#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
NPHP4	261734	hgsc.bcm.edu	37	1	5965397	5965397	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr1:5965397C>G	ENST00000378156.4	-	15	2175	c.1910G>C	c.(1909-1911)tGt>tCt	p.C637S	NPHP4_ENST00000478423.2_5'UTR	NM_015102.3	NP_055917.1	O75161	NPHP4_HUMAN	nephronophthisis 4	637					actin cytoskeleton organization (GO:0030036)|hippo signaling (GO:0035329)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(4)	47	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		GCTTTGTAGACAATCTGATTC	0.458																																					p.C637S		Atlas-SNP	.											.	NPHP4	119	.	0			c.G1910C						PASS	.						162.0	162.0	162.0					1																	5965397		1983	4163	6146	SO:0001583	missense	261734	exon15			TGTAGACAATCTG	AB014573	CCDS44052.1	1p36	2010-03-26			ENSG00000131697	ENSG00000131697			19104	protein-coding gene	gene with protein product	"""nephroretinin"", ""nephrocystin-4"", ""POC10 centriolar protein homolog (Chlamydomonas)"""	607215				11920287, 12205563	Standard	XR_244787		Approved	SLSN4, KIAA0673, POC10	uc001alq.2	O75161	OTTHUMG00000000701	ENST00000378156.4:c.1910G>C	chr1.hg19:g.5965397C>G	ENSP00000367398:p.Cys637Ser	119.0	0.0	.		119.0	44.0	.	NM_015102	Q8IWC0	Missense_Mutation	SNP	ENST00000378156.4	hg19	CCDS44052.1	.	.	.	.	.	.	.	.	.	.	C	1.924	-0.447616	0.04572	.	.	ENSG00000131697	ENST00000378156;ENST00000378160	D	0.86097	-2.07	5.52	3.44	0.39384	.	0.958176	0.08697	N	0.907022	T	0.74329	0.3702	L	0.35414	1.06	0.09310	N	0.999991	B	0.14012	0.009	B	0.12837	0.008	T	0.58255	-0.7668	10	0.20046	T	0.44	.	3.0279	0.06097	0.2008:0.4175:0.2899:0.0917	.	637	O75161	NPHP4_HUMAN	S	637;40	ENSP00000367398:C637S	ENSP00000367398:C637S	C	-	2	0	NPHP4	5887984	0.225000	0.23685	0.034000	0.17996	0.361000	0.29550	0.868000	0.27982	1.283000	0.44513	0.561000	0.74099	TGT	.	.	.	none		0.458	NPHP4-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001715.2		
UBR4	23352	hgsc.bcm.edu	37	1	19526229	19526229	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr1:19526229C>G	ENST00000375254.3	-	3	321	c.294G>C	c.(292-294)caG>caC	p.Q98H	UBR4_ENST00000375226.2_Missense_Mutation_p.Q98H|UBR4_ENST00000375217.2_Missense_Mutation_p.Q98H|UBR4_ENST00000375267.2_Missense_Mutation_p.Q98H	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	98					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CTGCCACTGACTGAAGTTGGT	0.448																																					p.Q98H		Atlas-SNP	.											.	UBR4	415	.	0			c.G294C						PASS	.						66.0	70.0	69.0					1																	19526229		2203	4300	6503	SO:0001583	missense	23352	exon3			CACTGACTGAAGT	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.294G>C	chr1.hg19:g.19526229C>G	ENSP00000364403:p.Gln98His	84.0	0.0	.		96.0	30.0	.	NM_020765	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	ENST00000375254.3	hg19	CCDS189.1	.	.	.	.	.	.	.	.	.	.	C	11.70	1.716487	0.30413	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226	T;T;T;T	0.22945	1.93;1.93;1.93;1.93	5.45	3.58	0.41010	.	0.070642	0.56097	D	0.000023	T	0.12220	0.0297	N	0.08118	0	0.80722	D	1	P	0.44090	0.826	B	0.38562	0.276	T	0.07712	-1.0758	10	0.48119	T	0.1	.	8.9721	0.35912	0.0:0.7689:0.0:0.2311	.	98	Q5T4S7	UBR4_HUMAN	H	98	ENSP00000364403:Q98H;ENSP00000364416:Q98H;ENSP00000364365:Q98H;ENSP00000364374:Q98H	ENSP00000364365:Q98H	Q	-	3	2	UBR4	19398816	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.114000	0.31196	0.780000	0.33566	-0.157000	0.13467	CAG	.	.	.	none		0.448	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
GPBP1L1	60313	hgsc.bcm.edu	37	1	46120388	46120388	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr1:46120388C>T	ENST00000290795.3	-	5	1525	c.304G>A	c.(304-306)Ggt>Agt	p.G102S	GPBP1L1_ENST00000355105.3_Missense_Mutation_p.G102S			Q9HC44	GPBL1_HUMAN	GC-rich promoter binding protein 1-like 1	102					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)		GPBP1L1/MAST2_ENST00000361297(2)	breast(1)|endometrium(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|stomach(1)	21	Acute lymphoblastic leukemia(166;0.155)					CCATCATGACCTCGGGAAGAG	0.547																																					p.G102S		Atlas-SNP	.											.	GPBP1L1	43	.	0			c.G304A						PASS	.						89.0	79.0	83.0					1																	46120388		2203	4300	6503	SO:0001583	missense	60313	exon6			CATGACCTCGGGA		CCDS528.1	1p34.1	2008-02-05			ENSG00000159592	ENSG00000159592			28843	protein-coding gene	gene with protein product						12477932	Standard	NM_021639		Approved	SP192	uc001coq.3	Q9HC44	OTTHUMG00000040990	ENST00000290795.3:c.304G>A	chr1.hg19:g.46120388C>T	ENSP00000290795:p.Gly102Ser	134.0	0.0	.		113.0	42.0	.	NM_021639	D3DQ10|Q9H751	Missense_Mutation	SNP	ENST00000290795.3	hg19	CCDS528.1	.	.	.	.	.	.	.	.	.	.	C	34	5.363208	0.95877	.	.	ENSG00000159592	ENST00000290795;ENST00000355105	T;T	0.50277	0.75;0.75	5.95	5.05	0.67936	.	0.048934	0.85682	N	0.000000	T	0.67126	0.2860	M	0.66939	2.045	0.43207	D	0.995062	D	0.89917	1.0	D	0.91635	0.999	T	0.71279	-0.4640	10	0.87932	D	0	-17.3444	15.1228	0.72457	0.0:0.9326:0.0:0.0674	.	102	Q9HC44	GPBL1_HUMAN	S	102	ENSP00000290795:G102S;ENSP00000347224:G102S	ENSP00000290795:G102S	G	-	1	0	GPBP1L1	45892975	1.000000	0.71417	0.955000	0.39395	0.888000	0.51559	5.504000	0.66968	1.534000	0.49203	0.655000	0.94253	GGT	.	.	.	none		0.547	GPBP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098375.1	NM_021639	
PTGER3	5733	hgsc.bcm.edu	37	1	71513083	71513084	+	Missense_Mutation	DNP	GC	GC	TA			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr1:71513083_71513084GC>TA	ENST00000306666.5	-	1	387_388	c.177_178GC>TA	c.(175-180)ctGCtc>ctTAtc	p.L60I	ZRANB2-AS1_ENST00000450461.1_RNA|PTGER3_ENST00000370931.3_Missense_Mutation_p.L60I|PTGER3_ENST00000370932.2_Missense_Mutation_p.L60I|PTGER3_ENST00000460330.1_Missense_Mutation_p.L60I|PTGER3_ENST00000356595.4_Missense_Mutation_p.L60I|PTGER3_ENST00000370924.4_Missense_Mutation_p.L60I|PTGER3_ENST00000351052.5_Missense_Mutation_p.L60I|PTGER3_ENST00000354608.5_Missense_Mutation_p.L60I|PTGER3_ENST00000414819.1_Missense_Mutation_p.L60I	NM_198719.1	NP_942012.1	P43115	PE2R3_HUMAN	prostaglandin E receptor 3 (subtype EP3)	60					cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of fever generation (GO:0031622)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|prostaglandin E receptor activity (GO:0004957)			endometrium(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25					Bimatoprost(DB00905)|Dinoprostone(DB00917)|Misoprostol(DB00929)	AAACCAGTGAGCAGCATGGTGA	0.678																																					p.L60I|p.L59L		Atlas-SNP	.											.	PTGER3	246	.	0			c.C178A|c.G177T						PASS	.																																			SO:0001583	missense	5733	exon1			CAGTGAGCAGCAT|AGTGAGCAGCATG	X83863	CCDS652.1, CCDS655.1, CCDS656.1, CCDS657.1, CCDS658.1	1p31.2	2012-08-08			ENSG00000050628	ENSG00000050628		"""GPCR / Class A : Prostanoid receptors"""	9595	protein-coding gene	gene with protein product		176806				7759114, 9073510	Standard	NM_001126044		Approved	EP3	uc001dfo.3	P43115	OTTHUMG00000009399	ENST00000306666.5:c.177_178delinsTA	chr1.hg19:g.71513083_71513084delinsTA	ENSP00000302313:p.Leu60Ile	288.0|285.0	0.0	.		269.0|271.0	92.0	.	NM_001126044	B0AZN4|B1AK19|B5BUP5|O00326|Q12943|Q12944|Q12945|Q16546|Q5CZ59|Q5CZ61|Q5CZ62|Q5CZ63|Q5CZ64	Missense_Mutation|Silent	SNP	ENST00000306666.5	hg19	CCDS657.1																																																																																			.	.	.	none		0.678	PTGER3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000026076.1	NM_000957	
ADORA3	140	hgsc.bcm.edu	37	1	112029234	112029234	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr1:112029234T>A	ENST00000369716.4	-	4	979	c.846A>T	c.(844-846)aaA>aaT	p.K282N	ADORA3_ENST00000369717.4_Missense_Mutation_p.K201N	NM_020683.6	NP_065734.5	P33765	AA3R_HUMAN	adenosine A3 receptor	0					activation of adenylate cyclase activity (GO:0007190)|histamine secretion by mast cell (GO:0002553)|inflammatory response (GO:0006954)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of mucus secretion (GO:0070257)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of heart contraction (GO:0008016)|response to wounding (GO:0009611)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	G-protein coupled adenosine receptor activity (GO:0001609)			NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|skin(1)	12		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)		all cancers(265;0.0185)|Colorectal(144;0.0186)|Lung(183;0.0238)|COAD - Colon adenocarcinoma(174;0.0644)|Epithelial(280;0.0872)|LUSC - Lung squamous cell carcinoma(189;0.134)	Adenosine(DB00640)|Aminophylline(DB01223)|Enprofylline(DB00824)	TGCGGACAACTTTGGGAGCCT	0.562																																					p.K282N		Atlas-SNP	.											.	ADORA3	104	.	0			c.A846T						PASS	.						102.0	92.0	96.0					1																	112029234		2203	4300	6503	SO:0001583	missense	140	exon4			GACAACTTTGGGA	BC029831	CCDS838.1, CCDS839.1, CCDS41369.1	1p13.2	2014-09-17			ENSG00000121933	ENSG00000121933		"""GPCR / Class A : Adenosine receptors"", ""Immunoglobulin superfamily / V-set domain containing"""	268	protein-coding gene	gene with protein product		600445				7607699	Standard	NM_020683		Approved	AD026	uc001ebf.3	P33765	OTTHUMG00000011957	ENST00000369716.4:c.846A>T	chr1.hg19:g.112029234T>A	ENSP00000358730:p.Lys282Asn	69.0	0.0	.		75.0	35.0	.	NM_020683	A2A3P4|Q6UWU0|Q9BYZ1	Missense_Mutation	SNP	ENST00000369716.4	hg19	CCDS838.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.82|11.82	1.752256|1.752256	0.31046|0.31046	.|.	.|.	ENSG00000121933|ENSG00000121933	ENST00000414219;ENST00000442484|ENST00000369717;ENST00000369716;ENST00000355437;ENST00000443498	T|T;T	0.20200|0.54279	2.09|2.4;0.58	4.5|4.5	-0.965|-0.965	0.10323|0.10323	.|.	0.649942|0.649942	0.14219|0.14219	N|N	0.333533|0.333533	T|T	0.18551|0.18551	0.0445|0.0445	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	1|1	.|B;B	.|0.30281	.|0.275;0.275	.|B;B	.|0.36418	.|0.224;0.104	T|T	0.25916|0.25916	-1.0118|-1.0118	8|10	0.45353|0.72032	T|D	0.12|0.01	-3.4141|-3.4141	3.1776|3.1776	0.06573|0.06573	0.1969:0.3231:0.0:0.48|0.1969:0.3231:0.0:0.48	.|.	.|201;282	.|Q5QNY7;P33765-2	.|.;.	M|N	142;95|201;282;113;107	ENSP00000415646:K142M|ENSP00000358731:K201N;ENSP00000358730:K282N	ENSP00000415646:K142M|ENSP00000347612:K113N	K|K	-|-	2|3	0|2	ADORA3|ADORA3	111830757|111830757	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	0.208000|0.208000	0.17415|0.17415	-0.015000|-0.015000	0.14150|0.14150	-0.441000|-0.441000	0.05720|0.05720	AAG|AAA	.	.	.	none		0.562	ADORA3-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000157679.1	NM_000677, NM_020683	
PDE4DIP	9659	hgsc.bcm.edu	37	1	144882724	144882724	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr1:144882724G>T	ENST00000369354.3	-	24	3484	c.3295C>A	c.(3295-3297)Cag>Aag	p.Q1099K	PDE4DIP_ENST00000369359.4_Missense_Mutation_p.Q1236K|PDE4DIP_ENST00000524974.1_5'UTR|PDE4DIP_ENST00000530740.1_Missense_Mutation_p.Q1236K|PDE4DIP_ENST00000369356.4_Missense_Mutation_p.Q1099K|PDE4DIP_ENST00000313382.9_Intron			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	1099					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		AACTCAGCCTGAAGGCTACTC	0.483			T	PDGFRB	MPD																																p.Q1099K		Atlas-SNP	.		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	PDE4DIP_ENST00000369356,bladder,carcinoma,0,2	PDE4DIP	817	.	0			c.C3295A						PASS	.						273.0	257.0	262.0					1																	144882724		2203	4296	6499	SO:0001583	missense	9659	exon24			CAGCCTGAAGGCT	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.3295C>A	chr1.hg19:g.144882724G>T	ENSP00000358360:p.Gln1099Lys	164.0	0.0	.		140.0	29.0	.	NM_014644	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000369354.3	hg19	CCDS30824.1	.	.	.	.	.	.	.	.	.	.	G	8.520	0.868649	0.17322	.	.	ENSG00000178104	ENST00000369354;ENST00000369356;ENST00000530740;ENST00000369359	T;T;T;T	0.01464	4.86;4.86;4.87;4.87	5.84	4.75	0.60458	.	.	.	.	.	T	0.00784	0.0026	L	0.51422	1.61	0.80722	D	1	B	0.34015	0.435	B	0.24974	0.057	T	0.58418	-0.7640	9	0.14252	T	0.57	.	10.7121	0.45990	0.0993:0.0:0.9007:0.0	.	1099	Q5VU43	MYOME_HUMAN	K	1099;1099;1236;1236	ENSP00000358360:Q1099K;ENSP00000358363:Q1099K;ENSP00000435654:Q1236K;ENSP00000358366:Q1236K	ENSP00000358360:Q1099K	Q	-	1	0	PDE4DIP	143594081	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.424000	0.34848	2.778000	0.95560	0.655000	0.94253	CAG	.	.	.	none		0.483	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359	
THEM4	117145	hgsc.bcm.edu	37	1	151867562	151867562	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr1:151867562C>G	ENST00000368814.3	-	2	557	c.208G>C	c.(208-210)Gac>Cac	p.D70H	THEM4_ENST00000489410.1_Missense_Mutation_p.D70H	NM_053055.4	NP_444283.2	Q5T1C6	THEM4_HUMAN	thioesterase superfamily member 4	70					epidermal growth factor receptor signaling pathway (GO:0007173)|fatty acid metabolic process (GO:0006631)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|protein kinase B signaling (GO:0043491)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)	cell projection (GO:0042995)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	palmitoyl-CoA hydrolase activity (GO:0016290)			endometrium(1)|large_intestine(4)|lung(3)|urinary_tract(1)	9	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			CAGGAGCCGTCTTCACATTTC	0.433																																					p.D70H		Atlas-SNP	.											.	THEM4	19	.	0			c.G208C						PASS	.						102.0	99.0	100.0					1																	151867562		2203	4298	6501	SO:0001583	missense	117145	exon2			AGCCGTCTTCACA	AJ313515	CCDS1006.1	1q21.3	2008-02-05			ENSG00000159445	ENSG00000159445			17947	protein-coding gene	gene with protein product	"""C-terminal modulator protein"""	606388				11598301	Standard	NM_053055		Approved	CTMP	uc001ezj.2	Q5T1C6	OTTHUMG00000013049	ENST00000368814.3:c.208G>C	chr1.hg19:g.151867562C>G	ENSP00000357804:p.Asp70His	146.0	0.0	.		108.0	39.0	.	NM_053055	B2RBX2|Q96KR2	Missense_Mutation	SNP	ENST00000368814.3	hg19	CCDS1006.1	.	.	.	.	.	.	.	.	.	.	C	17.45	3.392158	0.62066	.	.	ENSG00000159445	ENST00000368814;ENST00000489410	T;T	0.27256	1.78;1.68	4.16	4.16	0.48862	.	0.414693	0.26079	N	0.026465	T	0.28200	0.0696	M	0.74258	2.255	0.42205	D	0.991782	D	0.57571	0.98	P	0.50231	0.635	T	0.04752	-1.0929	10	0.54805	T	0.06	-16.359	12.2685	0.54691	0.0:1.0:0.0:0.0	.	70	Q5T1C6	THEM4_HUMAN	H	70	ENSP00000357804:D70H;ENSP00000433304:D70H	ENSP00000357804:D70H	D	-	1	0	THEM4	150134186	0.995000	0.38212	0.997000	0.53966	0.718000	0.41266	1.809000	0.38922	2.606000	0.88127	0.650000	0.86243	GAC	.	.	.	none		0.433	THEM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036615.1	NM_053055	
ADAM15	8751	hgsc.bcm.edu	37	1	155034762	155034762	+	Silent	SNP	G	G	A			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr1:155034762G>A	ENST00000356955.2	+	22	2567	c.2466G>A	c.(2464-2466)ctG>ctA	p.L822L	EFNA3_ENST00000505139.1_5'Flank|ADAM15_ENST00000271836.6_Silent_p.L773L|ADAM15_ENST00000368410.2_Silent_p.L479L|ADAM15_ENST00000360674.4_Missense_Mutation_p.C750Y|ADAM15_ENST00000359280.4_Silent_p.L797L|ADAM15_ENST00000368413.1_Silent_p.L479L|ADAM15_ENST00000472434.1_3'UTR|ADAM15_ENST00000368412.3_Missense_Mutation_p.C774Y|ADAM15_ENST00000531455.1_Silent_p.L783L|ADAM15_ENST00000355956.2_Silent_p.L798L|ADAM15_ENST00000449910.2_Silent_p.L821L|EFNA3_ENST00000556931.1_5'Flank|EFNA4_ENST00000368409.3_5'Flank|EFNA4_ENST00000427683.2_5'Flank|EFNA4_ENST00000359751.4_5'Flank	NM_207197.2	NP_997080.1	Q13444	ADA15_HUMAN	ADAM metallopeptidase domain 15	822					angiogenesis (GO:0001525)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of receptor binding (GO:1900121)|protein kinase C signaling (GO:0070528)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(5)|urinary_tract(1)	39	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			GGAAGCCACTGCCTGCCGACC	0.711											OREG0013848	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.C774Y		Atlas-SNP	.											ADAM15,colon,carcinoma,0,1	ADAM15	92	.	0			c.G2321A						PASS	.						6.0	7.0	7.0					1																	155034762		2111	4155	6266	SO:0001819	synonymous_variant	8751	exon20			GCCACTGCCTGCC	U46005	CCDS1084.1, CCDS1085.1, CCDS1086.1, CCDS1087.1, CCDS1088.1, CCDS44236.1, CCDS58031.1, CCDS58032.1, CCDS60282.1	1q21.3	2008-02-05	2007-06-04		ENSG00000143537	ENSG00000143537		"""ADAM metallopeptidase domain containing"""	193	protein-coding gene	gene with protein product	"""metargidin"""	605548	"""a disintegrin and metalloproteinase domain 15 (metargidin)"""			9516430	Standard	NM_003815		Approved	MDC15	uc001fgr.2	Q13444	OTTHUMG00000013898	ENST00000356955.2:c.2466G>A	chr1.hg19:g.155034762G>A		106.0	0.0	.	1767	82.0	36.0	.	NM_001261465	B3KQU5|B4DLB5|B4DMH8|E9PN65|Q13493|Q53XQ0|Q5SR68|Q5SR69|Q6R267|Q71S61|Q71S62|Q71S63|Q71S64|Q71S65|Q71S66|Q71S67|Q71S68|Q71S69|Q96C78|U3KQL5	Missense_Mutation	SNP	ENST00000356955.2	hg19	CCDS1087.1	.	.	.	.	.	.	.	.	.	.	G	10.29	1.308991	0.23821	.	.	ENSG00000143537	ENST00000360674;ENST00000368412	T;T	0.00932	5.76;5.53	4.37	2.39	0.29439	.	.	.	.	.	T	0.01156	0.0038	.	.	.	0.80722	D	1	D;D	0.54964	0.969;0.969	P;P	0.53809	0.735;0.735	T	0.63932	-0.6525	8	0.62326	D	0.03	.	10.3708	0.44053	0.0:0.3895:0.6105:0.0	.	750;774	Q13444-10;Q13444-9	.;.	Y	750;774	ENSP00000353892:C750Y;ENSP00000357397:C774Y	ENSP00000353892:C750Y	C	+	2	0	ADAM15	153301386	1.000000	0.71417	0.988000	0.46212	0.480000	0.33159	1.364000	0.34171	0.419000	0.25927	0.655000	0.94253	TGC	.	.	.	none		0.711	ADAM15-019	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387168.1	NM_003815	
POU2F1	5451	hgsc.bcm.edu	37	1	167343431	167343431	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr1:167343431C>G	ENST00000541643.3	+	7	582	c.420C>G	c.(418-420)caC>caG	p.H140Q	POU2F1_ENST00000452019.1_Missense_Mutation_p.H140Q|POU2F1_ENST00000367866.2_Missense_Mutation_p.H163Q|POU2F1_ENST00000420254.3_Missense_Mutation_p.H140Q|POU2F1_ENST00000429375.2_Intron|POU2F1_ENST00000367862.5_Missense_Mutation_p.H152Q|POU2F1_ENST00000367865.1_3'UTR			P14859	PO2F1_HUMAN	POU class 2 homeobox 1	140					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	30						TGCAGCAGCACTCCGCCAGCC	0.607																																					p.H163Q		Atlas-SNP	.											.	POU2F1	120	.	0			c.C489G						PASS	.						24.0	24.0	24.0					1																	167343431		2203	4300	6503	SO:0001583	missense	5451	exon6			GCAGCACTCCGCC	BC001664	CCDS1259.1, CCDS1259.2, CCDS55655.1, CCDS55656.1	1q24.2	2011-06-20	2007-07-13		ENSG00000143190	ENSG00000143190		"""Homeoboxes / POU class"""	9212	protein-coding gene	gene with protein product		164175	"""POU domain class 2, transcription factor 1"""	OTF1		1887216	Standard	NM_002697		Approved	OCT1	uc001gee.3	P14859	OTTHUMG00000034436	ENST00000541643.3:c.420C>G	chr1.hg19:g.167343431C>G	ENSP00000441285:p.His140Gln	188.0	0.0	.		198.0	81.0	.	NM_002697	B1AL91|B1AL93|B4E029|J3KP77|Q5TBT7|Q6PK46|Q8NEU9|Q9BPV1	Missense_Mutation	SNP	ENST00000541643.3	hg19		.	.	.	.	.	.	.	.	.	.	C	14.61	2.588083	0.46110	.	.	ENSG00000143190	ENST00000367866;ENST00000452019;ENST00000492850;ENST00000367865;ENST00000420254;ENST00000541643;ENST00000367862;ENST00000443275	T;T;T;T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07;-1.07;-1.07;-1.07	5.81	-5.64	0.02466	.	4.687520	0.00397	N	0.000049	T	0.75443	0.3850	L	0.32530	0.975	0.44985	D	0.998002	D;D;D;D	0.69078	0.96;0.997;0.997;0.995	D;D;D;D	0.78314	0.944;0.986;0.991;0.969	T	0.67413	-0.5677	10	0.41790	T	0.15	.	16.7965	0.85603	0.0:0.5772:0.0:0.4228	.	140;152;138;140	P14859-4;P14859-2;P14859-3;P14859	.;.;.;PO2F1_HUMAN	Q	163;140;17;138;140;140;152;48	ENSP00000356840:H163Q;ENSP00000391523:H140Q;ENSP00000356839:H138Q;ENSP00000414660:H140Q;ENSP00000441285:H140Q;ENSP00000356836:H152Q;ENSP00000415993:H48Q	ENSP00000356836:H152Q	H	+	3	2	POU2F1	165610055	0.003000	0.15002	0.669000	0.29828	0.687000	0.40016	-1.326000	0.02685	-1.120000	0.02953	-0.793000	0.03317	CAC	.	.	.	none		0.607	POU2F1-203	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_002697	
PRG4	10216	hgsc.bcm.edu	37	1	186277770	186277770	+	Silent	SNP	T	T	C			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr1:186277770T>C	ENST00000445192.2	+	7	2964	c.2919T>C	c.(2917-2919)atT>atC	p.I973I	PRG4_ENST00000367486.3_Silent_p.I930I|PRG4_ENST00000367485.4_Silent_p.I880I|PRG4_ENST00000367483.4_Silent_p.I932I|PRG4_ENST00000367484.3_Silent_p.I502I	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	973					cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						CATTCAAAATTACTACTCTTA	0.353																																					p.I973I		Atlas-SNP	.											.	PRG4	259	.	0			c.T2919C						PASS	.						196.0	215.0	208.0					1																	186277770		2203	4300	6503	SO:0001819	synonymous_variant	10216	exon7			CAAAATTACTACT	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.2919T>C	chr1.hg19:g.186277770T>C		163.0	0.0	.		151.0	62.0	.	NM_005807	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Silent	SNP	ENST00000445192.2	hg19	CCDS1369.1																																																																																			.	.	.	none		0.353	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	NM_005807	
F13B	2165	hgsc.bcm.edu	37	1	197026477	197026477	+	Silent	SNP	G	G	T	rs141627684		TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr1:197026477G>T	ENST00000367412.1	-	6	967	c.924C>A	c.(922-924)atC>atA	p.I308I		NM_001994.2	NP_001985.2	P05160	F13B_HUMAN	coagulation factor XIII, B polypeptide	308	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)	extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(40)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	66						CTGACCCATGGATCTCAAAAT	0.373																																					p.I308I		Atlas-SNP	.											F13B,NS,carcinoma,0,1	F13B	137	.	0			c.C924A						PASS	.						203.0	188.0	193.0					1																	197026477		2203	4300	6503	SO:0001819	synonymous_variant	2165	exon6			CCCATGGATCTCA	M14057	CCDS1388.1	1q31-q32.1	2012-10-02			ENSG00000143278	ENSG00000143278			3534	protein-coding gene	gene with protein product		134580				2339067, 2271707	Standard	NM_001994		Approved	FXIIIB	uc001gtt.1	P05160	OTTHUMG00000036519	ENST00000367412.1:c.924C>A	chr1.hg19:g.197026477G>T		174.0	0.0	.		131.0	57.0	.	NM_001994	A8K3E5|Q5VYL5	Silent	SNP	ENST00000367412.1	hg19	CCDS1388.1																																																																																			.	G|1.000;A|0.000	.	alt		0.373	F13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088821.2	NM_001994	
PKP1	5317	hgsc.bcm.edu	37	1	201292313	201292313	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr1:201292313G>A	ENST00000352845.3	+	10	1739	c.1739G>A	c.(1738-1740)gGg>gAg	p.G580E	PKP1_ENST00000263946.3_Missense_Mutation_p.G580E|PKP1_ENST00000367324.3_Missense_Mutation_p.G559E			Q13835	PKP1_HUMAN	plakophilin 1	580					apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intermediate filament bundle assembly (GO:0045110)|multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|lamin binding (GO:0005521)|signal transducer activity (GO:0004871)|structural constituent of epidermis (GO:0030280)			NS(2)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(5)|prostate(1)	22						GCCAGCAAGGGGCTGGTGAGT	0.617																																					p.G580E		Atlas-SNP	.											.	PKP1	127	.	0			c.G1739A						PASS	.						95.0	89.0	91.0					1																	201292313		2203	4300	6503	SO:0001583	missense	5317	exon10			GCAAGGGGCTGGT	X79293	CCDS30966.1, CCDS30967.1	1q32	2014-06-18	2014-06-18		ENSG00000081277	ENSG00000081277		"""Armadillo repeat containing"""	9023	protein-coding gene	gene with protein product	"""ectodermal dysplasia/skin fragility syndrome"""	601975	"""plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)"""			9272178	Standard	NM_001005337		Approved	B6P	uc001gwd.3	Q13835	OTTHUMG00000035729	ENST00000352845.3:c.1739G>A	chr1.hg19:g.201292313G>A	ENSP00000295597:p.Gly580Glu	65.0	0.0	.		53.0	21.0	.	NM_000299	O00645|Q14CA0|Q15152	Missense_Mutation	SNP	ENST00000352845.3	hg19	CCDS30966.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.034838	0.75617	.	.	ENSG00000081277	ENST00000367324;ENST00000263946;ENST00000352845	T;T;T	0.46063	0.88;0.88;0.88	5.49	5.49	0.81192	Armadillo-like helical (1);Armadillo-type fold (1);	0.250213	0.45867	D	0.000326	T	0.65048	0.2654	M	0.73217	2.22	0.58432	D	0.999999	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.77557	0.99;0.975;0.974	T	0.61744	-0.7000	10	0.35671	T	0.21	-16.8875	19.3649	0.94458	0.0:0.0:1.0:0.0	.	167;559;580	Q14BN3;Q13835-2;Q13835	.;.;PKP1_HUMAN	E	559;580;580	ENSP00000356293:G559E;ENSP00000263946:G580E;ENSP00000295597:G580E	ENSP00000263946:G580E	G	+	2	0	PKP1	199558936	1.000000	0.71417	0.999000	0.59377	0.921000	0.55340	6.580000	0.74040	2.571000	0.86741	0.591000	0.81541	GGG	.	.	.	none		0.617	PKP1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000086897.1	NM_000299	
SMYD3	64754	hgsc.bcm.edu	37	1	246670463	246670463	+	Silent	SNP	G	G	T			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr1:246670463G>T	ENST00000388985.4	-	1	56	c.57C>A	c.(55-57)cgC>cgA	p.R19R	SMYD3_ENST00000490107.1_5'UTR|SMYD3_ENST00000403792.3_Silent_p.R19R			Q9H7B4	SMYD3_HUMAN	SET and MYND domain containing 3	19	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				cellular response to dexamethasone stimulus (GO:0071549)|establishment of protein localization (GO:0045184)|myotube cell development (GO:0014904)|negative regulation of protein kinase activity (GO:0006469)|nucleosome assembly (GO:0006334)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II intronic transcription regulatory region sequence-specific DNA binding (GO:0001162)			breast(3)|large_intestine(5)|lung(8)|skin(1)	17	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)		GGGTCACGGCGCGCAGCCCGT	0.682																																					p.R19R		Atlas-SNP	.											.	SMYD3	77	.	0			c.C57A						PASS	.						31.0	42.0	39.0					1																	246670463		692	1591	2283	SO:0001819	synonymous_variant	64754	exon1			CACGGCGCGCAGC	AK023594	CCDS31083.1	1q44	2011-07-01	2003-05-14	2003-05-16	ENSG00000185420	ENSG00000185420		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	15513	protein-coding gene	gene with protein product		608783	"""zinc finger, MYND domain containing 1"""	ZNFN3A1, ZMYND1			Standard	NM_022743		Approved	KMT3E	uc001ibl.3	Q9H7B4	OTTHUMG00000040508	ENST00000388985.4:c.57C>A	chr1.hg19:g.246670463G>T		174.0	0.0	.		153.0	65.0	.	NM_001167740	A8K0P0|B1AN38|Q86TL8|Q8N5Z6|Q96AI5	Silent	SNP	ENST00000388985.4	hg19	CCDS53486.1																																																																																			.	.	.	none		0.682	SMYD3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_022743	
ALMS1	7840	hgsc.bcm.edu	37	2	73613065	73613065	+	Silent	SNP	G	G	A			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr2:73613065G>A	ENST00000264448.6	+	1	180	c.69G>A	c.(67-69)gaG>gaA	p.E23E	ALMS1_ENST00000377715.1_Silent_p.E23E|ALMS1_ENST00000409009.1_Silent_p.E23E	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	23	Glu-rich.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						aggaggaggaggaggaagagg	0.687																																					p.E23E		Atlas-SNP	.											.	ALMS1	384	.	0			c.G69A						PASS	.						6.0	9.0	8.0					2																	73613065		1849	3831	5680	SO:0001819	synonymous_variant	7840	exon1			GGAGGAGGAGGAA	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.69G>A	chr2.hg19:g.73613065G>A		646.0	0.0	.		564.0	66.0	.	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Silent	SNP	ENST00000264448.6	hg19	CCDS42697.1																																																																																			.	.	.	none		0.687	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
LRP2	4036	hgsc.bcm.edu	37	2	170097724	170097724	+	Silent	SNP	T	T	C			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr2:170097724T>C	ENST00000263816.3	-	25	4104	c.3819A>G	c.(3817-3819)tcA>tcG	p.S1273S	LRP2_ENST00000443831.1_Silent_p.S1136S	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	1273	LDL-receptor class A 14. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	GGAAATATGATGAAGGGCAAG	0.512																																					p.S1273S		Atlas-SNP	.											.	LRP2	751	.	0			c.A3819G						PASS	.						161.0	136.0	144.0					2																	170097724		2203	4300	6503	SO:0001819	synonymous_variant	4036	exon25			ATATGATGAAGGG		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.3819A>G	chr2.hg19:g.170097724T>C		133.0	0.0	.		133.0	42.0	.	NM_004525	O00711|Q16215	Silent	SNP	ENST00000263816.3	hg19	CCDS2232.1																																																																																			.	.	.	none		0.512	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
TTN	7273	hgsc.bcm.edu	37	2	179424376	179424376	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr2:179424376T>C	ENST00000591111.1	-	276	81784	c.81560A>G	c.(81559-81561)cAg>cGg	p.Q27187R	TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.Q28828R|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.Q26260R|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.Q19955R|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.Q19888R|TTN_ENST00000460472.2_Missense_Mutation_p.Q19763R|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000590807.1_RNA			Q8WZ42	TITIN_HUMAN	titin	27187	Ig-like 129.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAAAACATTCTGAATTGTTAA	0.408																																					p.Q28828R		Atlas-SNP	.											.	TTN	18412	.	0			c.A86483G						PASS	.						178.0	166.0	170.0					2																	179424376		1953	4152	6105	SO:0001583	missense	7273	exon326			ACATTCTGAATTG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.81560A>G	chr2.hg19:g.179424376T>C	ENSP00000465570:p.Gln27187Arg	91.0	0.0	.		104.0	35.0	.	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	T	13.02	2.113492	0.37339	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23	5.77	5.77	0.91146	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.53899	0.1825	N	0.17764	0.52	0.38198	D	0.940119	P;P;P;P	0.43231	0.801;0.801;0.801;0.684	B;B;B;B	0.38378	0.265;0.265;0.265;0.272	T	0.65179	-0.6231	9	0.87932	D	0	.	16.383	0.83481	0.0:0.0:0.0:1.0	.	19763;19888;19955;27187	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	R	26260;19763;19955;19888;19760	ENSP00000343764:Q26260R;ENSP00000434586:Q19763R;ENSP00000340554:Q19955R;ENSP00000352154:Q19888R	ENSP00000340554:Q19955R	Q	-	2	0	TTN	179132622	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.081000	0.64444	2.326000	0.78906	0.533000	0.62120	CAG	.	.	.	none		0.408	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
FASTKD2	22868	hgsc.bcm.edu	37	2	207655298	207655298	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr2:207655298T>C	ENST00000236980.6	+	11	2249	c.1901T>C	c.(1900-1902)gTa>gCa	p.V634A	FASTKD2_ENST00000402774.3_Missense_Mutation_p.V634A|FASTKD2_ENST00000403094.3_Missense_Mutation_p.V634A	NM_014929.3	NP_055744.2	Q9NYY8	FAKD2_HUMAN	FAST kinase domains 2	634	RAP. {ECO:0000255|PROSITE- ProRule:PRU00619}.				cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(2)	21				LUSC - Lung squamous cell carcinoma(261;0.0718)|Epithelial(149;0.119)|Lung(261;0.138)		GTTTTCAGAGTAGCTGTGCTA	0.383																																					p.V634A		Atlas-SNP	.											.	FASTKD2	49	.	0			c.T1901C						PASS	.						126.0	126.0	126.0					2																	207655298		2203	4300	6503	SO:0001583	missense	22868	exon11			TCAGAGTAGCTGT	BC001544	CCDS2371.1	2q33.3	2008-02-05	2006-07-07	2006-07-07	ENSG00000118246	ENSG00000118246			29160	protein-coding gene	gene with protein product		612322	"""KIAA0971"""	KIAA0971			Standard	NM_014929		Approved		uc002vbx.3	Q9NYY8	OTTHUMG00000132917	ENST00000236980.6:c.1901T>C	chr2.hg19:g.207655298T>C	ENSP00000236980:p.Val634Ala	51.0	0.0	.		54.0	21.0	.	NM_001136193	Q9NVX6|Q9Y2H7	Missense_Mutation	SNP	ENST00000236980.6	hg19	CCDS2371.1	.	.	.	.	.	.	.	.	.	.	T	15.64	2.892723	0.52121	.	.	ENSG00000118246	ENST00000236980;ENST00000402774;ENST00000403094	T;T;T	0.21734	1.99;1.99;1.99	5.96	5.96	0.96718	RAP domain (1);	0.288889	0.34268	N	0.004111	T	0.24890	0.0604	M	0.68952	2.095	0.34651	D	0.721629	P	0.40431	0.717	B	0.35813	0.211	T	0.46373	-0.9196	10	0.87932	D	0	-20.0213	13.9717	0.64245	0.0:0.0:0.0:1.0	.	634	Q9NYY8	FAKD2_HUMAN	A	634	ENSP00000236980:V634A;ENSP00000385990:V634A;ENSP00000384929:V634A	ENSP00000236980:V634A	V	+	2	0	FASTKD2	207363543	1.000000	0.71417	1.000000	0.80357	0.610000	0.37248	2.909000	0.48758	2.285000	0.76669	0.533000	0.62120	GTA	.	.	.	none		0.383	FASTKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256428.2	NM_014929	
AQP12B	653437	hgsc.bcm.edu	37	2	241621833	241621833	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr2:241621833T>A	ENST00000407834.3	-	1	484	c.422A>T	c.(421-423)cAc>cTc	p.H141L		NM_001102467.1	NP_001095937.1	A6NM10	AQ12B_HUMAN	aquaporin 12B	129						integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|lung(8)|ovary(1)	13		all_epithelial(40;1.71e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)		CTGCAGCAGGTGCAGGTCACT	0.697																																					p.H141L		Atlas-SNP	.											.	AQP12B	33	.	0			c.A422T						PASS	.						13.0	13.0	13.0					2																	241621833		2174	4214	6388	SO:0001583	missense	653437	exon1			AGCAGGTGCAGGT	BC041460	CCDS46560.1	2q37.3	2007-12-14	2005-05-26	2005-05-26	ENSG00000185176	ENSG00000185176		"""Ion channels / Aquaporins"""	6096	protein-coding gene	gene with protein product			"""insulin synthesis associated 3"""	INSSA3			Standard	NM_001102467		Approved		uc010fzj.3	A6NM10	OTTHUMG00000152263	ENST00000407834.3:c.422A>T	chr2.hg19:g.241621833T>A	ENSP00000384894:p.His141Leu	207.0	0.0	.		194.0	48.0	.	NM_001102467	A4QPB9	Missense_Mutation	SNP	ENST00000407834.3	hg19	CCDS46560.1	.	.	.	.	.	.	.	.	.	.	.	18.49	3.636002	0.67130	.	.	ENSG00000185176	ENST00000407834	T	0.38887	1.11	2.8	1.59	0.23543	.	0.103713	0.64402	D	0.000003	T	0.53578	0.1805	M	0.80982	2.52	0.42521	D	0.993008	D	0.58268	0.982	P	0.56042	0.79	T	0.55431	-0.8142	10	0.87932	D	0	1.3049	6.5696	0.22531	0.0:0.1293:0.0:0.8707	.	141	A6NM10-2	.	L	141	ENSP00000384894:H141L	ENSP00000384894:H141L	H	-	2	0	AQP12B	241270506	1.000000	0.71417	0.119000	0.21687	0.931000	0.56810	3.976000	0.56867	0.469000	0.27268	0.376000	0.23039	CAC	.	.	.	none		0.697	AQP12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325625.1		
D2HGDH	728294	hgsc.bcm.edu	37	2	242683053	242683053	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr2:242683053G>T	ENST00000321264.4	+	5	716	c.507G>T	c.(505-507)caG>caT	p.Q169H	D2HGDH_ENST00000403782.1_Missense_Mutation_p.Q35H|D2HGDH_ENST00000537090.1_Missense_Mutation_p.Q169H|D2HGDH_ENST00000342518.6_Missense_Mutation_p.Q169H	NM_152783.3	NP_689996.4	Q8N465	D2HDH_HUMAN	D-2-hydroxyglutarate dehydrogenase	169	FAD-binding PCMH-type. {ECO:0000255|PROSITE-ProRule:PRU00718}.				2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular protein metabolic process (GO:0044267)|response to cobalt ion (GO:0032025)|response to manganese ion (GO:0010042)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	(R)-2-hydroxyglutarate dehydrogenase activity (GO:0051990)|flavin adenine dinucleotide binding (GO:0050660)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)			breast(1)|endometrium(3)|lung(10)|skin(1)|urinary_tract(1)	16		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)		TGGTTTGCCAGGCGGGCTGCG	0.637																																					p.Q169H		Atlas-SNP	.											.	D2HGDH	39	.	0			c.G507T						PASS	.						35.0	35.0	35.0					2																	242683053		2203	4296	6499	SO:0001583	missense	728294	exon5			TTGCCAGGCGGGC	AK091725	CCDS33426.1, CCDS74684.1	2p25.3	2010-05-11			ENSG00000180902	ENSG00000180902	1.1.99.-		28358	protein-coding gene	gene with protein product		609186				15070399, 15609246	Standard	NM_152783		Approved	MGC25181, D2HGD, FLJ42195	uc002wce.1	Q8N465	OTTHUMG00000151474	ENST00000321264.4:c.507G>T	chr2.hg19:g.242683053G>T	ENSP00000315351:p.Gln169His	42.0	0.0	.		34.0	11.0	.	NM_152783	B4E3L6|E7ENP2|Q6IQ24|Q8N5Q8	Missense_Mutation	SNP	ENST00000321264.4	hg19	CCDS33426.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.75|12.75	2.032526|2.032526	0.35893|0.35893	.|.	.|.	ENSG00000180902|ENSG00000180902	ENST00000417686|ENST00000537090;ENST00000321264;ENST00000403782;ENST00000342518	.|D;D;D;D	.|0.96913	.|-4.17;-4.17;-4.17;-4.17	4.73|4.73	4.73|4.73	0.59995|0.59995	.|FAD-linked oxidase, FAD-binding, subdomain 2 (1);FAD-binding, type 2 (2);FAD linked oxidase, N-terminal (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.98369|0.98369	0.9458|0.9458	H|H	0.96269|0.96269	3.795|3.795	0.80722|0.80722	D|D	1|1	.|D	.|0.60160	.|0.987	.|P	.|0.61275	.|0.886	D|D	0.99063|0.99063	1.0831|1.0831	5|10	.|0.87932	.|D	.|0	.|.	11.7108|11.7108	0.51625|0.51625	0.0942:0.0:0.9058:0.0|0.0942:0.0:0.9058:0.0	.|.	.|169	.|Q8N465	.|D2HDH_HUMAN	C|H	11|169;169;35;169	.|ENSP00000442796:Q169H;ENSP00000315351:Q169H;ENSP00000384723:Q35H;ENSP00000339536:Q169H	.|ENSP00000315351:Q169H	G|Q	+|+	1|3	0|2	D2HGDH|D2HGDH	242331726|242331726	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.322000|0.322000	0.28314|0.28314	5.002000|5.002000	0.63952|0.63952	2.191000|2.191000	0.70037|0.70037	0.462000|0.462000	0.41574|0.41574	GGC|CAG	.	.	.	none		0.637	D2HGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322794.2	NM_152783	
SCN5A	6331	hgsc.bcm.edu	37	3	38592252	38592252	+	Silent	SNP	G	G	A			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr3:38592252G>A	ENST00000333535.4	-	28	5760	c.5611C>T	c.(5611-5613)Ctg>Ttg	p.L1871L	SCN5A_ENST00000425664.1_Silent_p.L1853L|SCN5A_ENST00000414099.2_Silent_p.L1853L|SCN5A_ENST00000464652.1_5'Flank|SCN5A_ENST00000423572.2_Silent_p.L1870L|SCN5A_ENST00000455624.2_Silent_p.L1838L|SCN5A_ENST00000443581.1_Silent_p.L1870L|SCN5A_ENST00000451551.2_Silent_p.L1817L|SCN5A_ENST00000450102.2_Silent_p.L1817L|SCN5A_ENST00000449557.2_Silent_p.L1817L|SCN5A_ENST00000413689.1_Silent_p.L1871L			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	1871	Interaction with FGF13.				AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	TGGATCTTCAGGGCGTCCATC	0.577																																					p.L1871L		Atlas-SNP	.											.	SCN5A	634	.	0			c.C5611T						PASS	.						164.0	178.0	173.0					3																	38592252		2090	4210	6300	SO:0001819	synonymous_variant	6331	exon28			TCTTCAGGGCGTC	AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.5611C>T	chr3.hg19:g.38592252G>A		81.0	0.0	.		130.0	43.0	.	NM_198056	A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Silent	SNP	ENST00000333535.4	hg19	CCDS46796.1																																																																																			.	.	.	none		0.577	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	NM_198056	
CCDC66	285331	hgsc.bcm.edu	37	3	56649243	56649243	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr3:56649243A>G	ENST00000394672.3	+	12	1724	c.1654A>G	c.(1654-1656)Atc>Gtc	p.I552V	CCDC66_ENST00000326595.7_Missense_Mutation_p.I518V|CCDC66_ENST00000436465.2_Missense_Mutation_p.I552V	NM_001012506.4|NM_001141947.1	NP_001012524.4|NP_001135419.1	A2RUB6	CCD66_HUMAN	coiled-coil domain containing 66	552					post-embryonic retina morphogenesis in camera-type eye (GO:0060060)|retinal rod cell development (GO:0046548)					breast(1)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|skin(2)|urinary_tract(1)	12				KIRC - Kidney renal clear cell carcinoma(284;0.0478)|Kidney(284;0.0597)|OV - Ovarian serous cystadenocarcinoma(275;0.233)		AGAACAAAGAATCCGAGAATT	0.383																																					p.I552V		Atlas-SNP	.											.	CCDC66	145	.	0			c.A1654G						PASS	.						112.0	112.0	112.0					3																	56649243		2203	4300	6503	SO:0001583	missense	285331	exon12			CAAAGAATCCGAG	AL832692	CCDS33770.2, CCDS46852.1	3p14.3	2006-03-27			ENSG00000180376	ENSG00000180376			27709	protein-coding gene	gene with protein product						14702039	Standard	NR_024460		Approved	DKFZp686C0433	uc003dhz.3	A2RUB6	OTTHUMG00000155748	ENST00000394672.3:c.1654A>G	chr3.hg19:g.56649243A>G	ENSP00000378167:p.Ile552Val	717.0	2.0	.		848.0	444.0	.	NM_001141947	B3KWL8|Q4VC34|Q8N949	Missense_Mutation	SNP	ENST00000394672.3	hg19	CCDS46852.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.241738	0.79912	.	.	ENSG00000180376	ENST00000422222;ENST00000394672;ENST00000326595;ENST00000436465	T;T;T;T	0.41400	1.0;1.0;1.0;1.0	5.97	5.97	0.96955	.	0.181866	0.48286	D	0.000190	T	0.63570	0.2522	M	0.72118	2.19	0.80722	D	1	D	0.71674	0.998	D	0.72982	0.979	T	0.61652	-0.7019	10	0.35671	T	0.21	-10.0888	16.4562	0.84015	1.0:0.0:0.0:0.0	.	552	A2RUB6	CCD66_HUMAN	V	508;552;518;552	ENSP00000401451:I508V;ENSP00000378167:I552V;ENSP00000326050:I518V;ENSP00000404320:I552V	ENSP00000326050:I518V	I	+	1	0	CCDC66	56624283	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.384000	0.73177	2.289000	0.77006	0.459000	0.35465	ATC	.	.	.	none		0.383	CCDC66-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341473.1	NM_001012506	
GOLGB1	2804	hgsc.bcm.edu	37	3	121410064	121410064	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr3:121410064T>A	ENST00000340645.5	-	14	8257	c.8132A>T	c.(8131-8133)gAt>gTt	p.D2711V	GOLGB1_ENST00000393667.3_Missense_Mutation_p.D2716V	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	2711					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		CTCCACCAAATCTCTTGCTAG	0.388																																					p.D2716V		Atlas-SNP	.											.	GOLGB1	319	.	0			c.A8147T						PASS	.						247.0	257.0	254.0					3																	121410064		2203	4300	6503	SO:0001583	missense	2804	exon14			ACCAAATCTCTTG	X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.8132A>T	chr3.hg19:g.121410064T>A	ENSP00000341848:p.Asp2711Val	77.0	0.0	.		112.0	13.0	.	NM_001256486	B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	ENST00000340645.5	hg19	CCDS3004.1	.	.	.	.	.	.	.	.	.	.	T	13.20	2.165936	0.38217	.	.	ENSG00000173230	ENST00000340645;ENST00000393667	T;T	0.29142	1.58;1.59	5.46	5.46	0.80206	.	0.094413	0.45867	D	0.000327	T	0.54902	0.1887	M	0.73598	2.24	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.981;0.981;0.999	T	0.56625	-0.7948	10	0.48119	T	0.1	.	13.4815	0.61338	0.0:0.0:0.0:1.0	.	2716;2716;2711	E7EP74;B2ZZ91;Q14789	.;.;GOGB1_HUMAN	V	2711;2716	ENSP00000341848:D2711V;ENSP00000377275:D2716V	ENSP00000341848:D2711V	D	-	2	0	GOLGB1	122892754	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.548000	0.82154	2.062000	0.61559	0.533000	0.62120	GAT	.	.	.	none		0.388	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355159.1	NM_004487	
CHST2	9435	hgsc.bcm.edu	37	3	142840256	142840256	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr3:142840256G>A	ENST00000309575.3	+	2	1982	c.598G>A	c.(598-600)Gta>Ata	p.V200I		NM_004267.4	NP_004258.2	Q9Y4C5	CHST2_HUMAN	carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2	200					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|multicellular organismal development (GO:0007275)|N-acetylglucosamine metabolic process (GO:0006044)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|trans-Golgi network (GO:0005802)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(2)	22						AGTGTGGCATGTATGGCAAAA	0.582																																					p.V200I		Atlas-SNP	.											.	CHST2	67	.	0			c.G598A						PASS	.						67.0	83.0	78.0					3																	142840256		2198	4297	6495	SO:0001583	missense	9435	exon2			TGGCATGTATGGC	BC042160	CCDS3129.1	3q24	2007-03-14			ENSG00000175040	ENSG00000175040		"""Sulfotransferases, membrane-bound"""	1970	protein-coding gene	gene with protein product		603798				10049591	Standard	NM_004267		Approved	C6ST	uc003evm.3	Q9Y4C5	OTTHUMG00000159351	ENST00000309575.3:c.598G>A	chr3.hg19:g.142840256G>A	ENSP00000307911:p.Val200Ile	133.0	0.0	.		166.0	109.0	.	NM_004267	D3DNG5|Q2M370|Q9GZN5|Q9UED5|Q9Y6F2	Missense_Mutation	SNP	ENST00000309575.3	hg19	CCDS3129.1	.	.	.	.	.	.	.	.	.	.	G	13.16	2.154982	0.38021	.	.	ENSG00000175040	ENST00000309575	D	0.96619	-4.07	4.45	4.45	0.53987	Sulfotransferase domain (1);	0.082297	0.48767	U	0.000162	D	0.91195	0.7226	N	0.10916	0.065	0.43084	D	0.994742	B	0.23591	0.088	B	0.27500	0.08	D	0.88039	0.2780	10	0.25106	T	0.35	-0.111	17.2545	0.87051	0.0:0.0:1.0:0.0	.	200	Q9Y4C5	CHST2_HUMAN	I	200	ENSP00000307911:V200I	ENSP00000307911:V200I	V	+	1	0	CHST2	144322946	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	3.671000	0.54576	2.295000	0.77249	0.407000	0.27541	GTA	.	.	.	none		0.582	CHST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354850.1	NM_004267	
DSPP	1834	hgsc.bcm.edu	37	4	88536436	88536436	+	Silent	SNP	C	C	T			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr4:88536436C>T	ENST00000282478.7	+	4	2655	c.2622C>T	c.(2620-2622)agC>agT	p.S874S	DSPP_ENST00000399271.1_Silent_p.S874S|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	874	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gtgacagcagcaacagcagtg	0.502																																					p.S874S		Atlas-SNP	.											.	DSPP	174	.	0			c.C2622T						PASS	.						70.0	85.0	79.0					4																	88536436		1641	2936	4577	SO:0001819	synonymous_variant	1834	exon5			CAGCAGCAACAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.2622C>T	chr4.hg19:g.88536436C>T		250.0	0.0	.		220.0	17.0	.	NM_014208	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	hg19	CCDS43248.1																																																																																			.	.	.	none		0.502	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
LRBA	987	hgsc.bcm.edu	37	4	151520233	151520233	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr4:151520233C>T	ENST00000357115.3	-	38	6215	c.5972G>A	c.(5971-5973)cGc>cAc	p.R1991H	LRBA_ENST00000507224.1_Missense_Mutation_p.R1991H|LRBA_ENST00000535741.1_Missense_Mutation_p.R1991H|LRBA_ENST00000510413.1_Missense_Mutation_p.R1991H	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	1991	Poly-Arg.					cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					TCGTCGCCGGCGCCGCAAGTC	0.488																																					p.R1991H		Atlas-SNP	.											.	LRBA	253	.	0			c.G5972A						PASS	.						111.0	100.0	104.0					4																	151520233		2203	4300	6503	SO:0001583	missense	987	exon38			CGCCGGCGCCGCA	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.5972G>A	chr4.hg19:g.151520233C>T	ENSP00000349629:p.Arg1991His	67.0	0.0	.		95.0	41.0	.	NM_006726	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	ENST00000357115.3	hg19	CCDS3773.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.1|23.1	4.380224|4.380224	0.82682|0.82682	.|.	.|.	ENSG00000198589|ENSG00000198589	ENST00000509835|ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224	.|T;T;T;T	.|0.60672	.|0.17;0.17;0.17;0.17	5.55|5.55	5.55|5.55	0.83447|0.83447	.|Domain of unknown function DUF1088 (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.79627|0.79627	0.4478|0.4478	M|M	0.82823|0.82823	2.61|2.61	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;0.999	.|D;D	.|0.91635	.|0.999;0.989	T|T	0.81422|0.81422	-0.0940|-0.0940	5|10	.|0.72032	.|D	.|0.01	.|.	19.872|19.872	0.96854|0.96854	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1991;1991	.|P50851;P50851-2	.|LRBA_HUMAN;.	T|H	644|1991	.|ENSP00000446299:R1991H;ENSP00000421552:R1991H;ENSP00000349629:R1991H;ENSP00000422180:R1991H	.|ENSP00000349629:R1991H	A|R	-|-	1|2	0|0	LRBA|LRBA	151739683|151739683	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.776000|7.776000	0.85560|0.85560	2.779000|2.779000	0.95612|0.95612	0.585000|0.585000	0.79938|0.79938	GCC|CGC	.	.	.	none		0.488	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1		
SLC12A7	10723	hgsc.bcm.edu	37	5	1087045	1087045	+	Nonsense_Mutation	SNP	A	A	T			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr5:1087045A>T	ENST00000264930.5	-	6	691	c.648T>A	c.(646-648)taT>taA	p.Y216*		NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	216					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	TCCCCAAAATATACATGGCCC	0.587																																					p.Y216X		Atlas-SNP	.											.	SLC12A7	97	.	0			c.T648A						PASS	.						71.0	70.0	70.0					5																	1087045		2203	4300	6503	SO:0001587	stop_gained	10723	exon6			CAAAATATACATG	AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.648T>A	chr5.hg19:g.1087045A>T	ENSP00000264930:p.Tyr216*	311.0	0.0	.		224.0	84.0	.	NM_006598	A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Nonsense_Mutation	SNP	ENST00000264930.5	hg19	CCDS34129.1	.	.	.	.	.	.	.	.	.	.	A	18.59	3.656716	0.67586	.	.	ENSG00000113504	ENST00000264930;ENST00000343658	.	.	.	3.93	-0.467	0.12150	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.6725	0.34159	0.409:0.0:0.591:0.0	.	.	.	.	X	216	.	ENSP00000264930:Y216X	Y	-	3	2	SLC12A7	1140045	1.000000	0.71417	0.898000	0.35279	0.171000	0.22731	1.306000	0.33505	-0.071000	0.12886	-0.366000	0.07423	TAT	.	.	.	none		0.587	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366446.2	NM_006598	
HEXB	3074	hgsc.bcm.edu	37	5	74009349	74009349	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr5:74009349C>A	ENST00000261416.7	+	7	907	c.790C>A	c.(790-792)Cat>Aat	p.H264N	HEXB_ENST00000511181.1_Missense_Mutation_p.H39N	NM_000521.3	NP_000512	P07686	HEXB_HUMAN	hexosaminidase B (beta polypeptide)	264					astrocyte cell migration (GO:0043615)|carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|cellular protein metabolic process (GO:0044267)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|ganglioside catabolic process (GO:0006689)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|lipid storage (GO:0019915)|locomotory behavior (GO:0007626)|lysosome organization (GO:0007040)|male courtship behavior (GO:0008049)|myelination (GO:0042552)|neuromuscular process controlling balance (GO:0050885)|oligosaccharide catabolic process (GO:0009313)|oogenesis (GO:0048477)|penetration of zona pellucida (GO:0007341)|phospholipid biosynthetic process (GO:0008654)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	acrosomal vesicle (GO:0001669)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	beta-N-acetylhexosaminidase activity (GO:0004563)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(3)|large_intestine(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	14		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Breast(144;0.231)		OV - Ovarian serous cystadenocarcinoma(47;1.72e-57)		TTCTTTGTCTCATGTTTATAC	0.373																																					p.H264N	Melanoma(66;841 1270 13391 18706 27225)	Atlas-SNP	.											.	HEXB	34	.	0			c.C790A						PASS	.						149.0	148.0	148.0					5																	74009349		2203	4300	6503	SO:0001583	missense	3074	exon7			TTGTCTCATGTTT	M13519	CCDS4022.1	5q13.3	2012-10-02			ENSG00000049860	ENSG00000049860	3.2.1.52		4879	protein-coding gene	gene with protein product		606873				2579389, 3013851	Standard	NM_000521		Approved		uc003kdf.4	P07686	OTTHUMG00000102057	ENST00000261416.7:c.790C>A	chr5.hg19:g.74009349C>A	ENSP00000261416:p.His264Asn	105.0	0.0	.		116.0	49.0	.	NM_000521		Missense_Mutation	SNP	ENST00000261416.7	hg19	CCDS4022.1	.	.	.	.	.	.	.	.	.	.	C	15.72	2.915689	0.52546	.	.	ENSG00000049860	ENST00000511181;ENST00000261416	D;D	0.95377	-3.69;-3.69	5.73	4.86	0.63082	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycoside hydrolase, family 20, catalytic core (1);	0.000000	0.85682	D	0.000000	D	0.97636	0.9225	M	0.83223	2.63	0.80722	D	1	D	0.58970	0.984	D	0.69142	0.962	D	0.97847	1.0272	10	0.52906	T	0.07	-19.5886	16.7955	0.85601	0.0:0.871:0.129:0.0	.	264	P07686	HEXB_HUMAN	N	39;264	ENSP00000426285:H39N;ENSP00000261416:H264N	ENSP00000261416:H264N	H	+	1	0	HEXB	74045105	1.000000	0.71417	0.982000	0.44146	0.733000	0.41908	4.019000	0.57181	1.406000	0.46857	0.650000	0.86243	CAT	.	.	.	none		0.373	HEXB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219859.6	NM_000521	
LNPEP	4012	hgsc.bcm.edu	37	5	96329525	96329525	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr5:96329525G>T	ENST00000231368.5	+	6	1949	c.1257G>T	c.(1255-1257)ttG>ttT	p.L419F	LNPEP_ENST00000395770.3_Missense_Mutation_p.L405F	NM_005575.2	NP_005566.2	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase	419					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-cell signaling (GO:0007267)|female pregnancy (GO:0007565)|membrane organization (GO:0061024)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|early endosome lumen (GO:0031905)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	34		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		GTCCAGATTTGGTGGCTATTC	0.393																																					p.L419F		Atlas-SNP	.											.	LNPEP	80	.	0			c.G1257T						PASS	.						140.0	136.0	137.0					5																	96329525		2203	4300	6503	SO:0001583	missense	4012	exon6			AGATTTGGTGGCT	D50810	CCDS4087.1, CCDS43346.1	5q15	2011-07-25			ENSG00000113441	ENSG00000113441	3.4.11.3		6656	protein-coding gene	gene with protein product	"""cystinyl aminopeptidase"", ""placental leucine aminopeptidase"""	151300				8550619	Standard	NM_175920		Approved	CAP, PLAP, P-LAP	uc003kmw.1	Q9UIQ6	OTTHUMG00000128719	ENST00000231368.5:c.1257G>T	chr5.hg19:g.96329525G>T	ENSP00000231368:p.Leu419Phe	69.0	0.0	.		76.0	34.0	.	NM_005575	O00769|Q15145|Q59H76|Q9TNQ2|Q9TNQ3|Q9UIQ7	Missense_Mutation	SNP	ENST00000231368.5	hg19	CCDS4087.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.933413	0.73442	.	.	ENSG00000113441	ENST00000231368;ENST00000395770	T;T	0.05382	3.45;3.45	4.89	4.89	0.63831	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.000000	0.64402	D	0.000003	T	0.24586	0.0596	M	0.75884	2.315	0.58432	D	0.999998	D	0.71674	0.998	D	0.81914	0.995	T	0.00465	-1.1723	10	0.66056	D	0.02	.	14.7976	0.69889	0.0:0.1448:0.8552:0.0	.	419	Q9UIQ6	LCAP_HUMAN	F	419;405	ENSP00000231368:L419F;ENSP00000379117:L405F	ENSP00000231368:L419F	L	+	3	2	LNPEP	96355281	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	3.863000	0.56016	2.409000	0.81822	0.655000	0.94253	TTG	.	.	.	none		0.393	LNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250624.1	NM_005575	
KIAA0141	9812	hgsc.bcm.edu	37	5	141313856	141313856	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr5:141313856T>C	ENST00000432126.2	+	9	1083	c.949T>C	c.(949-951)Tac>Cac	p.Y317H	KIAA0141_ENST00000194118.4_Missense_Mutation_p.Y317H	NM_001142603.1|NM_014773.3	NP_001136075.1|NP_055588.3	Q14154	DELE_HUMAN	KIAA0141	317					extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	mitochondrion (GO:0005739)				endometrium(3)|large_intestine(4)|lung(5)|skin(1)|urinary_tract(3)	16		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTGGCTCAGTACCGCTATGC	0.597																																					p.Y317H		Atlas-SNP	.											.	KIAA0141	44	.	0			c.T949C						PASS	.						44.0	42.0	43.0					5																	141313856		2203	4300	6503	SO:0001583	missense	9812	exon9			GCTCAGTACCGCT	BC011269	CCDS4268.1	5q31	2011-05-05			ENSG00000081791	ENSG00000081791			28969	protein-coding gene	gene with protein product	"""death ligand signal enhancer"""	615741				20563667	Standard	XM_005268549		Approved	DELE	uc003llt.3	Q14154	OTTHUMG00000129662	ENST00000432126.2:c.949T>C	chr5.hg19:g.141313856T>C	ENSP00000396225:p.Tyr317His	119.0	0.0	.		130.0	56.0	.	NM_001142603	Q969R4|Q96EU9	Missense_Mutation	SNP	ENST00000432126.2	hg19	CCDS4268.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.451431	0.84209	.	.	ENSG00000081791	ENST00000432126;ENST00000194118;ENST00000508751	T;T;T	0.58060	0.55;0.55;0.36	5.82	5.82	0.92795	Tetratricopeptide-like helical (1);	0.124431	0.56097	D	0.000025	T	0.68723	0.3032	L	0.61218	1.895	0.40580	D	0.981385	D	0.89917	1.0	D	0.91635	0.999	T	0.71862	-0.4464	10	0.59425	D	0.04	-18.5976	12.5686	0.56323	0.0:0.0:0.0:1.0	.	317	Q14154	DELE_HUMAN	H	317;317;311	ENSP00000396225:Y317H;ENSP00000194118:Y317H;ENSP00000422686:Y311H	ENSP00000194118:Y317H	Y	+	1	0	KIAA0141	141294040	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.534000	0.67167	2.217000	0.71921	0.533000	0.62120	TAC	.	.	.	none		0.597	KIAA0141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251863.2	NM_014773	
DHX16	8449	hgsc.bcm.edu	37	6	30638231	30638231	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr6:30638231C>G	ENST00000376442.3	-	4	817	c.622G>C	c.(622-624)Gct>Cct	p.A208P		NM_001164239.1|NM_003587.4	NP_001157711.1|NP_003578.2	O60231	DHX16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 16	208					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			kidney(2)|ovary(2)	4						CGCTTCTGAGCCTCTTCATAA	0.522																																					p.A208P		Atlas-SNP	.											.	DHX16	119	.	0			c.G622C						PASS	.						32.0	31.0	31.0					6																	30638231		1507	2708	4215	SO:0001583	missense	8449	exon4			TCTGAGCCTCTTC	AB001601	CCDS4685.1	6p21.3	2010-02-17	2003-06-13	2003-06-20	ENSG00000204560	ENSG00000204560		"""DEAH-boxes"""	2739	protein-coding gene	gene with protein product		603405	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 16"""	DDX16		9547260	Standard	NM_003587		Approved	DBP2, Prp2, PRPF2	uc003nqz.3	O60231	OTTHUMG00000031060	ENST00000376442.3:c.622G>C	chr6.hg19:g.30638231C>G	ENSP00000365625:p.Ala208Pro	58.0	0.0	.		45.0	12.0	.	NM_003587	O60322|Q5JP45|Q969X7|Q96QC1	Missense_Mutation	SNP	ENST00000376442.3	hg19	CCDS4685.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.624830	0.87560	.	.	ENSG00000204560	ENST00000376442;ENST00000415603	T;T	0.52295	0.67;0.67	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	T	0.64811	0.2632	M	0.85197	2.74	0.80722	D	1	D;B	0.76494	0.999;0.029	D;B	0.67103	0.949;0.04	T	0.65882	-0.6060	10	0.38643	T	0.18	.	17.0904	0.86620	0.0:1.0:0.0:0.0	.	148;208	B4DZ28;O60231	.;DHX16_HUMAN	P	208;148	ENSP00000365625:A208P;ENSP00000399101:A148P	ENSP00000365625:A208P	A	-	1	0	DHX16	30746210	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	6.452000	0.73485	2.560000	0.86352	0.455000	0.32223	GCT	.	.	.	none		0.522	DHX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076076.2	NM_003587	
NFYA	4800	hgsc.bcm.edu	37	6	41046900	41046900	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr6:41046900G>T	ENST00000341376.6	+	2	273	c.72G>T	c.(70-72)caG>caT	p.Q24H	OARD1_ENST00000480585.1_Intron|NFYA_ENST00000353205.5_Missense_Mutation_p.Q24H	NM_002505.4	NP_002496.1	P23511	NFYA_HUMAN	nuclear transcription factor Y, alpha	24	Gln-rich.				cellular lipid metabolic process (GO:0044255)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|small molecule metabolic process (GO:0044281)|transcription from RNA polymerase II promoter (GO:0006366)	CCAAT-binding factor complex (GO:0016602)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|large_intestine(4)|lung(2)|urinary_tract(1)	9	Ovarian(28;0.0418)|Colorectal(47;0.196)					AGATTCAGCAGCAGGTATGGA	0.443																																					p.Q24H		Atlas-SNP	.											.	NFYA	33	.	0			c.G72T						PASS	.						143.0	124.0	131.0					6																	41046900		2203	4300	6503	SO:0001583	missense	4800	exon2			TCAGCAGCAGGTA		CCDS4849.1, CCDS4850.1	6p21.3	2008-11-11			ENSG00000001167	ENSG00000001167			7804	protein-coding gene	gene with protein product		189903				1774067, 9612081	Standard	NM_002505		Approved	HAP2, CBF-B, NF-YA	uc003opo.3	P23511	OTTHUMG00000014669	ENST00000341376.6:c.72G>T	chr6.hg19:g.41046900G>T	ENSP00000345702:p.Gln24His	82.0	0.0	.		60.0	4.0	.	NM_002505	Q8IXU0	Missense_Mutation	SNP	ENST00000341376.6	hg19	CCDS4849.1	.	.	.	.	.	.	.	.	.	.	G	17.57	3.422564	0.62622	.	.	ENSG00000001167	ENST00000341376;ENST00000353205	.	.	.	6.17	4.38	0.52667	.	0.000000	0.85682	D	0.000000	T	0.56978	0.2022	L	0.44542	1.39	0.45883	D	0.998735	D;P	0.54397	0.966;0.943	P;D	0.66979	0.891;0.948	T	0.59952	-0.7357	9	0.46703	T	0.11	-3.2484	12.333	0.55049	0.1369:0.0:0.8631:0.0	.	24;24	P23511-2;P23511	.;NFYA_HUMAN	H	24	.	ENSP00000345702:Q24H	Q	+	3	2	NFYA	41154878	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.759000	0.38420	1.620000	0.50308	0.655000	0.94253	CAG	.	.	.	none		0.443	NFYA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040496.1		
PHF3	23469	hgsc.bcm.edu	37	6	64395141	64395141	+	Silent	SNP	G	G	A	rs149984169		TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr6:64395141G>A	ENST00000262043.3	+	4	1858	c.1518G>A	c.(1516-1518)ccG>ccA	p.P506P	PHF3_ENST00000393387.1_Silent_p.P506P|PHF3_ENST00000509330.1_Silent_p.P506P			Q92576	PHF3_HUMAN	PHD finger protein 3	506					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(7)|cervix(2)|endometrium(8)|kidney(7)|large_intestine(18)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(6)	75	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			CAGATGCTCCGAAGAAAATTG	0.343																																					p.P506P	GBM(135;136 1820 29512 34071 46235)	Atlas-SNP	.											PHF3,NS,carcinoma,0,2	PHF3	191	.	0			c.G1518A						PASS	.						40.0	43.0	42.0					6																	64395141		2203	4297	6500	SO:0001819	synonymous_variant	23469	exon3			TGCTCCGAAGAAA	AF091622	CCDS4966.1	6q12	2013-09-24			ENSG00000118482	ENSG00000118482		"""Zinc fingers, PHD-type"""	8921	protein-coding gene	gene with protein product		607789				11856869	Standard	XM_005248701		Approved		uc003pep.1	Q92576	OTTHUMG00000014952	ENST00000262043.3:c.1518G>A	chr6.hg19:g.64395141G>A		336.0	0.0	.		298.0	114.0	.	NM_015153	A3KFI8|Q14CR5|Q5CZI1|Q5T1T6|Q9NQ16|Q9UI45	Silent	SNP	ENST00000262043.3	hg19	CCDS4966.1																																																																																			.	G|1.000;T|0.000	.	alt		0.343	PHF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041086.2		
OGFRL1	79627	hgsc.bcm.edu	37	6	72011551	72011551	+	Silent	SNP	C	C	T			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr6:72011551C>T	ENST00000370435.4	+	7	1289	c.1155C>T	c.(1153-1155)agC>agT	p.S385S	RP11-154D6.1_ENST00000423255.1_RNA|RP11-154D6.1_ENST00000587253.1_RNA|RP3-331H24.5_ENST00000602823.1_lincRNA|RP11-154D6.1_ENST00000412751.1_RNA|RP11-154D6.1_ENST00000591156.1_RNA|RP11-154D6.1_ENST00000585882.1_RNA|RP11-154D6.1_ENST00000587036.1_RNA|RP11-154D6.1_ENST00000587397.1_RNA|RP11-154D6.1_ENST00000588612.1_RNA|RP11-154D6.1_ENST00000586232.1_RNA|RP11-154D6.1_ENST00000432050.1_RNA|RP11-154D6.1_ENST00000450998.1_RNA|RP11-154D6.1_ENST00000586030.1_RNA	NM_024576.3	NP_078852.3	Q5TC84	OGRL1_HUMAN	opioid growth factor receptor-like 1	385						membrane (GO:0016020)	receptor activity (GO:0004872)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|upper_aerodigestive_tract(1)	13						CAGAGCCCAGCAATGAAGCTG	0.453																																					p.S385S		Atlas-SNP	.											.	OGFRL1	44	.	0			c.C1155T						PASS	.						51.0	58.0	56.0					6																	72011551		2203	4300	6503	SO:0001819	synonymous_variant	79627	exon7			GCCCAGCAATGAA		CCDS34482.1	6q13	2008-02-05			ENSG00000119900	ENSG00000119900			21378	protein-coding gene	gene with protein product							Standard	NM_024576		Approved	dJ331H24.1	uc003pfx.1	Q5TC84	OTTHUMG00000015000	ENST00000370435.4:c.1155C>T	chr6.hg19:g.72011551C>T		398.0	0.0	.		387.0	153.0	.	NM_024576	Q2TAC1|Q8NEQ4|Q9H7B5	Silent	SNP	ENST00000370435.4	hg19	CCDS34482.1																																																																																			.	.	.	none		0.453	OGFRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041153.2	NM_024576	
MYO6	4646	hgsc.bcm.edu	37	6	76621412	76621412	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr6:76621412T>G	ENST00000369977.3	+	33	3575	c.3436T>G	c.(3436-3438)Tca>Gca	p.S1146A	MYO6_ENST00000369985.4_Missense_Mutation_p.S1123A|MYO6_ENST00000369981.3_Intron|MYO6_ENST00000369975.1_Intron	NM_004999.3	NP_004990.3	Q9UM54	MYO6_HUMAN	myosin VI	1155					actin filament-based movement (GO:0030048)|auditory receptor cell differentiation (GO:0042491)|cellular response to electrical stimulus (GO:0071257)|dendrite development (GO:0016358)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|endocytosis (GO:0006897)|glutamate secretion (GO:0014047)|inner ear morphogenesis (GO:0042472)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein targeting (GO:0006605)|regulation of secretion (GO:0051046)|regulation of synaptic plasticity (GO:0048167)|response to drug (GO:0042493)|sensory perception of sound (GO:0007605)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell cortex (GO:0005938)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microvillus (GO:0005902)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|unconventional myosin complex (GO:0016461)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|minus-end directed microfilament motor activity (GO:0060001)|motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(16)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	58		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		TTTGAACAATTCACGTAAGTC	0.279																																					p.S1146A		Atlas-SNP	.											.	MYO6	124	.	0			c.T3436G						PASS	.						80.0	79.0	79.0					6																	76621412		2203	4298	6501	SO:0001583	missense	4646	exon33			AACAATTCACGTA	U90236, AB002387	CCDS34487.1, CCDS75481.1	6q14.1	2014-09-17	2004-05-19		ENSG00000196586	ENSG00000196586		"""Myosins / Myosin superfamily : Class VI"""	7605	protein-coding gene	gene with protein product		600970	"""deafness, autosomal recessive 37"""	DFNA22, DFNB37		9259267, 11468689	Standard	XM_005248719		Approved	KIAA0389	uc003pih.1	Q9UM54	OTTHUMG00000015061	ENST00000369977.3:c.3436T>G	chr6.hg19:g.76621412T>G	ENSP00000358994:p.Ser1146Ala	446.0	0.0	.		325.0	137.0	.	NM_004999	A6H8V4|E1P540|Q5TEM5|Q5TEM6|Q5TEM7|Q9BZZ7|Q9UEG2	Missense_Mutation	SNP	ENST00000369977.3	hg19	CCDS34487.1	.	.	.	.	.	.	.	.	.	.	T	5.623	0.299601	0.10622	.	.	ENSG00000196586	ENST00000428345;ENST00000369985;ENST00000369977	D;T	0.88586	-2.4;-1.05	5.93	4.78	0.61160	.	0.536594	0.18535	N	0.138382	T	0.50171	0.1600	N	0.01352	-0.895	0.80722	D	1	B;B	0.24768	0.0;0.111	B;B	0.25405	0.0;0.06	T	0.57556	-0.7791	10	0.07644	T	0.81	.	8.5494	0.33442	0.0:0.0681:0.1314:0.8005	.	1123;1146	Q9UM54-2;Q9UM54-1	.;.	A	1156;1123;1146	ENSP00000359002:S1123A;ENSP00000358994:S1146A	ENSP00000358994:S1146A	S	+	1	0	MYO6	76678132	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.427000	0.44740	2.270000	0.75569	0.460000	0.39030	TCA	.	.	.	none		0.279	MYO6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041279.2	NM_004999	
SLC2A12	154091	hgsc.bcm.edu	37	6	134350058	134350058	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr6:134350058G>A	ENST00000275230.5	-	2	1060	c.905C>T	c.(904-906)tCa>tTa	p.S302L		NM_145176.2	NP_660159.1	Q8TD20	GTR12_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 12	302					glucose transport (GO:0015758)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			NS(1)|breast(1)|large_intestine(6)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	17	Breast(56;0.214)|Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0101)|GBM - Glioblastoma multiforme(68;0.0123)		CAAAACAGTTGATGCATAGAA	0.438																																					p.S302L	Melanoma(122;1663 1672 14489 35294 41228)	Atlas-SNP	.											.	SLC2A12	43	.	0			c.C905T						PASS	.						78.0	71.0	73.0					6																	134350058		2203	4300	6503	SO:0001583	missense	154091	exon2			ACAGTTGATGCAT	AL035699	CCDS5169.1	6q23.2	2013-05-22			ENSG00000146411	ENSG00000146411		"""Solute carriers"""	18067	protein-coding gene	gene with protein product		610372				11780753, 11832379	Standard	XM_006715349		Approved	GLUT12, GLUT8	uc003qem.1	Q8TD20	OTTHUMG00000015611	ENST00000275230.5:c.905C>T	chr6.hg19:g.134350058G>A	ENSP00000275230:p.Ser302Leu	114.0	0.0	.		109.0	50.0	.	NM_145176	B3KV17|Q7Z6U3|Q96MR8	Missense_Mutation	SNP	ENST00000275230.5	hg19	CCDS5169.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.418468	0.83559	.	.	ENSG00000146411	ENST00000275230	T	0.81163	-1.46	5.16	5.16	0.70880	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.89164	0.6637	M	0.82923	2.615	0.80722	D	1	D	0.69078	0.997	D	0.70227	0.968	D	0.90629	0.4565	10	0.87932	D	0	-11.8076	18.6483	0.91419	0.0:0.0:1.0:0.0	.	302	Q8TD20	GTR12_HUMAN	L	302	ENSP00000275230:S302L	ENSP00000275230:S302L	S	-	2	0	SLC2A12	134391751	1.000000	0.71417	0.979000	0.43373	0.931000	0.56810	9.476000	0.97823	2.426000	0.82243	0.467000	0.42956	TCA	.	.	.	none		0.438	SLC2A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042302.1		
SGK1	6446	hgsc.bcm.edu	37	6	134495179	134495179	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr6:134495179C>A	ENST00000237305.7	-	3	280	c.192G>T	c.(190-192)caG>caT	p.Q64H	SGK1_ENST00000367858.5_Missense_Mutation_p.Q159H|SGK1_ENST00000489458.2_5'UTR|SGK1_ENST00000475719.2_Missense_Mutation_p.Q64H|SGK1_ENST00000528577.1_Missense_Mutation_p.Q92H|SGK1_ENST00000367857.5_Missense_Mutation_p.Q54H|SGK1_ENST00000413996.3_Missense_Mutation_p.Q78H	NM_005627.3	NP_005618.2	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1	64					apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|ion transmembrane transport (GO:0034220)|long-term memory (GO:0007616)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of gastric acid secretion (GO:0060453)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|renal sodium ion absorption (GO:0070294)|response to stress (GO:0006950)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|sodium channel regulator activity (GO:0017080)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(21)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(4)|stomach(1)	46	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		GCTCAGGCTCCTGAGGTTGGG	0.493																																					p.Q159H		Atlas-SNP	.											.	SGK1	387	.	0			c.G477T						PASS	.						146.0	139.0	141.0					6																	134495179		2203	4300	6503	SO:0001583	missense	6446	exon5			AGGCTCCTGAGGT	AJ000512	CCDS5170.1, CCDS47476.1, CCDS47477.1, CCDS47478.1	6q23	2008-02-05	2007-12-05	2007-12-05	ENSG00000118515	ENSG00000118515			10810	protein-coding gene	gene with protein product		602958	"""serum/glucocorticoid regulated kinase"""	SGK		9114008, 9722955	Standard	NM_005627		Approved		uc003qeo.4	O00141	OTTHUMG00000015613	ENST00000237305.7:c.192G>T	chr6.hg19:g.134495179C>A	ENSP00000237305:p.Gln64His	138.0	0.0	.		107.0	41.0	.	NM_001143676	B7UUP7|B7UUP8|B7UUP9|B7Z5B2|E1P583|Q5TCN2|Q5TCN3|Q5TCN4|Q5VY65|Q9UN56	Missense_Mutation	SNP	ENST00000237305.7	hg19	CCDS5170.1	.	.	.	.	.	.	.	.	.	.	C	15.59	2.879434	0.51801	.	.	ENSG00000118515	ENST00000367858;ENST00000413996;ENST00000237305;ENST00000367857;ENST00000528577;ENST00000475719;ENST00000461976	T;T;T;T;T;T	0.73258	-0.73;-0.71;-0.72;-0.72;-0.71;-0.73	5.99	2.79	0.32731	.	0.000000	0.85682	D	0.000000	T	0.55465	0.1922	L	0.59436	1.845	0.80722	D	1	B;D;B;B;B;B	0.54964	0.018;0.969;0.013;0.001;0.018;0.006	B;P;B;B;B;B	0.47981	0.021;0.563;0.009;0.008;0.037;0.006	T	0.59632	-0.7418	10	0.62326	D	0.03	.	5.6053	0.17377	0.0:0.383:0.0:0.617	.	92;78;64;54;159;64	O00141-5;O00141-3;E9PR89;O00141-4;O00141-2;O00141	.;.;.;.;.;SGK1_HUMAN	H	159;78;64;54;92;64;128	ENSP00000356832:Q159H;ENSP00000396242:Q78H;ENSP00000237305:Q64H;ENSP00000356831:Q54H;ENSP00000434450:Q92H;ENSP00000434302:Q64H	ENSP00000237305:Q64H	Q	-	3	2	SGK1	134536872	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.913000	0.39956	0.797000	0.33971	0.655000	0.94253	CAG	.	.	.	none		0.493	SGK1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042312.2		
AUTS2	26053	hgsc.bcm.edu	37	7	70239070	70239070	+	Silent	SNP	C	C	T	rs143201197		TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr7:70239070C>T	ENST00000342771.4	+	12	2208	c.1887C>T	c.(1885-1887)ctC>ctT	p.L629L	AUTS2_ENST00000406775.2_Intron	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	629										breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		ACACTTTACTCCAAAAGGACC	0.527																																					p.L629L		Atlas-SNP	.											.	AUTS2	173	.	0			c.C1887T						PASS	.						123.0	96.0	105.0					7																	70239070		2203	4300	6503	SO:0001819	synonymous_variant	26053	exon12			TTTACTCCAAAAG	AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.1887C>T	chr7.hg19:g.70239070C>T		103.0	0.0	.		137.0	58.0	.	NM_015570	A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Silent	SNP	ENST00000342771.4	hg19	CCDS5539.1	.	.	.	.	.	.	.	.	.	.	C	7.138	0.581166	0.13686	.	.	ENSG00000158321	ENST00000443672	.	.	.	6.06	-4.78	0.03209	.	.	.	.	.	T	0.35913	0.0948	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.36114	-0.9761	4	.	.	.	-37.1785	1.0348	0.01546	0.1989:0.2867:0.2715:0.2428	.	.	.	.	F	156	.	.	S	+	2	0	AUTS2	69877006	0.606000	0.26949	0.424000	0.26647	0.944000	0.59088	-0.128000	0.10531	-0.883000	0.03982	-2.134000	0.00341	TCC	.	C|1.000;G|0.000	.	alt		0.527	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251971.2		
TFR2	7036	hgsc.bcm.edu	37	7	100238449	100238449	+	Silent	SNP	G	G	A			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr7:100238449G>A	ENST00000462107.1	-	4	620	c.333C>T	c.(331-333)tgC>tgT	p.C111C	TFR2_ENST00000431692.1_Silent_p.C111C|TFR2_ENST00000223051.3_Silent_p.C111C			Q9UP52	TFR2_HUMAN	transferrin receptor 2	111					cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transferrin receptor activity (GO:0004998)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)				Gallium nitrate(DB05260)	CAGAGTCTCCGCACGCCTGGC	0.592																																					p.C111C		Atlas-SNP	.											.	TFR2	53	.	0			c.C333T						PASS	.						68.0	63.0	64.0					7																	100238449		2203	4300	6503	SO:0001819	synonymous_variant	7036	exon3			GTCTCCGCACGCC	AF053356	CCDS34707.1	7q22	2003-01-27			ENSG00000106327	ENSG00000106327			11762	protein-coding gene	gene with protein product		604720				9799793, 12130528	Standard	NM_003227		Approved	HFE3, TFRC2	uc003uvv.1	Q9UP52	OTTHUMG00000159598	ENST00000462107.1:c.333C>T	chr7.hg19:g.100238449G>A		110.0	0.0	.		169.0	78.0	.	NM_003227	A6NGM7|O75422|Q1HE13|Q9HA99|Q9NX67	Silent	SNP	ENST00000462107.1	hg19	CCDS34707.1																																																																																			.	.	.	none		0.592	TFR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356392.3	NM_003227	
AASS	10157	hgsc.bcm.edu	37	7	121755193	121755193	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr7:121755193C>G	ENST00000393376.1	-	8	1073	c.978G>C	c.(976-978)caG>caC	p.Q326H	AASS_ENST00000473553.1_Intron|AASS_ENST00000417368.2_Missense_Mutation_p.Q326H			Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase	326	Lysine-ketoglutarate reductase.				cellular nitrogen compound metabolic process (GO:0034641)|L-lysine catabolic process to acetyl-CoA via saccharopine (GO:0033512)|lysine catabolic process (GO:0006554)|protein tetramerization (GO:0051262)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity (GO:0047131)|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity (GO:0047130)			autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(6)|large_intestine(12)|lung(27)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	54						CCAGGAGACTCTGAGCATCTT	0.483																																					p.Q326H		Atlas-SNP	.											.	AASS	123	.	0			c.G978C						PASS	.						125.0	117.0	120.0					7																	121755193		2203	4300	6503	SO:0001583	missense	10157	exon9			GAGACTCTGAGCA	AF229180	CCDS5783.1	7q31.3	2010-12-14			ENSG00000008311	ENSG00000008311			17366	protein-coding gene	gene with protein product		605113				10775527	Standard	NM_005763		Approved	LORSDH, LKRSDH	uc003vkb.3	Q9UDR5	OTTHUMG00000157058	ENST00000393376.1:c.978G>C	chr7.hg19:g.121755193C>G	ENSP00000377040:p.Gln326His	139.0	0.0	.		208.0	87.0	.	NM_005763	O95462	Missense_Mutation	SNP	ENST00000393376.1	hg19	CCDS5783.1	.	.	.	.	.	.	.	.	.	.	C	18.81	3.702335	0.68501	.	.	ENSG00000008311	ENST00000393376;ENST00000417368	D;D	0.83755	-1.76;-1.76	5.68	1.33	0.21861	Alanine dehydrogenase/PNT, C-terminal (1);	0.051519	0.85682	D	0.000000	D	0.87549	0.6205	M	0.83483	2.645	0.54753	D	0.999989	P	0.45428	0.858	P	0.54312	0.748	D	0.85721	0.1325	10	0.72032	D	0.01	-9.2803	9.477	0.38878	0.0:0.6502:0.0:0.3498	.	326	Q9UDR5	AASS_HUMAN	H	326	ENSP00000377040:Q326H;ENSP00000403768:Q326H	ENSP00000351834:Q326H	Q	-	3	2	AASS	121542429	1.000000	0.71417	0.995000	0.50966	0.983000	0.72400	1.188000	0.32102	-0.038000	0.13624	-0.142000	0.14014	CAG	.	.	.	none		0.483	AASS-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347300.1	NM_005763	
ZNF467	168544	hgsc.bcm.edu	37	7	149462502	149462502	+	Silent	SNP	G	G	A			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr7:149462502G>A	ENST00000302017.3	-	5	1502	c.1089C>T	c.(1087-1089)agC>agT	p.S363S	ZNF467_ENST00000484747.1_Intron	NM_207336.1	NP_997219.1	Q7Z7K2	ZN467_HUMAN	zinc finger protein 467	363					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(2)|liver(1)|lung(7)|urinary_tract(1)	13	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			TCCAGCCGAAGCTCAAGCCGC	0.657																																					p.S363S		Atlas-SNP	.											.	ZNF467	50	.	0			c.C1089T						PASS	.						12.0	13.0	12.0					7																	149462502		2181	4279	6460	SO:0001819	synonymous_variant	168544	exon5			GCCGAAGCTCAAG	BC029296	CCDS5899.1	7q36.1	2013-01-08			ENSG00000181444	ENSG00000181444		"""Zinc fingers, C2H2-type"""	23154	protein-coding gene	gene with protein product		614040				12426389	Standard	NM_207336		Approved	EZI, Zfp467	uc003wgd.2	Q7Z7K2	OTTHUMG00000157883	ENST00000302017.3:c.1089C>T	chr7.hg19:g.149462502G>A		163.0	0.0	.		287.0	136.0	.	NM_207336		Silent	SNP	ENST00000302017.3	hg19	CCDS5899.1																																																																																			.	.	.	none		0.657	ZNF467-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349833.1	NM_207336	
BLK	640	hgsc.bcm.edu	37	8	11412365	11412365	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr8:11412365C>T	ENST00000259089.4	+	7	1178	c.586C>T	c.(586-588)Ccc>Tcc	p.P196S	RP11-148O21.4_ENST00000528629.1_RNA|RP11-148O21.3_ENST00000527922.1_RNA|BLK_ENST00000529894.1_Missense_Mutation_p.P125S|RP11-148O21.6_ENST00000602626.1_lincRNA	NM_001715.2	NP_001706.2	P51451	BLK_HUMAN	BLK proto-oncogene, Src family tyrosine kinase	196	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				B cell receptor signaling pathway (GO:0050853)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of insulin secretion (GO:0032024)	plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			endometrium(1)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|skin(4)|stomach(1)	27			STAD - Stomach adenocarcinoma(15;0.00391)	COAD - Colon adenocarcinoma(149;0.207)		GATCACCTTCCCCTCGCTCCA	0.587																																					p.P196S		Atlas-SNP	.											.	BLK	78	.	0			c.C586T						PASS	.						45.0	42.0	43.0					8																	11412365		2203	4300	6503	SO:0001583	missense	640	exon7			ACCTTCCCCTCGC	BC004473	CCDS5982.1	8p23-p22	2014-06-25	2014-06-25		ENSG00000136573	ENSG00000136573		"""SH2 domain containing"""	1057	protein-coding gene	gene with protein product		191305	"""B lymphoid tyrosine kinase"""			7845672	Standard	NM_001715		Approved	MGC10442	uc003wty.3	P51451	OTTHUMG00000090729	ENST00000259089.4:c.586C>T	chr8.hg19:g.11412365C>T	ENSP00000259089:p.Pro196Ser	25.0	0.0	.		24.0	13.0	.	NM_001715	Q16291|Q96IN1	Missense_Mutation	SNP	ENST00000259089.4	hg19	CCDS5982.1	.	.	.	.	.	.	.	.	.	.	C	9.081	0.999208	0.19121	.	.	ENSG00000136573	ENST00000259089;ENST00000427279;ENST00000529894	T;T	0.25085	1.82;1.82	4.57	4.57	0.56435	SH2 motif (5);	0.171825	0.27807	N	0.017777	T	0.13543	0.0328	N	0.20986	0.625	0.80722	D	1	B	0.13594	0.008	B	0.25405	0.06	T	0.11941	-1.0567	10	0.07482	T	0.82	.	5.3329	0.15942	0.0:0.6497:0.1766:0.1737	.	196	P51451	BLK_HUMAN	S	196;196;125	ENSP00000259089:P196S;ENSP00000433663:P125S	ENSP00000259089:P196S	P	+	1	0	BLK	11449774	0.000000	0.05858	1.000000	0.80357	0.969000	0.65631	-0.136000	0.10405	2.249000	0.74217	0.462000	0.41574	CCC	.	.	.	none		0.587	BLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207460.1		
ASPH	444	hgsc.bcm.edu	37	8	62556523	62556523	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr8:62556523C>A	ENST00000379454.4	-	8	877	c.690G>T	c.(688-690)atG>atT	p.M230I	ASPH_ENST00000517847.2_Missense_Mutation_p.M216I|ASPH_ENST00000445642.3_Missense_Mutation_p.M216I|ASPH_ENST00000522919.1_Missense_Mutation_p.M43I|ASPH_ENST00000541428.1_Missense_Mutation_p.M201I|ASPH_ENST00000522835.1_Missense_Mutation_p.M173I|ASPH_ENST00000517903.1_Missense_Mutation_p.M216I|ASPH_ENST00000523897.1_5'Flank|ASPH_ENST00000356457.5_Missense_Mutation_p.M230I|ASPH_ENST00000518068.1_Missense_Mutation_p.M187I	NM_004318.3	NP_004309.2	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase	230	Glu-rich.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular response to calcium ion (GO:0071277)|detection of calcium ion (GO:0005513)|face morphogenesis (GO:0060325)|limb morphogenesis (GO:0035108)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|palate development (GO:0060021)|pattern specification process (GO:0007389)|peptidyl-aspartic acid hydroxylation (GO:0042264)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of proteolysis (GO:0045862)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|regulation of protein depolymerization (GO:1901879)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|response to ATP (GO:0033198)	calcium channel complex (GO:0034704)|cortical endoplasmic reticulum (GO:0032541)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|electron carrier activity (GO:0009055)|ion channel binding (GO:0044325)|peptide-aspartate beta-dioxygenase activity (GO:0004597)|structural constituent of muscle (GO:0008307)|structural molecule activity (GO:0005198)			breast(1)|cervix(1)|endometrium(5)|large_intestine(5)|lung(16)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	CCTGCTCAGACATCATCTCTT	0.328																																					p.M230I		Atlas-SNP	.											.	ASPH	87	.	0			c.G690T						PASS	.						80.0	77.0	78.0					8																	62556523		2202	4298	6500	SO:0001583	missense	444	exon8			CTCAGACATCATC	AF224468	CCDS34898.1, CCDS34899.1, CCDS34900.1, CCDS43742.1, CCDS47866.1, CCDS55234.1, CCDS55235.1, CCDS55236.1, CCDS55237.1, CCDS55238.1, CCDS75746.1	8q12.1	2008-02-05			ENSG00000198363	ENSG00000198363	1.14.11.16		757	protein-coding gene	gene with protein product	"""junctin"", ""humbug"", ""junctate"""	600582				7821814, 10974562	Standard	NM_004318		Approved	CASQ2BP1, BAH, JCTN, HAAH	uc003xuj.3	Q12797	OTTHUMG00000164375	ENST00000379454.4:c.690G>T	chr8.hg19:g.62556523C>A	ENSP00000368767:p.Met230Ile	157.0	0.0	.		145.0	69.0	.	NM_032466	A6NDF4|A6NHI2|B4DIC9|B4E2K4|B7ZM95|E5RGP5|F5H667|Q6NXR7|Q8TB28|Q9H291|Q9H2C4|Q9NRI0|Q9NRI1|Q9Y4J0	Missense_Mutation	SNP	ENST00000379454.4	hg19	CCDS34898.1	.	.	.	.	.	.	.	.	.	.	C	0.036	-1.308824	0.01342	.	.	ENSG00000198363	ENST00000541428;ENST00000379454;ENST00000522919;ENST00000356457;ENST00000519234;ENST00000518068;ENST00000517903;ENST00000445642;ENST00000517847;ENST00000522835	T;T;T;T;T;T;T;T;T;T	0.55234	0.53;0.53;0.53;0.53;0.53;0.53;0.53;0.53;0.53;0.53	5.22	-3.83	0.04269	Aspartyl beta-hydroxylase/Triadin domain (1);	1.348970	0.04759	N	0.425950	T	0.40815	0.1132	L	0.40543	1.245	0.09310	N	1	B;B;B;B;B;B;B	0.13145	0.0;0.0;0.0;0.007;0.0;0.0;0.0	B;B;B;B;B;B;B	0.12837	0.003;0.002;0.002;0.008;0.001;0.002;0.003	T	0.30592	-0.9973	10	0.40728	T	0.16	0.7054	7.006	0.24836	0.1179:0.3434:0.0:0.5387	.	173;216;201;187;230;216;230	B4DIC9;B7ZM95;F5H667;Q8TB28;Q12797-2;Q9H291;Q12797	.;.;.;.;.;.;ASPH_HUMAN	I	201;230;43;230;245;187;216;216;216;173	ENSP00000437864:M201I;ENSP00000368767:M230I;ENSP00000430516:M43I;ENSP00000348841:M230I;ENSP00000427823:M245I;ENSP00000429286:M187I;ENSP00000430245:M216I;ENSP00000394013:M216I;ENSP00000429954:M216I;ENSP00000429160:M173I	ENSP00000348841:M230I	M	-	3	0	ASPH	62719077	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-2.322000	0.01118	-0.795000	0.04462	-0.895000	0.02911	ATG	.	.	.	none		0.328	ASPH-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378510.3	NM_004318	
PYCRL	65263	hgsc.bcm.edu	37	8	144689268	144689268	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr8:144689268T>G	ENST00000220966.6	-	3	256	c.227A>C	c.(226-228)gAg>gCg	p.E76A	PYCRL_ENST00000377579.3_5'UTR|PYCRL_ENST00000495276.1_5'UTR	NM_023078.3	NP_075566.2	Q53H96	P5CR3_HUMAN	pyrroline-5-carboxylate reductase-like	64					L-proline biosynthetic process (GO:0055129)		pyrroline-5-carboxylate reductase activity (GO:0004735)			central_nervous_system(1)|endometrium(1)|lung(2)|ovary(1)	5	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.17e-38)|Epithelial(56;7.17e-37)|all cancers(56;2.46e-32)|Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)		L-Proline(DB00172)	CTGCAGCACCTCCTGGTTGGA	0.632																																					p.E76A		Atlas-SNP	.											.	PYCRL	14	.	0			c.A227C						PASS	.						46.0	38.0	41.0					8																	144689268		2202	4294	6496	SO:0001583	missense	65263	exon3			AGCACCTCCTGGT	AF086378	CCDS6407.2	8q24.3	2011-09-30	2011-09-30	2011-09-30	ENSG00000104524	ENSG00000104524			25846	protein-coding gene	gene with protein product							Standard	NM_023078		Approved	FLJ13852	uc003yyy.3	Q53H96	OTTHUMG00000157010	ENST00000220966.6:c.227A>C	chr8.hg19:g.144689268T>G	ENSP00000220966:p.Glu76Ala	114.0	0.0	.		112.0	46.0	.	NM_023078	B3KMB5|B4DVT6|H0Y6C3|Q8N3N9|Q96HX4|Q9H896	Missense_Mutation	SNP	ENST00000220966.6	hg19	CCDS6407.2	.	.	.	.	.	.	.	.	.	.	T	17.02	3.280808	0.59758	.	.	ENSG00000104524	ENST00000220966;ENST00000433751	T;T	0.68181	-0.31;-0.31	4.67	4.67	0.58626	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.70395	0.3219	L	0.41124	1.26	0.80722	D	1	D;P	0.63046	0.992;0.934	D;P	0.63283	0.913;0.677	T	0.72001	-0.4422	10	0.59425	D	0.04	-26.6107	9.3378	0.38060	0.0:0.0:0.1806:0.8194	.	76;64	D3DWK4;Q53H96	.;P5CR3_HUMAN	A	76;71	ENSP00000220966:E76A;ENSP00000404493:E71A	ENSP00000220966:E76A	E	-	2	0	PYCRL	144760411	1.000000	0.71417	1.000000	0.80357	0.757000	0.42996	4.821000	0.62679	1.743000	0.51761	0.379000	0.24179	GAG	.	.	.	none		0.632	PYCRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347081.2	NM_023078	
UNC13B	10497	hgsc.bcm.edu	37	9	35396502	35396502	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr9:35396502G>A	ENST00000378495.3	+	26	3313	c.3091G>A	c.(3091-3093)Gct>Act	p.A1031T	UNC13B_ENST00000378496.4_Missense_Mutation_p.A1031T|UNC13B_ENST00000396787.1_Missense_Mutation_p.A1043T	NM_006377.3	NP_006368.3	O14795	UN13B_HUMAN	unc-13 homolog B (C. elegans)	1031	MHD1. {ECO:0000255|PROSITE- ProRule:PRU00587}.				apoptotic process (GO:0006915)|excretion (GO:0007588)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synaptic vesicle priming (GO:0010808)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|terminal bouton (GO:0043195)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(16)|liver(2)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			GTGTAAAAGTGCTGACTACAT	0.552																																					p.A1031T		Atlas-SNP	.											.	UNC13B	153	.	0			c.G3091A						PASS	.						112.0	91.0	98.0					9																	35396502		2203	4300	6503	SO:0001583	missense	10497	exon26			AAAAGTGCTGACT	AF020202	CCDS6579.1	9p13.3	2008-05-15	2003-10-17	2003-10-17	ENSG00000198722	ENSG00000198722			12566	protein-coding gene	gene with protein product		605836	"""unc-13-like (C. elegans)"""	UNC13		9607201	Standard	NM_006377		Approved	hmunc13, Unc13h2	uc003zwq.3	O14795	OTTHUMG00000019856	ENST00000378495.3:c.3091G>A	chr9.hg19:g.35396502G>A	ENSP00000367756:p.Ala1031Thr	78.0	0.0	.		65.0	31.0	.	NM_006377	Q5VYM8	Missense_Mutation	SNP	ENST00000378495.3	hg19	CCDS6579.1	.	.	.	.	.	.	.	.	.	.	G	14.33	2.503565	0.44558	.	.	ENSG00000198722	ENST00000396787;ENST00000378495;ENST00000378496;ENST00000535471	D;D;D	0.84146	-1.68;-1.62;-1.81	4.95	4.95	0.65309	Munc13 homology 1 (1);	0.095455	0.64402	D	0.000001	T	0.70020	0.3176	N	0.10972	0.075	0.51482	D	0.999927	B;B	0.32365	0.367;0.007	B;B	0.28232	0.087;0.014	T	0.70142	-0.4953	10	0.06625	T	0.88	-13.5866	18.3726	0.90412	0.0:0.0:1.0:0.0	.	1031;1031	F8W8M9;O14795	.;UN13B_HUMAN	T	1043;1031;1031;618	ENSP00000380006:A1043T;ENSP00000367756:A1031T;ENSP00000367757:A1031T	ENSP00000367756:A1031T	A	+	1	0	UNC13B	35386502	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	6.120000	0.71596	2.561000	0.86390	0.563000	0.77884	GCT	.	.	.	none		0.552	UNC13B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052296.1	NM_006377	
ECM2	1842	hgsc.bcm.edu	37	9	95272295	95272295	+	Silent	SNP	A	A	G			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr9:95272295A>G	ENST00000344604.5	-	6	1341	c.1192T>C	c.(1192-1194)Ttg>Ctg	p.L398L	ECM2_ENST00000444490.2_Silent_p.L376L|CENPP_ENST00000375587.3_Intron	NM_001197295.1|NM_001393.3	NP_001184224.1|NP_001384.1	O94769	ECM2_HUMAN	extracellular matrix protein 2, female organ and adipocyte specific	398					cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	interstitial matrix (GO:0005614)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27						TCCATATTCAAACGCATTAAC	0.333																																					p.L398L		Atlas-SNP	.											.	ECM2	147	.	0			c.T1192C						PASS	.						81.0	80.0	80.0					9																	95272295		2201	4298	6499	SO:0001819	synonymous_variant	1842	exon6			TATTCAAACGCAT	AB011792	CCDS6698.1, CCDS56578.1	9q22.3	2008-07-21			ENSG00000106823	ENSG00000106823			3154	protein-coding gene	gene with protein product	"""matrix glycoprotein SC1/ECM2"""	603479				9790758	Standard	NM_001393		Approved		uc011lty.2	O94769	OTTHUMG00000020226	ENST00000344604.5:c.1192T>C	chr9.hg19:g.95272295A>G		72.0	0.0	.		76.0	4.0	.	NM_001393	B2R730|E2PU11|Q5T9F2|Q7Z3D0	Silent	SNP	ENST00000344604.5	hg19	CCDS6698.1																																																																																			.	.	.	none		0.333	ECM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053091.1	NM_001393	
ERCC6L2	375748	hgsc.bcm.edu	37	9	98684631	98684631	+	Silent	SNP	C	C	T			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr9:98684631C>T	ENST00000288985.7	+	8	1682	c.1377C>T	c.(1375-1377)taC>taT	p.Y459Y	ERCC6L2_ENST00000437817.1_Silent_p.Y270Y|ERCC6L2_ENST00000466840.1_3'UTR	NM_001010895.2	NP_001010895.1	Q5T890	ER6L2_HUMAN	excision repair cross-complementation group 6-like 2	459					DNA repair (GO:0006281)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)										ATCTCAGTTACCTTACAGTCC	0.393																																					p.Y459Y		Atlas-SNP	.											.	.	.	.	0			c.C1377T						PASS	.						101.0	89.0	93.0					9																	98684631		2203	4300	6503	SO:0001819	synonymous_variant	375748	exon8			CAGTTACCTTACA	BC022957	CCDS35072.1	9q22.32	2014-03-07	2014-03-07	2012-03-30	ENSG00000182150	ENSG00000182150			26922	protein-coding gene	gene with protein product		615667	"""chromosome 9 open reading frame 102"", ""excision repair cross-complementing rodent repair deficiency, complementation group 6-like 2"""	C9orf102			Standard	NM_001010895		Approved	FLJ37706, RAD26L	uc004avt.4	Q5T890	OTTHUMG00000020289	ENST00000288985.7:c.1377C>T	chr9.hg19:g.98684631C>T		71.0	0.0	.		52.0	18.0	.	NM_001010895	A4D997|B2RTP8|Q49AM9|Q5T892|Q8N663|Q8N9D0|Q9NPM7	Silent	SNP	ENST00000288985.7	hg19	CCDS35072.1																																																																																			.	.	.	none		0.393	ERCC6L2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000053247.2	NM_001010895	
DDX31	64794	hgsc.bcm.edu	37	9	135505682	135505682	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr9:135505682A>G	ENST00000372159.3	-	16	2066	c.1915T>C	c.(1915-1917)Tat>Cat	p.Y639H	DDX31_ENST00000372153.1_Silent_p.N630N|DDX31_ENST00000438527.3_Missense_Mutation_p.Y510H	NM_022779.7	NP_073616.6	Q9H8H2	DDX31_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 31	639	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(1)	27				OV - Ovarian serous cystadenocarcinoma(145;2.67e-06)|Epithelial(140;7.61e-05)		GAGTTGACATATTCTGCCTCC	0.493																																					p.Y639H		Atlas-SNP	.											.	DDX31	76	.	0			c.T1915C						PASS	.						118.0	125.0	122.0					9																	135505682		2203	4300	6503	SO:0001583	missense	64794	exon16			TGACATATTCTGC	AF427339	CCDS6951.1, CCDS6952.1	9q34.2	2012-04-17	2003-06-13		ENSG00000125485	ENSG00000125485		"""DEAD-boxes"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16715	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 25"""		"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31"""				Standard	NM_022779		Approved	FLJ13633, FLJ23349, FLJ14578, PPP1R25	uc004cbq.1	Q9H8H2	OTTHUMG00000020843	ENST00000372159.3:c.1915T>C	chr9.hg19:g.135505682A>G	ENSP00000361232:p.Tyr639His	81.0	0.0	.		78.0	36.0	.	NM_022779	Q5K6N2|Q5K6N3|Q5K6N4|Q5VZJ4|Q5VZJ9|Q96E91|Q96NY2|Q96SX5|Q9H5K6	Missense_Mutation	SNP	ENST00000372159.3	hg19	CCDS6951.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.133832	0.77662	.	.	ENSG00000125485	ENST00000372159;ENST00000372155;ENST00000438527	T;T	0.04862	3.54;3.54	5.54	5.54	0.83059	Helicase, C-terminal (1);	0.109437	0.64402	D	0.000006	T	0.21550	0.0519	L	0.60067	1.865	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	T	0.00184	-1.1944	10	0.87932	D	0	-14.67	14.9265	0.70881	1.0:0.0:0.0:0.0	.	639	Q9H8H2	DDX31_HUMAN	H	639;639;510	ENSP00000361232:Y639H;ENSP00000387730:Y510H	ENSP00000361228:Y639H	Y	-	1	0	DDX31	134495503	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.561000	0.82288	2.117000	0.64856	0.529000	0.55759	TAT	.	.	.	none		0.493	DDX31-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054794.1	NM_138620	
ARID5B	84159	hgsc.bcm.edu	37	10	63852419	63852419	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr10:63852419C>T	ENST00000279873.7	+	10	3607	c.3197C>T	c.(3196-3198)tCa>tTa	p.S1066L	ARID5B_ENST00000309334.5_Missense_Mutation_p.S823L	NM_032199.2	NP_115575.1	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)	1066					adipose tissue development (GO:0060612)|adrenal gland development (GO:0030325)|cell development (GO:0048468)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|fat pad development (GO:0060613)|female gonad development (GO:0008585)|fibroblast migration (GO:0010761)|kidney development (GO:0001822)|liver development (GO:0001889)|male gonad development (GO:0008584)|multicellular organism growth (GO:0035264)|muscle organ morphogenesis (GO:0048644)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(13)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	Prostate(12;0.016)|all_hematologic(501;0.215)					GGGGGCGGATCAGAAGGCCAC	0.612																																					p.S1066L		Atlas-SNP	.											.	ARID5B	125	.	0			c.C3197T						PASS	.						72.0	70.0	71.0					10																	63852419		2203	4300	6503	SO:0001583	missense	84159	exon10			GCGGATCAGAAGG	M73837	CCDS31208.1, CCDS58082.1	10q11.22	2013-02-07			ENSG00000150347	ENSG00000150347		"""-"""	17362	protein-coding gene	gene with protein product		608538				11483573, 11478881	Standard	NM_032199		Approved	FLJ21150, MRF2	uc001jlt.2	Q14865	OTTHUMG00000018298	ENST00000279873.7:c.3197C>T	chr10.hg19:g.63852419C>T	ENSP00000279873:p.Ser1066Leu	63.0	0.0	.		70.0	28.0	.	NM_032199	B4DLB3|Q05DG6|Q32Q59|Q5VST4|Q6NZ42|Q7Z3M4|Q8N421|Q9H786	Missense_Mutation	SNP	ENST00000279873.7	hg19	CCDS31208.1	.	.	.	.	.	.	.	.	.	.	C	0.017	-1.504483	0.00992	.	.	ENSG00000150347	ENST00000279873;ENST00000309334	T;T	0.42131	0.98;0.99	5.72	2.16	0.27623	.	0.521061	0.22867	N	0.054680	T	0.19446	0.0467	N	0.11560	0.145	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.18713	-1.0328	10	0.17832	T	0.49	0.005	7.2708	0.26256	0.0:0.5022:0.0:0.4978	.	1066	Q14865	ARI5B_HUMAN	L	1066;823	ENSP00000279873:S1066L;ENSP00000308862:S823L	ENSP00000279873:S1066L	S	+	2	0	ARID5B	63522425	0.007000	0.16637	0.008000	0.14137	0.545000	0.35147	1.891000	0.39738	0.657000	0.30906	0.655000	0.94253	TCA	.	.	.	none		0.612	ARID5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048233.1	XM_084482	
WAPAL	23063	hgsc.bcm.edu	37	10	88197365	88197365	+	Splice_Site	SNP	A	A	G			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr10:88197365A>G	ENST00000298767.5	-	19	3980	c.3508T>C	c.(3508-3510)Tgt>Cgt	p.C1170R	WAPAL_ENST00000484070.1_5'UTR|WAPAL_ENST00000372075.1_Splice_Site_p.C382R|WAPAL_ENST00000263070.7_Splice_Site_p.C382R	NM_015045.2	NP_055860.1	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog (Drosophila)	1170					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of chromatin binding (GO:0035562)|negative regulation of DNA replication (GO:0008156)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of fibroblast proliferation (GO:0048146)|protein localization to chromatin (GO:0071168)|regulation of chromosome condensation (GO:0060623)|regulation of cohesin localization to chromatin (GO:0071922)|response to toxic substance (GO:0009636)|viral process (GO:0016032)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)				breast(2)|endometrium(2)|kidney(5)|large_intestine(6)|lung(13)|ovary(2)|stomach(1)	31						CCAACAGCACACTGAAAGCAG	0.368																																					p.C1170R		Atlas-SNP	.											.	WAPAL	81	.	0			c.T3508C						PASS	.						73.0	66.0	68.0					10																	88197365		2203	4300	6503	SO:0001630	splice_region_variant	23063	exon19			CAGCACACTGAAA	AB065003	CCDS7375.1	10q23.31	2006-12-08	2006-03-16	2006-03-16	ENSG00000062650	ENSG00000062650			23293	protein-coding gene	gene with protein product	"""friend of EBNA2"""	610754	"""KIAA0261"""	KIAA0261		9039502, 17112726	Standard	XM_006717726		Approved	FOE, WAPL	uc001kdo.3	Q7Z5K2	OTTHUMG00000018651	ENST00000298767.5:c.3508-1T>C	chr10.hg19:g.88197365A>G		81.0	0.0	.		74.0	32.0	.	NM_015045	A7E2B5|Q5VSK5|Q8IX10|Q92549	Missense_Mutation	SNP	ENST00000298767.5	hg19	CCDS7375.1	.	.	.	.	.	.	.	.	.	.	A	16.85	3.235515	0.58886	.	.	ENSG00000062650	ENST00000342368;ENST00000298767;ENST00000372076;ENST00000372075;ENST00000263070	T;T;T	0.36157	1.27;1.27;1.27	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.53094	0.1775	L	0.51422	1.61	0.80722	D	1	D;D;D;D	0.76494	0.99;0.99;0.99;0.999	P;P;P;D	0.68943	0.797;0.802;0.797;0.961	T	0.45687	-0.9244	10	0.32370	T	0.25	.	16.1534	0.81640	1.0:0.0:0.0:0.0	.	1164;1208;1170;1207	B2RTX8;E9PH12;Q7Z5K2;Q7Z5K2-2	.;.;WAPL_HUMAN;.	R	1255;1170;1255;382;382	ENSP00000298767:C1170R;ENSP00000361145:C382R;ENSP00000263070:C382R	ENSP00000263070:C382R	C	-	1	0	WAPAL	88187345	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	8.914000	0.92735	2.211000	0.71520	0.460000	0.39030	TGT	.	.	.	none		0.368	WAPAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049151.2	NM_015045	Missense_Mutation
PYROXD2	84795	hgsc.bcm.edu	37	10	100167377	100167377	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr10:100167377G>T	ENST00000370575.4	-	4	325	c.277C>A	c.(277-279)Ctg>Atg	p.L93M	PYROXD2_ENST00000483923.1_5'UTR	NM_032709.2	NP_116098.2	Q8N2H3	PYRD2_HUMAN	pyridine nucleotide-disulphide oxidoreductase domain 2	93							oxidoreductase activity (GO:0016491)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	12						GGCCTCAGCAGGCTGAGCAGG	0.612																																					p.L93M		Atlas-SNP	.											.	PYROXD2	43	.	0			c.C277A						PASS	.						43.0	49.0	47.0					10																	100167377		2203	4300	6503	SO:0001583	missense	84795	exon4			TCAGCAGGCTGAG	AK074429	CCDS7474.1	10q24.2	2009-04-22	2009-04-22	2009-04-22	ENSG00000119943	ENSG00000119943			23517	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 33"""	C10orf33			Standard	NM_032709		Approved	FLJ23849	uc001kpc.3	Q8N2H3	OTTHUMG00000018877	ENST00000370575.4:c.277C>A	chr10.hg19:g.100167377G>T	ENSP00000359607:p.Leu93Met	28.0	0.0	.		47.0	16.0	.	NM_032709	D3DR61|Q5TAA9|Q9BRQ1	Missense_Mutation	SNP	ENST00000370575.4	hg19	CCDS7474.1	.	.	.	.	.	.	.	.	.	.	G	19.30	3.801114	0.70567	.	.	ENSG00000119943	ENST00000370575	T	0.61510	0.1	5.18	3.3	0.37823	.	0.077564	0.53938	D	0.000058	T	0.56804	0.2010	L	0.41236	1.265	0.58432	D	0.999998	P	0.46277	0.875	P	0.51016	0.656	T	0.57499	-0.7801	10	0.87932	D	0	-31.4788	10.2148	0.43162	0.1473:0.0:0.8527:0.0	.	93	Q8N2H3	PYRD2_HUMAN	M	93	ENSP00000359607:L93M	ENSP00000359607:L93M	L	-	1	2	PYROXD2	100157367	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	4.676000	0.61627	0.565000	0.29255	0.563000	0.77884	CTG	.	.	.	none		0.612	PYROXD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049782.2	NM_032709	
ADRA2A	150	hgsc.bcm.edu	37	10	112837876	112837876	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr10:112837876C>A	ENST00000280155.2	+	1	1087	c.122C>A	c.(121-123)aCc>aAc	p.T41N		NM_000681.3	NP_000672.3	P08913	ADA2A_HUMAN	adrenoceptor alpha 2A	26					actin cytoskeleton organization (GO:0030036)|activation of MAPK activity by adrenergic receptor signaling pathway (GO:0071883)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|acute inflammatory response (GO:0002526)|adenylate cyclase-inhibiting adrenergic receptor signaling pathway (GO:0071881)|blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|DNA replication (GO:0006260)|energy reserve metabolic process (GO:0006112)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|fear response (GO:0042596)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|intestinal absorption (GO:0050892)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of adrenergic receptor signaling pathway (GO:0071878)|negative regulation of calcium ion transmembrane transporter activity (GO:1901020)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of insulin secretion (GO:0046676)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of norepinephrine secretion (GO:0010700)|negative regulation of uterine smooth muscle contraction (GO:0070473)|phospholipase C-activating adrenergic receptor signaling pathway (GO:0071882)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine production (GO:0001819)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of potassium ion transport (GO:0043268)|positive regulation of vasodilation (GO:0045909)|positive regulation of wound healing (GO:0090303)|Ras protein signal transduction (GO:0007265)|regulation of insulin secretion (GO:0050796)|regulation of vasoconstriction (GO:0019229)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|thermoception (GO:0050955)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	alpha-1B adrenergic receptor binding (GO:0031692)|alpha-2C adrenergic receptor binding (GO:0031696)|alpha2-adrenergic receptor activity (GO:0004938)|epinephrine binding (GO:0051379)|heterotrimeric G-protein binding (GO:0032795)|norepinephrine binding (GO:0051380)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|thioesterase binding (GO:0031996)			breast(1)|cervix(3)|endometrium(6)|large_intestine(3)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Breast(234;0.0735)|Lung NSC(174;0.238)		Epithelial(162;0.000316)|all cancers(201;0.00501)|BRCA - Breast invasive adenocarcinoma(275;0.118)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Apraclonidine(DB00964)|Aripiprazole(DB01238)|Asenapine(DB06216)|Benzphetamine(DB00865)|Bethanidine(DB00217)|Brimonidine(DB00484)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Clozapine(DB00363)|Desipramine(DB01151)|Dexmedetomidine(DB00633)|Dihydroergotamine(DB00320)|Dipivefrin(DB00449)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinastine(DB00751)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Flupirtine(DB06623)|Guanabenz(DB00629)|Guanfacine(DB01018)|Lisuride(DB00589)|Lofexidine(DB04948)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methamphetamine(DB01577)|Methotrimeprazine(DB01403)|Methyldopa(DB00968)|Mianserin(DB06148)|Mirtazapine(DB00370)|Naphazoline(DB06711)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxymetazoline(DB00935)|Paliperidone(DB01267)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phentolamine(DB00692)|Phenylpropanolamine(DB00397)|Pramipexole(DB00413)|Prazosin(DB00457)|Propericiazine(DB01608)|Pseudoephedrine(DB00852)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Tizanidine(DB00697)|Tolazoline(DB00797)|Trazodone(DB00656)|Trimipramine(DB00726)|Xylometazoline(DB06694)|Yohimbine(DB01392)|Ziprasidone(DB00246)	gcccgggccACCCCTTACTCC	0.711																																					p.T41N	Esophageal Squamous(173;605 2658 7278 49362)	Atlas-SNP	.											.	ADRA2A	38	.	0			c.C122A						PASS	.						14.0	15.0	15.0					10																	112837876		2195	4289	6484	SO:0001583	missense	150	exon1			GGGCCACCCCTTA	AF284095	CCDS7569.2	10q25.2	2012-08-08	2012-05-09		ENSG00000150594	ENSG00000150594		"""GPCR / Class A : Adrenoceptors : alpha"""	281	protein-coding gene	gene with protein product	"""alpha-2AAR subtype C10"", "" alpha-2A-adrenergic receptor"""	104210	"""adrenergic, alpha-2A-, receptor"""	ADRA2, ADRA2R			Standard	NM_000681		Approved	ADRAR	uc001kzo.3	P08913	OTTHUMG00000019050	ENST00000280155.2:c.122C>A	chr10.hg19:g.112837876C>A	ENSP00000280155:p.Thr41Asn	43.0	0.0	.		42.0	14.0	.	NM_000681	B0LPF6|Q2I8G2|Q2XN99|Q86TH8|Q9BZK1	Missense_Mutation	SNP	ENST00000280155.2	hg19	CCDS7569.2	.	.	.	.	.	.	.	.	.	.	C	11.59	1.683708	0.29872	.	.	ENSG00000150594	ENST00000280155	T	0.37584	1.19	4.91	3.02	0.34903	.	3.496670	0.01278	U	0.009655	T	0.21387	0.0515	N	0.08118	0	0.22171	N	0.999314	B	0.16802	0.019	B	0.17098	0.017	T	0.22977	-1.0201	10	0.15952	T	0.53	.	6.5228	0.22285	0.0:0.5318:0.3044:0.1638	.	26	P08913	ADA2A_HUMAN	N	41	ENSP00000280155:T41N	ENSP00000280155:T41N	T	+	2	0	ADRA2A	112827866	.	.	0.835000	0.33067	0.994000	0.84299	.	.	0.460000	0.27045	0.555000	0.69702	ACC	.	.	.	none		0.711	ADRA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050372.2	NM_000681	
ARHGAP1	392	hgsc.bcm.edu	37	11	46701795	46701795	+	Silent	SNP	G	G	A			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr11:46701795G>A	ENST00000311956.4	-	10	955	c.858C>T	c.(856-858)aaC>aaT	p.N286N		NM_004308.3	NP_004299.1	Q07960	RHG01_HUMAN	Rho GTPase activating protein 1	286	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	Rac GTPase activator activity (GO:0030675)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			endometrium(1)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	11		Lung NSC(402;1.76e-12)|all_lung(304;1.3e-11)		GBM - Glioblastoma multiforme(35;5.17e-06)|BRCA - Breast invasive adenocarcinoma(625;0.00112)|Lung(87;0.153)		CCACTTGGGTGTTGGCCGACC	0.627																																					p.N286N		Atlas-SNP	.											.	ARHGAP1	27	.	0			c.C858T						PASS	.						112.0	99.0	103.0					11																	46701795		2201	4299	6500	SO:0001819	synonymous_variant	392	exon10			TTGGGTGTTGGCC	BC018118	CCDS7922.1	11p11.2	2006-04-11			ENSG00000175220	ENSG00000175220		"""Rho GTPase activating proteins"""	673	protein-coding gene	gene with protein product		602732				8288572	Standard	NM_004308		Approved	RhoGAP, p50rhoGAP, CDC42GAP, Cdc42GAP	uc001ndd.4	Q07960	OTTHUMG00000166567	ENST00000311956.4:c.858C>T	chr11.hg19:g.46701795G>A		76.0	0.0	.		53.0	19.0	.	NM_004308	D3DQQ6	Silent	SNP	ENST00000311956.4	hg19	CCDS7922.1	.	.	.	.	.	.	.	.	.	.	G	1.017	-0.686082	0.03328	.	.	ENSG00000175220	ENST00000528837	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	T	0.60919	0.2306	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58940	-0.7547	4	.	.	.	.	9.5717	0.39431	0.0728:0.0:0.786:0.1411	.	.	.	.	Y	240	.	.	H	-	1	0	ARHGAP1	46658371	0.892000	0.30473	1.000000	0.80357	0.128000	0.20619	0.437000	0.21543	2.615000	0.88500	0.555000	0.69702	CAC	.	.	.	none		0.627	ARHGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390472.1	NM_004308	
CKAP5	9793	hgsc.bcm.edu	37	11	46772905	46772905	+	Silent	SNP	T	T	C			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr11:46772905T>C	ENST00000529230.1	-	39	5359	c.5313A>G	c.(5311-5313)aaA>aaG	p.K1771K	CKAP5_ENST00000312055.5_Silent_p.K1711K|CKAP5_ENST00000354558.3_Silent_p.K1711K|CKAP5_ENST00000415402.1_Silent_p.K1771K|MIR5582_ENST00000579697.1_RNA			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	1771					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)		p.K1771K(1)		breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						CCTTGGGCCCTTTTAATTTGC	0.443																																					p.K1771K	Ovarian(4;85 273 2202 4844 13323)	Atlas-SNP	.											CKAP5,NS,carcinoma,0,1	CKAP5	134	.	1	Substitution - coding silent(1)	lung(1)	c.A5313G						PASS	.						165.0	160.0	161.0					11																	46772905		2201	4299	6500	SO:0001819	synonymous_variant	9793	exon39			GGGCCCTTTTAAT		CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.5313A>G	chr11.hg19:g.46772905T>C		82.0	0.0	.		89.0	4.0	.	NM_001008938	Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Silent	SNP	ENST00000529230.1	hg19	CCDS31477.1	.	.	.	.	.	.	.	.	.	.	T	8.631	0.893624	0.17613	.	.	ENSG00000175216	ENST00000525896	.	.	.	5.72	4.6	0.57074	.	.	.	.	.	T	0.57330	0.2046	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55604	-0.8115	4	.	.	.	-13.3618	7.7932	0.29133	0.0:0.1821:0.0:0.8179	.	.	.	.	G	10	.	.	R	-	1	2	CKAP5	46729481	0.978000	0.34361	1.000000	0.80357	0.988000	0.76386	0.096000	0.15147	2.183000	0.69458	0.533000	0.62120	AGG	.	.	.	none		0.443	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390679.1	NM_014756	
MYBPC3	4607	hgsc.bcm.edu	37	11	47372130	47372130	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr11:47372130G>A	ENST00000545968.1	-	3	383	c.329C>T	c.(328-330)cCt>cTt	p.P110L	MYBPC3_ENST00000399249.2_Missense_Mutation_p.P110L|MYBPC3_ENST00000256993.4_Missense_Mutation_p.P110L	NM_000256.3	NP_000247.2	Q14896	MYPC3_HUMAN	myosin binding protein C, cardiac	110	Pro-rich.				cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|heart morphogenesis (GO:0003007)|muscle filament sliding (GO:0030049)|myosin filament assembly (GO:0031034)|positive regulation of ATPase activity (GO:0032781)|regulation of heart rate (GO:0002027)|regulation of muscle filament sliding (GO:0032971)|regulation of striated muscle contraction (GO:0006942)|sarcomere organization (GO:0045214)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	A band (GO:0031672)|C zone (GO:0014705)|cytosol (GO:0005829)|sarcomere (GO:0030017)|striated muscle myosin thick filament (GO:0005863)	ATPase activator activity (GO:0001671)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|myosin binding (GO:0017022)|myosin heavy chain binding (GO:0032036)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(4)|lung(16)|ovary(3)|prostate(3)|urinary_tract(2)	42				Lung(87;0.176)		GGCCTCAGCAGGGGCAGGGGC	0.672																																					p.P110L		Atlas-SNP	.											.	MYBPC3	102	.	0			c.C329T						PASS	.						7.0	8.0	8.0					11																	47372130		1838	4050	5888	SO:0001583	missense	4607	exon3			TCAGCAGGGGCAG	X84075	CCDS53621.1	11p11.2	2014-09-17	2001-11-28			ENSG00000134571		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7551	protein-coding gene	gene with protein product		600958	"""myosin-binding protein C, cardiac"""	CMH4		7744002, 8358441	Standard	NM_000256		Approved	MYBP-C, FHC	uc021qis.1	Q14896		ENST00000545968.1:c.329C>T	chr11.hg19:g.47372130G>A	ENSP00000442795:p.Pro110Leu	160.0	0.0	.		165.0	26.0	.	NM_000256	A5PL00|Q16410|Q6R2F7|Q9UE27|Q9UM53	Missense_Mutation	SNP	ENST00000545968.1	hg19	CCDS53621.1	.	.	.	.	.	.	.	.	.	.	G	15.13	2.742480	0.49151	.	.	ENSG00000134571	ENST00000545968;ENST00000399249;ENST00000256993	T;T;T	0.58940	0.3;0.3;0.36	2.16	2.16	0.27623	.	.	.	.	.	T	0.34890	0.0913	N	0.08118	0	0.24976	N	0.991637	B	0.13594	0.008	B	0.09377	0.004	T	0.27571	-1.0070	9	0.66056	D	0.02	.	7.7704	0.29004	0.0:0.0:1.0:0.0	.	110	Q14896	MYPC3_HUMAN	L	110	ENSP00000442795:P110L;ENSP00000382193:P110L;ENSP00000256993:P110L	ENSP00000256993:P110L	P	-	2	0	MYBPC3	47328706	0.590000	0.26815	0.347000	0.25668	0.645000	0.38454	1.834000	0.39171	1.229000	0.43630	0.462000	0.41574	CCT	.	.	.	none		0.672	MYBPC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392271.3		
CELF1	10658	hgsc.bcm.edu	37	11	47494737	47494737	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr11:47494737A>C	ENST00000358597.3	-	11	1235	c.1236T>G	c.(1234-1236)ttT>ttG	p.F412L	CELF1_ENST00000310513.5_Missense_Mutation_p.F408L|CELF1_ENST00000361904.3_Missense_Mutation_p.F409L|CELF1_ENST00000532048.1_Missense_Mutation_p.F438L|CELF1_ENST00000531165.1_Missense_Mutation_p.F440L|CELF1_ENST00000395292.2_Missense_Mutation_p.F409L|CELF1_ENST00000395290.2_Missense_Mutation_p.F411L|CELF1_ENST00000539455.1_5'UTR			Q92879	CELF1_HUMAN	CUGBP, Elav-like family member 1	412	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				embryo development (GO:0009790)|germ cell development (GO:0007281)|mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|negative regulation of translation (GO:0017148)|positive regulation of multicellular organism growth (GO:0040018)|regulation of RNA splicing (GO:0043484)|RNA interference (GO:0016246)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	BRE binding (GO:0042835)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation repressor activity, nucleic acid binding (GO:0000900)			central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|ovary(2)	18						CCTGATCACCAAACTCCTGGG	0.488																																					p.F438L	Pancreas(163;1949 1966 9906 43218 43785)	Atlas-SNP	.											.	CELF1	43	.	0			c.T1314G						PASS	.						108.0	95.0	100.0					11																	47494737		2201	4298	6499	SO:0001583	missense	10658	exon14			ATCACCAAACTCC	U63289	CCDS7938.1, CCDS7939.1, CCDS31482.1, CCDS53622.1, CCDS53623.1	11p11	2013-02-12	2010-02-19	2010-02-19				"""RNA binding motif (RRM) containing"""	2549	protein-coding gene	gene with protein product	"""CUG RNA-binding protein"", ""nuclear polyadenylated RNA-binding protein, 50-kD"", ""bruno-like 2"", ""embryo deadenylation element binding protein"""	601074	"""CUG triplet repeat, RNA-binding protein 1"", ""CUG triplet repeat, RNA binding protein 1"""	CUGBP1		8948631, 9371827	Standard	NM_006560		Approved	CUG-BP, hNab50, BRUNOL2, NAB50, CUGBP, NAPOR, EDEN-BP	uc001nfl.3	Q92879		ENST00000358597.3:c.1236T>G	chr11.hg19:g.47494737A>C	ENSP00000351409:p.Phe412Leu	80.0	0.0	.		76.0	37.0	.	NM_001172639	B4E2U5|D3DQS0|F8W940|Q4LE52|Q9NP83|Q9NR06	Missense_Mutation	SNP	ENST00000358597.3	hg19	CCDS31482.1	.	.	.	.	.	.	.	.	.	.	A	19.26	3.793578	0.70452	.	.	ENSG00000149187	ENST00000395290;ENST00000358597;ENST00000395292;ENST00000310513;ENST00000361904;ENST00000531165;ENST00000532048	T;T;T;T;T;T;T	0.14391	2.51;2.51;2.51;2.51;2.51;2.51;2.51	6.07	3.79	0.43588	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.096317	0.64402	D	0.000001	T	0.19248	0.0462	N	0.25957	0.775	0.80722	D	1	B;B;D;B;B;D	0.54601	0.004;0.004;0.967;0.082;0.004;0.964	B;B;P;B;B;P	0.61940	0.004;0.004;0.896;0.261;0.004;0.88	T	0.01242	-1.1408	10	0.49607	T	0.09	-11.2757	8.6583	0.34077	0.7964:0.0:0.2036:0.0	.	411;440;438;408;409;412	F8W940;G5EA30;Q92879-4;Q92879-2;Q92879-3;Q92879	.;.;.;.;.;CELF1_HUMAN	L	411;412;409;408;409;440;438	ENSP00000378705:F411L;ENSP00000351409:F412L;ENSP00000378706:F409L;ENSP00000308386:F408L;ENSP00000354639:F409L;ENSP00000436864:F440L;ENSP00000435926:F438L	ENSP00000308386:F408L	F	-	3	2	CELF1	47451313	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.627000	0.37050	0.550000	0.28991	0.533000	0.62120	TTT	.	.	.	none		0.488	CELF1-024	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398352.1	NM_006560	
OR10S1	219873	hgsc.bcm.edu	37	11	123847533	123847533	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr11:123847533A>T	ENST00000531945.1	-	1	955	c.866T>A	c.(865-867)tTc>tAc	p.F289Y		NM_001004474.1	NP_001004474.1	Q8NGN2	O10S1_HUMAN	olfactory receptor, family 10, subfamily S, member 1	289						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	36		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		GATTGTGTAGAAGACAGCAGG	0.547																																					p.F289Y		Atlas-SNP	.											.	OR10S1	78	.	0			c.T866A						PASS	.						89.0	93.0	91.0					11																	123847533		2202	4299	6501	SO:0001583	missense	219873	exon1			GTGTAGAAGACAG	BK004509	CCDS31701.1	11q24.1	2012-08-09			ENSG00000196248	ENSG00000196248		"""GPCR / Class A : Olfactory receptors"""	14807	protein-coding gene	gene with protein product							Standard	NM_001004474		Approved		uc001pzm.1	Q8NGN2	OTTHUMG00000165963	ENST00000531945.1:c.866T>A	chr11.hg19:g.123847533A>T	ENSP00000431914:p.Phe289Tyr	76.0	0.0	.		59.0	26.0	.	NM_001004474	B9EH43|Q6IEV3|Q96R78	Missense_Mutation	SNP	ENST00000531945.1	hg19	CCDS31701.1	.	.	.	.	.	.	.	.	.	.	A	16.80	3.222817	0.58668	.	.	ENSG00000196248	ENST00000531945	T	0.00224	8.51	4.85	4.85	0.62838	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36972	U	0.002306	T	0.00695	0.0023	H	0.95504	3.68	0.25935	N	0.98295	D	0.63880	0.993	P	0.60012	0.867	T	0.14309	-1.0477	10	0.87932	D	0	-26.4199	10.2325	0.43264	0.8516:0.0:0.0:0.1484	.	289	Q8NGN2	O10S1_HUMAN	Y	289	ENSP00000431914:F289Y	ENSP00000431914:F289Y	F	-	2	0	OR10S1	123352743	0.027000	0.19231	1.000000	0.80357	0.619000	0.37552	2.258000	0.43249	2.039000	0.60335	0.533000	0.62120	TTC	.	.	.	none		0.547	OR10S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387265.2	NM_001004474	
CLECL1	160365	hgsc.bcm.edu	37	12	9875396	9875396	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr12:9875396A>C	ENST00000327839.3	-	2	364	c.330T>G	c.(328-330)ttT>ttG	p.F110L		NM_172004.3	NP_742001.1	Q8IZS7	CLCL1_HUMAN	C-type lectin-like 1	110						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			breast(1)|kidney(1)|large_intestine(4)|lung(3)	9						GGACAGTAGAAAAGTTGAAAG	0.328																																					p.F110L		Atlas-SNP	.											.	CLECL1	18	.	0			c.T330G						PASS	.						56.0	52.0	53.0					12																	9875396		2203	4299	6502	SO:0001583	missense	160365	exon2			AGTAGAAAAGTTG	AF518873	CCDS8603.1, CCDS73441.1	12p13.31	2007-06-21				ENSG00000184293			24462	protein-coding gene	gene with protein product	"""dendritic cell associated lectin 1"""	607467				12421943	Standard	NM_172004		Approved	DCAL1	uc001qwi.3	Q8IZS7		ENST00000327839.3:c.330T>G	chr12.hg19:g.9875396A>C	ENSP00000331766:p.Phe110Leu	116.0	0.0	.		124.0	76.0	.	NM_001267701		Missense_Mutation	SNP	ENST00000327839.3	hg19	CCDS8603.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	3.681|3.681	-0.065539|-0.065539	0.07273|0.07273	.|.	.|.	ENSG00000184293|ENSG00000184293	ENST00000542530|ENST00000327839	T|T	0.16597|0.15139	2.33|2.45	2.49|2.49	2.49|2.49	0.30216|0.30216	.|.	.|.	.|.	.|.	.|.	T|T	0.11153|0.11153	0.0272|0.0272	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	1|1	.|B	.|0.21452	.|0.056	.|B	.|0.17979	.|0.02	T|T	0.26155|0.26155	-1.0111|-1.0111	6|8	.|.	.|.	.|.	.|.	6.8863|6.8863	0.24202|0.24202	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|110	.|Q8IZS7	.|CLCL1_HUMAN	C|L	62|110	ENSP00000438981:F62C|ENSP00000331766:F110L	.|.	F|F	-|-	2|3	0|2	CLECL1|CLECL1	9766663|9766663	0.001000|0.001000	0.12720|0.12720	0.001000|0.001000	0.08648|0.08648	0.003000|0.003000	0.03518|0.03518	0.889000|0.889000	0.28282|0.28282	1.389000|1.389000	0.46526|0.46526	0.486000|0.486000	0.48141|0.48141	TTT|TTT	.	.	.	none		0.328	CLECL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399815.1	NM_172004	
OVCH1	341350	hgsc.bcm.edu	37	12	29639178	29639178	+	Splice_Site	SNP	C	C	A			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr12:29639178C>A	ENST00000318184.5	-	8	995		c.e8+1		OVCH1-AS1_ENST00000551108.1_Intron|OVCH1-AS1_ENST00000549411.1_Intron	NM_183378.2	NP_899234.2	Q7RTY7	OVCH1_HUMAN	ovochymase 1							extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)	p.?(1)		NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(43)|ovary(5)|pancreas(3)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)	92	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					TAGAACCACACATACCCTTTC	0.428																																					.		Atlas-SNP	.											OVCH1,NS,carcinoma,0,1	OVCH1	195	.	1	Unknown(1)	lung(1)	c.995+1G>T						PASS	.						93.0	88.0	89.0					12																	29639178		1849	4098	5947	SO:0001630	splice_region_variant	341350	exon9			ACCACACATACCC	BN000128		12p11.23	2012-11-08			ENSG00000187950	ENSG00000187950			23080	protein-coding gene	gene with protein product						12838346	Standard	NM_183378		Approved	OVCH	uc001rix.1	Q7RTY7	OTTHUMG00000167741	ENST00000318184.5:c.995+1G>T	chr12.hg19:g.29639178C>A		107.0	0.0	.		128.0	72.0	.	NM_183378		Splice_Site	SNP	ENST00000318184.5	hg19		.	.	.	.	.	.	.	.	.	.	C	3.919	-0.018587	0.07681	.	.	ENSG00000187950	ENST00000318184	.	.	.	1.94	1.02	0.19986	.	.	.	.	.	.	.	.	.	.	.	0.20196	N	0.999927	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.2497	0.10689	0.0:0.7911:0.0:0.2089	.	.	.	.	.	-1	.	.	.	-	.	.	OVCH1	29530445	0.000000	0.05858	0.001000	0.08648	0.024000	0.10985	0.230000	0.17852	0.359000	0.24239	0.563000	0.77884	.	.	.	.	none		0.428	OVCH1-001	KNOWN	non_canonical_TEC|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395997.2	NM_183378	Intron
IPO8	10526	hgsc.bcm.edu	37	12	30834737	30834737	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr12:30834737A>G	ENST00000256079.4	-	4	676	c.338T>C	c.(337-339)aTg>aCg	p.M113T		NM_006390.3	NP_006381.2	O15397	IPO8_HUMAN	importin 8	113					intracellular protein transport (GO:0006886)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	Ran GTPase binding (GO:0008536)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(16)|liver(1)|lung(22)|prostate(2)|skin(2)|urinary_tract(2)	52	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					ACGGAGACACATTGTTAATTG	0.373																																					p.M113T		Atlas-SNP	.											.	IPO8	105	.	0			c.T338C						PASS	.						68.0	65.0	66.0					12																	30834737		2201	4300	6501	SO:0001583	missense	10526	exon4			AGACACATTGTTA	U77494	CCDS8719.1, CCDS53773.1	12p11.21	2011-05-23	2003-03-11	2003-03-14	ENSG00000133704	ENSG00000133704		"""Importins"""	9853	protein-coding gene	gene with protein product		605600	"""RAN binding protein 8"""	RANBP8		9214382	Standard	NM_006390		Approved	IMP8	uc001rjd.3	O15397	OTTHUMG00000169172	ENST00000256079.4:c.338T>C	chr12.hg19:g.30834737A>G	ENSP00000256079:p.Met113Thr	133.0	0.0	.		149.0	50.0	.	NM_006390	B7Z7M3	Missense_Mutation	SNP	ENST00000256079.4	hg19	CCDS8719.1	.	.	.	.	.	.	.	.	.	.	A	5.572	0.290340	0.10567	.	.	ENSG00000133704	ENST00000256079;ENST00000535989	T;T	0.65732	-0.17;-0.17	5.13	5.13	0.70059	Armadillo-like helical (1);Armadillo-type fold (1);	0.161352	0.56097	D	0.000023	T	0.44414	0.1292	N	0.13043	0.29	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.33803	-0.9854	10	0.17832	T	0.49	-28.9758	15.0801	0.72108	1.0:0.0:0.0:0.0	.	113	O15397	IPO8_HUMAN	T	113;51	ENSP00000256079:M113T;ENSP00000440979:M51T	ENSP00000256079:M113T	M	-	2	0	IPO8	30726004	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.504000	0.53347	2.157000	0.67596	0.482000	0.46254	ATG	.	.	.	none		0.373	IPO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402700.2	NM_006390	
NXPH4	11247	hgsc.bcm.edu	37	12	57619121	57619121	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr12:57619121C>A	ENST00000349394.5	+	2	693	c.518C>A	c.(517-519)cCc>cAc	p.P173H	NXPH4_ENST00000555154.1_3'UTR|Y_RNA_ENST00000365197.1_RNA	NM_007224.3	NP_009155.1	O95158	NXPH4_HUMAN	neurexophilin 4	173	IV (linker domain).				neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(2)|stomach(1)|upper_aerodigestive_tract(1)	10						GGGCCTGTCCCCCACCCTCTG	0.716																																					p.P173H		Atlas-SNP	.											.	NXPH4	40	.	0			c.C518A						PASS	.						53.0	59.0	57.0					12																	57619121		2203	4300	6503	SO:0001583	missense	11247	exon2			CTGTCCCCCACCC	AF043469	CCDS8933.1	12q13.3	2014-09-04			ENSG00000182379	ENSG00000182379			8078	protein-coding gene	gene with protein product		604637				9570794	Standard	NM_007224		Approved	NPH4	uc009zpj.4	O95158	OTTHUMG00000171241	ENST00000349394.5:c.518C>A	chr12.hg19:g.57619121C>A	ENSP00000333593:p.Pro173His	36.0	0.0	.		73.0	40.0	.	NM_007224	A8K4I4|Q7Z6L3|Q8N462	Missense_Mutation	SNP	ENST00000349394.5	hg19	CCDS8933.1	.	.	.	.	.	.	.	.	.	.	C	12.17	1.857001	0.32791	.	.	ENSG00000182379	ENST00000349394	.	.	.	4.27	4.27	0.50696	.	0.218561	0.23194	N	0.050870	T	0.14657	0.0354	N	0.08118	0	0.23449	N	0.997656	P	0.40000	0.698	B	0.37091	0.241	T	0.07868	-1.0750	9	0.49607	T	0.09	-11.004	7.9642	0.30089	0.0:0.8893:0.0:0.1107	.	173	O95158	NXPH4_HUMAN	H	173	.	ENSP00000333593:P173H	P	+	2	0	NXPH4	55905388	0.851000	0.29673	0.999000	0.59377	0.608000	0.37181	1.983000	0.40648	2.211000	0.71520	0.462000	0.41574	CCC	.	.	.	none		0.716	NXPH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412474.1	NM_007224	
TMEM132C	92293	hgsc.bcm.edu	37	12	128899711	128899711	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr12:128899711G>A	ENST00000435159.2	+	2	520	c.520G>A	c.(520-522)Gct>Act	p.A174T		NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	174						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						GAGGGTCTTTGCTTTCCGAGA	0.627																																					p.A174T		Atlas-SNP	.											.	TMEM132C	142	.	0			c.G520A						PASS	.						16.0	19.0	18.0					12																	128899711		692	1591	2283	SO:0001583	missense	92293	exon2			GTCTTTGCTTTCC	AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.520G>A	chr12.hg19:g.128899711G>A	ENSP00000410852:p.Ala174Thr	116.0	0.0	.		140.0	91.0	.	NM_001136103	Q69YX8	Missense_Mutation	SNP	ENST00000435159.2	hg19		.	.	.	.	.	.	.	.	.	.	G	31	5.095351	0.94197	.	.	ENSG00000181234	ENST00000435159	T	0.16897	2.31	5.0	5.0	0.66597	.	.	.	.	.	T	0.48537	0.1505	M	0.85859	2.78	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.54159	-0.8335	9	0.54805	T	0.06	.	18.6523	0.91435	0.0:0.0:1.0:0.0	.	174	Q8N3T6	T132C_HUMAN	T	174	ENSP00000410852:A174T	ENSP00000410852:A174T	A	+	1	0	TMEM132C	127465664	1.000000	0.71417	0.505000	0.27651	0.865000	0.49528	9.403000	0.97302	2.472000	0.83506	0.655000	0.94253	GCT	.	.	.	none		0.627	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		XM_044062	
SLITRK1	114798	hgsc.bcm.edu	37	13	84453695	84453695	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr13:84453695T>G	ENST00000377084.2	-	1	2833	c.1948A>C	c.(1948-1950)Aag>Cag	p.K650Q		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	650					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		TCTCGTCTCTTGGACCGCTTT	0.567																																					p.K650Q		Atlas-SNP	.											.	SLITRK1	196	.	0			c.A1948C						PASS	.						82.0	69.0	74.0					13																	84453695		2203	4300	6503	SO:0001583	missense	114798	exon1			GTCTCTTGGACCG	AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.1948A>C	chr13.hg19:g.84453695T>G	ENSP00000366288:p.Lys650Gln	115.0	0.0	.		109.0	36.0	.	NM_052910	Q5U5I6|Q96SF9	Missense_Mutation	SNP	ENST00000377084.2	hg19	CCDS9464.1	.	.	.	.	.	.	.	.	.	.	T	13.86	2.363605	0.41902	.	.	ENSG00000178235	ENST00000377084	T	0.56776	0.44	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.31827	0.0809	N	0.08118	0	0.54753	D	0.99998	B	0.21520	0.057	B	0.27715	0.082	T	0.15235	-1.0444	10	0.09843	T	0.71	-15.9777	13.9372	0.64032	0.0:0.0:0.0:1.0	.	650	Q96PX8	SLIK1_HUMAN	Q	650	ENSP00000366288:K650Q	ENSP00000366288:K650Q	K	-	1	0	SLITRK1	83351696	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.085000	0.71343	2.225000	0.72522	0.533000	0.62120	AAG	.	.	.	none		0.567	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910	
EAPP	55837	hgsc.bcm.edu	37	14	35002688	35002688	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr14:35002688A>G	ENST00000250454.3	-	3	395	c.314T>C	c.(313-315)aTa>aCa	p.I105T		NM_018453.3	NP_060923.2	Q56P03	EAPP_HUMAN	E2F-associated phosphoprotein	105					negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|urinary_tract(2)	12	Breast(36;0.0473)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00342)|Epithelial(34;0.18)	GBM - Glioblastoma multiforme(112;0.0196)		ATCAAAATATATATCATCGTA	0.338																																					p.I105T		Atlas-SNP	.											.	EAPP	28	.	0			c.T314C						PASS	.						139.0	129.0	132.0					14																	35002688		1853	4090	5943	SO:0001583	missense	55837	exon3			AAATATATATCAT	AF217512	CCDS41941.1	14q13	2007-03-26	2007-03-26	2007-03-26		ENSG00000129518			19312	protein-coding gene	gene with protein product		609486	"""chromosome 14 open reading frame 11"""	C14orf11		15716352	Standard	NM_018453		Approved	BM036, FLJ20578	uc001wsd.1	Q56P03		ENST00000250454.3:c.314T>C	chr14.hg19:g.35002688A>G	ENSP00000250454:p.Ile105Thr	99.0	0.0	.		106.0	49.0	.	NM_018453	Q9BVF4|Q9NWV5|Q9NZ86	Missense_Mutation	SNP	ENST00000250454.3	hg19	CCDS41941.1	.	.	.	.	.	.	.	.	.	.	A	16.06	3.015726	0.54468	.	.	ENSG00000129518	ENST00000250454;ENST00000554792	T;T	0.46063	0.89;0.88	5.54	5.54	0.83059	.	0.316524	0.38663	N	0.001606	T	0.44993	0.1320	M	0.70275	2.135	0.46203	D	0.998921	P	0.36753	0.568	B	0.34991	0.193	T	0.48422	-0.9037	10	0.49607	T	0.09	-4.4801	15.9956	0.80237	1.0:0.0:0.0:0.0	.	105	Q56P03	EAPP_HUMAN	T	105;84	ENSP00000250454:I105T;ENSP00000450908:I84T	ENSP00000250454:I105T	I	-	2	0	EAPP	34072439	1.000000	0.71417	0.998000	0.56505	0.937000	0.57800	5.183000	0.65065	2.248000	0.74166	0.533000	0.62120	ATA	.	.	.	none		0.338	EAPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409847.1	NM_018453	
STYX	6815	hgsc.bcm.edu	37	14	53224474	53224474	+	Silent	SNP	G	G	C			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr14:53224474G>C	ENST00000354586.4	+	7	647	c.354G>C	c.(352-354)gtG>gtC	p.V118V	STYX_ENST00000442123.2_Silent_p.V118V|STYX_ENST00000556861.1_Intron	NM_145251.3	NP_660294.1	Q8WUJ0	STYX_HUMAN	serine/threonine/tyrosine interacting protein	118	Tyrosine-protein phosphatase.				MAPK export from nucleus (GO:0045204)|protein dephosphorylation (GO:0006470)|regulation of ERK1 and ERK2 cascade (GO:0070372)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)	5	Breast(41;0.176)					AAGTTCTTGTGCATGGAAATG	0.313																																					p.V118V		Atlas-SNP	.											.	STYX	14	.	0			c.G354C						PASS	.						70.0	75.0	73.0					14																	53224474		2203	4295	6498	SO:0001819	synonymous_variant	6815	exon8			TCTTGTGCATGGA		CCDS9711.1	14q22.1	2011-06-09	2001-11-29		ENSG00000198252	ENSG00000198252		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	11447	protein-coding gene	gene with protein product		615814	"""serine/threonine/tyrosine-interacting protein"""			7592916	Standard	NM_145251		Approved		uc010tqy.2	Q8WUJ0	OTTHUMG00000140306	ENST00000354586.4:c.354G>C	chr14.hg19:g.53224474G>C		75.0	0.0	.		72.0	22.0	.	NM_001130701	B9EJG0|Q99850	Silent	SNP	ENST00000354586.4	hg19	CCDS9711.1																																																																																			.	.	.	none		0.313	STYX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276902.1	NM_145251	
SERPINA12	145264	hgsc.bcm.edu	37	14	94956103	94956103	+	Splice_Site	SNP	C	C	G			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr14:94956103C>G	ENST00000341228.2	-	5	1702	c.907G>C	c.(907-909)Gtc>Ctc	p.V303L	SERPINA12_ENST00000556881.1_Splice_Site_p.V303L	NM_173850.2	NP_776249.1	Q8IW75	SPA12_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12	303					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	33				COAD - Colon adenocarcinoma(157;0.235)		ACGTCTACGACCCTGGGGAAT	0.522																																					p.V303L		Atlas-SNP	.											.	SERPINA12	93	.	0			c.G907C						PASS	.						115.0	91.0	99.0					14																	94956103		2203	4300	6503	SO:0001630	splice_region_variant	145264	exon5			CTACGACCCTGGG	AY177692	CCDS9926.1	14q32.13	2014-02-21	2005-08-18		ENSG00000165953	ENSG00000165953		"""Serine (or cysteine) peptidase inhibitors"""	18359	protein-coding gene	gene with protein product			"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12"""			24172014	Standard	NM_173850		Approved	OL-64, Vaspin	uc001ydj.3	Q8IW75	OTTHUMG00000171349	ENST00000341228.2:c.906-1G>C	chr14.hg19:g.94956103C>G		106.0	0.0	.		101.0	43.0	.	NM_173850		Missense_Mutation	SNP	ENST00000341228.2	hg19	CCDS9926.1	.	.	.	.	.	.	.	.	.	.	C	6.845	0.525180	0.13066	.	.	ENSG00000165953	ENST00000556881;ENST00000341228	D;D	0.84070	-1.8;-1.8	5.14	2.95	0.34219	Serpin domain (3);	0.253832	0.27759	N	0.017975	T	0.64724	0.2624	N	0.16066	0.365	0.09310	N	0.999995	B	0.11235	0.004	B	0.04013	0.001	T	0.49428	-0.8941	10	0.26408	T	0.33	.	5.9952	0.19489	0.4795:0.4268:0.0:0.0937	.	303	Q8IW75	SPA12_HUMAN	L	303	ENSP00000451738:V303L;ENSP00000342109:V303L	ENSP00000342109:V303L	V	-	1	0	SERPINA12	94025856	0.000000	0.05858	0.980000	0.43619	0.176000	0.22953	0.069000	0.14552	1.251000	0.43983	0.462000	0.41574	GTC	.	.	.	none		0.522	SERPINA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413097.1	NM_173850	Missense_Mutation
GCNT3	9245	hgsc.bcm.edu	37	15	59911624	59911624	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr15:59911624G>A	ENST00000396065.1	+	3	1635	c.1187G>A	c.(1186-1188)gGg>gAg	p.G396E	GCNT3_ENST00000560585.1_Missense_Mutation_p.G396E	NM_004751.2	NP_004742.1	O95395	GCNT3_HUMAN	glucosaminyl (N-acetyl) transferase 3, mucin type	396					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|immunoglobulin production in mucosal tissue (GO:0002426)|intestinal absorption (GO:0050892)|kidney morphogenesis (GO:0060993)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|tissue morphogenesis (GO:0048729)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylgalactosaminyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0047225)|beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0003829)|N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)			central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TATGGGGCTGGGGACTTGAAT	0.498																																					p.G396E		Atlas-SNP	.											.	GCNT3	42	.	0			c.G1187A						PASS	.						143.0	138.0	139.0					15																	59911624		2190	4290	6480	SO:0001583	missense	9245	exon3			GGGCTGGGGACTT	AF102542	CCDS10172.1	15q22	2013-02-25			ENSG00000140297	ENSG00000140297	2.4.1.102, 2.4.1.150	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	4205	protein-coding gene	gene with protein product		606836				9915862, 9988682	Standard	NM_004751		Approved	C2GnT-M, C2/4GnT, C2GnT2	uc002age.3	O95395	OTTHUMG00000132726	ENST00000396065.1:c.1187G>A	chr15.hg19:g.59911624G>A	ENSP00000379377:p.Gly396Glu	103.0	0.0	.		75.0	28.0	.	NM_004751		Missense_Mutation	SNP	ENST00000396065.1	hg19	CCDS10172.1	.	.	.	.	.	.	.	.	.	.	G	15.55	2.866696	0.51588	.	.	ENSG00000140297	ENST00000396065	T	0.08370	3.1	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.35128	0.0921	M	0.89287	3.02	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.27502	-1.0072	10	0.21540	T	0.41	.	18.8129	0.92065	0.0:0.0:1.0:0.0	.	396	O95395	GCNT3_HUMAN	E	396	ENSP00000379377:G396E	ENSP00000379377:G396E	G	+	2	0	GCNT3	57698916	1.000000	0.71417	0.975000	0.42487	0.267000	0.26476	6.753000	0.74904	2.437000	0.82529	0.655000	0.94253	GGG	.	.	.	none		0.498	GCNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256068.1	NM_004751	
ALDH1A3	220	hgsc.bcm.edu	37	15	101438391	101438391	+	Splice_Site	SNP	G	G	C			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr15:101438391G>C	ENST00000329841.5	+	8	1415		c.e8+1		RP11-66B24.4_ENST00000560351.1_RNA|ALDH1A3_ENST00000346623.6_Splice_Site	NM_000693.2	NP_000684.2	P47895	AL1A3_HUMAN	aldehyde dehydrogenase 1 family, member A3						embryonic eye morphogenesis (GO:0048048)|face development (GO:0060324)|inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|nucleus accumbens development (GO:0021768)|olfactory pit development (GO:0060166)|optic cup morphogenesis involved in camera-type eye development (GO:0002072)|positive regulation of apoptotic process (GO:0043065)|retinal metabolic process (GO:0042574)|retinoic acid biosynthetic process (GO:0002138)|retinoic acid metabolic process (GO:0042573)|retinol metabolic process (GO:0042572)|righting reflex (GO:0060013)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)|NAD+ binding (GO:0070403)|protein homodimerization activity (GO:0042803)|thyroid hormone binding (GO:0070324)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(7)|lung(9)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	27	Lung NSC(78;0.00144)|all_lung(78;0.0018)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)		Vitamin A(DB00162)	GACGCTGACTGTGAGTCTCTG	0.572																																					.		Atlas-SNP	.											.	ALDH1A3	61	.	0			c.883+1G>C						PASS	.						51.0	50.0	51.0					15																	101438391		2203	4300	6503	SO:0001630	splice_region_variant	220	exon8			CTGACTGTGAGTC	U07919	CCDS10389.1	15q26	2010-05-07			ENSG00000184254	ENSG00000184254	1.2.1.5	"""Aldehyde dehydrogenases"""	409	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 3"""	600463		ALDH6		7698756	Standard	XR_111558		Approved	RALDH3	uc002bwn.4	P47895	OTTHUMG00000149870	ENST00000329841.5:c.883+1G>C	chr15.hg19:g.101438391G>C		116.0	0.0	.		103.0	46.0	.	NM_000693	Q6NT64	Splice_Site	SNP	ENST00000329841.5	hg19	CCDS10389.1	.	.	.	.	.	.	.	.	.	.	G	12.98	2.101857	0.37048	.	.	ENSG00000184254	ENST00000329841;ENST00000346623	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4533	0.94876	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ALDH1A3	99255914	1.000000	0.71417	0.967000	0.41034	0.080000	0.17528	9.338000	0.96553	2.604000	0.88044	0.555000	0.69702	.	.	.	.	none		0.572	ALDH1A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313620.2		Intron
CLN3	1201	hgsc.bcm.edu	37	16	28495396	28495396	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr16:28495396C>A	ENST00000569430.1	-	11	1540	c.721G>T	c.(721-723)Ggg>Tgg	p.G241W	CLN3_ENST00000568224.1_Missense_Mutation_p.G163W|CLN3_ENST00000333496.9_Missense_Mutation_p.G217W|CLN3_ENST00000395653.4_Missense_Mutation_p.G141W|CLN3_ENST00000354630.5_Missense_Mutation_p.G241W|CLN3_ENST00000565316.1_Missense_Mutation_p.G241W|CLN3_ENST00000535392.1_Missense_Mutation_p.G163W|CLN3_ENST00000359984.7_Missense_Mutation_p.G241W|CLN3_ENST00000357857.9_Missense_Mutation_p.G187W|CLN3_ENST00000357076.5_Intron|CLN3_ENST00000357806.7_Missense_Mutation_p.G142W|CLN3_ENST00000360019.2_Missense_Mutation_p.G241W|CLN3_ENST00000355477.5_Missense_Mutation_p.G193W|CLN3_ENST00000567963.1_Missense_Mutation_p.G241W			Q13286	CLN3_HUMAN	ceroid-lipofuscinosis, neuronal 3	241					action potential (GO:0001508)|amyloid precursor protein catabolic process (GO:0042987)|arginine transport (GO:0015809)|associative learning (GO:0008306)|autophagic vacuole fusion (GO:0000046)|cell death (GO:0008219)|cellular amino acid metabolic process (GO:0006520)|ceramide metabolic process (GO:0006672)|cytosolic calcium ion homeostasis (GO:0051480)|galactosylceramide metabolic process (GO:0006681)|globoside metabolic process (GO:0001575)|glucosylceramide metabolic process (GO:0006678)|ionotropic glutamate receptor signaling pathway (GO:0035235)|lysosomal lumen acidification (GO:0007042)|lysosomal lumen pH elevation (GO:0035752)|lysosome organization (GO:0007040)|macroautophagy (GO:0016236)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of macroautophagy (GO:0016242)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteolysis (GO:0045861)|neuromuscular process controlling balance (GO:0050885)|neurotransmitter metabolic process (GO:0042133)|protein catabolic process (GO:0030163)|protein processing (GO:0016485)|receptor-mediated endocytosis (GO:0006898)|sphingomyelin metabolic process (GO:0006684)|vacuolar transport (GO:0007034)|vesicle transport along microtubule (GO:0047496)	autophagic vacuole (GO:0005776)|caveola (GO:0005901)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|trans-Golgi network (GO:0005802)	unfolded protein binding (GO:0051082)			breast(1)|large_intestine(2)|lung(11)|upper_aerodigestive_tract(1)	15						TCTTCTTCCCCTCCAGGGTCC	0.592																																					p.G241W		Atlas-SNP	.											.	CLN3	33	.	0			c.G721T						PASS	.						44.0	42.0	42.0					16																	28495396		2197	4300	6497	SO:0001583	missense	1201	exon10			CTTCCCCTCCAGG	U32680	CCDS10632.1, CCDS73852.1, CCDS73853.1, CCDS73854.1, CCDS73855.1	16p12	2014-09-17	2008-07-29		ENSG00000188603	ENSG00000188603			2074	protein-coding gene	gene with protein product	"""juvenile neuronal ceroid lipofuscinosis"""	607042	"""Batten, Spielmeyer-Vogt disease"""	BTS		18317235	Standard	NM_001042432		Approved	JNCL	uc002dpp.3	Q13286	OTTHUMG00000097024	ENST00000569430.1:c.721G>T	chr16.hg19:g.28495396C>A	ENSP00000454229:p.Gly241Trp	58.0	0.0	.		63.0	33.0	.	NM_001042432	B2R7J1|O00668|O95089|Q549S9|Q9UP09|Q9UP11|Q9UP12|Q9UP13|Q9UP14	Missense_Mutation	SNP	ENST00000569430.1	hg19	CCDS10632.1	.	.	.	.	.	.	.	.	.	.	C	18.96	3.733284	0.69189	.	.	ENSG00000188603	ENST00000535392;ENST00000359984;ENST00000360019;ENST00000354630;ENST00000355477;ENST00000357857;ENST00000333496;ENST00000395653;ENST00000357806	D;D;D;D;D;D;D;D	0.96774	-4.12;-4.12;-4.12;-4.12;-4.12;-4.12;-4.12;-4.12	5.28	1.8	0.24995	Major facilitator superfamily domain, general substrate transporter (1);	0.386796	0.29212	N	0.012803	D	0.97222	0.9092	M	0.76838	2.35	0.58432	D	0.999991	D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	0.999;0.98;0.99;0.995;0.998;0.999;0.998;0.992;0.998;0.98;0.99;0.991;1.0	D;P;P;P;D;D;D;P;P;P;P;P;D	0.77557	0.975;0.796;0.708;0.839;0.954;0.98;0.964;0.792;0.907;0.796;0.694;0.855;0.99	D	0.96088	0.9059	10	0.87932	D	0	-3.7144	7.6992	0.28613	0.0:0.6916:0.0:0.3083	.	141;217;241;241;292;88;118;139;141;187;193;241;142	B4DFT5;B4DXL3;Q13286-3;Q13286-4;B4DIA8;O95093;O95090;O95086;B4DMY6;B4DFF3;Q13286-2;Q13286;O95089	.;.;.;.;.;.;.;.;.;.;.;CLN3_HUMAN;.	W	163;241;241;241;193;187;118;141;142	ENSP00000443221:G163W;ENSP00000353073:G241W;ENSP00000353116:G241W;ENSP00000346650:G241W;ENSP00000347660:G193W;ENSP00000350523:G187W;ENSP00000379014:G141W;ENSP00000350457:G142W	ENSP00000329171:G118W	G	-	1	0	CLN3	28402897	0.974000	0.33945	0.993000	0.49108	0.918000	0.54935	0.778000	0.26732	0.626000	0.30322	0.556000	0.70494	GGG	.	.	.	none		0.592	CLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214115.2		
DERL2	51009	hgsc.bcm.edu	37	17	5389469	5389469	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr17:5389469T>C	ENST00000158771.4	-	1	68	c.13A>G	c.(13-15)Agc>Ggc	p.S5G	MIS12_ENST00000381165.3_5'Flank|DERL2_ENST00000570848.1_Missense_Mutation_p.S5G|DERL2_ENST00000572834.1_Missense_Mutation_p.S5G|DERL2_ENST00000571968.1_Intron|MIS12_ENST00000573759.1_5'Flank	NM_016041.3	NP_057125.2	Q9GZP9	DERL2_HUMAN	derlin 2	5					endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|retrograde protein transport, ER to cytosol (GO:0030970)|suckling behavior (GO:0001967)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|late endosome (GO:0005770)|membrane (GO:0016020)				large_intestine(3)	3						AGCCGCAAGCTCTGGTACGCC	0.721																																					p.S5G		Atlas-SNP	.											.	DERL2	15	.	0			c.A13G						PASS	.						31.0	26.0	28.0					17																	5389469		2196	4291	6487	SO:0001583	missense	51009	exon1			GCAAGCTCTGGTA	BC010890	CCDS11073.1	17p13.2	2012-02-01	2012-02-01		ENSG00000072849	ENSG00000072849			17943	protein-coding gene	gene with protein product		610304	"""Der1-like domain family, member 2"""			10810093, 11500051	Standard	NM_016041		Approved	F-LAN-1, FLANa, F-LANa, CGI-101, derlin-2	uc002gcc.1	Q9GZP9	OTTHUMG00000102040	ENST00000158771.4:c.13A>G	chr17.hg19:g.5389469T>C	ENSP00000158771:p.Ser5Gly	228.0	0.0	.		295.0	71.0	.	NM_016041	Q9Y3A7	Missense_Mutation	SNP	ENST00000158771.4	hg19	CCDS11073.1	.	.	.	.	.	.	.	.	.	.	T	17.02	3.280895	0.59758	.	.	ENSG00000072849	ENST00000158771	T	0.23348	1.91	6.17	6.17	0.99709	.	0.047139	0.85682	D	0.000000	T	0.17066	0.0410	N	0.16708	0.43	0.48452	D	0.999658	B	0.02656	0.0	B	0.01281	0.0	T	0.11690	-1.0577	10	0.13853	T	0.58	-0.348	16.0034	0.80327	0.0:0.0:0.0:1.0	.	5	Q9GZP9	DERL2_HUMAN	G	5	ENSP00000158771:S5G	ENSP00000158771:S5G	S	-	1	0	DERL2	5330193	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.541000	0.60670	2.371000	0.80710	0.533000	0.62120	AGC	.	.	.	none		0.721	DERL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219825.1	NM_016041	
EVPLL	645027	hgsc.bcm.edu	37	17	18286356	18286356	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr17:18286356C>T	ENST00000399134.4	+	7	887	c.529C>T	c.(529-531)Cgg>Tgg	p.R177W	RP1-37N7.1_ENST00000579352.1_RNA	NM_001145127.1	NP_001138599.1	A8MZ36	EVPLL_HUMAN	envoplakin-like	177										NS(1)|endometrium(1)|large_intestine(1)|lung(2)	5						CGTCGTGGCGCGGGCAGAGCC	0.706																																					p.R177W		Atlas-SNP	.											.	EVPLL	10	.	0			c.C529T						PASS	.						5.0	8.0	7.0					17																	18286356		666	1537	2203	SO:0001583	missense	645027	exon7			GTGGCGCGGGCAG		CCDS45626.1	17p11.2	2009-08-25			ENSG00000214860	ENSG00000214860			35236	protein-coding gene	gene with protein product							Standard	NM_001145127		Approved		uc002gte.3	A8MZ36	OTTHUMG00000059095	ENST00000399134.4:c.529C>T	chr17.hg19:g.18286356C>T	ENSP00000382086:p.Arg177Trp	39.0	0.0	.		60.0	15.0	.	NM_001145127	B4DPD4	Missense_Mutation	SNP	ENST00000399134.4	hg19	CCDS45626.1	.	.	.	.	.	.	.	.	.	.	.	14.63	2.591371	0.46214	.	.	ENSG00000214860	ENST00000399134	T	0.26373	1.74	0.505	0.505	0.16953	.	.	.	.	.	T	0.13200	0.0320	N	0.19112	0.55	0.24914	N	0.992025	D	0.67145	0.996	B	0.40982	0.345	T	0.17167	-1.0378	9	0.66056	D	0.02	.	3.564	0.07893	0.4389:0.561:1.0E-4:1.0E-4	.	177	A8MZ36	EVPLL_HUMAN	W	177	ENSP00000382086:R177W	ENSP00000382086:R177W	R	+	1	2	EVPLL	18227081	0.868000	0.29978	0.989000	0.46669	0.453000	0.32348	-0.765000	0.04730	0.554000	0.29061	0.089000	0.15464	CGG	.	.	.	none		0.706	EVPLL-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000130836.2	NM_001145127	
SLFN11	91607	hgsc.bcm.edu	37	17	33679953	33679953	+	Silent	SNP	A	A	G			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr17:33679953A>G	ENST00000394566.1	-	7	2400	c.2128T>C	c.(2128-2130)Ttg>Ctg	p.L710L	SLFN11_ENST00000308377.4_Silent_p.L710L	NM_001104587.1|NM_001104588.1|NM_001104589.1|NM_001104590.1	NP_001098057.1|NP_001098058.1|NP_001098059.1|NP_001098060.1	Q7Z7L1	SLN11_HUMAN	schlafen family member 11	710					defense response to virus (GO:0051607)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|tRNA binding (GO:0000049)			autonomic_ganglia(1)|breast(1)|kidney(3)|large_intestine(14)|lung(17)|ovary(1)|prostate(4)|skin(2)|stomach(5)|upper_aerodigestive_tract(2)	50		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CTGCAATCCAAGTGGCTGGTC	0.483																																					p.L710L		Atlas-SNP	.											SLFN11,right_upper_lobe,carcinoma,0,1	SLFN11	112	.	0			c.T2128C						PASS	.						115.0	120.0	118.0					17																	33679953		2203	4300	6503	SO:0001819	synonymous_variant	91607	exon5			AATCCAAGTGGCT	AK074184	CCDS11294.1	17q12	2006-04-05			ENSG00000172716	ENSG00000172716			26633	protein-coding gene	gene with protein product		614953				12477932	Standard	NM_001104587		Approved	FLJ34922	uc010ctr.3	Q7Z7L1	OTTHUMG00000132948	ENST00000394566.1:c.2128T>C	chr17.hg19:g.33679953A>G		94.0	0.0	.		136.0	46.0	.	NM_152270	E1P643|Q8N3S8|Q8N762|Q8TEE0	Silent	SNP	ENST00000394566.1	hg19	CCDS11294.1																																																																																			.	.	.	none		0.483	SLFN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256480.1	NM_152270	
TNS4	84951	hgsc.bcm.edu	37	17	38634839	38634839	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr17:38634839G>A	ENST00000254051.6	-	11	2130	c.1972C>T	c.(1972-1974)Caa>Taa	p.Q658*		NM_032865.5	NP_116254.4	Q8IZW8	TENS4_HUMAN	tensin 4	658	Phosphatase tensin-type.				apoptotic process (GO:0006915)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	30		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			TACTTCCGTTGCTCAGGGTCC	0.622																																					p.Q658X		Atlas-SNP	.											.	TNS4	72	.	0			c.C1972T						PASS	.						102.0	87.0	92.0					17																	38634839		2203	4300	6503	SO:0001587	stop_gained	84951	exon11			TCCGTTGCTCAGG	AF417488	CCDS11368.1	17q21.2	2013-02-14			ENSG00000131746	ENSG00000131746		"""SH2 domain containing"""	24352	protein-coding gene	gene with protein product	"""C terminal tensin like"""	608385				12154022, 12711115	Standard	NM_032865		Approved	CTEN	uc010cxb.3	Q8IZW8	OTTHUMG00000133330	ENST00000254051.6:c.1972C>T	chr17.hg19:g.38634839G>A	ENSP00000254051:p.Gln658*	87.0	0.0	.		118.0	46.0	.	NM_032865	A6NMJ7|Q71RB7|Q8WV64|Q96JV4	Nonsense_Mutation	SNP	ENST00000254051.6	hg19	CCDS11368.1	.	.	.	.	.	.	.	.	.	.	G	39	7.830813	0.98513	.	.	ENSG00000131746	ENST00000377816;ENST00000394072;ENST00000254051	.	.	.	5.0	4.02	0.46733	.	0.000000	0.39475	N	0.001345	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-3.8218	7.5698	0.27900	0.0869:0.0:0.7019:0.2112	.	.	.	.	X	658;71;658	.	ENSP00000254051:Q658X	Q	-	1	0	TNS4	35888365	0.997000	0.39634	1.000000	0.80357	0.978000	0.69477	1.654000	0.37334	2.326000	0.78906	0.462000	0.41574	CAA	.	.	.	none		0.622	TNS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257154.3	NM_032865	
KRTAP4-5	85289	hgsc.bcm.edu	37	17	39305773	39305775	+	Missense_Mutation	TNP	TCT	TCT	GGC	rs137947981|rs141265645|rs201152898|rs535144703|rs58117746	byFrequency	TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	T|C|T	T|C|T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr17:39305773_39305775TCT>GGC	ENST00000343246.4	-	1	279_281	c.245_247AGA>GCC	c.(244-249)cAGAcc>cGCCcc	p.82_83QT>RP		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	82	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.Q82H(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			cagcaggtggtctggcagcagca	0.655																																					p.T83P|p.Q82H|p.Q82R		Atlas-SNP	.											.|KRTAP4-5,NS,carcinoma,0,1|KRTAP4-5,NS,carcinoma,+1,1	KRTAP4-5	34	.	1	Substitution - Missense(1)	lung(1)	c.A247C|c.G246C|c.A245G						PASS	.																																			SO:0001583	missense	85289	exon1			AGGTGGTCTGGCA|GGTGGTCTGGCAG|GTGGTCTGGCAGC	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.245_247AGA>GCC	chr17.hg19:g.39305773TCT>GGC	ENSP00000340546:p.Q82_T83delinsRP	56.0|55.0|52.0	0.0	.		84.0|83.0|81.0	32.0|32.0|33.0	.	NM_033188		Missense_Mutation	SNP	ENST00000343246.4	hg19	CCDS32650.1																																																																																			.	.	.	weak		0.655	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257783.1		
CHAD	1101	hgsc.bcm.edu	37	17	48545565	48545565	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr17:48545565T>C	ENST00000508540.1	-	1	762	c.610A>G	c.(610-612)Agg>Ggg	p.R204G	ACSF2_ENST00000502667.1_Intron|ACSF2_ENST00000504392.1_Intron|ACSF2_ENST00000300441.4_Intron|ACSF2_ENST00000541920.1_Intron|CHAD_ENST00000258969.4_Missense_Mutation_p.R204G|ACSF2_ENST00000427954.2_Intron	NM_001267.2	NP_001258.2	O15335	CHAD_HUMAN	chondroadherin	204					bone development (GO:0060348)|cartilage condensation (GO:0001502)|negative regulation of bone trabecula formation (GO:1900155)	proteinaceous extracellular matrix (GO:0005578)				central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(2)|ovary(2)	15	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			AGCTGGTTCCTGTCCACGTGG	0.622																																					p.R204G		Atlas-SNP	.											.	CHAD	36	.	0			c.A610G						PASS	.						89.0	92.0	91.0					17																	48545565		2203	4300	6503	SO:0001583	missense	1101	exon1			GGTTCCTGTCCAC	U96767	CCDS11568.1	17q21.33	2008-02-05			ENSG00000136457	ENSG00000136457		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	1909	protein-coding gene	gene with protein product	"""chondroadherin proteoglycan"""	602178				9344663	Standard	NM_001267		Approved	SLRR4A	uc010dbr.3	O15335	OTTHUMG00000162129	ENST00000508540.1:c.610A>G	chr17.hg19:g.48545565T>C	ENSP00000423812:p.Arg204Gly	88.0	0.0	.		131.0	33.0	.	NM_001267	A8K812|Q6GTU0|Q96RJ5	Missense_Mutation	SNP	ENST00000508540.1	hg19	CCDS11568.1	.	.	.	.	.	.	.	.	.	.	T	9.910	1.209334	0.22205	.	.	ENSG00000136457	ENST00000508540;ENST00000258969	T;T	0.57107	0.42;0.42	4.59	2.26	0.28386	.	0.483431	0.24328	N	0.039484	T	0.22666	0.0547	N	0.03281	-0.365	0.27249	N	0.958952	B	0.02656	0.0	B	0.01281	0.0	T	0.18241	-1.0343	10	0.14252	T	0.57	.	6.2292	0.20726	0.0:0.0792:0.3141:0.6067	.	204	O15335	CHAD_HUMAN	G	204	ENSP00000423812:R204G;ENSP00000258969:R204G	ENSP00000258969:R204G	R	-	1	2	CHAD	45900564	0.939000	0.31865	0.994000	0.49952	0.979000	0.70002	0.446000	0.21694	0.242000	0.21303	0.460000	0.39030	AGG	.	.	.	none		0.622	CHAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367447.3	NM_001267	
CARD14	79092	hgsc.bcm.edu	37	17	78178935	78178935	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr17:78178935C>A	ENST00000573882.1	+	20	3036	c.2500C>A	c.(2500-2502)Ccc>Acc	p.P834T	CARD14_ENST00000344227.2_Missense_Mutation_p.P834T|RP11-334C17.5_ENST00000576824.1_RNA|RP11-334C17.5_ENST00000573935.1_RNA|RP11-334C17.5_ENST00000573346.1_RNA|RP11-334C17.5_ENST00000572730.1_RNA|RP11-334C17.5_ENST00000570309.1_RNA			Q9BXL6	CAR14_HUMAN	caspase recruitment domain family, member 14	834	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)			NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(5)|prostate(1)|skin(1)	23	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.017)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			GCTCCTCGTGCCCAGGGCGGT	0.652																																					p.P834T		Atlas-SNP	.											.	CARD14	98	.	0			c.C2500A						PASS	.						75.0	72.0	73.0					17																	78178935		2203	4300	6503	SO:0001583	missense	79092	exon18			CTCGTGCCCAGGG	AF322642	CCDS11768.1, CCDS58605.1	17q25.3	2014-09-04			ENSG00000141527	ENSG00000141527			16446	protein-coding gene	gene with protein product		607211	"""psoriasis susceptibility 2"""	PSORS2		11278692, 11356195, 22521418	Standard	NM_052819		Approved	CARMA2, BIMP2	uc031res.1	Q9BXL6	OTTHUMG00000177549	ENST00000573882.1:c.2500C>A	chr17.hg19:g.78178935C>A	ENSP00000458715:p.Pro834Thr	70.0	0.0	.		96.0	32.0	.	NM_024110	B8QQJ3|Q9BVB5	Missense_Mutation	SNP	ENST00000573882.1	hg19	CCDS11768.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.986821	0.74589	.	.	ENSG00000141527	ENST00000344227	T	0.06371	3.31	4.13	4.13	0.48395	Guanylate kinase/L-type calcium channel (1);	0.000000	0.85682	D	0.000000	T	0.25606	0.0623	M	0.80746	2.51	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.02345	-1.1173	10	0.54805	T	0.06	-27.3668	13.8635	0.63574	0.0:1.0:0.0:0.0	.	834	Q9BXL6	CAR14_HUMAN	T	834	ENSP00000344549:P834T	ENSP00000344549:P834T	P	+	1	0	CARD14	75793530	1.000000	0.71417	0.990000	0.47175	0.847000	0.48162	6.111000	0.71541	1.861000	0.53984	0.491000	0.48974	CCC	.	.	.	none		0.652	CARD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437507.1		
CEP192	55125	hgsc.bcm.edu	37	18	13105009	13105009	+	Silent	SNP	T	T	C			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr18:13105009T>C	ENST00000325971.8	+	38	6783	c.5190T>C	c.(5188-5190)ttT>ttC	p.F1730F	CEP192_ENST00000540847.2_3'UTR|CEP192_ENST00000430049.2_Silent_p.F1851F|CEP192_ENST00000506447.1_Silent_p.F2326F			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	1730					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						GAGATGTTTTTAGAGCTACCT	0.373																																					p.F2326F		Atlas-SNP	.											.	CEP192	340	.	0			c.T6978C						PASS	.						232.0	218.0	223.0					18																	13105009		2203	4300	6503	SO:0001819	synonymous_variant	55125	exon40			TGTTTTTAGAGCT	AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.5190T>C	chr18.hg19:g.13105009T>C		115.0	0.0	.		71.0	28.0	.	NM_032142	A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Silent	SNP	ENST00000325971.8	hg19																																																																																				.	.	.	none		0.373	CEP192-201	KNOWN	basic	protein_coding	protein_coding		NM_032142	
EPG5	57724	hgsc.bcm.edu	37	18	43481032	43481032	+	Silent	SNP	A	A	C			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr18:43481032A>C	ENST00000282041.5	-	26	4609	c.4575T>G	c.(4573-4575)gcT>gcG	p.A1525A	EPG5_ENST00000585906.1_5'UTR	NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	1525					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						TCAATAGCACAGCAGAGGAAA	0.542																																					p.A1525A		Atlas-SNP	.											.	EPG5	199	.	0			c.T4575G						PASS	.						72.0	77.0	75.0					18																	43481032		2081	4216	6297	SO:0001819	synonymous_variant	57724	exon26			TAGCACAGCAGAG	AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.4575T>G	chr18.hg19:g.43481032A>C		74.0	0.0	.		60.0	20.0	.	NM_020964	A2BDF3|Q9H8C8	Silent	SNP	ENST00000282041.5	hg19	CCDS11926.2																																																																																			.	.	.	none		0.542	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445081.1	NM_020964	
SLC44A2	57153	hgsc.bcm.edu	37	19	10742023	10742023	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr19:10742023T>G	ENST00000335757.5	+	6	779	c.403T>G	c.(403-405)Tat>Gat	p.Y135D	SLC44A2_ENST00000407327.4_Missense_Mutation_p.Y133D|SLC44A2_ENST00000586078.1_Missense_Mutation_p.Y135D			Q8IWA5	CTL2_HUMAN	solute carrier family 44 (choline transporter), member 2	135					choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)|signal transducer activity (GO:0004871)			NS(1)|breast(3)|endometrium(5)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	27			Epithelial(33;8.7e-06)|all cancers(31;2.77e-05)		Choline(DB00122)	CTTTGAGTACTATAAGCAGTT	0.522																																					p.Y135D		Atlas-SNP	.											.	SLC44A2	56	.	0			c.T403G						PASS	.						111.0	114.0	113.0					19																	10742023		2203	4300	6503	SO:0001583	missense	57153	exon6			GAGTACTATAAGC	AF070636	CCDS12245.1, CCDS54216.1	19p13.2	2014-08-12	2013-07-17		ENSG00000129353	ENSG00000129353		"""Solute carriers"""	17292	protein-coding gene	gene with protein product		606106				10677542, 15715662	Standard	NM_001145056		Approved	CTL2	uc002mpf.3	Q8IWA5	OTTHUMG00000180585	ENST00000335757.5:c.403T>G	chr19.hg19:g.10742023T>G	ENSP00000336888:p.Tyr135Asp	50.0	0.0	.		60.0	23.0	.	NM_020428	B2RBB1|B3KNH3|B4DFJ0|F2Q9D7|Q658V1|Q658Z2|Q6PJV7|Q8N2F0|Q9NY68	Missense_Mutation	SNP	ENST00000335757.5	hg19	CCDS12245.1	.	.	.	.	.	.	.	.	.	.	T	16.07	3.019151	0.54576	.	.	ENSG00000129353	ENST00000407327;ENST00000335757;ENST00000380614	T;T	0.09538	2.97;2.98	4.86	4.86	0.63082	.	0.062114	0.64402	D	0.000003	T	0.19565	0.0470	M	0.87682	2.9	0.51482	D	0.999924	B;B	0.02656	0.0;0.0	B;B	0.12837	0.002;0.008	T	0.02560	-1.1141	10	0.36615	T	0.2	.	13.62	0.62132	0.0:0.0:0.0:1.0	.	135;133	Q8IWA5;Q8IWA5-3	CTL2_HUMAN;.	D	133;135;135	ENSP00000385135:Y133D;ENSP00000336888:Y135D	ENSP00000336888:Y135D	Y	+	1	0	SLC44A2	10603023	1.000000	0.71417	0.988000	0.46212	0.946000	0.59487	7.050000	0.76620	2.064000	0.61679	0.374000	0.22700	TAT	.	.	.	none		0.522	SLC44A2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452045.1		
FBL	2091	hgsc.bcm.edu	37	19	40330883	40330883	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr19:40330883A>C	ENST00000221801.3	-	4	481	c.368T>G	c.(367-369)gTc>gGc	p.V123G	FBL_ENST00000593503.1_5'Flank	NM_001436.3	NP_001427.2	P22087	FBRL_HUMAN	fibrillarin	123					histone glutamine methylation (GO:1990258)|osteoblast differentiation (GO:0001649)|rRNA processing (GO:0006364)|snoRNA metabolic process (GO:0016074)|tRNA processing (GO:0008033)	box C/D snoRNP complex (GO:0031428)|Cajal body (GO:0015030)|extracellular vesicular exosome (GO:0070062)|granular component (GO:0001652)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone-glutamine methyltransferase activity (GO:1990259)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)	9	all_cancers(60;5.79e-06)|all_lung(34;5.2e-08)|Lung NSC(34;6.14e-08)|Ovarian(47;0.06)	Renal(1328;0.000518)|Hepatocellular(1079;0.0893)	Epithelial(26;5.74e-25)|OV - Ovarian serous cystadenocarcinoma(5;3.13e-24)|all cancers(26;8.59e-23)	GBM - Glioblastoma multiforme(1328;0.000826)|STAD - Stomach adenocarcinoma(1328;0.138)		CGAAATCGAGACTCTCTTCTC	0.557																																					p.V123G		Atlas-SNP	.											.	FBL	37	.	0			c.T368G						PASS	.						97.0	84.0	88.0					19																	40330883		2203	4300	6503	SO:0001583	missense	2091	exon4			ATCGAGACTCTCT	AC005393	CCDS12545.1	19q13.1	2010-02-17			ENSG00000105202	ENSG00000105202			3599	protein-coding gene	gene with protein product		134795				1846968, 2026646	Standard	NM_001436		Approved	RNU3IP1, FLRN, FIB	uc002omn.3	P22087		ENST00000221801.3:c.368T>G	chr19.hg19:g.40330883A>C	ENSP00000221801:p.Val123Gly	103.0	0.0	.		112.0	13.0	.	NM_001436	B5BUE8|O75259|Q6IAT5|Q9UPI6	Missense_Mutation	SNP	ENST00000221801.3	hg19	CCDS12545.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.294597	0.81025	.	.	ENSG00000105202	ENST00000221801	.	.	.	5.08	5.08	0.68730	.	0.101737	0.64402	D	0.000005	T	0.74718	0.3753	M	0.72894	2.215	0.80722	D	1	D;P;D	0.62365	0.991;0.923;0.976	P;P;P	0.61722	0.864;0.64;0.893	T	0.78280	-0.2265	9	0.87932	D	0	-25.8191	12.8246	0.57712	1.0:0.0:0.0:0.0	.	123;62;123	B4DLD4;Q96BS4;P22087	.;.;FBRL_HUMAN	G	123	.	ENSP00000221801:V123G	V	-	2	0	FBL	45022723	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	8.304000	0.89958	1.909000	0.55274	0.418000	0.28097	GTC	.	.	.	none		0.557	FBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462509.4	NM_001436	
XRN2	22803	hgsc.bcm.edu	37	20	21321426	21321426	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr20:21321426C>G	ENST00000377191.3	+	15	1441	c.1346C>G	c.(1345-1347)cCa>cGa	p.P449R	XRN2_ENST00000430571.2_Missense_Mutation_p.P373R|XRN2_ENST00000539513.1_Missense_Mutation_p.P395R	NM_012255.3	NP_036387.2	Q9H0D6	XRN2_HUMAN	5'-3' exoribonuclease 2	449					cell growth (GO:0016049)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA-templated transcription, termination (GO:0006353)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA catabolic process (GO:0006401)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|RNA processing (GO:0006396)|spermatogenesis (GO:0007283)	aggresome (GO:0016235)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|5'-3' exoribonuclease activity (GO:0004534)|nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(6)|large_intestine(10)|lung(12)|ovary(1)|skin(5)	39						AGAAATTCACCAGGTTCTCAA	0.383																																					p.P449R		Atlas-SNP	.											.	XRN2	90	.	0			c.C1346G						PASS	.						114.0	116.0	115.0					20																	21321426		2203	4300	6503	SO:0001583	missense	22803	exon15			ATTCACCAGGTTC	AF064257	CCDS13144.1	20p11.2-p11.1	2011-09-12			ENSG00000088930	ENSG00000088930	3.1.13.-		12836	protein-coding gene	gene with protein product		608851				10409438	Standard	NM_012255		Approved		uc002wsf.1	Q9H0D6	OTTHUMG00000032025	ENST00000377191.3:c.1346C>G	chr20.hg19:g.21321426C>G	ENSP00000366396:p.Pro449Arg	130.0	0.0	.		175.0	54.0	.	NM_012255	Q3L8N4|Q6KGZ9|Q9BQL1|Q9NTW0|Q9NXS6|Q9UL53	Missense_Mutation	SNP	ENST00000377191.3	hg19	CCDS13144.1	.	.	.	.	.	.	.	.	.	.	C	14.89	2.671790	0.47781	.	.	ENSG00000088930	ENST00000377191;ENST00000430571;ENST00000539513	T;T;T	0.72942	-0.7;-0.7;-0.7	4.72	3.71	0.42584	.	0.160480	0.56097	D	0.000025	T	0.71467	0.3343	M	0.74258	2.255	0.58432	D	0.999998	P	0.40578	0.722	B	0.41988	0.372	T	0.73052	-0.4104	10	0.32370	T	0.25	-6.9533	14.7454	0.69488	0.1445:0.8555:0.0:0.0	.	449	Q9H0D6	XRN2_HUMAN	R	449;373;395	ENSP00000366396:P449R;ENSP00000413548:P373R;ENSP00000441113:P395R	ENSP00000366396:P449R	P	+	2	0	XRN2	21269426	0.995000	0.38212	1.000000	0.80357	0.979000	0.70002	3.365000	0.52335	2.340000	0.79590	0.460000	0.39030	CCA	.	.	.	none		0.383	XRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078273.2	NM_012255	
SRSF6	6431	hgsc.bcm.edu	37	20	42088517	42088517	+	Silent	SNP	C	C	T			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr20:42088517C>T	ENST00000244020.3	+	3	469	c.363C>T	c.(361-363)tgC>tgT	p.C121C		NM_006275.5	NP_006266.2	Q13247	SRSF6_HUMAN	serine/arginine-rich splicing factor 6	121	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splice site selection (GO:0006376)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell death (GO:0060548)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of keratinocyte proliferation (GO:0010837)|regulation of wound healing (GO:0061041)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA binding (GO:0003723)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|upper_aerodigestive_tract(2)	5						CTAGTCGGTGCAGTTGGCAAG	0.363																																					p.C121C		Atlas-SNP	.											.	SRSF6	37	.	0			c.C363T						PASS	.						129.0	121.0	124.0					20																	42088517		2203	4300	6503	SO:0001819	synonymous_variant	6431	exon3			TCGGTGCAGTTGG	U30883	CCDS13318.1	20q12-q13.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000124193	ENSG00000124193		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10788	protein-coding gene	gene with protein product	"""pre-mRNA splicing factor SRP55"", ""SR splicing factor 6"""	601944	"""splicing factor, arginine/serine-rich 6"""	SFRS6		7556075, 20516191	Standard	NM_006275		Approved	SRP55, B52	uc010zwg.2	Q13247	OTTHUMG00000032502	ENST00000244020.3:c.363C>T	chr20.hg19:g.42088517C>T		131.0	0.0	.		128.0	38.0	.	NM_006275	B7Z6J3|E1P5W6|Q13244|Q13245|Q96J06|Q9UJB8|Q9Y3N7	Silent	SNP	ENST00000244020.3	hg19	CCDS13318.1																																																																																			.	.	.	none		0.363	SRSF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079292.1	NM_006275	
CBLN4	140689	hgsc.bcm.edu	37	20	54579177	54579177	+	Silent	SNP	G	G	A			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr20:54579177G>A	ENST00000064571.2	-	1	1351	c.51C>T	c.(49-51)gtC>gtT	p.V17V		NM_080617.5	NP_542184.1	Q9NTU7	CBLN4_HUMAN	cerebellin 4 precursor	17					protein secretion (GO:0009306)	cell junction (GO:0030054)|extracellular space (GO:0005615)|synapse (GO:0045202)				endometrium(2)|large_intestine(1)|lung(10)|ovary(3)|pancreas(1)	17			Colorectal(105;0.202)			GCAGCGTGAGGACCAGCAGCA	0.746																																					p.V17V		Atlas-SNP	.											.	CBLN4	54	.	0			c.C51T						PASS	.						19.0	17.0	18.0					20																	54579177		2196	4292	6488	SO:0001819	synonymous_variant	140689	exon1			CGTGAGGACCAGC	AY358527	CCDS13448.1	20q13	2004-08-19	2004-08-19	2004-08-19	ENSG00000054803	ENSG00000054803			16231	protein-coding gene	gene with protein product		615029	"""cerebellin precursor-like 1"""	CBLNL1			Standard	NM_080617		Approved	dJ885A10.1	uc002xxa.4	Q9NTU7	OTTHUMG00000032782	ENST00000064571.2:c.51C>T	chr20.hg19:g.54579177G>A		27.0	0.0	.		40.0	11.0	.	NM_080617	A8K0S5	Silent	SNP	ENST00000064571.2	hg19	CCDS13448.1																																																																																			.	.	.	none		0.746	CBLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079783.2	NM_080617	
CSTF1	1477	hgsc.bcm.edu	37	20	54972276	54972276	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr20:54972276T>G	ENST00000217109.4	+	3	535	c.183T>G	c.(181-183)gaT>gaG	p.D61E	CSTF1_ENST00000493039.1_3'UTR	NM_001033521.1|NM_001324.2	NP_001028693.1|NP_001315.1	Q05048	CSTF1_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa	61					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	15			Colorectal(105;0.202)			TGGAAAACGATGACACCGCAG	0.408																																					p.D61E		Atlas-SNP	.											.	CSTF1	29	.	0			c.T183G						PASS	.						111.0	107.0	108.0					20																	54972276		2203	4300	6503	SO:0001583	missense	1477	exon3			AAACGATGACACC		CCDS13452.1	20q13.31	2013-01-10	2002-08-29		ENSG00000101138	ENSG00000101138		"""WD repeat domain containing"""	2483	protein-coding gene	gene with protein product		600369	"""cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kD"""			1358884, 11257228	Standard	NM_001033521		Approved		uc002xxl.1	Q05048	OTTHUMG00000032791	ENST00000217109.4:c.183T>G	chr20.hg19:g.54972276T>G	ENSP00000217109:p.Asp61Glu	124.0	0.0	.		107.0	53.0	.	NM_001033522	Q5QPD8	Missense_Mutation	SNP	ENST00000217109.4	hg19	CCDS13452.1	.	.	.	.	.	.	.	.	.	.	T	5.796	0.331191	0.10956	.	.	ENSG00000101138	ENST00000415828;ENST00000217109;ENST00000428552;ENST00000425890;ENST00000452950	T;T;T	0.55760	0.5;0.52;0.5	6.06	2.6	0.31112	.	0.127094	0.64402	D	0.000001	T	0.22475	0.0542	N	0.03608	-0.345	0.48040	D	0.999574	B	0.12630	0.006	B	0.06405	0.002	T	0.24048	-1.0171	10	0.02654	T	1	5.922	9.8264	0.40914	0.0:0.3244:0.0:0.6756	.	61	Q05048	CSTF1_HUMAN	E	61;61;61;48;61	ENSP00000387968:D61E;ENSP00000217109:D61E;ENSP00000409035:D61E	ENSP00000217109:D61E	D	+	3	2	CSTF1	54405683	0.978000	0.34361	0.433000	0.26760	0.981000	0.71138	0.092000	0.15066	0.182000	0.20032	-0.256000	0.11100	GAT	.	.	.	none		0.408	CSTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079794.2	NM_001033521	
RTEL1	51750	hgsc.bcm.edu	37	20	62322275	62322275	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr20:62322275G>A	ENST00000360203.5	+	27	2856	c.2531G>A	c.(2530-2532)cGg>cAg	p.R844Q	RTEL1-TNFRSF6B_ENST00000482936.1_Missense_Mutation_p.R844Q|RTEL1_ENST00000370018.3_Missense_Mutation_p.R844Q|RTEL1_ENST00000370003.1_Missense_Mutation_p.R89Q|RTEL1_ENST00000508582.2_Missense_Mutation_p.R868Q|RTEL1_ENST00000318100.4_Missense_Mutation_p.R844Q					regulator of telomere elongation helicase 1											NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			AGCGAACAGCGGGCGGGGAGC	0.682																																					p.R868Q		Atlas-SNP	.											.	RTEL1	114	.	0			c.G2603A						PASS	.						15.0	17.0	16.0					20																	62322275		2121	4219	6340	SO:0001583	missense	51750	exon27			AACAGCGGGCGGG	AB029011	CCDS13530.2, CCDS13531.1, CCDS13530.3, CCDS63331.1, CCDS74751.1	20q13.3	2012-06-27	2004-10-29	2004-10-29	ENSG00000258366	ENSG00000258366			15888	protein-coding gene	gene with protein product		608833	"""chromosome 20 open reading frame 41"""	C20orf41		10655513, 15210109	Standard	NM_016434		Approved	bK3184A7.3, NHL, DKFZP434C013, KIAA1088, RTEL	uc011abd.2	Q9NZ71	OTTHUMG00000032992	ENST00000360203.5:c.2531G>A	chr20.hg19:g.62322275G>A	ENSP00000353332:p.Arg844Gln	81.0	0.0	.		104.0	39.0	.	NM_032957		Missense_Mutation	SNP	ENST00000360203.5	hg19		.	.	.	.	.	.	.	.	.	.	G	9.354	1.066199	0.20067	.	.	ENSG00000258366	ENST00000370018;ENST00000318100;ENST00000508582;ENST00000360203;ENST00000370003	T;T;T;T;T	0.08896	3.04;3.04;3.04;3.04;3.04	4.77	-9.54	0.00572	.	2.650120	0.01147	N	0.006331	T	0.02848	0.0085	N	0.03608	-0.345	0.09310	N	1	B;B;B;B	0.14012	0.009;0.003;0.0;0.001	B;B;B;B	0.06405	0.002;0.001;0.0;0.001	T	0.33137	-0.9880	10	0.14252	T	0.57	-0.0689	6.1268	0.20184	0.4743:0.0:0.3168:0.2089	.	868;89;844;844	Q9NZ71-7;Q9NZ71-5;Q9NZ71;Q9NZ71-6	.;.;RTEL1_HUMAN;.	Q	844;844;868;844;89	ENSP00000359035:R844Q;ENSP00000322287:R844Q;ENSP00000424307:R868Q;ENSP00000353332:R844Q;ENSP00000359020:R89Q	ENSP00000353332:R844Q	R	+	2	0	AL353715.1	61792719	0.000000	0.05858	0.004000	0.12327	0.003000	0.03518	-1.477000	0.02331	-2.313000	0.00648	-1.008000	0.02478	CGG	.	.	.	none		0.682	RTEL1-011	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000289781.1	NM_032957	
PTTG1IP	754	hgsc.bcm.edu	37	21	46285323	46285323	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr21:46285323A>G	ENST00000330938.3	-	2	375	c.155T>C	c.(154-156)cTg>cCg	p.L52P	PTTG1IP_ENST00000445724.2_Missense_Mutation_p.L52P|PTTG1IP_ENST00000494690.1_5'UTR|PTTG1IP_ENST00000397887.3_Missense_Mutation_p.L52P	NM_004339.3	NP_004330.1	P53801	PTTG_HUMAN	pituitary tumor-transforming 1 interacting protein	52	PSI.				multicellular organismal development (GO:0007275)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	receptor activity (GO:0004872)			ovary(1)|prostate(1)	2				Colorectal(79;0.0659)		GACGTTCTTCAGGCACTCTTC	0.507																																					p.L52P		Atlas-SNP	.											.	PTTG1IP	22	.	0			c.T155C						PASS	.						198.0	145.0	163.0					21																	46285323		2203	4300	6503	SO:0001583	missense	754	exon2			TTCTTCAGGCACT	AF149785	CCDS13715.1, CCDS68221.1	21q22.3	2008-07-04			ENSG00000183255	ENSG00000183255			13524	protein-coding gene	gene with protein product		603784		C21orf3, C21orf1		9570958, 10830953	Standard	NM_004339		Approved	PBF	uc002zgb.2	P53801	OTTHUMG00000090254	ENST00000330938.3:c.155T>C	chr21.hg19:g.46285323A>G	ENSP00000328325:p.Leu52Pro	65.0	0.0	.		45.0	17.0	.	NM_004339	B2RDP7|D3DSL9|Q9NS09	Missense_Mutation	SNP	ENST00000330938.3	hg19	CCDS13715.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.965227	0.74131	.	.	ENSG00000183255	ENST00000397887;ENST00000330938;ENST00000445724	T;T;T	0.69806	-0.43;-0.43;0.8	4.66	4.66	0.58398	.	0.000000	0.64402	D	0.000001	T	0.80507	0.4636	M	0.76170	2.325	0.80722	D	1	D;D	0.89917	1.0;0.996	D;D	0.87578	0.998;0.958	T	0.83101	-0.0128	10	0.87932	D	0	-45.6165	13.1312	0.59382	1.0:0.0:0.0:0.0	.	52;52	B4DPZ0;P53801	.;PTTG_HUMAN	P	52	ENSP00000380984:L52P;ENSP00000328325:L52P;ENSP00000395374:L52P	ENSP00000328325:L52P	L	-	2	0	PTTG1IP	45109751	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.973000	0.70456	1.735000	0.51646	0.451000	0.29950	CTG	.	.	.	none		0.507	PTTG1IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206553.1		
MICAL3	57553	hgsc.bcm.edu	37	22	18369959	18369959	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr22:18369959T>C	ENST00000441493.2	-	15	2396	c.2044A>G	c.(2044-2046)Aga>Gga	p.R682G	MICAL3_ENST00000207726.7_Missense_Mutation_p.R682G|MICAL3_ENST00000383094.3_Missense_Mutation_p.R682G|MICAL3_ENST00000414725.2_Missense_Mutation_p.R682G|MICAL3_ENST00000429452.1_Missense_Mutation_p.R682G|MICAL3_ENST00000400561.2_Missense_Mutation_p.R682G|MICAL3_ENST00000444520.1_Missense_Mutation_p.R682G|MICAL3_ENST00000585038.1_Missense_Mutation_p.R682G	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	682					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		CTGGTCTTTCTCCTCTTCCCA	0.428																																					p.R682G		Atlas-SNP	.											.	MICAL3	53	.	0			c.A2044G						PASS	.						143.0	122.0	129.0					22																	18369959		1568	3582	5150	SO:0001583	missense	57553	exon15			TCTTTCTCCTCTT	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.2044A>G	chr22.hg19:g.18369959T>C	ENSP00000416015:p.Arg682Gly	137.0	0.0	.		128.0	47.0	.	NM_015241	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Missense_Mutation	SNP	ENST00000441493.2	hg19	CCDS46659.1	.	.	.	.	.	.	.	.	.	.	T	18.79	3.699631	0.68501	.	.	ENSG00000093100;ENSG00000093100;ENSG00000243156;ENSG00000243156;ENSG00000243156;ENSG00000243156;ENSG00000243156	ENST00000441493;ENST00000429452;ENST00000400561;ENST00000444520;ENST00000414725;ENST00000383094;ENST00000207726	T;T;T;T;T;T;T	0.69806	-0.19;-0.43;-0.27;-0.27;-0.26;-0.26;-0.26	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.73666	0.3616	M	0.77820	2.39	0.58432	D	0.999998	P;B;B;P;P	0.43633	0.546;0.438;0.38;0.554;0.813	B;B;P;B;B	0.46049	0.156;0.343;0.502;0.322;0.202	T	0.75193	-0.3404	10	0.42905	T	0.14	.	16.3721	0.83368	0.0:0.0:0.0:1.0	.	682;682;682;682;682	B2RXJ5;Q7RTP6-3;Q7RTP6-2;Q7RTP6-4;Q7RTP6	.;.;.;.;MICA3_HUMAN	G	682	ENSP00000416015:R682G;ENSP00000414846:R682G;ENSP00000383406:R682G;ENSP00000410315:R682G;ENSP00000391827:R682G;ENSP00000372574:R682G;ENSP00000207726:R682G	ENSP00000207726:R682G	R	-	1	2	XXbac-B461K10.4;MICAL3	16749959	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.495000	0.66912	2.257000	0.74773	0.533000	0.62120	AGA	.	.	.	none		0.428	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1		
RGL4	266747	hgsc.bcm.edu	37	22	24036113	24036113	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr22:24036113G>C	ENST00000290691.5	+	4	2034	c.864G>C	c.(862-864)agG>agC	p.R288S	RGL4_ENST00000401461.1_Missense_Mutation_p.R152S|KB-1572G7.2_ENST00000421064.1_RNA|AP000347.2_ENST00000417194.1_RNA|GUSBP11_ENST00000455485.1_RNA	NM_153615.1	NP_705843.1	Q8IZJ4	RGDSR_HUMAN	ral guanine nucleotide dissociation stimulator-like 4	288	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)	guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(3)	15						ACAGCATGAGGGCCCGGGACA	0.592																																					p.R288S		Atlas-SNP	.											.	RGL4	29	.	0			c.G864C						PASS	.						83.0	62.0	69.0					22																	24036113		2203	4300	6503	SO:0001583	missense	266747	exon4			CATGAGGGCCCGG		CCDS13811.1	22q11.23	2008-02-22			ENSG00000159496	ENSG00000159496			31911	protein-coding gene	gene with protein product	"""RalGDS related oncogene"""	612214				9178890, 10851075	Standard	NM_153615		Approved	Rgr	uc002zxn.3	Q8IZJ4	OTTHUMG00000150711	ENST00000290691.5:c.864G>C	chr22.hg19:g.24036113G>C	ENSP00000290691:p.Arg288Ser	146.0	0.0	.		117.0	33.0	.	NM_153615	Q495L8	Missense_Mutation	SNP	ENST00000290691.5	hg19	CCDS13811.1	.	.	.	.	.	.	.	.	.	.	g	10.17	1.277356	0.23307	.	.	ENSG00000159496	ENST00000401461;ENST00000290691;ENST00000382833;ENST00000423392	T;T;T	0.27104	1.69;1.69;1.69	2.6	-3.45	0.04781	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.412983	0.19855	N	0.104560	T	0.22360	0.0539	L	0.33668	1.02	0.09310	N	1	P;P;B;P	0.45986	0.87;0.87;0.043;0.87	P;P;B;P	0.54815	0.61;0.61;0.079;0.761	T	0.13019	-1.0525	10	0.36615	T	0.2	.	3.8098	0.08792	0.45:0.0:0.382:0.168	.	152;152;288;288	E7EW79;Q495L8;E9PH87;Q8IZJ4	.;.;.;RGDSR_HUMAN	S	152;288;288;288	ENSP00000383951:R152S;ENSP00000290691:R288S;ENSP00000402142:R288S	ENSP00000290691:R288S	R	+	3	2	RGL4	22366113	1.000000	0.71417	0.000000	0.03702	0.025000	0.11179	2.771000	0.47670	-0.757000	0.04697	-0.399000	0.06403	AGG	.	.	.	none		0.592	RGL4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319711.1	NM_153615	
CCDC117	150275	hgsc.bcm.edu	37	22	29182126	29182126	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr22:29182126C>G	ENST00000249064.4	+	5	828	c.652C>G	c.(652-654)Ctt>Gtt	p.L218V	CCDC117_ENST00000448492.2_Missense_Mutation_p.L200V|CCDC117_ENST00000421503.2_Missense_Mutation_p.L143V|CCDC117_ENST00000443309.2_Missense_Mutation_p.L86V	NM_001284263.1|NM_001284265.1|NM_173510.2	NP_001271192.1|NP_001271194.1|NP_775781.1	Q8IWD4	CC117_HUMAN	coiled-coil domain containing 117	218										breast(1)|kidney(1)|large_intestine(4)|upper_aerodigestive_tract(1)	7						CCCTGAACTCCTTTCTGATAA	0.433																																					p.L218V		Atlas-SNP	.											.	CCDC117	26	.	0			c.C652G						PASS	.						76.0	75.0	75.0					22																	29182126		2203	4300	6503	SO:0001583	missense	150275	exon5			GAACTCCTTTCTG	AK091133	CCDS13846.1, CCDS63435.1, CCDS63436.1	22q12.1	2006-06-27			ENSG00000159873	ENSG00000159873			26599	protein-coding gene	gene with protein product						12477932	Standard	NM_001284263		Approved	FLJ33814	uc003aeb.3	Q8IWD4	OTTHUMG00000151091	ENST00000249064.4:c.652C>G	chr22.hg19:g.29182126C>G	ENSP00000249064:p.Leu218Val	165.0	0.0	.		156.0	68.0	.	NM_173510	A8K0F1|B7Z2V1|B7Z860|Q6ICA7|Q8N278	Missense_Mutation	SNP	ENST00000249064.4	hg19	CCDS13846.1	.	.	.	.	.	.	.	.	.	.	C	19.85	3.904080	0.72754	.	.	ENSG00000159873	ENST00000249064;ENST00000448492;ENST00000421503;ENST00000443309	T;T;T;T	0.18502	2.21;2.21;2.21;2.21	5.94	5.94	0.96194	.	0.072659	0.56097	D	0.000021	T	0.30324	0.0761	L	0.36672	1.1	0.43564	D	0.995887	D;D;D	0.65815	0.995;0.995;0.995	P;P;P	0.61800	0.894;0.857;0.857	T	0.00455	-1.1729	10	0.72032	D	0.01	.	15.7233	0.77732	0.1369:0.863:0.0:0.0	.	143;200;218	B7Z2V1;B7Z860;Q8IWD4	.;.;CC117_HUMAN	V	218;200;143;86	ENSP00000249064:L218V;ENSP00000389478:L200V;ENSP00000387827:L143V;ENSP00000399363:L86V	ENSP00000249064:L218V	L	+	1	0	CCDC117	27512126	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.531000	0.45650	2.816000	0.96949	0.561000	0.74099	CTT	.	.	.	none		0.433	CCDC117-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321258.1	NM_173510	
TMPRSS6	164656	hgsc.bcm.edu	37	22	37471189	37471189	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr22:37471189T>C	ENST00000346753.3	-	11	1471	c.1355A>G	c.(1354-1356)tAc>tGc	p.Y452C	TMPRSS6_ENST00000381792.2_Missense_Mutation_p.Y443C|TMPRSS6_ENST00000406725.1_Missense_Mutation_p.Y443C|TMPRSS6_ENST00000406856.1_Missense_Mutation_p.Y443C	NM_153609.2	NP_705837.1	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	452	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				angiogenesis (GO:0001525)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|intracellular signal transduction (GO:0035556)|iron ion homeostasis (GO:0055072)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			breast(5)|central_nervous_system(4)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)	40						CGACTGGTTGTACAAGCCATA	0.662																																					p.Y452C		Atlas-SNP	.											.	TMPRSS6	99	.	0			c.A1355G						PASS	.						56.0	61.0	60.0					22																	37471189		2203	4300	6503	SO:0001583	missense	164656	exon11			TGGTTGTACAAGC	AY055383	CCDS13941.1, CCDS74856.1, CCDS74857.1	22q13.1	2010-04-13			ENSG00000187045	ENSG00000187045		"""Serine peptidases / Transmembrane"""	16517	protein-coding gene	gene with protein product		609862					Standard	NM_001289000		Approved	FLJ30744	uc003aqs.1	Q8IU80	OTTHUMG00000150541	ENST00000346753.3:c.1355A>G	chr22.hg19:g.37471189T>C	ENSP00000334962:p.Tyr452Cys	113.0	0.0	.		96.0	42.0	.	NM_153609	B0QYB4|B0QYB7|B0QYB8|Q5TI06|Q6ICC2|Q6UXD8|Q8IUE2|Q8IXV8	Missense_Mutation	SNP	ENST00000346753.3	hg19	CCDS13941.1	.	.	.	.	.	.	.	.	.	.	T	19.34	3.809609	0.70797	.	.	ENSG00000187045	ENST00000381792;ENST00000346753;ENST00000406725;ENST00000406856	D;D;D;D	0.92805	-3.11;-3.1;-3.09;-3.11	5.27	5.27	0.74061	CUB (3);	0.067665	0.64402	D	0.000008	D	0.94262	0.8157	M	0.62723	1.935	0.48762	D	0.9997	D;D	0.69078	0.997;0.994	P;P	0.58873	0.847;0.707	D	0.94866	0.8026	10	0.87932	D	0	.	15.1744	0.72899	0.0:0.0:0.0:1.0	.	443;452	Q8IU80-5;Q8IU80	.;TMPS6_HUMAN	C	443;452;443;443	ENSP00000371211:Y443C;ENSP00000334962:Y452C;ENSP00000385453:Y443C;ENSP00000384964:Y443C	ENSP00000334962:Y452C	Y	-	2	0	TMPRSS6	35801135	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	5.548000	0.67255	1.986000	0.57962	0.459000	0.35465	TAC	.	.	.	none		0.662	TMPRSS6-003	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000318822.1	NM_153609	
EP300	2033	hgsc.bcm.edu	37	22	41572322	41572322	+	Silent	SNP	T	T	C			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr22:41572322T>C	ENST00000263253.7	+	30	6070	c.4851T>C	c.(4849-4851)ccT>ccC	p.P1617P	RP1-85F18.6_ENST00000415054.1_RNA|RP1-85F18.5_ENST00000420537.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	1617	Binding region for E1A adenovirus.|CBP/p300-type HAT. {ECO:0000255|PROSITE- ProRule:PRU01065}.				apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						ATCCTGATCCTCTCATCCCCT	0.532			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																												p.P1617P		Atlas-SNP	.		Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	.	EP300	367	.	0			c.T4851C						PASS	.						129.0	118.0	122.0					22																	41572322		2203	4300	6503	SO:0001819	synonymous_variant	2033	exon30	Familial Cancer Database	Broad Thumb-Hallux syndrome	TGATCCTCTCATC	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.4851T>C	chr22.hg19:g.41572322T>C		84.0	0.0	.		90.0	34.0	.	NM_001429	B1AKC2	Silent	SNP	ENST00000263253.7	hg19	CCDS14010.1																																																																																			.	.	.	none		0.532	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1	NM_001429	
RBM10	8241	hgsc.bcm.edu	37	X	47030585	47030585	+	Missense_Mutation	SNP	T	T	G	rs377667483		TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chrX:47030585T>G	ENST00000377604.3	+	4	1102	c.360T>G	c.(358-360)gaT>gaG	p.D120E	RBM10_ENST00000329236.7_Intron|RBM10_ENST00000345781.6_Intron	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10	120	Poly-Glu.				3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						aggaggaggatgaggaggagg	0.667													T|||	2	0.000529801	0.0	0.0	3775	,	,		8316	0.002		0.0	False		,,,				2504	0.0				p.D185E	Melanoma(171;120 2705 19495 39241)	Atlas-SNP	.											.	RBM10	117	.	0			c.T555G						PASS	.						20.0	19.0	20.0					X																	47030585		2202	4297	6499	SO:0001583	missense	8241	exon4			GGAGGATGAGGAG	U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	ENST00000377604.3:c.360T>G	chrX.hg19:g.47030585T>G	ENSP00000366829:p.Asp120Glu	54.0	0.0	.		68.0	4.0	.	NM_001204468	C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	Missense_Mutation	SNP	ENST00000377604.3	hg19	CCDS14274.1	.	.	.	.	.	.	.	.	.	.	T	1.034	-0.680868	0.03353	.	.	ENSG00000182872	ENST00000377604	T	0.10960	2.82	2.89	-2.28	0.06826	Nucleotide-binding, alpha-beta plait (1);	0.397395	0.18197	N	0.148658	T	0.03783	0.0107	N	0.08118	0	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.49153	-0.8969	10	0.02654	T	1	-3.1034	10.6013	0.45369	0.0:0.0:0.7699:0.2301	.	185;120;120	Q7Z3D7;P98175-2;P98175	.;.;RBM10_HUMAN	E	120	ENSP00000366829:D120E	ENSP00000366829:D120E	D	+	3	2	RBM10	46915529	0.996000	0.38824	0.881000	0.34555	0.930000	0.56654	-0.096000	0.11059	-0.655000	0.05387	-0.549000	0.04216	GAT	.	.	.	weak		0.667	RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056381.1	NM_005676	
SHROOM4	57477	hgsc.bcm.edu	37	X	50378467	50378467	+	Silent	SNP	A	A	G			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chrX:50378467A>G	ENST00000289292.7	-	4	889	c.606T>C	c.(604-606)tgT>tgC	p.C202C	SHROOM4_ENST00000376020.2_Silent_p.C202C|SHROOM4_ENST00000460112.3_Silent_p.C86C			Q9ULL8	SHRM4_HUMAN	shroom family member 4	202					actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					GGGAAAGGGCACAGTCAGAAG	0.572																																					p.C202C		Atlas-SNP	.											.	SHROOM4	171	.	0			c.T606C						PASS	.						49.0	34.0	39.0					X																	50378467		2203	4299	6502	SO:0001819	synonymous_variant	57477	exon4			AAGGGCACAGTCA	AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.606T>C	chrX.hg19:g.50378467A>G		109.0	0.0	.		84.0	70.0	.	NM_020717	A7E2X9|D6RFW0|Q96LA0	Silent	SNP	ENST00000289292.7	hg19	CCDS35277.1																																																																																			.	.	.	none		0.572	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056564.4	NM_020717	
CENPI	2491	hgsc.bcm.edu	37	X	100375404	100375404	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chrX:100375404G>C	ENST00000372927.1	+	6	882	c.605G>C	c.(604-606)tGc>tCc	p.C202S	CENPI_ENST00000218507.5_Missense_Mutation_p.C202S|CENPI_ENST00000423383.1_Missense_Mutation_p.C202S|CENPI_ENST00000372926.1_Missense_Mutation_p.C202S	NM_006733.2	NP_006724.2	Q92674	CENPI_HUMAN	centromere protein I	202					CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)|sex differentiation (GO:0007548)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)				breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(19)|prostate(1)|skin(2)	30						CCTTATGTTTGCCATTTGTTA	0.289																																					p.C202S		Atlas-SNP	.											.	CENPI	70	.	0			c.G605C						PASS	.						76.0	66.0	70.0					X																	100375404		2197	4291	6488	SO:0001583	missense	2491	exon6			ATGTTTGCCATTT	X97249	CCDS14479.1	Xq22.1	2013-11-05	2006-06-15	2006-06-15	ENSG00000102384	ENSG00000102384			3968	protein-coding gene	gene with protein product		300065	"""FSH primary response (LRPR1, rat) homolog 1"", ""FSH primary response (LRPR1 homolog, rat) 1"""	FSHPRH1		16622420	Standard	NM_006733		Approved	LRPR1, CENP-I, Mis6	uc004egx.3	Q92674	OTTHUMG00000022018	ENST00000372927.1:c.605G>C	chrX.hg19:g.100375404G>C	ENSP00000362018:p.Cys202Ser	198.0	1.0	.		189.0	139.0	.	NM_006733	Q5JWZ9|Q96ED0	Missense_Mutation	SNP	ENST00000372927.1	hg19	CCDS14479.1	.	.	.	.	.	.	.	.	.	.	G	19.76	3.887294	0.72410	.	.	ENSG00000102384	ENST00000423383;ENST00000218507;ENST00000372926;ENST00000372927	.	.	.	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	T	0.77857	0.4193	M	0.78801	2.425	0.58432	D	0.999999	D;D	0.60575	0.988;0.988	P;P	0.61940	0.896;0.896	T	0.77859	-0.2431	9	0.37606	T	0.19	-7.424	18.0793	0.89438	0.0:0.0:1.0:0.0	.	202;202	B4DZL4;Q92674	.;CENPI_HUMAN	S	202	.	ENSP00000218507:C202S	C	+	2	0	CENPI	100262060	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.845000	0.75394	2.293000	0.77203	0.590000	0.80494	TGC	.	.	.	none		0.289	CENPI-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057519.1	NM_006733	
RAP1GDS1	5910	hgsc.bcm.edu	37	4	99363256	99363257	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr4:99363256_99363257delTG	ENST00000408927.3	+	15	1925_1926	c.1812_1813delTG	c.(1810-1815)actgtgfs	p.V605fs	RAP1GDS1_ENST00000453712.2_Frame_Shift_Del_p.V605fs|RAP1GDS1_ENST00000380158.4_Frame_Shift_Del_p.V557fs|RAP1GDS1_ENST00000264572.7_Frame_Shift_Del_p.V514fs|RAP1GDS1_ENST00000339360.5_Frame_Shift_Del_p.V606fs|RAP1GDS1_ENST00000408900.3_Frame_Shift_Del_p.V556fs	NM_001100426.1|NM_001100427.1|NM_021159.4	NP_001093896.1|NP_001093897.1|NP_066982.3	P52306	GDS1_HUMAN	RAP1, GTP-GDP dissociation stimulator 1	605					myosin filament assembly (GO:0031034)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|positive regulation of Rho GTPase activity (GO:0032321)|vascular smooth muscle contraction (GO:0014829)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)	28				OV - Ovarian serous cystadenocarcinoma(123;2.9e-07)|LUSC - Lung squamous cell carcinoma(1;0.0253)|Lung(1;0.0576)		AGAGACTTACTGTGGAAAGCTG	0.49			T	NUP98	T-ALL																																p.605_605del		Atlas-INDEL	.		Dom	yes		4	4q21-q25	5910	"""RAP1, GTP-GDP dissociation stimulator 1"""		L	.	RAP1GDS1	61	.	0			c.1814_1815del						PASS	.																																			SO:0001589	frameshift_variant	5910	exon15			.		CCDS43253.1, CCDS43254.1, CCDS47105.1, CCDS47106.1, CCDS47107.1, CCDS47108.1	4q23-q25	2013-02-14			ENSG00000138698	ENSG00000138698		"""Armadillo repeat containing"""	9859	protein-coding gene	gene with protein product		179502				8262526, 17951244	Standard	NM_001100426		Approved	SmgGDS	uc003htw.4	P52306	OTTHUMG00000160987	ENST00000408927.3:c.1812_1813delTG	chr4.hg19:g.99363258_99363259delTG	ENSP00000386153:p.Val605fs	65.0	0.0	0		45.0	12.0	0.266667	NM_001100426	E9PH06|G5E9P9|Q499L7|Q4KMV2|Q4QQI8|Q9BUW9|Q9BUX6|Q9NYM2|Q9NZA8	Frame_Shift_Del	DEL	ENST00000408927.3	hg19	CCDS43253.1																																																																																			.	.	.	none		0.490	RAP1GDS1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363273.2	NM_001100426	
NEK2	4751	hgsc.bcm.edu	37	1	211836794	211836794	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr1:211836794delT	ENST00000366999.4	-	8	1450	c.1312delA	c.(1312-1314)agcfs	p.S438fs	NEK2_ENST00000462283.1_5'UTR|NEK2_ENST00000540251.1_Frame_Shift_Del_p.S395fs	NM_002497.3	NP_002488.1	P51955	NEK2_HUMAN	NIMA-related kinase 2	438	Interaction with PCNT.|Interaction with SAV1 and STK3/MST2.|Necessary for interaction with MAD1L1.				blastocyst development (GO:0001824)|centrosome separation (GO:0051299)|chromosome segregation (GO:0007059)|G2/M transition of mitotic cell cycle (GO:0000086)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of centriole-centriole cohesion (GO:1903126)|negative regulation of DNA binding (GO:0043392)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of mitosis (GO:0007088)|regulation of mitotic centrosome separation (GO:0046602)|spindle assembly (GO:0051225)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|microtubule (GO:0005874)|midbody (GO:0030496)|nucleus (GO:0005634)|protein complex (GO:0043234)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|stomach(1)	3				OV - Ovarian serous cystadenocarcinoma(81;0.00203)|all cancers(67;0.0339)|Epithelial(68;0.0546)		ATCTGTCTGCTTTTCAGTTGG	0.463																																					p.S438fs		Atlas-Indel,Pindel	.											.	NEK2	49	.	0			c.1313delG						PASS	.						43.0	40.0	41.0					1																	211836794		2203	4300	6503	SO:0001589	frameshift_variant	4751	exon8			.	U11050	CCDS1500.1, CCDS55682.1, CCDS73024.1	1q32.3	2014-06-12	2012-11-15		ENSG00000117650	ENSG00000117650			7745	protein-coding gene	gene with protein product	"""HsPK 21"", ""protein phosphatase 1, regulatory subunit 111"""	604043	"""NIMA (never in mitosis gene a)-related kinase 2"""			8274451, 24043777	Standard	NM_002497		Approved	NLK1, NEK2A, RP67, PPP1R111	uc001hir.2	P51955	OTTHUMG00000037121	ENST00000366999.4:c.1312delA	chr1.hg19:g.211836794delT	ENSP00000355966:p.Ser438fs	113.0	0.0	0		96.0	41.0	0.427083	NM_002497	Q53FD6|Q5I1Z9|Q5VXZ1|Q6NZX8|Q7Z634|Q86XH2|Q96QN9	Frame_Shift_Del	DEL	ENST00000366999.4	hg19	CCDS1500.1																																																																																			.	.	.	none		0.463	NEK2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090154.1	NM_002497	
IRF2BP1	26145	hgsc.bcm.edu	37	19	46387877	46387878	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr19:46387877_46387878insG	ENST00000302165.3	-	1	1498_1499	c.1155_1156insC	c.(1153-1158)cccgagfs	p.E386fs		NM_015649.1	NP_056464.1	Q8IU81	I2BP1_HUMAN	interferon regulatory factor 2 binding protein 1	386					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)			cervix(1)|kidney(1)|lung(2)	4		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00442)|GBM - Glioblastoma multiforme(486;0.0402)|Epithelial(262;0.231)		CCCTCCGGCTCGGGGGATGCCT	0.738																																					p.E386fs		Atlas-Indel,Pindel	.											.	IRF2BP1	23	.	0			c.1156_1157insC						PASS	.																																			SO:0001589	frameshift_variant	26145	exon1			.	AY278022	CCDS12678.1	19q13.32	2008-02-05							21728	protein-coding gene	gene with protein product		615331				12799427	Standard	NM_015649		Approved	DKFZP434M154, IRF-2BP1	uc002pds.1	Q8IU81		ENST00000302165.3:c.1156dupC	chr19.hg19:g.46387882_46387882dupG	ENSP00000307265:p.Glu386fs	43.0	0.0	0		46.0	16.0	0.347826	NM_015649	Q53EL7|Q6DC95|Q9BRZ9|Q9Y4P4	Frame_Shift_Ins	INS	ENST00000302165.3	hg19	CCDS12678.1																																																																																			.	.	.	none		0.738	IRF2BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461683.1	NM_015649	
SCGB2B2	284402	hgsc.bcm.edu	37	19	35085225	35085226	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	AC	AC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr19:35085225_35085226delAC	ENST00000601241.1	-	3	2200_2201	c.100_101delGT	c.(100-102)gttfs	p.V35fs	SCGB2B2_ENST00000595326.1_Intron|SCGB2B2_ENST00000379204.2_Frame_Shift_Del_p.V35fs			Q4G0G5	SC2B2_HUMAN	secretoglobin, family 2B, member 2	35						extracellular region (GO:0005576)											ATCAAACACAACATTCGCAAGC	0.505																																					p.34_34del		Atlas-Indel,Pindel	.											.	.	.	.	0			c.101_102del						PASS	.																																			SO:0001589	frameshift_variant	284402	exon2			.	AK093495	CCDS32989.1	19q13.12	2011-12-14	2011-12-14	2011-12-14	ENSG00000205209	ENSG00000205209		"""Secretoglobins"""	27616	protein-coding gene	gene with protein product		615063	"""secretoglobin-like"""	SCGBL		22155607	Standard	NM_001025591		Approved	SCGB4A2	uc002nvn.3	Q4G0G5		ENST00000601241.1:c.100_101delGT	chr19.hg19:g.35085225_35085226delAC	ENSP00000469876:p.Val35fs	97.0	0.0	0		87.0	34.0	0.390805	NM_001025591		Frame_Shift_Del	DEL	ENST00000601241.1	hg19	CCDS32989.1																																																																																			.	.	.	none		0.505	SCGB2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461457.2	NM_001025591	
TAF2	6873	hgsc.bcm.edu	37	8	120831745	120831745	+	Splice_Site	DEL	C	C	-			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr8:120831745delC	ENST00000378164.2	-	3	438	c.140delG	c.(139-141)gga>ga	p.G47fs		NM_003184.3	NP_003175	Q6P1X5	TAF2_HUMAN	TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa	47					G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to organic cyclic compound (GO:0014070)|transcription initiation from RNA polymerase II promoter (GO:0006367)	transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	metallopeptidase activity (GO:0008237)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(21)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	49	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			TTCCACAAATCCCTGTAAAGA	0.308																																					p.G47fs		Atlas-Indel,Pindel	.											.	TAF2	204	.	0			c.141delA						PASS	.						84.0	84.0	84.0					8																	120831745		2203	4300	6503	SO:0001630	splice_region_variant	6873	exon3			.	AF040701	CCDS34937.1	8q24	2012-07-18	2002-08-29	2001-12-07	ENSG00000064313	ENSG00000064313			11536	protein-coding gene	gene with protein product		604912	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, B, 150kD"""	TAF2B		9774672, 9418870	Standard	NM_003184		Approved	TAFII150, CIF150	uc003you.3	Q6P1X5	OTTHUMG00000165009	ENST00000378164.2:c.139-1G>-	chr8.hg19:g.120831745delC		42.0	0.0	0		46.0	20.0	0.434783	NM_003184	B2RE82|O43487|O43604|O60668|Q86WW7|Q8IWK4	Frame_Shift_Del	DEL	ENST00000378164.2	hg19	CCDS34937.1																																																																																			.	.	.	none		0.308	TAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381436.1	NM_003184	Frame_Shift_Del
CSMD1	64478	hgsc.bcm.edu	37	8	4494878	4494878	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr8:4494878delC	ENST00000520002.1	-	2	843	c.288delG	c.(286-288)gggfs	p.G96fs	CSMD1_ENST00000602723.1_Frame_Shift_Del_p.G96fs|CSMD1_ENST00000400186.3_Frame_Shift_Del_p.G96fs|CSMD1_ENST00000542608.1_Frame_Shift_Del_p.G96fs|CSMD1_ENST00000602557.1_Frame_Shift_Del_p.G96fs|CSMD1_ENST00000539096.1_Frame_Shift_Del_p.G96fs|CSMD1_ENST00000537824.1_Frame_Shift_Del_p.G96fs			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	96	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CTTTTAAATTCCCTTGTTGAG	0.333																																					p.N97fs		Atlas-Indel,Pindel	.											.	CSMD1	1469	.	0			c.289delA						PASS	.						100.0	99.0	99.0					8																	4494878		1858	4100	5958	SO:0001589	frameshift_variant	64478	exon2			.			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.288delG	chr8.hg19:g.4494878delC	ENSP00000430733:p.Gly96fs	78.0	0.0	0		71.0	23.0	0.323944	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Frame_Shift_Del	DEL	ENST00000520002.1	hg19																																																																																				.	.	.	none		0.333	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
SHPK	23729	hgsc.bcm.edu	37	17	3539502	3539525	+	Start_Codon_Del	DEL	CCGCGCAGCCATTATCTCCCTGAC	CCGCGCAGCCATTATCTCCCTGAC	-	rs190457036|rs367944958|rs201343679	byFrequency	TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	CCGCGCAGCCATTATCTCCCTGAC	CCGCGCAGCCATTATCTCCCTGAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr17:3539502_3539525delCCGCGCAGCCATTATCTCCCTGAC	ENST00000225519.3	-	0	91_114				CTNS_ENST00000399306.2_5'Flank|CTNS_ENST00000046640.3_5'Flank|CTNS_ENST00000381870.3_5'Flank|CTNS_ENST00000414524.2_5'Flank|CTNS_ENST00000441220.2_5'Flank	NM_013276.2	NP_037408	Q9UHJ6	SHPK_HUMAN	sedoheptulokinase						carbohydrate metabolic process (GO:0005975)|cellular response to interleukin-13 (GO:0035963)|cellular response to interleukin-4 (GO:0071353)|cellular response to lipopolysaccharide (GO:0071222)|pentose-phosphate shunt, non-oxidative branch (GO:0009052)|phosphorylation (GO:0016310)|regulation of inflammatory response (GO:0050727)|regulation of macrophage activation (GO:0043030)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|sedoheptulokinase activity (GO:0050277)	p.A2V(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16				COAD - Colon adenocarcinoma(5;0.0828)		GGGTGATCGGCCGCGCAGCCATTATCTCCCTGACCCGCGCAGCT	0.692																																					.		Atlas-Indel,Pindel	.											.	SHPK	34	.	1	Substitution - Missense(1)	lung(1)	.						PASS	.																																			SO:0001582	initiator_codon_variant	23729	wholegene			.	AF163573	CCDS11030.1	17p13	2008-02-08	2008-02-08	2008-02-08	ENSG00000197417	ENSG00000197417	2.7.1.14		1492	protein-coding gene	gene with protein product		605060	"""carbohydrate kinase-like"""	CARKL		10673275, 18186520	Standard	NM_013276		Approved	SHK	uc002fvz.1	Q9UHJ6	OTTHUMG00000090694		chr17.hg19:g.3539502_3539525delCCGCGCAGCCATTATCTCCCTGAC		139.0	0.0	0		184.0	14.0	0.076087	NM_013276	B2R640|Q8WUH3	Frame_Shift_Del	DEL	ENST00000225519.3	hg19	CCDS11030.1																																																																																			.	.	.	none		0.692	SHPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207378.2		
CCRN4L	25819	hgsc.bcm.edu	37	4	139965852	139965871	+	Frame_Shift_Del	DEL	GAAAGGAAATGTCTCATCCT	GAAAGGAAATGTCTCATCCT	-	rs527306073|rs150676868		TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	GAAAGGAAATGTCTCATCCT	GAAAGGAAATGTCTCATCCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr4:139965852_139965871delGAAAGGAAATGTCTCATCCT	ENST00000280614.2	+	3	713_732	c.520_539delGAAAGGAAATGTCTCATCCT	c.(520-540)gaaaggaaatgtctcatcctgfs	p.ERKCLIL174fs	ELF2_ENST00000515489.1_Intron	NM_012118.2	NP_036250.2	Q9UK39	NOCT_HUMAN	CCR4 carbon catabolite repression 4-like (S. cerevisiae)	174					circadian regulation of gene expression (GO:0032922)|cytoplasmic mRNA processing body assembly (GO:0033962)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|negative regulation of gene expression (GO:0010629)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|regulation of circadian rhythm (GO:0042752)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|response to extracellular stimulus (GO:0009991)|response to lipopolysaccharide (GO:0032496)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A)-specific ribonuclease activity (GO:0004535)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(2)|large_intestine(3)|lung(3)|ovary(1)	9	all_hematologic(180;0.162)					CAAATGGGAAGAAAGGAAATGTCTCATCCTGGAAGAAATC	0.45																																					p.173_180del	Ovarian(144;566 1842 19130 21379 22209)	Atlas-Indel,Pindel	.											.	CCRN4L	22	.	0			c.519_538del						PASS	.																																			SO:0001589	frameshift_variant	25819	exon3			.	AF183961	CCDS3743.1	4q31.1	2014-06-18	2001-11-28		ENSG00000151014	ENSG00000151014			14254	protein-coding gene	gene with protein product		608468	"""CCR4-like (carbon catabolite repression 4, S.cerevisiae)"""			10521507	Standard	NM_012118		Approved	CCR4L, Ccr4c	uc003ihl.3	Q9UK39	OTTHUMG00000161271	ENST00000280614.2:c.520_539delGAAAGGAAATGTCTCATCCT	chr4.hg19:g.139965852_139965871delGAAAGGAAATGTCTCATCCT	ENSP00000280614:p.Glu174fs	159.0	0.0	0		113.0	30.0	0.265487	NM_012118	D3DNY5|Q14D51|Q9HD93|Q9HD94|Q9HD95	Frame_Shift_Del	DEL	ENST00000280614.2	hg19	CCDS3743.1																																																																																			.	.	.	none		0.450	CCRN4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257231.3	NM_012118	
CRYBA1	1411	hgsc.bcm.edu	37	17	27580671	27580672	+	Frame_Shift_Ins	INS	-	-	T			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr17:27580671_27580672insT	ENST00000225387.3	+	5	372_373	c.371_372insT	c.(370-375)tctaagfs	p.K125fs		NM_005208.4	NP_005199.2	P05813	CRBA1_HUMAN	crystallin, beta A1	125	Beta/gamma crystallin 'Greek key' 3. {ECO:0000255|PROSITE-ProRule:PRU00028}.				lens development in camera-type eye (GO:0002088)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	structural constituent of eye lens (GO:0005212)			breast(1)|large_intestine(2)|lung(1)|prostate(1)	5			BRCA - Breast invasive adenocarcinoma(11;3.3e-05)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)			CATAAGGAGTCTAAGATGACCA	0.386																																					p.S124fs		Atlas-Indel,Pindel	.											.	CRYBA1	15	.	0			c.371_372insT						PASS	.																																			SO:0001589	frameshift_variant	1411	exon5			.		CCDS11249.1	17q11.2-q12	2008-07-18			ENSG00000108255	ENSG00000108255			2394	protein-coding gene	gene with protein product	"""eye lens structural protein"""	123610		CRYB1		3745196, 3770741	Standard	NM_005208		Approved		uc002hdw.3	P05813	OTTHUMG00000132729	ENST00000225387.3:c.372dupT	chr17.hg19:g.27580672_27580672dupT	ENSP00000225387:p.Lys125fs	156.0	0.0	0		210.0	126.0	0.6	NM_005208	Q13633|Q14CM9	Frame_Shift_Ins	INS	ENST00000225387.3	hg19	CCDS11249.1																																																																																			.	.	.	none		0.386	CRYBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256071.2	NM_005208	
CHST2	9435	hgsc.bcm.edu	37	3	142840258	142840258	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr3:142840258delA	ENST00000309575.3	+	2	1984	c.600delA	c.(598-600)gtafs	p.V200fs		NM_004267.4	NP_004258.2	Q9Y4C5	CHST2_HUMAN	carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2	200					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|multicellular organismal development (GO:0007275)|N-acetylglucosamine metabolic process (GO:0006044)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|trans-Golgi network (GO:0005802)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(2)	22						TGTGGCATGTATGGCAAAAAC	0.577																																					p.V200fs		Atlas-INDEL	.											.	CHST2	67	.	0			c.599delT						PASS	.						67.0	83.0	78.0					3																	142840258		2198	4297	6495	SO:0001589	frameshift_variant	9435	exon2			.	BC042160	CCDS3129.1	3q24	2007-03-14			ENSG00000175040	ENSG00000175040		"""Sulfotransferases, membrane-bound"""	1970	protein-coding gene	gene with protein product		603798				10049591	Standard	NM_004267		Approved	C6ST	uc003evm.3	Q9Y4C5	OTTHUMG00000159351	ENST00000309575.3:c.600delA	chr3.hg19:g.142840258delA	ENSP00000307911:p.Val200fs	129.0	0.0	0		167.0	110.0	0.658683	NM_004267	D3DNG5|Q2M370|Q9GZN5|Q9UED5|Q9Y6F2	Frame_Shift_Del	DEL	ENST00000309575.3	hg19	CCDS3129.1																																																																																			.	.	.	none		0.577	CHST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354850.1	NM_004267	
ARSE	415	hgsc.bcm.edu	37	X	2867593	2867593	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chrX:2867593delT	ENST00000381134.3	-	6	672	c.606delA	c.(604-606)caafs	p.Q202fs	ARSE_ENST00000540563.1_Frame_Shift_Del_p.Q157fs|ARSE_ENST00000545496.1_Frame_Shift_Del_p.Q227fs	NM_000047.2	NP_000038.2	P51690	ARSE_HUMAN	arylsulfatase E (chondrodysplasia punctata 1)	202					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				AGGCCAGGACTTGGAAGAGGA	0.552																																					p.V203fs		Atlas-Indel,Pindel	.											.	ARSE	43	.	0			c.607delG						PASS	.						132.0	109.0	116.0					X																	2867593		2203	4300	6503	SO:0001589	frameshift_variant	415	exon6			.	X83573	CCDS14122.1, CCDS75948.1, CCDS75949.1	Xp22.33	2013-02-14			ENSG00000157399	ENSG00000157399		"""Arylsulfatase family"""	719	protein-coding gene	gene with protein product		300180		CDPX, CDPX1		7720070	Standard	NM_000047		Approved		uc004crc.4	P51690	OTTHUMG00000137358	ENST00000381134.3:c.606delA	chrX.hg19:g.2867593delT	ENSP00000370526:p.Gln202fs	151.0	0.0	0		139.0	105.0	0.755396	NM_000047	Q53FT2|Q53FU8	Frame_Shift_Del	DEL	ENST00000381134.3	hg19	CCDS14122.1																																																																																			.	.	.	none		0.552	ARSE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055643.1	NM_000047	
PLXNA3	55558	hgsc.bcm.edu	37	X	153695615	153695615	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chrX:153695615delC	ENST00000369682.3	+	19	3417	c.3242delC	c.(3241-3243)gccfs	p.A1081fs		NM_017514.3	NP_059984.3	P51805	PLXA3_HUMAN	plexin A3	1081	IPT/TIG 3.				axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|hippocampus development (GO:0021766)|multicellular organismal development (GO:0007275)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|positive regulation of cytoskeleton organization (GO:0051495)|pyramidal neuron development (GO:0021860)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|trigeminal nerve structural organization (GO:0021637)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	48	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CTGTGTAAGGCCCCCGGCATC	0.642																																					p.A1081fs		Atlas-Indel,Pindel	.											.	PLXNA3	156	.	0			c.3241delG						PASS	.						50.0	48.0	49.0					X																	153695615		2202	4299	6501	SO:0001589	frameshift_variant	55558	exon19			.	X74609	CCDS14752.1	Xq28	2008-02-05			ENSG00000130827	ENSG00000130827		"""Plexins"""	9101	protein-coding gene	gene with protein product		300022		PLXN4		8248200, 8733135	Standard	NM_017514		Approved	SEX, XAP-6, 6.3, Plxn3	uc004flm.3	P51805	OTTHUMG00000033290	ENST00000369682.3:c.3242delC	chrX.hg19:g.153695615delC	ENSP00000358696:p.Ala1081fs	42.0	0.0	0		44.0	31.0	0.704545	NM_017514	Q5HY36	Frame_Shift_Del	DEL	ENST00000369682.3	hg19	CCDS14752.1																																																																																			.	.	.	none		0.642	PLXNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081634.1	NM_017514	
SLC12A7	10723	hgsc.bcm.edu	37	5	1087036	1087036	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr5:1087036delC	ENST00000264930.5	-	6	700	c.657delG	c.(655-657)gggfs	p.G219fs		NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	219					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	TCTCGATGGTCCCCAAAATAT	0.582																																					p.T220fs		Pindel	.											.	SLC12A7	97	.	0			c.658delA						PASS	.						74.0	73.0	73.0					5																	1087036		2203	4300	6503	SO:0001589	frameshift_variant	10723	exon6			.	AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.657delG	chr5.hg19:g.1087036delC	ENSP00000264930:p.Gly219fs	312.0	0.0	.		223.0	59.0	0.265	NM_006598	A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Frame_Shift_Del	DEL	ENST00000264930.5	hg19	CCDS34129.1																																																																																			.	.	.	none		0.582	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366446.2	NM_006598	
CHST2	9435	hgsc.bcm.edu	37	3	142840256	142840258	+	In_Frame_Del	DEL	GTA	GTA	-			TCGA-B9-A8YH-01A-11D-A36X-10	TCGA-B9-A8YH-10A-01D-A370-10	GTA	GTA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e6bab9a-ad14-4f30-93d9-00dede084e9c	60ce4360-70f6-4ad0-9057-9fe7428603f7	g.chr3:142840256_142840258delGTA	ENST00000309575.3	+	2	1982_1984	c.598_600delGTA	c.(598-600)gtadel	p.V200del		NM_004267.4	NP_004258.2	Q9Y4C5	CHST2_HUMAN	carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2	200					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|multicellular organismal development (GO:0007275)|N-acetylglucosamine metabolic process (GO:0006044)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|trans-Golgi network (GO:0005802)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(2)	22						AGTGTGGCATGTATGGCAAAAAC	0.581																																					p.199_200del		Pindel	.											.	CHST2	67	.	0			c.597_599del						PASS	.																																			SO:0001651	inframe_deletion	9435	exon2			.	BC042160	CCDS3129.1	3q24	2007-03-14			ENSG00000175040	ENSG00000175040		"""Sulfotransferases, membrane-bound"""	1970	protein-coding gene	gene with protein product		603798				10049591	Standard	NM_004267		Approved	C6ST	uc003evm.3	Q9Y4C5	OTTHUMG00000159351	ENST00000309575.3:c.598_600delGTA	chr3.hg19:g.142840256_142840258delGTA	ENSP00000307911:p.Val200del	134.0	0.0	.		167.0	62.0	0.371	NM_004267	D3DNG5|Q2M370|Q9GZN5|Q9UED5|Q9Y6F2	In_Frame_Del	DEL	ENST00000309575.3	hg19	CCDS3129.1																																																																																			.	.	.	none		0.581	CHST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354850.1	NM_004267	
