#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CHD5	26038	hgsc.bcm.edu	37	1	6214783	6214783	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr1:6214783C>T	ENST00000262450.3	-	5	781	c.682G>A	c.(682-684)Gtc>Atc	p.V228I	CHD5_ENST00000378021.1_5'UTR	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		GGGGGGCTGACGGCTAGCGGA	0.687																																					p.V228I		Atlas-SNP	.											.	CHD5	267	.	0			c.G682A						PASS	.						23.0	21.0	22.0					1																	6214783		2180	4275	6455	SO:0001583	missense	26038	exon5			GGCTGACGGCTAG	AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.682G>A	chr1.hg19:g.6214783C>T	ENSP00000262450:p.Val228Ile	95.0	0.0	.		129.0	55.0	.	NM_015557	A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	ENST00000262450.3	hg19	CCDS57.1	.	.	.	.	.	.	.	.	.	.	C	2.102	-0.405865	0.04832	.	.	ENSG00000116254	ENST00000262450	D	0.90563	-2.69	3.84	-2.17	0.07059	.	0.808768	0.10850	N	0.627297	T	0.79650	0.4482	N	0.12746	0.255	0.21473	N	0.999679	B	0.02656	0.0	B	0.01281	0.0	T	0.64287	-0.6443	10	0.36615	T	0.2	-17.4027	10.8414	0.46718	0.0:0.6614:0.0:0.3386	.	228	Q8TDI0	CHD5_HUMAN	I	228	ENSP00000262450:V228I	ENSP00000262450:V228I	V	-	1	0	CHD5	6137370	0.004000	0.15560	0.842000	0.33263	0.036000	0.12997	-0.171000	0.09883	-0.238000	0.09724	-0.657000	0.03884	GTC	.	.	.	none		0.687	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002823.2	NM_015557	
ENO1	2023	hgsc.bcm.edu	37	1	8926559	8926559	+	Splice_Site	SNP	G	G	T			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr1:8926559G>T	ENST00000234590.4	-	7	565	c.446C>A	c.(445-447)gCg>gAg	p.A149E		NM_001428.3	NP_001419.1	P06733	ENOA_HUMAN	enolase 1, (alpha)	149	Required for repression of c-myc promoter activity.				carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|negative regulation of cell growth (GO:0030308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|response to virus (GO:0009615)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphopyruvate hydratase complex (GO:0000015)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	10	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;2.54e-20)|all_lung(118;2.99e-06)|Lung NSC(185;6.25e-06)|Renal(390;0.000147)|Breast(348;0.00086)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.42e-07)|COAD - Colon adenocarcinoma(227;2.78e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00177)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|READ - Rectum adenocarcinoma(331;0.0642)		GACATTGAACGCCTGGGGAGA	0.567																																					p.A149E	Esophageal Squamous(21;302 608 19946 22210 33560)	Atlas-SNP	.											.	ENO1	38	.	0			c.C446A						PASS	.						77.0	75.0	76.0					1																	8926559		2203	4300	6503	SO:0001630	splice_region_variant	2023	exon7			TTGAACGCCTGGG	BC022545	CCDS97.1	1p36.2	2010-03-11			ENSG00000074800	ENSG00000074800	4.2.1.11		3350	protein-coding gene	gene with protein product		172430		ENO1L1, MPB1		9653645, 9691177	Standard	NM_001428		Approved	PPH, MBP-1	uc001apj.2	P06733	OTTHUMG00000001773	ENST00000234590.4:c.445-1C>A	chr1.hg19:g.8926559G>T		42.0	0.0	.		52.0	20.0	.	NM_001428	B2RD59|P22712|Q16704|Q4TUS4|Q53FT9|Q53HR3|Q658M5|Q6GMP2|Q71V37|Q7Z3V6|Q8WU71|Q96GV1|Q9BT62|Q9UCH6|Q9UM55	Missense_Mutation	SNP	ENST00000234590.4	hg19	CCDS97.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.804238	0.90623	.	.	ENSG00000074800	ENST00000234590	T	0.18016	2.24	5.33	5.33	0.75918	Enolase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.48732	0.1516	M	0.85462	2.755	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.997;0.996;0.998	T	0.55515	-0.8129	10	0.87932	D	0	-16.4671	18.013	0.89230	0.0:0.0:1.0:0.0	.	53;116;56;149	E2DRY6;A4UCS8;P06733-2;P06733	.;.;.;ENOA_HUMAN	E	149	ENSP00000234590:A149E	ENSP00000234590:A149E	A	-	2	0	ENO1	8849146	1.000000	0.71417	0.982000	0.44146	0.696000	0.40369	9.824000	0.99380	2.492000	0.84095	0.563000	0.77884	GCG	.	.	.	none		0.567	ENO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004945.1	NM_001428	Missense_Mutation
TMEM57	55219	hgsc.bcm.edu	37	1	25784936	25784936	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr1:25784936G>A	ENST00000374343.4	+	6	886	c.707G>A	c.(706-708)gGt>gAt	p.G236D	TMEM57_ENST00000470035.1_3'UTR|TMEM57_ENST00000399766.3_Intron|TMEM57_ENST00000399763.3_Intron	NM_018202.4	NP_060672.2	Q8N5G2	MACOI_HUMAN	transmembrane protein 57	236					brain development (GO:0007420)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuron projection terminus (GO:0044306)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|synapse (GO:0045202)				breast(3)|endometrium(2)|kidney(2)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	27		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00715)|all_lung(284;0.00989)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0675)|all_neural(195;0.201)		UCEC - Uterine corpus endometrioid carcinoma (279;0.042)|OV - Ovarian serous cystadenocarcinoma(117;1.85e-26)|Colorectal(126;2.99e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|STAD - Stomach adenocarcinoma(196;0.000766)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|GBM - Glioblastoma multiforme(114;0.0191)|READ - Rectum adenocarcinoma(331;0.0649)		CACAATGGAGGTATCCCAGCC	0.418																																					p.G236D		Atlas-SNP	.											.	TMEM57	72	.	0			c.G707A						PASS	.						114.0	123.0	120.0					1																	25784936		2203	4300	6503	SO:0001583	missense	55219	exon6			ATGGAGGTATCCC	AK001609	CCDS30638.1, CCDS60034.1	1p36.11	2008-02-05			ENSG00000204178	ENSG00000204178			25572	protein-coding gene	gene with protein product		610301				12459264, 15255972	Standard	XM_005245931		Approved	FLJ10747	uc001bkk.3	Q8N5G2	OTTHUMG00000003473	ENST00000374343.4:c.707G>A	chr1.hg19:g.25784936G>A	ENSP00000363463:p.Gly236Asp	297.0	0.0	.		302.0	111.0	.	NM_018202	B1AK00|Q2TLX5|Q2TLX6|Q9NVG6	Missense_Mutation	SNP	ENST00000374343.4	hg19	CCDS30638.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.448157	0.84101	.	.	ENSG00000204178	ENST00000374343	.	.	.	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.78375	0.4273	M	0.77820	2.39	0.80722	D	1	D	0.89917	1.0	D	0.70487	0.969	T	0.72865	-0.4163	9	0.15499	T	0.54	-9.6004	19.0021	0.92838	0.0:0.0:1.0:0.0	.	236	Q8N5G2	MACOI_HUMAN	D	236	.	ENSP00000363463:G236D	G	+	2	0	TMEM57	25657523	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.476000	0.97823	2.724000	0.93272	0.563000	0.77884	GGT	.	.	.	none		0.418	TMEM57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009659.2	NM_018202	
STMN1	3925	hgsc.bcm.edu	37	1	26230144	26230144	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr1:26230144T>A	ENST00000399728.1	-	3	537	c.174A>T	c.(172-174)gaA>gaT	p.E58D	STMN1_ENST00000465604.1_5'UTR|STMN1_ENST00000374291.1_Missense_Mutation_p.E58D|MIR3917_ENST00000580971.1_RNA|STMN1_ENST00000426559.2_Missense_Mutation_p.E58D|STMN1_ENST00000357865.2_Missense_Mutation_p.E58D|STMN1_ENST00000455785.2_Missense_Mutation_p.E58D	NM_203401.1	NP_981946.1	P16949	STMN1_HUMAN	stathmin 1	58	SLD. {ECO:0000255|PROSITE- ProRule:PRU00998}.				axonogenesis (GO:0007409)|intracellular signal transduction (GO:0035556)|microtubule depolymerization (GO:0007019)|mitotic spindle organization (GO:0007052)|negative regulation of microtubule polymerization (GO:0031115)|positive regulation of cellular component movement (GO:0051272)|response to virus (GO:0009615)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|microtubule (GO:0005874)	signal transducer activity (GO:0004871)|tubulin binding (GO:0015631)			breast(2)|large_intestine(2)|skin(2)	6		Colorectal(325;3.46e-05)|Lung NSC(340;0.000163)|all_lung(284;0.000234)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0505)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.85e-25)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.013)|READ - Rectum adenocarcinoma(331;0.0649)		TGCGTCTTTCTTCTGCAGCTT	0.388																																					p.E58D		Atlas-SNP	.											.	STMN1	22	.	0			c.A174T						PASS	.						166.0	179.0	175.0					1																	26230144		2203	4300	6503	SO:0001583	missense	3925	exon3			TCTTTCTTCTGCA	J04991	CCDS269.1, CCDS44090.1	1p36.11	2011-02-09	2009-04-28	2001-07-13	ENSG00000117632	ENSG00000117632			6510	protein-coding gene	gene with protein product	"""oncoprotein 18"""	151442	"""chromosome 1 open reading frame 215"", ""stathmin 1/oncoprotein 18"""	LAP18, C1orf215		2917975	Standard	NM_005563		Approved	SMN, OP18, PR22, PP19, PP17, Lag, FLJ32206	uc010oev.2	P16949	OTTHUMG00000007389	ENST00000399728.1:c.174A>T	chr1.hg19:g.26230144T>A	ENSP00000382633:p.Glu58Asp	65.0	0.0	.		61.0	15.0	.	NM_005563	A2A2D1|B2R4E7|B7Z8N4|D3DPJ5	Missense_Mutation	SNP	ENST00000399728.1	hg19	CCDS269.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.140629	0.77775	.	.	ENSG00000117632	ENST00000426559;ENST00000455785;ENST00000399728;ENST00000357865;ENST00000374291;ENST00000446334	.	.	.	5.54	1.94	0.25998	.	0.000000	0.85682	D	0.000000	T	0.74884	0.3775	M	0.93507	3.425	0.26297	N	0.978036	D;D;D	0.62365	0.991;0.972;0.972	D;D;D	0.68943	0.961;0.958;0.958	T	0.67921	-0.5545	9	0.87932	D	0	.	9.3358	0.38049	0.0:0.2825:0.0:0.7175	.	58;58;58	P16949-2;B5BU83;P16949	.;.;STMN1_HUMAN	D	58	.	ENSP00000350531:E58D	E	-	3	2	STMN1	26102731	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.000000	0.29770	0.080000	0.16959	0.533000	0.62120	GAA	.	.	.	none		0.388	STMN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019359.1	NM_005563	
UBXN11	91544	hgsc.bcm.edu	37	1	26608865	26608865	+	Silent	SNP	A	A	G			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr1:26608865A>G	ENST00000374222.1	-	16	1952	c.1488T>C	c.(1486-1488)ggT>ggC	p.G496G	UBXN11_ENST00000374221.3_Silent_p.G496G|UBXN11_ENST00000374217.2_Silent_p.G463G|UBXN11_ENST00000314675.7_Silent_p.G376G|UBXN11_ENST00000357089.4_Silent_p.G463G|UBXN11_ENST00000374223.1_Silent_p.G253G			Q5T124	UBX11_HUMAN	UBX domain protein 11	496	3 X 8 AA tandem repeats of P-G-P-G-P-G-P- S.|Pro-rich.		Missing.			cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.G490_P515delGPGPSPGPGPGPSPGPGPGPSPCPGP(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(3)	23						cgggaccgggaccgggactgg	0.721																																					p.G496G		Atlas-SNP	.											.	UBXN11	54	.	1	Deletion - In frame(1)	ovary(1)	c.T1488C						PASS	.						25.0	29.0	28.0					1																	26608865		1768	4016	5784	SO:0001819	synonymous_variant	91544	exon16			ACCGGGACCGGGA	AF521017	CCDS41286.1, CCDS41287.1, CCDS41288.1	1p36.11	2008-07-25	2008-07-25	2008-07-25	ENSG00000158062	ENSG00000158062		"""UBX domain containing"""	30600	protein-coding gene	gene with protein product	"""socius"""	609151	"""UBX domain containing 5"""	UBXD5		11940653	Standard	NM_183008		Approved	SOC, SOCI	uc001blw.3	Q5T124	OTTHUMG00000003382	ENST00000374222.1:c.1488T>C	chr1.hg19:g.26608865A>G		31.0	0.0	.		33.0	24.0	.	NM_183008	D3DPK6|Q5T117|Q5T120|Q5T125|Q5T126|Q5T129|Q5T131|Q5T133|Q63HM6|Q71RB3|Q8IY27|Q8N1L6|Q8N9M4|Q8NA18|Q8NFE3|Q8NFE4|Q8NFE6	Silent	SNP	ENST00000374222.1	hg19	CCDS41288.1																																																																																			.	.	.	none		0.721	UBXN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000009500.1	NM_145345	
WASF2	10163	hgsc.bcm.edu	37	1	27742557	27742557	+	Silent	SNP	A	A	C			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr1:27742557A>C	ENST00000430629.2	-	5	674	c.459T>G	c.(457-459)ccT>ccG	p.P153P	WASF2_ENST00000536657.1_Silent_p.P153P	NM_001201404.1|NM_006990.3	NP_001188333.1|NP_008921.1	Q9Y6W5	WASF2_HUMAN	WAS protein family, member 2	153					actin cytoskeleton organization (GO:0030036)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of lamellipodium assembly (GO:0010592)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|SCAR complex (GO:0031209)	actin binding (GO:0003779)|protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	18		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0446)|OV - Ovarian serous cystadenocarcinoma(117;2.46e-25)|Colorectal(126;1.7e-08)|COAD - Colon adenocarcinoma(152;2e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00139)|KIRC - Kidney renal clear cell carcinoma(1967;0.00204)|STAD - Stomach adenocarcinoma(196;0.00325)|READ - Rectum adenocarcinoma(331;0.0481)		AGAAGTATGAAGGGTCTGTGT	0.458																																					p.P153P		Atlas-SNP	.											.	WASF2	41	.	0			c.T459G						PASS	.						202.0	177.0	186.0					1																	27742557		2203	4300	6503	SO:0001819	synonymous_variant	10163	exon5			GTATGAAGGGTCT	AB026542	CCDS304.1, CCDS55582.1	1p36.11	2011-05-10			ENSG00000158195	ENSG00000158195			12733	protein-coding gene	gene with protein product		605875				10381382	Standard	NM_006990		Approved	WAVE2, SCAR2	uc001bof.2	Q9Y6W5	OTTHUMG00000003393	ENST00000430629.2:c.459T>G	chr1.hg19:g.27742557A>C		88.0	0.0	.		103.0	31.0	.	NM_006990	B4DZN0|O60794|Q9UDY7	Silent	SNP	ENST00000430629.2	hg19	CCDS304.1																																																																																			.	.	.	none		0.458	WASF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009516.1	NM_006990	
PTPRU	10076	hgsc.bcm.edu	37	1	29585188	29585188	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr1:29585188G>C	ENST00000345512.3	+	3	506	c.377G>C	c.(376-378)gGc>gCc	p.G126A	PTPRU_ENST00000323874.8_Missense_Mutation_p.G126A|PTPRU_ENST00000428026.2_Missense_Mutation_p.G126A|PTPRU_ENST00000356870.3_Missense_Mutation_p.G126A|PTPRU_ENST00000460170.2_Missense_Mutation_p.G126A|PTPRU_ENST00000373779.3_Missense_Mutation_p.G126A	NM_005704.4	NP_005695.3	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	126	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|homotypic cell-cell adhesion (GO:0034109)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|organ regeneration (GO:0031100)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|response to glucocorticoid (GO:0051384)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(26)|ovary(1)|prostate(3)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	79		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		GTTAATGGGGGCCCCCTGGGC	0.607																																					p.G126A		Atlas-SNP	.											.	PTPRU	374	.	0			c.G377C						PASS	.						78.0	86.0	83.0					1																	29585188		2203	4300	6503	SO:0001583	missense	10076	exon3			ATGGGGGCCCCCT	U71075	CCDS334.1, CCDS335.1, CCDS44098.1, CCDS44098.2, CCDS53290.1	1p35.3	2013-02-11			ENSG00000060656	ENSG00000060656		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9683	protein-coding gene	gene with protein product	"""pi R-PTP-Psi"""	602454				8700514, 9434160	Standard	NM_133178		Approved	PTPRO, hPTP-J, PCP-2, FMI, PTP	uc001bru.3	Q92729	OTTHUMG00000003699	ENST00000345512.3:c.377G>C	chr1.hg19:g.29585188G>C	ENSP00000334941:p.Gly126Ala	121.0	0.0	.		132.0	50.0	.	NM_001195001	A6H8L1|O00197|P78399|Q59HA4|Q5SYU4|Q5SYU5|Q92735|Q92850	Missense_Mutation	SNP	ENST00000345512.3	hg19	CCDS334.1	.	.	.	.	.	.	.	.	.	.	G	34	5.382138	0.95967	.	.	ENSG00000060656	ENST00000345512;ENST00000373779;ENST00000356870;ENST00000323874;ENST00000428026;ENST00000460170	T;T;T;T;T;T	0.02631	4.22;4.22;4.22;4.22;4.22;4.22	5.72	5.72	0.89469	Concanavalin A-like lectin/glucanase (1);MAM domain (3);	0.000000	0.85682	D	0.000000	T	0.13543	0.0328	L	0.58583	1.82	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.999	T	0.00498	-1.1704	9	.	.	.	.	18.8634	0.92281	0.0:0.0:1.0:0.0	.	126;126;126;126;126	Q92729-3;Q92729-4;Q92729-2;E9PH42;Q92729	.;.;.;.;PTPRU_HUMAN	A	126	ENSP00000334941:G126A;ENSP00000362884:G126A;ENSP00000349333:G126A;ENSP00000314987:G126A;ENSP00000392332:G126A;ENSP00000432906:G126A	.	G	+	2	0	PTPRU	29457775	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.960000	0.87893	2.699000	0.92147	0.591000	0.81541	GGC	.	.	.	none		0.607	PTPRU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010447.1		
DLGAP3	58512	hgsc.bcm.edu	37	1	35370206	35370206	+	Nonsense_Mutation	SNP	C	C	T			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr1:35370206C>T	ENST00000373347.1	-	3	1047	c.779G>A	c.(778-780)tGg>tAg	p.W260*	DLGAP3_ENST00000235180.4_Nonsense_Mutation_p.W260*|DLGAP3_ENST00000495979.1_5'Flank			O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated protein 3	260					cell-cell signaling (GO:0007267)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|prostate(3)|skin(3)|urinary_tract(1)	46		Myeloproliferative disorder(586;0.0393)				GGAACTCCACCAGCCTGTGGA	0.652																																					p.W260X		Atlas-SNP	.											.	DLGAP3	107	.	0			c.G779A						PASS	.						124.0	114.0	117.0					1																	35370206		2203	4300	6503	SO:0001587	stop_gained	58512	exon1			CTCCACCAGCCTG	AF131778	CCDS30670.1	1p35.3-p34.1	2008-02-05			ENSG00000116544	ENSG00000116544			30368	protein-coding gene	gene with protein product		611413				8619474, 9110174	Standard	NM_001080418		Approved	SAPAP3, DAP3	uc001byc.3	O95886	OTTHUMG00000004049	ENST00000373347.1:c.779G>A	chr1.hg19:g.35370206C>T	ENSP00000362444:p.Trp260*	99.0	0.0	.		93.0	33.0	.	NM_001080418	Q5TDD5|Q9H3X7	Nonsense_Mutation	SNP	ENST00000373347.1	hg19	CCDS30670.1	.	.	.	.	.	.	.	.	.	.	C	38	7.264207	0.98171	.	.	ENSG00000116544	ENST00000373347;ENST00000235180	.	.	.	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.5694	18.7023	0.91625	0.0:1.0:0.0:0.0	.	.	.	.	X	260	.	ENSP00000235180:W260X	W	-	2	0	DLGAP3	35142793	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	7.378000	0.79679	2.492000	0.84095	0.655000	0.94253	TGG	.	.	.	none		0.652	DLGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011554.1	NM_021234	
KLHL20	27252	hgsc.bcm.edu	37	1	173754361	173754361	+	Silent	SNP	A	A	G			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr1:173754361A>G	ENST00000209884.4	+	12	1942	c.1806A>G	c.(1804-1806)acA>acG	p.T602T	KLHL20_ENST00000546011.1_Silent_p.T413T	NM_014458.3	NP_055273.2	Q9Y2M5	KLH20_HUMAN	kelch-like family member 20	602					cytoskeleton organization (GO:0007010)|Golgi to endosome transport (GO:0006895)|negative regulation of apoptotic process (GO:0043066)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K33-linked ubiquitination (GO:1990390)|protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|response to interferon-alpha (GO:0035455)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|PML body (GO:0016605)|trans-Golgi network (GO:0005802)	interferon-gamma binding (GO:0019964)|ubiquitin-protein transferase activity (GO:0004842)			breast(3)|endometrium(6)|kidney(1)|large_intestine(8)|lung(14)|ovary(1)|upper_aerodigestive_tract(1)	34						TTAAAATGACACATTGTGAAT	0.408																																					p.T602T	GBM(159;862 2695 6559 23041)	Atlas-SNP	.											.	KLHL20	54	.	0			c.A1806G						PASS	.						110.0	110.0	110.0					1																	173754361		2203	4300	6503	SO:0001819	synonymous_variant	27252	exon12			AATGACACATTGT	AB026190	CCDS1310.1	1q25.1	2013-01-30	2013-01-30		ENSG00000076321	ENSG00000076321		"""Kelch-like"", ""BTB/POZ domain containing"""	25056	protein-coding gene	gene with protein product			"""kelch-like 20 (Drosophila)"""			14668487, 20389280	Standard	NM_014458		Approved	KLEIP, KHLHX	uc001gjc.3	Q9Y2M5	OTTHUMG00000040548	ENST00000209884.4:c.1806A>G	chr1.hg19:g.173754361A>G		51.0	0.0	.		44.0	20.0	.	NM_014458	B3KMA0|B4DUR0|Q5TZF2|Q5ZF45|Q9H457	Silent	SNP	ENST00000209884.4	hg19	CCDS1310.1																																																																																			.	.	.	none		0.408	KLHL20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097582.1	NM_014458	
RFWD2	64326	hgsc.bcm.edu	37	1	176105635	176105635	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr1:176105635T>G	ENST00000367669.3	-	7	1394	c.880A>C	c.(880-882)Aag>Cag	p.K294Q	RFWD2_ENST00000308769.8_Intron	NM_022457.5	NP_071902.2	Q8NHY2	RFWD2_HUMAN	ring finger and WD repeat domain 2, E3 ubiquitin protein ligase	294					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin protein ligase activity (GO:0061630)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						TCCACTCTCTTAATATCCTCT	0.343																																					p.K294Q	Ovarian(134;1413 1765 5706 35534 51541)	Atlas-SNP	.											.	RFWD2	67	.	0			c.A880C						PASS	.						119.0	113.0	115.0					1																	176105635		2202	4300	6502	SO:0001583	missense	64326	exon7			CTCTCTTAATATC	AK001278	CCDS30944.1, CCDS44279.1	1q25.1-q25.2	2013-01-09	2012-02-23		ENSG00000143207	ENSG00000143207		"""WD repeat domain containing"", ""RING-type (C3HC4) zinc fingers"""	17440	protein-coding gene	gene with protein product		608067	"""ring finger and WD repeat domain 2"""			10395541	Standard	XM_005245447		Approved	FLJ10416, COP1, RNF200	uc001gku.1	Q8NHY2	OTTHUMG00000034986	ENST00000367669.3:c.880A>C	chr1.hg19:g.176105635T>G	ENSP00000356641:p.Lys294Gln	168.0	0.0	.		191.0	60.0	.	NM_022457	E9PKI0|Q504W6|Q6H103|Q9H6L7|X5D9B4	Missense_Mutation	SNP	ENST00000367669.3	hg19	CCDS30944.1	.	.	.	.	.	.	.	.	.	.	T	13.08	2.128960	0.37533	.	.	ENSG00000143207	ENST00000367665;ENST00000367669	T	0.12147	2.71	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.21718	0.0523	N	0.21448	0.665	0.80722	D	1	B;P;D	0.57899	0.2;0.659;0.981	B;P;D	0.67231	0.175;0.775;0.95	T	0.06881	-1.0802	10	0.21014	T	0.42	-14.9048	15.0966	0.72238	0.0:0.0:0.0:1.0	.	30;54;294	Q8NHY2-3;B1AMD2;Q8NHY2	.;.;RFWD2_HUMAN	Q	30;294	ENSP00000356641:K294Q	ENSP00000356637:K30Q	K	-	1	0	RFWD2	174372258	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.068000	0.71201	2.060000	0.61445	0.528000	0.53228	AAG	.	.	.	none		0.343	RFWD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084672.2	NM_022457	
WDR64	128025	hgsc.bcm.edu	37	1	241823862	241823862	+	Nonsense_Mutation	SNP	C	C	A	rs150170869	byFrequency	TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr1:241823862C>A	ENST00000366552.2	+	2	383	c.176C>A	c.(175-177)tCg>tAg	p.S59*	WDR64_ENST00000461971.1_3'UTR|WDR64_ENST00000437684.2_Nonsense_Mutation_p.S59*	NM_144625.4	NP_653226.4	B1ANS9	WDR64_HUMAN	WD repeat domain 64	59										breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(17)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			TTTTATGCATCGGTACAGAAG	0.393																																					p.S59X		Atlas-SNP	.											.	WDR64	234	.	0			c.C176A						PASS	.						262.0	219.0	232.0					1																	241823862		692	1591	2283	SO:0001587	stop_gained	128025	exon2			ATGCATCGGTACA	AK057540		1q43	2013-01-09			ENSG00000162843	ENSG00000162843		"""WD repeat domain containing"""	26570	protein-coding gene	gene with protein product							Standard	NM_144625		Approved	FLJ32978	uc001hzg.2	B1ANS9	OTTHUMG00000039705	ENST00000366552.2:c.176C>A	chr1.hg19:g.241823862C>A	ENSP00000355510:p.Ser59*	243.0	0.0	.		241.0	76.0	.	NM_144625	B1ANT0|Q7Z573|Q96LY9	Nonsense_Mutation	SNP	ENST00000366552.2	hg19		.	.	.	.	.	.	.	.	.	.	C	37	6.339487	0.97489	.	.	ENSG00000162843	ENST00000366552;ENST00000437684	.	.	.	5.36	2.28	0.28536	.	1.244700	0.05867	N	0.623941	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	0.5859	4.3923	0.11346	0.3709:0.4575:0.0:0.1716	.	.	.	.	X	59	.	ENSP00000355510:S59X	S	+	2	0	WDR64	239890485	0.000000	0.05858	0.000000	0.03702	0.721000	0.41392	0.083000	0.14871	0.148000	0.19059	0.655000	0.94253	TCG	.	C|0.997;T|0.003	.	alt		0.393	WDR64-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_144625	
OR11L1	391189	hgsc.bcm.edu	37	1	248004550	248004550	+	Missense_Mutation	SNP	G	G	A	rs563634223		TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr1:248004550G>A	ENST00000355784.2	-	1	704	c.649C>T	c.(649-651)Ccc>Tcc	p.P217S		NM_001001959.1	NP_001001959.1	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L, member 1	217						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			AAAACATAGGGCCCCAGTGTC	0.488													G|||	1	0.000199681	0.0	0.0	5008	,	,		20737	0.0		0.0	False		,,,				2504	0.001				p.P217S		Atlas-SNP	.											.	OR11L1	108	.	0			c.C649T						PASS	.						83.0	87.0	86.0					1																	248004550		2203	4300	6503	SO:0001583	missense	391189	exon1			CATAGGGCCCCAG	AB065646	CCDS31098.1	1q44	2013-09-24			ENSG00000197591	ENSG00000197591		"""GPCR / Class A : Olfactory receptors"""	14998	protein-coding gene	gene with protein product							Standard	NM_001001959		Approved		uc001idn.1	Q8NGX0	OTTHUMG00000040193	ENST00000355784.2:c.649C>T	chr1.hg19:g.248004550G>A	ENSP00000348033:p.Pro217Ser	304.0	0.0	.		302.0	96.0	.	NM_001001959		Missense_Mutation	SNP	ENST00000355784.2	hg19	CCDS31098.1	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.365610	0.00212	.	.	ENSG00000197591	ENST00000355784	T	0.28895	1.59	4.27	3.13	0.36017	GPCR, rhodopsin-like superfamily (1);	0.000000	0.34245	N	0.004124	T	0.02649	0.0080	N	0.00004	-3.355	0.21553	N	0.999641	B	0.02656	0.0	B	0.01281	0.0	T	0.40869	-0.9540	10	0.02654	T	1	.	5.3774	0.16172	0.7611:0.0:0.0856:0.1533	.	217	Q8NGX0	O11L1_HUMAN	S	217	ENSP00000348033:P217S	ENSP00000348033:P217S	P	-	1	0	OR11L1	246071173	0.973000	0.33851	0.617000	0.29091	0.139000	0.21198	3.184000	0.50926	0.774000	0.33427	-0.474000	0.04947	CCC	.	.	.	none		0.488	OR11L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096850.1	NM_001001959	
PNPT1	87178	hgsc.bcm.edu	37	2	55900032	55900032	+	Missense_Mutation	SNP	G	G	C	rs141543222	byFrequency	TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr2:55900032G>C	ENST00000447944.2	-	9	948	c.862C>G	c.(862-864)Cat>Gat	p.H288D		NM_033109.3	NP_149100.2	Q8TCS8	PNPT1_HUMAN	polyribonucleotide nucleotidyltransferase 1	288					cellular response to interferon-beta (GO:0035458)|cellular response to oxidative stress (GO:0034599)|mitochondrial mRNA catabolic process (GO:0000958)|mitochondrial mRNA polyadenylation (GO:0097222)|mitochondrial RNA 3'-end processing (GO:0000965)|mitochondrial RNA 5'-end processing (GO:0000964)|mitochondrial RNA catabolic process (GO:0000957)|mitochondrion morphogenesis (GO:0070584)|mitotic cell cycle arrest (GO:0071850)|mRNA catabolic process (GO:0006402)|negative regulation of growth (GO:0045926)|nuclear polyadenylation-dependent mRNA catabolic process (GO:0071042)|positive regulation of miRNA catabolic process (GO:2000627)|positive regulation of mitochondrial RNA catabolic process (GO:0000962)|positive regulation of mRNA catabolic process (GO:0061014)|protein homooligomerization (GO:0051260)|protein homotrimerization (GO:0070207)|regulation of cellular respiration (GO:0043457)|regulation of cellular senescence (GO:2000772)|RNA catabolic process (GO:0006401)|RNA import into mitochondrion (GO:0035927)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|RNA polyadenylation (GO:0043631)|rRNA import into mitochondrion (GO:0035928)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrial degradosome (GO:0045025)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)	3'-5'-exoribonuclease activity (GO:0000175)|miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|polyribonucleotide nucleotidyltransferase activity (GO:0004654)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(9)|skin(2)|urinary_tract(1)	27			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			TCTTACTTATGAGTATATTTC	0.388																																					p.H288D		Atlas-SNP	.											.	PNPT1	68	.	0			c.C862G						PASS	.						120.0	122.0	122.0					2																	55900032		2203	4300	6503	SO:0001583	missense	87178	exon9			ACTTATGAGTATA	BC053660	CCDS1856.1	2p15	2013-01-08			ENSG00000138035	ENSG00000138035			23166	protein-coding gene	gene with protein product	"""polynucleotide phosphorylase"", ""3'-5' RNA exonuclease"""	610316	"""deafness, autosomal recessive 70"""	DFNB70		12419256	Standard	NM_033109		Approved	PNPase, OLD35, old-35	uc002rzf.3	Q8TCS8	OTTHUMG00000129335	ENST00000447944.2:c.862C>G	chr2.hg19:g.55900032G>C	ENSP00000400646:p.His288Asp	92.0	0.0	.		97.0	39.0	.	NM_033109	Q53SU0|Q68CN1|Q7Z7D1|Q8IWX1|Q96T05|Q9BRU3|Q9BVX0	Missense_Mutation	SNP	ENST00000447944.2	hg19	CCDS1856.1	.	.	.	.	.	.	.	.	.	.	G	9.531	1.110961	0.20714	.	.	ENSG00000138035	ENST00000447944	T	0.56444	0.46	5.77	1.71	0.24356	Polynucleotide phosphorylase, phosphorolytic RNA-binding, bacterial/organelle-type (3);	0.736854	0.13396	N	0.390997	T	0.30696	0.0773	N	0.08118	0	0.21416	N	0.999699	B	0.02656	0.0	B	0.06405	0.002	T	0.20773	-1.0265	10	0.44086	T	0.13	.	9.8321	0.40948	0.071:0.0:0.4272:0.5018	.	288	Q8TCS8	PNPT1_HUMAN	D	288	ENSP00000400646:H288D	ENSP00000386075:H288D	H	-	1	0	PNPT1	55753536	0.997000	0.39634	0.469000	0.27204	0.706000	0.40770	2.348000	0.44045	0.435000	0.26365	-0.169000	0.13324	CAT	.	G|0.998;A|0.002	.	alt		0.388	PNPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251481.2	NM_033109	
CNNM4	26504	hgsc.bcm.edu	37	2	97427711	97427711	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr2:97427711C>G	ENST00000377075.2	+	1	1073	c.975C>G	c.(973-975)gaC>gaG	p.D325E		NM_020184.3	NP_064569.3	Q6P4Q7	CNNM4_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 4	325	DUF21.				biomineral tissue development (GO:0031214)|ion transport (GO:0006811)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)			breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)	20						AGCTCCTGGACTTTTTTCTGG	0.517																																					p.D325E		Atlas-SNP	.											.	CNNM4	48	.	0			c.C975G						PASS	.						94.0	98.0	97.0					2																	97427711		2203	4300	6503	SO:0001583	missense	26504	exon1			CCTGGACTTTTTT	AB046812	CCDS2024.2	2q11.2	2014-08-08	2014-08-07		ENSG00000158158	ENSG00000158158			105	protein-coding gene	gene with protein product		607805	"""cyclin M4"""	ACDP4		21393841, 24194943	Standard	XM_005263914		Approved	KIAA1592	uc002swx.3	Q6P4Q7	OTTHUMG00000130532	ENST00000377075.2:c.975C>G	chr2.hg19:g.97427711C>G	ENSP00000366275:p.Asp325Glu	154.0	0.0	.		174.0	65.0	.	NM_020184	B7Z1U0|C7SQM3|C7SQM4|C7SQM5|Q53RE5|Q9H9G3|Q9HCI0|Q9NRN1	Missense_Mutation	SNP	ENST00000377075.2	hg19	CCDS2024.2	.	.	.	.	.	.	.	.	.	.	C	15.01	2.706539	0.48412	.	.	ENSG00000158158	ENST00000377075	D	0.88509	-2.39	5.03	0.441	0.16577	Domain of unknown function DUF21 (1);	0.000000	0.85682	D	0.000000	D	0.90964	0.7159	M	0.81239	2.535	0.80722	D	1	P	0.47191	0.891	P	0.53809	0.735	D	0.88147	0.2848	10	0.38643	T	0.18	-3.7681	10.429	0.44395	0.0:0.6505:0.0:0.3495	.	325	Q6P4Q7	CNNM4_HUMAN	E	325	ENSP00000366275:D325E	ENSP00000366275:D325E	D	+	3	2	CNNM4	96791438	0.977000	0.34250	0.961000	0.40146	0.995000	0.86356	0.470000	0.22084	0.136000	0.18733	0.655000	0.94253	GAC	.	.	.	none		0.517	CNNM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252954.1	NM_020184	
MCM6	4175	hgsc.bcm.edu	37	2	136614438	136614438	+	Missense_Mutation	SNP	G	G	A	rs202222981		TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr2:136614438G>A	ENST00000264156.2	-	11	1546	c.1486C>T	c.(1486-1488)Cgg>Tgg	p.R496W	MCM6_ENST00000492091.1_Intron	NM_005915.5	NP_005906.2	Q14566	MCM6_HUMAN	minichromosome maintenance complex component 6	496	MCM.				DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|identical protein binding (GO:0042802)|single-stranded DNA binding (GO:0003697)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(15)|prostate(2)|skin(1)	29				BRCA - Breast invasive adenocarcinoma(221;0.166)		ATGGACGTCCGGGCGTTCAGA	0.388																																					p.R496W	Ovarian(196;141 2104 8848 24991 25939)	Atlas-SNP	.											.	MCM6	64	.	0			c.C1486T						PASS	.						79.0	77.0	78.0					2																	136614438		2203	4300	6503	SO:0001583	missense	4175	exon11			ACGTCCGGGCGTT		CCDS2179.1	2q14-q21	2008-02-05	2007-04-04		ENSG00000076003	ENSG00000076003			6949	protein-coding gene	gene with protein product	"""MIS5 homolog (S.pombe)"""	601806	"""minichromosome maintenance deficient (mis5, S. pombe) 6"", ""MCM6 minichromosome maintenance deficient 6 (MIS5 homolog, S. pombe) (S. cerevisiae)"", ""minichromosome maintenance deficient 6 homolog (S. cerevisiae)"""				Standard	NM_005915		Approved	Mis5	uc002tuw.4	Q14566	OTTHUMG00000131739	ENST00000264156.2:c.1486C>T	chr2.hg19:g.136614438G>A	ENSP00000264156:p.Arg496Trp	106.0	0.0	.		112.0	32.0	.	NM_005915	B2R6H2|Q13504|Q99859	Missense_Mutation	SNP	ENST00000264156.2	hg19	CCDS2179.1	.	.	.	.	.	.	.	.	.	.	G	17.19	3.325884	0.60743	.	.	ENSG00000076003	ENST00000264156	T	0.12672	2.66	5.87	3.46	0.39613	.	0.000000	0.85682	D	0.000000	T	0.57359	0.2048	H	0.99626	4.665	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74140	-0.3761	10	0.87932	D	0	-14.5676	12.8383	0.57786	0.0:0.0:0.4151:0.5849	.	496	Q14566	MCM6_HUMAN	W	496	ENSP00000264156:R496W	ENSP00000264156:R496W	R	-	1	2	MCM6	136330908	1.000000	0.71417	1.000000	0.80357	0.690000	0.40134	3.514000	0.53422	0.460000	0.27045	-0.467000	0.05162	CGG	.	G|1.000;T|0.000	.	alt		0.388	MCM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254658.1	NM_005915	
TTN	7273	hgsc.bcm.edu	37	2	179604477	179604477	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr2:179604477T>A	ENST00000591111.1	-	46	12756	c.12532A>T	c.(12532-12534)Att>Ttt	p.I4178F	TTN_ENST00000359218.5_Missense_Mutation_p.I4257F|TTN_ENST00000460472.2_Missense_Mutation_p.I4132F|TTN_ENST00000342175.6_Missense_Mutation_p.I4324F|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.I4495F|TTN-AS1_ENST00000582847.1_RNA|TTN-AS1_ENST00000590773.1_RNA			Q8WZ42	TITIN_HUMAN	titin	0					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCTTGCTGAATTCTAGGACCC	0.383																																					p.I4495F		Atlas-SNP	.											.	TTN	18412	.	0			c.A13483T						PASS	.						189.0	188.0	188.0					2																	179604477		1861	4101	5962	SO:0001583	missense	7273	exon48			GCTGAATTCTAGG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.12532A>T	chr2.hg19:g.179604477T>A	ENSP00000465570:p.Ile4178Phe	155.0	0.0	.		153.0	56.0	.	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	T	4.968	0.179779	0.09443	.	.	ENSG00000155657	ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T	0.63580	0.01;-0.04;-0.05	5.44	1.48	0.22813	.	.	.	.	.	T	0.47322	0.1439	L	0.42245	1.32	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.47355	-0.9124	9	0.87932	D	0	.	0.8604	0.01192	0.1519:0.2518:0.1568:0.4394	.	4132;4257;4324	D3DPF9;E7EQE6;E7ET18	.;.;.	F	4132;4324;4257;4132	ENSP00000434586:I4132F;ENSP00000340554:I4324F;ENSP00000352154:I4257F	ENSP00000340554:I4324F	I	-	1	0	TTN	179312722	0.000000	0.05858	0.195000	0.23364	0.349000	0.29174	-0.311000	0.08124	0.354000	0.24105	0.533000	0.62120	ATT	.	.	.	none		0.383	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	hgsc.bcm.edu	37	2	179604480	179604480	+	Silent	SNP	T	T	G			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr2:179604480T>G	ENST00000591111.1	-	46	12753	c.12529A>C	c.(12529-12531)Aga>Cga	p.R4177R	TTN_ENST00000359218.5_Silent_p.R4256R|TTN_ENST00000460472.2_Silent_p.R4131R|TTN_ENST00000342175.6_Silent_p.R4323R|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Silent_p.R4494R|TTN-AS1_ENST00000582847.1_RNA|TTN-AS1_ENST00000590773.1_RNA			Q8WZ42	TITIN_HUMAN	titin	0					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGCTGAATTCTAGGACCCTCA	0.388																																					p.R4494R		Atlas-SNP	.											.	TTN	18412	.	0			c.A13480C						PASS	.						189.0	187.0	188.0					2																	179604480		1855	4102	5957	SO:0001819	synonymous_variant	7273	exon48			GAATTCTAGGACC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.12529A>C	chr2.hg19:g.179604480T>G		153.0	0.0	.		153.0	57.0	.	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	hg19																																																																																				.	.	.	none		0.388	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
DIS3L2	129563	hgsc.bcm.edu	37	2	233001388	233001388	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr2:233001388C>T	ENST00000360410.4	+	9	1244	c.968C>T	c.(967-969)gCc>gTc	p.A323V	DIS3L2_ENST00000273009.6_Silent_p.C303C|DIS3L2_ENST00000409307.1_Silent_p.C303C|DIS3L2_ENST00000325385.7_Silent_p.C303C					DIS3 like 3'-5' exoribonuclease 2											breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(2)|urinary_tract(1)	40		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		TGTTCATCTGCCGCATTGTGG	0.517																																					p.C303C		Atlas-SNP	.											.	DIS3L2	77	.	0			c.C909T						PASS	.						115.0	110.0	112.0					2																	233001388		1948	4147	6095	SO:0001583	missense	129563	exon8			CATCTGCCGCATT	BC026166	CCDS42834.1, CCDS58752.1, CCDS58753.1	2q37.1	2014-09-17	2014-03-05		ENSG00000144535	ENSG00000144535			28648	protein-coding gene	gene with protein product		614184	"""family with sequence similarity 6, member A"", ""DIS3 mitotic control homolog (S. cerevisiae)-like 2"""	FAM6A		22306653, 23503588	Standard	NM_152383		Approved	FLJ36974, MGC42174	uc010fxz.3	Q8IYB7	OTTHUMG00000153385	ENST00000360410.4:c.968C>T	chr2.hg19:g.233001388C>T	ENSP00000353584:p.Ala323Val	138.0	0.0	.		148.0	49.0	.	NM_152383		Silent	SNP	ENST00000360410.4	hg19		.	.	.	.	.	.	.	.	.	.	C	24.4	4.524345	0.85600	.	.	ENSG00000144535	ENST00000360410	T	0.38560	1.13	6.08	5.21	0.72293	.	.	.	.	.	T	0.49270	0.1547	.	.	.	0.25328	N	0.989053	.	.	.	.	.	.	T	0.47560	-0.9108	6	0.87932	D	0	-20.4148	11.8835	0.52589	0.0:0.8511:0.0:0.1489	.	.	.	.	V	323	ENSP00000353584:A323V	ENSP00000353584:A323V	A	+	2	0	DIS3L2	232709632	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.662000	0.37418	1.592000	0.50018	0.591000	0.81541	GCC	.	.	.	none		0.517	DIS3L2-202	KNOWN	basic	protein_coding	protein_coding		NM_152383	
NUP210	23225	hgsc.bcm.edu	37	3	13383246	13383246	+	Splice_Site	SNP	A	A	G			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr3:13383246A>G	ENST00000254508.5	-	23	3311		c.e23+1		NUP210_ENST00000485755.1_5'Flank	NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					AACTCGTCTTACTTCAATCTG	0.507																																					.		Atlas-SNP	.											.	NUP210	182	.	0			c.3228+2T>C						PASS	.						158.0	130.0	140.0					3																	13383246		2203	4300	6503	SO:0001630	splice_region_variant	23225	exon24			CGTCTTACTTCAA	AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.3228+1T>C	chr3.hg19:g.13383246A>G		46.0	0.0	.		47.0	17.0	.	NM_024923	A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Splice_Site	SNP	ENST00000254508.5	hg19	CCDS33704.1	.	.	.	.	.	.	.	.	.	.	A	15.91	2.972046	0.53614	.	.	ENSG00000132182	ENST00000254508	.	.	.	5.64	5.64	0.86602	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8389	0.70209	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NUP210	13358246	1.000000	0.71417	0.859000	0.33776	0.496000	0.33645	8.214000	0.89760	2.147000	0.66899	0.455000	0.32223	.	.	.	.	none		0.507	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340085.1	NM_024923	Intron
COLQ	8292	hgsc.bcm.edu	37	3	15531095	15531095	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr3:15531095G>T	ENST00000383788.5	-	2	281	c.156C>A	c.(154-156)tgC>tgA	p.C52*	COLQ_ENST00000383786.5_Nonsense_Mutation_p.C52*|COLQ_ENST00000603808.1_Nonsense_Mutation_p.C52*|COLQ_ENST00000435459.2_Nonsense_Mutation_p.C42*|COLQ_ENST00000383781.4_Nonsense_Mutation_p.C42*|COLQ_ENST00000383785.2_Nonsense_Mutation_p.C52*|COLQ_ENST00000383787.2_Nonsense_Mutation_p.C52*	NM_005677.3	NP_005668.2	Q9Y215	COLQ_HUMAN	collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase	52	PRAD.				acetylcholine catabolic process in synaptic cleft (GO:0001507)|asymmetric protein localization (GO:0008105)	basal lamina (GO:0005605)|cell junction (GO:0030054)|collagen trimer (GO:0005581)|extracellular space (GO:0005615)|synapse (GO:0045202)				endometrium(2)|large_intestine(4)|lung(10)|skin(3)	19						GCGTCAGCAGGCAGCATGCTT	0.552																																					p.C52X		Atlas-SNP	.											.	COLQ	82	.	0			c.C156A						PASS	.						97.0	79.0	85.0					3																	15531095		2203	4300	6503	SO:0001587	stop_gained	8292	exon2			CAGCAGGCAGCAT	AF057036	CCDS33709.1, CCDS43057.1, CCDS46768.1	3p	2008-07-18			ENSG00000206561	ENSG00000206561			2226	protein-coding gene	gene with protein product	"""single strand of homotrimeric collagen-like tail subunit of asymmetric acetylcholinesterase"", ""collagenic tail of endplate acetylcholinesterase"", ""AChE Q subunit"", ""acetylcholinesterase-associated collagen"""	603033				9689136	Standard	NM_005677		Approved	EAD	uc003bzx.3	Q9Y215	OTTHUMG00000156233	ENST00000383788.5:c.156C>A	chr3.hg19:g.15531095G>T	ENSP00000373298:p.Cys52*	48.0	0.0	.		66.0	22.0	.	NM_080539	B3KY09|Q6DK18|Q6YH18|Q6YH19|Q6YH20|Q6YH21|Q9NP18|Q9NP19|Q9NP20|Q9NP21|Q9NP22|Q9NP23|Q9NP24|Q9UP88	Nonsense_Mutation	SNP	ENST00000383788.5	hg19	CCDS33709.1	.	.	.	.	.	.	.	.	.	.	G	34	5.335466	0.95758	.	.	ENSG00000206561	ENST00000383787;ENST00000383781;ENST00000435459;ENST00000383785;ENST00000383788;ENST00000420589;ENST00000454772;ENST00000383786;ENST00000430319	.	.	.	5.31	2.52	0.30459	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.6715	6.8574	0.24048	0.2721:0.0:0.7279:0.0	.	.	.	.	X	52;42;42;52;52;42;52;52;29	.	ENSP00000373291:C42X	C	-	3	2	COLQ	15506099	1.000000	0.71417	1.000000	0.80357	0.839000	0.47603	1.188000	0.32102	1.249000	0.43950	0.561000	0.74099	TGC	.	.	.	none		0.552	COLQ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000343575.1	NM_005677	
CTNNB1	1499	hgsc.bcm.edu	37	3	41275683	41275683	+	Silent	SNP	T	T	G			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr3:41275683T>G	ENST00000349496.5	+	10	1858	c.1578T>G	c.(1576-1578)ccT>ccG	p.P526P	CTNNB1_ENST00000396185.3_Silent_p.P526P|CTNNB1_ENST00000405570.1_Silent_p.P526P|CTNNB1_ENST00000396183.3_Silent_p.P526P|CTNNB1_ENST00000453024.1_Silent_p.P519P	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	526					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)		CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		ATCATGCACCTTTGCGTGAGC	0.483		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.P526P	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	.	CTNNB1	4904	.	0			c.T1578G						PASS	.						157.0	134.0	142.0					3																	41275683		2203	4300	6503	SO:0001819	synonymous_variant	1499	exon10	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	TGCACCTTTGCGT	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.1578T>G	chr3.hg19:g.41275683T>G		123.0	0.0	.		157.0	61.0	.	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Silent	SNP	ENST00000349496.5	hg19	CCDS2694.1																																																																																			.	.	.	none		0.483	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
GPR87	53836	hgsc.bcm.edu	37	3	151012726	151012726	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr3:151012726C>G	ENST00000260843.4	-	3	772	c.308G>C	c.(307-309)gGa>gCa	p.G103A	MED12L_ENST00000491549.1_Intron|MED12L_ENST00000273432.4_Intron|MED12L_ENST00000474524.1_Intron	NM_023915.3	NP_076404.3	Q9BY21	GPR87_HUMAN	G protein-coupled receptor 87	103					negative regulation of adenylate cyclase activity (GO:0007194)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			endometrium(6)|large_intestine(6)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	19			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			AGGTCCAAATCCTGCATCATG	0.378																																					p.G103A		Atlas-SNP	.											.	GPR87	52	.	0			c.G308C						PASS	.						130.0	129.0	129.0					3																	151012726		2203	4300	6503	SO:0001583	missense	53836	exon3			CCAAATCCTGCAT	AF237763	CCDS3157.1	3q24	2012-08-21			ENSG00000138271	ENSG00000138271		"""GPCR / Class A : Orphans"""	4538	protein-coding gene	gene with protein product		606379		GPR95		11273702	Standard	NM_023915		Approved		uc003eyt.2	Q9BY21	OTTHUMG00000159858	ENST00000260843.4:c.308G>C	chr3.hg19:g.151012726C>G	ENSP00000260843:p.Gly103Ala	84.0	0.0	.		94.0	27.0	.	NM_023915	Q5KU35|Q96JZ8|Q9BXC2	Missense_Mutation	SNP	ENST00000260843.4	hg19	CCDS3157.1	.	.	.	.	.	.	.	.	.	.	C	15.73	2.920883	0.52653	.	.	ENSG00000138271	ENST00000260843	T	0.70631	-0.5	5.4	5.4	0.78164	GPCR, rhodopsin-like superfamily (1);	0.138010	0.47852	D	0.000213	T	0.71929	0.3398	L	0.46741	1.465	0.44771	D	0.99777	D	0.56746	0.977	P	0.57204	0.815	T	0.65825	-0.6074	10	0.07644	T	0.81	-8.5498	13.8439	0.63455	0.0:0.9243:0.0:0.0757	.	103	Q9BY21	GPR87_HUMAN	A	103	ENSP00000260843:G103A	ENSP00000260843:G103A	G	-	2	0	GPR87	152495416	0.975000	0.34042	0.899000	0.35326	0.921000	0.55340	3.443000	0.52907	2.688000	0.91661	0.655000	0.94253	GGA	.	.	.	none		0.378	GPR87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357788.1		
PIK3CA	5290	hgsc.bcm.edu	37	3	178936082	178936082	+	Missense_Mutation	SNP	G	G	A	rs121913273		TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr3:178936082G>A	ENST00000263967.3	+	10	1781	c.1624G>A	c.(1624-1626)Gaa>Aaa	p.E542K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	542	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> K (in CLOVE, KERSEB, CRC and BC; also found in glioblastoma multiforme and endometrial carcinoma; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N- terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|E -> Q (found in an endometrial carcinoma sample; unknown pathological significance). {ECO:0000269|PubMed:16322209}.|E -> V (in BC; unknown pathological significance). {ECO:0000269|PubMed:16353168}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E542K(545)|p.E542Q(10)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TCCTCTCTCTGAAATCACTGA	0.333	E542K(BT483_BREAST)|E542K(CAL51_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(VMCUB1_URINARY_TRACT)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.E542K	Colon(199;1504 1750 3362 26421 31210 32040)	Atlas-SNP	.		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA_ENST00000263967,NS,carcinoma,0,2	PIK3CA	8460	.	555	Substitution - Missense(555)	breast(176)|large_intestine(166)|urinary_tract(45)|endometrium(37)|skin(19)|lung(18)|stomach(16)|ovary(16)|thyroid(14)|upper_aerodigestive_tract(9)|central_nervous_system(7)|cervix(6)|liver(6)|oesophagus(5)|penis(4)|kidney(3)|soft_tissue(2)|haematopoietic_and_lymphoid_tissue(2)|prostate(2)|biliary_tract(1)|pituitary(1)	c.G1624A						PASS	.						56.0	56.0	56.0					3																	178936082		1809	4069	5878	SO:0001583	missense	5290	exon10			CTCTCTGAAATCA		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1624G>A	chr3.hg19:g.178936082G>A	ENSP00000263967:p.Glu542Lys	468.0	0.0	.		502.0	193.0	.	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	hg19	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	34	5.360420	0.95877	.	.	ENSG00000121879	ENST00000263967	T	0.62105	0.05	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69287	0.3094	L	0.41356	1.27	0.80722	D	1	D	0.65815	0.995	D	0.63192	0.912	T	0.60296	-0.7291	10	0.09843	T	0.71	-23.9623	20.0024	0.97423	0.0:0.0:1.0:0.0	.	542	P42336	PK3CA_HUMAN	K	542	ENSP00000263967:E542K	ENSP00000263967:E542K	E	+	1	0	PIK3CA	180418776	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAA	.	.	.	weak		0.333	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
FAM157A	728262	hgsc.bcm.edu	37	3	197880164	197880164	+	lincRNA	SNP	G	G	A			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr3:197880164G>A	ENST00000437428.2	+	0	44							C9JC47	F157A_HUMAN	family with sequence similarity 157, member A											NS(1)|skin(1)	2						agcagcagcagcagcagcaAC	0.527																																					p.Q81Q		Atlas-SNP	.											.	FAM157A	4	.	0			c.G243A						PASS	.						3.0	6.0	5.0					3																	197880164		474	1113	1587			728262	exon2			GCAGCAGCAGCAG			3q29	2013-01-30			ENSG00000236438	ENSG00000236438			34079	other	unknown							Standard	NM_001145248		Approved		uc011bup.1	C9JC47			chr3.hg19:g.197880164G>A		262.0	0.0	.		310.0	24.0	.	NM_001145248		Silent	SNP	ENST00000437428.2	hg19																																																																																				.	.	.	none		0.527	FAM157A-001	KNOWN	not_best_in_genome_evidence|mRNA_end_NF|basic	lincRNA	lincRNA	OTTHUMT00000340078.2	NM_001145248	
PIGG	54872	hgsc.bcm.edu	37	4	514958	514958	+	Silent	SNP	A	A	C			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr4:514958A>C	ENST00000453061.2	+	7	1334	c.1228A>C	c.(1228-1230)Agg>Cgg	p.R410R	PIGG_ENST00000310340.5_Silent_p.R410R|PIGG_ENST00000383028.4_Silent_p.R277R|PIGG_ENST00000504346.1_Silent_p.R321R|PIGG_ENST00000536264.1_Silent_p.R288R|PIGG_ENST00000503111.1_Intron|PIGG_ENST00000296306.7_Intron|PIGG_ENST00000509768.1_Silent_p.R321R	NM_001127178.1	NP_001120650.1	Q5H8A4	PIGG_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class G	410					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	CP2 mannose-ethanolamine phosphotransferase activity (GO:0051267)|phosphotransferase activity, for other substituted phosphate groups (GO:0016780)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	39						CAAGGTTCTCAGGCAGTACCT	0.488																																					p.R410R		Atlas-SNP	.											.	PIGG	86	.	0			c.A1228C						PASS	.						137.0	113.0	121.0					4																	514958		2203	4300	6503	SO:0001819	synonymous_variant	54872	exon7			GTTCTCAGGCAGT		CCDS3336.1, CCDS46992.1, CCDS75080.1, CCDS75081.1, CCDS75082.1, CCDS75083.1	4p16.3	2013-02-26	2006-06-28		ENSG00000174227	ENSG00000174227		"""Phosphatidylinositol glycan anchor biosynthesis"""	25985	protein-coding gene	gene with protein product			"""phosphatidylinositol glycan, class G"""			15632136	Standard	XM_005272287		Approved	FLJ20265, GPI7, LAS21	uc003gak.4	Q5H8A4	OTTHUMG00000112457	ENST00000453061.2:c.1228A>C	chr4.hg19:g.514958A>C		117.0	0.0	.		141.0	54.0	.	NM_017733	B4DKC7|Q2TAK5|Q6UX31|Q7L5Y4|Q8N866|Q8NCC9|Q96SY9|Q9BVT7|Q9NXG5	Silent	SNP	ENST00000453061.2	hg19	CCDS46992.1																																																																																			.	.	.	none		0.488	PIGG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000357494.1	NM_017733	
NSG1	27065	hgsc.bcm.edu	37	4	4389387	4389387	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr4:4389387A>G	ENST00000421177.2	+	6	2022	c.31A>G	c.(31-33)Aag>Gag	p.K11E	NSG1_ENST00000433139.2_Missense_Mutation_p.K11E|NSG1_ENST00000505246.1_Missense_Mutation_p.K11E|NSG1_ENST00000504171.1_Missense_Mutation_p.K11E|NSG1_ENST00000513555.1_Missense_Mutation_p.K11E|NSG1_ENST00000506380.1_Missense_Mutation_p.K11E|NSG1_ENST00000397958.1_Missense_Mutation_p.K11E			P42857	NSG1_HUMAN		11					clathrin coat assembly (GO:0048268)|dopamine receptor signaling pathway (GO:0007212)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)											TTTCGCAGAGAAGGGCACCAA	0.637																																					p.K11E		Atlas-SNP	.											.	.	.	.	0			c.A31G						PASS	.						75.0	70.0	72.0					4																	4389387		2203	4300	6503	SO:0001583	missense	0	exon2			GCAGAGAAGGGCA																												ENST00000421177.2:c.31A>G	chr4.hg19:g.4389387A>G	ENSP00000388823:p.Lys11Glu	243.0	0.0	.		347.0	120.0	.	NM_014392	B4DXC5|Q49AQ1	Missense_Mutation	SNP	ENST00000421177.2	hg19	CCDS3376.1	.	.	.	.	.	.	.	.	.	.	A	17.52	3.410458	0.62399	.	.	ENSG00000168824	ENST00000421177;ENST00000513555;ENST00000505246;ENST00000506380;ENST00000397958;ENST00000433139;ENST00000504171	.	.	.	3.41	3.41	0.39046	.	0.184924	0.35013	N	0.003502	T	0.68540	0.3012	M	0.73217	2.22	0.48511	D	0.999661	B;B	0.31054	0.043;0.306	B;B	0.43360	0.073;0.417	T	0.72836	-0.4172	9	0.87932	D	0	-11.9118	12.1775	0.54194	1.0:0.0:0.0:0.0	.	11;11	B4DXC5;P42857	.;NSG1_HUMAN	E	11	.	ENSP00000381049:K11E	K	+	1	0	AC110814.1	4440288	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.816000	0.86201	1.334000	0.45468	0.260000	0.18958	AAG	.	.	.	none		0.637	NSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246799.1		
KLF3	51274	hgsc.bcm.edu	37	4	38690438	38690438	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr4:38690438T>C	ENST00000261438.5	+	3	595	c.290T>C	c.(289-291)aTg>aCg	p.M97T	KLF3_ENST00000514033.1_Missense_Mutation_p.M97T	NM_016531.5	NP_057615.3	P57682	KLF3_HUMAN	Kruppel-like factor 3 (basic)	97	Pro-rich.				cellular response to peptide (GO:1901653)|multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(5)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	18						GGGTTGAGCATGCCTTCTTCC	0.612																																					p.M97T		Atlas-SNP	.											.	KLF3	40	.	0			c.T290C						PASS	.						77.0	75.0	76.0					4																	38690438		2203	4300	6503	SO:0001583	missense	51274	exon3			TGAGCATGCCTTC	AF285837	CCDS3444.1	4p16.1-p15.2	2013-01-08			ENSG00000109787	ENSG00000109787		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	16516	protein-coding gene	gene with protein product	"""basic Kruppel-like factor"""	609392				18391014	Standard	NM_016531		Approved	BKLF	uc003gth.4	P57682	OTTHUMG00000097821	ENST00000261438.5:c.290T>C	chr4.hg19:g.38690438T>C	ENSP00000261438:p.Met97Thr	108.0	0.0	.		129.0	46.0	.	NM_016531	Q6PIR1|Q86TN0|Q9P2X6	Missense_Mutation	SNP	ENST00000261438.5	hg19	CCDS3444.1	.	.	.	.	.	.	.	.	.	.	T	10.08	1.252657	0.22965	.	.	ENSG00000109787	ENST00000261438;ENST00000514033	T;T	0.48522	0.81;0.81	6.06	6.06	0.98353	.	0.400686	0.28077	N	0.016682	T	0.33000	0.0848	N	0.14661	0.345	0.30663	N	0.754158	B	0.11235	0.004	B	0.09377	0.004	T	0.18398	-1.0338	10	0.22706	T	0.39	.	16.6093	0.84858	0.0:0.0:0.0:1.0	.	97	P57682	KLF3_HUMAN	T	97	ENSP00000261438:M97T;ENSP00000421252:M97T	ENSP00000261438:M97T	M	+	2	0	KLF3	38366833	1.000000	0.71417	1.000000	0.80357	0.114000	0.19823	3.153000	0.50685	2.324000	0.78689	0.533000	0.62120	ATG	.	.	.	none		0.612	KLF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215093.2		
AMBN	258	hgsc.bcm.edu	37	4	71468348	71468348	+	Missense_Mutation	SNP	G	G	T	rs368655454|rs141384720|rs199556863	byFrequency	TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr4:71468348G>T	ENST00000322937.6	+	7	642	c.539G>T	c.(538-540)gGa>gTa	p.G180V	AMBN_ENST00000449493.2_Missense_Mutation_p.G165V	NM_016519.5	NP_057603.1	Q9NP70	AMBN_HUMAN	ameloblastin (enamel matrix protein)	180				G -> R (in Ref. 3; AAG35772 and 4; AAG27036). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|odontogenesis of dentin-containing tooth (GO:0042475)	proteinaceous extracellular matrix (GO:0005578)	growth factor activity (GO:0008083)|structural constituent of tooth enamel (GO:0030345)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)	29			Lung(101;0.235)			TAGCTCCCAGGAGTAGATTTT	0.264																																					p.G180V		Atlas-SNP	.											.	AMBN	73	.	0			c.G539T						PASS	.						42.0	49.0	47.0					4																	71468348		2161	4276	6437	SO:0001583	missense	258	exon7			TCCCAGGAGTAGA	AF209780	CCDS3543.1	4q21	2006-11-28	2006-04-27		ENSG00000178522	ENSG00000178522			452	protein-coding gene	gene with protein product		601259	"""ameloblastin, enamel matrix protein"""			9126491	Standard	NM_016519		Approved		uc003hfl.3	Q9NP70	OTTHUMG00000129913	ENST00000322937.6:c.539G>T	chr4.hg19:g.71468348G>T	ENSP00000313809:p.Gly180Val	247.0	0.0	.		309.0	16.0	.	NM_016519	Q3B862|Q9H2X1|Q9H4L1	Missense_Mutation	SNP	ENST00000322937.6	hg19	CCDS3543.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.097|0.097	-1.157535|-1.157535	0.01686|0.01686	.|.	.|.	ENSG00000178522|ENSG00000178522	ENST00000322937;ENST00000449493|ENST00000538728	T;T|.	0.27890|.	1.64;1.64|.	3.34|3.34	-2.84|-2.84	0.05751|0.05751	.|.	2.543920|.	0.02234|.	U|.	0.065161|.	T|T	0.18002|0.18002	0.0432|0.0432	N|N	0.22421|0.22421	0.69|0.69	0.19575|0.19575	N|N	0.999964|0.999964	B|.	0.17268|.	0.021|.	B|.	0.12837|.	0.008|.	T|T	0.24190|0.24190	-1.0167|-1.0167	10|6	0.22706|0.29301	T|T	0.39|0.29	.|.	0.3396|0.3396	0.00331|0.00331	0.3712:0.1546:0.2472:0.227|0.3712:0.1546:0.2472:0.227	.|.	180|.	Q9NP70|.	AMBN_HUMAN|.	V|L	180;165|179	ENSP00000313809:G180V;ENSP00000391234:G165V|.	ENSP00000313809:G180V|ENSP00000445605:R179L	G|R	+|+	2|2	0|0	AMBN|AMBN	71502937|71502937	0.095000|0.095000	0.21747|0.21747	0.002000|0.002000	0.10522|0.10522	0.194000|0.194000	0.23727|0.23727	-0.066000|-0.066000	0.11598|0.11598	-0.545000|-0.545000	0.06224|0.06224	0.305000|0.305000	0.20034|0.20034	GGA|CGA	.	.	.	weak		0.264	AMBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252165.1	NM_016519	
TMEM150C	441027	hgsc.bcm.edu	37	4	83424056	83424056	+	Silent	SNP	T	T	G			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr4:83424056T>G	ENST00000515780.2	-	4	363	c.159A>C	c.(157-159)ccA>ccC	p.P53P	TMEM150C_ENST00000449862.2_Silent_p.P53P|TMEM150C_ENST00000508701.1_Silent_p.P53P			B9EJG8	T150C_HUMAN	transmembrane protein 150C	53						integral component of membrane (GO:0016021)				ovary(1)	1						ACCTTATATATGGTGCATGCT	0.378																																					p.P53P		Atlas-SNP	.											.	TMEM150C	16	.	0			c.A159C						PASS	.						54.0	50.0	51.0					4																	83424056		1818	4082	5900	SO:0001819	synonymous_variant	441027	exon4			TATATATGGTGCA	BC147027	CCDS47087.1	4q21.22	2010-06-25			ENSG00000249242	ENSG00000249242			37263	protein-coding gene	gene with protein product							Standard	NM_001080506		Approved	FLJ12993	uc003hmy.1	B9EJG8	OTTHUMG00000161083	ENST00000515780.2:c.159A>C	chr4.hg19:g.83424056T>G		181.0	0.0	.		182.0	65.0	.	NM_001080506	B7Z4J5|B7Z4L3|B7Z692|B7Z6X6	Silent	SNP	ENST00000515780.2	hg19	CCDS47087.1																																																																																			.	.	.	none		0.378	TMEM150C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363685.2	NM_001080506	
WDFY3	23001	hgsc.bcm.edu	37	4	85748064	85748064	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr4:85748064T>C	ENST00000295888.4	-	10	1434	c.1027A>G	c.(1027-1029)Aca>Gca	p.T343A	WDFY3_ENST00000322366.6_Missense_Mutation_p.T343A	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	343					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CCATATGTTGTTAGGGAAGTT	0.403																																					p.T343A		Atlas-SNP	.											.	WDFY3	314	.	0			c.A1027G						PASS	.						131.0	120.0	124.0					4																	85748064		2203	4300	6503	SO:0001583	missense	23001	exon10			ATGTTGTTAGGGA	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.1027A>G	chr4.hg19:g.85748064T>C	ENSP00000295888:p.Thr343Ala	92.0	0.0	.		117.0	41.0	.	NM_014991	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	ENST00000295888.4	hg19	CCDS3609.1	.	.	.	.	.	.	.	.	.	.	T	14.31	2.497563	0.44455	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	T;T	0.15372	2.43;2.43	5.54	5.54	0.83059	.	0.102926	0.64402	D	0.000003	T	0.12092	0.0294	L	0.36672	1.1	0.54753	D	0.999988	B;B	0.28378	0.209;0.129	B;B	0.25140	0.058;0.058	T	0.07693	-1.0759	10	0.08837	T	0.75	.	10.8264	0.46635	0.0:0.0736:0.0:0.9264	.	343;343	E2QRK8;Q8IZQ1	.;WDFY3_HUMAN	A	343	ENSP00000318466:T343A;ENSP00000295888:T343A	ENSP00000295888:T343A	T	-	1	0	WDFY3	85967088	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	3.679000	0.54634	2.102000	0.63906	0.533000	0.62120	ACA	.	.	.	none		0.403	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991	
SPRY1	10252	hgsc.bcm.edu	37	4	124323105	124323105	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr4:124323105C>T	ENST00000394339.2	+	2	699	c.359C>T	c.(358-360)gCa>gTa	p.A120V	SPRY1_ENST00000339241.1_Missense_Mutation_p.A120V	NM_001258039.1|NM_005841.2	NP_001244968.1|NP_005832.1	O43609	SPY1_HUMAN	sprouty homolog 1, antagonist of FGF signaling (Drosophila)	120					epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	cytosol (GO:0005829)|plasma membrane (GO:0005886)				NS(1)|large_intestine(4)|lung(2)|ovary(1)|skin(3)	11						ACTGGAAGTGCAGCCAGCTCT	0.542																																					p.A120V		Atlas-SNP	.											.	SPRY1	28	.	0			c.C359T						PASS	.						55.0	59.0	58.0					4																	124323105		2203	4300	6503	SO:0001583	missense	10252	exon2			GAAGTGCAGCCAG	AF041037	CCDS3731.1	4q	2009-04-17	2001-11-28		ENSG00000164056	ENSG00000164056			11269	protein-coding gene	gene with protein product		602465	"""sprouty (Drosophila) homolog 1 (antagonist of FGF signaling)"""			9458049, 15962011	Standard	NM_001258038		Approved	hSPRY1	uc003ifa.4	O43609	OTTHUMG00000133071	ENST00000394339.2:c.359C>T	chr4.hg19:g.124323105C>T	ENSP00000377871:p.Ala120Val	195.0	0.0	.		227.0	91.0	.	NM_001258039	D3DNX6|Q6PNE0	Missense_Mutation	SNP	ENST00000394339.2	hg19	CCDS3731.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.022104	0.75275	.	.	ENSG00000164056	ENST00000339241;ENST00000507703;ENST00000394339	T;T;T	0.55760	0.5;1.48;0.5	5.06	5.06	0.68205	.	0.066264	0.64402	D	0.000017	T	0.66336	0.2779	M	0.63428	1.95	0.58432	D	0.999997	D	0.61080	0.989	P	0.57846	0.828	T	0.65500	-0.6153	9	.	.	.	-14.3112	18.2393	0.89961	0.0:1.0:0.0:0.0	.	120	O43609	SPY1_HUMAN	V	120	ENSP00000343785:A120V;ENSP00000421036:A120V;ENSP00000377871:A120V	.	A	+	2	0	SPRY1	124542555	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.292000	0.65673	2.622000	0.88805	0.561000	0.74099	GCA	.	.	.	none		0.542	SPRY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256711.1		
TLR2	7097	hgsc.bcm.edu	37	4	154625017	154625017	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr4:154625017C>T	ENST00000260010.6	+	1	2366	c.958C>T	c.(958-960)Cca>Tca	p.P320S		NM_003264.3	NP_003255.2	O60603	TLR2_HUMAN	toll-like receptor 2	320					apoptotic process (GO:0006915)|cell surface pattern recognition receptor signaling pathway (GO:0002752)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to diacyl bacterial lipopeptide (GO:0071726)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to peptidoglycan (GO:0071224)|cellular response to triacyl bacterial lipopeptide (GO:0071727)|central nervous system myelin formation (GO:0032289)|chloramphenicol transport (GO:0042892)|defense response to Gram-positive bacterium (GO:0050830)|detection of diacyl bacterial lipopeptide (GO:0042496)|detection of triacyl bacterial lipopeptide (GO:0042495)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|induction by symbiont of defense-related host nitric oxide production (GO:0052063)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukotriene metabolic process (GO:0006691)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-17 production (GO:0032700)|nitric oxide metabolic process (GO:0046209)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of Wnt signaling pathway (GO:0030177)|response to fatty acid (GO:0070542)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to molecule of fungal origin (GO:0002238)|response to progesterone (GO:0032570)|response to toxic substance (GO:0009636)|signal transduction (GO:0007165)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cell body (GO:0044297)|cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)|Toll-like receptor 2-Toll-like receptor 6 protein complex (GO:0035355)	diacyl lipopeptide binding (GO:0042498)|lipopolysaccharide receptor activity (GO:0001875)|lipoteichoic acid binding (GO:0070891)|peptidoglycan binding (GO:0042834)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)|triacyl lipopeptide binding (GO:0042497)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	29	all_hematologic(180;0.093)	Renal(120;0.117)			OspA lipoprotein(DB00045)	GCTGCATATTCCAAGGTTTTA	0.348																																					p.P320S		Atlas-SNP	.											.	TLR2	84	.	0			c.C958T						PASS	.						64.0	68.0	66.0					4																	154625017		2203	4298	6501	SO:0001583	missense	7097	exon3			CATATTCCAAGGT	U88878	CCDS3784.1	4q32	2008-02-05				ENSG00000137462		"""CD molecules"""	11848	protein-coding gene	gene with protein product		603028				9435236	Standard	XM_005263193		Approved	TIL4, CD282	uc003inq.3	O60603		ENST00000260010.6:c.958C>T	chr4.hg19:g.154625017C>T	ENSP00000260010:p.Pro320Ser	99.0	0.0	.		116.0	42.0	.	NM_003264	B3Y612|D1CS45|D1CS48|D1CS49|O15454|Q8NI00	Missense_Mutation	SNP	ENST00000260010.6	hg19	CCDS3784.1	.	.	.	.	.	.	.	.	.	.	C	9.250	1.040467	0.19669	.	.	ENSG00000137462	ENST00000260010	T	0.45668	0.89	6.06	3.3	0.37823	.	0.968721	0.08531	N	0.932044	T	0.38134	0.1029	L	0.55481	1.735	0.09310	N	1	B	0.13145	0.007	B	0.11329	0.006	T	0.22487	-1.0215	10	0.31617	T	0.26	.	8.4038	0.32603	0.0969:0.6591:0.1723:0.0718	.	320	O60603	TLR2_HUMAN	S	320	ENSP00000260010:P320S	ENSP00000260010:P320S	P	+	1	0	TLR2	154844467	0.000000	0.05858	0.033000	0.17914	0.002000	0.02628	0.533000	0.23082	1.581000	0.49865	-0.140000	0.14226	CCA	.	.	.	none		0.348	TLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365205.1		
FNIP2	57600	hgsc.bcm.edu	37	4	159816926	159816926	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr4:159816926C>G	ENST00000264433.6	+	16	3250	c.3175C>G	c.(3175-3177)Cta>Gta	p.L1059V	C4orf45_ENST00000508011.1_Intron|C4orf45_ENST00000434826.2_Intron|FNIP2_ENST00000379346.3_Missense_Mutation_p.L1082V	NM_020840.1	NP_065891.1	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2	1059					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|regulation of protein phosphorylation (GO:0001932)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	9	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		TGAAGATAGACTACAGGAGAT	0.403																																					p.L1059V		Atlas-SNP	.											.	FNIP2	90	.	0			c.C3175G						PASS	.						118.0	117.0	117.0					4																	159816926		1907	4124	6031	SO:0001583	missense	57600	exon16			GATAGACTACAGG	AB040883	CCDS47155.1	4q32.1	2012-10-31			ENSG00000052795	ENSG00000052795			29280	protein-coding gene	gene with protein product	"""O6-methylguanine-induced apoptosis 1"""	612768				18403135	Standard	NM_020840		Approved	KIAA1450, FNIPL, MAPO1	uc003iqe.4	Q9P278	OTTHUMG00000161983	ENST00000264433.6:c.3175C>G	chr4.hg19:g.159816926C>G	ENSP00000264433:p.Leu1059Val	73.0	0.0	.		80.0	22.0	.	NM_020840	Q05DC3|Q96I31|Q9H994	Missense_Mutation	SNP	ENST00000264433.6	hg19	CCDS47155.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.094483	0.76870	.	.	ENSG00000052795	ENST00000264433;ENST00000379346	T;T	0.60797	0.16;0.16	5.49	3.74	0.42951	.	0.074626	0.56097	D	0.000035	T	0.77089	0.4079	M	0.87900	2.915	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80446	-0.1379	9	.	.	.	.	12.08	0.53665	0.0:0.8584:0.0:0.1416	.	1059	Q9P278	FNIP2_HUMAN	V	1059;1082	ENSP00000264433:L1059V;ENSP00000368651:L1082V	.	L	+	1	2	FNIP2	160036376	1.000000	0.71417	0.946000	0.38457	0.996000	0.88848	4.894000	0.63206	1.333000	0.45449	0.591000	0.81541	CTA	.	.	.	none		0.403	FNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366602.1	NM_020840	
KIAA0825	285600	hgsc.bcm.edu	37	5	93722048	93722048	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr5:93722048C>T	ENST00000513200.3	-	18	3590	c.3518G>A	c.(3517-3519)cGa>cAa	p.R1173Q	KIAA0825_ENST00000427991.2_Missense_Mutation_p.R1173Q	NM_001145678.1	NP_001139150.1	Q8IV33	K0825_HUMAN	KIAA0825	1173										breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(1)|pancreas(1)|prostate(1)|skin(1)	13						CTTTAAAGGTCGGATGGGTAA	0.383																																					p.R1173Q		Atlas-SNP	.											.	KIAA0825	172	.	0			c.G3518A						PASS	.						160.0	139.0	145.0					5																	93722048		692	1591	2283	SO:0001583	missense	285600	exon19			AAAGGTCGGATGG	BX648338	CCDS4070.1	5q15	2011-02-23	2011-02-23	2011-02-23	ENSG00000185261	ENSG00000185261			28532	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 36"""	C5orf36		12477932	Standard	NM_173665		Approved	DKFZp686F0372, MGC34713	uc011cuk.2	Q8IV33	OTTHUMG00000131331	ENST00000513200.3:c.3518G>A	chr5.hg19:g.93722048C>T	ENSP00000424618:p.Arg1173Gln	132.0	0.0	.		167.0	56.0	.	NM_001145678	O94914|Q6ZNN2	Missense_Mutation	SNP	ENST00000513200.3	hg19		.	.	.	.	.	.	.	.	.	.	C	12.03	1.814698	0.32053	.	.	ENSG00000185261	ENST00000513200;ENST00000427991	T;T	0.42900	0.96;0.96	5.97	-1.74	0.08056	.	.	.	.	.	T	0.25269	0.0614	L	0.28740	0.885	0.26413	N	0.976228	B;B	0.22346	0.03;0.068	B;B	0.15052	0.012;0.007	T	0.17471	-1.0368	9	0.27082	T	0.32	2.5431	6.6098	0.22745	0.0:0.3608:0.2184:0.4208	.	1173;1173	Q8IV33;C9J0Q2	K0825_HUMAN;.	Q	1173	ENSP00000424618:R1173Q;ENSP00000400288:R1173Q	ENSP00000400288:R1173Q	R	-	2	0	KIAA0825	93747804	0.011000	0.17503	0.425000	0.26659	0.952000	0.60782	-0.055000	0.11807	-0.732000	0.04856	-0.142000	0.14014	CGA	.	.	.	none		0.383	KIAA0825-001	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000254102.5	NM_173665	
CSF1R	1436	hgsc.bcm.edu	37	5	149449790	149449790	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr5:149449790G>A	ENST00000286301.3	-	9	1565	c.1274C>T	c.(1273-1275)cCc>cTc	p.P425L		NM_005211.3	NP_005202.2	P07333	CSF1R_HUMAN	colony stimulating factor 1 receptor	425	Ig-like C2-type 5.				cell proliferation (GO:0008283)|cell-cell junction maintenance (GO:0045217)|cellular response to cytokine stimulus (GO:0071345)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cytokine-mediated signaling pathway (GO:0019221)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage differentiation (GO:0030225)|mammary gland duct morphogenesis (GO:0060603)|monocyte differentiation (GO:0030224)|multicellular organismal development (GO:0007275)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell motility (GO:2000147)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of bone resorption (GO:0045124)|regulation of cell shape (GO:0008360)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|macrophage colony-stimulating factor receptor activity (GO:0005011)|protein homodimerization activity (GO:0042803)			NS(2)|breast(2)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(38)|kidney(2)|large_intestine(6)|liver(3)|lung(23)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	93			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Imatinib(DB00619)|Sunitinib(DB01268)	GTTGGGCTGGGGGTACCCAGA	0.607																																					p.P425L		Atlas-SNP	.											.	CSF1R	250	.	0			c.C1274T						PASS	.						76.0	72.0	73.0					5																	149449790		2203	4300	6503	SO:0001583	missense	1436	exon9			GGCTGGGGGTACC	U63963	CCDS4302.1	5q32	2013-01-11	2008-08-01		ENSG00000182578	ENSG00000182578		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	2433	protein-coding gene	gene with protein product		164770	"""McDonough feline sarcoma viral (v-fms) oncogene homolog"""	FMS		1611909	Standard	NM_005211		Approved	C-FMS, CSFR, CD115	uc003lrm.3	P07333	OTTHUMG00000130050	ENST00000286301.3:c.1274C>T	chr5.hg19:g.149449790G>A	ENSP00000286301:p.Pro425Leu	53.0	0.0	.		80.0	33.0	.	NM_005211	B5A955|D3DQG2|Q6LDW5|Q6LDY4|Q86VW7	Missense_Mutation	SNP	ENST00000286301.3	hg19	CCDS4302.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.658484	0.88154	.	.	ENSG00000182578	ENST00000286301;ENST00000394307	T	0.61392	0.11	5.89	5.89	0.94794	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.56097	D	0.000032	T	0.78201	0.4246	M	0.83774	2.66	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.80585	-0.1317	10	0.87932	D	0	.	15.7567	0.78037	0.0:0.0:1.0:0.0	.	277;425	B4E2Y8;P07333	.;CSF1R_HUMAN	L	425;277	ENSP00000286301:P425L	ENSP00000286301:P425L	P	-	2	0	CSF1R	149429983	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	5.043000	0.64208	2.793000	0.96121	0.561000	0.74099	CCC	.	.	.	none		0.607	CSF1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252329.2	NM_005211	
GABRB2	2561	hgsc.bcm.edu	37	5	160763641	160763641	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr5:160763641G>T	ENST00000393959.1	-	6	676	c.677C>A	c.(676-678)aCa>aAa	p.T226K	GABRB2_ENST00000520240.1_Missense_Mutation_p.T226K|GABRB2_ENST00000274547.2_Missense_Mutation_p.T226K|GABRB2_ENST00000353437.6_Missense_Mutation_p.T226K|GABRB2_ENST00000517901.1_Missense_Mutation_p.T163K|GABRB2_ENST00000517547.1_Missense_Mutation_p.T66K			P47870	GBRB2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 2	226					cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|GABA-A receptor activity (GO:0004890)|inhibitory extracellular ligand-gated ion channel activity (GO:0005237)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(9)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	26	Renal(175;0.00259)	Medulloblastoma(196;0.021)|all_neural(177;0.0463)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Fospropofol(DB06716)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	ATACAAACCTGTGGAAAAAAC	0.368																																					p.T226K		Atlas-SNP	.											.	GABRB2	161	.	0			c.C677A						PASS	.						86.0	87.0	87.0					5																	160763641		2202	4300	6502	SO:0001583	missense	2561	exon7			AAACCTGTGGAAA		CCDS4354.1, CCDS4355.1	5q34	2012-06-22			ENSG00000145864	ENSG00000145864		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4082	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 2"""	600232				7851879	Standard	NM_000813		Approved		uc003lys.1	P47870	OTTHUMG00000130349	ENST00000393959.1:c.677C>A	chr5.hg19:g.160763641G>T	ENSP00000377531:p.Thr226Lys	84.0	0.0	.		105.0	39.0	.	NM_021911	A8K115|A8K1A0|D1LYT0|D1LYT1|Q16323|Q4FZB2	Missense_Mutation	SNP	ENST00000393959.1	hg19	CCDS4355.1	.	.	.	.	.	.	.	.	.	.	G	32	5.128847	0.94473	.	.	ENSG00000145864	ENST00000393959;ENST00000274547;ENST00000353437;ENST00000520240;ENST00000517901;ENST00000517547	T;T;T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24;-1.24;-1.24	5.47	5.47	0.80525	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.90421	0.7001	M	0.88105	2.93	0.80722	D	1	D;P;D;D	0.89917	1.0;0.952;0.984;0.989	D;D;D;D	0.87578	0.998;0.969;0.969;0.962	D	0.91866	0.5503	10	0.87932	D	0	.	19.3443	0.94357	0.0:0.0:1.0:0.0	.	66;163;226;226	B7Z279;E7EV50;P47870;P47870-1	.;.;GBRB2_HUMAN;.	K	226;226;226;226;163;66	ENSP00000377531:T226K;ENSP00000274547:T226K;ENSP00000274546:T226K;ENSP00000429320:T226K;ENSP00000430532:T163K;ENSP00000429750:T66K	ENSP00000274547:T226K	T	-	2	0	GABRB2	160696219	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.638000	0.98445	2.561000	0.86390	0.655000	0.94253	ACA	.	.	.	none		0.368	GABRB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252704.1		
RGS14	10636	hgsc.bcm.edu	37	5	176799074	176799074	+	Nonstop_Mutation	SNP	T	T	C			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr5:176799074T>C	ENST00000408923.3	+	15	1887	c.1699T>C	c.(1699-1701)Tga>Cga	p.*567R	RGS14_ENST00000506944.1_3'UTR	NM_006480.4	NP_006471.2	O43566	RGS14_HUMAN	regulator of G-protein signaling 14	0					cell division (GO:0051301)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mitotic nuclear division (GO:0007067)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of synaptic plasticity (GO:0031914)|nucleocytoplasmic transport (GO:0006913)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of GTPase activity (GO:0043547)|positive regulation of neurogenesis (GO:0050769)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to oxidative stress (GO:0006979)|spindle organization (GO:0007051)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual learning (GO:0008542)|zygote asymmetric cell division (GO:0010070)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|microtubule (GO:0005874)|nuclear body (GO:0016604)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|spindle (GO:0005819)|spindle pole (GO:0000922)	GDP-dissociation inhibitor activity (GO:0005092)|GTPase activator activity (GO:0005096)|microtubule binding (GO:0008017)|receptor signaling complex scaffold activity (GO:0030159)|receptor signaling protein activity (GO:0005057)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|skin(3)|upper_aerodigestive_tract(1)	12	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTCAGCCCTCTGACAGCTACC	0.657																																					p.X567R	NSCLC(47;353 1896 28036)	Atlas-SNP	.											.	RGS14	34	.	0			c.T1699C						PASS	.						74.0	88.0	83.0					5																	176799074		2092	4193	6285	SO:0001578	stop_lost	10636	exon15			GCCCTCTGACAGC	AF037195	CCDS43405.1	5q35.3	2008-02-05	2007-08-14		ENSG00000169220	ENSG00000169220		"""Regulators of G-protein signaling"""	9996	protein-coding gene	gene with protein product		602513	"""regulator of G-protein signalling 14"""				Standard	NM_006480		Approved		uc003mgf.3	O43566	OTTHUMG00000163324	ENST00000408923.3:c.1699T>C	chr5.hg19:g.176799074T>C	ENSP00000386229:p.*567Argext*163	63.0	0.0	.		58.0	12.0	.	NM_006480	O43565|Q506M1|Q6ZWA4|Q8TD62	Missense_Mutation	SNP	ENST00000408923.3	hg19	CCDS43405.1	.	.	.	.	.	.	.	.	.	.	T	9.365	1.069109	0.20147	.	.	ENSG00000169220	ENST00000408923;ENST00000336477	.	.	.	4.75	4.75	0.60458	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.2366	0.37470	0.0:0.0:0.2464:0.7536	.	.	.	.	R	567;348	.	.	X	+	1	0	RGS14	176731680	0.997000	0.39634	1.000000	0.80357	0.194000	0.23727	0.357000	0.20199	1.999000	0.58509	0.454000	0.30748	TGA	.	.	.	none		0.657	RGS14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372676.1	NM_006480	
DPCR1	135656	hgsc.bcm.edu	37	6	30917945	30917945	+	Silent	SNP	G	G	A			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr6:30917945G>A	ENST00000462446.1	+	2	1732	c.1704G>A	c.(1702-1704)ttG>ttA	p.L568L	HCG21_ENST00000419481.1_RNA|DPCR1_ENST00000304311.2_5'UTR			Q3MIW9	DPCR1_HUMAN	diffuse panbronchiolitis critical region 1	120						integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)	10						GGACTCCTTTGGCCAATGAGA	0.502																																					p.L568L		Atlas-SNP	.											.	DPCR1	99	.	0			c.G1704A						PASS	.						65.0	64.0	64.0					6																	30917945		692	1591	2283	SO:0001819	synonymous_variant	135656	exon2			TCCTTTGGCCAAT	AB064272	CCDS4692.1, CCDS4692.2	6p21.32	2008-02-05			ENSG00000168631	ENSG00000168631			21666	protein-coding gene	gene with protein product		613928				12185533, 10677310	Standard	NM_080870		Approved	PBLT, bCX105N19.6	uc003nsg.2	Q3MIW9	OTTHUMG00000031104	ENST00000462446.1:c.1704G>A	chr6.hg19:g.30917945G>A		123.0	0.0	.		113.0	45.0	.	NM_080870	C9IZC0|Q658M7|Q8WYN2	Silent	SNP	ENST00000462446.1	hg19	CCDS4692.2																																																																																			.	.	.	none		0.502	DPCR1-001	NOVEL	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076173.3	NM_080870	
CRISP2	7180	hgsc.bcm.edu	37	6	49668403	49668403	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr6:49668403G>A	ENST00000339139.4	-	5	397	c.161C>T	c.(160-162)cCt>cTt	p.P54L		NM_001142407.2|NM_001142408.2|NM_001142417.2|NM_001142435.2|NM_001261822.1|NM_003296.3	NP_001135879.1|NP_001135880.1|NP_001135889.1|NP_001135907.1|NP_001248751.1|NP_003287.1	P16562	CRIS2_HUMAN	cysteine-rich secretory protein 2	54	SCP.				single organismal cell-cell adhesion (GO:0016337)	extracellular space (GO:0005615)				kidney(1)|large_intestine(2)|lung(10)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	19	Lung NSC(77;0.0161)		KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)			GTTACTGGCAGGTGGAGAGAC	0.468																																					p.P54L		Atlas-SNP	.											.	CRISP2	53	.	0			c.C161T						PASS	.						108.0	91.0	97.0					6																	49668403		2203	4299	6502	SO:0001583	missense	7180	exon5			CTGGCAGGTGGAG	X95239	CCDS4928.1	6p12.3	2009-03-12	2003-09-03	2003-09-05	ENSG00000124490	ENSG00000124490			12024	protein-coding gene	gene with protein product	"""cancer/testis antigen 36"""	187430	"""testis specific protein 1 (probe H4-1 p3-1)"""	GAPDL5, TPX1		2613236, 8665901	Standard	NM_003296		Approved	CRISP-2, CT36	uc003ozo.3	P16562	OTTHUMG00000014822	ENST00000339139.4:c.161C>T	chr6.hg19:g.49668403G>A	ENSP00000339155:p.Pro54Leu	100.0	0.0	.		112.0	43.0	.	NM_001142408	A8K8M0|Q53FF2|Q5U8Z9|Q7Z7B2	Missense_Mutation	SNP	ENST00000339139.4	hg19	CCDS4928.1	.	.	.	.	.	.	.	.	.	.	G	13.70	2.315527	0.40996	.	.	ENSG00000124490	ENST00000339139;ENST00000211238	T	0.13196	2.61	5.23	4.36	0.52297	CAP domain (3);	0.666605	0.15704	N	0.248777	T	0.14141	0.0342	M	0.85299	2.745	0.38730	D	0.953655	B;B	0.23650	0.089;0.049	B;B	0.33254	0.109;0.16	T	0.02132	-1.1208	10	0.66056	D	0.02	.	11.5043	0.50456	0.0864:0.0:0.9136:0.0	.	54;54	Q7Z7B2;P16562	.;CRIS2_HUMAN	L	54	ENSP00000339155:P54L	ENSP00000211238:P54L	P	-	2	0	CRISP2	49776362	0.998000	0.40836	0.969000	0.41365	0.801000	0.45260	2.993000	0.49425	1.441000	0.47550	-0.225000	0.12378	CCT	.	.	.	none		0.468	CRISP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040870.2	NM_003296	
MB21D1	115004	hgsc.bcm.edu	37	6	74149944	74149944	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr6:74149944T>G	ENST00000370315.3	-	3	1196	c.1102A>C	c.(1102-1104)Aat>Cat	p.N368H	MB21D1_ENST00000370318.1_Missense_Mutation_p.N368H	NM_138441.2	NP_612450.2	Q8N884	CGAS_HUMAN	Mab-21 domain containing 1	368					activation of innate immune response (GO:0002218)|cellular response to exogenous dsRNA (GO:0071360)|cyclic nucleotide biosynthetic process (GO:0009190)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of type I interferon production (GO:0032481)	cytosol (GO:0005829)	ATP binding (GO:0005524)|cyclic-GMP-AMP synthase activity (GO:0061501)|DNA binding (GO:0003677)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(4)|lung(1)	6						TGGAAACCATTTCCTTCCTTT	0.363																																					p.N368H		Atlas-SNP	.											.	MB21D1	33	.	0			c.A1102C						PASS	.						64.0	62.0	62.0					6																	74149944		2203	4300	6503	SO:0001583	missense	115004	exon3			AACCATTTCCTTC	BC012928	CCDS4978.1	6q13	2011-02-23	2011-02-23	2011-02-23	ENSG00000164430	ENSG00000164430			21367	protein-coding gene	gene with protein product		613973	"""chromosome 6 open reading frame 150"""	C6orf150			Standard	NM_138441		Approved		uc003pgx.1	Q8N884	OTTHUMG00000015034	ENST00000370315.3:c.1102A>C	chr6.hg19:g.74149944T>G	ENSP00000359339:p.Asn368His	108.0	0.0	.		108.0	29.0	.	NM_138441	L0L2J9|Q14CV6|Q32NC9|Q5SWL0|Q5SWL1|Q96E45	Missense_Mutation	SNP	ENST00000370315.3	hg19	CCDS4978.1	.	.	.	.	.	.	.	.	.	.	T	14.56	2.572058	0.45798	.	.	ENSG00000164430	ENST00000370318;ENST00000370315;ENST00000296913	T;T	0.08370	3.1;3.1	5.35	-0.905	0.10527	.	0.884083	0.09786	N	0.755980	T	0.07773	0.0195	L	0.48362	1.52	0.25017	N	0.991369	D	0.67145	0.996	D	0.66847	0.947	T	0.21449	-1.0245	10	0.62326	D	0.03	-6.9955	6.3604	0.21425	0.0:0.1059:0.4453:0.4488	.	368	Q8N884	M21D1_HUMAN	H	368	ENSP00000359342:N368H;ENSP00000359339:N368H	ENSP00000296913:N368H	N	-	1	0	MB21D1	74206665	0.590000	0.26815	0.251000	0.24312	0.771000	0.43674	0.625000	0.24477	-0.053000	0.13289	0.374000	0.22700	AAT	.	.	.	none		0.363	MB21D1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041221.5	NM_138441	
SASH1	23328	hgsc.bcm.edu	37	6	148855991	148855991	+	Silent	SNP	C	C	T			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr6:148855991C>T	ENST00000367467.3	+	16	2524	c.2049C>T	c.(2047-2049)caC>caT	p.H683H		NM_015278.3	NP_056093.3	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	683	SAM 1. {ECO:0000255|PROSITE- ProRule:PRU00184}.				positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of p38MAPK cascade (GO:1900745)|protein polyubiquitination (GO:0000209)|regulation of protein autoubiquitination (GO:1902498)|regulation of protein K63-linked ubiquitination (GO:1900044)	membrane (GO:0016020)|protein complex (GO:0043234)	mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein C-terminus binding (GO:0008022)|protein complex scaffold (GO:0032947)|protein kinase binding (GO:0019901)			breast(4)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		ACCCGGAACACAGAGCTGTTC	0.493																																					p.H683H		Atlas-SNP	.											.	SASH1	123	.	0			c.C2049T						PASS	.						109.0	105.0	106.0					6																	148855991		2203	4300	6503	SO:0001819	synonymous_variant	23328	exon16			GGAACACAGAGCT	AB018333	CCDS5212.1	6q24.3	2013-01-10			ENSG00000111961	ENSG00000111961		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	19182	protein-coding gene	gene with protein product		607955				9872452, 12771949	Standard	NM_015278		Approved	KIAA0790, dJ323M4.1, SH3D6A	uc003qme.1	O94885	OTTHUMG00000015773	ENST00000367467.3:c.2049C>T	chr6.hg19:g.148855991C>T		91.0	0.0	.		103.0	44.0	.	NM_015278	Q5TGN5|Q8TAI0|Q9H7R7	Silent	SNP	ENST00000367467.3	hg19	CCDS5212.1																																																																																			.	.	.	none		0.493	SASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042619.1	NM_015278	
SYNE1	23345	hgsc.bcm.edu	37	6	152473219	152473219	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr6:152473219A>G	ENST00000367255.5	-	134	24788	c.24187T>C	c.(24187-24189)Tac>Cac	p.Y8063H	SYNE1_ENST00000448038.1_Missense_Mutation_p.Y7992H|SYNE1_ENST00000347037.5_5'UTR|SYNE1_ENST00000356820.4_Missense_Mutation_p.Y2587H|SYNE1_ENST00000354674.4_Missense_Mutation_p.Y218H|SYNE1_ENST00000265368.4_Missense_Mutation_p.Y8063H|SYNE1_ENST00000539504.1_Missense_Mutation_p.Y218H|SYNE1_ENST00000341594.5_Missense_Mutation_p.Y7675H|SYNE1_ENST00000423061.1_Missense_Mutation_p.Y7992H	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	8063					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AGGCGGCGGTACTGCTTGTTG	0.542										HNSCC(10;0.0054)																											p.Y8063H		Atlas-SNP	.											.	SYNE1	3227	.	0			c.T24187C						PASS	.						109.0	86.0	94.0					6																	152473219		2203	4300	6503	SO:0001583	missense	23345	exon134			GGCGGTACTGCTT	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.24187T>C	chr6.hg19:g.152473219A>G	ENSP00000356224:p.Tyr8063His	71.0	0.0	.		71.0	24.0	.	NM_182961	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	hg19	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	A	33	5.209411	0.95069	.	.	ENSG00000131018	ENST00000367255;ENST00000539504;ENST00000367257;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820;ENST00000313630;ENST00000367247;ENST00000367251;ENST00000354674	T;T;T;T;T;T;T;T;T;T	0.34667	1.37;1.35;1.37;1.37;1.37;1.37;1.37;1.37;1.37;1.35	5.96	5.96	0.96718	.	0.000000	0.50627	D	0.000110	T	0.56630	0.1998	M	0.80982	2.52	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.999;1.0;0.999;0.996	T	0.62798	-0.6778	10	0.66056	D	0.02	.	16.4447	0.83919	1.0:0.0:0.0:0.0	.	8063;8063;7992;7992;265	Q8NF91;E7EQI5;Q8NF91-4;E9PEL9;B7Z9Y6	SYNE1_HUMAN;.;.;.;.	H	8063;218;709;7992;8063;7992;7675;2587;225;220;985;218	ENSP00000356224:Y8063H;ENSP00000441052:Y218H;ENSP00000356226:Y709H;ENSP00000396024:Y7992H;ENSP00000265368:Y8063H;ENSP00000390975:Y7992H;ENSP00000341887:Y7675H;ENSP00000349276:Y2587H;ENSP00000356220:Y985H;ENSP00000346701:Y218H	ENSP00000265368:Y8063H	Y	-	1	0	SYNE1	152514912	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.108000	0.94275	2.284000	0.76573	0.528000	0.53228	TAC	.	.	.	none		0.542	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
ARID1B	57492	hgsc.bcm.edu	37	6	157099429	157099429	+	Silent	SNP	G	G	A			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr6:157099429G>A	ENST00000350026.5	+	1	367	c.366G>A	c.(364-366)caG>caA	p.Q122Q	ARID1B_ENST00000275248.4_Silent_p.Q64Q|ARID1B_ENST00000346085.5_Silent_p.Q122Q|ARID1B_ENST00000367148.1_Silent_p.Q122Q|RP11-230C9.3_ENST00000604792.1_RNA|RP11-230C9.2_ENST00000603191.1_lincRNA|MIR4466_ENST00000606121.1_RNA	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	122	Gln-rich.|Poly-Gln.				chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		agcagcaacagcagcagcagc	0.647																																					p.Q122Q		Atlas-SNP	.											.	ARID1B	320	.	0			c.G366A						PASS	.						4.0	7.0	6.0					6																	157099429		1651	3290	4941	SO:0001819	synonymous_variant	57492	exon1			GCAACAGCAGCAG	AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.366G>A	chr6.hg19:g.157099429G>A		29.0	0.0	.		43.0	8.0	.	NM_017519	Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Silent	SNP	ENST00000350026.5	hg19	CCDS5251.2																																																																																			.	.	.	none		0.647	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372723.1	NM_020732	
IGF2R	3482	hgsc.bcm.edu	37	6	160466824	160466824	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr6:160466824T>A	ENST00000356956.1	+	14	1961	c.1813T>A	c.(1813-1815)Tgc>Agc	p.C605S		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	605					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	GGAAGGCGGTTGCTTTTATGA	0.502																																					p.C605S		Atlas-SNP	.											.	IGF2R	251	.	0			c.T1813A						PASS	.						173.0	183.0	180.0					6																	160466824		2203	4300	6503	SO:0001583	missense	3482	exon14			GGCGGTTGCTTTT	J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.1813T>A	chr6.hg19:g.160466824T>A	ENSP00000349437:p.Cys605Ser	79.0	0.0	.		90.0	24.0	.	NM_000876	Q7Z7G9|Q96PT5	Missense_Mutation	SNP	ENST00000356956.1	hg19	CCDS5273.1	.	.	.	.	.	.	.	.	.	.	T	25.9	4.688195	0.88639	.	.	ENSG00000197081	ENST00000356956	T	0.15834	2.39	5.67	5.67	0.87782	Mannose-6-phosphate receptor, binding (1);	0.000000	0.85682	D	0.000000	T	0.44932	0.1317	M	0.92268	3.29	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.58853	-0.7563	10	0.62326	D	0.03	-13.6324	15.9212	0.79575	0.0:0.0:0.0:1.0	.	605	P11717	MPRI_HUMAN	S	605	ENSP00000349437:C605S	ENSP00000349437:C605S	C	+	1	0	IGF2R	160386814	1.000000	0.71417	0.996000	0.52242	0.789000	0.44602	7.637000	0.83313	2.155000	0.67459	0.460000	0.39030	TGC	.	.	.	none		0.502	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042931.1	NM_000876	
ITGB8	3696	hgsc.bcm.edu	37	7	20418715	20418715	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr7:20418715A>C	ENST00000222573.4	+	4	1114	c.430A>C	c.(430-432)Aaa>Caa	p.K144Q	ITGB8_ENST00000537992.1_Missense_Mutation_p.K9Q|SNORD56_ENST00000363883.1_RNA	NM_002214.2	NP_002205.1	P26012	ITB8_HUMAN	integrin, beta 8	144					cartilage development (GO:0051216)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|ganglioside metabolic process (GO:0001573)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of gene expression (GO:0010629)|placenta blood vessel development (GO:0060674)|positive regulation of gene expression (GO:0010628)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	extracellular matrix protein binding (GO:1990430)|receptor activity (GO:0004872)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(17)|prostate(2)|skin(4)|stomach(2)|urinary_tract(1)	37						TCCTCTGAAGAAATATCCTGT	0.308																																					p.K144Q		Atlas-SNP	.											.	ITGB8	159	.	0			c.A430C						PASS	.						70.0	81.0	77.0					7																	20418715		2193	4298	6491	SO:0001583	missense	3696	exon4			CTGAAGAAATATC		CCDS5370.1	7p15.3	2010-03-23			ENSG00000105855	ENSG00000105855		"""Integrins"""	6163	protein-coding gene	gene with protein product		604160					Standard	XM_005249751		Approved		uc003suu.3	P26012	OTTHUMG00000023594	ENST00000222573.4:c.430A>C	chr7.hg19:g.20418715A>C	ENSP00000222573:p.Lys144Gln	95.0	0.0	.		109.0	34.0	.	NM_002214	A4D133|B4DHD4	Missense_Mutation	SNP	ENST00000222573.4	hg19	CCDS5370.1	.	.	.	.	.	.	.	.	.	.	A	14.02	2.410153	0.42715	.	.	ENSG00000105855	ENST00000537992;ENST00000222573	D;D	0.92495	-3.05;-3.05	5.42	4.25	0.50352	Integrin beta subunit, N-terminal (2);	0.067674	0.64402	N	0.000011	D	0.89097	0.6618	L	0.47716	1.5	0.35175	D	0.771931	B;B	0.10296	0.001;0.003	B;B	0.19666	0.014;0.026	D	0.88226	0.2900	10	0.66056	D	0.02	-20.749	12.8016	0.57588	0.863:0.137:0.0:0.0	.	144;144	P26012;Q9BUG9	ITB8_HUMAN;.	Q	9;144	ENSP00000441561:K9Q;ENSP00000222573:K144Q	ENSP00000222573:K144Q	K	+	1	0	ITGB8	20385240	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.942000	0.49018	0.972000	0.38314	0.528000	0.53228	AAA	.	.	.	none		0.308	ITGB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059915.3	NM_002214	
HOXA10	3206	hgsc.bcm.edu	37	7	27211696	27211696	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr7:27211696T>C	ENST00000283921.4	-	2	1054	c.1055A>G	c.(1054-1056)gAg>gGg	p.E352G	HOXA10_ENST00000396344.4_Missense_Mutation_p.E36G|HOXA-AS4_ENST00000519694.1_RNA|RP1-170O19.20_ENST00000470747.4_Intron|MIR196B_ENST00000384852.1_RNA|HOXA-AS4_ENST00000523790.1_RNA|HOXA10_ENST00000521421.1_5'UTR|HOXA-AS4_ENST00000519935.1_RNA|RP1-170O19.20_ENST00000465941.1_Intron|HOXA9_ENST00000497089.1_5'Flank	NM_018951.3	NP_061824.3	P31260	HXA10_HUMAN	homeobox A10	352					anterior/posterior pattern specification (GO:0009952)|embryonic limb morphogenesis (GO:0030326)|male gonad development (GO:0008584)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase binding (GO:0042826)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	9						AAACTCCTTCTCCAGCTCCAG	0.537																																					p.E352G		Atlas-SNP	.											.	HOXA10	55	.	0			c.A1055G						PASS	.						110.0	105.0	107.0					7																	27211696		2203	4300	6503	SO:0001583	missense	3206	exon2			TCCTTCTCCAGCT		CCDS5410.2	7p15.2	2011-06-20	2005-12-22		ENSG00000253293	ENSG00000253293		"""Homeoboxes / ANTP class : HOXL subclass"""	5100	protein-coding gene	gene with protein product		142957	"""homeo box A10"""	HOX1H, HOX1		1973146, 1358459	Standard	NR_037939		Approved		uc011jzm.2	P31260	OTTHUMG00000023436	ENST00000283921.4:c.1055A>G	chr7.hg19:g.27211696T>C	ENSP00000283921:p.Glu352Gly	131.0	0.0	.		154.0	42.0	.	NM_018951	O43370|O43605|Q15949|Q504T1	Missense_Mutation	SNP	ENST00000283921.4	hg19	CCDS5410.2	.	.	.	.	.	.	.	.	.	.	T	21.7	4.191945	0.78902	.	.	ENSG00000253293	ENST00000283921;ENST00000396344	D;D	0.97831	-4.56;-4.56	5.7	5.7	0.88788	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.99236	0.9734	H	0.97587	4.035	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.98858	1.0761	10	0.87932	D	0	.	15.9644	0.79956	0.0:0.0:0.0:1.0	.	352;36	P31260;Q504T1	HXA10_HUMAN;.	G	352;36	ENSP00000283921:E352G;ENSP00000379633:E36G	ENSP00000283921:E352G	E	-	2	0	HOXA10	27178221	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.040000	0.89188	2.172000	0.68678	0.460000	0.39030	GAG	.	.	.	none		0.537	HOXA10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358724.2		
ABCA13	154664	hgsc.bcm.edu	37	7	48317949	48317949	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr7:48317949C>A	ENST00000435803.1	+	18	7182	c.7158C>A	c.(7156-7158)ttC>ttA	p.F2386L		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	2386					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TAGACTTTTTCACAGTGGTGA	0.358																																					p.F2386L		Atlas-SNP	.											.	ABCA13	1192	.	0			c.C7158A						PASS	.						35.0	34.0	35.0					7																	48317949		1817	4072	5889	SO:0001583	missense	154664	exon18			CTTTTTCACAGTG	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.7158C>A	chr7.hg19:g.48317949C>A	ENSP00000411096:p.Phe2386Leu	141.0	0.0	.		155.0	52.0	.	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	hg19	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	C	1.034	-0.680960	0.03353	.	.	ENSG00000179869	ENST00000435803	T	0.49720	0.77	4.99	-2.02	0.07388	.	0.495153	0.16799	N	0.199073	T	0.21631	0.0521	N	0.12746	0.255	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29088	-1.0023	10	0.08179	T	0.78	.	9.2681	0.37654	0.0:0.4592:0.0:0.5408	.	2386	Q86UQ4	ABCAD_HUMAN	L	2386	ENSP00000411096:F2386L	ENSP00000411096:F2386L	F	+	3	2	ABCA13	48288495	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.668000	0.05268	-0.566000	0.06054	-0.140000	0.14226	TTC	.	.	.	none		0.358	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
CLDN3	1365	hgsc.bcm.edu	37	7	73184246	73184246	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr7:73184246A>G	ENST00000395145.2	-	1	354	c.134T>C	c.(133-135)aTc>aCc	p.I45T		NM_001306.3	NP_001297.1	O15551	CLD3_HUMAN	claudin 3	45					calcium-independent cell-cell adhesion (GO:0016338)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)|transmembrane signaling receptor activity (GO:0004888)			kidney(1)|lung(1)	2		Lung NSC(55;0.159)				GCCCTCCCAGATGTTCTGCGA	0.642																																					p.I45T		Atlas-SNP	.											.	CLDN3	6	.	0			c.T134C						PASS	.						76.0	65.0	69.0					7																	73184246		2203	4300	6503	SO:0001583	missense	1365	exon1			TCCCAGATGTTCT	AF007189	CCDS5559.1	7q11	2008-07-18			ENSG00000165215	ENSG00000165215		"""Claudins"""	2045	protein-coding gene	gene with protein product	"""Clostridium perfringens enterotoxin receptor 2"", ""ventral prostate.1-like protein"", ""claudin-3"", ""CPE-receptor 2"""	602910		C7orf1, CPETR2		9441748, 9892664	Standard	NM_001306		Approved	RVP1, CPE-R2, HRVP1	uc003tzg.4	O15551	OTTHUMG00000023424	ENST00000395145.2:c.134T>C	chr7.hg19:g.73184246A>G	ENSP00000378577:p.Ile45Thr	112.0	0.0	.		138.0	46.0	.	NM_001306		Missense_Mutation	SNP	ENST00000395145.2	hg19	CCDS5559.1	.	.	.	.	.	.	.	.	.	.	A	7.850	0.723712	0.15439	.	.	ENSG00000165215	ENST00000395145	D	0.88354	-2.37	4.83	-3.28	0.05033	.	0.255462	0.36740	N	0.002431	T	0.81678	0.4873	L	0.52573	1.65	0.26410	N	0.976288	B	0.06786	0.001	B	0.15052	0.012	T	0.65459	-0.6163	10	0.20046	T	0.44	.	11.5454	0.50690	0.8061:0.0:0.1939:0.0	.	45	O15551	CLD3_HUMAN	T	45	ENSP00000378577:I45T	ENSP00000378577:I45T	I	-	2	0	CLDN3	72822182	0.005000	0.15991	0.951000	0.38953	0.520000	0.34377	-0.052000	0.11865	-0.606000	0.05746	-0.375000	0.07067	ATC	.	.	.	none		0.642	CLDN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252310.1	NM_001306	
ZNF804B	219578	hgsc.bcm.edu	37	7	88964261	88964261	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr7:88964261C>G	ENST00000333190.4	+	4	2574	c.1965C>G	c.(1963-1965)aaC>aaG	p.N655K		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	655							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			GACAATTCAACTGCAAGTCCA	0.408										HNSCC(36;0.09)																											p.N655K		Atlas-SNP	.											.	ZNF804B	322	.	0			c.C1965G						PASS	.						102.0	95.0	97.0					7																	88964261		2203	4300	6503	SO:0001583	missense	219578	exon4			ATTCAACTGCAAG	AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.1965C>G	chr7.hg19:g.88964261C>G	ENSP00000329638:p.Asn655Lys	205.0	0.0	.		233.0	83.0	.	NM_181646	B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	ENST00000333190.4	hg19	CCDS5613.1	.	.	.	.	.	.	.	.	.	.	C	2.059	-0.415957	0.04766	.	.	ENSG00000182348	ENST00000333190	T	0.04603	3.59	5.48	-2.51	0.06365	.	0.797440	0.11763	N	0.531868	T	0.01661	0.0053	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.46034	-0.9220	10	0.05525	T	0.97	-1.7321	3.2285	0.06740	0.1081:0.35:0.1062:0.4357	.	655	A4D1E1	Z804B_HUMAN	K	655	ENSP00000329638:N655K	ENSP00000329638:N655K	N	+	3	2	ZNF804B	88802197	0.000000	0.05858	0.021000	0.16686	0.022000	0.10575	-1.055000	0.03493	-0.334000	0.08463	0.650000	0.86243	AAC	.	.	.	none		0.408	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	NM_181646	
ZNF3	7551	hgsc.bcm.edu	37	7	99674930	99674930	+	Silent	SNP	G	G	A			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr7:99674930G>A	ENST00000424697.1	-	3	357	c.51C>T	c.(49-51)gaC>gaT	p.D17D	ZNF3_ENST00000303915.6_Silent_p.D17D|ZNF3_ENST00000413658.2_Silent_p.D17D|ZNF3_ENST00000299667.4_Silent_p.D17D	NM_001278284.1|NM_001278287.1|NM_001278290.1|NM_001278291.1|NM_001278292.1|NM_032924.3	NP_001265213.1|NP_001265216.1|NP_001265219.1|NP_001265220.1|NP_001265221.1|NP_116313.3	P17036	ZNF3_HUMAN	zinc finger protein 3	17					cell differentiation (GO:0030154)|leukocyte activation (GO:0045321)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(8)|ovary(1)|skin(2)	25	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)	Ovarian(593;2.06e-05)|Myeloproliferative disorder(862;0.0122)|Breast(660;0.029)	STAD - Stomach adenocarcinoma(171;0.129)			CCTCACCACTGTCAAGCAGGG	0.488																																					p.D17D		Atlas-SNP	.											.	ZNF3	54	.	0			c.C51T						PASS	.						143.0	147.0	146.0					7																	99674930		1992	4179	6171	SO:0001819	synonymous_variant	7551	exon3			ACCACTGTCAAGC	AF027136	CCDS43618.1, CCDS43619.1	7q22.1	2013-01-08	2006-05-05					"""Zinc fingers, C2H2-type"", ""-"""	13089	protein-coding gene	gene with protein product		194510	"""zinc finger protein 3 (A8-51)"""				Standard	NM_032924		Approved	A8-51, KOX25, PP838, FLJ20216, HF.12, Zfp113	uc003usr.4	P17036		ENST00000424697.1:c.51C>T	chr7.hg19:g.99674930G>A		91.0	0.0	.		130.0	6.0	.	NM_032924	D6W5U0|P13683|Q9HBR4|Q9NNX8|Q9NXJ1|Q9UC15|Q9UC16	Silent	SNP	ENST00000424697.1	hg19	CCDS43619.1																																																																																			.	.	.	none		0.488	ZNF3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336247.3	NM_017715	
ATXN7L1	222255	hgsc.bcm.edu	37	7	105516974	105516974	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr7:105516974G>C	ENST00000419735.3	-	1	76	c.31C>G	c.(31-33)Ctc>Gtc	p.L11V	ATXN7L1_ENST00000478915.1_5'Flank|ATXN7L1_ENST00000318724.4_Missense_Mutation_p.L11V	NM_020725.1	NP_065776.1	Q9ULK2	AT7L1_HUMAN	ataxin 7-like 1	11										endometrium(1)|large_intestine(4)|lung(5)	10						GCAGCCGAGAGACACGGGATT	0.587																																					p.L11V		Atlas-SNP	.											.	ATXN7L1	56	.	0			c.C31G						PASS	.						73.0	64.0	67.0					7																	105516974		2203	4300	6503	SO:0001583	missense	222255	exon1			CCGAGAGACACGG	AB033044	CCDS34727.1, CCDS47682.1, CCDS47683.1	7q22.1	2007-11-13			ENSG00000146776	ENSG00000146776			22210	protein-coding gene	gene with protein product			"""ataxin 7-like 4"""	ATXN7L4		15115762	Standard	NM_152749		Approved	KIAA1218, MGC33190	uc003vde.2	Q9ULK2	OTTHUMG00000157521	ENST00000419735.3:c.31C>G	chr7.hg19:g.105516974G>C	ENSP00000410759:p.Leu11Val	88.0	0.0	.		87.0	25.0	.	NM_020725	A4D0Q2|B4DTS1|Q8N2T0	Missense_Mutation	SNP	ENST00000419735.3	hg19	CCDS47682.1	.	.	.	.	.	.	.	.	.	.	G	14.24	2.475744	0.44044	.	.	ENSG00000146776	ENST00000419735;ENST00000318724	T	0.16597	2.33	4.77	4.77	0.60923	.	.	.	.	.	T	0.17492	0.0420	L	0.36672	1.1	0.80722	D	1	P;P	0.41673	0.728;0.759	B;B	0.38500	0.275;0.259	T	0.03443	-1.1036	9	0.72032	D	0.01	.	18.1766	0.89764	0.0:0.0:1.0:0.0	.	11;11	A4D0Q2;Q9ULK2	.;AT7L1_HUMAN	V	11	ENSP00000410759:L11V	ENSP00000326344:L11V	L	-	1	0	ATXN7L1	105304210	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.485000	0.60279	2.342000	0.79632	0.555000	0.69702	CTC	.	.	.	none		0.587	ATXN7L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349037.2		
KMT2C	58508	hgsc.bcm.edu	37	7	151874116	151874116	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr7:151874116C>T	ENST00000262189.6	-	38	8640	c.8422G>A	c.(8422-8424)Gat>Aat	p.D2808N	KMT2C_ENST00000355193.2_Missense_Mutation_p.D2808N	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	2808					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										GAATGTTTATCAGAGAGAACC	0.348																																					p.D2808N		Atlas-SNP	.											.	MLL3	1564	.	0			c.G8422A						PASS	.						149.0	143.0	145.0					7																	151874116		2203	4300	6503	SO:0001583	missense	58508	exon38			GTTTATCAGAGAG	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.8422G>A	chr7.hg19:g.151874116C>T	ENSP00000262189:p.Asp2808Asn	65.0	0.0	.		80.0	23.0	.	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	hg19	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	C	11.33	1.605994	0.28623	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.85339	-1.97;-1.96	5.58	3.75	0.43078	.	0.136399	0.32578	N	0.005917	T	0.81187	0.4770	L	0.29908	0.895	0.20196	N	0.999929	P;D;B	0.56521	0.682;0.976;0.302	B;P;B	0.51701	0.326;0.677;0.08	T	0.72717	-0.4209	10	0.72032	D	0.01	.	7.3772	0.26835	0.0:0.7163:0.1392:0.1445	.	2808;1869;2808	Q8NEZ4;Q8NEZ4-2;Q8NEZ4-3	MLL3_HUMAN;.;.	N	2808	ENSP00000262189:D2808N;ENSP00000347325:D2808N	ENSP00000262189:D2808N	D	-	1	0	MLL3	151505049	0.517000	0.26226	0.044000	0.18714	0.763000	0.43281	2.280000	0.43443	0.692000	0.31613	0.650000	0.86243	GAT	.	.	.	none		0.348	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
TNKS	8658	hgsc.bcm.edu	37	8	9564428	9564428	+	Silent	SNP	T	T	C			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr8:9564428T>C	ENST00000310430.6	+	8	1403	c.1377T>C	c.(1375-1377)gcT>gcC	p.A459A	TNKS_ENST00000518027.1_3'UTR|TNKS_ENST00000520408.1_Silent_p.A459A|TNKS_ENST00000518281.1_Silent_p.A222A	NM_003747.2	NP_003738.2	O95271	TNKS1_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase	459					mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|mRNA transport (GO:0051028)|negative regulation of DNA binding (GO:0043392)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein poly-ADP-ribosylation (GO:0070212)|protein polyubiquitination (GO:0000209)|protein transport (GO:0015031)|regulation of telomere maintenance via telomerase (GO:0032210)|spindle assembly (GO:0051225)|Wnt signaling pathway (GO:0016055)	chromosome, centromeric region (GO:0000775)|chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nuclear chromosome, telomeric region (GO:0000784)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	NAD+ ADP-ribosyltransferase activity (GO:0003950)|zinc ion binding (GO:0008270)			NS(1)|endometrium(10)|kidney(6)|large_intestine(4)|lung(17)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	49				COAD - Colon adenocarcinoma(149;0.0467)		GCCATGGCGCTGATCCTACAT	0.473																																					p.A459A		Atlas-SNP	.											.	TNKS	198	.	0			c.T1377C						PASS	.						104.0	88.0	94.0					8																	9564428		2203	4300	6503	SO:0001819	synonymous_variant	8658	exon8			TGGCGCTGATCCT	AF082556	CCDS5974.1	8p23.1	2013-01-10			ENSG00000173273	ENSG00000173273		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	11941	protein-coding gene	gene with protein product		603303				9822378, 10198177	Standard	XM_006716263		Approved	TIN1, TINF1, TNKS1, PARP-5a, PARP5A, pART5	uc003wss.3	O95271	OTTHUMG00000090481	ENST00000310430.6:c.1377T>C	chr8.hg19:g.9564428T>C		89.0	0.0	.		105.0	41.0	.	NM_003747	O95272|Q4G0F2	Silent	SNP	ENST00000310430.6	hg19	CCDS5974.1																																																																																			.	.	.	none		0.473	TNKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206935.1	NM_003747	
DPP7	29952	hgsc.bcm.edu	37	9	140009153	140009153	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr9:140009153G>C	ENST00000371579.2	-	1	17	c.13C>G	c.(13-15)Ccc>Gcc	p.P5A		NM_013379.2	NP_037511.2	Q9UHL4	DPP2_HUMAN	dipeptidyl-peptidase 7	5						cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			endometrium(2)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	7	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;4.25e-05)|Epithelial(140;0.000633)		GGGGCCCAGGGAGCGGAGCCC	0.811																																					p.P5A		Atlas-SNP	.											.	DPP7	22	.	0			c.C13G						PASS	.						1.0	1.0	1.0					9																	140009153		699	1539	2238	SO:0001583	missense	29952	exon1			CCCAGGGAGCGGA	AF154502	CCDS7030.1	9q34.3	2008-02-05	2006-01-12		ENSG00000176978	ENSG00000176978			14892	protein-coding gene	gene with protein product		610537	"""dipeptidylpeptidase 7"""			10477574, 11139392	Standard	XM_005266075		Approved	DPPII	uc004clh.3	Q9UHL4	OTTHUMG00000020977	ENST00000371579.2:c.13C>G	chr9.hg19:g.140009153G>C	ENSP00000360635:p.Pro5Ala	34.0	0.0	.		34.0	11.0	.	NM_013379	A8K7U7|Q5VSF1|Q969X4	Missense_Mutation	SNP	ENST00000371579.2	hg19	CCDS7030.1	.	.	.	.	.	.	.	.	.	.	G	10.11	1.260209	0.23051	.	.	ENSG00000176978	ENST00000371579;ENST00000443858	T	0.12465	2.68	2.39	0.47	0.16747	.	1.637370	0.03575	N	0.229169	T	0.07007	0.0178	N	0.08118	0	0.09310	N	1	B;B	0.19331	0.002;0.035	B;B	0.08055	0.002;0.003	T	0.33624	-0.9861	10	0.16896	T	0.51	.	5.9139	0.19043	0.1339:0.1986:0.6675:0.0	.	5;5	E7EQS4;Q9UHL4	.;DPP2_HUMAN	A	5	ENSP00000360635:P5A	ENSP00000360635:P5A	P	-	1	0	DPP7	139128974	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-1.158000	0.03153	-0.164000	0.10927	-1.961000	0.00478	CCC	.	.	.	none		0.811	DPP7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055279.1	NM_013379	
PNPLA7	375775	hgsc.bcm.edu	37	9	140354898	140354898	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr9:140354898G>T	ENST00000277531.4	-	34	4087	c.3901C>A	c.(3901-3903)Ccc>Acc	p.P1301T	PNPLA7_ENST00000492278.1_5'UTR|NSMF_ENST00000339554.3_5'Flank|NSMF_ENST00000371472.2_5'Flank|NSMF_ENST00000371473.3_5'Flank|NSMF_ENST00000371474.3_5'Flank|NSMF_ENST00000392812.4_5'Flank|NSMF_ENST00000437259.1_5'Flank|NSMF_ENST00000265663.7_5'Flank|PNPLA7_ENST00000406427.1_Missense_Mutation_p.P1326T|NSMF_ENST00000371475.3_5'Flank|PNPLA7_ENST00000371457.1_Missense_Mutation_p.P907T	NM_152286.3	NP_689499.3	Q6ZV29	PLPL7_HUMAN	patatin-like phospholipase domain containing 7	1301					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_cancers(76;0.126)			OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)		GCCAGACTGGGGTGTCGATGC	0.627																																					p.P1326T		Atlas-SNP	.											.	PNPLA7	124	.	0			c.C3976A						PASS	.						53.0	48.0	50.0					9																	140354898		2203	4300	6503	SO:0001583	missense	375775	exon35			GACTGGGGTGTCG	AK126267	CCDS7045.1, CCDS48070.1	9q34.3	2009-01-12	2006-06-12	2006-06-12	ENSG00000130653	ENSG00000130653		"""Patatin-like phospholipase domain containing"""	24768	protein-coding gene	gene with protein product		612122	"""chromosome 9 open reading frame 111"""	C9orf111		16799181, 12640454, 19029121	Standard	XM_005266082		Approved	FLJ43070, FLJ31318, FLJ44279, RP11-48C7.2, NTEL1, NTE-R1	uc010ncj.1	Q6ZV29	OTTHUMG00000020990	ENST00000277531.4:c.3901C>A	chr9.hg19:g.140354898G>T	ENSP00000277531:p.Pro1301Thr	51.0	0.0	.		61.0	22.0	.	NM_001098537	B5MDD3|Q5T364|Q658X0|Q658Y3|Q6ZTS1|Q86YU8|Q8TAY5|Q96N75|Q9H7N5	Missense_Mutation	SNP	ENST00000277531.4	hg19	CCDS7045.1	.	.	.	.	.	.	.	.	.	.	G	9.846	1.192362	0.21954	.	.	ENSG00000130653	ENST00000371457;ENST00000371446;ENST00000277531;ENST00000406427;ENST00000371451	T;T;T;T	0.70045	-0.45;3.47;0.36;0.36	3.27	1.01	0.19927	.	2.580500	0.01842	U	0.035387	T	0.46229	0.1382	N	0.19112	0.55	0.09310	N	1	B;P;P;B	0.45348	0.294;0.59;0.856;0.078	B;B;B;B	0.38803	0.084;0.168;0.282;0.035	T	0.44697	-0.9311	10	0.22109	T	0.4	-1.2333	1.2022	0.01887	0.1471:0.215:0.4191:0.2189	.	709;1326;1301;548	E2QRF8;Q6ZV29-5;Q6ZV29;B3KXH5	.;.;PLPL7_HUMAN;.	T	907;709;1301;1326;1238	ENSP00000360512:P907T;ENSP00000360501:P709T;ENSP00000277531:P1301T;ENSP00000384610:P1326T	ENSP00000277531:P1301T	P	-	1	0	PNPLA7	139474719	0.000000	0.05858	0.001000	0.08648	0.019000	0.09904	-0.123000	0.10611	0.620000	0.30215	0.457000	0.33378	CCC	.	.	.	none		0.627	PNPLA7-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254787.1	NM_152286	
GAD2	2572	hgsc.bcm.edu	37	10	26505778	26505778	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr10:26505778G>T	ENST00000376261.3	+	1	543	c.40G>T	c.(40-42)Gaa>Taa	p.E14*	GAD2_ENST00000259271.3_Nonsense_Mutation_p.E14*|GAD2_ENST00000376248.1_5'Flank	NM_001134366.1	NP_001127838.1	Q05329	DCE2_HUMAN	glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)	14					glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|cell junction (GO:0030054)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(26)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						TTTCGGGTCGGAAGATGGCTC	0.647																																					p.E14X		Atlas-SNP	.											.	GAD2	116	.	0			c.G40T						PASS	.						64.0	70.0	68.0					10																	26505778		2203	4300	6503	SO:0001587	stop_gained	2572	exon1			GGGTCGGAAGATG	AJ251501	CCDS7149.1	10p13-p11.2	2003-11-11	2002-08-29		ENSG00000136750	ENSG00000136750	4.1.1.15		4093	protein-coding gene	gene with protein product		138275	"""glutamate decarboxylase 2 (pancreatic islets and brain, 65kD)"""			2039509	Standard	NM_000818		Approved	GAD65	uc001isp.2	Q05329	OTTHUMG00000017836	ENST00000376261.3:c.40G>T	chr10.hg19:g.26505778G>T	ENSP00000365437:p.Glu14*	80.0	0.0	.		107.0	41.0	.	NM_000818	Q9UD87	Nonsense_Mutation	SNP	ENST00000376261.3	hg19	CCDS7149.1	.	.	.	.	.	.	.	.	.	.	G	35	5.435317	0.96150	.	.	ENSG00000136750	ENST00000376261;ENST00000259271;ENST00000428517	.	.	.	4.92	4.92	0.64577	.	0.070572	0.56097	D	0.000033	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-22.9908	16.9203	0.86162	0.0:0.0:1.0:0.0	.	.	.	.	X	14	.	ENSP00000259271:E14X	E	+	1	0	GAD2	26545784	1.000000	0.71417	1.000000	0.80357	0.380000	0.30137	5.787000	0.69013	2.282000	0.76494	0.455000	0.32223	GAA	.	.	.	none		0.647	GAD2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047255.1	NM_000818	
NRP1	8829	hgsc.bcm.edu	37	10	33496597	33496597	+	Silent	SNP	A	A	G			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr10:33496597A>G	ENST00000265371.4	-	11	2187	c.1662T>C	c.(1660-1662)ttT>ttC	p.F554F	NRP1_ENST00000395995.1_Silent_p.F554F|NRP1_ENST00000374867.2_Silent_p.F554F|NRP1_ENST00000374816.3_Silent_p.F554F|NRP1_ENST00000374822.4_Silent_p.F554F|NRP1_ENST00000374821.5_Silent_p.F554F|NRP1_ENST00000374823.5_Silent_p.F554F|NRP1_ENST00000374875.1_Silent_p.F373F			O14786	NRP1_HUMAN	neuropilin 1	554	F5/8 type C 2. {ECO:0000255|PROSITE- ProRule:PRU00081}.				angiogenesis (GO:0001525)|angiogenesis involved in coronary vascular morphogenesis (GO:0060978)|artery morphogenesis (GO:0048844)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell signaling (GO:0007267)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|commissural neuron axon guidance (GO:0071679)|coronary artery morphogenesis (GO:0060982)|dendrite development (GO:0016358)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell chemotaxis (GO:0035767)|endothelial tip cell fate specification (GO:0097102)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|patterning of blood vessels (GO:0001569)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of cytokine activity (GO:0060301)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of retinal ganglion cell axon guidance (GO:1902336)|positive regulation of smooth muscle cell migration (GO:0014911)|protein localization to early endosome (GO:1902946)|regulation of retinal ganglion cell axon guidance (GO:0090259)|regulation of vesicle-mediated transport (GO:0060627)|renal artery morphogenesis (GO:0061441)|response to wounding (GO:0009611)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal ganglion cell axon guidance (GO:0031290)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|sympathetic ganglion development (GO:0061549)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|VEGF-activated neuropilin signaling pathway (GO:0038190)|VEGF-activated neuropilin signaling pathway involved in axon guidance (GO:1902378)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neurofilament (GO:0005883)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|semaphorin receptor complex (GO:0002116)|sorting endosome (GO:0097443)	coreceptor activity (GO:0015026)|cytokine binding (GO:0019955)|growth factor binding (GO:0019838)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|semaphorin receptor activity (GO:0017154)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(2)	48					Palifermin(DB00039)|Pegaptanib(DB04895)	AGAGAGCTGGAAAAGTCCGCA	0.507																																					p.F554F	Melanoma(104;886 1489 44640 45944 51153)	Atlas-SNP	.											.	NRP1	126	.	0			c.T1662C						PASS	.						168.0	158.0	161.0					10																	33496597		2203	4300	6503	SO:0001819	synonymous_variant	8829	exon10			AGCTGGAAAAGTC	AF016050	CCDS7177.1, CCDS31179.1, CCDS31180.1	10p12	2006-02-23			ENSG00000099250	ENSG00000099250		"""CD molecules"""	8004	protein-coding gene	gene with protein product		602069				9529250, 9331348	Standard	NM_003873		Approved	NRP, VEGF165R, CD304	uc001iwx.4	O14786	OTTHUMG00000019343	ENST00000265371.4:c.1662T>C	chr10.hg19:g.33496597A>G		62.0	0.0	.		103.0	8.0	.	NM_001244973	B0LPG9|O60461|Q5T7F1|Q5T7F2|Q5T7F3|Q86T59|Q96I90|Q96IH5	Silent	SNP	ENST00000265371.4	hg19	CCDS7177.1																																																																																			.	.	.	none		0.507	NRP1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051203.2		
BICC1	80114	hgsc.bcm.edu	37	10	60549020	60549020	+	Splice_Site	SNP	A	A	G			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr10:60549020A>G	ENST00000373886.3	+	7	604		c.e7-1			NM_001080512.1	NP_001073981.1	Q9H694	BICC1_HUMAN	BicC family RNA binding protein 1						multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)	cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	44						ATTTCATTTTAGGAGCTGCTT	0.378																																					.		Atlas-SNP	.											.	BICC1	121	.	0			c.601-2A>G						PASS	.						94.0	89.0	91.0					10																	60549020		2203	4300	6503	SO:0001630	splice_region_variant	80114	exon7			CATTTTAGGAGCT	AK026129	CCDS31206.1	10q21.3	2014-09-17	2014-02-03		ENSG00000122870	ENSG00000122870		"""Sterile alpha motif (SAM) domain containing"""	19351	protein-coding gene	gene with protein product		614295	"""bicaudal C homolog 1 (Drosophila)"""				Standard	XM_005270166		Approved		uc001jki.1	Q9H694	OTTHUMG00000018271	ENST00000373886.3:c.601-1A>G	chr10.hg19:g.60549020A>G		80.0	0.0	.		91.0	40.0	.	NM_001080512		Splice_Site	SNP	ENST00000373886.3	hg19	CCDS31206.1	.	.	.	.	.	.	.	.	.	.	A	19.84	3.902221	0.72754	.	.	ENSG00000122870	ENST00000373886	.	.	.	5.66	5.66	0.87406	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9023	0.79387	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	BICC1	60219026	1.000000	0.71417	0.988000	0.46212	0.717000	0.41224	9.064000	0.93933	2.153000	0.67306	0.533000	0.62120	.	.	.	.	none		0.378	BICC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048150.2	NM_025044	Intron
UBTD1	80019	hgsc.bcm.edu	37	10	99330070	99330070	+	Silent	SNP	C	C	A			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr10:99330070C>A	ENST00000370664.3	+	3	810	c.474C>A	c.(472-474)ggC>ggA	p.G158G	ANKRD2_ENST00000455090.1_5'Flank|ANKRD2_ENST00000298808.5_5'Flank|ANKRD2_ENST00000370655.1_5'Flank|ANKRD2_ENST00000307518.5_5'Flank	NM_024954.3	NP_079230.1	Q9HAC8	UBTD1_HUMAN	ubiquitin domain containing 1	158	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.									central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(1)|skin(1)	7		Colorectal(252;0.162)		Epithelial(162;3.04e-10)|all cancers(201;2.86e-08)		TGTCCACGGGCAAGGACGTGA	0.697																																					p.G158G	Pancreas(100;169 2668 32720)	Atlas-SNP	.											.	UBTD1	19	.	0			c.C474A						PASS	.						43.0	43.0	43.0					10																	99330070		2203	4299	6502	SO:0001819	synonymous_variant	80019	exon3			CACGGGCAAGGAC	BC007331	CCDS7465.1	10q24.2	2005-09-22			ENSG00000165886	ENSG00000165886			25683	protein-coding gene	gene with protein product						12477932	Standard	NM_024954		Approved	FLJ11807	uc001knv.1	Q9HAC8	OTTHUMG00000018856	ENST00000370664.3:c.474C>A	chr10.hg19:g.99330070C>A		81.0	0.0	.		76.0	25.0	.	NM_024954	D3DR57|Q53HI3	Silent	SNP	ENST00000370664.3	hg19	CCDS7465.1																																																																																			.	.	.	none		0.697	UBTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049701.1	NM_024954	
MKI67	4288	hgsc.bcm.edu	37	10	129909928	129909929	+	Missense_Mutation	DNP	GT	GT	AA			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	G|T	G|T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr10:129909928_129909929GT>AA	ENST00000368654.3	-	11	2615_2616	c.2240_2241AC>TT	c.(2239-2241)gAC>gTT	p.D747V	MKI67_ENST00000484853.1_5'UTR|MKI67_ENST00000368653.3_Missense_Mutation_p.D387V	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	747					cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				CTTCCTTAAAGTCCATTTTTTG	0.347																																					p.D747D|p.D747V		Atlas-SNP	.											.	MKI67	363	.	0			c.C2241T|c.A2240T						PASS	.																																			SO:0001583	missense	4288	exon11			CTTAAAGTCCATT|TTAAAGTCCATTT	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.2240_2241delinsAA	chr10.hg19:g.129909928_129909929delinsAA	ENSP00000357643:p.Asp747Val	64.0|65.0	0.0	.		90.0|94.0	27.0	.	NM_002417	Q5VWH2	Silent|Missense_Mutation	SNP	ENST00000368654.3	hg19	CCDS7659.1																																																																																			.	.	.	none		0.347	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417	
MUC6	4588	hgsc.bcm.edu	37	11	1020248	1020248	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr11:1020248G>T	ENST00000421673.2	-	29	3700	c.3650C>A	c.(3649-3651)cCc>cAc	p.P1217H		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1217					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GACTTGCGTGGGCCGTGAGCC	0.672																																					p.P1217H		Atlas-SNP	.											.	MUC6	408	.	0			c.C3650A						PASS	.						71.0	83.0	79.0					11																	1020248		2115	4209	6324	SO:0001583	missense	4588	exon29			TGCGTGGGCCGTG	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.3650C>A	chr11.hg19:g.1020248G>T	ENSP00000406861:p.Pro1217His	67.0	0.0	.		94.0	32.0	.	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	hg19	CCDS44513.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	3.420|3.420	-0.118416|-0.118416	0.06838|0.06838	.|.	.|.	ENSG00000184956|ENSG00000184956	ENST00000421673|ENST00000527242	T|.	0.20463|.	2.07|.	1.31|1.31	1.31|1.31	0.21738|0.21738	.|.	.|.	.|.	.|.	.|.	T|T	0.35799|0.35799	0.0944|0.0944	L|L	0.36672|0.36672	1.1|1.1	0.09310|0.09310	N|N	1|1	D|.	0.63046|.	0.992|.	B|.	0.41332|.	0.354|.	T|T	0.33752|0.33752	-0.9856|-0.9856	9|6	0.62326|0.87932	D|D	0.03|0	.|.	6.0061|6.0061	0.19547|0.19547	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1217|.	Q6W4X9|.	MUC6_HUMAN|.	H|T	1217|22	ENSP00000406861:P1217H|.	ENSP00000406861:P1217H|ENSP00000436903:P22T	P|P	-|-	2|1	0|0	MUC6|MUC6	1010248|1010248	0.006000|0.006000	0.16342|0.16342	0.004000|0.004000	0.12327|0.12327	0.105000|0.105000	0.19272|0.19272	1.607000|1.607000	0.36836|0.36836	1.027000|1.027000	0.39758|0.39758	0.313000|0.313000	0.20887|0.20887	CCC|CCA	.	.	.	none		0.672	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
OR56A3	390083	hgsc.bcm.edu	37	11	5969097	5969097	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr11:5969097G>T	ENST00000329564.6	+	1	528	c.521G>T	c.(520-522)gGa>gTa	p.G174V	AC025016.1_ENST00000528915.1_lincRNA	NM_001003443.2	NP_001003443.2	Q8NH54	O56A3_HUMAN	olfactory receptor, family 56, subfamily A, member 3	174						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(27)|stomach(1)|upper_aerodigestive_tract(1)	41		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;9.41e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CGTTATTGTGGAAGAAATGTC	0.443																																					p.G174V		Atlas-SNP	.											.	OR56A3	81	.	0			c.G521T						PASS	.						102.0	103.0	103.0					11																	5969097		2165	4289	6454	SO:0001583	missense	390083	exon1			ATTGTGGAAGAAA		CCDS41614.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184478	ENSG00000184478		"""GPCR / Class A : Olfactory receptors"""	14786	protein-coding gene	gene with protein product				OR56A6, OR56A3P			Standard	NM_001003443		Approved		uc010qzt.2	Q8NH54	OTTHUMG00000165373	ENST00000329564.6:c.521G>T	chr11.hg19:g.5969097G>T	ENSP00000331572:p.Gly174Val	81.0	0.0	.		81.0	25.0	.	NM_001003443	A6NN77|Q6IFF7	Missense_Mutation	SNP	ENST00000329564.6	hg19	CCDS41614.1	.	.	.	.	.	.	.	.	.	.	G	1.952	-0.440878	0.04636	.	.	ENSG00000184478	ENST00000329564	T	0.00123	8.7	5.13	-1.72	0.08107	GPCR, rhodopsin-like superfamily (1);	0.742131	0.12370	N	0.474882	T	0.00210	0.0006	M	0.78344	2.41	0.18873	N	0.999982	B	0.15473	0.013	B	0.29176	0.099	T	0.23048	-1.0199	10	0.54805	T	0.06	-1.8477	6.3867	0.21563	0.3047:0.23:0.4653:0.0	.	174	Q8NH54	O56A3_HUMAN	V	174	ENSP00000331572:G174V	ENSP00000331572:G174V	G	+	2	0	OR56A3	5925673	0.000000	0.05858	0.002000	0.10522	0.020000	0.10135	0.057000	0.14279	-0.148000	0.11234	0.650000	0.86243	GGA	.	.	.	none		0.443	OR56A3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383753.1	NM_001003443	
RRP8	23378	hgsc.bcm.edu	37	11	6622765	6622765	+	Silent	SNP	A	A	C			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr11:6622765A>C	ENST00000254605.6	-	3	648	c.531T>G	c.(529-531)ccT>ccG	p.P177P	ILK_ENST00000537806.1_5'Flank|RRP8_ENST00000534343.1_Intron|RP11-732A19.8_ENST00000527191.1_RNA|ILK_ENST00000528995.1_5'Flank|ILK_ENST00000299421.4_5'Flank|ILK_ENST00000420936.2_5'Flank|ILK_ENST00000396751.2_5'Flank	NM_015324.3	NP_056139.1	O43159	RRP8_HUMAN	ribosomal RNA processing 8, methyltransferase, homolog (yeast)	177					cellular response to glucose starvation (GO:0042149)|chromatin modification (GO:0016568)|chromatin silencing at rDNA (GO:0000183)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of cell cycle arrest (GO:0071158)|regulation of transcription by glucose (GO:0046015)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|rDNA heterochromatin (GO:0033553)	methylated histone binding (GO:0035064)|poly(A) RNA binding (GO:0044822)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)	13						GAGGGGGTTTAGGGGAAGTGG	0.527																																					p.P177P		Atlas-SNP	.											.	RRP8	40	.	0			c.T531G						PASS	.						107.0	104.0	105.0					11																	6622765		2201	4296	6497	SO:0001819	synonymous_variant	23378	exon3			GGGTTTAGGGGAA	AB007869	CCDS31411.1	11p15.4	2009-02-23	2009-02-23	2009-02-23	ENSG00000132275	ENSG00000132275			29030	protein-coding gene	gene with protein product	RRP8 methyltransferase homolog (S. cerevisiae)	615818	"""KIAA0409"""	KIAA0409		9455477	Standard	NM_015324		Approved		uc001med.3	O43159		ENST00000254605.6:c.531T>G	chr11.hg19:g.6622765A>C		19.0	0.0	.		23.0	4.0	.	NM_015324	Q7KZ78|Q9BVM6	Silent	SNP	ENST00000254605.6	hg19	CCDS31411.1																																																																																			.	.	.	none		0.527	RRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384505.1	NM_015324	
PRDM11	56981	hgsc.bcm.edu	37	11	45203876	45203876	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr11:45203876A>C	ENST00000530656.1	+	3	301	c.301A>C	c.(301-303)Agc>Cgc	p.S101R	PRDM11_ENST00000424263.2_Missense_Mutation_p.S67R|PRDM11_ENST00000263765.4_Missense_Mutation_p.S101R			Q9NQV5	PRD11_HUMAN	PR domain containing 11	101							methyltransferase activity (GO:0008168)			endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	26						CGTGCCCAAAAGCTTCCAGCA	0.607																																					p.S67R	NSCLC(118;1511 1736 6472 36603 43224)	Atlas-SNP	.											.	PRDM11	53	.	0			c.A199C						PASS	.						76.0	70.0	72.0					11																	45203876		2203	4299	6502	SO:0001583	missense	56981	exon3			CCCAAAAGCTTCC	AF275818	CCDS58130.1, CCDS73277.1	11p11	2008-07-21			ENSG00000019485	ENSG00000019485			13996	protein-coding gene	gene with protein product	"""PR-domain containing protein 11"""						Standard	NM_001256695		Approved	PFM8	uc031qab.1	Q9NQV5	OTTHUMG00000166478	ENST00000530656.1:c.301A>C	chr11.hg19:g.45203876A>C	ENSP00000435976:p.Ser101Arg	106.0	0.0	.		101.0	35.0	.	NM_001256695	Q8N9F1	Missense_Mutation	SNP	ENST00000530656.1	hg19		.	.	.	.	.	.	.	.	.	.	A	20.4	3.983774	0.74474	.	.	ENSG00000019485	ENST00000263765;ENST00000530656;ENST00000526442;ENST00000424263	T;T;T;T	0.51817	0.69;0.69;0.69;0.69	5.18	4.05	0.47172	.	0.159392	0.45126	D	0.000396	T	0.53818	0.1820	L	0.29908	0.895	0.32518	N	0.536669	D	0.76494	0.999	D	0.78314	0.991	T	0.63024	-0.6729	10	0.54805	T	0.06	-23.6209	10.7232	0.46052	0.9247:0.0:0.0753:0.0	.	101	Q9NQV5	PRD11_HUMAN	R	101;101;67;67	ENSP00000263765:S101R;ENSP00000435976:S101R;ENSP00000431898:S67R;ENSP00000394314:S67R	ENSP00000263765:S101R	S	+	1	0	PRDM11	45160452	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	4.780000	0.62382	0.821000	0.34540	0.402000	0.26972	AGC	.	.	.	none		0.607	PRDM11-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000389928.1	NM_020229	
USP28	57646	hgsc.bcm.edu	37	11	113683009	113683009	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr11:113683009T>A	ENST00000003302.4	-	16	2029	c.1961A>T	c.(1960-1962)tAc>tTc	p.Y654F	USP28_ENST00000544967.1_Missense_Mutation_p.Y362F|USP28_ENST00000260188.5_Missense_Mutation_p.Y654F|USP28_ENST00000545540.1_Missense_Mutation_p.Y529F	NM_020886.2	NP_065937.1	Q96RU2	UBP28_HUMAN	ubiquitin specific peptidase 28	654					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|protein deubiquitination (GO:0016579)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(24)|ovary(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	59		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		TGCATTGAAGTAGGGTAGTTT	0.378																																					p.Y654F	Melanoma(4;162 555 7664)|GBM(79;500 2010 17506)|Esophageal Squamous(9;463 924 15765)	Atlas-SNP	.											.	USP28	135	.	0			c.A1961T						PASS	.						84.0	78.0	80.0					11																	113683009		2201	4296	6497	SO:0001583	missense	57646	exon16			TTGAAGTAGGGTA	AB040948	CCDS31680.1, CCDS73394.1	11q23	2008-04-11	2005-08-08		ENSG00000048028	ENSG00000048028		"""Ubiquitin-specific peptidases"""	12625	protein-coding gene	gene with protein product		610748	"""ubiquitin specific protease 28"""			12838346, 11597335	Standard	XM_005271630		Approved	KIAA1515	uc001poh.3	Q96RU2	OTTHUMG00000168205	ENST00000003302.4:c.1961A>T	chr11.hg19:g.113683009T>A	ENSP00000003302:p.Tyr654Phe	91.0	0.0	.		118.0	39.0	.	NM_020886	B0YJC0|B0YJC1|Q9P213	Missense_Mutation	SNP	ENST00000003302.4	hg19	CCDS31680.1	.	.	.	.	.	.	.	.	.	.	T	4.187	0.033316	0.08101	.	.	ENSG00000048028	ENST00000003302;ENST00000260188;ENST00000544967;ENST00000545540;ENST00000538475	T;T;T;T;T	0.44083	1.51;1.52;0.93;1.52;0.93	5.0	3.83	0.44106	.	0.355351	0.34879	N	0.003616	T	0.22898	0.0553	N	0.14661	0.345	0.33755	D	0.62112	B;B;B	0.28605	0.042;0.001;0.217	B;B;B	0.27608	0.037;0.001;0.081	T	0.24941	-1.0146	10	0.09338	T	0.73	-8.4386	11.7095	0.51616	0.0:0.0:0.2787:0.7212	.	529;654;362	B4E3L3;Q96RU2;G3V1N5	.;UBP28_HUMAN;.	F	654;654;362;529;358	ENSP00000003302:Y654F;ENSP00000260188:Y654F;ENSP00000442431:Y362F;ENSP00000444991:Y529F;ENSP00000442257:Y358F	ENSP00000003302:Y654F	Y	-	2	0	USP28	113188219	0.982000	0.34865	0.509000	0.27700	0.927000	0.56198	2.490000	0.45294	0.883000	0.36040	0.533000	0.62120	TAC	.	.	.	none		0.378	USP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398789.1		
ETS1	2113	hgsc.bcm.edu	37	11	128354849	128354849	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr11:128354849T>G	ENST00000319397.6	-	5	908	c.599A>C	c.(598-600)aAg>aCg	p.K200T	ETS1_ENST00000345075.4_Missense_Mutation_p.K200T|ETS1_ENST00000531611.1_Missense_Mutation_p.K200T|ETS1_ENST00000392668.4_Missense_Mutation_p.K244T|ETS1_ENST00000526145.2_Missense_Mutation_p.K200T|ETS1_ENST00000535549.1_Intron	NM_005238.3	NP_005229.1	P14921	ETS1_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog 1	200	Activation domain; required for transcription activation.				angiogenesis involved in wound healing (GO:0060055)|cell motility (GO:0048870)|cellular response to hydrogen peroxide (GO:0070301)|estrous cycle phase (GO:0060206)|female pregnancy (GO:0007565)|hypothalamus development (GO:0021854)|immune response (GO:0006955)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|pituitary gland development (GO:0021983)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of apoptotic process (GO:0042981)|regulation of extracellular matrix disassembly (GO:0010715)|response to antibiotic (GO:0046677)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to laminar fluid shear stress (GO:0034616)|response to mechanical stimulus (GO:0009612)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|pleura(1)|prostate(1)|upper_aerodigestive_tract(3)	35	all_hematologic(175;0.0537)	Lung NSC(97;0.000542)|all_lung(97;0.000665)|Breast(109;0.00765)|all_neural(223;0.0351)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.47e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0174)|LUSC - Lung squamous cell carcinoma(976;0.0815)|Lung(307;0.0833)		ATTCTCATACTTGAGGGAGAG	0.527																																					p.K244T		Atlas-SNP	.											.	ETS1	123	.	0			c.A731C						PASS	.						152.0	135.0	141.0					11																	128354849		2201	4297	6498	SO:0001583	missense	2113	exon7			TCATACTTGAGGG		CCDS8475.1, CCDS44767.1, CCDS53724.1	11q23.3	2013-07-09	2013-07-09		ENSG00000134954	ENSG00000134954			3488	protein-coding gene	gene with protein product	"""Avian erythroblastosis virus E26 (v-ets) oncogene homolog-1"", ""ets protein"""	164720		EWSR2		1522903	Standard	NM_005238		Approved	FLJ10768, ETS-1	uc001qej.2	P14921	OTTHUMG00000165799	ENST00000319397.6:c.599A>C	chr11.hg19:g.128354849T>G	ENSP00000324578:p.Lys200Thr	95.0	0.0	.		130.0	62.0	.	NM_001143820	A9UL17|F5GYX9|Q14278|Q16080|Q6N087|Q96AC5	Missense_Mutation	SNP	ENST00000319397.6	hg19	CCDS8475.1	.	.	.	.	.	.	.	.	.	.	T	19.35	3.809866	0.70797	.	.	ENSG00000134954	ENST00000345075;ENST00000392668;ENST00000531611;ENST00000319397;ENST00000526145	T;T;T;T;T	0.55413	2.96;2.62;0.52;2.62;2.96	5.67	5.67	0.87782	.	0.197284	0.52532	D	0.000076	T	0.68128	0.2967	L	0.55481	1.735	0.80722	D	1	D;P;P	0.71674	0.998;0.651;0.791	D;B;B	0.76071	0.987;0.214;0.273	T	0.68150	-0.5485	10	0.46703	T	0.11	.	15.9141	0.79496	0.0:0.0:0.0:1.0	.	200;200;244	P14921;Q96AC5;Q6N087	ETS1_HUMAN;.;.	T	200;244;200;200;200	ENSP00000340485:K200T;ENSP00000376436:K244T;ENSP00000435666:K200T;ENSP00000324578:K200T;ENSP00000433500:K200T	ENSP00000324578:K200T	K	-	2	0	ETS1	127860059	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.004000	0.88535	2.159000	0.67721	0.459000	0.35465	AAG	.	.	.	none		0.527	ETS1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386269.2	NM_005238	
ANP32D	23519	hgsc.bcm.edu	37	12	48866715	48866715	+	Missense_Mutation	SNP	C	C	G	rs147147368		TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr12:48866715C>G	ENST00000266594.1	+	1	268	c.268C>G	c.(268-270)Ctc>Gtc	p.L90V		NM_012404.2	NP_036536.2	O95626	AN32D_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32 family, member D	90						nuclear matrix (GO:0016363)				central_nervous_system(1)|large_intestine(2)|lung(3)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	9						GTGTCCAAACCTCATACATCT	0.388																																					p.L90V		Atlas-SNP	.											ANP32D,NS,malignant_melanoma,0,1	ANP32D	15	.	0			c.C268G						PASS	.						90.0	89.0	90.0					12																	48866715		2203	4300	6503	SO:0001583	missense	23519	exon1			CCAAACCTCATAC	U71084	CCDS31788.1	12q13.12	2008-08-04			ENSG00000139223	ENSG00000139223		"""ANP32 acidic nuclear phosphoproteins"""	16676	protein-coding gene	gene with protein product	"""pp32 related 2"""	606878				10086381, 10400610	Standard	NM_012404		Approved	PP32R2	uc010slt.2	O95626	OTTHUMG00000162681	ENST00000266594.1:c.268C>G	chr12.hg19:g.48866715C>G	ENSP00000266594:p.Leu90Val	107.0	1.0	.		122.0	40.0	.	NM_012404	Q6NTC4	Missense_Mutation	SNP	ENST00000266594.1	hg19	CCDS31788.1	.	.	.	.	.	.	.	.	.	.	c	11.53	1.665208	0.29604	.	.	ENSG00000139223	ENST00000266594	T	0.62105	0.05	1.55	0.553	0.17235	.	0.000000	0.85682	D	0.000000	T	0.80116	0.4564	H	0.95645	3.7	0.52099	D	0.999941	D	0.58970	0.984	D	0.67382	0.951	T	0.77351	-0.2620	10	0.87932	D	0	.	6.048	0.19770	0.0:0.8125:0.0:0.1875	.	90	O95626	AN32D_HUMAN	V	90	ENSP00000266594:L90V	ENSP00000266594:L90V	L	+	1	0	ANP32D	47152982	1.000000	0.71417	0.001000	0.08648	0.039000	0.13416	1.769000	0.38522	0.039000	0.15632	-1.057000	0.02308	CTC	.	C|1.000;T|0.000	.	alt		0.388	ANP32D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370058.1	NM_012404	
NCKAP1L	3071	hgsc.bcm.edu	37	12	54930739	54930739	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr12:54930739A>T	ENST00000293373.6	+	29	3164	c.3085A>T	c.(3085-3087)Aat>Tat	p.N1029Y	NCKAP1L_ENST00000545638.2_Missense_Mutation_p.N979Y	NM_005337.4	NP_005328.2	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	1029					actin polymerization-dependent cell motility (GO:0070358)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|chemotaxis (GO:0006935)|cortical actin cytoskeleton organization (GO:0030866)|erythrocyte development (GO:0048821)|maintenance of cell polarity (GO:0030011)|myeloid cell homeostasis (GO:0002262)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of myosin-light-chain-phosphatase activity (GO:0035509)|neutrophil chemotaxis (GO:0030593)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of CD8-positive, alpha-beta T cell differentiation (GO:0043378)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of lymphocyte differentiation (GO:0045621)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of T cell proliferation (GO:0042102)|protein complex assembly (GO:0006461)|response to drug (GO:0042493)|T cell homeostasis (GO:0043029)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)|protein kinase activator activity (GO:0030295)|Rac GTPase activator activity (GO:0030675)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(37)|ovary(3)|prostate(3)|skin(3)|stomach(2)	80						TTACAACAACAATATTCATTG	0.403																																					p.N1029Y		Atlas-SNP	.											.	NCKAP1L	180	.	0			c.A3085T						PASS	.						109.0	104.0	106.0					12																	54930739		2203	4300	6503	SO:0001583	missense	3071	exon29			AACAACAATATTC	AI924363	CCDS31813.1, CCDS53799.1	12q13.1	2005-10-11	2005-10-11	2005-10-11		ENSG00000123338			4862	protein-coding gene	gene with protein product		141180	"""hematopoietic protein 1"""	HEM1		1932118	Standard	NM_005337		Approved		uc001sgc.4	P55160	OTTHUMG00000169843	ENST00000293373.6:c.3085A>T	chr12.hg19:g.54930739A>T	ENSP00000293373:p.Asn1029Tyr	78.0	0.0	.		57.0	19.0	.	NM_005337	B4DUT5|Q52LW0	Missense_Mutation	SNP	ENST00000293373.6	hg19	CCDS31813.1	.	.	.	.	.	.	.	.	.	.	A	18.20	3.571514	0.65765	.	.	ENSG00000123338	ENST00000293373;ENST00000545638	T;T	0.54479	0.57;0.57	3.99	2.83	0.33086	.	0.118609	0.56097	D	0.000030	T	0.66366	0.2782	M	0.75615	2.305	0.52501	D	0.999952	D	0.69078	0.997	D	0.67900	0.954	T	0.67401	-0.5680	10	0.87932	D	0	-18.7262	8.0508	0.30577	0.9:0.0:0.1:0.0	.	1029	P55160	NCKPL_HUMAN	Y	1029;979	ENSP00000293373:N1029Y;ENSP00000445596:N979Y	ENSP00000293373:N1029Y	N	+	1	0	NCKAP1L	53217006	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	8.733000	0.91539	0.880000	0.35969	0.533000	0.62120	AAT	.	.	.	none		0.403	NCKAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406195.1	NM_005337	
RAB21	23011	hgsc.bcm.edu	37	12	72179447	72179448	+	Missense_Mutation	DNP	TG	TG	CA			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	T|G	T|G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr12:72179447_72179448TG>CA	ENST00000261263.3	+	7	928_929	c.672_673TG>CA	c.(670-675)tcTGga>tcCAga	p.G225R		NM_014999.2	NP_055814.1	Q9UL25	RAB21_HUMAN	RAB21, member RAS oncogene family	225					GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			large_intestine(1)|lung(4)|prostate(1)	6						GCTGTTCTTCTGGATAACTGTT	0.45																																					p.S224S|p.G225R		Atlas-SNP	.											.	RAB21	17	.	0			c.T672C|c.G673A						PASS	.																																			SO:0001583	missense	23011	exon7			TTCTTCTGGATAA|TCTTCTGGATAAC	AF091035	CCDS9003.1	12q21.1	2014-09-04			ENSG00000080371	ENSG00000080371		"""RAB, member RAS oncogene"""	18263	protein-coding gene	gene with protein product		612398				10887961, 11697911, 16754960	Standard	NM_014999		Approved	KIAA0118	uc001swt.3	Q9UL25	OTTHUMG00000169572	Exception_encountered	chr12.hg19:g.72179447_72179448delinsCA	ENSP00000261263:p.Gly225Arg	169.0|166.0	0.0	.		159.0|158.0	50.0|49.0	.	NM_014999	Q14466|Q569H3	Silent|Missense_Mutation	SNP	ENST00000261263.3	hg19	CCDS9003.1																																																																																			.	.	.	none		0.450	RAB21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404855.1		
PAH	5053	hgsc.bcm.edu	37	12	103248991	103248991	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr12:103248991A>T	ENST00000553106.1	-	6	1101	c.629T>A	c.(628-630)tTt>tAt	p.F210Y	PAH_ENST00000307000.2_Missense_Mutation_p.F205Y|PAH_ENST00000551988.1_5'Flank	NM_000277.1	NP_000268.1	P00439	PH4H_HUMAN	phenylalanine hydroxylase	210					catecholamine biosynthetic process (GO:0042423)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|neurotransmitter biosynthetic process (GO:0042136)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|phenylalanine 4-monooxygenase activity (GO:0004505)			endometrium(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(5)|skin(2)|urinary_tract(1)	27					Droxidopa(DB06262)|Epinephrine(DB00668)|L-Phenylalanine(DB00120)|Norepinephrine(DB00368)|Tetrahydrobiopterin(DB00360)	AAGAAGTGGAAAAATGTGATT	0.428																																					p.F210Y		Atlas-SNP	.											.	PAH	77	.	0			c.T629A						PASS	.						138.0	129.0	132.0					12																	103248991		2203	4300	6503	SO:0001583	missense	5053	exon6			AGTGGAAAAATGT	U49897	CCDS9092.1	12q22-q24.2	2010-04-27				ENSG00000171759	1.14.16.1		8582	protein-coding gene	gene with protein product	"""phenylalanine 4-monooxygenase"""	612349				2063869	Standard	NM_000277		Approved	PH	uc001tjq.1	P00439		ENST00000553106.1:c.629T>A	chr12.hg19:g.103248991A>T	ENSP00000448059:p.Phe210Tyr	108.0	0.0	.		107.0	46.0	.	NM_000277	Q16717|Q8TC14	Missense_Mutation	SNP	ENST00000553106.1	hg19	CCDS9092.1	.	.	.	.	.	.	.	.	.	.	A	33	5.265919	0.95399	.	.	ENSG00000171759	ENST00000553106;ENST00000307000	D;D	0.99674	-6.36;-6.36	5.63	5.63	0.86233	Aromatic amino acid hydroxylase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.99729	0.9894	M	0.88031	2.925	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.993	D	0.97321	0.9944	10	0.87932	D	0	-26.0147	15.8352	0.78793	1.0:0.0:0.0:0.0	.	210;210	B4DPN2;P00439	.;PH4H_HUMAN	Y	210;205	ENSP00000448059:F210Y;ENSP00000303500:F205Y	ENSP00000303500:F205Y	F	-	2	0	PAH	101773121	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.339000	0.96797	2.149000	0.67028	0.528000	0.53228	TTT	.	.	.	none		0.428	PAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406692.1		
SSH1	54434	hgsc.bcm.edu	37	12	109212091	109212091	+	Splice_Site	SNP	T	T	A			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr12:109212091T>A	ENST00000326495.5	-	4	308		c.e4-2		SSH1_ENST00000326470.5_Splice_Site|SSH1_ENST00000551165.1_Splice_Site|SSH1_ENST00000546812.1_Intron|SSH1_ENST00000360239.3_Splice_Site	NM_018984.3	NP_061857.3	Q8WYL5	SSH1_HUMAN	slingshot protein phosphatase 1						actin cytoskeleton organization (GO:0030036)|cell morphogenesis (GO:0000902)|cellular response to ATP (GO:0071318)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of cellular protein metabolic process (GO:0032268)|regulation of lamellipodium assembly (GO:0010591)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GCAGATCACCTGTTGGACCAA	0.398																																					.		Atlas-SNP	.											.	SSH1	144	.	0			c.215-2A>T						PASS	.						99.0	98.0	98.0					12																	109212091		2203	4300	6503	SO:0001630	splice_region_variant	54434	exon5			ATCACCTGTTGGA	BC062341	CCDS9121.1, CCDS53825.1, CCDS55882.1	12q24.12	2013-03-05	2013-03-05			ENSG00000084112		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30579	protein-coding gene	gene with protein product		606778	"""slingshot homolog 1 (Drosophila)"""			10718198, 11832213	Standard	NM_018984		Approved	KIAA1298	uc001tnm.3	Q8WYL5	OTTHUMG00000169371	ENST00000326495.5:c.215-2A>T	chr12.hg19:g.109212091T>A		205.0	0.0	.		188.0	84.0	.	NM_018984	Q6P6C0|Q8N9A7|Q8WYL3|Q8WYL4|Q9P2P8	Splice_Site	SNP	ENST00000326495.5	hg19	CCDS9121.1	.	.	.	.	.	.	.	.	.	.	T	16.19	3.052953	0.55218	.	.	ENSG00000084112	ENST00000326495;ENST00000551165;ENST00000326470;ENST00000546697	.	.	.	5.79	5.79	0.91817	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2992	0.73933	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	SSH1	107736220	1.000000	0.71417	0.992000	0.48379	0.533000	0.34776	7.845000	0.86875	2.205000	0.71048	0.528000	0.53228	.	.	.	.	none		0.398	SSH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000403724.1	NM_018984	Intron
ERP29	10961	hgsc.bcm.edu	37	12	112457648	112457648	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr12:112457648A>C	ENST00000261735.3	+	2	383	c.233A>C	c.(232-234)gAa>gCa	p.E78A	ERP29_ENST00000455836.1_Intron|ERP29_ENST00000546477.1_5'UTR	NM_006817.3	NP_006808.1	P30040	ERP29_HUMAN	endoplasmic reticulum protein 29	78					intracellular protein transport (GO:0006886)|protein folding (GO:0006457)|protein secretion (GO:0009306)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein disulfide isomerase activity (GO:0003756)			cervix(1)|endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	5						CGTCTTGCTGAAAACTCGGCT	0.552																																					p.E78A		Atlas-SNP	.											.	ERP29	17	.	0			c.A233C						PASS	.						101.0	89.0	93.0					12																	112457648		2203	4300	6503	SO:0001583	missense	10961	exon2			TTGCTGAAAACTC	X94910	CCDS9158.1, CCDS44977.1	12q24.13	2011-10-19	2005-10-05	2005-10-05		ENSG00000089248		"""Protein disulfide isomerases"""	13799	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 9"""	602287	"""chromosome 12 open reading frame 8"""	C12orf8		9738895, 9037184	Standard	NM_006817		Approved	ERp28, ERp31, ERp29, PDI-DB, PDIA9	uc001ttk.1	P30040	OTTHUMG00000169637	ENST00000261735.3:c.233A>C	chr12.hg19:g.112457648A>C	ENSP00000261735:p.Glu78Ala	74.0	0.0	.		114.0	38.0	.	NM_006817	C9J183|Q3MJC3|Q6FHT4	Missense_Mutation	SNP	ENST00000261735.3	hg19	CCDS9158.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.449258	0.84101	.	.	ENSG00000089248	ENST00000261735	.	.	.	5.59	5.59	0.84812	ERp29, N-terminal (1);Thioredoxin-like fold (2);	0.000000	0.64402	D	0.000001	T	0.53238	0.1784	L	0.52126	1.63	0.80722	D	1	P	0.48640	0.913	B	0.42995	0.404	T	0.50906	-0.8772	9	0.18276	T	0.48	-1.0617	15.7616	0.78087	1.0:0.0:0.0:0.0	.	78	P30040	ERP29_HUMAN	A	78	.	ENSP00000261735:E78A	E	+	2	0	ERP29	110942031	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.414000	0.73318	2.118000	0.64928	0.533000	0.62120	GAA	.	.	.	none		0.552	ERP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405200.1		
SUDS3	64426	hgsc.bcm.edu	37	12	118852238	118852238	+	Nonstop_Mutation	SNP	A	A	C			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr12:118852238A>C	ENST00000543473.1	+	12	1299	c.987A>C	c.(985-987)tgA>tgC	p.*329C	SUDS3_ENST00000397564.2_Nonstop_Mutation_p.*330C	NM_022491.2	NP_071936.2	Q9H7L9	SDS3_HUMAN	suppressor of defective silencing 3 homolog (S. cerevisiae)	0					apoptotic process (GO:0006915)|histone deacetylation (GO:0016575)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|substantia nigra development (GO:0021762)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Sin3 complex (GO:0016580)	enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)			breast(1)|lung(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CAGCTGCTTGACTTTCTACAG	0.468																																					p.X329C		Atlas-SNP	.											.	SUDS3	26	.	0			c.A987C						PASS	.						24.0	23.0	23.0					12																	118852238		1860	4095	5955	SO:0001578	stop_lost	64426	exon12			TGCTTGACTTTCT	AK023801	CCDS44993.1	12q24.23	2006-02-13	2006-02-13		ENSG00000111707	ENSG00000111707			29545	protein-coding gene	gene with protein product	"""sin3A-associated protein, 45kDa"""	608250	"""suppressor of defective silencing 3 homolog (SDS3, S. cerevisiae)"""			11909966	Standard	NM_022491		Approved	SDS3, FLJ00052, SAP45	uc001twz.3	Q9H7L9	OTTHUMG00000168884	ENST00000543473.1:c.987A>C	chr12.hg19:g.118852238A>C	ENSP00000443988:p.*329Cysext*8	35.0	0.0	.		35.0	13.0	.	NM_022491	Q4KMQ5|Q8N6H0|Q9H8D2	Missense_Mutation	SNP	ENST00000543473.1	hg19	CCDS44993.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.242032	0.79912	.	.	ENSG00000111707	ENST00000543473;ENST00000397564	.	.	.	5.7	5.7	0.88788	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.638	0.76970	1.0:0.0:0.0:0.0	.	.	.	.	C	329;330	.	.	X	+	3	0	SUDS3	117336621	1.000000	0.71417	0.974000	0.42286	0.918000	0.54935	6.310000	0.72830	2.172000	0.68678	0.533000	0.62120	TGA	.	.	.	none		0.468	SUDS3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401504.1	NM_022491	
KLHL1	57626	hgsc.bcm.edu	37	13	70371015	70371015	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr13:70371015C>G	ENST00000377844.4	-	7	2253	c.1494G>C	c.(1492-1494)caG>caC	p.Q498H	KLHL1_ENST00000545028.1_Missense_Mutation_p.Q305H	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	498					actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		CCACACCAAACTGCAGCCTTC	0.388																																					p.Q498H		Atlas-SNP	.											.	KLHL1	164	.	0			c.G1494C						PASS	.						202.0	179.0	186.0					13																	70371015		2203	4300	6503	SO:0001583	missense	57626	exon7			ACCAAACTGCAGC	AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.1494G>C	chr13.hg19:g.70371015C>G	ENSP00000367075:p.Gln498His	103.0	0.0	.		146.0	58.0	.	NM_020866	A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Missense_Mutation	SNP	ENST00000377844.4	hg19	CCDS9445.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.616437	0.87359	.	.	ENSG00000150361	ENST00000377844;ENST00000545028	T;T	0.76448	-1.02;-1.02	5.45	5.45	0.79879	Galactose oxidase, beta-propeller (1);	0.000000	0.64402	D	0.000009	T	0.78253	0.4254	N	0.05031	-0.125	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.82989	-0.0183	10	0.54805	T	0.06	.	19.6558	0.95837	0.0:1.0:0.0:0.0	.	498;498	Q8TBJ7;Q9NR64	.;KLHL1_HUMAN	H	498;305	ENSP00000367075:Q498H;ENSP00000439602:Q305H	ENSP00000367075:Q498H	Q	-	3	2	KLHL1	69269016	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.939000	0.63526	2.719000	0.93026	0.655000	0.94253	CAG	.	.	.	none		0.388	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045231.3	NM_020866	
PCCA	5095	hgsc.bcm.edu	37	13	101077890	101077890	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr13:101077890G>C	ENST00000376285.1	+	20	1788	c.1750G>C	c.(1750-1752)Gaa>Caa	p.E584Q	PCCA_ENST00000376279.3_Missense_Mutation_p.E584Q|PCCA_ENST00000376286.4_Missense_Mutation_p.E558Q	NM_000282.3	NP_000273.2	P05165	PCCA_HUMAN	propionyl CoA carboxylase, alpha polypeptide	584					biotin metabolic process (GO:0006768)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|propionyl-CoA carboxylase activity (GO:0004658)			breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|prostate(1)|skin(2)	26	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)	ACAACAGGTGGAAGTTGATGG	0.458																																					p.E584Q		Atlas-SNP	.											.	PCCA	59	.	0			c.G1750C						PASS	.						160.0	133.0	142.0					13																	101077890		2203	4300	6503	SO:0001583	missense	5095	exon20			CAGGTGGAAGTTG	X14608	CCDS9496.2, CCDS45065.1, CCDS53878.1	13q32	2011-01-14	2010-04-30		ENSG00000175198	ENSG00000175198	6.4.1.3		8653	protein-coding gene	gene with protein product		232000	"""propionyl Coenzyme A carboxylase, alpha polypeptide"""			1427880	Standard	NM_000282		Approved		uc001voo.3	P05165	OTTHUMG00000017284	ENST00000376285.1:c.1750G>C	chr13.hg19:g.101077890G>C	ENSP00000365462:p.Glu584Gln	141.0	0.0	.		142.0	52.0	.	NM_001178004	B4DKY8|B4DPF9|C9JPQ8|Q15979|Q8WXQ7	Missense_Mutation	SNP	ENST00000376285.1	hg19	CCDS9496.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.1|27.1	4.798318|4.798318	0.90538|0.90538	.|.	.|.	ENSG00000175198|ENSG00000175198	ENST00000376286;ENST00000376279;ENST00000376285;ENST00000424527;ENST00000536640|ENST00000458283;ENST00000413170	T;T;T;T|.	0.78246|.	-1.16;-1.16;-1.16;-1.16|.	5.7|5.7	5.7|5.7	0.88788|0.88788	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.69984|0.69984	0.3172|0.3172	L|L	0.47716|0.47716	1.5|1.5	0.80722|0.80722	D|D	1|1	B;B;B|.	0.28933|.	0.017;0.013;0.228|.	B;B;B|.	0.40228|.	0.04;0.037;0.323|.	T|T	0.64905|0.64905	-0.6297|-0.6297	10|5	0.22109|.	T|.	0.4|.	.|.	19.8351|19.8351	0.96655|0.96655	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	584;558;584|.	C9JPQ8;P05165-2;P05165|.	.;.;PCCA_HUMAN|.	Q|A	558;584;584;118;80|36;27	ENSP00000365463:E558Q;ENSP00000365456:E584Q;ENSP00000365462:E584Q;ENSP00000396050:E118Q|.	ENSP00000365456:E584Q|.	E|G	+|+	1|2	0|0	PCCA|PCCA	99875891|99875891	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	8.621000|8.621000	0.90949|0.90949	2.693000|2.693000	0.91896|0.91896	0.650000|0.650000	0.86243|0.86243	GAA|GGA	.	.	.	none		0.458	PCCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045627.2		
ABHD13	84945	hgsc.bcm.edu	37	13	108882094	108882094	+	Silent	SNP	G	G	A			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr13:108882094G>A	ENST00000375898.3	+	2	829	c.528G>A	c.(526-528)gtG>gtA	p.V176V		NM_032859.2	NP_116248.2	Q7L211	ABHDD_HUMAN	abhydrolase domain containing 13	176						integral component of membrane (GO:0016021)|membrane (GO:0016020)	hydrolase activity (GO:0016787)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					TAGACTACGTGATGACTAGAC	0.393																																					p.V176V	Pancreas(22;506 789 38166 45896 51596)	Atlas-SNP	.											.	ABHD13	39	.	0			c.G528A						PASS	.						108.0	95.0	100.0					13																	108882094		2203	4300	6503	SO:0001819	synonymous_variant	84945	exon2			CTACGTGATGACT	AK027812	CCDS32007.1	13q33.2	2007-04-03	2006-03-10	2006-03-10	ENSG00000139826	ENSG00000139826		"""Abhydrolase domain containing"""	20293	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 6"""	C13orf6			Standard	NM_032859		Approved	bA153I24.2, FLJ14906, BEM46L1	uc001vqq.3	Q7L211	OTTHUMG00000017330	ENST00000375898.3:c.528G>A	chr13.hg19:g.108882094G>A		75.0	0.0	.		81.0	27.0	.	NM_032859	B3KWE7|Q8NBW1|Q96JX9	Silent	SNP	ENST00000375898.3	hg19	CCDS32007.1																																																																																			.	.	.	none		0.393	ABHD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045743.1	NM_032859	
BTBD6	90135	hgsc.bcm.edu	37	14	105716843	105716843	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr14:105716843C>A	ENST00000392554.3	+	4	1589	c.1292C>A	c.(1291-1293)aCg>aAg	p.T431K	BRF1_ENST00000446501.2_5'Flank|BRF1_ENST00000440513.3_Intron|BTBD6_ENST00000463376.2_Missense_Mutation_p.T356K|BTBD6_ENST00000536364.1_Missense_Mutation_p.T431K|BRF1_ENST00000327359.3_Intron|BRF1_ENST00000379937.2_Intron|BRF1_ENST00000392557.4_5'Flank|BRF1_ENST00000546474.1_Intron|BTBD6_ENST00000327471.3_Missense_Mutation_p.T356K			Q96KE9	BTBD6_HUMAN	BTB (POZ) domain containing 6	431						cytoplasm (GO:0005737)				endometrium(1)|lung(3)	4		Melanoma(154;0.226)	OV - Ovarian serous cystadenocarcinoma(23;0.0163)|Epithelial(46;0.0391)	Epithelial(152;0.18)		ACCTTCTACACGGCCAGTGCC	0.567																																					p.T431K		Atlas-SNP	.											.	BTBD6	24	.	0			c.C1292A						PASS	.						93.0	79.0	84.0					14																	105716843		2203	4300	6503	SO:0001583	missense	90135	exon5			TCTACACGGCCAG	AF353674	CCDS10002.1, CCDS10002.2	14q32.33	2013-01-08			ENSG00000184887	ENSG00000184887		"""BTB/POZ domain containing"""	19897	protein-coding gene	gene with protein product							Standard	NM_033271		Approved	BDPL	uc010tyq.2	Q96KE9	OTTHUMG00000029887	ENST00000392554.3:c.1292C>A	chr14.hg19:g.105716843C>A	ENSP00000376337:p.Thr431Lys	57.0	0.0	.		78.0	12.0	.	NM_033271	Q8IVQ7|Q9BR94	Missense_Mutation	SNP	ENST00000392554.3	hg19	CCDS10002.2	.	.	.	.	.	.	.	.	.	.	C	18.65	3.670003	0.67814	.	.	ENSG00000184887	ENST00000536364;ENST00000392554;ENST00000327471	T;T;T	0.76186	-1.0;-1.0;-0.86	5.16	4.19	0.49359	PHR (1);	0.117488	0.56097	D	0.000021	D	0.86188	0.5873	M	0.88450	2.955	0.58432	D	0.999994	D	0.69078	0.997	D	0.67231	0.95	D	0.87972	0.2737	9	.	.	.	-21.705	11.8691	0.52511	0.2103:0.7897:0.0:0.0	.	431	Q96KE9	BTBD6_HUMAN	K	431;431;356	ENSP00000443091:T431K;ENSP00000376337:T431K;ENSP00000329361:T356K	.	T	+	2	0	BTBD6	104787888	0.998000	0.40836	0.953000	0.39169	0.765000	0.43378	3.980000	0.56895	2.392000	0.81423	0.655000	0.94253	ACG	.	.	.	none		0.567	BTBD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000074556.4		
VPS18	57617	hgsc.bcm.edu	37	15	41191884	41191884	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr15:41191884G>A	ENST00000220509.5	+	4	1207	c.868G>A	c.(868-870)Gat>Aat	p.D290N	VPS18_ENST00000558474.1_Intron	NM_020857.2	NP_065908.1	Q9P253	VPS18_HUMAN	vacuolar protein sorting 18 homolog (S. cerevisiae)	290					endosome organization (GO:0007032)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|vesicle-mediated transport (GO:0016192)|viral entry into host cell (GO:0046718)	actin filament (GO:0005884)|early endosome (GO:0005769)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	metal ion binding (GO:0046872)			autonomic_ganglia(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	28		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.07e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.164)		GATGATGGGGGATGGTGTGTT	0.642																																					p.D290N		Atlas-SNP	.											.	VPS18	67	.	0			c.G868A						PASS	.						68.0	67.0	67.0					15																	41191884		2203	4300	6503	SO:0001583	missense	57617	exon4			ATGGGGGATGGTG	AF308802	CCDS10069.1	15q14-q15	2006-12-19	2006-12-19		ENSG00000104142	ENSG00000104142			15972	protein-coding gene	gene with protein product		608551	"""vacuolar protein sorting protein 18"""			11250079, 16203730	Standard	NM_020857		Approved	KIAA1475, PEP3	uc001zne.3	Q9P253	OTTHUMG00000130135	ENST00000220509.5:c.868G>A	chr15.hg19:g.41191884G>A	ENSP00000220509:p.Asp290Asn	48.0	0.0	.		26.0	17.0	.	NM_020857	Q8TCG0|Q96DI3|Q9H268	Missense_Mutation	SNP	ENST00000220509.5	hg19	CCDS10069.1	.	.	.	.	.	.	.	.	.	.	G	4.362	0.066694	0.08388	.	.	ENSG00000104142	ENST00000220509	T	0.41400	1.0	4.81	4.81	0.61882	.	0.045890	0.85682	D	0.000000	T	0.11410	0.0278	N	0.00677	-1.265	0.80722	D	1	B	0.09022	0.002	B	0.08055	0.003	T	0.28586	-1.0039	10	0.10902	T	0.67	-29.5425	5.9914	0.19465	0.2254:0.0:0.7746:0.0	.	290	Q9P253	VPS18_HUMAN	N	290	ENSP00000220509:D290N	ENSP00000220509:D290N	D	+	1	0	VPS18	38979176	1.000000	0.71417	0.941000	0.38009	0.986000	0.74619	6.007000	0.70731	2.646000	0.89796	0.655000	0.94253	GAT	.	.	.	none		0.642	VPS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252443.2		
CEP152	22995	hgsc.bcm.edu	37	15	49089695	49089695	+	Silent	SNP	G	G	T			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr15:49089695G>T	ENST00000380950.2	-	5	530	c.343C>A	c.(343-345)Cga>Aga	p.R115R	CEP152_ENST00000325747.5_Intron|CEP152_ENST00000399334.3_Silent_p.R115R	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	115					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		ACAGGATGTCGGTCTTCAGTT	0.378																																					p.R115R		Atlas-SNP	.											.	CEP152	145	.	0			c.C343A						PASS	.						108.0	97.0	100.0					15																	49089695		1868	4103	5971	SO:0001819	synonymous_variant	22995	exon5			GATGTCGGTCTTC	AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.343C>A	chr15.hg19:g.49089695G>T		139.0	0.0	.		125.0	50.0	.	NM_014985	E7ER66|Q17RV1|Q6NTA0	Silent	SNP	ENST00000380950.2	hg19	CCDS58361.1																																																																																			.	.	.	none		0.378	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417365.1	NM_014985	
HERC1	8925	hgsc.bcm.edu	37	15	63991178	63991178	+	Silent	SNP	A	A	G			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr15:63991178A>G	ENST00000443617.2	-	26	4741	c.4654T>C	c.(4654-4656)Ttg>Ctg	p.L1552L	RP11-317G6.1_ENST00000559303.2_RNA	NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	1552					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						AGGGATTCCAATTGACTGTGC	0.408																																					p.L1552L		Atlas-SNP	.											.	HERC1	624	.	0			c.T4654C						PASS	.						168.0	164.0	165.0					15																	63991178		1907	4120	6027	SO:0001819	synonymous_variant	8925	exon26			ATTCCAATTGACT	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.4654T>C	chr15.hg19:g.63991178A>G		141.0	0.0	.		133.0	57.0	.	NM_003922	Q8IW65	Silent	SNP	ENST00000443617.2	hg19	CCDS45277.1																																																																																			.	.	.	none		0.408	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922	
CIB1	10519	hgsc.bcm.edu	37	15	90774633	90774633	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr15:90774633G>T	ENST00000328649.6	-	4	463	c.302C>A	c.(301-303)aCa>aAa	p.T101K	GDPGP1_ENST00000558017.1_5'Flank	NM_006384.3	NP_006375.2	Q99828	CIB1_HUMAN	calcium and integrin binding 1 (calmyrin)	101					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cell division (GO:0051301)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to growth factor stimulus (GO:0071363)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to tumor necrosis factor (GO:0071356)|cytoplasmic microtubule organization (GO:0031122)|double-strand break repair (GO:0006302)|endomitotic cell cycle (GO:0007113)|extrinsic apoptotic signaling pathway (GO:0097191)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of megakaryocyte differentiation (GO:0045653)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of neuron projection development (GO:0010977)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|platelet formation (GO:0030220)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of gene expression involved in extracellular matrix organization (GO:1901313)|positive regulation of male germ cell proliferation (GO:2000256)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of cell division (GO:0051302)|regulation of cell proliferation (GO:0042127)|response to ischemia (GO:0002931)|spermatid development (GO:0007286)|thrombopoietin-mediated signaling pathway (GO:0038163)	cell periphery (GO:0071944)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|protein anchor (GO:0043495)|Ras GTPase binding (GO:0017016)			lung(1)|prostate(1)	2	Melanoma(11;0.00551)|Lung NSC(78;0.0141)|all_lung(78;0.0303)		BRCA - Breast invasive adenocarcinoma(143;0.00269)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.217)			TGGCGTGGCTGTGTCACTGAA	0.567																																					p.T101K		Atlas-SNP	.											.	CIB1	8	.	0			c.C302A						PASS	.						113.0	92.0	99.0					15																	90774633		2199	4298	6497	SO:0001583	missense	10519	exon4			GTGGCTGTGTCAC	U82226	CCDS10360.1, CCDS73781.1	15q25.3-q26	2013-01-10			ENSG00000185043	ENSG00000185043		"""EF-hand domain containing"""	16920	protein-coding gene	gene with protein product		602293				9030514, 10826701	Standard	NM_006384		Approved	SIP2-28, CALMYRIN, CIB, KIP	uc031qtq.1	Q99828	OTTHUMG00000149808	ENST00000328649.6:c.302C>A	chr15.hg19:g.90774633G>T	ENSP00000333873:p.Thr101Lys	103.0	0.0	.		111.0	41.0	.	NM_006384	B5BU40|H6WJF3|O00693|O00735|Q6IB49|Q96J54|Q99971	Missense_Mutation	SNP	ENST00000328649.6	hg19	CCDS10360.1	.	.	.	.	.	.	.	.	.	.	G	13.82	2.352680	0.41700	.	.	ENSG00000185043	ENST00000328649	T	0.08807	3.05	4.35	4.35	0.52113	EF-hand-like domain (1);	0.119263	0.64402	D	0.000017	T	0.04679	0.0127	N	0.04746	-0.17	0.43803	D	0.996356	B	0.20459	0.045	B	0.20384	0.029	T	0.42464	-0.9450	10	0.11794	T	0.64	-0.1605	16.0477	0.80731	0.0:0.0:1.0:0.0	.	101	Q99828	CIB1_HUMAN	K	101	ENSP00000333873:T101K	ENSP00000333873:T101K	T	-	2	0	CIB1	88575637	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	7.143000	0.77348	2.254000	0.74563	0.563000	0.77884	ACA	.	.	.	none		0.567	CIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313419.1		
ABCC6	368	hgsc.bcm.edu	37	16	16244452	16244452	+	Silent	SNP	G	G	C			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr16:16244452G>C	ENST00000205557.7	-	30	4415	c.4386C>G	c.(4384-4386)tcC>tcG	p.S1462S		NM_001171.5	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 6	1462	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|skin(6)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)	Cisplatin(DB00515)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Etoposide(DB00773)|Indomethacin(DB00328)|Probenecid(DB01032)|Sulfinpyrazone(DB01138)|Teniposide(DB00444)|Vinblastine(DB00570)	AGTCCATCACGGAGCGCAGGC	0.687																																					p.S1462S		Atlas-SNP	.											.	ABCC6	110	.	0			c.C4386G						PASS	.						38.0	31.0	33.0					16																	16244452		2197	4298	6495	SO:0001819	synonymous_variant	368	exon30			CATCACGGAGCGC	AF076622	CCDS10568.1, CCDS58430.1	16p13.11	2013-01-08			ENSG00000091262	ENSG00000091262		"""ATP binding cassette transporters / subfamily C"""	57	protein-coding gene	gene with protein product		603234	"""pseudoxanthoma elasticum"""	ARA, PXE		9721217, 11439001	Standard	NM_001079528		Approved	MRP6, EST349056, MLP1, URG7	uc002den.4	O95255	OTTHUMG00000129967	ENST00000205557.7:c.4386C>G	chr16.hg19:g.16244452G>C		104.0	0.0	.		164.0	62.0	.	NM_001171	A2RRN8|A8KIG6|A8Y988|E7ESW8|P78420|Q8TCY8|Q9UMZ7	Silent	SNP	ENST00000205557.7	hg19	CCDS10568.1																																																																																			.	.	.	none		0.687	ABCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252232.2		
FHOD1	29109	hgsc.bcm.edu	37	16	67264360	67264360	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr16:67264360C>T	ENST00000258201.4	-	19	3155	c.2908G>A	c.(2908-2910)Gaa>Aaa	p.E970K		NM_013241.2	NP_037373.2	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	970	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			breast(4)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	34		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		ATGCGCACTTCACGGGCCGCC	0.592																																					p.E970K		Atlas-SNP	.											.	FHOD1	86	.	0			c.G2908A						PASS	.						85.0	84.0	84.0					16																	67264360		2198	4300	6498	SO:0001583	missense	29109	exon19			GCACTTCACGGGC	AF113615	CCDS10834.1	16q22	2008-02-22			ENSG00000135723	ENSG00000135723			17905	protein-coding gene	gene with protein product		606881				10352228, 16112087	Standard	NM_013241		Approved	FHOS	uc002esl.3	Q9Y613	OTTHUMG00000137521	ENST00000258201.4:c.2908G>A	chr16.hg19:g.67264360C>T	ENSP00000258201:p.Glu970Lys	91.0	0.0	.		217.0	32.0	.	NM_013241	Q59F76|Q6Y1F2|Q76MS8|Q8N521	Missense_Mutation	SNP	ENST00000258201.4	hg19	CCDS10834.1	.	.	.	.	.	.	.	.	.	.	C	15.81	2.943253	0.53079	.	.	ENSG00000135723	ENST00000258201	T	0.17854	2.25	5.76	5.76	0.90799	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.097634	0.64402	D	0.000002	T	0.22475	0.0542	L	0.35644	1.08	0.58432	D	0.999997	B	0.24963	0.115	B	0.37989	0.262	T	0.03922	-1.0992	10	0.35671	T	0.21	.	18.5254	0.90969	0.0:1.0:0.0:0.0	.	970	Q9Y613	FHOD1_HUMAN	K	970	ENSP00000258201:E970K	ENSP00000258201:E970K	E	-	1	0	FHOD1	65821861	1.000000	0.71417	0.305000	0.25099	0.164000	0.22412	7.609000	0.82925	2.724000	0.93272	0.561000	0.74099	GAA	.	.	.	none		0.592	FHOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268844.2		
CENPT	80152	hgsc.bcm.edu	37	16	67862427	67862427	+	Silent	SNP	A	A	G			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr16:67862427A>G	ENST00000562787.1	-	15	2060	c.1512T>C	c.(1510-1512)caT>caC	p.H504H	CENPT_ENST00000562947.1_5'Flank|CENPT_ENST00000564817.1_Silent_p.H449H|CENPT_ENST00000440851.2_Silent_p.H504H|CENPT_ENST00000219172.3_Silent_p.H504H	NM_025082.3	NP_079358.3	Q96BT3	CENPT_HUMAN	centromere protein T	504					chromosome organization (GO:0051276)|chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|lung(6)|urinary_tract(1)	10		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00429)|Epithelial(162;0.019)|all cancers(182;0.124)		TGCGGCCAGCATGAGCAGCAA	0.542																																					p.H504H		Atlas-SNP	.											.	CENPT	26	.	0			c.T1512C						PASS	.						121.0	130.0	127.0					16																	67862427		2055	4208	6263	SO:0001819	synonymous_variant	80152	exon15			GCCAGCATGAGCA	AK056097	CCDS42182.1	16q22.1	2013-11-05	2006-06-15	2006-06-15		ENSG00000102901			25787	protein-coding gene	gene with protein product		611510	"""chromosome 16 open reading frame 56"""	C16orf56		16622420, 16622419	Standard	NM_025082		Approved	FLJ13111, CENP-T	uc002eun.4	Q96BT3		ENST00000562787.1:c.1512T>C	chr16.hg19:g.67862427A>G		76.0	0.0	.		200.0	36.0	.	NM_025082	Q96I29|Q96IC6|Q96NK9|Q9H901	Silent	SNP	ENST00000562787.1	hg19	CCDS42182.1	.	.	.	.	.	.	.	.	.	.	A	7.927	0.739794	0.15642	.	.	ENSG00000102901	ENST00000436104	.	.	.	5.67	1.04	0.20106	.	.	.	.	.	T	0.46210	0.1381	.	.	.	0.80722	D	1	B	0.19583	0.037	B	0.18561	0.022	T	0.38178	-0.9673	7	0.87932	D	0	-4.3691	8.2039	0.31441	0.7038:0.0:0.2962:0.0	.	256	F5H5A6	.	T	256	.	ENSP00000404857:M256T	M	-	2	0	CENPT	66419928	0.999000	0.42202	1.000000	0.80357	0.864000	0.49448	0.466000	0.22019	0.113000	0.18004	0.459000	0.35465	ATG	.	.	.	none		0.542	CENPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422020.1	NM_025082	
GEMIN4	50628	hgsc.bcm.edu	37	17	649755	649755	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr17:649755C>T	ENST00000319004.5	-	2	1646	c.1528G>A	c.(1528-1530)Ggc>Agc	p.G510S	GEMIN4_ENST00000576778.1_Missense_Mutation_p.G499S	NM_015721.2	NP_056536.2	P57678	GEMI4_HUMAN	gem (nuclear organelle) associated protein 4	510					gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)				breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(4)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(207;0.204)		UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		TCAGAGAGGCCCTTTCGCCCC	0.527																																					p.G510S		Atlas-SNP	.											.	GEMIN4	116	.	0			c.G1528A						PASS	.						41.0	43.0	42.0					17																	649755		1929	4135	6064	SO:0001583	missense	50628	exon2			AGAGGCCCTTTCG	AF177341	CCDS45559.1	17p13.3	2008-07-18				ENSG00000179409			15717	protein-coding gene	gene with protein product	"""HCC-associated protein 1"", ""component of gems 4"""	606969				10725331	Standard	NM_015721		Approved	HHRF-1, DKFZP434B131, p97, DKFZP434D174, HC56, HCAP1	uc002frs.1	P57678		ENST00000319004.5:c.1528G>A	chr17.hg19:g.649755C>T	ENSP00000321706:p.Gly510Ser	119.0	0.0	.		122.0	34.0	.	NM_015721	Q9NZS7|Q9UG32|Q9Y4Q2	Missense_Mutation	SNP	ENST00000319004.5	hg19	CCDS45559.1	.	.	.	.	.	.	.	.	.	.	C	17.03	3.284219	0.59867	.	.	ENSG00000179409	ENST00000319004	T	0.14893	2.47	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.43389	0.1245	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.22173	-1.0224	10	0.87932	D	0	-19.9739	18.8377	0.92169	0.0:1.0:0.0:0.0	.	510	P57678	GEMI4_HUMAN	S	510	ENSP00000321706:G510S	ENSP00000321706:G510S	G	-	1	0	GEMIN4	596505	1.000000	0.71417	0.999000	0.59377	0.093000	0.18481	7.423000	0.80229	2.779000	0.95612	0.591000	0.81541	GGC	.	.	.	none		0.527	GEMIN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437181.1	NM_015721	
SCO1	6341	hgsc.bcm.edu	37	17	10596136	10596136	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr17:10596136G>C	ENST00000255390.5	-	3	567	c.507C>G	c.(505-507)tgC>tgG	p.C169W	SCO1_ENST00000582053.1_5'Flank|SCO1_ENST00000577427.1_Intron	NM_004589.2	NP_004580.1	O75880	SCO1_HUMAN	SCO1 cytochrome c oxidase assembly protein	169					cellular copper ion homeostasis (GO:0006878)|copper ion transport (GO:0006825)|generation of precursor metabolites and energy (GO:0006091)|respiratory chain complex IV assembly (GO:0008535)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|myofibril (GO:0030016)	copper ion binding (GO:0005507)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|urinary_tract(1)	10						AGACATCAGGGCAATGAGTGA	0.403																																					p.C169W	Melanoma(128;591 1731 19711 31891 44645)	Atlas-SNP	.											.	SCO1	24	.	0			c.C507G						PASS	.						131.0	116.0	121.0					17																	10596136		2203	4300	6503	SO:0001583	missense	6341	exon3			ATCAGGGCAATGA	AF026852	CCDS11158.1	17p13.1	2012-10-15	2012-10-15		ENSG00000133028	ENSG00000133028		"""Mitochondrial respiratory chain complex assembly factors"""	10603	protein-coding gene	gene with protein product		603644	"""SCO (cytochrome oxidase deficient, yeast) homolog 1"", ""SCO cytochrome oxidase deficient homolog 1 (yeast)"""	SCOD1		9878253	Standard	NM_004589		Approved		uc002gmr.4	O75880	OTTHUMG00000130364	ENST00000255390.5:c.507C>G	chr17.hg19:g.10596136G>C	ENSP00000255390:p.Cys169Trp	62.0	0.0	.		82.0	30.0	.	NM_004589	B2RDM0	Missense_Mutation	SNP	ENST00000255390.5	hg19	CCDS11158.1	.	.	.	.	.	.	.	.	.	.	G	17.69	3.451580	0.63290	.	.	ENSG00000133028	ENST00000255390	D	0.94497	-3.44	6.08	1.4	0.22301	Thioredoxin-like fold (2);	0.000000	0.85682	D	0.000000	D	0.98121	0.9380	H	0.98802	4.335	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97288	0.9922	10	0.87932	D	0	-14.6714	10.5038	0.44821	0.4036:0.0:0.5964:0.0	.	169	O75880	SCO1_HUMAN	W	169	ENSP00000255390:C169W	ENSP00000255390:C169W	C	-	3	2	SCO1	10536861	0.995000	0.38212	1.000000	0.80357	0.997000	0.91878	0.367000	0.20382	0.466000	0.27193	0.591000	0.81541	TGC	.	.	.	none		0.403	SCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252729.2	NM_004589	
KRTAP4-5	85289	hgsc.bcm.edu	37	17	39305774	39305775	+	Missense_Mutation	DNP	CT	CT	GC	rs137947981|rs535144703|rs141265645|rs58117746	byFrequency	TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	C|T	C|T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr17:39305774_39305775CT>GC	ENST00000343246.4	-	1	279_280	c.245_246AG>GC	c.(244-246)cAG>cGC	p.Q82R		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	82	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.Q82H(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			agcaggtggtctggcagcagca	0.653																																					p.Q82H|p.Q82R		Atlas-SNP	.											KRTAP4-5,NS,carcinoma,0,1|KRTAP4-5,NS,carcinoma,+1,1	KRTAP4-5	34	.	1	Substitution - Missense(1)	lung(1)	c.G246C|c.A245G						PASS	.																																			SO:0001583	missense	85289	exon1			GGTGGTCTGGCAG|GTGGTCTGGCAGC	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.245_246delinsGC	chr17.hg19:g.39305774_39305775delinsGC	ENSP00000340546:p.Gln82Arg	34.0	2.0	.		57.0|56.0	36.0	.	NM_033188		Missense_Mutation	SNP	ENST00000343246.4	hg19	CCDS32650.1																																																																																			.	.	.	weak		0.653	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257783.1		
KRT9	3857	hgsc.bcm.edu	37	17	39723874	39723874	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr17:39723874C>G	ENST00000246662.4	-	7	1588	c.1523G>C	c.(1522-1524)gGa>gCa	p.G508A	KRT9_ENST00000588431.1_Missense_Mutation_p.G275A	NM_000226.3	NP_000217.2	P35527	K1C9_HUMAN	keratin 9	508	Tail.				epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		Breast(137;0.000307)				cccacttcctccaccatagcc	0.597																																					p.G508A		Atlas-SNP	.											.	KRT9	78	.	0			c.G1523C						PASS	.						195.0	129.0	151.0					17																	39723874		2200	4294	6494	SO:0001583	missense	3857	exon7			CTTCCTCCACCAT		CCDS32654.1	17q21.2	2013-06-20	2008-08-01		ENSG00000171403	ENSG00000171403		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6447	protein-coding gene	gene with protein product	"""cytokeratin 9"", ""type I cytoskeletal 9"", ""epidermolytic palmoplantar keratoderma"""	607606				7512862, 16831889	Standard	NM_000226		Approved	EPPK, K9, CK-9	uc002hxe.4	P35527	OTTHUMG00000133599	ENST00000246662.4:c.1523G>C	chr17.hg19:g.39723874C>G	ENSP00000246662:p.Gly508Ala	93.0	0.0	.		116.0	49.0	.	NM_000226	O00109|Q0IJ47|Q14665	Missense_Mutation	SNP	ENST00000246662.4	hg19	CCDS32654.1	.	.	.	.	.	.	.	.	.	.	C	8.973	0.973413	0.18736	.	.	ENSG00000171403	ENST00000246662	D	0.96554	-4.05	3.1	2.11	0.27256	.	0.270585	0.19745	N	0.107025	D	0.91229	0.7236	N	0.24115	0.695	0.26842	N	0.96836	D	0.56035	0.974	P	0.49252	0.604	D	0.85008	0.0904	10	0.07482	T	0.82	.	6.2431	0.20801	0.0:0.8527:0.0:0.1473	.	508	P35527	K1C9_HUMAN	A	508	ENSP00000246662:G508A	ENSP00000246662:G508A	G	-	2	0	KRT9	36977400	0.090000	0.21635	0.757000	0.31301	0.407000	0.30961	1.505000	0.35736	0.531000	0.28639	0.458000	0.33432	GGA	.	.	.	none		0.597	KRT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257707.1	NM_000226	
NT5C3B	115024	hgsc.bcm.edu	37	17	39981892	39981892	+	Silent	SNP	C	C	T			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr17:39981892C>T	ENST00000435506.2	-	9	855	c.786G>A	c.(784-786)gaG>gaA	p.E262E	NT5C3B_ENST00000269534.8_Silent_p.E254E|NT5C3B_ENST00000521789.1_Silent_p.E162E			Q969T7	5NT3B_HUMAN	5'-nucleotidase, cytosolic IIIB	262					nucleotide metabolic process (GO:0009117)	cytoplasm (GO:0005737)	5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)										CCATGTAGCGCTCCCGCCGCT	0.632																																					p.E262E		Atlas-SNP	.											.	.	.	.	0			c.G786A						PASS	.						88.0	89.0	88.0					17																	39981892		2203	4300	6503	SO:0001819	synonymous_variant	115024	exon9			GTAGCGCTCCCGC		CCDS11410.1, CCDS11410.2	17q21.2	2013-01-31	2013-01-31	2013-01-31	ENSG00000141698	ENSG00000141698	3.1.3.5		28300	protein-coding gene	gene with protein product			"""5'-nucleotidase, cytosolic III-like"""	NT5C3L		23223233	Standard	NM_052935		Approved	MGC20781	uc021txo.1	Q969T7	OTTHUMG00000133499	ENST00000435506.2:c.786G>A	chr17.hg19:g.39981892C>T		67.0	0.0	.		94.0	43.0	.	NM_052935	A8MWB9|C9JKC4|Q7L3B7	Silent	SNP	ENST00000435506.2	hg19	CCDS11410.2																																																																																			.	.	.	none		0.632	NT5C3B-008	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257430.2	NM_052935	
ITGA2B	3674	hgsc.bcm.edu	37	17	42457409	42457409	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr17:42457409C>A	ENST00000262407.5	-	17	1744	c.1713G>T	c.(1711-1713)aaG>aaT	p.K571N	ITGA2B_ENST00000353281.4_Missense_Mutation_p.K571N	NM_000419.3	NP_000410.2	P08514	ITA2B_HUMAN	integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)	571					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)	extracellular matrix binding (GO:0050840)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			biliary_tract(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.191)	Abciximab(DB00054)|Tirofiban(DB00775)	TGGGGCTGTGCTTTCCGCCCA	0.647																																					p.K571N		Atlas-SNP	.											.	ITGA2B	88	.	0			c.G1713T						PASS	.						46.0	47.0	47.0					17																	42457409		2201	4296	6497	SO:0001583	missense	3674	exon17			GCTGTGCTTTCCG		CCDS32665.1	17q21.32	2014-09-17	2006-02-22			ENSG00000005961		"""CD molecules"", ""Integrins"""	6138	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 93"""	607759	"""integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41B)"""	GP2B			Standard	NM_000419		Approved	CD41B, CD41, PPP1R93	uc002igt.1	P08514		ENST00000262407.5:c.1713G>T	chr17.hg19:g.42457409C>A	ENSP00000262407:p.Lys571Asn	67.0	0.0	.		90.0	37.0	.	NM_000419	B2RCY8|O95366|Q14443|Q17R67	Missense_Mutation	SNP	ENST00000262407.5	hg19	CCDS32665.1	.	.	.	.	.	.	.	.	.	.	C	7.724	0.697783	0.15106	.	.	ENSG00000005961	ENST00000262407;ENST00000353281	T;T	0.48522	0.81;0.81	4.69	0.243	0.15503	Integrin alpha-2 (1);	0.641780	0.12817	N	0.436713	T	0.18130	0.0435	N	0.02539	-0.55	0.09310	N	1	B;B	0.18863	0.031;0.015	B;B	0.18561	0.008;0.022	T	0.17899	-1.0354	10	0.30078	T	0.28	.	4.1669	0.10310	0.1606:0.5581:0.0:0.2812	.	169;571	Q59FA8;P08514	.;ITA2B_HUMAN	N	571	ENSP00000262407:K571N;ENSP00000340536:K571N	ENSP00000262407:K571N	K	-	3	2	ITGA2B	39812935	0.000000	0.05858	0.000000	0.03702	0.059000	0.15707	0.024000	0.13555	0.180000	0.19960	0.561000	0.74099	AAG	.	.	.	none		0.647	ITGA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439823.1		
SCRN2	90507	hgsc.bcm.edu	37	17	45916949	45916949	+	Silent	SNP	C	C	A			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr17:45916949C>A	ENST00000290216.9	-	4	542	c.417G>T	c.(415-417)ctG>ctT	p.L139L	SCRN2_ENST00000584123.1_Silent_p.L147L|SCRN2_ENST00000407215.3_Silent_p.L139L	NM_001145023.1|NM_138355.3	NP_001138495.1|NP_612364.2	Q96FV2	SCRN2_HUMAN	secernin 2	139						extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)			cervix(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	14						CATAGTGCTCCAGTAACCCTG	0.612																																					p.L139L		Atlas-SNP	.											.	SCRN2	35	.	0			c.G417T						PASS	.						135.0	130.0	132.0					17																	45916949		2203	4300	6503	SO:0001819	synonymous_variant	90507	exon4			GTGCTCCAGTAAC	BC002980	CCDS11519.1, CCDS45723.1	17q21	2008-02-05							30381	protein-coding gene	gene with protein product		614966				12221138	Standard	NM_001145023		Approved		uc002imd.3	Q96FV2		ENST00000290216.9:c.417G>T	chr17.hg19:g.45916949C>A		101.0	0.0	.		117.0	33.0	.	NM_138355	A8K3N1|B7Z8S7|E9PBV5|Q96AC3|Q9BU04	Silent	SNP	ENST00000290216.9	hg19	CCDS11519.1																																																																																			.	.	.	none		0.612	SCRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441383.1	NM_138355	
KAT7	11143	hgsc.bcm.edu	37	17	47888871	47888871	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr17:47888871A>C	ENST00000259021.4	+	7	1067	c.787A>C	c.(787-789)Aaa>Caa	p.K263Q	KAT7_ENST00000503935.2_Missense_Mutation_p.K107Q|KAT7_ENST00000424009.2_Missense_Mutation_p.K233Q|KAT7_ENST00000509773.1_Missense_Mutation_p.K153Q|KAT7_ENST00000510819.1_Missense_Mutation_p.K94Q|KAT7_ENST00000454930.2_Missense_Mutation_p.K124Q|KAT7_ENST00000435742.2_Missense_Mutation_p.K77Q	NM_007067.4	NP_008998.1	O95251	KAT7_HUMAN	K(lysine) acetyltransferase 7	263					chromatin organization (GO:0006325)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										ATATAAGGAAAAAGTGGCTGA	0.368																																					p.K263Q		Atlas-SNP	.											.	.	.	.	0			c.A787C						PASS	.						53.0	56.0	55.0					17																	47888871		2203	4300	6503	SO:0001583	missense	11143	exon7			AAGGAAAAAGTGG	AF074606	CCDS11554.1, CCDS56035.1, CCDS56036.1, CCDS56037.1, CCDS56038.1	17q21.32	2013-01-10	2011-07-21	2011-07-21	ENSG00000136504	ENSG00000136504	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	17016	protein-coding gene	gene with protein product	"""histone acetyltransferase binding to ORC1"""	609880	"""MYST histone acetyltransferase 2"""	MYST2		10438470, 10930412	Standard	NM_001199155		Approved	HBOA, HBO1, ZC2HC7	uc002ipm.3	O95251	OTTHUMG00000161770	ENST00000259021.4:c.787A>C	chr17.hg19:g.47888871A>C	ENSP00000259021:p.Lys263Gln	480.0	0.0	.		515.0	225.0	.	NM_007067	B3KN74|B4DF85|B4DFB4|B4DFE0|B4DGY4|E7ER15|G5E9K7	Missense_Mutation	SNP	ENST00000259021.4	hg19	CCDS11554.1	.	.	.	.	.	.	.	.	.	.	A	13.35	2.210633	0.39102	.	.	ENSG00000136504	ENST00000259021;ENST00000454930;ENST00000509773;ENST00000510819;ENST00000424009;ENST00000503935;ENST00000435742	.	.	.	5.65	5.65	0.86999	.	0.097322	0.64402	D	0.000002	T	0.57475	0.2056	L	0.47716	1.5	0.58432	D	0.999991	B;B;B;B;B;B	0.20052	0.024;0.006;0.024;0.007;0.031;0.041	B;B;B;B;B;B	0.17433	0.005;0.002;0.003;0.007;0.007;0.018	T	0.54583	-0.8272	9	0.48119	T	0.1	-20.7432	15.6986	0.77521	1.0:0.0:0.0:0.0	.	226;94;153;124;263;233	B4DGY4;B4DFE0;B4DFB4;E7ER15;O95251;G5E9K7	.;.;.;.;KAT7_HUMAN;.	Q	263;124;153;94;233;107;77	.	ENSP00000259021:K263Q	K	+	1	0	KAT7	45243870	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	5.394000	0.66285	2.371000	0.80710	0.533000	0.62120	AAA	.	.	.	none		0.368	KAT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366032.1	NM_007067	
ST8SIA5	29906	hgsc.bcm.edu	37	18	44260388	44260388	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr18:44260388A>C	ENST00000315087.7	-	7	1408	c.748T>G	c.(748-750)Tac>Gac	p.Y250D	ST8SIA5_ENST00000590497.1_5'UTR|ST8SIA5_ENST00000538168.1_Missense_Mutation_p.Y286D|ST8SIA5_ENST00000536490.1_Missense_Mutation_p.Y219D	NM_013305.4	NP_037437.2	O15466	SIA8E_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5	250					carbohydrate metabolic process (GO:0005975)|glycosphingolipid biosynthetic process (GO:0006688)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialyltransferase activity (GO:0008373)			kidney(1)|large_intestine(10)|lung(7)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	22						CGCGTGTTGTAGAAGGCAGGC	0.602																																					p.Y250D		Atlas-SNP	.											.	ST8SIA5	57	.	0			c.T748G						PASS	.						89.0	51.0	64.0					18																	44260388		2203	4300	6503	SO:0001583	missense	29906	exon7			TGTTGTAGAAGGC	U91641	CCDS11930.1	18q12.3	2013-03-01	2003-01-14	2005-02-07	ENSG00000101638	ENSG00000101638		"""Sialyltransferases"""	17827	protein-coding gene	gene with protein product	"""ST8Sia V"""	607162	"""sialyltransferase 8E (alpha-2, 8-polysialytransferase)"""	SIAT8E		9199191	Standard	XM_005258250		Approved		uc002lcj.1	O15466	OTTHUMG00000132643	ENST00000315087.7:c.748T>G	chr18.hg19:g.44260388A>C	ENSP00000321343:p.Tyr250Asp	65.0	0.0	.		96.0	51.0	.	NM_013305	B7Z1K9|Q6IAW7	Missense_Mutation	SNP	ENST00000315087.7	hg19	CCDS11930.1	.	.	.	.	.	.	.	.	.	.	A	24.2	4.508290	0.85282	.	.	ENSG00000101638	ENST00000315087;ENST00000538168;ENST00000536490	T;T;T	0.32023	1.47;1.47;1.47	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.46795	0.1411	L	0.41415	1.275	0.80722	D	1	D;B;D	0.89917	1.0;0.15;1.0	D;B;D	0.87578	0.998;0.246;0.995	T	0.31392	-0.9945	10	0.36615	T	0.2	-9.7928	15.6254	0.76851	1.0:0.0:0.0:0.0	.	219;286;250	F5H8D1;B7Z1K9;O15466	.;.;SIA8E_HUMAN	D	250;286;219	ENSP00000321343:Y250D;ENSP00000445492:Y286D;ENSP00000443683:Y219D	ENSP00000321343:Y250D	Y	-	1	0	ST8SIA5	42514386	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.339000	0.96797	2.090000	0.63153	0.459000	0.35465	TAC	.	.	.	none		0.602	ST8SIA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255892.1	NM_013305	
ZNF844	284391	hgsc.bcm.edu	37	19	12187708	12187708	+	Silent	SNP	G	G	C			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr19:12187708G>C	ENST00000439326.3	+	4	1948	c.1773G>C	c.(1771-1773)gtG>gtC	p.V591V	ZNF844_ENST00000441304.2_3'UTR	NM_001136501.1	NP_001129973.1	Q08AG5	ZN844_HUMAN	zinc finger protein 844	591					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(1)|prostate(1)	10						TAAAGAGTGTGACAAAGCATT	0.393																																					p.V591V		Atlas-SNP	.											.	ZNF844	69	.	0			c.G1773C						PASS	.						122.0	108.0	112.0					19																	12187708		692	1591	2283	SO:0001819	synonymous_variant	284391	exon4			GAGTGTGACAAAG	AL832297	CCDS45985.1	19p13.2	2013-01-08			ENSG00000223547	ENSG00000223547		"""Zinc fingers, C2H2-type"", ""-"""	25932	protein-coding gene	gene with protein product							Standard	NM_001136501		Approved	FLJ14959	uc002mtb.2	Q08AG5	OTTHUMG00000156405	ENST00000439326.3:c.1773G>C	chr19.hg19:g.12187708G>C		137.0	0.0	.		155.0	55.0	.	NM_001136501	Q5JPI8	Silent	SNP	ENST00000439326.3	hg19	CCDS45985.1																																																																																			.	.	.	none		0.393	ZNF844-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344086.2		
PARD6B	84612	hgsc.bcm.edu	37	20	49354467	49354467	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr20:49354467T>C	ENST00000371610.2	+	2	383	c.140T>C	c.(139-141)cTa>cCa	p.L47P	PARD6B_ENST00000396039.1_Missense_Mutation_p.L47P	NM_032521.2	NP_115910.1	Q9BYG5	PAR6B_HUMAN	par-6 family cell polarity regulator beta	47	OPR.				axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell junction assembly (GO:0034329)|cell-cell junction assembly (GO:0007043)|cell-cell junction organization (GO:0045216)|establishment or maintenance of cell polarity (GO:0007163)|protein complex assembly (GO:0006461)|regulation of cell migration (GO:0030334)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				NS(1)|breast(1)|endometrium(1)|kidney(4)|lung(3)|urinary_tract(1)	11						TATGGATTACTACAACATGTT	0.343																																					p.L47P		Atlas-SNP	.											.	PARD6B	31	.	0			c.T140C						PASS	.						84.0	83.0	84.0					20																	49354467		2203	4300	6503	SO:0001583	missense	84612	exon2			GATTACTACAACA	AB044555	CCDS33485.1	20q13.13	2013-08-28	2013-08-28		ENSG00000124171	ENSG00000124171			16245	protein-coding gene	gene with protein product		608975	"""par-6 (partitioning defective 6, C.elegans) homolog beta"", ""par-6 partitioning defective 6 homolog beta (C. elegans)"""			11260256	Standard	NM_032521		Approved	PAR-6B	uc002xvo.3	Q9BYG5	OTTHUMG00000032732	ENST00000371610.2:c.140T>C	chr20.hg19:g.49354467T>C	ENSP00000360672:p.Leu47Pro	165.0	0.0	.		173.0	52.0	.	NM_032521	A2A2A7|Q9Y510	Missense_Mutation	SNP	ENST00000371610.2	hg19	CCDS33485.1	.	.	.	.	.	.	.	.	.	.	T	19.79	3.892162	0.72524	.	.	ENSG00000124171	ENST00000371610;ENST00000396039	T;T	0.27890	1.64;1.64	5.92	5.92	0.95590	Phox/Bem1p (2);	0.000000	0.64402	D	0.000001	T	0.56804	0.2010	M	0.75615	2.305	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	T	0.60732	-0.7205	10	0.87932	D	0	-21.6554	15.5593	0.76229	0.0:0.0:0.0:1.0	.	47	Q9BYG5	PAR6B_HUMAN	P	47	ENSP00000360672:L47P;ENSP00000379354:L47P	ENSP00000360672:L47P	L	+	2	0	PARD6B	48787874	1.000000	0.71417	0.749000	0.31150	0.589000	0.36550	7.662000	0.83803	2.277000	0.76020	0.528000	0.53228	CTA	.	.	.	none		0.343	PARD6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079697.2	NM_032521	
DIP2A	23181	hgsc.bcm.edu	37	21	47986481	47986481	+	Missense_Mutation	SNP	G	G	T	rs537914823		TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr21:47986481G>T	ENST00000417564.2	+	37	4369	c.4348G>T	c.(4348-4350)Gat>Tat	p.D1450Y	DIP2A_ENST00000479654.1_3'UTR|DIP2A_ENST00000400274.1_Missense_Mutation_p.D1446Y|DIP2A_ENST00000318711.7_Missense_Mutation_p.D1451Y			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	1450					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		AGGGCGGCACGATGCACTGTA	0.557																																					p.D1450Y		Atlas-SNP	.											.	DIP2A	332	.	0			c.G4348T						PASS	.						112.0	118.0	116.0					21																	47986481		2195	4299	6494	SO:0001583	missense	23181	exon37			CGGCACGATGCAC	AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.4348G>T	chr21.hg19:g.47986481G>T	ENSP00000392066:p.Asp1450Tyr	68.0	0.0	.		93.0	4.0	.	NM_015151	A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Missense_Mutation	SNP	ENST00000417564.2	hg19	CCDS46655.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.444922	0.83993	.	.	ENSG00000160305	ENST00000400274;ENST00000318711;ENST00000417564	T;T;T	0.26957	1.7;1.7;1.7	5.52	5.52	0.82312	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.56992	0.2023	M	0.83012	2.62	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.62210	-0.6902	10	0.87932	D	0	-18.8768	18.425	0.90606	0.0:0.0:1.0:0.0	.	1451;1450	E9PER1;Q14689	.;DIP2A_HUMAN	Y	1446;1451;1450	ENSP00000383133:D1446Y;ENSP00000323633:D1451Y;ENSP00000392066:D1450Y	ENSP00000323633:D1451Y	D	+	1	0	DIP2A	46810909	1.000000	0.71417	0.728000	0.30774	0.707000	0.40811	9.627000	0.98412	2.599000	0.87857	0.655000	0.94253	GAT	.	.	.	none		0.557	DIP2A-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376736.1	NM_015151	
TBC1D22A	25771	hgsc.bcm.edu	37	22	47433038	47433038	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr22:47433038C>A	ENST00000337137.4	+	11	1439	c.1273C>A	c.(1273-1275)Ctg>Atg	p.L425M	TBC1D22A_ENST00000406733.1_Missense_Mutation_p.L378M|TBC1D22A_ENST00000355704.3_Missense_Mutation_p.L347M|TBC1D22A_ENST00000407381.3_Missense_Mutation_p.L366M	NM_001284304.1|NM_001284305.1|NM_014346.2	NP_001271233.1|NP_001271234.1|NP_055161.1	Q8WUA7	TB22A_HUMAN	TBC1 domain family, member 22A	425	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						protein homodimerization activity (GO:0042803)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(3)|large_intestine(10)|lung(5)|ovary(2)|prostate(1)	22		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)		GATGAACAACCTGCTGATGAG	0.607																																					p.L425M		Atlas-SNP	.											.	TBC1D22A	54	.	0			c.C1273A						PASS	.						122.0	99.0	107.0					22																	47433038		2203	4300	6503	SO:0001583	missense	25771	exon11			AACAACCTGCTGA	AK125705	CCDS14078.1, CCDS63511.1, CCDS63512.1, CCDS74877.1	22q13	2008-01-22	2005-01-05	2005-01-05	ENSG00000054611	ENSG00000054611			1309	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 4"""	C22orf4			Standard	XM_005261496		Approved		uc003bib.3	Q8WUA7	OTTHUMG00000150332	ENST00000337137.4:c.1273C>A	chr22.hg19:g.47433038C>A	ENSP00000336724:p.Leu425Met	64.0	0.0	.		88.0	26.0	.	NM_014346	B0QYI2|B0QYI3|B9A6M3|Q5TE47|Q6ZUH2|Q92680|Q9BVD6|Q9UGG0|Q9UGT2|Q9UGU6|Q9UH25|Q9Y4W5	Missense_Mutation	SNP	ENST00000337137.4	hg19	CCDS14078.1	.	.	.	.	.	.	.	.	.	.	C	17.81	3.481640	0.63849	.	.	ENSG00000054611	ENST00000337137;ENST00000407381;ENST00000355704;ENST00000406733	T;T;T;T	0.18657	2.2;2.2;2.2;2.2	4.59	2.39	0.29439	Rab-GAP/TBC domain (4);	0.000000	0.64402	D	0.000001	T	0.43122	0.1233	M	0.82923	2.615	0.80722	D	1	D;D;D;D	0.89917	0.995;0.999;1.0;0.995	D;D;D;D	0.76071	0.969;0.977;0.987;0.969	T	0.35599	-0.9782	10	0.59425	D	0.04	.	7.0227	0.24922	0.0:0.7199:0.0:0.2801	.	425;347;366;425	B9A6M3;Q8WUA7-2;B0QYI1;Q8WUA7	.;.;.;TB22A_HUMAN	M	425;366;347;378	ENSP00000336724:L425M;ENSP00000384036:L366M;ENSP00000347932:L347M;ENSP00000385634:L378M	ENSP00000336724:L425M	L	+	1	2	TBC1D22A	45811702	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.985000	0.40668	1.137000	0.42214	0.462000	0.41574	CTG	.	.	.	none		0.607	TBC1D22A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317600.3	NM_014346	
JADE3	9767	hgsc.bcm.edu	37	X	46898381	46898381	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chrX:46898381C>G	ENST00000218343.4	+	8	1184	c.886C>G	c.(886-888)Ccg>Gcg	p.P296A	PHF16_ENST00000397189.1_Missense_Mutation_p.P296A	NM_014735.3	NP_055550.1														NS(2)|endometrium(8)|kidney(4)|large_intestine(5)|lung(12)|upper_aerodigestive_tract(2)	33						GAGGATGGAACCGATCACGAA	0.483																																					p.P296A		Atlas-SNP	.											.	PHF16	72	.	0			c.C886G						PASS	.						174.0	152.0	160.0					X																	46898381		2203	4300	6503	SO:0001583	missense	9767	exon8			ATGGAACCGATCA																												ENST00000218343.4:c.886C>G	chrX.hg19:g.46898381C>G	ENSP00000218343:p.Pro296Ala	66.0	0.0	.		68.0	46.0	.	NM_001077445		Missense_Mutation	SNP	ENST00000218343.4	hg19	CCDS14271.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.680539	0.88542	.	.	ENSG00000102221	ENST00000397189;ENST00000218343	T;T	0.15139	2.45;2.45	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.51092	0.1654	M	0.89478	3.035	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.61073	-0.7136	10	0.87932	D	0	.	18.4146	0.90565	0.0:1.0:0.0:0.0	.	296	Q92613	JADE3_HUMAN	A	296	ENSP00000380373:P296A;ENSP00000218343:P296A	ENSP00000218343:P296A	P	+	1	0	PHF16	46783325	1.000000	0.71417	0.994000	0.49952	0.881000	0.50899	7.367000	0.79558	2.289000	0.77006	0.513000	0.50165	CCG	.	.	.	none		0.483	PHF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056376.1		
UBL4A	8266	hgsc.bcm.edu	37	X	153713966	153713966	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chrX:153713966C>T	ENST00000369660.4	-	4	471	c.386G>A	c.(385-387)cGc>cAc	p.R129H	UBL4A_ENST00000477777.1_5'UTR|UBL4A_ENST00000369653.4_Missense_Mutation_p.R129H	NM_014235.3	NP_055050.1	P11441	UBL4A_HUMAN	ubiquitin-like 4A	129					cellular protein modification process (GO:0006464)|tail-anchored membrane protein insertion into ER membrane (GO:0071816)|transport (GO:0006810)	BAT3 complex (GO:0071818)|cytosol (GO:0005829)	small conjugating protein ligase activity (GO:0019787)			endometrium(5)|lung(1)|urinary_tract(1)	7	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CAGCGTCAGGCGACTCAGGGA	0.597																																					p.R129H	Esophageal Squamous(74;88 1215 11149 34177 46777)	Atlas-SNP	.											.	UBL4A	12	.	0			c.G386A						PASS	.						89.0	83.0	85.0					X																	153713966		2203	4300	6503	SO:0001583	missense	8266	exon4			GTCAGGCGACTCA	J03589	CCDS14754.1	Xq28	2010-08-05	2005-09-27	2005-09-27	ENSG00000102178	ENSG00000102178			12505	protein-coding gene	gene with protein product		312070	"""ubiquitin-like 4"""	UBL4		2829204, 16872915	Standard	NM_014235		Approved	GDX, DXS254E, GET5, MDY2, TMA24	uc004flo.3	P11441	OTTHUMG00000013370	ENST00000369660.4:c.386G>A	chrX.hg19:g.153713966C>T	ENSP00000358674:p.Arg129His	45.0	0.0	.		65.0	43.0	.	NM_014235	Q5HY80	Missense_Mutation	SNP	ENST00000369660.4	hg19	CCDS14754.1	.	.	.	.	.	.	.	.	.	.	C	16.81	3.227136	0.58668	.	.	ENSG00000102178	ENST00000369660;ENST00000369653	T;T	0.47528	0.88;0.84	5.35	3.31	0.37934	.	0.203112	0.42821	D	0.000656	T	0.53981	0.1830	M	0.74258	2.255	0.32176	N	0.580979	D	0.67145	0.996	P	0.53689	0.732	T	0.64723	-0.6340	10	0.66056	D	0.02	-0.0623	5.1063	0.14785	0.3116:0.5794:0.0:0.109	.	129	P11441	UBL4A_HUMAN	H	129	ENSP00000358674:R129H;ENSP00000358667:R129H	ENSP00000358667:R129H	R	-	2	0	UBL4A	153367160	1.000000	0.71417	1.000000	0.80357	0.085000	0.17905	1.164000	0.31810	1.161000	0.42604	0.529000	0.55759	CGC	.	.	.	none		0.597	UBL4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000037238.2	NM_014235	
ARHGEF5	7984	hgsc.bcm.edu	37	7	144062673	144062673	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr7:144062673delA	ENST00000056217.5	+	2	3085	c.2911delA	c.(2911-2913)acafs	p.T972fs	ARHGEF5_ENST00000471847.2_5'Flank	NM_005435.3	NP_005426.2	Q12774	ARHG5_HUMAN	Rho guanine nucleotide exchange factor (GEF) 5	972					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)|myeloid dendritic cell chemotaxis (GO:0002408)|positive regulation of podosome assembly (GO:0071803)|regulation of Rho GTPase activity (GO:0032319)		GTP binding (GO:0005525)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(6)|kidney(8)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Melanoma(164;0.14)					TTTGAGAAGGACAACCCCTCA	0.612																																					p.R970fs		Atlas-Indel,Pindel	.											.	ARHGEF5	73	.	0			c.2910delG						PASS	.						1.0	1.0	1.0					7																	144062673		462	1119	1581	SO:0001589	frameshift_variant	7984	exon2			.	U02082	CCDS34771.1	7q35	2012-09-20			ENSG00000050327	ENSG00000050327		"""Rho guanine nucleotide exchange factors"""	13209	protein-coding gene	gene with protein product	"""transforming immortalized mammary oncogene"", ""guanine nucleotide regulatory protein TIM"""	600888				8134109, 7656213	Standard	NM_005435		Approved	TIM, TIM1, GEF5, P60	uc003wel.3	Q12774	OTTHUMG00000158004	ENST00000056217.5:c.2911delA	chr7.hg19:g.144062673delA	ENSP00000056217:p.Thr972fs	180.0	0.0	0		195.0	26.0	0.133333	NM_005435	A6NNJ2|Q6ZML7	Frame_Shift_Del	DEL	ENST00000056217.5	hg19	CCDS34771.1																																																																																			.	.	.	none		0.612	ARHGEF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349981.1	NM_005435	
WAC	51322	hgsc.bcm.edu	37	10	28908467	28908468	+	Splice_Site	INS	-	-	TACT			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr10:28908467_28908468insTACT	ENST00000354911.4	+	14	2037_2038	c.1876_1877insTACT	c.(1876-1878)ata>aTACTta	p.-627fs	WAC_ENST00000347934.4_Splice_Site_p.-524fs|WAC_ENST00000375646.1_Splice_Site_p.-475fs|WAC_ENST00000375664.4_Splice_Site_p.-582fs	NM_016628.4	NP_057712.2	Q9BTA9	WAC_HUMAN	WW domain containing adaptor with coiled-coil						cellular response to DNA damage stimulus (GO:0006974)|G1 DNA damage checkpoint (GO:0044783)|histone H2B conserved C-terminal lysine ubiquitination (GO:0071894)|histone monoubiquitination (GO:0010390)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	chromatin binding (GO:0003682)|RNA polymerase II core binding (GO:0000993)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|urinary_tract(1)	32						TTTTTTCAGGATACTATTTTTG	0.277																																					p.I626fs		Atlas-Indel,Pindel	.											.	WAC	77	.	0			c.1876_1877insTACT						PASS	.																																			SO:0001630	splice_region_variant	51322	exon14			.	AK055852	CCDS7159.1, CCDS7160.1, CCDS7161.1	10p12.1	2007-05-17	2003-03-19		ENSG00000095787	ENSG00000095787			17327	protein-coding gene	gene with protein product		615049	"""WW domain-containing adaptor with coiled coil"""			11827461	Standard	NR_024557		Approved	Wwp4, FLJ31290, PRO1741, BM-016, MGC10753	uc001iuf.3	Q9BTA9	OTTHUMG00000017872	ENST00000354911.4:c.1875-1->TACT	chr10.hg19:g.28908468_28908471dupTACT		232.0	0.0	0		244.0	62.0	0.254098	NM_016628	A8K2A9|C9JBT9|D3DRW5|D3DRW6|D3DRW7|Q53EN9|Q5JU75|Q5JU77|Q5VXK0|Q5VXK2|Q8TCK1|Q96DP3|Q96FW6|Q96JI3	Frame_Shift_Ins	INS	ENST00000354911.4	hg19	CCDS7159.1																																																																																			.	.	.	none		0.277	WAC-017	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000047371.1	NM_100264	Frame_Shift_Ins
SCAF11	9169	hgsc.bcm.edu	37	12	46322508	46322509	+	Frame_Shift_Ins	INS	-	-	A			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr12:46322508_46322509insA	ENST00000369367.3	-	11	1208_1209	c.975_976insT	c.(973-978)cgtaacfs	p.N326fs	SCAF11_ENST00000419565.2_Frame_Shift_Ins_p.N326fs|SCAF11_ENST00000549162.1_Frame_Shift_Ins_p.N134fs|SCAF11_ENST00000465950.1_Frame_Shift_Ins_p.N11fs	NM_004719.2	NP_004710.2	Q99590	SCAFB_HUMAN	SR-related CTD-associated factor 11	326					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(17)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	69						GCTCTTGTGTTACGTGTAGACC	0.446																																					p.N326_T327delinsX		Atlas-Indel,Pindel	.											.	SCAF11	145	.	0			c.976_977insT						PASS	.																																			SO:0001589	frameshift_variant	9169	exon11			.	Y11251	CCDS8748.2	12q13.11	2013-01-09	2011-01-10	2011-01-10	ENSG00000139218	ENSG00000139218		"""RING-type (C3HC4) zinc fingers"""	10784	protein-coding gene	gene with protein product		603668	"""splicing factor, arginine/serine-rich 2, interacting protein"", ""serine/arginine-rich splicing factor 2, interacting protein"""	SFRS2IP, SRSF2IP		9224939, 9447963	Standard	NM_004719		Approved	SIP1, SRRP129, CASP11	uc001rox.3	Q99590	OTTHUMG00000149930	ENST00000369367.3:c.976dupT	chr12.hg19:g.46322509_46322509dupA	ENSP00000358374:p.Asn326fs	56.0	0.0	0		80.0	28.0	0.35	NM_004719	A6NEU9|A6NLW5|Q8IW59	Frame_Shift_Ins	INS	ENST00000369367.3	hg19	CCDS8748.2																																																																																			.	.	.	none		0.446	SCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313992.2	NM_004719	
PTPN14	5784	hgsc.bcm.edu	37	1	214568286	214568292	+	Frame_Shift_Del	DEL	GAATGGT	GAATGGT	-			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	GAATGGT	GAATGGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr1:214568286_214568292delGAATGGT	ENST00000366956.5	-	9	990_996	c.796_802delACCATTC	c.(796-804)accattctafs	p.TIL266fs	PTPN14_ENST00000543945.1_3'UTR	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14	266	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)	p.L268L(1)		NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		AGCTCCACTAGAATGGTCGACTTGTTA	0.43																																					p.266_268del	Colon(92;557 1424 24372 34121 40073)	Atlas-INDEL	.											.	PTPN14	168	.	1	Substitution - coding silent(1)	lung(1)	c.797_803del						PASS	.																																			SO:0001589	frameshift_variant	5784	exon9			.	X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.796_802delACCATTC	chr1.hg19:g.214568286_214568292delGAATGGT	ENSP00000355923:p.Thr266fs	66.0	0.0	0		62.0	15.0	0.241935	NM_005401	Q5VSI0	Frame_Shift_Del	DEL	ENST00000366956.5	hg19	CCDS1514.1																																																																																			.	.	.	none		0.430	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089918.2	NM_005401	
B4GALT1	2683	hgsc.bcm.edu	37	9	33167143	33167148	+	In_Frame_Del	DEL	TCAGGA	TCAGGA	-			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	TCAGGA	TCAGGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr9:33167143_33167148delTCAGGA	ENST00000379731.4	-	1	206_211	c.20_25delTCCTGA	c.(19-27)ctcctgagc>cgc	p.7_9LLS>R	B4GALT1_ENST00000535206.1_In_Frame_Del_p.7_9LLS>R|RP11-326F20.5_ENST00000426270.1_RNA|RP11-326F20.5_ENST00000442432.1_RNA	NM_001497.3	NP_001488.2	P15291	B4GT1_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1	7					acute inflammatory response (GO:0002526)|angiogenesis involved in wound healing (GO:0060055)|binding of sperm to zona pellucida (GO:0007339)|branching morphogenesis of an epithelial tube (GO:0048754)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|development of secondary sexual characteristics (GO:0045136)|epithelial cell development (GO:0002064)|extracellular matrix organization (GO:0030198)|galactose metabolic process (GO:0006012)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|lactose biosynthetic process (GO:0005989)|leukocyte migration (GO:0050900)|mammary gland development (GO:0030879)|multicellular organism reproduction (GO:0032504)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|oligosaccharide biosynthetic process (GO:0009312)|penetration of zona pellucida (GO:0007341)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|regulation of acrosome reaction (GO:0060046)|regulation of cellular component movement (GO:0051270)|single fertilization (GO:0007338)|small molecule metabolic process (GO:0044281)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|desmosome (GO:0030057)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|glycocalyx (GO:0030112)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi trans cisterna (GO:0000138)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alpha-tubulin binding (GO:0043014)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|beta-tubulin binding (GO:0048487)|galactosyltransferase activity (GO:0008378)|lactose synthase activity (GO:0004461)|manganese ion binding (GO:0030145)|N-acetyllactosamine synthase activity (GO:0003945)|protein homodimerization activity (GO:0042803)|UDP-galactosyltransferase activity (GO:0035250)			endometrium(1)|large_intestine(7)|lung(4)|prostate(1)|skin(1)	14			LUSC - Lung squamous cell carcinoma(29;0.0084)	GBM - Glioblastoma multiforme(74;0.121)	N-Acetyl-D-glucosamine(DB00141)	GCGCTGCCGCTCAGGAGCGGCTCCCG	0.723																																					p.7_9del		Atlas-INDEL	.											.	B4GALT1	28	.	0			c.21_26del						PASS	.																																			SO:0001651	inframe_deletion	2683	exon1			.	X14085	CCDS6535.1	9p13	2013-02-19			ENSG00000086062	ENSG00000086062	2.4.1.22	"""Beta 4-glycosyltransferases"""	924	protein-coding gene	gene with protein product		137060		GGTB2		9597550	Standard	NM_001497		Approved	beta4Gal-T1	uc003zsg.2	P15291	OTTHUMG00000019764	ENST00000379731.4:c.20_25delTCCTGA	chr9.hg19:g.33167143_33167148delTCAGGA	ENSP00000369055:p.Leu7_Ser9delinsArg	66.0	0.0	0		76.0	20.0	0.263158	NM_001497	B2R710|D3DRL2|Q12909|Q12910|Q12911|Q14456|Q14509|Q14523	In_Frame_Del	DEL	ENST00000379731.4	hg19	CCDS6535.1																																																																																			.	.	.	none		0.723	B4GALT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052039.1	NM_001497	
FKBP5	2289	hgsc.bcm.edu	37	6	35604801	35604826	+	Frame_Shift_Del	DEL	ACTAAAGACAAATGGTTCATTTCTAT	ACTAAAGACAAATGGTTCATTTCTAT	-			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	ACTAAAGACAAATGGTTCATTTCTAT	ACTAAAGACAAATGGTTCATTTCTAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr6:35604801_35604826delACTAAAGACAAATGGTTCATTTCTAT	ENST00000539068.1	-	3	417_442	c.215_240delATAGAAATGAACCATTTGTCTTTAGT	c.(214-240)gatagaaatgaaccatttgtctttagtfs	p.DRNEPFVFS72fs	FKBP5_ENST00000357266.4_Frame_Shift_Del_p.DRNEPFVFS72fs|FKBP5_ENST00000542713.1_Frame_Shift_Del_p.DRNEPFVFS72fs|FKBP5_ENST00000536438.1_Frame_Shift_Del_p.DRNEPFVFS72fs|FKBP5_ENST00000540787.1_Intron	NM_001145776.1	NP_001139248.1	Q13451	FKBP5_HUMAN	FK506 binding protein 5	72	PPIase FKBP-type 1. {ECO:0000255|PROSITE- ProRule:PRU00277}.				chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	FK506 binding (GO:0005528)|heat shock protein binding (GO:0031072)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(3)|urinary_tract(2)	17						CTTTGCCAAGACTAAAGACAAATGGTTCATTTCTATCATGACTGGA	0.345																																					p.72_81del		Atlas-Indel,Pindel	.											.	FKBP5	64	.	0			c.216_241del						PASS	.																																			SO:0001589	frameshift_variant	2289	exon4			.	U42031	CCDS4808.1, CCDS54996.1	6p21.31	2013-01-10	2001-11-28		ENSG00000096060	ENSG00000096060		"""Tetratricopeptide (TTC) repeat domain containing"""	3721	protein-coding gene	gene with protein product		602623	"""FK506-binding protein 5"""			9001212	Standard	NM_004117		Approved	FKBP51, FKBP54, PPIase, P54, Ptg-10	uc003okx.2	Q13451	OTTHUMG00000014576	ENST00000539068.1:c.215_240delATAGAAATGAACCATTTGTCTTTAGT	chr6.hg19:g.35604801_35604826delACTAAAGACAAATGGTTCATTTCTAT	ENSP00000441205:p.Asp72fs	77.0	0.0	0		59.0	10.0	0.169492	NM_001145775	F5H7R1|Q59EB8|Q5TGM6	Frame_Shift_Del	DEL	ENST00000539068.1	hg19	CCDS4808.1																																																																																			.	.	.	none		0.345	FKBP5-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040309.2		
SYTL2	54843	hgsc.bcm.edu	37	11	85416053	85416053	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr11:85416053delT	ENST00000528231.1	-	14	2399	c.2122delA	c.(2122-2124)atcfs	p.I708fs	SYTL2_ENST00000525423.1_Frame_Shift_Del_p.I1030fs|SYTL2_ENST00000527523.1_Frame_Shift_Del_p.I676fs|SYTL2_ENST00000525702.1_Frame_Shift_Del_p.I150fs|SYTL2_ENST00000389958.3_Frame_Shift_Del_p.I139fs|SYTL2_ENST00000524452.1_Frame_Shift_Del_p.I684fs|SYTL2_ENST00000389960.4_Frame_Shift_Del_p.I684fs|SYTL2_ENST00000533892.1_Frame_Shift_Del_p.I110fs|SYTL2_ENST00000529581.1_Frame_Shift_Del_p.I150fs|SYTL2_ENST00000316356.4_Frame_Shift_Del_p.I709fs|SYTL2_ENST00000359152.5_Frame_Shift_Del_p.I1554fs|SYTL2_ENST00000354566.3_Frame_Shift_Del_p.I1046fs	NM_001162951.1|NM_001162953.1	NP_001156423.1|NP_001156425.1	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2	708	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of mucus secretion (GO:0070257)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|exocytic vesicle (GO:0070382)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|melanosome (GO:0042470)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)|phosphatase binding (GO:0019902)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(22)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		GTCTTTAAGATTTGTTTTTCA	0.333																																					p.I1046fs		Atlas-Indel,Pindel	.											SYTL2_ENST00000316356,colon,carcinoma,0,2	SYTL2	231	.	0			c.3137delT						PASS	.						102.0	97.0	99.0					11																	85416053		2203	4299	6502	SO:0001589	frameshift_variant	54843	exon9			.	AJ303364	CCDS31649.1, CCDS31652.1, CCDS41698.1, CCDS53687.1, CCDS53688.1, CCDS53689.1	11q14.1	2014-06-13			ENSG00000137501	ENSG00000137501			15585	protein-coding gene	gene with protein product	"""chromosome 11 synaptotagmin"", ""breast cancer-associated antigen SGA-72M"", ""protein phosphatase 1, regulatory subunit 151"""	612880				10997877	Standard	XM_005274057		Approved	FLJ20163, FLJ21219, KIAA1597, exophilin-4, CHR11SYT, SLP2, SGA72M, MGC102768, PPP1R151	uc001pbb.3	Q9HCH5	OTTHUMG00000166977	ENST00000528231.1:c.2122delA	chr11.hg19:g.85416053delT	ENSP00000431701:p.Ile708fs	96.0	0.0	0		103.0	36.0	0.349515	NM_206927	B3KRS3|B4DJT5|B4DKW3|B4DQ26|B7SA85|B7ZLX6|B7ZLX7|Q2YDA7|Q6TV07|Q6ZN59|Q6ZVC5|Q8ND34|Q96BJ2|Q9H768|Q9NXM1	Frame_Shift_Del	DEL	ENST00000528231.1	hg19	CCDS53688.1																																																																																			.	.	.	none		0.333	SYTL2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000392192.1	NM_206927	
CDH1	999	hgsc.bcm.edu	37	16	68867229	68867229	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr16:68867229delC	ENST00000261769.5	+	16	2667	c.2476delC	c.(2476-2478)cctfs	p.P826fs	CDH1_ENST00000562836.1_3'UTR|CDH1_ENST00000422392.2_Frame_Shift_Del_p.P765fs	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	826	Required for binding alpha, beta and gamma catenins.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)			NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		CACAGCCCCGCCTTATGATTC	0.498			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																												p.P825fs		Atlas-Indel,Pindel	.	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	.	CDH1	535	.	0			c.2475delG						PASS	.						83.0	84.0	84.0					16																	68867229		2198	4300	6498	SO:0001589	frameshift_variant	999	exon16	Familial Cancer Database	HDGC	.	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.2476delC	chr16.hg19:g.68867229delC	ENSP00000261769:p.Pro826fs	59.0	0.0	0		161.0	44.0	0.273292	NM_004360	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Frame_Shift_Del	DEL	ENST00000261769.5	hg19	CCDS10869.1																																																																																			.	.	.	none		0.498	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268897.2	NM_004360	
IARS2	55699	hgsc.bcm.edu	37	1	220316411	220316411	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr1:220316411delA	ENST00000302637.5	+	21	2790	c.2686delA	c.(2686-2688)aaafs	p.K896fs	IARS2_ENST00000366922.1_Frame_Shift_Del_p.K824fs|IARS2_ENST00000467924.1_3'UTR	NM_018060.3	NP_060530.3	Q9NSE4	SYIM_HUMAN	isoleucyl-tRNA synthetase 2, mitochondrial	896					gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)			NS(1)|breast(1)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(7)|lung(17)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51				GBM - Glioblastoma multiforme(131;0.0554)	L-Isoleucine(DB00167)	CATCCCTGGCAAAAATGCAGC	0.433																																					p.G895fs		Atlas-Indel,Pindel	.											.	IARS2	106	.	0			c.2685delC						PASS	.						144.0	136.0	139.0					1																	220316411		2203	4300	6503	SO:0001589	frameshift_variant	55699	exon21			.	AK022665	CCDS1523.1	1q41	2011-07-01	2007-02-26		ENSG00000067704	ENSG00000067704	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	29685	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 2, mitochondrial"""	612801					Standard	NM_018060		Approved	FLJ10326	uc001hmc.3	Q9NSE4	OTTHUMG00000037287	ENST00000302637.5:c.2686delA	chr1.hg19:g.220316411delA	ENSP00000303279:p.Lys896fs	106.0	0.0	0		146.0	40.0	0.273973	NM_018060	B2RPG8|Q1M2P9|Q6PI85|Q7L439|Q86WU9|Q96D91|Q9H9Q8|Q9NW42	Frame_Shift_Del	DEL	ENST00000302637.5	hg19	CCDS1523.1																																																																																			.	.	.	none		0.433	IARS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_018060	
SCN8A	6334	hgsc.bcm.edu	37	12	52201156	52201161	+	In_Frame_Del	DEL	GGAAGG	GGAAGG	-			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	GGAAGG	GGAAGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr12:52201156_52201161delGGAAGG	ENST00000354534.6	+	27	6064_6069	c.5886_5891delGGAAGG	c.(5884-5892)gaggaagga>gaa	p.EG1963del	SCN8A_ENST00000545061.1_In_Frame_Del_p.EG1922del|AC068987.1_ENST00000599343.1_5'Flank|RP11-923I11.3_ENST00000565518.1_lincRNA	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	1963					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	AGCGGGCAGAGGAAGGAAGAAGGGAA	0.451																																					p.1962_1964del		Atlas-Indel,Pindel	.											.	SCN8A	331	.	0			c.5885_5890del						PASS	.																																			SO:0001651	inframe_deletion	6334	exon27			.	AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.5886_5891delGGAAGG	chr12.hg19:g.52201156_52201161delGGAAGG	ENSP00000346534:p.Glu1963_Gly1964del	343.0	0.0	0		349.0	104.0	0.297994	NM_014191	B9VWG8|O95788|Q9NYX2|Q9UPB2	In_Frame_Del	DEL	ENST00000354534.6	hg19	CCDS44891.1																																																																																			.	.	.	none		0.451	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404372.3	NM_014191	
CHRNA4	1137	hgsc.bcm.edu	37	20	61981808	61981808	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr20:61981808delG	ENST00000370263.4	-	5	1176	c.955delC	c.(955-957)ctgfs	p.L319fs	CHRNA4_ENST00000463705.1_5'UTR	NM_000744.6|NM_001256573.1	NP_000735.1|NP_001243502.1	P43681	ACHA4_HUMAN	cholinergic receptor, nicotinic, alpha 4 (neuronal)	319					action potential (GO:0001508)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cognition (GO:0050890)|DNA repair (GO:0006281)|exploration behavior (GO:0035640)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|neurological system process (GO:0050877)|regulation of dopamine secretion (GO:0014059)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(19)|prostate(3)|skin(3)|soft_tissue(1)	33	all_cancers(38;1.71e-10)				Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	ACGATGGACAGGGTGACGAAG	0.597																																					p.L319fs		Atlas-Indel,Pindel	.											.	CHRNA4	98	.	0			c.956delT						PASS	.						233.0	160.0	185.0					20																	61981808		2203	4300	6503	SO:0001589	frameshift_variant	1137	exon5			.		CCDS13517.1	20q13.33	2013-09-20	2012-02-07		ENSG00000101204	ENSG00000101204		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1958	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 4 (neuronal)"""	118504	"""cholinergic receptor, nicotinic, alpha polypeptide 4"""	EBN, EBN1		1505988	Standard	NM_000744		Approved	BFNC	uc002yes.3	P43681	OTTHUMG00000033080	ENST00000370263.4:c.955delC	chr20.hg19:g.61981808delG	ENSP00000359285:p.Leu319fs	117.0	0.0	0		136.0	49.0	0.360294	NM_000744	Q4JGR7|Q4VAQ5|Q4VAQ6	Frame_Shift_Del	DEL	ENST00000370263.4	hg19	CCDS13517.1																																																																																			.	.	.	none		0.597	CHRNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080508.3		
CUL3	8452	hgsc.bcm.edu	37	2	225360561	225360561	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr2:225360561delT	ENST00000264414.4	-	13	2168	c.1830delA	c.(1828-1830)aaafs	p.K610fs	CUL3_ENST00000409777.1_Frame_Shift_Del_p.K586fs|CUL3_ENST00000409096.1_Frame_Shift_Del_p.K586fs|CUL3_ENST00000344951.4_Frame_Shift_Del_p.K544fs	NM_003590.4	NP_003581.1	Q13618	CUL3_HUMAN	cullin 3	610					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|COPII vesicle coating (GO:0048208)|cyclin catabolic process (GO:0008054)|embryonic cleavage (GO:0040016)|ER to Golgi vesicle-mediated transport (GO:0006888)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|integrin-mediated signaling pathway (GO:0007229)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic metaphase plate congression (GO:0007080)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|stem cell division (GO:0017145)|stress fiber assembly (GO:0043149)|trophectodermal cellular morphogenesis (GO:0001831)|Wnt signaling pathway (GO:0016055)	Cul3-RING ubiquitin ligase complex (GO:0031463)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|nucleus (GO:0005634)|polar microtubule (GO:0005827)	POZ domain binding (GO:0031208)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	46		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		CAAATGTGTATTTTTCTCTAT	0.333																																					p.Y617fs		Atlas-Indel,Pindel	.											.	CUL3	96	.	0			c.1849delT						PASS	.						103.0	101.0	101.0					2																	225360561		2202	4300	6502	SO:0001589	frameshift_variant	8452	exon13			.	U58089	CCDS2462.1, CCDS58751.1	2q36.2	2011-05-24			ENSG00000036257	ENSG00000036257			2553	protein-coding gene	gene with protein product		603136				8681378, 17192413	Standard	NM_003590		Approved		uc002vny.3	Q13618	OTTHUMG00000133167	ENST00000264414.4:c.1830delA	chr2.hg19:g.225360561delT	ENSP00000264414:p.Lys610fs	118.0	0.0	0		109.0	43.0	0.394495	NM_001257198	A8K536|B8ZZC3|O75415|Q569L3|Q9UBI8|Q9UET7	Frame_Shift_Del	DEL	ENST00000264414.4	hg19	CCDS2462.1																																																																																			.	.	.	none		0.333	CUL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256871.2		
B4GALT1	2683	hgsc.bcm.edu	37	9	33167151	33167151	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr9:33167151delG	ENST00000379731.4	-	1	203	c.17delC	c.(16-18)ccgfs	p.P6fs	B4GALT1_ENST00000535206.1_Frame_Shift_Del_p.P6fs|RP11-326F20.5_ENST00000426270.1_RNA|RP11-326F20.5_ENST00000442432.1_RNA	NM_001497.3	NP_001488.2	P15291	B4GT1_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1	6					acute inflammatory response (GO:0002526)|angiogenesis involved in wound healing (GO:0060055)|binding of sperm to zona pellucida (GO:0007339)|branching morphogenesis of an epithelial tube (GO:0048754)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|development of secondary sexual characteristics (GO:0045136)|epithelial cell development (GO:0002064)|extracellular matrix organization (GO:0030198)|galactose metabolic process (GO:0006012)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|lactose biosynthetic process (GO:0005989)|leukocyte migration (GO:0050900)|mammary gland development (GO:0030879)|multicellular organism reproduction (GO:0032504)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|oligosaccharide biosynthetic process (GO:0009312)|penetration of zona pellucida (GO:0007341)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|regulation of acrosome reaction (GO:0060046)|regulation of cellular component movement (GO:0051270)|single fertilization (GO:0007338)|small molecule metabolic process (GO:0044281)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|desmosome (GO:0030057)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|glycocalyx (GO:0030112)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi trans cisterna (GO:0000138)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alpha-tubulin binding (GO:0043014)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|beta-tubulin binding (GO:0048487)|galactosyltransferase activity (GO:0008378)|lactose synthase activity (GO:0004461)|manganese ion binding (GO:0030145)|N-acetyllactosamine synthase activity (GO:0003945)|protein homodimerization activity (GO:0042803)|UDP-galactosyltransferase activity (GO:0035250)			endometrium(1)|large_intestine(7)|lung(4)|prostate(1)|skin(1)	14			LUSC - Lung squamous cell carcinoma(29;0.0084)	GBM - Glioblastoma multiforme(74;0.121)	N-Acetyl-D-glucosamine(DB00141)	GCTCAGGAGCGGCTCCCGAAG	0.736																																					p.P6fs		Atlas-INDEL	.											.	B4GALT1	28	.	0			c.18delG						PASS	.						6.0	10.0	9.0					9																	33167151		1694	3514	5208	SO:0001589	frameshift_variant	2683	exon1			.	X14085	CCDS6535.1	9p13	2013-02-19			ENSG00000086062	ENSG00000086062	2.4.1.22	"""Beta 4-glycosyltransferases"""	924	protein-coding gene	gene with protein product		137060		GGTB2		9597550	Standard	NM_001497		Approved	beta4Gal-T1	uc003zsg.2	P15291	OTTHUMG00000019764	ENST00000379731.4:c.17delC	chr9.hg19:g.33167151delG	ENSP00000369055:p.Pro6fs	71.0	0.0	0		77.0	20.0	0.25974	NM_001497	B2R710|D3DRL2|Q12909|Q12910|Q12911|Q14456|Q14509|Q14523	Frame_Shift_Del	DEL	ENST00000379731.4	hg19	CCDS6535.1																																																																																			.	.	.	none		0.736	B4GALT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052039.1	NM_001497	
B4GALNT2	124872	hgsc.bcm.edu	37	17	47219412	47219413	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	TC	TC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr17:47219412_47219413delTC	ENST00000300404.2	+	3	470_471	c.411_412delTC	c.(409-414)aatcagfs	p.NQ137fs	B4GALNT2_ENST00000393354.2_Frame_Shift_Del_p.NQ77fs|B4GALNT2_ENST00000504681.1_Frame_Shift_Del_p.NQ51fs	NM_153446.2	NP_703147.2	Q8NHY0	B4GN2_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 2	137					lipid glycosylation (GO:0030259)|negative regulation of cell-cell adhesion (GO:0022408)|protein glycosylation (GO:0006486)|UDP-N-acetylgalactosamine metabolic process (GO:0019276)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)			endometrium(3)|large_intestine(6)|liver(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	24			all cancers(6;0.000316)			TCCCGAAAAATCAGTGCAAATG	0.52																																					p.137_137del	GBM(124;244 1635 8663 18097 33175)	Atlas-Indel,Pindel	.											.	B4GALNT2	67	.	0			c.410_411del						PASS	.																																			SO:0001589	frameshift_variant	124872	exon3			.	AJ517770	CCDS11544.1, CCDS54139.1, CCDS54140.1	17q21.33	2013-02-22	2006-01-08	2006-01-08	ENSG00000167080	ENSG00000167080	2.4.1.-	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	24136	protein-coding gene	gene with protein product		111730	"""UDP-GalNAc:Neu5Acalpha2-3Galbeta-R beta1,4-N-acetylgalactosaminyltransferase"""	GALGT2		8782649, 12678917	Standard	NM_153446		Approved	Sda, Cad	uc002ion.2	Q8NHY0	OTTHUMG00000161307	ENST00000300404.2:c.411_412delTC	chr17.hg19:g.47219412_47219413delTC	ENSP00000300404:p.Asn137fs	104.0	0.0	0		96.0	31.0	0.322917	NM_153446	B4DZE4|Q14CP1|Q86Y40	Frame_Shift_Del	DEL	ENST00000300404.2	hg19	CCDS11544.1																																																																																			.	.	.	none		0.520	B4GALNT2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364477.1	NM_153446	
ILVBL	10994	hgsc.bcm.edu	37	19	15230250	15230250	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr19:15230250delG	ENST00000263383.3	-	8	1032	c.893delC	c.(892-894)ccafs	p.P298fs	ILVBL_ENST00000531635.1_5'UTR|ILVBL_ENST00000534378.1_Frame_Shift_Del_p.P191fs	NM_006844.3	NP_006835.2	A1L0T0	ILVBL_HUMAN	ilvB (bacterial acetolactate synthase)-like	298						integral component of membrane (GO:0016021)|membrane (GO:0016020)	magnesium ion binding (GO:0000287)|thiamine pyrophosphate binding (GO:0030976)|transferase activity (GO:0016740)			NS(3)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(1)	26						GGCAGACGTTGGGGTGAGCAG	0.647																																					p.P298fs		Atlas-Indel,Pindel	.											.	ILVBL	54	.	0			c.894delA						PASS	.						53.0	48.0	50.0					19																	15230250		2203	4300	6503	SO:0001589	frameshift_variant	10994	exon8			.	U61263	CCDS12325.1	19p13.1	2008-07-16			ENSG00000105135	ENSG00000105135			6041	protein-coding gene	gene with protein product	"""acetolactate synthase homolog"""	605770				8954801	Standard	NM_006844		Approved	209L8, AHAS, ILV2H, MGC1269, FLJ39061, MGC19535	uc002nam.3	A1L0T0	OTTHUMG00000165630	ENST00000263383.3:c.893delC	chr19.hg19:g.15230250delG	ENSP00000263383:p.Pro298fs	201.0	0.0	0		228.0	79.0	0.346491	NM_006844	O43341|Q96F08|Q99651|Q9BWN5|Q9UEB2	Frame_Shift_Del	DEL	ENST00000263383.3	hg19	CCDS12325.1																																																																																			.	.	.	none		0.647	ILVBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385439.1	NM_006844	
SHPRH	257218	hgsc.bcm.edu	37	6	146215295	146215296	+	Frame_Shift_Ins	INS	-	-	T			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr6:146215295_146215296insT	ENST00000367505.2	-	27	4949_4950	c.4685_4686insA	c.(4684-4686)aagfs	p.K1562fs	SHPRH_ENST00000438092.2_Frame_Shift_Ins_p.K1566fs|SHPRH_ENST00000275233.7_Frame_Shift_Ins_p.K1562fs|SHPRH_ENST00000367503.3_Frame_Shift_Ins_p.K1566fs			Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase	1562	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				DNA repair (GO:0006281)|nucleosome assembly (GO:0006334)|protein polyubiquitination (GO:0000209)	nucleosome (GO:0000786)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(33)|ovary(3)|pancreas(2)|prostate(7)|skin(1)|urinary_tract(1)	79		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		CCTGAAATGTCTTAACACGACT	0.317																																					p.K1566fs		Atlas-Indel,Pindel	.											.	SHPRH	169	.	0			c.4698_4699insA						PASS	.																																			SO:0001589	frameshift_variant	257218	exon27			.	AB095943	CCDS43513.1, CCDS47496.1, CCDS43513.2	6q24.2	2012-02-23	2012-02-23		ENSG00000146414	ENSG00000146414		"""RING-type (C3HC4) zinc fingers"""	19336	protein-coding gene	gene with protein product		608048	"""SNF2 histone linker PHD RING helicase"""			12837266	Standard	NM_001042683		Approved	FLJ90837, KIAA2023, bA545I5.2	uc003qlf.3	Q149N8	OTTHUMG00000015750	ENST00000367505.2:c.4686dupA	chr6.hg19:g.146215297_146215297dupT	ENSP00000356475:p.Lys1562fs	81.0	0.0	0		86.0	33.0	0.383721	NM_173082	Q149N9|Q5VV79|Q68DS5|Q7Z5J5|Q8IVE8|Q8IWQ9|Q8N1S8|Q8NBR7	Frame_Shift_Ins	INS	ENST00000367505.2	hg19	CCDS43513.2																																																																																			.	.	.	none		0.317	SHPRH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042571.2	NM_173082	
NCKAP1L	3071	hgsc.bcm.edu	37	12	54930731	54930733	+	In_Frame_Del	DEL	ACA	ACA	-			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	ACA	ACA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr12:54930731_54930733delACA	ENST00000293373.6	+	29	3156_3158	c.3077_3079delACA	c.(3076-3081)tacaac>tac	p.N1029del	NCKAP1L_ENST00000545638.2_In_Frame_Del_p.N979del	NM_005337.4	NP_005328.2	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	1029					actin polymerization-dependent cell motility (GO:0070358)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|chemotaxis (GO:0006935)|cortical actin cytoskeleton organization (GO:0030866)|erythrocyte development (GO:0048821)|maintenance of cell polarity (GO:0030011)|myeloid cell homeostasis (GO:0002262)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of myosin-light-chain-phosphatase activity (GO:0035509)|neutrophil chemotaxis (GO:0030593)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of CD8-positive, alpha-beta T cell differentiation (GO:0043378)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of lymphocyte differentiation (GO:0045621)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of T cell proliferation (GO:0042102)|protein complex assembly (GO:0006461)|response to drug (GO:0042493)|T cell homeostasis (GO:0043029)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)|protein kinase activator activity (GO:0030295)|Rac GTPase activator activity (GO:0030675)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(37)|ovary(3)|prostate(3)|skin(3)|stomach(2)	80						AACCTAGGTTACAACAACAATAT	0.394																																					p.1026_1026del		Atlas-Indel,Pindel	.											.	NCKAP1L	180	.	0			c.3076_3078del						PASS	.																																			SO:0001651	inframe_deletion	3071	exon29			.	AI924363	CCDS31813.1, CCDS53799.1	12q13.1	2005-10-11	2005-10-11	2005-10-11		ENSG00000123338			4862	protein-coding gene	gene with protein product		141180	"""hematopoietic protein 1"""	HEM1		1932118	Standard	NM_005337		Approved		uc001sgc.4	P55160	OTTHUMG00000169843	ENST00000293373.6:c.3077_3079delACA	chr12.hg19:g.54930737_54930739delACA	ENSP00000293373:p.Asn1029del	66.0	0.0	0		47.0	17.0	0.361702	NM_005337	B4DUT5|Q52LW0	In_Frame_Del	DEL	ENST00000293373.6	hg19	CCDS31813.1																																																																																			.	.	.	none		0.394	NCKAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406195.1	NM_005337	
POTEH	23784	hgsc.bcm.edu	37	22	16258291	16258294	+	Frame_Shift_Del	DEL	ATTT	ATTT	-	rs200891952|rs565828046	byFrequency	TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	ATTT	ATTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr22:16258291_16258294delATTT	ENST00000343518.6	-	10	1581_1584	c.1530_1533delAAAT	c.(1528-1533)caaaatfs	p.QN510fs		NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	510										NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						TCTGAGTATCATTTTGTTCATCAC	0.358																																					p.511_512del		Pindel	.											.	POTEH	114	.	0			c.1531_1534del						PASS	.																																			SO:0001589	frameshift_variant	23784	exon10			.	AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.1530_1533delAAAT	chr22.hg19:g.16258291_16258294delATTT	ENSP00000340610:p.Gln510fs	783.0	0.0	.		886.0	61.0	0.069	NM_001136213	A2CEK4|A6NCI1|A9Z1W0	Frame_Shift_Del	DEL	ENST00000343518.6	hg19	CCDS46658.1																																																																																			.	.	.	none		0.358	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276918.4	NM_001136213	
B4GALT1	2683	hgsc.bcm.edu	37	9	33167143	33167151	+	In_Frame_Del	DEL	TCAGGAGCG	TCAGGAGCG	-			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	TCAGGAGCG	TCAGGAGCG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr9:33167143_33167151delTCAGGAGCG	ENST00000379731.4	-	1	203_211	c.17_25delCGCTCCTGA	c.(16-27)ccgctcctgagc>cgc	p.6_9PLLS>R	B4GALT1_ENST00000535206.1_In_Frame_Del_p.6_9PLLS>R|RP11-326F20.5_ENST00000426270.1_RNA|RP11-326F20.5_ENST00000442432.1_RNA	NM_001497.3	NP_001488.2	P15291	B4GT1_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1	6					acute inflammatory response (GO:0002526)|angiogenesis involved in wound healing (GO:0060055)|binding of sperm to zona pellucida (GO:0007339)|branching morphogenesis of an epithelial tube (GO:0048754)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|development of secondary sexual characteristics (GO:0045136)|epithelial cell development (GO:0002064)|extracellular matrix organization (GO:0030198)|galactose metabolic process (GO:0006012)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|lactose biosynthetic process (GO:0005989)|leukocyte migration (GO:0050900)|mammary gland development (GO:0030879)|multicellular organism reproduction (GO:0032504)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|oligosaccharide biosynthetic process (GO:0009312)|penetration of zona pellucida (GO:0007341)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|regulation of acrosome reaction (GO:0060046)|regulation of cellular component movement (GO:0051270)|single fertilization (GO:0007338)|small molecule metabolic process (GO:0044281)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|desmosome (GO:0030057)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|glycocalyx (GO:0030112)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi trans cisterna (GO:0000138)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alpha-tubulin binding (GO:0043014)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|beta-tubulin binding (GO:0048487)|galactosyltransferase activity (GO:0008378)|lactose synthase activity (GO:0004461)|manganese ion binding (GO:0030145)|N-acetyllactosamine synthase activity (GO:0003945)|protein homodimerization activity (GO:0042803)|UDP-galactosyltransferase activity (GO:0035250)			endometrium(1)|large_intestine(7)|lung(4)|prostate(1)|skin(1)	14			LUSC - Lung squamous cell carcinoma(29;0.0084)	GBM - Glioblastoma multiforme(74;0.121)	N-Acetyl-D-glucosamine(DB00141)	GCGCTGCCGCTCAGGAGCGGCTCCCGAAG	0.722																																					p.6_9del		Pindel	.											.	B4GALT1	28	.	0			c.18_26del						PASS	.																																			SO:0001651	inframe_deletion	2683	exon1			.	X14085	CCDS6535.1	9p13	2013-02-19			ENSG00000086062	ENSG00000086062	2.4.1.22	"""Beta 4-glycosyltransferases"""	924	protein-coding gene	gene with protein product		137060		GGTB2		9597550	Standard	NM_001497		Approved	beta4Gal-T1	uc003zsg.2	P15291	OTTHUMG00000019764	ENST00000379731.4:c.17_25delCGCTCCTGA	chr9.hg19:g.33167143_33167151delTCAGGAGCG	ENSP00000369055:p.Pro6_Ser9delinsArg	70.0	0.0	.		80.0	17.0	0.213	NM_001497	B2R710|D3DRL2|Q12909|Q12910|Q12911|Q14456|Q14509|Q14523	In_Frame_Del	DEL	ENST00000379731.4	hg19	CCDS6535.1																																																																																			.	.	.	none		0.722	B4GALT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052039.1	NM_001497	
NAA15	80155	hgsc.bcm.edu	37	4	140291525	140291525	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr4:140291525delA	ENST00000296543.5	+	15	2237	c.1914delA	c.(1912-1914)ccafs	p.P638fs	NAA15_ENST00000398947.1_Frame_Shift_Del_p.P638fs	NM_057175.3	NP_476516.1	Q9BXJ9	NAA15_HUMAN	N(alpha)-acetyltransferase 15, NatA auxiliary subunit	638	Interaction with HYPK.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	N-acetyltransferase activity (GO:0008080)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)			NS(1)|endometrium(3)|large_intestine(7)|liver(2)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29						taggaggtccaaaagaagaaC	0.353																																					p.P638fs		Pindel	.											.	NAA15	88	.	0			c.1913delC						PASS	.						81.0	81.0	81.0					4																	140291525		1855	4102	5957	SO:0001589	frameshift_variant	80155	exon15			.	AY039242	CCDS43270.1	4q31.1	2010-01-14	2010-01-14	2010-01-14	ENSG00000164134	ENSG00000164134		"""N(alpha)-acetyltransferase subunits"""	30782	protein-coding gene	gene with protein product		608000	"""NMDA receptor regulated 1"""	NARG1		12140756, 11478804, 19660095	Standard	XM_005263236		Approved	TBDN100, NATH, FLJ13340	uc003ihu.1	Q9BXJ9	OTTHUMG00000137363	ENST00000296543.5:c.1914delA	chr4.hg19:g.140291525delA	ENSP00000296543:p.Pro638fs	577.0	0.0	.		673.0	113.0	0.168	NM_057175	D3DNY6|Q52LG9|Q8IWH4|Q8NEV2|Q9H8P6	Frame_Shift_Del	DEL	ENST00000296543.5	hg19	CCDS43270.1																																																																																			.	.	.	none		0.353	NAA15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000267839.2	NM_057175	
UGT3A2	167127	hgsc.bcm.edu	37	5	36049438	36049439	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-B9-A8YI-01A-21D-A36X-10	TCGA-B9-A8YI-10A-01D-A370-10	AT	AT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b4b55b-1ee7-4b50-838e-95aa7d2fcd51	7aa75db8-fcf8-49cb-b097-27dc79933907	g.chr5:36049438_36049439delAT	ENST00000282507.3	-	4	496_497	c.395_396delAT	c.(394-396)gatfs	p.D132fs	UGT3A2_ENST00000504954.1_Intron|UGT3A2_ENST00000513300.1_Frame_Shift_Del_p.D98fs|UGT3A2_ENST00000545528.1_Intron	NM_174914.3	NP_777574.2	Q3SY77	UD3A2_HUMAN	UDP glycosyltransferase 3 family, polypeptide A2	132					cellular response to genistein (GO:0071412)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)|UDP-glycosyltransferase activity (GO:0008194)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	43	all_lung(31;0.000179)		Lung(74;0.111)|Epithelial(62;0.113)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TCTTTAAGGAATCCATGATATC	0.351																																					p.132_133del		Pindel	.											.	UGT3A2	117	.	0			c.396_397del						PASS	.																																			SO:0001589	frameshift_variant	167127	exon4			.		CCDS3914.1, CCDS54842.1	5p13.2	2014-05-20			ENSG00000168671	ENSG00000168671		"""UDP glucuronosyltransferases"""	27266	protein-coding gene	gene with protein product						12975309	Standard	NM_174914		Approved		uc003jjz.2	Q3SY77	OTTHUMG00000131108	ENST00000282507.3:c.395_396delAT	chr5.hg19:g.36049438_36049439delAT	ENSP00000282507:p.Asp132fs	134.0	0.0	.		159.0	44.0	0.277	NM_174914	B4DUQ7|E9PFK7|Q6UXC4|Q8NBP2	Frame_Shift_Del	DEL	ENST00000282507.3	hg19	CCDS3914.1																																																																																			.	.	.	none		0.351	UGT3A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253771.2	NM_174914	
