#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PITHD1	57095	hgsc.bcm.edu	37	1	24105128	24105128	+	Silent	SNP	A	A	G	rs562148184		TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr1:24105128A>G	ENST00000246151.4	+	1	234	c.123A>G	c.(121-123)caA>caG	p.Q41Q	RP5-886K2.3_ENST00000427796.1_RNA	NM_020362.4	NP_065095.2	Q9GZP4	PITH1_HUMAN	PITH (C-terminal proteasome-interacting domain of thioredoxin-like) domain containing 1	41	PITH. {ECO:0000255|PROSITE- ProRule:PRU00864}.					nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)	6						AGCGGCTGCAATGCCTTAACG	0.751													G|||	1	0.000199681	0.0	0.0014	5008	,	,		6646	0.0		0.0	False		,,,				2504	0.0				p.Q41Q		Atlas-SNP	.											.	PITHD1	20	.	0			c.A123G						PASS	.																																			SO:0001819	synonymous_variant	57095	exon1			GCTGCAATGCCTT		CCDS240.1	1p36.11	2011-02-21	2011-02-21	2011-02-21	ENSG00000057757	ENSG00000057757			25022	protein-coding gene	gene with protein product	"""TXNL1 C-terminal like"""		"""chromosome 1 open reading frame 128"""	C1orf128		12477932	Standard	NM_020362		Approved	HT014, TXNL1CL	uc001bhq.3	Q9GZP4	OTTHUMG00000002960	ENST00000246151.4:c.123A>G	chr1.hg19:g.24105128A>G		4.0	0.0	.		17.0	7.0	.	NM_020362	B2R7J4|Q5QPN6|Q5QPN7|Q9NRI8	Silent	SNP	ENST00000246151.4	hg19	CCDS240.1																																																																																			.	.	.	none		0.751	PITHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008243.1	NM_020362	
HFM1	164045	hgsc.bcm.edu	37	1	91742587	91742587	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr1:91742587C>G	ENST00000370425.3	-	31	3522	c.3424G>C	c.(3424-3426)Gaa>Caa	p.E1142Q	HFM1_ENST00000370424.3_Missense_Mutation_p.E821Q|HFM1_ENST00000462405.1_5'UTR|HFM1_ENST00000294696.5_Missense_Mutation_p.E374Q	NM_001017975.3	NP_001017975.3	A2PYH4	HFM1_HUMAN	HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)	1142					resolution of meiotic recombination intermediates (GO:0000712)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(33)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	75		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		TGATTGCATTCTCGGTTCCCA	0.289																																					p.E1142Q		Atlas-SNP	.											.	HFM1	188	.	0			c.G3424C						PASS	.						129.0	128.0	129.0					1																	91742587		2203	4299	6502	SO:0001583	missense	164045	exon31			TGCATTCTCGGTT	AB204867	CCDS30769.2	1p22.2	2008-03-26			ENSG00000162669	ENSG00000162669			20193	protein-coding gene	gene with protein product		615684	"""SEC63 domain containing 1"""	SEC63D1		14702039, 17286053	Standard	XM_006710395		Approved	MER3, FLJ39011, FLJ36760	uc001doa.4	A2PYH4	OTTHUMG00000010093	ENST00000370425.3:c.3424G>C	chr1.hg19:g.91742587C>G	ENSP00000359454:p.Glu1142Gln	109.0	0.0	.		88.0	30.0	.	NM_001017975	B1B0B6|Q8N9Q0	Missense_Mutation	SNP	ENST00000370425.3	hg19	CCDS30769.2	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	12.44|12.44|12.44	1.937796|1.937796|1.937796	0.34189|0.34189|0.34189	.|.|.	.|.|.	ENSG00000162669|ENSG00000162669|ENSG00000162669	ENST00000430465|ENST00000370425;ENST00000294696;ENST00000370424|ENST00000370421	.|T;T;T|.	.|0.64618|.	.|0.25;0.63;-0.11|.	5.71|5.71|5.71	5.71|5.71|5.71	0.89125|0.89125|0.89125	.|.|.	0.237508|0.237508|.	0.33005|0.33005|.	N|N|.	0.005389|0.005389|.	T|T|T	0.55481|0.55481|0.55481	0.1923|0.1923|0.1923	M|M|M	0.64997|0.64997|0.64997	1.995|1.995|1.995	0.36745|0.36745|0.36745	D|D|D	0.882419|0.882419|0.882419	.|B;B;B|.	.|0.28378|.	.|0.082;0.209;0.105|.	.|B;B;B|.	.|0.25614|.	.|0.045;0.062;0.034|.	T|T|T	0.59461|0.59461|0.59461	-0.7450|-0.7450|-0.7450	6|10|6	.|0.40728|0.42905	.|T|T	.|0.16|0.14	.|.|.	10.7947|10.7947|10.7947	0.46453|0.46453|0.46453	0.0:0.9137:0.0:0.0863|0.0:0.9137:0.0:0.0863|0.0:0.9137:0.0:0.0863	.|.|.	.|821;353;1142|.	.|A6NGI5;B1B0B5;A2PYH4|.	.|.;.;HFM1_HUMAN|.	D|Q|T	353|1142;374;821|825	.|ENSP00000359454:E1142Q;ENSP00000294696:E374Q;ENSP00000359453:E821Q|.	.|ENSP00000294696:E374Q|ENSP00000359450:R825T	E|E|R	-|-|-	3|1|2	2|0|0	HFM1|HFM1|HFM1	91515175|91515175|91515175	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.815000|0.815000|0.815000	0.46073|0.46073|0.46073	3.562000|3.562000|3.562000	0.53777|0.53777|0.53777	2.698000|2.698000|2.698000	0.92095|0.92095|0.92095	0.585000|0.585000|0.585000	0.79938|0.79938|0.79938	GAG|GAA|AGA	.	.	.	none		0.289	HFM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316716.2	NM_001017975	
SLC44A3	126969	hgsc.bcm.edu	37	1	95330398	95330398	+	Silent	SNP	T	T	A			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr1:95330398T>A	ENST00000271227.6	+	11	1440	c.1338T>A	c.(1336-1338)tcT>tcA	p.S446S	SLC44A3_ENST00000446120.2_Silent_p.S410S|SLC44A3_ENST00000529450.1_Silent_p.S414S|SLC44A3_ENST00000527077.1_Silent_p.S378S|SLC44A3_ENST00000467909.1_Silent_p.S398S|SLC44A3_ENST00000530397.1_3'UTR|SLC44A3_ENST00000532427.1_Silent_p.S366S	NM_001114106.2|NM_001258340.1|NM_001258341.1	NP_001107578.1|NP_001245269.1|NP_001245270.1	Q8N4M1	CTL3_HUMAN	solute carrier family 44, member 3	446					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(6)|prostate(2)|stomach(1)|urinary_tract(1)	23		all_lung(203;0.000712)|Lung NSC(277;0.00316)		all cancers(265;0.039)|Epithelial(280;0.124)	Choline(DB00122)	TTTTAATCTCTGTGGTGAGGA	0.433																																					p.S446S		Atlas-SNP	.											.	SLC44A3	109	.	0			c.T1338A						PASS	.						217.0	202.0	207.0					1																	95330398		2203	4300	6503	SO:0001819	synonymous_variant	126969	exon11			AATCTCTGTGGTG	BC033858	CCDS751.1, CCDS44176.1, CCDS58011.1, CCDS58012.1, CCDS58013.1, CCDS72827.1	1p22.1	2013-05-22	2005-09-06		ENSG00000143036	ENSG00000143036		"""Solute carriers"""	28689	protein-coding gene	gene with protein product			"""solute carrier family, member 3"""			15715662, 12975309	Standard	NM_001114106		Approved	MGC45474, CTL3	uc001dqv.5	Q8N4M1	OTTHUMG00000010700	ENST00000271227.6:c.1338T>A	chr1.hg19:g.95330398T>A		87.0	0.0	.		68.0	22.0	.	NM_001114106	B4DVY4|B4E1M4|B7ZA08|E9PJH2|E9PJY8|Q6UWT1|Q7Z6C5|Q9BWY7	Silent	SNP	ENST00000271227.6	hg19	CCDS44176.1																																																																																			.	.	.	none		0.433	SLC44A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029544.3	NM_152369	
DNAH14	127602	hgsc.bcm.edu	37	1	225546329	225546329	+	Silent	SNP	T	T	C			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr1:225546329T>C	ENST00000445597.2	+	53	9180	c.9180T>C	c.(9178-9180)acT>acC	p.T3060T	DNAH14_ENST00000439375.2_Silent_p.T3824T|DNAH14_ENST00000430092.1_Silent_p.T3824T			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	3060					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						ATGCCAGAACTCCGCTGATAC	0.348																																					p.T3824T		Atlas-SNP	.											.	DNAH14	300	.	0			c.T11472C						PASS	.						115.0	103.0	106.0					1																	225546329		692	1591	2283	SO:0001819	synonymous_variant	127602	exon72			CAGAACTCCGCTG	U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.9180T>C	chr1.hg19:g.225546329T>C		95.0	0.0	.		70.0	32.0	.	NM_001373	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Silent	SNP	ENST00000445597.2	hg19																																																																																				.	.	.	none		0.348	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000331217.3	XM_059166	
DHX57	90957	hgsc.bcm.edu	37	2	39088916	39088916	+	Silent	SNP	T	T	C			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr2:39088916T>C	ENST00000295373.6	-	5	762	c.636A>G	c.(634-636)gcA>gcG	p.A212A	AC018693.6_ENST00000442829.1_RNA|DHX57_ENST00000479345.2_5'UTR	NM_198963.1	NP_945314.1	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57	212	UBA. {ECO:0000255|PROSITE- ProRule:PRU00212}.						ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(20)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	62		all_hematologic(82;0.248)				GCTCTAGTGATGCTCCCACAT	0.448																																					p.A212A	Melanoma(191;1090 2095 4375 23729 47341)	Atlas-SNP	.											.	DHX57	127	.	0			c.A636G						PASS	.						84.0	79.0	81.0					2																	39088916		2203	4300	6503	SO:0001819	synonymous_variant	90957	exon5			TAGTGATGCTCCC	AF070590	CCDS1800.1	2p22.3	2008-02-05			ENSG00000163214	ENSG00000163214		"""DEAH-boxes"""	20086	protein-coding gene	gene with protein product							Standard	NM_198963		Approved	DDX57	uc002rrf.3	Q6P158	OTTHUMG00000102103	ENST00000295373.6:c.636A>G	chr2.hg19:g.39088916T>C		107.0	0.0	.		120.0	66.0	.	NM_198963	A2RRC7|Q53SI4|Q6P9G1|Q7Z6H3|Q8NG17|Q96M33	Silent	SNP	ENST00000295373.6	hg19	CCDS1800.1																																																																																			.	.	.	none		0.448	DHX57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219940.2	NM_145646	
STK11IP	114790	hgsc.bcm.edu	37	2	220473931	220473931	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr2:220473931T>C	ENST00000456909.1	+	16	2012	c.1922T>C	c.(1921-1923)gTc>gCc	p.V641A	STK11IP_ENST00000295641.10_Missense_Mutation_p.V652A			Q8N1F8	S11IP_HUMAN	serine/threonine kinase 11 interacting protein	652					protein localization (GO:0008104)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)	protein kinase binding (GO:0019901)			breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	23		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CACGCAGCTGTCCAGGTGATG	0.662																																					p.V652A		Atlas-SNP	.											.	STK11IP	152	.	0			c.T1955C						PASS	.						23.0	22.0	23.0					2																	220473931		2018	4164	6182	SO:0001583	missense	114790	exon16			CAGCTGTCCAGGT	AF450267	CCDS46521.1	2q35	2008-06-03			ENSG00000144589	ENSG00000144589			19184	protein-coding gene	gene with protein product	"""LKB1 interacting protein"""	607172				11741830	Standard	NM_052902		Approved	LIP1, KIAA1898, LKB1IP, STK11IP1	uc002vml.3	Q8N1F8	OTTHUMG00000059239	ENST00000456909.1:c.1922T>C	chr2.hg19:g.220473931T>C	ENSP00000389383:p.Val641Ala	82.0	0.0	.		89.0	35.0	.	NM_052902	Q8NAW9|Q8WXE4|Q96CN3|Q96PY9	Missense_Mutation	SNP	ENST00000456909.1	hg19		.	.	.	.	.	.	.	.	.	.	T	12.88	2.071525	0.36566	.	.	ENSG00000144589	ENST00000456909;ENST00000426736;ENST00000295641	T;T	0.05025	3.51;3.51	5.0	-0.564	0.11774	.	1.280970	0.05320	N	0.526447	T	0.07683	0.0193	L	0.43152	1.355	0.20821	N	0.999844	B;B;B	0.14012	0.009;0.004;0.002	B;B;B	0.15484	0.013;0.003;0.006	T	0.43956	-0.9359	10	0.72032	D	0.01	-0.0971	8.4014	0.32588	0.0:0.3626:0.0:0.6374	.	620;652;652	B4DUE4;Q8N1F8-2;Q8N1F8	.;.;S11IP_HUMAN	A	641;620;652	ENSP00000389383:V641A;ENSP00000295641:V652A	ENSP00000295641:V652A	V	+	2	0	STK11IP	220182175	0.431000	0.25546	0.117000	0.21633	0.652000	0.38707	0.654000	0.24918	-0.222000	0.09958	-0.250000	0.11733	GTC	.	.	.	none		0.662	STK11IP-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000131432.1	NM_052902	
ATXN7	6314	hgsc.bcm.edu	37	3	63983337	63983337	+	Intron	SNP	C	C	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr3:63983337C>T	ENST00000295900.6	+	12	3211				ATXN7_ENST00000398590.3_Missense_Mutation_p.T901I|ATXN7_ENST00000484332.1_Intron|ATXN7_ENST00000487717.1_Intron|ATXN7_ENST00000538065.1_Missense_Mutation_p.T901I	NM_000333.3	NP_000324.1	O15265	ATX7_HUMAN	ataxin 7						cell death (GO:0008219)|chromatin organization (GO:0006325)|histone deubiquitination (GO:0016578)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|nucleus organization (GO:0006997)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(12)|prostate(2)|stomach(1)|urinary_tract(3)	35		Prostate(884;0.0181)		BRCA - Breast invasive adenocarcinoma(55;0.000614)|KIRC - Kidney renal clear cell carcinoma(15;0.00294)|Kidney(15;0.00305)		ATTTCAGCAACATCACCCCAG	0.428																																					p.T901I		Atlas-SNP	.											.	ATXN7	126	.	0			c.C2702T						PASS	.						296.0	237.0	255.0					3																	63983337		692	1591	2283	SO:0001627	intron_variant	6314	exon12			CAGCAACATCACC	AJ000517	CCDS43102.1, CCDS46861.1, CCDS46861.2, CCDS54603.1	3p21.1-p12	2014-09-17	2004-08-12	2004-08-12	ENSG00000163635	ENSG00000163635		"""Ataxins"""	10560	protein-coding gene	gene with protein product		607640	"""spinocerebellar ataxia 7 (olivopontocerebellar atrophy with retinal degeneration)"""	SCA7		7647798, 10598805	Standard	NM_000333		Approved	OPCA3, ADCAII	uc021wzy.1	O15265	OTTHUMG00000158763	ENST00000295900.6:c.2661+1178C>T	chr3.hg19:g.63983337C>T		64.0	0.0	.		66.0	27.0	.	NM_001177387	B4E207|E9PHP9|O75328|O75329|Q9Y6P8	Missense_Mutation	SNP	ENST00000295900.6	hg19	CCDS43102.1	.	.	.	.	.	.	.	.	.	.	C	12.80	2.045840	0.36085	.	.	ENSG00000163635	ENST00000398590;ENST00000538065;ENST00000522345	T;T;T	0.51071	2.49;2.49;0.72	4.03	3.14	0.36123	.	0.628911	0.14004	N	0.347922	T	0.26159	0.0638	N	0.08118	0	0.22521	N	0.99903	B	0.12013	0.005	B	0.11329	0.006	T	0.15321	-1.0441	10	0.56958	D	0.05	0.0408	7.1588	0.25652	0.0:0.8751:0.0:0.1249	.	901	O15265-2	.	I	901;901;72	ENSP00000381590:T901I;ENSP00000439585:T901I;ENSP00000428067:T72I	ENSP00000381590:T901I	T	+	2	0	ATXN7	63958377	0.005000	0.15991	0.963000	0.40424	0.987000	0.75469	0.983000	0.29552	1.254000	0.44035	0.644000	0.83932	ACA	.	.	.	none		0.428	ATXN7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352070.1	NM_000333	
TOPBP1	11073	hgsc.bcm.edu	37	3	133331389	133331389	+	Silent	SNP	C	C	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr3:133331389C>T	ENST00000260810.5	-	24	4010	c.3879G>A	c.(3877-3879)ttG>ttA	p.L1293L		NM_007027.3	NP_008958.2	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	1293	BRCT 7. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cellular response to DNA damage stimulus (GO:0006974)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|response to ionizing radiation (GO:0010212)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(14)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	40						TTTCTATCACCAATCCACCTT	0.383								Other conserved DNA damage response genes																													p.L1293L	Ovarian(21;193 658 4424 15423 17362)	Atlas-SNP	.											.	TOPBP1	218	.	0			c.G3879A						PASS	.						50.0	48.0	49.0					3																	133331389		1904	4132	6036	SO:0001819	synonymous_variant	11073	exon24			TATCACCAATCCA	AB019397	CCDS46919.1	3q22.1	2004-06-21			ENSG00000163781	ENSG00000163781			17008	protein-coding gene	gene with protein product		607760				9461304, 9039502	Standard	NM_007027		Approved	KIAA0259, TOP2BP1	uc003eps.3	Q92547	OTTHUMG00000159773	ENST00000260810.5:c.3879G>A	chr3.hg19:g.133331389C>T		69.0	0.0	.		52.0	20.0	.	NM_007027	B7Z7W8|Q7LGC1|Q9UEB9	Silent	SNP	ENST00000260810.5	hg19	CCDS46919.1																																																																																			.	.	.	none		0.383	TOPBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357254.1	NM_007027	
CLDN16	10686	hgsc.bcm.edu	37	3	190126252	190126252	+	Missense_Mutation	SNP	T	T	G	rs143316426	byFrequency	TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr3:190126252T>G	ENST00000264734.2	+	4	990	c.742T>G	c.(742-744)Ttg>Gtg	p.L248V	CLDN16_ENST00000456423.1_Intron	NM_006580.3	NP_006571.1	Q9Y5I7	CLD16_HUMAN	claudin 16	248					calcium-independent cell-cell adhesion (GO:0016338)|cellular metal ion homeostasis (GO:0006875)|excretion (GO:0007588)|magnesium ion transport (GO:0015693)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|magnesium ion transmembrane transporter activity (GO:0015095)|structural molecule activity (GO:0005198)			breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|skin(1)	19	all_cancers(143;3.61e-10)|Ovarian(172;0.0991)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.018)		GGGTTGCTTTTTGGCTGGAGC	0.393																																					p.L248V		Atlas-SNP	.											.	CLDN16	59	.	0			c.T742G						PASS	.						142.0	138.0	140.0					3																	190126252		2203	4300	6503	SO:0001583	missense	10686	exon4			TGCTTTTTGGCTG	AF152101	CCDS3296.1	3q28	2008-12-10			ENSG00000113946	ENSG00000113946		"""Claudins"""	2037	protein-coding gene	gene with protein product	"""paracellin-1"", ""hypomagnesemia 3, with hypercalciuria and nephrocalcinosis"""	603959				10390358	Standard	NM_006580		Approved	PCLN1, HOMG3	uc003fsi.3	Q9Y5I7	OTTHUMG00000156215	ENST00000264734.2:c.742T>G	chr3.hg19:g.190126252T>G	ENSP00000264734:p.Leu248Val	69.0	0.0	.		78.0	40.0	.	NM_006580		Missense_Mutation	SNP	ENST00000264734.2	hg19	CCDS3296.1	.	.	.	.	.	.	.	.	.	.	T	12.93	2.084809	0.36758	.	.	ENSG00000113946	ENST00000264734	D	0.89875	-2.58	5.6	3.12	0.35913	.	0.099830	0.43919	D	0.000514	D	0.82282	0.5003	L	0.39326	1.205	0.80722	D	1	P	0.42296	0.775	B	0.39660	0.306	T	0.78966	-0.1995	10	0.44086	T	0.13	-2.4464	8.0251	0.30431	0.0:0.0724:0.135:0.7926	.	248	Q9Y5I7	CLD16_HUMAN	V	248	ENSP00000264734:L248V	ENSP00000264734:L248V	L	+	1	2	CLDN16	191608946	1.000000	0.71417	1.000000	0.80357	0.594000	0.36715	1.133000	0.31430	0.909000	0.36697	0.455000	0.32223	TTG	.	T|0.999;C|0.001	.	alt		0.393	CLDN16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343519.1	NM_006580	
PLK4	10733	hgsc.bcm.edu	37	4	128813596	128813596	+	Silent	SNP	T	T	C			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr4:128813596T>C	ENST00000270861.5	+	10	2389	c.2115T>C	c.(2113-2115)taT>taC	p.Y705Y	PLK4_ENST00000507249.1_Silent_p.Y644Y|PLK4_ENST00000515069.1_Silent_p.Y627Y|PLK4_ENST00000514379.1_Silent_p.Y664Y|RNU6-583P_ENST00000516012.1_RNA|PLK4_ENST00000513090.1_Silent_p.Y673Y	NM_014264.4	NP_055079.3	O00444	PLK4_HUMAN	polo-like kinase 4	705					centriole replication (GO:0007099)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of centriole replication (GO:0046601)|protein phosphorylation (GO:0006468)|trophoblast giant cell differentiation (GO:0060707)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	31						AAATCACTTATTTTACAAGAT	0.313																																					p.Y705Y	Colon(135;508 1718 19061 31832 42879)	Atlas-SNP	.											.	PLK4	65	.	0			c.T2115C						PASS	.						121.0	116.0	118.0					4																	128813596		2202	4299	6501	SO:0001819	synonymous_variant	10733	exon10			CACTTATTTTACA	Y13115	CCDS3735.1, CCDS54803.1, CCDS54804.1	4q27-q28	2013-01-18	2010-06-24	2004-01-28	ENSG00000142731	ENSG00000142731			11397	protein-coding gene	gene with protein product		605031	"""serine/threonine kinase 18"", ""polo-like kinase 4 (Drosophila)"""	STK18			Standard	NM_014264		Approved	Sak	uc003ifo.3	O00444	OTTHUMG00000133301	ENST00000270861.5:c.2115T>C	chr4.hg19:g.128813596T>C		72.0	0.0	.		115.0	31.0	.	NM_014264	B2RAL0|B7Z837|B7Z8G7|Q8IYF0|Q96Q95|Q9UD84|Q9UDE2	Silent	SNP	ENST00000270861.5	hg19	CCDS3735.1																																																																																			.	.	.	none		0.313	PLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257095.3		
CPE	1363	hgsc.bcm.edu	37	4	166300624	166300624	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr4:166300624A>C	ENST00000402744.4	+	1	531	c.251A>C	c.(250-252)gAg>gCg	p.E84A		NM_001873.2	NP_001864.1	P16870	CBPE_HUMAN	carboxypeptidase E	84					cardiac left ventricle morphogenesis (GO:0003214)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|insulin processing (GO:0030070)|metabolic process (GO:0008152)|neuropeptide signaling pathway (GO:0007218)|protein localization to membrane (GO:0072657)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)	carboxypeptidase activity (GO:0004180)|cell adhesion molecule binding (GO:0050839)|metallocarboxypeptidase activity (GO:0004181)|neurexin family protein binding (GO:0042043)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	26	all_hematologic(180;0.221)	Prostate(90;0.0962)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.137)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CGCAGCTTCGAGGGCCGGGAG	0.682																																					p.E84A		Atlas-SNP	.											.	CPE	65	.	0			c.A251C						PASS	.						13.0	14.0	14.0					4																	166300624		2161	4236	6397	SO:0001583	missense	1363	exon1			GCTTCGAGGGCCG	X51405	CCDS3810.1	4q32.3	2012-02-10			ENSG00000109472	ENSG00000109472	3.4.17.10		2303	protein-coding gene	gene with protein product	"""carboxypeptidase H"", ""enkephalin convertase"", ""insulin granule-associated carboxypeptidase"", ""cobalt-stimulated chromaffin granule carboxypeptidase"""	114855				2334405	Standard	NM_001873		Approved		uc003irg.4	P16870	OTTHUMG00000150252	ENST00000402744.4:c.251A>C	chr4.hg19:g.166300624A>C	ENSP00000386104:p.Glu84Ala	111.0	0.0	.		156.0	91.0	.	NM_001873	A8K4N1|B3KR42|B4DFN4|D3DP33|Q9UIU9	Missense_Mutation	SNP	ENST00000402744.4	hg19	CCDS3810.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.301811	0.81136	.	.	ENSG00000109472	ENST00000402744;ENST00000261510	T	0.15372	2.43	4.1	4.1	0.47936	Peptidase M14, carboxypeptidase A (2);	0.098707	0.64402	D	0.000002	T	0.27697	0.0681	M	0.84082	2.675	0.58432	D	0.999999	B	0.24576	0.106	B	0.31245	0.126	T	0.14615	-1.0466	10	0.59425	D	0.04	-28.9098	12.8978	0.58109	1.0:0.0:0.0:0.0	.	84	P16870	CBPE_HUMAN	A	84;48	ENSP00000386104:E84A	ENSP00000261510:E48A	E	+	2	0	CPE	166520074	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.494000	0.73661	1.707000	0.51288	0.254000	0.18369	GAG	.	.	.	none		0.682	CPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317094.2	NM_001873	
HIGD2A	192286	hgsc.bcm.edu	37	5	175816407	175816407	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr5:175816407T>A	ENST00000274787.2	+	2	303	c.230T>A	c.(229-231)cTc>cAc	p.L77H	NOP16_ENST00000510123.1_5'Flank|NOP16_ENST00000389158.5_5'Flank|NOP16_ENST00000509257.1_5'Flank|NOP16_ENST00000507413.1_5'Flank	NM_138820.2	NP_620175.1	Q9BW72	HIG2A_HUMAN	HIG1 hypoxia inducible domain family, member 2A	77	HIG1. {ECO:0000255|PROSITE- ProRule:PRU00836}.				negative regulation of apoptotic process (GO:0043066)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain (GO:0070469)				large_intestine(1)	1	all_cancers(89;0.00522)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.0965)		CGCTCTCAGCTCATGATGCGC	0.647																																					p.L77H		Atlas-SNP	.											.	HIGD2A	7	.	0			c.T230A						PASS	.						67.0	74.0	71.0					5																	175816407		2203	4300	6503	SO:0001583	missense	192286	exon2			CTCAGCTCATGAT	BC007502	CCDS4401.1	5q35.2	2009-03-17	2009-03-17		ENSG00000146066	ENSG00000146066			28311	protein-coding gene	gene with protein product			"""HIG1 domain family, member 2A"""			12477932	Standard	NM_138820		Approved	MGC2198	uc003meg.3	Q9BW72	OTTHUMG00000130657	ENST00000274787.2:c.230T>A	chr5.hg19:g.175816407T>A	ENSP00000274787:p.Leu77His	135.0	0.0	.		141.0	35.0	.	NM_138820		Missense_Mutation	SNP	ENST00000274787.2	hg19	CCDS4401.1	.	.	.	.	.	.	.	.	.	.	T	32	5.165072	0.94727	.	.	ENSG00000146066	ENST00000274787	.	.	.	5.89	5.89	0.94794	Hypoxia induced protein, domain (2);	0.244211	0.42548	D	0.000699	T	0.63965	0.2556	L	0.33710	1.025	0.80722	D	1	D	0.71674	0.998	D	0.68943	0.961	T	0.57911	-0.7729	9	0.13853	T	0.58	-17.0539	16.3158	0.82923	0.0:0.0:0.0:1.0	.	77	Q9BW72	HIG2A_HUMAN	H	77	.	ENSP00000274787:L77H	L	+	2	0	HIGD2A	175749013	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.646000	0.83445	2.254000	0.74563	0.533000	0.62120	CTC	.	.	.	none		0.647	HIGD2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253147.1	NM_138820	
UNC5A	90249	hgsc.bcm.edu	37	5	176300996	176300996	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr5:176300996T>G	ENST00000329542.4	+	7	1188	c.914T>G	c.(913-915)cTc>cGc	p.L305R	UNC5A_ENST00000261961.3_Missense_Mutation_p.L265R	NM_133369.2	NP_588610.2	Q6ZN44	UNC5A_HUMAN	unc-5 homolog A (C. elegans)	305					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(4)|kidney(3)|large_intestine(2)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	34	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GACGTGGCCCTCTATGTGGGC	0.627																																					p.L305R		Atlas-SNP	.											.	UNC5A	76	.	0			c.T914G						PASS	.						96.0	81.0	86.0					5																	176300996		2203	4300	6503	SO:0001583	missense	90249	exon7			TGGCCCTCTATGT	AB075856	CCDS34299.1	5q35.3	2013-01-11	2001-11-28		ENSG00000113763	ENSG00000113763		"""Immunoglobulin superfamily / I-set domain containing"""	12567	protein-coding gene	gene with protein product		607869	"""unc5 (C.elegans homolog) a"""				Standard	XM_006714927		Approved	KIAA1976, UNC5H1	uc003mey.3	Q6ZN44	OTTHUMG00000163225	ENST00000329542.4:c.914T>G	chr5.hg19:g.176300996T>G	ENSP00000332737:p.Leu305Arg	102.0	0.0	.		113.0	68.0	.	NM_133369	B2RXE6|Q8TF26|Q96GP4	Missense_Mutation	SNP	ENST00000329542.4	hg19	CCDS34299.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.466120	0.84425	.	.	ENSG00000113763	ENST00000329542;ENST00000261961	T;T	0.58506	0.33;0.68	5.3	5.3	0.74995	.	0.000000	0.64402	D	0.000001	T	0.74261	0.3693	M	0.69248	2.105	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.77603	-0.2526	10	0.87932	D	0	-27.0982	15.222	0.73320	0.0:0.0:0.0:1.0	.	265;305	Q6ZN44-3;Q6ZN44	.;UNC5A_HUMAN	R	305;265	ENSP00000332737:L305R;ENSP00000261961:L265R	ENSP00000261961:L265R	L	+	2	0	UNC5A	176233602	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	7.627000	0.83176	2.010000	0.58986	0.402000	0.26972	CTC	.	.	.	none		0.627	UNC5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372166.1	XM_030300	
TNFRSF21	27242	hgsc.bcm.edu	37	6	47254097	47254097	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr6:47254097G>A	ENST00000296861.2	-	2	724	c.331C>T	c.(331-333)Cag>Tag	p.Q111*		NM_014452.3	NP_055267.1	O75509	TNR21_HUMAN	tumor necrosis factor receptor superfamily, member 21	111					adaptive immune response (GO:0002250)|apoptotic process (GO:0006915)|B cell apoptotic process (GO:0001783)|cellular lipid metabolic process (GO:0044255)|cellular response to tumor necrosis factor (GO:0071356)|humoral immune response (GO:0006959)|myelination (GO:0042552)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-13 secretion (GO:2000666)|negative regulation of interleukin-5 secretion (GO:2000663)|negative regulation of myelination (GO:0031642)|negative regulation of T cell proliferation (GO:0042130)|neuron apoptotic process (GO:0051402)|oligodendrocyte apoptotic process (GO:0097252)|regulation of oligodendrocyte differentiation (GO:0048713)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(7)|pancreas(1)|skin(2)	21			Lung(136;0.189)			GGGCATGGCTGACTACAGTCA	0.522																																					p.Q111X		Atlas-SNP	.											.	TNFRSF21	61	.	0			c.C331T						PASS	.						162.0	141.0	149.0					6																	47254097		2203	4300	6503	SO:0001587	stop_gained	27242	exon2			ATGGCTGACTACA	AF068868	CCDS4921.1	6p21.1	2011-08-11			ENSG00000146072	ENSG00000146072		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	13469	protein-coding gene	gene with protein product	"""death receptor 6"""	605732				9714541	Standard	NM_014452		Approved	DR6, CD358	uc003oyv.3	O75509	OTTHUMG00000014796	ENST00000296861.2:c.331C>T	chr6.hg19:g.47254097G>A	ENSP00000296861:p.Gln111*	137.0	0.0	.		136.0	61.0	.	NM_014452	B2RDI9|Q0D2P5|Q96D86	Nonsense_Mutation	SNP	ENST00000296861.2	hg19	CCDS4921.1	.	.	.	.	.	.	.	.	.	.	G	39	7.562418	0.98361	.	.	ENSG00000146072	ENST00000296861	.	.	.	5.65	4.72	0.59763	.	0.399599	0.28612	N	0.014733	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	.	8.9938	0.36039	0.0:0.1192:0.6376:0.2432	.	.	.	.	X	111	.	ENSP00000296861:Q111X	Q	-	1	0	TNFRSF21	47362056	0.996000	0.38824	0.998000	0.56505	0.998000	0.95712	2.242000	0.43106	2.826000	0.97356	0.563000	0.77884	CAG	.	.	.	none		0.522	TNFRSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040814.1	NM_014452	
CEP85L	387119	hgsc.bcm.edu	37	6	118790282	118790282	+	Missense_Mutation	SNP	C	C	T	rs371610026		TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr6:118790282C>T	ENST00000368491.3	-	12	2828	c.2207G>A	c.(2206-2208)cGt>cAt	p.R736H	CEP85L_ENST00000368488.5_Missense_Mutation_p.R739H	NM_001042475.2	NP_001035940.1	Q5SZL2	CE85L_HUMAN	centrosomal protein 85kDa-like	736						centrosome (GO:0005813)|cytoplasm (GO:0005737)											GCCCTGAGCACGCTGATTAAG	0.378																																					p.R739H		Atlas-SNP	.											.	CEP85L	26	.	0			c.G2216A						PASS	.						93.0	91.0	92.0					6																	118790282		1996	4188	6184	SO:0001583	missense	387119	exon13			TGAGCACGCTGAT	AF308284	CCDS5119.2, CCDS43498.1, CCDS55052.1	6q22.31	2011-11-25	2011-11-25	2011-11-25	ENSG00000111860	ENSG00000111860			21638	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 204"""	C6orf204			Standard	NM_206921		Approved	NY-BR-15, bA57K17.2	uc003pya.2	Q5SZL2	OTTHUMG00000015465	ENST00000368491.3:c.2207G>A	chr6.hg19:g.118790282C>T	ENSP00000357477:p.Arg736His	121.0	0.0	.		105.0	22.0	.	NM_001178035	A1A4E1|A2A3P2|A2IDE5|F8W6J2|G3V0H3|Q2TAM2|Q5T323|Q7Z5K7|Q9H289	Missense_Mutation	SNP	ENST00000368491.3	hg19	CCDS43498.1	.	.	.	.	.	.	.	.	.	.	C	33	5.236142	0.95240	.	.	ENSG00000111860	ENST00000368491;ENST00000368488	T;T	0.12465	2.68;2.68	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.33411	0.0862	M	0.72118	2.19	0.52501	D	0.999954	D	0.89917	1.0	D	0.91635	0.999	T	0.01621	-1.1310	10	0.62326	D	0.03	-8.4553	20.6208	0.99490	0.0:1.0:0.0:0.0	.	736	Q5SZL2	CF204_HUMAN	H	736;739	ENSP00000357477:R736H;ENSP00000357474:R739H	ENSP00000357474:R739H	R	-	2	0	C6orf204	118896975	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.059000	0.64306	2.882000	0.98803	0.655000	0.94253	CGT	.	.	.	weak		0.378	CEP85L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041996.2	NM_001042475	
KIAA1244	57221	hgsc.bcm.edu	37	6	138656258	138656258	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr6:138656258G>A	ENST00000251691.4	+	33	6441	c.6275G>A	c.(6274-6276)aGg>aAg	p.R2092K		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		CAGGACAAGAGGCCCCGCTCA	0.647																																					p.R2092K		Atlas-SNP	.											.	KIAA1244	236	.	0			c.G6275A						PASS	.						19.0	19.0	19.0					6																	138656258		2203	4297	6500	SO:0001583	missense	57221	exon33			ACAAGAGGCCCCG	AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.6275G>A	chr6.hg19:g.138656258G>A	ENSP00000251691:p.Arg2092Lys	28.0	0.0	.		19.0	8.0	.	NM_020340		Missense_Mutation	SNP	ENST00000251691.4	hg19	CCDS5189.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.215145|5.215145	0.95104|0.95104	.|.	.|.	ENSG00000112379|ENSG00000112379	ENST00000367706|ENST00000251691	.|T	.|0.20598	.|2.06	5.76|5.76	5.76|5.76	0.90799|0.90799	.|.	.|0.156972	.|0.56097	.|D	.|0.000026	.|T	.|0.24812	.|0.0602	L|L	0.32530|0.32530	0.975|0.975	0.51012|0.51012	D|D	0.999903|0.999903	.|D	.|0.58268	.|0.982	.|D	.|0.67548	.|0.952	.|T	.|0.01301	.|-1.1391	.|10	.|0.18276	.|T	.|0.48	.|-24.3666	19.9626|19.9626	0.97256|0.97256	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|2092	.|Q5TH69	.|BIG3_HUMAN	.|K	-1|2092	.|ENSP00000251691:R2092K	.|ENSP00000251691:R2092K	.|R	+|+	.|2	.|0	KIAA1244|KIAA1244	138697951|138697951	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	9.198000|9.198000	0.94994|0.94994	2.723000|2.723000	0.93209|0.93209	0.511000|0.511000	0.50034|0.50034	.|AGG	.	.	.	none		0.647	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042425.4	NM_020340	
ANLN	54443	hgsc.bcm.edu	37	7	36446013	36446013	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr7:36446013A>C	ENST00000265748.2	+	4	932	c.711A>C	c.(709-711)aaA>aaC	p.K237N	ANLN_ENST00000396068.2_Missense_Mutation_p.K237N	NM_018685.2	NP_061155.2	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein	237	Interaction with F-actin.				hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|regulation of exit from mitosis (GO:0007096)|septin ring assembly (GO:0000921)	actin cytoskeleton (GO:0015629)|actomyosin contractile ring (GO:0005826)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	actin binding (GO:0003779)			breast(2)|endometrium(5)|kidney(5)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(2)	45						GTTTATCCAAATTTTCCTCTG	0.428																																					p.K237N		Atlas-SNP	.											.	ANLN	101	.	0			c.A711C						PASS	.						125.0	118.0	120.0					7																	36446013		2203	4300	6503	SO:0001583	missense	54443	exon4			ATCCAAATTTTCC	AF273437	CCDS5447.1, CCDS64628.1	7p15-p14	2013-01-10	2006-08-22		ENSG00000011426	ENSG00000011426		"""Pleckstrin homology (PH) domain containing"""	14082	protein-coding gene	gene with protein product			"""anillin (Drosophila Scraps homolog), actin binding protein"", ""anillin, actin binding protein (scraps homolog, Drosophila)"""			10931866	Standard	NM_001284301		Approved	ANILLIN, Scraps, scra	uc003tff.3	Q9NQW6	OTTHUMG00000023143	ENST00000265748.2:c.711A>C	chr7.hg19:g.36446013A>C	ENSP00000265748:p.Lys237Asn	104.0	0.0	.		89.0	49.0	.	NM_018685	Q5CZ78|Q6NSK5|Q9H8Y4|Q9NVN9|Q9NVP0	Missense_Mutation	SNP	ENST00000265748.2	hg19	CCDS5447.1	.	.	.	.	.	.	.	.	.	.	A	16.86	3.239520	0.58995	.	.	ENSG00000011426	ENST00000265748;ENST00000396068	T;T	0.03004	4.08;4.08	5.51	4.35	0.52113	.	0.142348	0.64402	D	0.000007	T	0.16214	0.0390	M	0.71581	2.175	0.44067	D	0.99681	D;D;D;D	0.89917	1.0;0.998;0.999;0.998	D;D;D;D	0.87578	0.998;0.913;0.973;0.913	T	0.00176	-1.1953	10	0.72032	D	0.01	-27.164	12.9765	0.58540	0.8648:0.1352:0.0:0.0	.	114;237;237;237	B4DSL6;A8K5D9;Q9NQW6-2;Q9NQW6	.;.;.;ANLN_HUMAN	N	237	ENSP00000265748:K237N;ENSP00000379380:K237N	ENSP00000265748:K237N	K	+	3	2	ANLN	36412538	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.978000	0.63799	1.024000	0.39682	0.528000	0.53228	AAA	.	.	.	none		0.428	ANLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218582.3	NM_018685	
C8orf82	414919	hgsc.bcm.edu	37	8	145753110	145753110	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr8:145753110C>A	ENST00000524821.1	-	3	482	c.267G>T	c.(265-267)gaG>gaT	p.E89D	C8orf82_ENST00000313465.5_3'UTR|LRRC24_ENST00000529415.2_5'Flank|LRRC24_ENST00000533758.1_5'Flank			Q6P1X6	CH082_HUMAN	chromosome 8 open reading frame 82	89										endometrium(1)|urinary_tract(1)	2						GGAAAGCGGCCTCGTAGCGCC	0.682																																					p.E89D		Atlas-SNP	.											.	C8orf82	7	.	0			c.G267T						PASS	.						38.0	48.0	45.0					8																	145753110		2179	4287	6466	SO:0001583	missense	414919	exon3			AGCGGCCTCGTAG		CCDS34970.1	8q24	2012-04-18			ENSG00000213563	ENSG00000213563			33826	protein-coding gene	gene with protein product						12477932	Standard	NM_001001795		Approved	MGC70857	uc003zdp.1	Q6P1X6	OTTHUMG00000165181	ENST00000524821.1:c.267G>T	chr8.hg19:g.145753110C>A	ENSP00000436621:p.Glu89Asp	8.0	0.0	.		30.0	16.0	.	NM_001001795	Q6GMR2|Q6P2Q7	Missense_Mutation	SNP	ENST00000524821.1	hg19	CCDS34970.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.5|20.5	3.998184|3.998184	0.74818|0.74818	.|.	.|.	ENSG00000213563|ENSG00000213563	ENST00000524821|ENST00000532827	.|.	.|.	.|.	3.97|3.97	2.88|2.88	0.33553|0.33553	.|.	0.238001|.	0.26891|.	U|.	0.021962|.	T|T	0.55752|0.55752	0.1940|0.1940	L|L	0.59436|0.59436	1.845|1.845	0.80722|0.80722	D|D	1|1	D;P|.	0.58268|.	0.982;0.939|.	P;P|.	0.58013|.	0.831;0.554|.	T|T	0.51872|0.51872	-0.8650|-0.8650	9|5	0.44086|.	T|.	0.13|.	-10.1373|-10.1373	3.8003|3.8003	0.08756|0.08756	0.0:0.6552:0.0:0.3448|0.0:0.6552:0.0:0.3448	.|.	81;89|.	Q6P1X6-2;Q6P1X6|.	.;CH082_HUMAN|.	D|C	89|134	.|.	ENSP00000436621:E89D|.	E|G	-|-	3|1	2|0	C8orf82|C8orf82	145723918|145723918	0.969000|0.969000	0.33509|0.33509	1.000000|1.000000	0.80357|0.80357	0.932000|0.932000	0.56968|0.56968	1.066000|1.066000	0.30604|0.30604	0.810000|0.810000	0.34279|0.34279	0.563000|0.563000	0.77884|0.77884	GAG|GGC	.	.	.	none		0.682	C8orf82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382503.1	NM_001001795	
HK1	3098	hgsc.bcm.edu	37	10	71128300	71128300	+	Silent	SNP	G	G	A			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr10:71128300G>A	ENST00000359426.6	+	5	608	c.504G>A	c.(502-504)ctG>ctA	p.L168L	HK1_ENST00000404387.2_Silent_p.L172L|HK1_ENST00000360289.2_Silent_p.L156L|HK1_ENST00000494253.1_3'UTR|HK1_ENST00000298649.3_Silent_p.L167L|HK1_ENST00000448642.2_Silent_p.L203L	NM_000188.2	NP_000179.2	P19367	HXK1_HUMAN	hexokinase 1	168	Hexokinase type-1 1.|Regulatory.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cell death (GO:0008219)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(1)|urinary_tract(2)	35						AGGCCATCCTGATCACCTGGA	0.547																																					p.L172L		Atlas-SNP	.											.	HK1	170	.	0			c.G516A						PASS	.						97.0	85.0	89.0					10																	71128300		2203	4300	6503	SO:0001819	synonymous_variant	3098	exon8			CATCCTGATCACC	M75126	CCDS7289.1, CCDS7290.1, CCDS7291.1, CCDS7292.1	10q22	2014-09-17			ENSG00000156515	ENSG00000156515	2.7.1.1		4922	protein-coding gene	gene with protein product		142600					Standard	NM_033496		Approved		uc001jpi.4	P19367	OTTHUMG00000018380	ENST00000359426.6:c.504G>A	chr10.hg19:g.71128300G>A		180.0	0.0	.		171.0	68.0	.	NM_033498	E9PCK0|O43443|O43444|O75574|Q5VTC3|Q96HC8|Q9NNZ4|Q9NNZ5	Silent	SNP	ENST00000359426.6	hg19	CCDS7292.1																																																																																			.	.	.	none		0.547	HK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048429.2	NM_000188	
HOGA1	112817	hgsc.bcm.edu	37	10	99358955	99358955	+	Silent	SNP	C	C	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr10:99358955C>T	ENST00000370646.4	+	3	811	c.450C>T	c.(448-450)ctC>ctT	p.L150L	HOGA1_ENST00000370647.4_Intron|PI4K2A_ENST00000555577.1_Intron|PI4K2A_ENST00000370649.3_Intron	NM_138413.3	NP_612422.2	Q86XE5	HOGA1_HUMAN	4-hydroxy-2-oxoglutarate aldolase 1	150					4-hydroxyproline catabolic process (GO:0019470)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|oxalate metabolic process (GO:0033609)|pyruvate biosynthetic process (GO:0042866)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	4-hydroxy-2-oxoglutarate aldolase activity (GO:0008700)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|prostate(2)|skin(1)|stomach(1)	14						GTGCGGCCCTCATTCACCACT	0.612																																					p.L150L		Atlas-SNP	.											.	HOGA1	25	.	0			c.C450T						PASS	.						52.0	47.0	49.0					10																	99358955		2203	4300	6503	SO:0001819	synonymous_variant	112817	exon3			GGCCCTCATTCAC	BC011916	CCDS7467.1, CCDS44469.1	10q24.1	2010-12-19	2010-12-19	2010-12-19	ENSG00000241935	ENSG00000241935			25155	protein-coding gene	gene with protein product	"""dihydrodipicolinate synthetase homolog 2 (E. coli)"", ""N-acetylneuraminate pyruvate lyase 2 (putative)"""	613597	"""chromosome 10 open reading frame 65"", ""dihydrodipicolinate synthase-like, mitochondrial"""	C10orf65, DHDPSL		20797690	Standard	NM_001134670		Approved	FLJ37472, DHDPS2, NPL2		Q86XE5	OTTHUMG00000018859	ENST00000370646.4:c.450C>T	chr10.hg19:g.99358955C>T		124.0	0.0	.		88.0	35.0	.	NM_138413	A8K075|Q5T680|Q5T684|Q711P0|Q8N9F2|Q96EV5	Silent	SNP	ENST00000370646.4	hg19	CCDS7467.1																																																																																			.	.	.	none		0.612	HOGA1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049726.1	NM_138413	
SLC18A2	6571	hgsc.bcm.edu	37	10	119003520	119003520	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr10:119003520G>T	ENST00000298472.5	+	3	303	c.160G>T	c.(160-162)Gag>Tag	p.E54*	SLC18A2_ENST00000497497.1_3'UTR|RP11-501J20.5_ENST00000425264.1_RNA	NM_003054.4	NP_003045.2	Q05940	VMAT2_HUMAN	solute carrier family 18 (vesicular monoamine transporter), member 2	54					aging (GO:0007568)|cellular response to ammonium ion (GO:0071242)|cellular response to drug (GO:0035690)|death (GO:0016265)|dopamine transport (GO:0015872)|endocytic recycling (GO:0032456)|glucose homeostasis (GO:0042593)|insulin secretion (GO:0030073)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|negative regulation of neurotransmitter transport (GO:0051589)|neurotransmitter loading into synaptic vesicle (GO:0098700)|neurotransmitter secretion (GO:0007269)|post-embryonic development (GO:0009791)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to corticosterone (GO:0051412)|response to herbicide (GO:0009635)|response to starvation (GO:0042594)|response to zinc ion (GO:0010043)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|dense core granule (GO:0031045)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)|terminal bouton (GO:0043195)	amine transmembrane transporter activity (GO:0005275)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)|serotonin transmembrane transporter activity (GO:0015222)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)	29		Colorectal(252;0.19)		all cancers(201;0.029)	Amphetamine(DB00182)|Benzphetamine(DB00865)|Deserpidine(DB01089)|Dextroamphetamine(DB01576)|Ephedra(DB01363)|Ephedrine(DB01364)|Isometheptene(DB06706)|Methamphetamine(DB01577)|Norepinephrine(DB00368)|Propylhexedrine(DB06714)|Reserpine(DB00206)|Tetrabenazine(DB04844)	CATTAAGCATGAGAAGAATGC	0.478																																					p.E54X		Atlas-SNP	.											SLC18A2,right_lower_lobe,carcinoma,0,1	SLC18A2	58	.	0			c.G160T						PASS	.						70.0	61.0	64.0					10																	119003520		2203	4300	6503	SO:0001587	stop_gained	6571	exon3			AAGCATGAGAAGA	L14269	CCDS7599.1	10q25	2013-07-18	2013-07-18		ENSG00000165646	ENSG00000165646		"""Solute carriers"""	10935	protein-coding gene	gene with protein product		193001		VMAT2			Standard	NM_003054		Approved	SVMT, SVAT	uc001ldd.2	Q05940	OTTHUMG00000019121	ENST00000298472.5:c.160G>T	chr10.hg19:g.119003520G>T	ENSP00000298472:p.Glu54*	88.0	0.0	.		64.0	29.0	.	NM_003054	B2RC96|D3DRC4|Q15876|Q4G147|Q5VW49|Q9H3P6	Nonsense_Mutation	SNP	ENST00000298472.5	hg19	CCDS7599.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.307301	0.81247	.	.	ENSG00000165646	ENST00000298472	.	.	.	5.82	5.82	0.92795	.	0.167513	0.52532	D	0.000078	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06494	T	0.89	-19.4478	14.7287	0.69365	0.0:0.144:0.856:0.0	.	.	.	.	X	54	.	ENSP00000298472:E54X	E	+	1	0	SLC18A2	118993510	0.976000	0.34144	0.990000	0.47175	0.418000	0.31294	1.665000	0.37449	2.756000	0.94617	0.563000	0.77884	GAG	.	.	.	none		0.478	SLC18A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050563.1	NM_003054	
ARL14EP	120534	hgsc.bcm.edu	37	11	30352522	30352522	+	Silent	SNP	C	C	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr11:30352522C>T	ENST00000282032.3	+	2	242	c.27C>T	c.(25-27)gtC>gtT	p.V9V		NM_152316.1	NP_689529.1	Q8N8R7	AL14E_HUMAN	ADP-ribosylation factor-like 14 effector protein	9						cytoplasm (GO:0005737)											CAGTTGGAGTCCAGCTTCGTA	0.378																																					p.V9V		Atlas-SNP	.											.	.	.	.	0			c.C27T						PASS	.						76.0	70.0	72.0					11																	30352522		2202	4299	6501	SO:0001819	synonymous_variant	120534	exon2			TGGAGTCCAGCTT	AK096287	CCDS7869.1	11p14.1	2014-09-17	2012-07-09	2012-07-09	ENSG00000152219	ENSG00000152219			26798	protein-coding gene	gene with protein product		612295	"""chromosome 11 open reading frame 46"""	C11orf46		21458045	Standard	XM_005252792		Approved	FLJ38968, ARF7EP	uc001mso.1	Q8N8R7	OTTHUMG00000166154	ENST00000282032.3:c.27C>T	chr11.hg19:g.30352522C>T		360.0	0.0	.		328.0	142.0	.	NM_152316	Q5HYH9	Silent	SNP	ENST00000282032.3	hg19	CCDS7869.1																																																																																			.	.	.	none		0.378	ARL14EP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388129.1	NM_152316	
CCDC85B	11007	hgsc.bcm.edu	37	11	65658488	65658488	+	Silent	SNP	C	C	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr11:65658488C>T	ENST00000312579.2	+	1	614	c.234C>T	c.(232-234)cgC>cgT	p.R78R	FIBP_ENST00000426652.2_5'Flank|FIBP_ENST00000533045.1_5'Flank|FIBP_ENST00000357519.4_5'Flank|FIBP_ENST00000338369.2_5'Flank	NM_006848.2	NP_006839.2	Q15834	CC85B_HUMAN	coiled-coil domain containing 85B	78					cell differentiation (GO:0030154)|negative regulation of cell growth (GO:0030308)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)									READ - Rectum adenocarcinoma(159;0.166)		GTGAGCTGCGCGACCTCTGCT	0.701																																					p.R78R		Atlas-SNP	.											.	CCDC85B	1	.	0			c.C234T						PASS	.						5.0	6.0	5.0					11																	65658488		2076	4086	6162	SO:0001819	synonymous_variant	11007	exon1			GCTGCGCGACCTC	BC008796	CCDS8120.1	11q13.1	2010-12-24				ENSG00000175602			24926	protein-coding gene	gene with protein product	"""hepatitis delta antigen interacting protein A"""	605360				8810253, 15644333, 17873903	Standard	NM_006848		Approved	DIPA	uc001ogf.3	Q15834		ENST00000312579.2:c.234C>T	chr11.hg19:g.65658488C>T		0.0	0.0	.		19.0	9.0	.	NM_006848	B2R598|Q96HA0	Silent	SNP	ENST00000312579.2	hg19	CCDS8120.1																																																																																			.	.	.	none		0.701	CCDC85B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391196.1	NM_006848	
SDHD	6392	hgsc.bcm.edu	37	11	111958619	111958619	+	Missense_Mutation	SNP	A	A	G	rs397514034		TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr11:111958619A>G	ENST00000375549.3	+	2	226	c.91A>G	c.(91-93)Atc>Gtc	p.I31V	SDHD_ENST00000532699.1_Missense_Mutation_p.I31V|TIMM8B_ENST00000541231.1_5'Flank|SDHD_ENST00000528182.1_Missense_Mutation_p.I31V|TIMM8B_ENST00000507614.1_5'Flank|SDHD_ENST00000526592.1_Missense_Mutation_p.I31V|TIMM8B_ENST00000504148.2_5'Flank|SDHD_ENST00000528021.1_Missense_Mutation_p.I31V|SDHD_ENST00000528048.1_Missense_Mutation_p.I31V|SDHD_ENST00000525291.1_Intron	NM_003002.2	NP_002993.1	O14521	DHSD_HUMAN	succinate dehydrogenase complex, subunit D, integral membrane protein	31					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|succinate dehydrogenase activity (GO:0000104)|ubiquinone binding (GO:0048039)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)|urinary_tract(1)	9		all_cancers(61;5.7e-14)|all_epithelial(67;3.4e-08)|Melanoma(852;8.81e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.13e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;1.05e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0515)	Hexachlorophene(DB00756)|Succinic acid(DB00139)	ACCTGCTCATATCTCAGCATT	0.473			"""Mis, N, F, S"""			"""paraganglioma, pheochromocytoma"""			Familial Paragangliomas;Cowden syndrome;Carney-Stratakis syndrome																												p.T31A		Atlas-SNP	.	yes	Rec		Familial paraganglioma	11	11q23	6392	"""succinate dehydrogenase complex, subunit D, integral membrane protein"""		O	.	SDHD	19	.	0			c.A91G						PASS	.						178.0	155.0	163.0					11																	111958619		2201	4297	6498	SO:0001583	missense	6392	exon2	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;Carney-Stratakis dyad, Paraganglioma-Gastric Stromal Sarcoma dyad	GCTCATATCTCAG	AB006202	CCDS31678.1, CCDS60958.1, CCDS60959.1, CCDS60960.1	11q23	2014-09-17				ENSG00000204370		"""Mitochondrial respiratory chain complex / Complex II"""	10683	protein-coding gene	gene with protein product		602690		PGL, PGL1		9533030, 1301144	Standard	NM_003002		Approved		uc001pmz.4	O14521		ENST00000375549.3:c.91A>G	chr11.hg19:g.111958619A>G	ENSP00000364699:p.Ile31Val	67.0	0.0	.		60.0	26.0	.	NM_003002	A6ND90|B3KQQ8|E9PIC0|E9PIG3|E9PQI9|Q53XW5|Q6IRW2	Missense_Mutation	SNP	ENST00000375549.3	hg19	CCDS31678.1	.	.	.	.	.	.	.	.	.	.	A	0.223	-1.026824	0.02045	.	.	ENSG00000204370	ENST00000375549;ENST00000528182;ENST00000528048;ENST00000528021;ENST00000526592	D;D;T;D;D	0.94497	-3.44;-2.77;-1.48;-2.76;-2.9	4.81	2.78	0.32641	.	0.321128	0.32244	N	0.006373	T	0.77624	0.4158	N	0.01168	-0.975	0.19300	N	0.999977	B	0.02656	0.0	B	0.01281	0.0	T	0.68224	-0.5465	10	0.02654	T	1	-1.6835	6.2353	0.20760	0.2591:0.0:0.7409:0.0	.	31	O14521	DHSD_HUMAN	V	31	ENSP00000364699:I31V;ENSP00000435475:I31V;ENSP00000436217:I31V;ENSP00000432465:I31V;ENSP00000432005:I31V	ENSP00000436395:I31V	I	+	1	0	SDHD	111463829	0.331000	0.24713	0.060000	0.19600	0.783000	0.44284	0.435000	0.21510	0.511000	0.28236	-0.248000	0.11899	ATC	.	.	.	none		0.473	SDHD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392351.1	NM_003002	
GXYLT1	283464	hgsc.bcm.edu	37	12	42481671	42481671	+	Missense_Mutation	SNP	A	A	G	rs202200134		TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr12:42481671A>G	ENST00000398675.3	-	8	1472	c.1240T>C	c.(1240-1242)Tgt>Cgt	p.C414R	GXYLT1_ENST00000280876.6_Missense_Mutation_p.C383R	NM_001099650.1|NM_173601.1	NP_001093120.1|NP_775872.1	Q4G148	GXLT1_HUMAN	glucoside xylosyltransferase 1	414					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|O-glycan processing (GO:0016266)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	UDP-xylosyltransferase activity (GO:0035252)			kidney(2)|large_intestine(4)|liver(3)|lung(8)	17						ATTTTTCCACAGTATGTATGC	0.313																																					p.C414R		Atlas-SNP	.											Q8IXV1_HUMAN,NS,carcinoma,0,2	GXYLT1	47	.	0			c.T1240C						PASS	.						84.0	75.0	78.0					12																	42481671		1807	4070	5877	SO:0001583	missense	283464	exon8			TTCCACAGTATGT	BC015597	CCDS41771.1, CCDS41772.1	12q12	2013-10-11	2009-11-17	2009-11-17	ENSG00000151233	ENSG00000151233		"""Glycosyltransferase family 8 domain containing"""	27482	protein-coding gene	gene with protein product		613321	"""glycosyltransferase 8 domain containing 3"""	GLT8D3		19940119	Standard	NM_001099650		Approved	FLJ43151	uc001rms.4	Q4G148	OTTHUMG00000169379	ENST00000398675.3:c.1240T>C	chr12.hg19:g.42481671A>G	ENSP00000381666:p.Cys414Arg	50.0	0.0	.		67.0	5.0	.	NM_173601	B3KWJ2|Q8IXV1|Q96BH4	Missense_Mutation	SNP	ENST00000398675.3	hg19	CCDS41772.1	.	.	.	.	.	.	.	.	.	.	A	16.55	3.153536	0.57259	.	.	ENSG00000151233	ENST00000398675;ENST00000280876	.	.	.	4.9	3.75	0.43078	.	0.000000	0.85682	D	0.000000	T	0.79173	0.4401	M	0.85197	2.74	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.80804	-0.1219	9	0.87932	D	0	-22.3783	10.8349	0.46681	0.9248:0.0:0.0752:0.0	.	383;414	Q4G148-2;Q4G148	.;GXLT1_HUMAN	R	414;383	.	ENSP00000280876:C383R	C	-	1	0	GXYLT1	40767938	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.672000	0.83956	0.830000	0.34757	-0.254000	0.11334	TGT	.	.	.	weak		0.313	GXYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403778.1	XM_290597	
KMT2D	8085	hgsc.bcm.edu	37	12	49432161	49432161	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr12:49432161A>C	ENST00000301067.7	-	34	8977	c.8978T>G	c.(8977-8979)cTg>cGg	p.L2993R	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	2993					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										ATCGTCATCCAGCTCGGGATC	0.597																																					p.L2993R		Atlas-SNP	.											.	MLL2	1173	.	0			c.T8978G						PASS	.						85.0	85.0	85.0					12																	49432161		2025	4193	6218	SO:0001583	missense	8085	exon34			TCATCCAGCTCGG	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.8978T>G	chr12.hg19:g.49432161A>C	ENSP00000301067:p.Leu2993Arg	153.0	0.0	.		173.0	49.0	.	NM_003482	O14687	Missense_Mutation	SNP	ENST00000301067.7	hg19	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	A	10.65	1.408624	0.25378	.	.	ENSG00000167548	ENST00000301067	D	0.83335	-1.71	5.46	5.46	0.80206	.	0.000000	0.30428	N	0.009645	D	0.86053	0.5841	L	0.29908	0.895	0.38041	D	0.935458	D	0.89917	1.0	D	0.75484	0.986	D	0.88960	0.3393	10	0.87932	D	0	.	14.8421	0.70233	1.0:0.0:0.0:0.0	.	2993	O14686	MLL2_HUMAN	R	2993	ENSP00000301067:L2993R	ENSP00000301067:L2993R	L	-	2	0	MLL2	47718428	0.520000	0.26250	0.999000	0.59377	0.717000	0.41224	4.553000	0.60753	2.207000	0.71202	0.533000	0.62120	CTG	.	.	.	none		0.597	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
RAB5B	5869	hgsc.bcm.edu	37	12	56384574	56384574	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr12:56384574A>G	ENST00000360299.5	+	4	645	c.424A>G	c.(424-426)Atg>Gtg	p.M142V	RAB5B_ENST00000553116.1_Missense_Mutation_p.M142V|RAB5B_ENST00000448789.2_Intron	NM_002868.3	NP_002859.1	P61020	RAB5B_HUMAN	RAB5B, member RAS oncogene family	142					antigen processing and presentation (GO:0019882)|endosome organization (GO:0007032)|GTP catabolic process (GO:0006184)|plasma membrane to endosome transport (GO:0048227)|protein transport (GO:0015031)|regulation of endocytosis (GO:0030100)|small GTPase mediated signal transduction (GO:0007264)	endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTP-dependent protein binding (GO:0030742)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(1)|liver(2)|lung(4)|upper_aerodigestive_tract(1)	9			UCEC - Uterine corpus endometrioid carcinoma (6;0.0471)|OV - Ovarian serous cystadenocarcinoma(18;0.235)			CAACAAACGTATGGTGGAGTA	0.522																																					p.M142V		Atlas-SNP	.											.	RAB5B	22	.	0			c.A424G						PASS	.						126.0	120.0	122.0					12																	56384574		2203	4300	6503	SO:0001583	missense	5869	exon4			AAACGTATGGTGG		CCDS8900.1, CCDS58244.1	12q13	2008-07-30						"""RAB, member RAS oncogene"""	9784	protein-coding gene	gene with protein product		179514				1541686, 10403367	Standard	NM_001252037		Approved		uc001siw.3	P61020		ENST00000360299.5:c.424A>G	chr12.hg19:g.56384574A>G	ENSP00000353444:p.Met142Val	102.0	0.0	.		151.0	87.0	.	NM_002868	A8K982|B4DKD7|P35239|P35277|Q6PIK9|Q86TH0|Q8IXL2	Missense_Mutation	SNP	ENST00000360299.5	hg19	CCDS8900.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.481|9.481	1.098275|1.098275	0.20552|0.20552	.|.	.|.	ENSG00000111540|ENSG00000111540	ENST00000553116;ENST00000360299|ENST00000549218	T;T|.	0.78364|.	-1.17;-1.17|.	4.81|4.81	3.66|3.66	0.41972|0.41972	Small GTP-binding protein domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.15782|0.15782	0.0380|0.0380	N|N	0.00633|0.00633	-1.31|-1.31	0.80722|0.80722	D|D	1|1	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.01281|.	0.0;0.0|.	T|T	0.06991|0.06991	-1.0796|-1.0796	10|5	0.09843|.	T|.	0.71|.	-6.2164|-6.2164	9.8491|9.8491	0.41046|0.41046	0.9168:0.0:0.0832:0.0|0.9168:0.0:0.0832:0.0	.|.	142;142|.	Q6FI54;P61020|.	.;RAB5B_HUMAN|.	V|C	142|61	ENSP00000450168:M142V;ENSP00000353444:M142V|.	ENSP00000353444:M142V|.	M|Y	+|+	1|2	0|0	RAB5B|RAB5B	54670841|54670841	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	1.607000|1.607000	0.36836|0.36836	0.974000|0.974000	0.38366|0.38366	0.477000|0.477000	0.44152|0.44152	ATG|TAT	.	.	.	none		0.522	RAB5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405396.1		
SLC17A8	246213	hgsc.bcm.edu	37	12	100811853	100811853	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr12:100811853T>G	ENST00000323346.5	+	11	1657	c.1344T>G	c.(1342-1344)atT>atG	p.I448M	SLC17A8_ENST00000552697.1_3'UTR|SLC17A8_ENST00000392989.3_Missense_Mutation_p.I398M	NM_001145288.1|NM_139319.2	NP_001138760.1|NP_647480.1	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 8	448					ion transport (GO:0006811)|neurotransmitter transport (GO:0006836)|sensory perception of sound (GO:0007605)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	44						ATGCCAGCATTCTCATGGGGA	0.478																																					p.I448M		Atlas-SNP	.											.	SLC17A8	89	.	0			c.T1344G						PASS	.						177.0	163.0	167.0					12																	100811853		2203	4300	6503	SO:0001583	missense	246213	exon11			CAGCATTCTCATG	AJ459241	CCDS9077.1, CCDS44957.1	12q23.1	2013-07-18	2013-07-18		ENSG00000179520	ENSG00000179520		"""Solute carriers"""	20151	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 3"""	607557	"""deafness, autosomal dominant 25"", ""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8"""	DFNA25		12151341	Standard	NM_139319		Approved	VGLUT3	uc010svi.2	Q8NDX2	OTTHUMG00000170358	ENST00000323346.5:c.1344T>G	chr12.hg19:g.100811853T>G	ENSP00000316909:p.Ile448Met	86.0	0.0	.		103.0	73.0	.	NM_139319	B3KXZ6|B7ZKV4|Q17RQ8	Missense_Mutation	SNP	ENST00000323346.5	hg19	CCDS9077.1	.	.	.	.	.	.	.	.	.	.	T	16.94	3.261452	0.59431	.	.	ENSG00000179520	ENST00000323346;ENST00000392989	T;T	0.55588	0.51;0.51	5.55	1.98	0.26296	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.73636	0.3612	M	0.90542	3.125	0.58432	D	0.999993	D;D	0.89917	0.999;1.0	D;D	0.87578	0.987;0.998	T	0.74121	-0.3767	10	0.66056	D	0.02	.	9.7886	0.40692	0.0:0.349:0.0:0.651	.	448;398	Q8NDX2;Q8NDX2-2	VGLU3_HUMAN;.	M	448;398	ENSP00000316909:I448M;ENSP00000376715:I398M	ENSP00000316909:I448M	I	+	3	3	SLC17A8	99335984	0.998000	0.40836	1.000000	0.80357	0.989000	0.77384	0.508000	0.22692	0.164000	0.19529	-0.250000	0.11733	ATT	.	.	.	none		0.478	SLC17A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408673.2	NM_139319	
PEBP1	5037	hgsc.bcm.edu	37	12	118575948	118575948	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr12:118575948A>C	ENST00000261313.2	+	2	592	c.240A>C	c.(238-240)aaA>aaC	p.K80N		NM_002567.2	NP_002558.1	P30086	PEBP1_HUMAN	phosphatidylethanolamine binding protein 1	80						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|phosphatidylethanolamine binding (GO:0008429)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|serine-type endopeptidase inhibitor activity (GO:0004867)			ovary(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AGGATCCCAAATACAGGTGAG	0.517																																					p.K80N	NSCLC(44;94 1357 12187 49467)	Atlas-SNP	.											.	PEBP1	13	.	0			c.A240C						PASS	.						41.0	36.0	38.0					12																	118575948		2203	4300	6503	SO:0001583	missense	5037	exon2			TCCCAAATACAGG	X85033	CCDS9187.1	12q24	2009-06-16	2006-02-16	2006-02-16	ENSG00000089220	ENSG00000089220			8630	protein-coding gene	gene with protein product	"""Raf kinase inhibitory protein"", ""hippocampal cholinergic neurostimulating peptide"""	604591	"""prostatic binding protein"""	PBP		15782137	Standard	NM_002567		Approved	RKIP, HCNP, PEBP	uc001twu.1	P30086	OTTHUMG00000168860	ENST00000261313.2:c.240A>C	chr12.hg19:g.118575948A>C	ENSP00000261313:p.Lys80Asn	35.0	0.0	.		73.0	24.0	.	NM_002567	B2R4S1	Missense_Mutation	SNP	ENST00000261313.2	hg19	CCDS9187.1	.	.	.	.	.	.	.	.	.	.	A	14.07	2.425675	0.43020	.	.	ENSG00000089220	ENST00000261313;ENST00000418769	T	0.48522	0.81	4.42	0.684	0.18003	Phosphatidylethanolamine-binding, conserved site (1);	0.048518	0.85682	D	0.000000	T	0.37433	0.1003	L	0.60904	1.88	0.54753	D	0.999985	B;B	0.12013	0.005;0.001	B;B	0.23716	0.048;0.046	T	0.08554	-1.0716	10	0.30078	T	0.28	-8.474	4.709	0.12863	0.5104:0.0:0.3477:0.142	.	80;80	B4DRT4;P30086	.;PEBP1_HUMAN	N	80	ENSP00000261313:K80N	ENSP00000261313:K80N	K	+	3	2	PEBP1	117060331	0.829000	0.29322	0.997000	0.53966	0.937000	0.57800	0.050000	0.14120	-0.044000	0.13491	-0.274000	0.10170	AAA	.	.	.	none		0.517	PEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401405.1	NM_002567	
KDM2B	84678	hgsc.bcm.edu	37	12	121881832	121881833	+	Missense_Mutation	DNP	GC	GC	AA			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr12:121881832_121881833GC>AA	ENST00000377071.4	-	16	2505_2506	c.2433_2434GC>TT	c.(2431-2436)gaGCtg>gaTTtg	p.E811D	KDM2B_ENST00000542973.1_Missense_Mutation_p.E179D|KDM2B_ENST00000377069.4_Missense_Mutation_p.E780D|KDM2B_ENST00000536437.1_Intron	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	811					embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						CGTCCACTCAGCTCCTGGGGCT	0.649											OREG0022201	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L812L|p.E811D		Atlas-SNP	.											.	KDM2B	218	.	0			c.C2434T|c.G2433T						PASS	.																																			SO:0001583	missense	84678	exon16			CACTCAGCTCCTG|ACTCAGCTCCTGG	AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.2433_2434delinsAA	chr12.hg19:g.121881832_121881833delinsAA	ENSP00000366271:p.Glu811Asp	54.0|55.0	0.0	.	1514	52.0|53.0	12.0	.	NM_032590	A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Silent|Missense_Mutation	SNP	ENST00000377071.4	hg19	CCDS41850.1																																																																																			.	.	.	none		0.649	KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402132.2	NM_032590	
MYCBP2	23077	hgsc.bcm.edu	37	13	77714983	77714983	+	De_novo_Start_OutOfFrame	SNP	T	T	C			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr13:77714983T>C	ENST00000360084.5	-	0	7377				MYCBP2_ENST00000407578.2_Missense_Mutation_p.K2467E|MYCBP2_ENST00000544440.2_Missense_Mutation_p.K2429E|MYCBP2_ENST00000357337.6_Missense_Mutation_p.K2429E					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		GCCCTAACCTTATTAGGCTGA	0.403																																					p.K2467E		Atlas-SNP	.											.	MYCBP2	1029	.	0			c.A7399G						PASS	.						220.0	222.0	222.0					13																	77714983		2203	4300	6503			23077	exon50			TAACCTTATTAGG	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000360084.5:c.-327A>G	chr13.hg19:g.77714983T>C		124.0	0.0	.		107.0	6.0	.	NM_015057		Missense_Mutation	SNP	ENST00000360084.5	hg19		.	.	.	.	.	.	.	.	.	.	T	20.4	3.985587	0.74589	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.36520	1.26;1.25;1.26	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.56277	0.1974	M	0.61703	1.905	0.80722	D	1	P	0.52842	0.956	D	0.65010	0.931	T	0.59658	-0.7413	10	0.72032	D	0.01	.	15.2435	0.73488	0.0:0.0:0.0:1.0	.	2429	O75592	MYCB2_HUMAN	E	2429;2467;2429	ENSP00000349892:K2429E;ENSP00000384288:K2467E;ENSP00000444596:K2429E	ENSP00000349892:K2429E	K	-	1	0	MYCBP2	76612984	1.000000	0.71417	1.000000	0.80357	0.822000	0.46500	7.642000	0.83385	2.012000	0.59069	0.482000	0.46254	AAG	.	.	.	none		0.403	MYCBP2-202	KNOWN	basic	protein_coding	protein_coding		NM_015057	
SPTB	6710	hgsc.bcm.edu	37	14	65253201	65253201	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr14:65253201C>T	ENST00000389721.5	-	15	3514	c.3482G>A	c.(3481-3483)aGc>aAc	p.S1161N	SPTB_ENST00000556626.1_Missense_Mutation_p.S1161N|SPTB_ENST00000542895.1_Missense_Mutation_p.S1161N|SPTB_ENST00000389720.3_Missense_Mutation_p.S1161N|SPTB_ENST00000389722.3_Missense_Mutation_p.S1161N	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	1161					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		GAGGGTGTGGCTGCGGCTCTC	0.612																																					p.S1161N		Atlas-SNP	.											.	SPTB	378	.	0			c.G3482A						PASS	.						58.0	59.0	59.0					14																	65253201		2203	4300	6503	SO:0001583	missense	6710	exon15			GTGTGGCTGCGGC		CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.3482G>A	chr14.hg19:g.65253201C>T	ENSP00000374371:p.Ser1161Asn	98.0	0.0	.		80.0	30.0	.	NM_001024858	Q15510|Q15519	Missense_Mutation	SNP	ENST00000389721.5	hg19	CCDS32100.1	.	.	.	.	.	.	.	.	.	.	C	12.15	1.851576	0.32699	.	.	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	T;T;T;T;T	0.50277	0.75;0.75;0.75;0.75;0.75	4.78	3.86	0.44501	.	0.412688	0.27549	N	0.018876	T	0.18551	0.0445	N	0.01352	-0.895	0.22096	N	0.999368	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.13176	-1.0519	10	0.59425	D	0.04	.	6.711	0.23276	0.0:0.7003:0.0:0.2997	.	1161;1165	P11277;Q59FP5	SPTB1_HUMAN;.	N	1165;1161;1161;1161;1161;1161	ENSP00000374372:S1161N;ENSP00000451752:S1161N;ENSP00000374371:S1161N;ENSP00000443882:S1161N;ENSP00000374370:S1161N	ENSP00000374370:S1161N	S	-	2	0	SPTB	64322954	0.429000	0.25530	0.066000	0.19879	0.879000	0.50718	3.324000	0.52022	1.079000	0.41038	0.549000	0.68633	AGC	.	.	.	none		0.612	SPTB-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414080.1		
SPTBN5	51332	hgsc.bcm.edu	37	15	42166194	42166194	+	Missense_Mutation	SNP	A	A	C	rs199969875		TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr15:42166194A>C	ENST00000320955.6	-	25	4966	c.4739T>G	c.(4738-4740)cTg>cGg	p.L1580R		NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	1580					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		CCCAGAACTCAGCACCCGTTG	0.652																																					p.L1545R		Atlas-SNP	.											.	SPTBN5	171	.	0			c.T4634G						PASS	.						26.0	31.0	29.0					15																	42166194		2009	4188	6197	SO:0001583	missense	51332	exon25			GAACTCAGCACCC	AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.4739T>G	chr15.hg19:g.42166194A>C	ENSP00000317790:p.Leu1580Arg	29.0	0.0	.		26.0	10.0	.	NM_016642		Missense_Mutation	SNP	ENST00000320955.6	hg19		.	.	.	.	.	.	.	.	.	.	.	16.38	3.107363	0.56291	.	.	ENSG00000137877	ENST00000320955	T	0.51071	0.72	5.26	5.26	0.73747	.	0.111511	0.39909	N	0.001223	T	0.71484	0.3345	M	0.84683	2.71	0.34983	D	0.754273	D	0.89917	1.0	D	0.87578	0.998	T	0.83027	-0.0164	10	0.87932	D	0	.	14.1772	0.65549	1.0:0.0:0.0:0.0	.	1580	Q9NRC6	SPTN5_HUMAN	R	1580	ENSP00000317790:L1580R	ENSP00000317790:L1580R	L	-	2	0	SPTBN5	39953486	1.000000	0.71417	0.240000	0.24138	0.217000	0.24651	6.813000	0.75231	1.979000	0.57680	0.529000	0.55759	CTG	.	.	.	alt		0.652	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420237.1	NM_016642	
GPR97	222487	hgsc.bcm.edu	37	16	57713092	57713092	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr16:57713092C>T	ENST00000333493.4	+	5	657	c.496C>T	c.(496-498)Ccc>Tcc	p.P166S	GPR97_ENST00000327655.6_5'UTR|GPR97_ENST00000450388.3_Missense_Mutation_p.P46S|RP11-405F3.4_ENST00000563062.1_RNA	NM_170776.4	NP_740746.4	Q86Y34	GPR97_HUMAN	G protein-coupled receptor 97	166					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						TTCACAGGGCCCCCGGCTCGG	0.632																																					p.P166S		Atlas-SNP	.											.	GPR97	74	.	0			c.C496T						PASS	.						60.0	61.0	61.0					16																	57713092		2198	4300	6498	SO:0001583	missense	222487	exon5			CAGGGCCCCCGGC	AY140959	CCDS10786.1	16q13	2014-08-08			ENSG00000182885	ENSG00000182885		"""-"", ""GPCR / Class B : Orphans"""	13728	protein-coding gene	gene with protein product						12435584, 222487	Standard	NM_170776		Approved	Pb99, PGR26	uc002emh.3	Q86Y34	OTTHUMG00000133458	ENST00000333493.4:c.496C>T	chr16.hg19:g.57713092C>T	ENSP00000332900:p.Pro166Ser	68.0	0.0	.		90.0	25.0	.	NM_170776	Q6ZMF4|Q86SL9|Q8IZF1	Missense_Mutation	SNP	ENST00000333493.4	hg19	CCDS10786.1	.	.	.	.	.	.	.	.	.	.	C	6.016	0.371299	0.11409	.	.	ENSG00000182885	ENST00000333493;ENST00000450388	T;T	0.28454	1.61;1.7	4.3	-0.0636	0.13776	.	0.491076	0.17461	N	0.173450	T	0.19248	0.0462	L	0.38838	1.175	0.34925	D	0.748776	B	0.21071	0.051	B	0.18561	0.022	T	0.09015	-1.0694	10	0.52906	T	0.07	.	4.2438	0.10662	0.0:0.5249:0.1709:0.3042	.	166	Q86Y34	GPR97_HUMAN	S	166;46	ENSP00000332900:P166S;ENSP00000404803:P46S	ENSP00000332900:P166S	P	+	1	0	GPR97	56270593	0.001000	0.12720	0.670000	0.29842	0.078000	0.17371	-0.024000	0.12435	0.104000	0.17725	0.313000	0.20887	CCC	.	.	.	none		0.632	GPR97-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257333.2	NM_170776	
ZFHX3	463	hgsc.bcm.edu	37	16	72821093	72821093	+	Silent	SNP	G	G	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr16:72821093G>T	ENST00000268489.5	-	10	11754	c.11082C>A	c.(11080-11082)acC>acA	p.T3694T	AC004943.1_ENST00000584072.1_RNA|ZFHX3_ENST00000397992.5_Silent_p.T2780T|RP5-991G20.4_ENST00000569195.1_RNA|RP5-991G20.1_ENST00000563328.2_RNA	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	3694					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				TTCCTACACTGGTCAGACCAC	0.463																																					p.T3694T		Atlas-SNP	.											.	ZFHX3	404	.	0			c.C11082A						PASS	.						161.0	173.0	169.0					16																	72821093		2198	4300	6498	SO:0001819	synonymous_variant	463	exon10			TACACTGGTCAGA	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.11082C>A	chr16.hg19:g.72821093G>T		112.0	0.0	.		127.0	37.0	.	NM_006885	D3DWS8|O15101|Q13719	Silent	SNP	ENST00000268489.5	hg19	CCDS10908.1																																																																																			.	.	.	none		0.463	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
GALNS	2588	hgsc.bcm.edu	37	16	88889080	88889080	+	Silent	SNP	G	G	A			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr16:88889080G>A	ENST00000268695.5	-	12	1369	c.1281C>T	c.(1279-1281)gtC>gtT	p.V427V	GALNS_ENST00000542788.1_Silent_p.V352V	NM_000512.4	NP_000503.1	P34059	GALNS_HUMAN	galactosamine (N-acetyl)-6-sulfatase	427					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	metal ion binding (GO:0046872)|N-acetylgalactosamine-4-sulfatase activity (GO:0003943)|N-acetylgalactosamine-6-sulfatase activity (GO:0043890)|sulfuric ester hydrolase activity (GO:0008484)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(8)	22				BRCA - Breast invasive adenocarcinoma(80;0.0496)		TGTGAGTTGTGACCCCTGAAA	0.622																																					p.V427V	GBM(129;1929 2344 25209 33204)	Atlas-SNP	.											.	GALNS	37	.	0			c.C1281T						PASS	.						105.0	88.0	94.0					16																	88889080		2196	4299	6495	SO:0001819	synonymous_variant	2588	exon12			AGTTGTGACCCCT	D17629	CCDS10970.1	16q24.3	2014-07-03	2014-07-03		ENSG00000141012	ENSG00000141012	3.1.6.4	"""Arylsulfatase family"""	4122	protein-coding gene	gene with protein product	"""Morquio syndrome"", ""mucopolysaccharidosis type IVA"""	612222	"""galactosamine (N-acetyl)-6-sulfate sulfatase"""			1755850	Standard	NM_000512		Approved	GAS, GALNAC6S	uc002fly.4	P34059	OTTHUMG00000137862	ENST00000268695.5:c.1281C>T	chr16.hg19:g.88889080G>A		205.0	0.0	.		251.0	75.0	.	NM_000512	Q86VK3	Silent	SNP	ENST00000268695.5	hg19	CCDS10970.1																																																																																			.	.	.	none		0.622	GALNS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269543.1		
MYO15A	51168	hgsc.bcm.edu	37	17	18058522	18058522	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr17:18058522C>T	ENST00000205890.5	+	46	8661	c.8323C>T	c.(8323-8325)Cgc>Tgc	p.R2775C	MYO15A_ENST00000585180.1_Missense_Mutation_p.R39C|MYO15A_ENST00000418233.3_Missense_Mutation_p.R39C	NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	2775	Tail.				inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					CTACTTCTCCCGCATCTTCCC	0.607																																					p.R2775C		Atlas-SNP	.											.	MYO15A	268	.	0			c.C8323T						PASS	.						39.0	48.0	45.0					17																	18058522		2100	4218	6318	SO:0001583	missense	51168	exon45			TTCTCCCGCATCT	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.8323C>T	chr17.hg19:g.18058522C>T	ENSP00000205890:p.Arg2775Cys	65.0	0.0	.		108.0	12.0	.	NM_016239	B4DFC7	Missense_Mutation	SNP	ENST00000205890.5	hg19	CCDS42271.1	.	.	.	.	.	.	.	.	.	.	C	15.66	2.898121	0.52227	.	.	ENSG00000091536	ENST00000205890	D	0.93488	-3.23	5.1	5.1	0.69264	.	.	.	.	.	D	0.97164	0.9073	M	0.87827	2.91	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.992;0.999	D	0.97931	1.0320	9	0.87932	D	0	.	18.5096	0.90911	0.0:1.0:0.0:0.0	.	39;2775	B4DFC7;Q9UKN7	.;MYO15_HUMAN	C	2775	ENSP00000205890:R2775C	ENSP00000205890:R2775C	R	+	1	0	MYO15A	17999247	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	7.086000	0.76885	2.363000	0.80096	0.561000	0.74099	CGC	.	.	.	none		0.607	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132048.1	NM_016239	
AATF	26574	hgsc.bcm.edu	37	17	35345926	35345926	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr17:35345926G>A	ENST00000225402.5	+	6	1307	c.1056G>A	c.(1054-1056)atG>atA	p.M352I		NM_012138.3	NP_036270.1	Q9NY61	AATF_HUMAN	apoptosis antagonizing transcription factor	352	RB1 binding.				apoptotic signaling pathway (GO:0097190)|cell adhesion (GO:0007155)|cellular response to DNA damage stimulus (GO:0006974)|embryonic cleavage (GO:0040016)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of apoptotic process (GO:0043066)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of superoxide anion generation (GO:0032929)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mitotic cell cycle (GO:0007346)|ribosome biogenesis (GO:0042254)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	leucine zipper domain binding (GO:0043522)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(1)|large_intestine(4)|lung(7)|ovary(2)|skin(2)	18		Breast(25;0.00607)				CCAGCTTCATGGCAAAGCGCT	0.493																																					p.M352I	NSCLC(49;901 1159 19183 41572 46244)	Atlas-SNP	.											.	AATF	36	.	0			c.G1056A						PASS	.						97.0	90.0	93.0					17																	35345926		2203	4300	6503	SO:0001583	missense	26574	exon6			CTTCATGGCAAAG	AF083208	CCDS32632.1	17q12	2014-05-06			ENSG00000108270	ENSG00000275700			19235	protein-coding gene	gene with protein product		608463				11027528, 10783144	Standard	NM_012138		Approved	DED, CHE-1, CHE1, BFR2	uc002hni.3	Q9NY61	OTTHUMG00000188458	ENST00000225402.5:c.1056G>A	chr17.hg19:g.35345926G>A	ENSP00000225402:p.Met352Ile	82.0	0.0	.		157.0	84.0	.	NM_012138	A6NCJ6|B3KQ26|Q9P0A4|Q9UNX5	Missense_Mutation	SNP	ENST00000225402.5	hg19	CCDS32632.1	.	.	.	.	.	.	.	.	.	.	G	11.78	1.740923	0.30865	.	.	ENSG00000108270	ENST00000225402	.	.	.	5.58	4.62	0.57501	.	0.033193	0.85682	D	0.000000	T	0.43722	0.1260	L	0.33339	1.005	0.52501	D	0.999955	B	0.12013	0.005	B	0.17098	0.017	T	0.26224	-1.0109	9	0.15066	T	0.55	-8.411	11.471	0.50268	0.1564:0.0:0.8436:0.0	.	352	Q9NY61	AATF_HUMAN	I	352	.	ENSP00000225402:M352I	M	+	3	0	AATF	32420039	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.264000	0.72527	1.370000	0.46153	0.561000	0.74099	ATG	.	.	.	none		0.493	AATF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451543.1	NM_012138	
SCPEP1	59342	hgsc.bcm.edu	37	17	55058480	55058480	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr17:55058480A>C	ENST00000262288.3	+	2	169	c.114A>C	c.(112-114)gaA>gaC	p.E38D	RP5-1107A17.4_ENST00000572877.1_RNA|SCPEP1_ENST00000571898.1_3'UTR	NM_021626.2	NP_067639.1	Q9HB40	RISC_HUMAN	serine carboxypeptidase 1	38					negative regulation of blood pressure (GO:0045776)|positive regulation of vasodilation (GO:0045909)|retinoic acid metabolic process (GO:0042573)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	serine-type carboxypeptidase activity (GO:0004185)			endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|skin(2)	14	Breast(9;2.86e-08)					AGGGCAAGGAAGTATGGGATT	0.493																																					p.E38D		Atlas-SNP	.											.	SCPEP1	35	.	0			c.A114C						PASS	.						128.0	105.0	113.0					17																	55058480		2203	4300	6503	SO:0001583	missense	59342	exon2			CAAGGAAGTATGG	AF282618	CCDS11593.1	17q22	2012-09-20			ENSG00000121064	ENSG00000121064			29507	protein-coding gene	gene with protein product	"""retinoid inducible serine carboxypeptidase"""					11447226, 12975309	Standard	NM_021626		Approved	RISC	uc002iuv.4	Q9HB40	OTTHUMG00000178129	ENST00000262288.3:c.114A>C	chr17.hg19:g.55058480A>C	ENSP00000262288:p.Glu38Asp	235.0	1.0	.		338.0	161.0	.	NM_021626	Q96A94|Q9H3F0	Missense_Mutation	SNP	ENST00000262288.3	hg19	CCDS11593.1	.	.	.	.	.	.	.	.	.	.	A	16.33	3.093414	0.56075	.	.	ENSG00000121064	ENST00000262288	D	0.85955	-2.05	5.84	3.64	0.41730	.	0.000000	0.85682	D	0.000000	D	0.91331	0.7266	M	0.89414	3.03	0.46954	D	0.99926	D	0.65815	0.995	D	0.70716	0.97	D	0.90110	0.4191	10	0.66056	D	0.02	-12.7064	5.5755	0.17220	0.71:0.0:0.29:0.0	.	38	Q9HB40	RISC_HUMAN	D	38	ENSP00000262288:E38D	ENSP00000262288:E38D	E	+	3	2	SCPEP1	52413479	0.816000	0.29132	0.975000	0.42487	0.312000	0.27988	0.445000	0.21677	1.036000	0.39998	0.533000	0.62120	GAA	.	.	.	none		0.493	SCPEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440622.1	NM_021626	
GREB1L	80000	hgsc.bcm.edu	37	18	19020247	19020247	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr18:19020247G>C	ENST00000580732.2	+	9	1348	c.967G>C	c.(967-969)Ggg>Cgg	p.G323R	GREB1L_ENST00000431264.1_Missense_Mutation_p.G323R|GREB1L_ENST00000424526.1_Missense_Mutation_p.G323R|GREB1L_ENST00000269218.6_Missense_Mutation_p.G323R|GREB1L_ENST00000578368.1_3'UTR|RP11-296E23.1_ENST00000584611.1_RNA|GREB1L_ENST00000400483.4_Missense_Mutation_p.G323R			Q9C091	GRB1L_HUMAN	growth regulation by estrogen in breast cancer-like	323						integral component of membrane (GO:0016021)				breast(5)|endometrium(4)|kidney(6)|lung(1)|skin(1)	17						GTTCATTTCTGGGCCACCAAA	0.458																																					p.G323R		Atlas-SNP	.											.	GREB1L	69	.	0			c.G967C						PASS	.						75.0	71.0	72.0					18																	19020247		692	1591	2283	SO:0001583	missense	80000	exon9			ATTTCTGGGCCAC	AK023749	CCDS45836.1	18q11.2	2009-09-08	2009-09-08	2009-09-08					31042	protein-coding gene	gene with protein product			"""KIAA1772"""	KIAA1772		11214970	Standard	NM_001142966		Approved	FLJ13687, C18orf6	uc010xam.2	Q9C091		ENST00000580732.2:c.967G>C	chr18.hg19:g.19020247G>C	ENSP00000464162:p.Gly323Arg	66.0	0.0	.		67.0	26.0	.	NM_001142966	A4QN17|Q9H8F1	Missense_Mutation	SNP	ENST00000580732.2	hg19	CCDS45836.1	.	.	.	.	.	.	.	.	.	.	G	19.34	3.809799	0.70797	.	.	ENSG00000141449	ENST00000424526;ENST00000269218;ENST00000400483;ENST00000431264	T;T;T;T	0.22945	2.72;2.59;1.94;1.93	5.48	5.48	0.80851	.	.	.	.	.	T	0.53981	0.1830	M	0.74881	2.28	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.53408	-0.8443	9	0.51188	T	0.08	-2.0122	19.3376	0.94324	0.0:0.0:1.0:0.0	.	323;323	Q9C091;Q9C091-2	GRB1L_HUMAN;.	R	323	ENSP00000412060:G323R;ENSP00000269218:G323R;ENSP00000383331:G323R;ENSP00000393125:G323R	ENSP00000269218:G323R	G	+	1	0	GREB1L	17274245	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	8.189000	0.89712	2.580000	0.87095	0.650000	0.86243	GGG	.	.	.	none		0.458	GREB1L-003	KNOWN	not_organism_supported|upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443782.2	NM_024935	
PODNL1	79883	hgsc.bcm.edu	37	19	14044012	14044012	+	Silent	SNP	G	G	A	rs79400921	byFrequency	TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr19:14044012G>A	ENST00000339560.5	-	8	1318	c.1045C>T	c.(1045-1047)Ctg>Ttg	p.L349L	PODNL1_ENST00000538371.2_Silent_p.L347L|PODNL1_ENST00000538517.2_Silent_p.L258L|PODNL1_ENST00000254320.3_Silent_p.L267L	NM_024825.3	NP_079101.3	Q6PEZ8	PONL1_HUMAN	podocan-like 1	349	Leu-rich.					proteinaceous extracellular matrix (GO:0005578)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(19;5.26e-23)			ACGCGGTCCAGCCCATTGCCA	0.726													G|||	17	0.00339457	0.0129	0.0	5008	,	,		12628	0.0		0.0	False		,,,				2504	0.0				p.L349L		Atlas-SNP	.											.	PODNL1	27	.	0			c.C1045T						PASS	.	G	,,	25,3857		0,25,1916	4.0	6.0	6.0		1039,772,1045	2.1	0.7	19	dbSNP_131	6	1,7563		0,1,3781	no	coding-synonymous,coding-synonymous,coding-synonymous	PODNL1	NM_001146254.1,NM_001146255.1,NM_024825.3	,,	0,26,5697	AA,AG,GG		0.0132,0.644,0.2272	,,	347/511,258/422,349/513	14044012	26,11420	1941	3782	5723	SO:0001819	synonymous_variant	79883	exon8			GGTCCAGCCCATT	AK027100	CCDS12300.1, CCDS54225.1, CCDS54226.1	19p13.12	2008-02-05							26275	protein-coding gene	gene with protein product						12477932	Standard	NM_024825		Approved	FLJ23447, SLRR5B	uc010xnj.2	Q6PEZ8		ENST00000339560.5:c.1045C>T	chr19.hg19:g.14044012G>A		0.0	0.0	.		24.0	9.0	.	NM_024825	B7Z564|Q9H5G9	Silent	SNP	ENST00000339560.5	hg19	CCDS12300.1																																																																																			.	.	.	weak		0.726	PODNL1-003	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457967.1	NM_024825	
CYP4F3	4051	hgsc.bcm.edu	37	19	15760902	15760902	+	Missense_Mutation	SNP	G	G	A	rs113330239		TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr19:15760902G>A	ENST00000221307.8	+	7	874	c.827G>A	c.(826-828)cGc>cAc	p.R276H	CYP4F3_ENST00000585846.1_Missense_Mutation_p.R276H|CYP4F3_ENST00000591058.1_Missense_Mutation_p.R276H|CYP4F3_ENST00000586182.2_Missense_Mutation_p.R276H	NM_000896.2	NP_000887.2	Q08477	CP4F3_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 3	276					arachidonic acid metabolic process (GO:0019369)|icosanoid metabolic process (GO:0006690)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-tocopherol omega-hydroxylase activity (GO:0052871)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)|monooxygenase activity (GO:0004497)	p.R276H(1)		endometrium(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|stomach(1)	34						GAGCGGCGCCGCACCCTCCCT	0.577													.|||	1	0.000199681	0.0008	0.0	5008	,	,		18604	0.0		0.0	False		,,,				2504	0.0				p.R276H		Atlas-SNP	.											CYP4F3,colon,NS,0,1	CYP4F3	69	.	1	Substitution - Missense(1)	large_intestine(1)	c.G827A						PASS	.						106.0	96.0	99.0					19																	15760902		2203	4300	6503	SO:0001583	missense	4051	exon7			GGCGCCGCACCCT	AB002454	CCDS12332.1, CCDS59362.1	19p13.12	2013-02-21	2003-01-14		ENSG00000186529	ENSG00000186529		"""Cytochrome P450s"""	2646	protein-coding gene	gene with protein product		601270	"""cytochrome P450, subfamily IVF, polypeptide 3 (leukotriene B4 omega hydroxylase)"""	LTB4H		8486631, 9539102	Standard	NM_000896		Approved	CYP4F	uc010xol.2	Q08477	OTTHUMG00000182374	ENST00000221307.8:c.827G>A	chr19.hg19:g.15760902G>A	ENSP00000221307:p.Arg276His	254.0	2.0	.		202.0	91.0	.	NM_001199209	B7Z8Z3|O60634|Q5U740	Missense_Mutation	SNP	ENST00000221307.8	hg19	CCDS12332.1	.	.	.	.	.	.	.	.	.	.	.	14.12	2.441442	0.43326	.	.	ENSG00000186529	ENST00000538865;ENST00000221307	T	0.69561	-0.41	3.99	-0.166	0.13351	.	0.712480	0.12645	U	0.450940	T	0.63117	0.2484	M	0.77406	2.37	0.09310	N	1	B;B	0.13145	0.007;0.001	B;B	0.19148	0.015;0.024	T	0.58188	-0.7680	10	0.52906	T	0.07	.	7.3165	0.26503	0.4513:0.0:0.5487:0.0	.	276;276	B7Z8Z3;Q08477	.;CP4F3_HUMAN	H	203;276	ENSP00000221307:R276H	ENSP00000221307:R276H	R	+	2	0	CYP4F3	15621902	0.000000	0.05858	0.009000	0.14445	0.817000	0.46193	-1.012000	0.03649	0.173000	0.19788	0.313000	0.20887	CGC	.	G|0.500;A|0.500	0.500	weak		0.577	CYP4F3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460819.3	NM_000896	
LRRC25	126364	hgsc.bcm.edu	37	19	18507658	18507658	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr19:18507658C>G	ENST00000339007.3	-	1	769	c.116G>C	c.(115-117)aGt>aCt	p.S39T	LRRC25_ENST00000595840.1_Missense_Mutation_p.S39T	NM_145256.2	NP_660299.2	Q8N386	LRC25_HUMAN	leucine rich repeat containing 25	39						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(3)|lung(3)|skin(1)	8						GCACGTGGCACTGAACTCCGC	0.622																																					p.S39T		Atlas-SNP	.											.	LRRC25	16	.	0			c.G116C						PASS	.						76.0	57.0	64.0					19																	18507658		2203	4300	6503	SO:0001583	missense	126364	exon1			GTGGCACTGAACT	AK095435	CCDS12377.1	19p13.11	2013-09-20			ENSG00000175489	ENSG00000175489			29806	protein-coding gene	gene with protein product		607518				12384430	Standard	NM_145256		Approved	MAPA, FLJ38116	uc002niw.3	Q8N386	OTTHUMG00000183361	ENST00000339007.3:c.116G>C	chr19.hg19:g.18507658C>G	ENSP00000340983:p.Ser39Thr	256.0	1.0	.		195.0	85.0	.	NM_145256	Q6IQ00|Q8N9A5	Missense_Mutation	SNP	ENST00000339007.3	hg19	CCDS12377.1	.	.	.	.	.	.	.	.	.	.	C	0.518	-0.863567	0.02590	.	.	ENSG00000175489	ENST00000339007	T	0.31510	1.49	4.4	-4.55	0.03441	.	2.202890	0.02302	N	0.071289	T	0.10680	0.0261	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.20739	-1.0266	10	0.02654	T	1	2.5899	1.3392	0.02151	0.2155:0.2315:0.3888:0.1642	.	39	Q8N386	LRC25_HUMAN	T	39	ENSP00000340983:S39T	ENSP00000340983:S39T	S	-	2	0	LRRC25	18368658	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.684000	0.05173	-0.454000	0.07066	-0.367000	0.07326	AGT	.	.	.	none		0.622	LRRC25-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466342.1	NM_145256	
ZNF14	7561	hgsc.bcm.edu	37	19	19822257	19822257	+	Silent	SNP	T	T	G			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr19:19822257T>G	ENST00000344099.3	-	4	1971	c.1833A>C	c.(1831-1833)ggA>ggC	p.G611G		NM_021030.2	NP_066358.2	P17017	ZNF14_HUMAN	zinc finger protein 14	611					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(2)|endometrium(1)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32		Renal(1328;0.0474)				AAGGTTTCTCTCCAGTGTGAG	0.408																																					p.G611G		Atlas-SNP	.											.	ZNF14	89	.	0			c.A1833C						PASS	.						83.0	81.0	82.0					19																	19822257		2203	4300	6503	SO:0001819	synonymous_variant	7561	exon4			TTTCTCTCCAGTG	AA286756	CCDS12409.1	19p13.11	2013-01-08	2006-05-10					"""Zinc fingers, C2H2-type"", ""-"""	12924	protein-coding gene	gene with protein product		194556	"""zinc finger protein 14 (KOX 6)"""				Standard	NM_021030		Approved	KOX6, GIOT-4	uc002nnk.1	P17017		ENST00000344099.3:c.1833A>C	chr19.hg19:g.19822257T>G		64.0	0.0	.		84.0	38.0	.	NM_021030	B9EGA4|Q9ULZ5	Silent	SNP	ENST00000344099.3	hg19	CCDS12409.1																																																																																			.	.	.	none		0.408	ZNF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460775.1	NM_021030	
ZNF835	90485	hgsc.bcm.edu	37	19	57175950	57175950	+	Missense_Mutation	SNP	A	A	G	rs369897881		TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr19:57175950A>G	ENST00000537055.2	-	2	848	c.617T>C	c.(616-618)gTc>gCc	p.V206A		NM_001005850.2	NP_001005850.2	Q9Y2P0	ZN835_HUMAN	zinc finger protein 835	206					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(22)|pancreas(3)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	47						CAGGTGCGTGACGCGCGTGAA	0.716																																					p.V206A		Atlas-SNP	.											.	ZNF835	106	.	0			c.T617C						PASS	.	A	ALA/VAL	3,4319		0,3,2158	15.0	16.0	16.0		617	-3.4	0.0	19		16	0,8402		0,0,4201	no	missense	ZNF835	NM_001005850.2	64	0,3,6359	GG,GA,AA		0.0,0.0694,0.0236	benign	206/538	57175950	3,12721	2161	4201	6362	SO:0001583	missense	90485	exon2			TGCGTGACGCGCG	AK023017	CCDS56105.1	19q13.43	2013-01-08			ENSG00000127903	ENSG00000127903		"""Zinc fingers, C2H2-type"""	34332	protein-coding gene	gene with protein product							Standard	NM_001005850		Approved	BC37295_3	uc010ygn.2	Q9Y2P0		ENST00000537055.2:c.617T>C	chr19.hg19:g.57175950A>G	ENSP00000444747:p.Val206Ala	0.0	0.0	.		46.0	19.0	.	NM_001005850	B7Z5Y0|G3V1S0	Missense_Mutation	SNP	ENST00000537055.2	hg19	CCDS56105.1	.	.	.	.	.	.	.	.	.	.	A	7.598	0.672178	0.14776	6.94E-4	0.0	ENSG00000127903	ENST00000342088;ENST00000537055	T	0.07114	3.22	2.12	-3.43	0.04810	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02807	0.0084	N	0.04245	-0.25	0.09310	N	1	B	0.11235	0.004	B	0.14578	0.011	T	0.45920	-0.9228	9	0.16896	T	0.51	.	4.1371	0.10176	0.246:0.0:0.5433:0.2107	.	228	Q9Y2P0	ZN835_HUMAN	A	228;206	ENSP00000444747:V206A	ENSP00000341756:V228A	V	-	2	0	ZNF835	61867762	0.000000	0.05858	0.000000	0.03702	0.296000	0.27459	-1.731000	0.01853	-0.977000	0.03537	-0.411000	0.06167	GTC	.	.	.	weak		0.716	ZNF835-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459800.1	NM_001005850	
BPIFB4	149954	hgsc.bcm.edu	37	20	31685559	31685559	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr20:31685559A>T	ENST00000375483.3	+	11	1535	c.1535A>T	c.(1534-1536)aAa>aTa	p.K512I		NM_182519.2	NP_872325.2	P59827	BPIB4_HUMAN	BPI fold containing family B, member 4	512						cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)										TCCCAGCCCAAAGACCTGGAG	0.577																																					p.K512I		Atlas-SNP	.											.	.	.	.	0			c.A1535T						PASS	.						100.0	72.0	81.0					20																	31685559		2203	4300	6503	SO:0001583	missense	149954	exon11			AGCCCAAAGACCT	AF549190	CCDS13213.2	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186191	ENSG00000186191		"""BPI fold containing"""	16179	protein-coding gene	gene with protein product		615718	"""chromosome 20 open reading frame 186"""	C20orf186		11971875, 21787333	Standard	NM_182519		Approved	dJ726C3.5, LPLUNC4	uc010zue.2	P59827	OTTHUMG00000032235	ENST00000375483.3:c.1535A>T	chr20.hg19:g.31685559A>T	ENSP00000364632:p.Lys512Ile	137.0	0.0	.		169.0	79.0	.	NM_182519	Q5TDX6	Missense_Mutation	SNP	ENST00000375483.3	hg19	CCDS13213.2	.	.	.	.	.	.	.	.	.	.	A	14.60	2.582504	0.46006	.	.	ENSG00000186191	ENST00000375483	T	0.07327	3.2	5.26	5.26	0.73747	.	0.240028	0.35067	N	0.003468	T	0.07279	0.0184	N	0.24115	0.695	0.24134	N	0.995755	B	0.30937	0.301	B	0.31812	0.136	T	0.27773	-1.0064	10	0.62326	D	0.03	-11.2987	11.8323	0.52303	1.0:0.0:0.0:0.0	.	512	P59827	BPIB4_HUMAN	I	512	ENSP00000364632:K512I	ENSP00000364632:K512I	K	+	2	0	BPIFB4	31149220	0.981000	0.34729	0.940000	0.37924	0.577000	0.36160	2.261000	0.43276	2.108000	0.64289	0.379000	0.24179	AAA	.	.	.	none		0.577	BPIFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078655.5	NM_182519	
KIAA1210	57481	hgsc.bcm.edu	37	X	118219440	118219440	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chrX:118219440T>G	ENST00000402510.2	-	12	4753	c.4754A>C	c.(4753-4755)aAg>aCg	p.K1585T		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	1585										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						ACTCTTCTGCTTCTGCTTTGC	0.448																																					p.K1585T		Atlas-SNP	.											.	KIAA1210	171	.	0			c.A4754C						PASS	.						108.0	96.0	99.0					X																	118219440		1887	4103	5990	SO:0001583	missense	57481	exon12			TTCTGCTTCTGCT	AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.4754A>C	chrX.hg19:g.118219440T>G	ENSP00000384670:p.Lys1585Thr	29.0	0.0	.		46.0	6.0	.	NM_020721	B7ZCI8|Q5JPN4	Missense_Mutation	SNP	ENST00000402510.2	hg19	CCDS48156.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.05|11.05	1.525709|1.525709	0.27299|0.27299	.|.	.|.	ENSG00000248857|ENSG00000250423	ENST00000440399|ENST00000402510	.|T	.|0.22743	.|1.94	5.16|5.16	-4.73|-4.73	0.03259|0.03259	.|.	.|.	.|.	.|.	.|.	T|T	0.32912|0.32912	0.0845|0.0845	L|L	0.60455|0.60455	1.87|1.87	0.09310|0.09310	N|N	1|1	.|D	.|0.62365	.|0.991	.|P	.|0.61070	.|0.883	T|T	0.21930|0.21930	-1.0231|-1.0231	5|9	.|0.35671	.|T	.|0.21	.|.	12.3761|12.3761	0.55281|0.55281	0.0:0.2909:0.0:0.7091|0.0:0.2909:0.0:0.7091	.|.	.|1585	.|Q9ULL0	.|K1210_HUMAN	D|T	991|1585	.|ENSP00000384670:K1585T	.|ENSP00000384670:K1585T	E|K	-|-	3|2	2|0	KIAA1210|RP13-347D8.6	118103468|118103468	0.049000|0.049000	0.20398|0.20398	0.001000|0.001000	0.08648|0.08648	0.044000|0.044000	0.14063|0.14063	-0.389000|-0.389000	0.07342|0.07342	-1.098000|-1.098000	0.03038|0.03038	0.486000|0.486000	0.48141|0.48141	GAA|AAG	.	.	.	none		0.448	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371251.2	NM_020721	
NBEAL1	65065	hgsc.bcm.edu	37	2	204009565	204009566	+	Frame_Shift_Ins	INS	-	-	T			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr2:204009565_204009566insT	ENST00000449802.1	+	31	5337_5338	c.5004_5005insT	c.(5005-5007)tttfs	p.F1669fs		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	1669										NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						GTAGCTCCTCATTTTTTGAAGA	0.317																																					p.S1668fs		Atlas-Indel,Pindel	.											.	NBEAL1	266	.	0			c.5004_5005insT						PASS	.																																			SO:0001589	frameshift_variant	65065	exon31			.	AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.5010dupT	chr2.hg19:g.204009571_204009571dupT	ENSP00000399903:p.Phe1669fs	52.0	0.0	0		45.0	16.0	0.355556	NM_001114132	A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Frame_Shift_Ins	INS	ENST00000449802.1	hg19	CCDS46495.1																																																																																			.	.	.	none		0.317	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333982.4		
KANSL2	54934	hgsc.bcm.edu	37	12	49073468	49073468	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr12:49073468delT	ENST00000420613.2	-	3	447	c.400delA	c.(400-402)agtfs	p.S135fs	KANSL2_ENST00000553086.1_Frame_Shift_Del_p.S135fs|KANSL2_ENST00000357861.3_5'UTR|KANSL2_ENST00000550347.1_Frame_Shift_Del_p.S318fs	NM_017822.3	NP_060292.3	Q9H9L4	KANL2_HUMAN	KAT8 regulatory NSL complex subunit 2	135					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)											CTGCGACTACTTTCTGGAGTC	0.493																																					p.S134fs		Atlas-INDEL	.											.	.	.	.	0			c.401delG						PASS	.						50.0	47.0	48.0					12																	49073468		1915	4135	6050	SO:0001589	frameshift_variant	54934	exon3			.	AK094528	CCDS44869.1	12q13.11	2011-10-31	2011-10-31	2011-10-31	ENSG00000139620	ENSG00000139620			26024	protein-coding gene	gene with protein product		615488	"""chromosome 12 open reading frame 41"""	C12orf41		12477932	Standard	NM_017822		Approved	FLJ20436, NSL2	uc001rrz.2	Q9H9L4	OTTHUMG00000170392	ENST00000420613.2:c.400delA	chr12.hg19:g.49073468delT	ENSP00000415436:p.Ser135fs	81.0	0.0	0		122.0	64.0	0.52459	NM_017822	Q8N3B5|Q96CV0|Q9NX51	Frame_Shift_Del	DEL	ENST00000420613.2	hg19	CCDS44869.1																																																																																			.	.	.	none		0.493	KANSL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408841.1	NM_017822	
NCOR2	9612	hgsc.bcm.edu	37	12	124824739	124824740	+	Frame_Shift_Ins	INS	-	-	GCCG			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr12:124824739_124824740insGCCG	ENST00000405201.1	-	37	5499_5500	c.5499_5500insCGGC	c.(5497-5502)cagagcfs	p.S1834fs	NCOR2_ENST00000356219.3_Frame_Shift_Ins_p.S1841fs|NCOR2_ENST00000404121.2_Frame_Shift_Ins_p.S1395fs|NCOR2_ENST00000397355.1_Frame_Shift_Ins_p.S1825fs|NCOR2_ENST00000404621.1_Frame_Shift_Ins_p.S1824fs|NCOR2_ENST00000429285.2_Frame_Shift_Ins_p.S1824fs			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	1845					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		ctgccgctgctctgctCTGTAC	0.713																																					p.S1834fs		Atlas-INDEL	.											.,14	NCOR2	475	.	0			c.5500_5501insCGGC						PASS	.																																			SO:0001589	frameshift_variant	9612	exon39			.	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.5499_5500insCGGC	chr12.hg19:g.124824739_124824740insGCCG	ENSP00000384018:p.Ser1834fs	10.0	0.0	0		61.0	11.0	0.180328	NM_006312	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Frame_Shift_Ins	INS	ENST00000405201.1	hg19	CCDS41858.2																																																																																			.	GCCGCTGCT|1.000;|0.000	.	alt		0.713	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312	
TM9SF1	10548	hgsc.bcm.edu	37	14	24661497	24661519	+	Frame_Shift_Del	DEL	CTGCTGAGTTAATGGCCCCATGA	CTGCTGAGTTAATGGCCCCATGA	-	rs150862560		TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	CTGCTGAGTTAATGGCCCCATGA	CTGCTGAGTTAATGGCCCCATGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr14:24661497_24661519delCTGCTGAGTTAATGGCCCCATGA	ENST00000261789.4	-	4	1369_1391	c.1011_1033delTCATGGGGCCATTAACTCAGCAG	c.(1009-1035)cgtcatggggccattaactcagcagccfs	p.HGAINSAA338fs	TM9SF1_ENST00000396854.4_Frame_Shift_Del_p.HGAINSAA338fs|TM9SF1_ENST00000530611.1_Frame_Shift_Del_p.HGAINSAA547fs|RP11-468E2.2_ENST00000561419.1_5'Flank|TM9SF1_ENST00000524835.1_Frame_Shift_Del_p.HGAINSAA251fs|TM9SF1_ENST00000556387.1_Frame_Shift_Del_p.HGAINSAA547fs|TM9SF1_ENST00000528669.1_Frame_Shift_Del_p.HGAINSAA338fs	NM_006405.5	NP_006396.2	O15321	TM9S1_HUMAN	transmembrane 9 superfamily member 1	338					autophagy (GO:0006914)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)		p.S343P(1)		NS(1)|breast(4)|endometrium(3)|large_intestine(11)|lung(4)|ovary(1)	24				GBM - Glioblastoma multiforme(265;0.0183)		AACAAGATGGCTGCTGAGTTAATGGCCCCATGACGGTGCACAT	0.538																																					p.338_345del		Atlas-Indel,Pindel	.											.	TM9SF1	58	.	1	Substitution - Missense(1)	large_intestine(1)	c.1012_1034del						PASS	.																																			SO:0001589	frameshift_variant	10548	exon4			.	U94831	CCDS9617.1, CCDS41934.1, CCDS73623.1	14q11.2	2005-10-11			ENSG00000100926	ENSG00000100926			11864	protein-coding gene	gene with protein product						9332367	Standard	NM_006405		Approved	MP70, HMP70	uc010tob.1	O15321	OTTHUMG00000029322	ENST00000261789.4:c.1011_1033delTCATGGGGCCATTAACTCAGCAG	chr14.hg19:g.24661497_24661519delCTGCTGAGTTAATGGCCCCATGA	ENSP00000261789:p.His338fs	253.0	0.0	0		209.0	48.0	0.229665	NM_001014842	D3DS65|Q86SZ6|Q96FI8	Frame_Shift_Del	DEL	ENST00000261789.4	hg19	CCDS9617.1																																																																																			.	.	.	none		0.538	TM9SF1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000073136.2	NM_006405	
HSPB6	126393	hgsc.bcm.edu	37	19	36243734	36243734	+	IGR	DEL	G	G	-			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr19:36243734delG	ENST00000592984.1	-	0	1634				AC002398.12_ENST00000587767.1_RNA|LIN37_ENST00000301159.9_Splice_Site_p.R64fs|AC002398.9_ENST00000591613.2_3'UTR|AC002398.11_ENST00000591091.1_RNA			O14558	HSPB6_HUMAN	heat shock protein, alpha-crystallin-related, B6						regulation of muscle contraction (GO:0006937)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)|structural constituent of eye lens (GO:0005212)			lung(1)	1	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			ACTGGCAAAAGGTAAGGTGGC	0.627																																					p.R64fs		Atlas-Indel,Pindel	.											.	LIN37	17	.	0			c.190delA						PASS	.						27.0	33.0	31.0					19																	36243734		2060	4204	6264	SO:0001628	intergenic_variant	55957	exon4			.	AJ278121	CCDS12475.1	19q13.13	2014-06-12			ENSG00000004776	ENSG00000004776		"""Heat shock proteins / HSPB"""	26511	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 91"""	610695				12820654, 14717697	Standard	NM_144617		Approved	FLJ32389, Hsp20, PPP1R91	uc002obn.2	O14558	OTTHUMG00000048122		chr19.hg19:g.36243734delG		83.0	0.0	0		73.0	28.0	0.383562	NM_019104	O14551|Q6NVI3|Q96MG9	Frame_Shift_Del	DEL	ENST00000592984.1	hg19	CCDS12475.1																																																																																			.	.	.	none		0.627	HSPB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109498.3	NM_144617	
DOCK3	1795	hgsc.bcm.edu	37	3	51393580	51393580	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr3:51393580delG	ENST00000266037.9	+	42	4333	c.4310delG	c.(4309-4311)aggfs	p.R1437fs		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1437	DHR-2.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		CAGATGGATAGGGTACCAGAT	0.493																																					p.R1437fs		Atlas-Indel,Pindel	.											.	DOCK3	397	.	0			c.4309delA						PASS	.						147.0	140.0	142.0					3																	51393580		1982	4180	6162	SO:0001589	frameshift_variant	1795	exon42			.	AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.4310delG	chr3.hg19:g.51393580delG	ENSP00000266037:p.Arg1437fs	232.0	0.0	0		199.0	65.0	0.326633	NM_004947	O15017	Frame_Shift_Del	DEL	ENST00000266037.9	hg19	CCDS46835.1																																																																																			.	.	.	none		0.493	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5	NM_004947	
KANSL2	54934	hgsc.bcm.edu	37	12	49073468	49073469	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-B9-A5W9-01A-11D-A28G-10	TCGA-B9-A5W9-10A-01D-A28G-10	TT	TT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad4535df-a616-4440-8204-9a498d22beb5	869fc941-e464-4427-8385-d302bb618ea9	g.chr12:49073468_49073469delTT	ENST00000420613.2	-	3	446_447	c.399_400delAA	c.(397-402)gaaagtfs	p.S135fs	KANSL2_ENST00000553086.1_Frame_Shift_Del_p.S135fs|KANSL2_ENST00000357861.3_5'UTR|KANSL2_ENST00000550347.1_Frame_Shift_Del_p.S318fs	NM_017822.3	NP_060292.3	Q9H9L4	KANL2_HUMAN	KAT8 regulatory NSL complex subunit 2	135					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)											CTGCGACTACTTTCTGGAGTCT	0.49																																					p.134_134del		Pindel	.											.	.	.	.	0			c.400_401del						PASS	.																																			SO:0001589	frameshift_variant	54934	exon3			.	AK094528	CCDS44869.1	12q13.11	2011-10-31	2011-10-31	2011-10-31	ENSG00000139620	ENSG00000139620			26024	protein-coding gene	gene with protein product		615488	"""chromosome 12 open reading frame 41"""	C12orf41		12477932	Standard	NM_017822		Approved	FLJ20436, NSL2	uc001rrz.2	Q9H9L4	OTTHUMG00000170392	ENST00000420613.2:c.399_400delAA	chr12.hg19:g.49073468_49073469delTT	ENSP00000415436:p.Ser135fs	82.0	0.0	.		122.0	41.0	0.336	NM_017822	Q8N3B5|Q96CV0|Q9NX51	Frame_Shift_Del	DEL	ENST00000420613.2	hg19	CCDS44869.1																																																																																			.	.	.	none		0.490	KANSL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408841.1	NM_017822	
