794.1	XM_060597	
FANCI	55215	hgsc.bcm.edu	37	15	89801970	89801970	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr15:89801970delA	ENST00000310775.7	+	3	206	c.120delA	c.(118-120)ggafs	p.G40fs	FANCI_ENST00000451393.2_5'UTR|FANCI_ENST00000567996.1_Frame_Shift_Del_p.G40fs|FANCI_ENST00000300027.8_Frame_Shift_Del_p.G40fs	NM_001113378.1	NP_001106849.1	Q9NVI1	FANCI_HUMAN	Fanconi anemia, complementation group I	40					cell cycle (GO:0007049)|DNA repair (GO:0006281)|positive regulation of protein ubiquitination (GO:0031398)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA polymerase binding (GO:0070182)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	Lung NSC(78;0.0472)|all_lung(78;0.089)					CAGTGAAAGGAAAAGTTGCTG	0.388								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.G40fs		Atlas-Indel,Pindel	.											.	FANCI	129	.	0			c.119delG						PASS	.						181.0	178.0	179.0					15																	89801970		2200	4299	6499	SO:0001589	frameshift_variant	55215	exon3	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	.	BC004277	CCDS10349.2, CCDS45346.1	15q26.1	2014-09-17	2007-05-03	2007-05-03	ENSG00000140525	ENSG00000140525		"""Fanconi anemia, complementation groups"""	25568	protein-coding gene	gene with protein product		611360	"""KIAA1794"""	KIAA1794		14630800, 17460694, 17412408	Standard	NM_001113378		Approved	FLJ10719	uc010bnp.1	Q9NVI1	OTTHUMG00000132993	ENST00000310775.7:c.120delA	chr15.hg19:g.89801970delA	ENSP00000310842:p.Gly40fs	82.0	0.0	0		102.0	46.0	0.45098	NM_001113378	A4ZVE4|A5YMH4|A6NJZ0|Q96JN1|Q96ST0|Q9BT96	Frame_Shift_Del	DEL	ENST00000310775.7	hg19	CCDS45346.1																																																																																			.	.	.	none		0.388	FANCI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421140.1	NM_018193	
SLC17A3	10786	hgsc.bcm.edu	37	6	25850278	25850278	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr6:25850278delA	ENST00000360657.3	-	8	1172	c.887delT	c.(886-888)ttafs	p.L296fs	SLC17A3_ENST00000397060.4_Frame_Shift_Del_p.L374fs|SLC17A3_ENST00000361703.6_Frame_Shift_Del_p.L296fs			O00476	NPT4_HUMAN	solute carrier family 17 (organic anion transporter), member 3	296					drug transmembrane transport (GO:0006855)|drug transport (GO:0015893)|glucose-6-phosphate transport (GO:0015760)|ion transmembrane transport (GO:0034220)|organic acid transport (GO:0015849)|organic anion transport (GO:0015711)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|regulation of anion transport (GO:0044070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)|urate transport (GO:0015747)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|efflux transmembrane transporter activity (GO:0015562)|organic anion transmembrane transporter activity (GO:0008514)|sodium:phosphate symporter activity (GO:0005436)|toxin transporter activity (GO:0019534)|urate transmembrane transporter activity (GO:0015143)|voltage-gated anion channel activity (GO:0008308)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)	20						GTTCTTACCTAAAATTGTGGC	0.408																																					p.L374fs		Atlas-Indel,Pindel	.											.	SLC17A3	95	.	0			c.1122delA						PASS	.						97.0	96.0	97.0					6																	25850278		2203	4300	6503	SO:0001589	frameshift_variant	10786	exon9			.	U90545	CCDS4566.2, CCDS47385.1	6p22.2	2013-07-18	2013-07-18		ENSG00000124564	ENSG00000124564		"""Solute carriers"""	10931	protein-coding gene	gene with protein product		611034	"""solute carrier family 17 (sodium phosphate), member 3"""			9149941	Standard	NM_006632		Approved	NPT4	uc003nfk.4	O00476	OTTHUMG00000014412	ENST00000360657.3:c.887delT	chr6.hg19:g.25850278delA	ENSP00000353873:p.Leu296fs	95.0	0.0	0		99.0	41.0	0.414141	NM_001098486	B7WNJ5|B7Z511|Q8WWC7|Q9H533	Frame_Shift_Del	DEL	ENST00000360657.3	hg19	CCDS4566.2																																																																																			.	.	.	none		0.408	SLC17A3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040070.2		
RCAN3	11123	hgsc.bcm.edu	37	1	24840954	24840954	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr1:24840954delA	ENST00000374395.4	+	2	405	c.92delA	c.(91-93)gaafs	p.E31fs	RCAN3_ENST00000436717.2_Frame_Shift_Del_p.E31fs|RCAN3_ENST00000412742.2_Frame_Shift_Del_p.E31fs|RCAN3_ENST00000538532.1_Frame_Shift_Del_p.E31fs|RCAN3_ENST00000374393.2_Frame_Shift_Del_p.E31fs	NM_001251978.1|NM_001251979.1|NM_001251984.1	NP_001238907.1|NP_001238908.1|NP_001238913.1	Q9UKA8	RCAN3_HUMAN	RCAN family member 3	31					anatomical structure morphogenesis (GO:0009653)|calcium-mediated signaling (GO:0019722)		RNA binding (GO:0003723)|troponin I binding (GO:0031013)			central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)	7		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00473)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0427)|OV - Ovarian serous cystadenocarcinoma(117;1.13e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;0.000923)|BRCA - Breast invasive adenocarcinoma(304;0.0018)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.00493)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.14)		ATTTTTGGTGAAAATGAAGAT	0.438																																					p.E31fs		Atlas-Indel,Pindel	.											.	RCAN3	22	.	0			c.91delG						PASS	.						199.0	184.0	189.0					1																	24840954		2203	4300	6503	SO:0001589	frameshift_variant	11123	exon1			.		CCDS254.1, CCDS57980.1, CCDS57981.1, CCDS57982.1, CCDS72730.1	1p35.3-p33	2008-02-05	2007-06-26	2007-06-26	ENSG00000117602	ENSG00000117602			3042	protein-coding gene	gene with protein product		605860	"""Down syndrome critical region gene 1-like 2"""	DSCR1L2		10756093	Standard	NM_001251984		Approved		uc001bjj.3	Q9UKA8	OTTHUMG00000003298	ENST00000374395.4:c.92delA	chr1.hg19:g.24840954delA	ENSP00000363516:p.Glu31fs	325.0	0.0	0		264.0	121.0	0.458333	NM_001251980	A4GU14|A4LA69|E3VWE2|E5L4P0|E5L4P7|E7ENV1|E7EWD8|G1FI66|G1FLF0|Q5ECL3|Q5TGC6|Q9NUC8|Q9UKA7	Frame_Shift_Del	DEL	ENST00000374395.4	hg19	CCDS254.1																																																																																			.	.	.	none		0.438	RCAN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009176.2		
PCLO	27445	hgsc.bcm.edu	37	7	82579041	82579041	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr7:82579041delT	ENST00000333891.9	-	6	11200	c.10863delA	c.(10861-10863)aaafs	p.K3621fs	PCLO_ENST00000437081.1_Frame_Shift_Del_p.K341fs|PCLO_ENST00000423517.2_Frame_Shift_Del_p.K3621fs	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						AGTAAAGGACTTTGGGGGATT	0.478																																					p.V3622fs		Atlas-Indel,Pindel	.											.	PCLO	1506	.	0			c.10864delG						PASS	.						106.0	107.0	106.0					7																	82579041		2005	4186	6191	SO:0001589	frameshift_variant	27445	exon6			.	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.10863delA	chr7.hg19:g.82579041delT	ENSP00000334319:p.Lys3621fs	87.0	0.0	0		111.0	46.0	0.414414	NM_014510		Frame_Shift_Del	DEL	ENST00000333891.9	hg19	CCDS47630.1																																																																																			.	.	.	none		0.478	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
PDCD11	22984	hgsc.bcm.edu	37	10	105205187	105205189	+	In_Frame_Del	DEL	TTC	TTC	-			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	TTC	TTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr10:105205187_105205189delTTC	ENST00000369797.3	+	36	5591_5593	c.5497_5499delTTC	c.(5497-5499)ttcdel	p.F1835del		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	1835					mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		GAGAATGAAGTTCTTCTTCAAGC	0.542																																					p.1832_1833del		Atlas-Indel,Pindel	.											.	PDCD11	160	.	0			c.5496_5498del						PASS	.																																			SO:0001651	inframe_deletion	22984	exon36			.	D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.5497_5499delTTC	chr10.hg19:g.105205193_105205195delTTC	ENSP00000358812:p.Phe1835del	218.0	0.0	0		209.0	56.0	0.267943	NM_014976	Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	In_Frame_Del	DEL	ENST00000369797.3	hg19	CCDS31276.1																																																																																			.	.	.	none		0.542	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050151.1		
ARID2	196528	hgsc.bcm.edu	37	12	46205220	46205221	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	AA	AA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr12:46205220_46205221delAA	ENST00000334344.6	+	4	476_477	c.304_305delAA	c.(304-306)aaafs	p.K102fs	ARID2_ENST00000422737.1_5'UTR	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	102	ARID. {ECO:0000255|PROSITE- ProRule:PRU00355}.				chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		AAAGTACGAGAAAGTTCATCAT	0.366			"""N, S, F"""		hepatocellular carcinoma																																p.101_102del		Atlas-Indel,Pindel	.		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	.	ARID2	311	.	0			c.303_304del						PASS	.																																			SO:0001589	frameshift_variant	196528	exon4			.		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.304_305delAA	chr12.hg19:g.46205220_46205221delAA	ENSP00000335044:p.Lys102fs	85.0	0.0	0		82.0	33.0	0.402439	NM_152641	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Frame_Shift_Del	DEL	ENST00000334344.6	hg19	CCDS31783.1																																																																																			.	.	.	none		0.366	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	
KLC4	89953	hgsc.bcm.edu	37	6	43041642	43041643	+	Frame_Shift_Ins	INS	-	-	CAACACGA			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr6:43041642_43041643insCAACACGA	ENST00000394056.2	+	16	2243_2244	c.1748_1749insCAACACGA	c.(1747-1752)agcaacfs	p.-584fs	PTK7_ENST00000230419.4_5'Flank|KLC4_ENST00000453940.2_Frame_Shift_Ins_p.-507fs|KLC4_ENST00000479388.1_Frame_Shift_Ins_p.-584fs|PTK7_ENST00000349241.2_5'Flank|RP11-387M24.5_ENST00000606123.1_RNA|PTK7_ENST00000352931.2_5'Flank|KLC4_ENST00000347162.5_Frame_Shift_Ins_p.-584fs|PTK7_ENST00000481273.1_5'Flank|KLC4_ENST00000394058.1_Frame_Shift_Ins_p.-584fs|PTK7_ENST00000345201.2_5'Flank|PTK7_ENST00000471863.1_5'Flank|PTK7_ENST00000476760.1_5'Flank|KLC4_ENST00000259708.3_Frame_Shift_Ins_p.-602fs			Q9NSK0	KLC4_HUMAN	kinesin light chain 4							cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)			endometrium(2)|large_intestine(7)|lung(5)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(4)	23			all cancers(41;0.00169)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0376)|KIRC - Kidney renal clear cell carcinoma(2;0.0453)			CATTGTAGCAGCAACATGAAGC	0.54																																					p.S601fs		Atlas-Indel,Pindel	.											.	KLC4	89	.	0			c.1802_1803insCAACACGA						PASS	.																																			SO:0001589	frameshift_variant	89953	exon15			.	AK055293	CCDS4882.1, CCDS4883.1, CCDS47429.1, CCDS75459.1	6p21.1	2013-01-10	2005-09-13	2005-09-13	ENSG00000137171	ENSG00000137171		"""Tetratricopeptide (TTC) repeat domain containing"""	21624	protein-coding gene	gene with protein product			"""kinesin-like 8"""	KNSL8			Standard	NM_001289034		Approved	bA387M24.3	uc003otw.1	Q9NSK0	OTTHUMG00000014720	Exception_encountered	chr6.hg19:g.43041642_43041643insCAACACGA	ENSP00000377620:p.Asn584fs	147.0	0.0	0		123.0	21.0	0.170732	NM_201523	B3KNY4|B3KPI3|B3KSQ3|B4DME9|Q66K28|Q96EG6	Frame_Shift_Ins	INS	ENST00000394056.2	hg19	CCDS4883.1																																																																																			.	.	.	none		0.540	KLC4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040579.2	NM_138343	
PXN	5829	hgsc.bcm.edu	37	12	120653013	120653013	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr12:120653013delG	ENST00000228307.7	-	8	1138	c.997delC	c.(997-999)cagfs	p.Q333fs	PXN-AS1_ENST00000542265.1_RNA|PXN_ENST00000536957.1_Frame_Shift_Del_p.Q331fs|PXN_ENST00000424649.2_Frame_Shift_Del_p.Q299fs|PXN_ENST00000458477.2_Frame_Shift_Del_p.Q166fs|PXN_ENST00000538144.1_5'UTR|PXN_ENST00000267257.7_Frame_Shift_Del_p.Q347fs|PXN_ENST00000397506.3_Frame_Shift_Del_p.Q145fs|PXN-AS1_ENST00000535200.1_RNA	NM_001080855.2	NP_001074324.1	P49023	PAXI_HUMAN	paxillin	333					activation of MAPK activity (GO:0000187)|branching morphogenesis of an epithelial tube (GO:0048754)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cellular component movement (GO:0006928)|cellular response to reactive oxygen species (GO:0034614)|cytoskeleton organization (GO:0007010)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|growth hormone receptor signaling pathway (GO:0060396)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|muscle contraction (GO:0006936)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of cell shape (GO:0008360)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	beta-catenin binding (GO:0008013)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|kidney(2)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CTGTCCAGCTGGCTCCCGGGC	0.677																																					p.Q347fs		Atlas-Indel,Pindel	.											.	PXN	69	.	0			c.1040delA						PASS	.						11.0	13.0	12.0					12																	120653013		2038	4192	6230	SO:0001589	frameshift_variant	5829	exon7			.	U14588	CCDS44996.1, CCDS44997.1, CCDS44998.1, CCDS58281.1	12q24	2006-01-23			ENSG00000089159	ENSG00000089159			9718	protein-coding gene	gene with protein product		602505				7534286	Standard	NM_001080855		Approved		uc001txv.3	P49023	OTTHUMG00000169169	ENST00000228307.7:c.997delC	chr12.hg19:g.120653013delG	ENSP00000228307:p.Gln333fs	84.0	0.0	0		68.0	28.0	0.411765	NM_001243756	B2RAI3|B7ZMB4|O14970|O14971|O60360|Q5HYA4	Frame_Shift_Del	DEL	ENST00000228307.7	hg19	CCDS44997.1																																																																																			.	.	.	none		0.677	PXN-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000402679.4	NM_002859	
C22orf42	150297	hgsc.bcm.edu	37	22	32555017	32555019	+	In_Frame_Del	DEL	CTG	CTG	-			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	CTG	CTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr22:32555017_32555019delCTG	ENST00000382097.3	-	1	256_258	c.184_186delCAG	c.(184-186)cagdel	p.Q62del	RP1-90G24.8_ENST00000426354.1_lincRNA	NM_001010859.1	NP_001010859.1	Q6IC83	CV042_HUMAN	chromosome 22 open reading frame 42	62										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(2)	24						GGCTGAGGTACTGCATGAGTTGG	0.537																																					p.62_63del		Atlas-Indel,Pindel	.											.	C22orf42	37	.	0			c.185_187del						PASS	.																																			SO:0001651	inframe_deletion	150297	exon1			.	BC040263	CCDS33639.1	22q12.3	2009-03-05			ENSG00000205856	ENSG00000205856			27160	protein-coding gene	gene with protein product						12477932	Standard	XM_005261369		Approved		uc003amd.3	Q6IC83	OTTHUMG00000030380	ENST00000382097.3:c.184_186delCAG	chr22.hg19:g.32555017_32555019delCTG	ENSP00000371529:p.Gln62del	290.0	0.0	0		274.0	49.0	0.178832	NM_001010859	A4QPH5	In_Frame_Del	DEL	ENST00000382097.3	hg19	CCDS33639.1																																																																																			.	.	.	none		0.537	C22orf42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075268.2	NM_001010859	
STAB1	23166	hgsc.bcm.edu	37	3	52555670	52555671	+	Frame_Shift_Ins	INS	-	-	T			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr3:52555670_52555671insT	ENST00000321725.6	+	57	6193_6194	c.6117_6118insT	c.(6118-6120)ttcfs	p.F2040fs		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	2040					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		CTGGCTCCTGCTTCTGTGATGA	0.604																																					p.C2039fs		Pindel	.											.	STAB1	178	.	0			c.6117_6118insT						PASS	.																																			SO:0001589	frameshift_variant	23166	exon57			.	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.6119dupT	chr3.hg19:g.52555672_52555672dupT	ENSP00000312946:p.Phe2040fs	108.0	0.0	.		92.0	14.0	0.152	NM_015136	A7E297|Q8IUH0|Q8IUH1|Q93072	Frame_Shift_Ins	INS	ENST00000321725.6	hg19	CCDS33768.1																																																																																			.	.	.	none		0.604	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2	NM_015136	
TMPRSS11A	339967	hgsc.bcm.edu	37	4	68777111	68777112	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	GT	GT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr4:68777111_68777112delGT	ENST00000334830.7	-	10	1960_1961	c.1214_1215delAC	c.(1213-1215)tacfs	p.Y405fs	TMPRSS11A_ENST00000396188.2_Frame_Shift_Del_p.Y402fs|UBA6-AS1_ENST00000500538.2_RNA|TMPRSS11A_ENST00000508048.1_Frame_Shift_Del_p.Y401fs			Q6ZMR5	TM11A_HUMAN	transmembrane protease, serine 11A	405	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cell cycle (GO:0007049)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			breast(1)|cervix(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	29						TCACTTGTGTGTAGACTCCAGG	0.411																																					p.405_406del	NSCLC(26;2 894 10941 14480 22546)	Pindel	.											.	TMPRSS11A	74	.	0			c.1215_1216del						PASS	.																																			SO:0001589	frameshift_variant	339967	exon10			.	AF071882	CCDS3519.1	4q13.2	2010-04-13			ENSG00000187054	ENSG00000187054		"""Serine peptidases / Transmembrane"""	27954	protein-coding gene	gene with protein product		611704				15328353	Standard	NM_182606		Approved	ECRG1	uc003hdr.1	Q6ZMR5	OTTHUMG00000129303	ENST00000334830.7:c.1214_1215delAC	chr4.hg19:g.68777111_68777112delGT	ENSP00000334611:p.Tyr405fs	207.0	0.0	.		165.0	48.0	0.291	NM_182606	J3KNQ8|Q2NKI9|Q6JE90|Q7RTY4|Q86TK8	Frame_Shift_Del	DEL	ENST00000334830.7	hg19	CCDS3519.1																																																																																			.	.	.	none		0.411	TMPRSS11A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251433.3	NM_182606	
DSP	1832	hgsc.bcm.edu	37	6	7562996	7562996	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B9-A44B-01A-11D-A25F-10	TCGA-B9-A44B-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	88e35d25-d98d-4576-8ebe-1cd74010ecd8	5d028c99-a58c-419a-b566-610dcba9cd5c	g.chr6:7562996delA	ENST00000379802.3	+	5	1050	c.709delA	c.(709-711)aaafs	p.K237fs	DSP_ENST00000418664.2_Frame_Shift_Del_p.K237fs	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	237	Globular 1.|Interacts with plakophilin 1 and junction plakoglobin.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		GCAGCTGGACAAAATCAAAGC	0.507																																					p.D236fs		Pindel	.											.	DSP	306	.	0			c.708delC						PASS	.						119.0	119.0	119.0					6																	7562996		2203	4300	6503	SO:0001589	frameshift_variant	1832	exon5			.	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.709delA	chr6.hg19:g.7562996delA	ENSP00000369129:p.Lys237fs	113.0	0.0	.		103.0	29.0	0.282	NM_004415	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Frame_Shift_Del	DEL	ENST00000379802.3	hg19	CCDS4501.1																																																																																			.	.	.	none		0.507	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415	
