#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MDGA1	266727	hgsc.bcm.edu	37	6	37606390	37606390	+	Missense_Mutation	SNP	C	C	T	rs376783889		TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr6:37606390C>T	ENST00000434837.3	-	15	3768	c.2590G>A	c.(2590-2592)Gcc>Acc	p.A864T	MDGA1_ENST00000297153.7_Missense_Mutation_p.A868T|MDGA1_ENST00000505425.1_Missense_Mutation_p.A864T	NM_153487.3	NP_705691.1	Q8NFP4	MDGA1_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 1	864	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				brain development (GO:0007420)|cerebral cortex radially oriented cell migration (GO:0021799)|neuron migration (GO:0001764)|spinal cord association neuron differentiation (GO:0021527)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)				central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	38						AGAGACCAGGCGTGCGTGTCC	0.642													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18090	0.0		0.0	False		,,,				2504	0.0				p.A864T		Atlas-SNP	.											MDGA1,NS,carcinoma,0,1	MDGA1	104	.	0			c.G2590A						PASS	.	C	THR/ALA	0,4120		0,0,2060	45.0	52.0	50.0		2590	4.2	0.9	6		50	1,8373		0,1,4186	no	missense	MDGA1	NM_153487.3	58	0,1,6246	TT,TC,CC		0.0119,0.0,0.0080	possibly-damaging	864/956	37606390	1,12493	2060	4187	6247	SO:0001583	missense	266727	exon15			ACCAGGCGTGCGT	AF478693	CCDS47417.1	6p21	2013-01-29			ENSG00000112139	ENSG00000112139		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19267	protein-coding gene	gene with protein product		609626				15922729, 15019943	Standard	NM_153487		Approved	GPIM, MAMDC3	uc003onu.1	Q8NFP4	OTTHUMG00000014626	ENST00000434837.3:c.2590G>A	chr6.hg19:g.37606390C>T	ENSP00000402584:p.Ala864Thr	92.0	0.0	.		69.0	3.0	.	NM_153487	A6NHG0|Q8NBE3	Missense_Mutation	SNP	ENST00000434837.3	hg19	CCDS47417.1	.	.	.	.	.	.	.	.	.	.	C	17.56	3.419072	0.62622	0.0	1.19E-4	ENSG00000112139	ENST00000434837;ENST00000297153;ENST00000505425	T;T;T	0.02158	4.42;4.42;4.42	5.04	4.17	0.49024	Concanavalin A-like lectin/glucanase (1);MAM domain (3);	0.274741	0.25321	N	0.031518	T	0.01156	0.0038	N	0.20445	0.575	0.24994	N	0.991515	D;P	0.64830	0.994;0.898	P;B	0.51385	0.668;0.104	T	0.56565	-0.7958	10	0.26408	T	0.33	.	11.8151	0.52204	0.0:0.913:0.0:0.087	.	864;864	Q8NFP4-2;Q8NFP4	.;MDGA1_HUMAN	T	864;868;864	ENSP00000402584:A864T;ENSP00000297153:A868T;ENSP00000422042:A864T	ENSP00000297153:A868T	A	-	1	0	MDGA1	37714368	0.971000	0.33674	0.945000	0.38365	0.956000	0.61745	4.713000	0.61895	1.245000	0.43885	0.650000	0.86243	GCC	.	.	.	weak		0.642	MDGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040419.3		
TSPAN33	340348	hgsc.bcm.edu	37	7	128804350	128804350	+	Silent	SNP	C	C	A			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr7:128804350C>A	ENST00000289407.4	+	5	508	c.399C>A	c.(397-399)gcC>gcA	p.A133A	Y_RNA_ENST00000363759.1_RNA	NM_178562.3	NP_848657.1	Q86UF1	TSN33_HUMAN	tetraspanin 33	133					establishment of protein localization to plasma membrane (GO:0090002)|protein maturation (GO:0051604)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	enzyme binding (GO:0019899)			NS(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	14						TCAACAATGCCATTGTGCACT	0.498											OREG0018304	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A133A		Atlas-SNP	.											.	TSPAN33	29	.	0			c.C399A						PASS	.						211.0	180.0	190.0					7																	128804350		2203	4300	6503	SO:0001819	synonymous_variant	340348	exon5			CAATGCCATTGTG		CCDS5810.1	7q32.3	2013-02-14			ENSG00000158457	ENSG00000158457		"""Tetraspanins"""	28743	protein-coding gene	gene with protein product		610120				16213355, 16242907	Standard	XM_006715960		Approved	MGC50844, Penumbra	uc003vop.2	Q86UF1	OTTHUMG00000158420	ENST00000289407.4:c.399C>A	chr7.hg19:g.128804350C>A		54.0	0.0	.	1567	76.0	48.0	.	NM_178562		Silent	SNP	ENST00000289407.4	hg19	CCDS5810.1																																																																																			.	.	.	none		0.498	TSPAN33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350983.1	NM_178562	
P2RY2	5029	hgsc.bcm.edu	37	11	72945937	72945937	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr11:72945937C>T	ENST00000311131.2	+	3	1200	c.733C>T	c.(733-735)Cgc>Tgc	p.R245C	P2RY2_ENST00000393597.2_Missense_Mutation_p.R245C|P2RY2_ENST00000393596.2_Missense_Mutation_p.R245C	NM_002564.2|NM_176072.1	NP_002555|NP_788086	P41231	P2RY2_HUMAN	purinergic receptor P2Y, G-protein coupled, 2	245					cellular ion homeostasis (GO:0006873)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of mucus secretion (GO:0070257)|regulation of vasodilation (GO:0042312)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|receptor activity (GO:0004872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(2)|urinary_tract(2)	25					Suramin(DB04786)	CAAGTCCGTGCGCACCATCGC	0.642																																					p.R245C		Atlas-SNP	.											.	P2RY2	54	.	0			c.C733T						PASS	.						101.0	92.0	95.0					11																	72945937		2200	4293	6493	SO:0001583	missense	5029	exon3			TCCGTGCGCACCA	U07225	CCDS8219.1	11q13.5-q14.1	2012-08-08				ENSG00000175591		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8541	protein-coding gene	gene with protein product		600041				8159738, 9286708	Standard	NM_002564		Approved	P2U	uc001otj.4	P41231		ENST00000311131.2:c.733C>T	chr11.hg19:g.72945937C>T	ENSP00000310305:p.Arg245Cys	51.0	0.0	.		33.0	13.0	.	NM_176071	B2R9W3|Q96EM8	Missense_Mutation	SNP	ENST00000311131.2	hg19	CCDS8219.1	.	.	.	.	.	.	.	.	.	.	C	16.27	3.076082	0.55646	.	.	ENSG00000175591	ENST00000393597;ENST00000311131;ENST00000393596	T;T;T	0.37411	1.2;1.2;1.2	4.42	3.34	0.38264	GPCR, rhodopsin-like superfamily (1);	0.057192	0.64402	D	0.000005	T	0.60830	0.2299	M	0.88450	2.955	0.52501	D	0.999954	D	0.89917	1.0	D	0.71414	0.973	T	0.66999	-0.5781	10	0.87932	D	0	.	9.3877	0.38354	0.4324:0.5676:0.0:0.0	.	245	P41231	P2RY2_HUMAN	C	245	ENSP00000377222:R245C;ENSP00000310305:R245C;ENSP00000377221:R245C	ENSP00000310305:R245C	R	+	1	0	P2RY2	72623585	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	3.622000	0.54217	2.170000	0.68504	0.561000	0.74099	CGC	.	.	.	none		0.642	P2RY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397336.1	NM_176072	
ATN1	1822	hgsc.bcm.edu	37	12	7045933	7045933	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr12:7045933G>T	ENST00000356654.4	+	5	1740	c.1503G>T	c.(1501-1503)caG>caT	p.Q501H	ATN1_ENST00000396684.2_Missense_Mutation_p.Q501H	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	501	Poly-Gln.				cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						agcagcagcagcagcaTCACG	0.632																																					p.Q501H		Atlas-SNP	.											.	ATN1	95	.	0			c.G1503T						PASS	.						50.0	59.0	56.0					12																	7045933		2203	4300	6503	SO:0001583	missense	1822	exon5			GCAGCAGCAGCAT	U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.1503G>T	chr12.hg19:g.7045933G>T	ENSP00000349076:p.Gln501His	78.0	0.0	.		109.0	10.0	.	NM_001007026	Q99495|Q99621|Q9UEK7	Missense_Mutation	SNP	ENST00000356654.4	hg19	CCDS31734.1	.	.	.	.	.	.	.	.	.	.	g	4.415	0.076769	0.08485	.	.	ENSG00000111676	ENST00000356654;ENST00000396684;ENST00000544325;ENST00000229279	T;T;T	0.56776	0.44;0.44;0.44	2.87	-4.98	0.03019	.	.	.	.	.	T	0.29158	0.0725	N	0.22421	0.69	0.09310	N	1	P	0.44521	0.837	B	0.36418	0.224	T	0.25537	-1.0129	9	0.12430	T	0.62	.	12.1608	0.54103	0.1812:0.0:0.8188:0.0	.	501	P54259	ATN1_HUMAN	H	501;501;501;86	ENSP00000349076:Q501H;ENSP00000379915:Q501H;ENSP00000441744:Q501H	ENSP00000229279:Q86H	Q	+	3	2	ATN1	6916194	0.370000	0.25047	0.054000	0.19295	0.338000	0.28826	0.810000	0.27183	-1.248000	0.02503	0.177000	0.17058	CAG	.	.	.	none		0.632	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401948.2	NM_001940	
KIF26A	26153	hgsc.bcm.edu	37	14	104639376	104639376	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr14:104639376G>A	ENST00000423312.2	+	8	1483	c.1483G>A	c.(1483-1485)Gcc>Acc	p.A495T	KIF26A_ENST00000315264.7_Missense_Mutation_p.A356T	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	495	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		CGTGCCCTGCGCCATCTCCTG	0.682																																					p.A495T		Atlas-SNP	.											.	KIF26A	84	.	0			c.G1483A						PASS	.						21.0	27.0	25.0					14																	104639376		2117	4214	6331	SO:0001583	missense	26153	exon8			CCCTGCGCCATCT	AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.1483G>A	chr14.hg19:g.104639376G>A	ENSP00000388241:p.Ala495Thr	84.0	0.0	.		76.0	6.0	.	NM_015656	Q8TAZ7|Q96GK3|Q9UFL3	Missense_Mutation	SNP	ENST00000423312.2	hg19	CCDS45171.1	.	.	.	.	.	.	.	.	.	.	G	35	5.536616	0.96460	.	.	ENSG00000066735	ENST00000423312;ENST00000315264	T;T	0.48522	0.81;0.81	4.84	4.84	0.62591	Kinesin, motor domain (4);	.	.	.	.	T	0.65616	0.2708	L	0.53617	1.68	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.68891	-0.5289	9	0.66056	D	0.02	.	17.9375	0.89017	0.0:0.0:1.0:0.0	.	495	Q9ULI4	KI26A_HUMAN	T	495;356	ENSP00000388241:A495T;ENSP00000325452:A356T	ENSP00000325452:A356T	A	+	1	0	KIF26A	103709129	1.000000	0.71417	1.000000	0.80357	0.739000	0.42172	7.702000	0.84576	2.223000	0.72356	0.462000	0.41574	GCC	.	.	.	none		0.682	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414356.1		
ALKBH7	84266	hgsc.bcm.edu	37	19	6374248	6374248	+	Missense_Mutation	SNP	G	G	T	rs377101608		TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr19:6374248G>T	ENST00000245812.3	+	2	627	c.239G>T	c.(238-240)cGc>cTc	p.R80L	ALKBH7_ENST00000596657.1_5'UTR|ALKBH7_ENST00000599849.1_Missense_Mutation_p.R19L	NM_032306.3	NP_115682.1	Q9BT30	ALKB7_HUMAN	alkB, alkylation repair homolog 7 (E. coli)	80					cellular response to DNA damage stimulus (GO:0006974)|fatty acid metabolic process (GO:0006631)|regulation of lipid storage (GO:0010883)|regulation of mitochondrial membrane permeability involved in programmed necrotic cell death (GO:1902445)	mitochondrial matrix (GO:0005759)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6						GAGAAGTCGCGCTGGTCAGAA	0.657																																					p.R80L		Atlas-SNP	.											.	ALKBH7	18	.	0			c.G239T						PASS	.						27.0	31.0	29.0					19																	6374248		2201	4299	6500	SO:0001583	missense	84266	exon2			AGTCGCGCTGGTC	AY427650	CCDS12163.1	19p13.3	2008-02-05	2006-02-09	2006-02-09		ENSG00000125652		"""Alkylation repair homologs"""	21306	protein-coding gene	gene with protein product		613305	"""spermatogenesis associated 11"""	SPATA11		12477932	Standard	NM_032306		Approved	MGC10974	uc002meo.2	Q9BT30		ENST00000245812.3:c.239G>T	chr19.hg19:g.6374248G>T	ENSP00000245812:p.Arg80Leu	125.0	0.0	.		109.0	5.0	.	NM_032306	B2R4U9|Q53FF3	Missense_Mutation	SNP	ENST00000245812.3	hg19	CCDS12163.1	.	.	.	.	.	.	.	.	.	.	G	16.43	3.121815	0.56613	.	.	ENSG00000125652	ENST00000245812	T	0.13778	2.56	4.66	3.62	0.41486	.	0.393786	0.28062	N	0.016752	T	0.09291	0.0229	L	0.34521	1.04	0.28251	N	0.925264	P	0.40970	0.734	B	0.39904	0.313	T	0.10428	-1.0630	10	0.30078	T	0.28	-20.618	5.3379	0.15967	0.2546:0.0:0.7454:0.0	.	80	Q9BT30	ALKB7_HUMAN	L	80	ENSP00000245812:R80L	ENSP00000245812:R80L	R	+	2	0	ALKBH7	6325248	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	2.920000	0.48844	2.590000	0.87494	0.555000	0.69702	CGC	.	.	.	alt		0.657	ALKBH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453036.1	NM_032306	
GRIK5	2901	hgsc.bcm.edu	37	19	42525580	42525580	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr19:42525580G>A	ENST00000262895.3	-	14	1743	c.1744C>T	c.(1744-1746)Cgc>Tgc	p.R582C	GRIK5_ENST00000301218.4_Missense_Mutation_p.R582C|GRIK5_ENST00000593562.1_Missense_Mutation_p.R582C	NM_002088.4	NP_002079.3	Q16478	GRIK5_HUMAN	glutamate receptor, ionotropic, kainate 5	582					cellular response to glucose stimulus (GO:0071333)|establishment of localization in cell (GO:0051649)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|positive regulation of neuron apoptotic process (GO:0043525)|protein retention in ER lumen (GO:0006621)|receptor clustering (GO:0043113)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.R582C(2)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	35		Prostate(69;0.059)				ATGTGGGGGCGTGCCCGCAGG	0.652																																					p.R582C		Atlas-SNP	.											GRIK5_ENST00000301218,NS,carcinoma,0,2	GRIK5	220	.	2	Substitution - Missense(2)	prostate(2)	c.C1744T						PASS	.						35.0	29.0	31.0					19																	42525580		2203	4300	6503	SO:0001583	missense	2901	exon14			GGGGGCGTGCCCG		CCDS12595.1	19q13.2	2012-08-29			ENSG00000105737	ENSG00000105737		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4583	protein-coding gene	gene with protein product		600283		GRIK2		7527545	Standard	NM_002088		Approved	GluK5, KA2	uc002osj.2	Q16478	OTTHUMG00000044573	ENST00000262895.3:c.1744C>T	chr19.hg19:g.42525580G>A	ENSP00000262895:p.Arg582Cys	54.0	0.0	.		62.0	16.0	.	NM_002088	Q8WWG8	Missense_Mutation	SNP	ENST00000262895.3	hg19	CCDS12595.1	.	.	.	.	.	.	.	.	.	.	G	16.70	3.194809	0.58017	.	.	ENSG00000105737	ENST00000262895;ENST00000301218	T;T	0.14022	2.59;2.54	4.51	4.51	0.55191	Ionotropic glutamate receptor (2);	0.153806	0.42821	D	0.000644	T	0.24353	0.0590	L	0.32530	0.975	0.45621	D	0.99855	D	0.89917	1.0	D	0.70016	0.967	T	0.01114	-1.1447	10	0.62326	D	0.03	.	11.8849	0.52596	0.0:0.0:0.8248:0.1752	.	582	Q16478	GRIK5_HUMAN	C	582	ENSP00000262895:R582C;ENSP00000301218:R582C	ENSP00000262895:R582C	R	-	1	0	GRIK5	47217420	0.846000	0.29590	0.903000	0.35520	0.645000	0.38454	1.338000	0.33873	2.055000	0.61198	0.563000	0.77884	CGC	.	.	.	none		0.652	GRIK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463453.1		
COPS4	51138	hgsc.bcm.edu	37	4	83996480	83996480	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr4:83996480delA	ENST00000264389.2	+	10	1253	c.1118delA	c.(1117-1119)cagfs	p.Q373fs	COPS4_ENST00000509093.1_Frame_Shift_Del_p.R345fs|COPS4_ENST00000511653.1_3'UTR|COPS4_ENST00000503682.1_Frame_Shift_Del_p.Q405fs	NM_016129.2	NP_057213.2	Q9BT78	CSN4_HUMAN	COP9 signalosome subunit 4	373					cullin deneddylation (GO:0010388)|protein deneddylation (GO:0000338)	cell junction (GO:0030054)|COP9 signalosome (GO:0008180)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)				endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|urinary_tract(2)	13		Hepatocellular(203;0.114)				TGGGATAAGCAGATCCAATCA	0.403																																					p.Q373fs		Atlas-Indel,Pindel	.											.	COPS4	31	.	0			c.1117delC						PASS	.						87.0	85.0	86.0					4																	83996480		2203	4300	6503	SO:0001589	frameshift_variant	51138	exon10			.	AF100757	CCDS3600.1, CCDS58909.1	4q21.22	2013-03-14	2013-03-14		ENSG00000138663	ENSG00000138663			16702	protein-coding gene	gene with protein product			"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 4"", ""COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis)"""			9707402	Standard	NM_016129		Approved	CSN4	uc003hoa.3	Q9BT78	OTTHUMG00000130298	ENST00000264389.2:c.1118delA	chr4.hg19:g.83996480delA	ENSP00000264389:p.Gln373fs	79.0	0.0	0		71.0	15.0	0.211268	NM_016129	B3KN88|B3KST5|Q561W7|Q9NW31|Q9Y677	Frame_Shift_Del	DEL	ENST00000264389.2	hg19	CCDS3600.1																																																																																			.	.	.	none		0.403	COPS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252643.1		
PIK3R4	30849	hgsc.bcm.edu	37	3	130425829	130425831	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-B9-A5W7-01A-11D-A31X-10	TCGA-B9-A5W7-10A-01D-A31X-10	GAG	GAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	04439867-bb35-44ec-aedd-2cd6183e9b6c	9ef148bd-57c7-41bb-98f3-cb473f34b1ab	g.chr3:130425829_130425831delGAG	ENST00000356763.3	-	11	3239_3241	c.2682_2684delCTC	c.(2680-2685)tcctct>tct	p.894_895SS>S		NM_014602.2	NP_055417.1	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	894					innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(6)|large_intestine(16)|lung(28)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	77						AATGCCAGCAGAGGACTCGGAAC	0.502																																					p.895_895del		Atlas-Indel,Pindel	.											.	PIK3R4	145	.	0			c.2683_2685del						PASS	.																																			SO:0001651	inframe_deletion	30849	exon11			.	Y08991	CCDS3067.1	3q22.1	2013-01-10	2008-02-04		ENSG00000196455	ENSG00000196455		"""WD repeat domain containing"""	8982	protein-coding gene	gene with protein product		602610				8999962	Standard	NM_014602		Approved	VPS15, p150	uc003enj.3	Q99570	OTTHUMG00000159645	ENST00000356763.3:c.2682_2684delCTC	chr3.hg19:g.130425829_130425831delGAG	ENSP00000349205:p.Ser895del	150.0	0.0	0		112.0	12.0	0.107143	NM_014602	Q2TBF4	In_Frame_Del	DEL	ENST00000356763.3	hg19	CCDS3067.1																																																																																			.	.	.	none		0.502	PIK3R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356668.1	NM_014602	
