#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ABCA7	10347	hgsc.bcm.edu	37	19	1049305	1049305	+	Silent	SNP	C	C	A	rs4147915	byFrequency	TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr19:1049305C>A	ENST00000263094.6	+	18	2652	c.2421C>A	c.(2419-2421)gtC>gtA	p.V807V	ABCA7_ENST00000433129.1_Silent_p.V807V|ABCA7_ENST00000435683.2_Silent_p.V669V	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	807	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTCCTGGCGTCTCCGTTCGCA	0.667													C|||	1001	0.19988	0.1157	0.2752	5008	,	,		9249	0.371		0.1233	False		,,,				2504	0.1626																0								C		539,3865	239.9+/-250.9	34,471,1697	53.0	61.0	59.0		2421	1.7	0.8	19	dbSNP_110	59	1175,7421	238.3+/-269.8	83,1009,3206	no	coding-synonymous	ABCA7	NM_019112.3		117,1480,4903	AA,AC,CC		13.6691,12.2389,13.1846		807/2147	1049305	1714,11286	2202	4298	6500	SO:0001819	synonymous_variant	10347			AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.2421C>A	19.37:g.1049305C>A			Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Silent	SNP	ENST00000263094.6	37	CCDS12055.1																																																																																				0.667	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1		NM_019112	
ABCB6	10058	hgsc.bcm.edu;ucsc.edu	37	2	220075156	220075156	+	Silent	SNP	C	C	T			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr2:220075156C>T	ENST00000265316.3	-	17	2614	c.2298G>A	c.(2296-2298)caG>caA	p.Q766Q	ABCB6_ENST00000439002.2_Silent_p.Q720Q	NM_005689.2	NP_005680.1	Q9NP58	ABCB6_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 6 (Langereis blood group)	766	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				brain development (GO:0007420)|cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|porphyrin-containing compound biosynthetic process (GO:0006779)|skin development (GO:0043588)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrial envelope (GO:0005740)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|efflux transmembrane transporter activity (GO:0015562)|heme binding (GO:0020037)|heme transporter activity (GO:0015232)|heme-transporting ATPase activity (GO:0015439)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	34		Renal(207;0.0474)		Epithelial(149;1.22e-06)|all cancers(144;0.000201)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCAGAGAAGCCTGGATGGCCC	0.572																																																	0													80.0	73.0	75.0					2																	220075156		2203	4300	6503	SO:0001819	synonymous_variant	10058			AF070598	CCDS2436.1	2q36	2014-08-27	2014-08-27		ENSG00000115657	ENSG00000115657		"""ATP binding cassette transporters / subfamily B"""	47	protein-coding gene	gene with protein product	"""ATP-binding cassette half-transporter"""	605452	"""ATP-binding cassette, sub-family B (MDR/TAP), member 6"""			8894702, 9110174	Standard	NM_005689		Approved	EST45597, umat, MTABC3	uc002vkc.2	Q9NP58	OTTHUMG00000133131	ENST00000265316.3:c.2298G>A	2.37:g.220075156C>T			O75542|Q49A66|Q59GQ5|Q6ZME6|Q96ME8|Q9HAQ6|Q9HAQ7	Silent	SNP	ENST00000265316.3	37	CCDS2436.1	.	.	.	.	.	.	.	.	.	.	C	9.118	1.008315	0.19199	.	.	ENSG00000115657	ENST00000295750	.	.	.	5.66	3.88	0.44766	.	.	.	.	.	T	0.60843	0.2300	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56637	-0.7946	4	.	.	.	-18.407	10.0498	0.42208	0.0:0.7829:0.0:0.2171	.	.	.	.	K	614	.	.	R	-	2	0	ABCB6	219783400	0.998000	0.40836	1.000000	0.80357	0.994000	0.84299	0.682000	0.25335	0.766000	0.33244	0.650000	0.86243	AGG		0.572	ABCB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256820.2		NM_005689	
AHNAK	79026	hgsc.bcm.edu;ucsc.edu	37	11	62287670	62287670	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr11:62287670T>G	ENST00000378024.4	-	5	14493	c.14219A>C	c.(14218-14220)gAt>gCt	p.D4740A	AHNAK_ENST00000525875.1_5'Flank|AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	4740					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				AAGGGTAACATCCACATCGCC	0.502																																																	0													179.0	169.0	172.0					11																	62287670		2202	4299	6501	SO:0001583	missense	79026			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.14219A>C	11.37:g.62287670T>G	ENSP00000367263:p.Asp4740Ala		A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	T	13.23	2.176170	0.38413	.	.	ENSG00000124942	ENST00000378024	T	0.03358	3.96	4.92	4.92	0.64577	.	0.000000	0.85682	D	0.000000	T	0.27663	0.0680	H	0.97587	4.035	0.49915	D	0.999832	D	0.76494	0.999	D	0.87578	0.998	T	0.39461	-0.9613	10	0.30854	T	0.27	-25.8564	11.9431	0.52913	0.0:0.0:0.0:1.0	.	4740	Q09666	AHNK_HUMAN	A	4740	ENSP00000367263:D4740A	ENSP00000367263:D4740A	D	-	2	0	AHNAK	62044246	0.988000	0.35896	0.926000	0.36857	0.116000	0.19942	3.370000	0.52372	1.839000	0.53478	0.391000	0.25812	GAT		0.502	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1		NM_024060	
ALS2	57679	hgsc.bcm.edu	37	2	202580492	202580492	+	Missense_Mutation	SNP	G	G	T	rs267599155		TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr2:202580492G>T	ENST00000264276.6	-	25	4279	c.3907C>A	c.(3907-3909)Caa>Aaa	p.Q1303K	ALS2_ENST00000457679.2_3'UTR	NM_020919.3	NP_065970.2	Q96Q42	ALS2_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	1303					behavioral fear response (GO:0001662)|cell death (GO:0008219)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|locomotory behavior (GO:0007626)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Rab GTPase activity (GO:0032851)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of Ran GTPase activity (GO:0032853)|protein localization (GO:0008104)|receptor recycling (GO:0001881)|regulation of endosome size (GO:0051036)|response to oxidative stress (GO:0006979)|synaptic transmission, glutamatergic (GO:0035249)|vesicle organization (GO:0016050)	centrosome (GO:0005813)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome (GO:0005769)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|ruffle (GO:0001726)|vesicle (GO:0031982)	protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)	p.Q1303*(2)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(22)|ovary(1)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	72						CAGCCCAGTTGGCGCCAACAT	0.517																																																	2	Substitution - Nonsense(2)	skin(2)											171.0	167.0	168.0					2																	202580492		1918	4118	6036	SO:0001583	missense	57679			AB053305	CCDS42800.1, CCDS46492.1	2q33-q35	2014-09-17	2004-06-23		ENSG00000003393	ENSG00000003393		"""Rho guanine nucleotide exchange factors"""	443	protein-coding gene	gene with protein product	"""alsin"""	606352	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 6"""	ALS2CR6		11586298	Standard	NM_020919		Approved		uc002uyo.3	Q96Q42	OTTHUMG00000154507	ENST00000264276.6:c.3907C>A	2.37:g.202580492G>T	ENSP00000264276:p.Gln1303Lys		Q53TT1|Q53TV2|Q8N1E0|Q96PC4|Q96Q41|Q9H973|Q9HCK9	Missense_Mutation	SNP	ENST00000264276.6	37	CCDS42800.1	.	.	.	.	.	.	.	.	.	.	G	13.91	2.377524	0.42105	.	.	ENSG00000003393	ENST00000264276	T	0.57436	0.4	5.43	5.43	0.79202	.	0.110957	0.64402	N	0.000006	T	0.52549	0.1741	L	0.54323	1.7	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.49476	-0.8936	10	0.54805	T	0.06	.	19.239	0.93875	0.0:0.0:1.0:0.0	.	1303	Q96Q42	ALS2_HUMAN	K	1303	ENSP00000264276:Q1303K	ENSP00000264276:Q1303K	Q	-	1	0	ALS2	202288737	1.000000	0.71417	0.998000	0.56505	0.980000	0.70556	5.181000	0.65054	2.533000	0.85409	0.491000	0.48974	CAA		0.517	ALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335562.3		NM_020919	
ARHGAP1	392	hgsc.bcm.edu	37	11	46717596	46717596	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr11:46717596T>A	ENST00000311956.4	-	2	159	c.62A>T	c.(61-63)aAc>aTc	p.N21I		NM_004308.3	NP_004299.1	Q07960	RHG01_HUMAN	Rho GTPase activating protein 1	21					positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	Rac GTPase activator activity (GO:0030675)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			endometrium(1)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	11		Lung NSC(402;1.76e-12)|all_lung(304;1.3e-11)		GBM - Glioblastoma multiforme(35;5.17e-06)|BRCA - Breast invasive adenocarcinoma(625;0.00112)|Lung(87;0.153)		CTTCAGCTGGTTCAGAGCCTC	0.577																																																	0													75.0	58.0	64.0					11																	46717596		2201	4299	6500	SO:0001583	missense	392			BC018118	CCDS7922.1	11p11.2	2006-04-11			ENSG00000175220	ENSG00000175220		"""Rho GTPase activating proteins"""	673	protein-coding gene	gene with protein product		602732				8288572	Standard	NM_004308		Approved	RhoGAP, p50rhoGAP, CDC42GAP, Cdc42GAP	uc001ndd.4	Q07960	OTTHUMG00000166567	ENST00000311956.4:c.62A>T	11.37:g.46717596T>A	ENSP00000310491:p.Asn21Ile		D3DQQ6	Missense_Mutation	SNP	ENST00000311956.4	37	CCDS7922.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.78|19.78	3.891382|3.891382	0.72524|0.72524	.|.	.|.	ENSG00000175220|ENSG00000175220	ENST00000528837|ENST00000311956;ENST00000443332;ENST00000525488	.|T;T	.|0.33654	.|2.2;1.4	5.2|5.2	5.2|5.2	0.72013|0.72013	.|.	.|0.191662	.|0.49305	.|D	.|0.000151	T|T	0.21881|0.21881	0.0527|0.0527	N|N	0.19112|0.19112	0.55|0.55	0.33366|0.33366	D|D	0.573005|0.573005	.|P;P	.|0.45283	.|0.855;0.553	.|B;B	.|0.38327	.|0.271;0.11	T|T	0.32295|0.32295	-0.9912|-0.9912	5|10	.|0.37606	.|T	.|0.19	.|.	9.8891|9.8891	0.41279|0.41279	0.0:0.087:0.0:0.913|0.0:0.087:0.0:0.913	.|.	.|21;21	.|B4DPZ4;Q07960	.|.;RHG01_HUMAN	D|I	18|21	.|ENSP00000310491:N21I;ENSP00000432794:N21I	.|ENSP00000310491:N21I	E|N	-|-	3|2	2|0	ARHGAP1|ARHGAP1	46674172|46674172	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	1.688000|1.688000	0.37690|0.37690	1.982000|1.982000	0.57802|0.57802	0.454000|0.454000	0.30748|0.30748	GAA|AAC		0.577	ARHGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390472.1		NM_004308	
ARSA	410	hgsc.bcm.edu	37	22	51065093	51065093	+	Silent	SNP	C	C	G	rs368769871		TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr22:51065093C>G	ENST00000547307.1	-	4	1179	c.774G>C	c.(772-774)gtG>gtC	p.V258V	ARSA_ENST00000395619.3_Silent_p.V260V|ARSA_ENST00000453344.2_Silent_p.V174V|ARSA_ENST00000216124.5_Silent_p.V260V|ARSA_ENST00000547805.1_Silent_p.V258V|ARSA_ENST00000395621.3_Silent_p.V260V|ARSA_ENST00000356098.5_Silent_p.V260V			P15289	ARSA_HUMAN	arylsulfatase A	258					autophagy (GO:0006914)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|central nervous system development (GO:0007417)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to methylmercury (GO:0051597)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum lumen (GO:0005788)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|cerebroside-sulfatase activity (GO:0004098)|sulfuric ester hydrolase activity (GO:0008484)			endometrium(1)|large_intestine(1)|lung(5)|pancreas(1)|skin(1)	9		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)	Micafungin(DB01141)|Suramin(DB04786)	TCAGGGTCCCCACAGCTGCAT	0.612																																																	0								C	,,,,	1,4405	2.1+/-5.4	0,1,2202	49.0	48.0	49.0		780,780,780,780,522	-0.6	1.0	22		49	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	ARSA	NM_000487.5,NM_001085425.2,NM_001085426.2,NM_001085427.2,NM_001085428.2	,,,,	0,1,6502	GG,GC,CC		0.0,0.0227,0.0077	,,,,	260/510,260/510,260/510,260/510,174/424	51065093	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	410			X52150	CCDS14100.1, CCDS46736.1, CCDS14100.2	22q13.33	2013-09-19			ENSG00000100299	ENSG00000100299	3.1.6.8	"""Arylsulfatase family"""	713	protein-coding gene	gene with protein product	"""metachromatic leucodystrophy"""	607574				15772092	Standard	NM_000487		Approved		uc003bmz.5	P15289	OTTHUMG00000150180	ENST00000547307.1:c.774G>C	22.37:g.51065093C>G			B2RCA6|B7XD04|F8WCC8|Q6ICI5|Q96CJ0	Silent	SNP	ENST00000547307.1	37																																																																																					0.612	ARSA-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding			NM_000487	
RSRP1	57035	hgsc.bcm.edu	37	1	25569164	25569164	+	Silent	SNP	A	A	C			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr1:25569164A>C	ENST00000243189.7	-	5	1065	c.789T>G	c.(787-789)gcT>gcG	p.A263A	C1orf63_ENST00000417642.2_Silent_p.A264A	NM_020317.3	NP_064713.3	Q9BUV0	RSRP1_HUMAN		263										breast(1)|large_intestine(1)|lung(4)|pancreas(1)	7		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;7.9e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;6.43e-07)|STAD - Stomach adenocarcinoma(196;0.000333)|BRCA - Breast invasive adenocarcinoma(304;0.000443)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.000932)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		TGGCAGCTTTAGCTGATTTTT	0.343																																																	0													133.0	123.0	127.0					1																	25569164		2202	4297	6499	SO:0001819	synonymous_variant	57035																														ENST00000243189.7:c.789T>G	1.37:g.25569164A>C			A8K917|Q49AA4|Q5TH71|Q9GZP6	Silent	SNP	ENST00000243189.7	37	CCDS260.1																																																																																				0.343	C1orf63-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000101966.2			
CDCA7	83879	hgsc.bcm.edu;ucsc.edu	37	2	174223501	174223501	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr2:174223501T>C	ENST00000347703.3	+	2	227	c.83T>C	c.(82-84)aTg>aCg	p.M28T	AC092573.2_ENST00000437243.1_RNA|CDCA7_ENST00000392567.2_Missense_Mutation_p.M28T|CDCA7_ENST00000306721.3_Missense_Mutation_p.M28T|CDCA7_ENST00000410019.3_Intron|CDCA7_ENST00000410101.3_Missense_Mutation_p.M28T	NM_145810.2	NP_665809.1	Q9BWT1	CDCA7_HUMAN	cell division cycle associated 7	28					apoptotic process (GO:0006915)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)	18			OV - Ovarian serous cystadenocarcinoma(117;0.116)			TTGATTTCCATGGAAACCTCG	0.383																																																	0													95.0	97.0	97.0					2																	174223501		2203	4300	6503	SO:0001583	missense	83879			BG354580	CCDS2252.1, CCDS2253.1	2q31.1	2008-02-05			ENSG00000144354	ENSG00000144354			14628	protein-coding gene	gene with protein product		609937				11598121, 12188893	Standard	NM_145810		Approved	FLJ14736, JPO1	uc002uic.1	Q9BWT1	OTTHUMG00000132296	ENST00000347703.3:c.83T>C	2.37:g.174223501T>C	ENSP00000272789:p.Met28Thr		B4DLP8|B4DV66|Q53EW5|Q580W9|Q658K4|Q658N4|Q8NBY9|Q96BV8|Q96SP5	Missense_Mutation	SNP	ENST00000347703.3	37	CCDS2253.1	.	.	.	.	.	.	.	.	.	.	T	15.14	2.743605	0.49151	.	.	ENSG00000144354	ENST00000347703;ENST00000392567;ENST00000306721;ENST00000410101	T;T;T;T	0.55588	0.61;0.51;0.55;0.63	5.77	5.77	0.91146	.	0.036977	0.85682	D	0.000000	T	0.63248	0.2495	L	0.34521	1.04	0.43863	D	0.99646	P;P;D	0.63046	0.745;0.546;0.992	B;B;D	0.71656	0.231;0.154;0.974	T	0.66670	-0.5865	10	0.87932	D	0	-16.9802	16.099	0.81152	0.0:0.0:0.0:1.0	.	28;28;28	B4DV66;Q9BWT1;Q9BWT1-2	.;CDCA7_HUMAN;.	T	28	ENSP00000272789:M28T;ENSP00000376348:M28T;ENSP00000306968:M28T;ENSP00000386656:M28T	ENSP00000306968:M28T	M	+	2	0	CDCA7	173931747	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.237000	0.78164	2.203000	0.70933	0.533000	0.62120	ATG		0.383	CDCA7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255400.1		NM_031942	
CRISP3	10321	hgsc.bcm.edu;ucsc.edu	37	6	49696473	49696473	+	Silent	SNP	G	G	T	rs488132	byFrequency	TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr6:49696473G>T	ENST00000393666.1	-	7	714	c.708C>A	c.(706-708)gcC>gcA	p.A236A	CRISP3_ENST00000263045.4_Silent_p.A249A|CRISP3_ENST00000433368.2_Silent_p.A259A|CRISP3_ENST00000423399.2_Silent_p.A146A|CRISP3_ENST00000371159.4_Silent_p.A267A			P54108	CRIS3_HUMAN	cysteine-rich secretory protein 3	236	ShKT. {ECO:0000255|PROSITE- ProRule:PRU01005}.				defense response (GO:0006952)|innate immune response (GO:0045087)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|specific granule (GO:0042581)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(14)|skin(6)|upper_aerodigestive_tract(1)	27	Lung NSC(77;0.0161)		KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)			AATTGCAGGAGGCCTTGCAAC	0.403													G|||	778	0.155351	0.2413	0.0634	5008	,	,		17608	0.1875		0.1103	False		,,,				2504	0.1176																0								G	,	853,3553	334.9+/-303.7	68,717,1418	186.0	167.0	174.0		777,747	-2.8	0.0	6	dbSNP_83	174	961,7639	209.4+/-250.6	61,839,3400	no	coding-synonymous,coding-synonymous	CRISP3	NM_001190986.1,NM_006061.2	,	129,1556,4818	TT,TG,GG		11.1744,19.36,13.9474	,	259/269,249/259	49696473	1814,11192	2203	4300	6503	SO:0001819	synonymous_variant	10321			X94323	CCDS4929.1, CCDS4929.2, CCDS55019.1	6p12.3	2008-02-05			ENSG00000096006	ENSG00000096006			16904	protein-coding gene	gene with protein product						8665901, 12223513	Standard	NM_006061		Approved	SGP28, CRISP-3, CRS3, dJ442L6.3, Aeg2	uc003ozs.3	P54108	OTTHUMG00000014823	ENST00000393666.1:c.708C>A	6.37:g.49696473G>T			A8K9S1|B2R8I8|Q15512|Q3MJ82|Q53FA9|Q5JW83|Q9H108	Silent	SNP	ENST00000393666.1	37																																																																																					0.403	CRISP3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_006061	
CRMP1	1400	hgsc.bcm.edu	37	4	5827342	5827342	+	Silent	SNP	A	A	T			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr4:5827342A>T	ENST00000397890.2	-	13	1720	c.1506T>A	c.(1504-1506)ccT>ccA	p.P502P	CRMP1_ENST00000324989.7_Silent_p.P616P|EVC_ENST00000382674.2_Intron|CRMP1_ENST00000512574.1_Silent_p.P500P|CRMP1_ENST00000511535.1_5'UTR	NM_001313.3	NP_001304.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	502					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		CCTCGTACACAGGACCGTCAT	0.522																																																	0													200.0	181.0	188.0					4																	5827342		2203	4300	6503	SO:0001819	synonymous_variant	1400			D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000397890.2:c.1506T>A	4.37:g.5827342A>T			A0EJG6|Q13024|Q4W5F1|Q96TC8	Silent	SNP	ENST00000397890.2	37	CCDS43207.1																																																																																				0.522	CRMP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358871.1		NM_001313	
CROCC	9696	hgsc.bcm.edu	37	1	17295771	17295771	+	Missense_Mutation	SNP	G	G	A	rs139786167	byFrequency	TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr1:17295771G>A	ENST00000375541.5	+	32	5306	c.5237G>A	c.(5236-5238)cGg>cAg	p.R1746Q		NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		AACAGCACCCGGGACAAGAAC	0.667													G|||	12	0.00239617	0.0	0.0086	5008	,	,		16978	0.0		0.006	False		,,,				2504	0.0																0								G	GLN/ARG	5,4401	9.9+/-24.2	0,5,2198	27.0	29.0	28.0		5237	2.3	1.0	1	dbSNP_134	28	50,8550	29.6+/-80.5	0,50,4250	no	missense	CROCC	NM_014675.3	43	0,55,6448	AA,AG,GG		0.5814,0.1135,0.4229	benign	1746/2018	17295771	55,12951	2203	4300	6503	SO:0001583	missense	9696			AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.5237G>A	1.37:g.17295771G>A	ENSP00000364691:p.Arg1746Gln			Missense_Mutation	SNP	ENST00000375541.5	37	CCDS30616.1	8	0.003663003663003663	0	0.0	2	0.0055248618784530384	0	0.0	6	0.0079155672823219	G	6.098	0.386432	0.11524	0.001135	0.005814	ENSG00000058453	ENST00000375541;ENST00000445545	T	0.07114	3.22	4.62	2.27	0.28462	.	.	.	.	.	T	0.01523	0.0049	N	0.01242	-0.935	0.24058	N	0.996021	B;B;B	0.27882	0.189;0.192;0.178	B;B;B	0.25884	0.027;0.024;0.064	T	0.42050	-0.9474	9	0.02654	T	1	.	7.2666	0.26234	0.809:0.0:0.191:0.0	.	1627;1049;1746	B1AKD8;Q5TZA2-2;Q5TZA2	.;.;CROCC_HUMAN	Q	1746;1627	ENSP00000364691:R1746Q	ENSP00000364691:R1746Q	R	+	2	0	CROCC	17168358	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	1.478000	0.35442	0.734000	0.32515	-0.573000	0.04149	CGG		0.667	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006249.2		NM_014675	
DLEC1	9940	hgsc.bcm.edu;ucsc.edu	37	3	38138227	38138227	+	Splice_Site	SNP	A	A	G			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr3:38138227A>G	ENST00000308059.6	+	15	2360	c.2339A>G	c.(2338-2340)aAg>aGg	p.K780R	DLEC1_ENST00000452631.2_Splice_Site_p.K780R|DLEC1_ENST00000346219.3_Splice_Site_p.K780R					deleted in lung and esophageal cancer 1											NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(3)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	51				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		AAGGCTTTTAAGGTAGGTCAT	0.512																																																	0													119.0	118.0	119.0					3																	38138227		2015	4203	6218	SO:0001630	splice_region_variant	9940			AB020522	CCDS2672.2	3p21.3	2014-07-31			ENSG00000008226	ENSG00000008226			2899	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 81"""	604050				10213508	Standard	XM_005265630		Approved	DLC1, CFAP81	uc003chp.1	Q9Y238	OTTHUMG00000131085	ENST00000308059.6:c.2340+1A>G	3.37:g.38138227A>G				Missense_Mutation	SNP	ENST00000308059.6	37	CCDS2672.2	.	.	.	.	.	.	.	.	.	.	A	11.30	1.598856	0.28445	.	.	ENSG00000008226	ENST00000308059;ENST00000346219;ENST00000452631	T;T;T	0.05513	3.44;3.43;3.67	4.93	3.77	0.43336	.	0.374299	0.26116	N	0.026253	T	0.11281	0.0275	L	0.60455	1.87	0.43819	D	0.996389	P;P;P	0.48640	0.913;0.824;0.913	P;B;P	0.50570	0.591;0.284;0.644	T	0.17048	-1.0382	10	0.22109	T	0.4	-30.8341	9.829	0.40930	0.9161:0.0:0.0839:0.0	.	780;780;780	F8W6T4;Q9Y238-3;Q9Y238	.;.;DLEC1_HUMAN	R	780	ENSP00000308597:K780R;ENSP00000315914:K780R;ENSP00000410427:K780R	ENSP00000308597:K780R	K	+	2	0	DLEC1	38113231	1.000000	0.71417	0.965000	0.40720	0.237000	0.25408	4.602000	0.61098	0.828000	0.34709	0.533000	0.62120	AAG		0.512	DLEC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253745.3		NM_007337	Missense_Mutation
DNAJC15	29103	hgsc.bcm.edu;ucsc.edu	37	13	43652746	43652746	+	Splice_Site	SNP	A	A	G			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr13:43652746A>G	ENST00000379221.2	+	4	658		c.e4-1		DNAJC15_ENST00000474320.1_Splice_Site	NM_013238.2	NP_037370.2	Q9Y5T4	DJC15_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 15						cellular response to starvation (GO:0009267)|negative regulation of mitochondrial electron transport, NADH to ubiquinone (GO:1902957)|negative regulation of protein complex assembly (GO:0031333)|protein transport (GO:0015031)|regulation of lipid metabolic process (GO:0019216)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(2)|kidney(1)|urinary_tract(1)	4		Lung NSC(96;4.3e-06)|Breast(139;0.00869)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		GBM - Glioblastoma multiforme(144;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0737)		TTTCCTATACAGAGCTTTTCA	0.393																																																	0													147.0	137.0	141.0					13																	43652746		2203	4300	6503	SO:0001630	splice_region_variant	29103			AF126743	CCDS9388.1	13q14.1	2011-09-02	2005-06-30	2005-06-30	ENSG00000120675	ENSG00000120675		"""Heat shock proteins / DNAJ (HSP40)"""	20325	protein-coding gene	gene with protein product		615339	"""DnaJ (Hsp40) homolog, subfamily D, member 1"""	DNAJD1		11358853	Standard	NM_013238		Approved	MCJ	uc001uyy.3	Q9Y5T4	OTTHUMG00000016813	ENST00000379221.2:c.235-1A>G	13.37:g.43652746A>G			B2R4L0|Q5T219|Q6X963	Splice_Site	SNP	ENST00000379221.2	37	CCDS9388.1	.	.	.	.	.	.	.	.	.	.	A	13.12	2.143372	0.37825	.	.	ENSG00000120675	ENST00000379221	.	.	.	5.98	4.82	0.62117	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.5363	0.50639	0.9307:0.0:0.0693:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DNAJC15	42550746	1.000000	0.71417	0.982000	0.44146	0.373000	0.29922	5.716000	0.68437	2.289000	0.77006	0.533000	0.62120	.		0.393	DNAJC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044709.2		NM_013238	Intron
DOCK10	55619	hgsc.bcm.edu;ucsc.edu	37	2	225761077	225761077	+	Silent	SNP	A	A	G			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr2:225761077A>G	ENST00000258390.7	-	4	418	c.351T>C	c.(349-351)agT>agC	p.S117S	DOCK10_ENST00000409592.3_Silent_p.S111S|DOCK10_ENST00000474102.1_5'UTR	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	117					regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		GCCACTGGGAACTATAAAATT	0.383																																																	0													47.0	42.0	43.0					2																	225761077		1796	4064	5860	SO:0001819	synonymous_variant	55619			AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.351T>C	2.37:g.225761077A>G			B3FL70|O75178|Q9NW06|Q9NXI8	Silent	SNP	ENST00000258390.7	37	CCDS46528.1																																																																																				0.383	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331246.1			
FAAH2	158584	hgsc.bcm.edu;ucsc.edu	37	X	57337126	57337126	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chrX:57337126G>A	ENST00000374900.4	+	3	496	c.376G>A	c.(376-378)Gtt>Att	p.V126I		NM_174912.3	NP_777572.2	Q6GMR7	FAAH2_HUMAN	fatty acid amide hydrolase 2	126						integral component of membrane (GO:0016021)	carbon-nitrogen ligase activity, with glutamine as amido-N-donor (GO:0016884)|hydrolase activity (GO:0016787)			endometrium(2)|large_intestine(4)|lung(10)|ovary(3)|upper_aerodigestive_tract(3)	22						CTTCCTTGGGGTTCCTTTGAC	0.413										HNSCC(52;0.14)																																							0													77.0	68.0	71.0					X																	57337126		2203	4300	6503	SO:0001583	missense	158584			AK055766	CCDS14375.1	Xp11.1	2008-02-05	2006-11-24	2006-11-24	ENSG00000165591	ENSG00000165591			26440	protein-coding gene	gene with protein product		300654	"""amidase domain containing"""	AMDD		17015445	Standard	NM_174912		Approved	RP11-479E16.1, FLJ31204, FAAH-2	uc004dvc.3	Q6GMR7	OTTHUMG00000021684	ENST00000374900.4:c.376G>A	X.37:g.57337126G>A	ENSP00000364035:p.Val126Ile		Q86VT2|Q96N98	Missense_Mutation	SNP	ENST00000374900.4	37	CCDS14375.1	.	.	.	.	.	.	.	.	.	.	G	15.11	2.737364	0.49045	.	.	ENSG00000165591	ENST00000374900	T	0.54866	0.55	2.34	2.34	0.29019	Amidase signature domain (2);	0.000000	0.64402	U	0.000006	T	0.58637	0.2136	L	0.53729	1.69	0.38084	D	0.936775	D	0.60575	0.988	D	0.64237	0.923	T	0.57429	-0.7813	10	0.25106	T	0.35	.	8.0339	0.30480	0.0:0.0:1.0:0.0	.	126	Q6GMR7	FAAH2_HUMAN	I	126	ENSP00000364035:V126I	ENSP00000364035:V126I	V	+	1	0	FAAH2	57353851	1.000000	0.71417	0.996000	0.52242	0.924000	0.55760	2.641000	0.46587	0.894000	0.36317	0.415000	0.27848	GTT		0.413	FAAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056919.1		NM_174912	
FEM1C	56929	hgsc.bcm.edu	37	5	114860558	114860558	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr5:114860558T>C	ENST00000274457.3	-	3	1862	c.1301A>G	c.(1300-1302)gAc>gGc	p.D434G		NM_020177.2	NP_064562.1	Q96JP0	FEM1C_HUMAN	fem-1 homolog c (C. elegans)	434			D -> N (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				breast(5)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|liver(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	18		all_cancers(142;0.000575)|all_epithelial(76;9.98e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;2.5e-07)|Epithelial(69;2.66e-07)|all cancers(49;1.39e-05)		CTGTAATGGGTCAGCTGGACA	0.383																																																	0													82.0	84.0	84.0					5																	114860558		2199	4299	6498	SO:0001583	missense	56929				CCDS4118.1	5q22	2013-01-10	2006-11-08		ENSG00000145780	ENSG00000145780		"""Ankyrin repeat domain containing"""	16933	protein-coding gene	gene with protein product		608767				14527725, 11733146	Standard	NM_020177		Approved	KIAA1785, EUROIMAGE686608, EUROIMAGE783647, FEM1A	uc003krb.1	Q96JP0	OTTHUMG00000128895	ENST00000274457.3:c.1301A>G	5.37:g.114860558T>C	ENSP00000274457:p.Asp434Gly		B2RE47|Q8N3V8|Q9H704|Q9NPL6|Q9NPL9	Missense_Mutation	SNP	ENST00000274457.3	37	CCDS4118.1	.	.	.	.	.	.	.	.	.	.	T	14.59	2.580294	0.46006	.	.	ENSG00000145780	ENST00000274457	T	0.57436	0.4	5.55	5.55	0.83447	Ankyrin repeat-containing domain (2);	0.000000	0.85682	D	0.000000	T	0.62696	0.2449	M	0.77820	2.39	0.53688	D	0.999972	D	0.52996	0.957	P	0.49140	0.601	T	0.64778	-0.6327	10	0.34782	T	0.22	-26.7803	15.6943	0.77481	0.0:0.0:0.0:1.0	.	434	Q96JP0	FEM1C_HUMAN	G	434	ENSP00000274457:D434G	ENSP00000274457:D434G	D	-	2	0	FEM1C	114888457	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	6.245000	0.72398	2.103000	0.63969	0.533000	0.62120	GAC		0.383	FEM1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250857.3		NM_020177	
FGB	2244	hgsc.bcm.edu	37	4	155487151	155487151	+	Splice_Site	SNP	G	G	T			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr4:155487151G>T	ENST00000302068.4	+	2	369	c.306G>T	c.(304-306)ctG>ctT	p.L102L	FGB_ENST00000509493.1_Intron|FGB_ENST00000502545.1_3'UTR	NM_005141.4	NP_005132.2	P02675	FIBB_HUMAN	fibrinogen beta chain	102			Missing (in New York-1). {ECO:0000269|PubMed:3156856}.		blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|cellular response to interleukin-1 (GO:0071347)|cellular response to leptin stimulus (GO:0044320)|extracellular matrix organization (GO:0030198)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	chaperone binding (GO:0051087)|structural molecule activity (GO:0005198)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(2)|lung(22)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	ACCCAGACCTGGTGGGTGCAC	0.522																																					NSCLC(106;1133 1613 21870 46110 52656)												0													32.0	29.0	30.0					4																	155487151		2202	4299	6501	SO:0001630	splice_region_variant	2244				CCDS3786.1	4q28	2014-09-17			ENSG00000171564	ENSG00000171564		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3662	protein-coding gene	gene with protein product		134830	"""fibrinogen, B beta polypeptide"""				Standard	NM_005141		Approved		uc003ioa.4	P02675	OTTHUMG00000150331	ENST00000302068.4:c.306+1G>T	4.37:g.155487151G>T			A0JLR9|B2R7G3|Q32Q65|Q3KPF2	Silent	SNP	ENST00000302068.4	37	CCDS3786.1																																																																																				0.522	FGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317595.1		NM_005141	Silent
FNIP1	96459	hgsc.bcm.edu;ucsc.edu	37	5	131039810	131039810	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr5:131039810T>C	ENST00000510461.1	-	10	1159	c.1064A>G	c.(1063-1065)cAt>cGt	p.H355R	FNIP1_ENST00000511848.1_Missense_Mutation_p.H355R|FNIP1_ENST00000307968.7_Missense_Mutation_p.H327R|CTC-432M15.3_ENST00000514667.1_Intron|FNIP1_ENST00000307954.8_Missense_Mutation_p.H310R	NM_133372.2	NP_588613	Q8TF40	FNIP1_HUMAN	folliculin interacting protein 1	355					cellular response to starvation (GO:0009267)|immature B cell differentiation (GO:0002327)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell apoptotic process (GO:0002904)|positive regulation of GTPase activity (GO:0043547)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|regulation of pro-B cell differentiation (GO:2000973)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34		all_cancers(142;0.00347)|Lung NSC(810;0.106)|all_lung(232;0.123)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0665)		GAGAGGAAAATGTGAAAAAAA	0.289																																																	0													43.0	47.0	46.0					5																	131039810		2201	4295	6496	SO:0001583	missense	96459			DQ145719	CCDS34226.1, CCDS34227.1	5q23.3	2014-01-28				ENSG00000217128			29418	protein-coding gene	gene with protein product		610594				11853319, 17028174	Standard	NM_001008738		Approved	KIAA1961		Q8TF40		ENST00000510461.1:c.1064A>G	5.37:g.131039810T>C	ENSP00000421985:p.His355Arg		D6RJH5|Q86T47|Q9BUT0	Missense_Mutation	SNP	ENST00000510461.1	37	CCDS34227.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.472756	0.84640	.	.	ENSG00000217128	ENST00000307968;ENST00000307954;ENST00000544351;ENST00000510461;ENST00000511848	T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19	5.75	5.75	0.90469	.	.	.	.	.	T	0.81564	0.4849	M	0.84846	2.72	0.80722	D	1	D;D;D;D	0.89917	1.0;0.996;1.0;1.0	D;D;D;D	0.97110	0.996;0.99;0.996;1.0	D	0.84761	0.0762	9	0.87932	D	0	-8.4788	16.0664	0.80878	0.0:0.0:0.0:1.0	.	355;355;327;355	A8K8V8;Q8TF40-2;Q8TF40-3;Q8TF40	.;.;.;FNIP1_HUMAN	R	327;310;115;355;355	ENSP00000309266:H327R;ENSP00000310453:H310R;ENSP00000421985:H355R;ENSP00000425619:H355R	ENSP00000310453:H310R	H	-	2	0	FNIP1	131067709	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.004000	0.88535	2.201000	0.70794	0.533000	0.62120	CAT		0.289	FNIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370077.1		NM_133372	
FZR1	51343	hgsc.bcm.edu	37	19	3532608	3532608	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr19:3532608A>G	ENST00000395095.3	+	10	1202	c.1202A>G	c.(1201-1203)cAa>cGa	p.Q401R	FZR1_ENST00000313639.8_Missense_Mutation_p.Q312R|FZR1_ENST00000441788.2_Missense_Mutation_p.Q401R	NM_001136198.1	NP_001129670.1	Q9UM11	FZR_HUMAN	fizzy/cell division cycle 20 related 1 (Drosophila)	401					activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|DNA repair (GO:0006281)|G2 DNA damage checkpoint (GO:0031572)|lens fiber cell differentiation (GO:0070306)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell aging (GO:0090344)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of meiosis (GO:0040020)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(1)|kidney(4)|liver(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)		ACGGGCTCCCAAGTGTGCAAT	0.667																																																	0													37.0	36.0	36.0					19																	3532608		2202	4300	6502	SO:0001583	missense	51343			AF083810	CCDS12109.1, CCDS45916.1, CCDS45917.1	19p13.3	2013-01-10				ENSG00000105325		"""WD repeat domain containing"""	24824	protein-coding gene	gene with protein product		603619				9734353, 11003657	Standard	NM_016263		Approved	HCDH1, CDH1, HCDH, FZR, FZR2, KIAA1242, CDC20C	uc010dtk.2	Q9UM11		ENST00000395095.3:c.1202A>G	19.37:g.3532608A>G	ENSP00000378529:p.Gln401Arg		O75869|Q86U66|Q96NW8|Q9UI96|Q9ULH8|Q9UM10|Q9UNQ1|Q9Y2T8	Missense_Mutation	SNP	ENST00000395095.3	37	CCDS45916.1	.	.	.	.	.	.	.	.	.	.	a	21.3	4.128906	0.77549	.	.	ENSG00000105325	ENST00000441788;ENST00000395095;ENST00000313639	T;T;T	0.28454	1.61;1.61;5.03	4.86	4.86	0.63082	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.71921	0.3397	H	0.99090	4.425	0.80722	D	1	D;D;P	0.76494	0.994;0.999;0.915	D;D;P	0.75484	0.972;0.986;0.635	D	0.83983	0.0333	10	0.87932	D	0	-20.3574	13.3497	0.60595	1.0:0.0:0.0:0.0	.	401;312;401	Q9UM11;Q9UM11-3;Q9UM11-2	FZR_HUMAN;.;.	R	401;401;312	ENSP00000410369:Q401R;ENSP00000378529:Q401R;ENSP00000321800:Q312R	ENSP00000321800:Q312R	Q	+	2	0	FZR1	3483608	1.000000	0.71417	0.998000	0.56505	0.614000	0.37383	9.003000	0.93577	1.840000	0.53500	0.439000	0.28862	CAA		0.667	FZR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452869.2		NM_016263	
HFM1	164045	hgsc.bcm.edu	37	1	91726880	91726880	+	Silent	SNP	C	C	T			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr1:91726880C>T	ENST00000370425.3	-	39	4373	c.4275G>A	c.(4273-4275)aaG>aaA	p.K1425K	HFM1_ENST00000462405.1_5'UTR|Y_RNA_ENST00000384090.1_RNA|HFM1_ENST00000370424.3_Silent_p.K1104K|HFM1_ENST00000294696.5_3'UTR	NM_001017975.3	NP_001017975.3	A2PYH4	HFM1_HUMAN	HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)	1425					resolution of meiotic recombination intermediates (GO:0000712)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(33)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	75		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		CCAATAAAGACTTCATTTCAT	0.254																																																	0													24.0	21.0	22.0					1																	91726880		1758	4015	5773	SO:0001819	synonymous_variant	164045			AB204867	CCDS30769.2	1p22.2	2008-03-26			ENSG00000162669	ENSG00000162669			20193	protein-coding gene	gene with protein product		615684	"""SEC63 domain containing 1"""	SEC63D1		14702039, 17286053	Standard	XM_006710395		Approved	MER3, FLJ39011, FLJ36760	uc001doa.4	A2PYH4	OTTHUMG00000010093	ENST00000370425.3:c.4275G>A	1.37:g.91726880C>T			B1B0B6|Q8N9Q0	Silent	SNP	ENST00000370425.3	37	CCDS30769.2																																																																																				0.254	HFM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316716.2		NM_001017975	
GSTM5	2949	hgsc.bcm.edu	37	1	110257831	110257831	+	Missense_Mutation	SNP	T	T	C	rs2227963	byFrequency	TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr1:110257831T>C	ENST00000256593.3	+	7	594	c.536T>C	c.(535-537)cTa>cCa	p.L179P	GSTM5_ENST00000492718.1_3'UTR|GSTM5_ENST00000369812.5_Missense_Mutation_p.L198P|GSTM5_ENST00000369813.1_Missense_Mutation_p.L138P	NM_000851.3	NP_000842.2	P46439	GSTM5_HUMAN	glutathione S-transferase mu 5	179	GST C-terminal.		L -> P (in dbSNP:rs2227963).		glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	glutathione transferase activity (GO:0004364)	p.L179P(4)		NS(1)|central_nervous_system(6)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	21		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Colorectal(144;0.0131)|all cancers(265;0.0252)|Epithelial(280;0.0265)|Lung(183;0.0425)|COAD - Colon adenocarcinoma(174;0.0474)|LUSC - Lung squamous cell carcinoma(189;0.228)	Glutathione(DB00143)	GACGCCTTCCTAAACTTGAAG	0.478													T|||	703	0.140375	0.3941	0.0663	5008	,	,		19912	0.001		0.0845	False		,,,				2504	0.0511																4	Substitution - Missense(4)	central_nervous_system(3)|skin(1)						T	PRO/LEU	1097,3309		276,545,1382	189.0	205.0	199.0		536	3.1	0.7	1	dbSNP_98	199	399,8201		16,367,3917	yes	missense	GSTM5	NM_000851.3	98	292,912,5299	CC,CT,TT		4.6395,24.8979,11.5024	benign	179/219	110257831	1496,11510	2203	4300	6503	SO:0001583	missense	2949			L02321	CCDS811.1	1p13.3	2012-06-21	2008-11-26		ENSG00000134201	ENSG00000134201	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4637	protein-coding gene	gene with protein product		138385	"""glutathione S-transferase M5"""			8473333	Standard	NM_000851		Approved		uc001dyn.3	P46439	OTTHUMG00000011644	ENST00000256593.3:c.536T>C	1.37:g.110257831T>C	ENSP00000256593:p.Leu179Pro		A8K0V8|Q6PD78	Missense_Mutation	SNP	ENST00000256593.3	37	CCDS811.1	295	0.13507326007326007	204	0.4146341463414634	26	0.0718232044198895	0	0.0	65	0.08575197889182058	t	0.004	-2.358658	0.00214	0.248979	0.046395	ENSG00000134201	ENST00000256593;ENST00000369813;ENST00000369812	T;T;T	0.00691	5.84;5.84;5.84	5.02	3.11	0.35812	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Glutathione S-transferase, C-terminal (1);	0.335277	0.25598	N	0.029571	T	0.00039	0.0001	N	0.00005	-3.3	0.27811	P	0.9421374	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.0	T	0.07673	-1.0760	9	0.02654	T	1	.	6.4549	0.21924	0.317:0.597:0.0:0.0859	rs2227963;rs61309452	138;179	Q5T8Q9;P46439	.;GSTM5_HUMAN	P	179;138;198	ENSP00000256593:L179P;ENSP00000358828:L138P;ENSP00000358827:L198P	ENSP00000256593:L179P	L	+	2	0	GSTM5	110059354	0.997000	0.39634	0.702000	0.30337	0.065000	0.16274	3.314000	0.51943	0.584000	0.29591	-0.206000	0.12725	CTA		0.478	GSTM5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000032200.1		NM_000851	
HUWE1	10075	hgsc.bcm.edu	37	X	53622278	53622278	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chrX:53622278C>A	ENST00000342160.3	-	29	3706	c.3249G>T	c.(3247-3249)agG>agT	p.R1083S	HUWE1_ENST00000262854.6_Missense_Mutation_p.R1083S|HUWE1_ENST00000218328.8_Missense_Mutation_p.R1083S			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	1083					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.R946S(2)		NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						CATGATGGCTCCTTCTCTGGC	0.527																																																	2	Substitution - Missense(2)	breast(2)											96.0	66.0	76.0					X																	53622278		2203	4300	6503	SO:0001583	missense	10075			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.3249G>T	X.37:g.53622278C>A	ENSP00000340648:p.Arg1083Ser		O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	37	CCDS35301.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.54|13.54	2.266494|2.266494	0.40095|0.40095	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000427052|ENST00000342160;ENST00000262854;ENST00000218328	.|T;T;T	.|0.55413	.|0.82;0.82;0.52	5.67|5.67	-2.12|-2.12	0.07165|0.07165	.|.	.|0.055917	.|0.64402	.|D	.|0.000002	.|T	.|0.37625	.|0.1010	L|L	0.43152|0.43152	1.355|1.355	0.45118|0.45118	D|D	0.99813|0.99813	.|P	.|0.38677	.|0.642	.|B	.|0.31442	.|0.13	.|T	.|0.18209	.|-1.0344	.|10	.|0.56958	.|D	.|0.05	.|.	12.9252|12.9252	0.58257|0.58257	0.0:0.3812:0.0:0.6188|0.0:0.3812:0.0:0.6188	.|.	.|1083	.|Q7Z6Z7	.|HUWE1_HUMAN	X|S	117|1083	.|ENSP00000340648:R1083S;ENSP00000262854:R1083S;ENSP00000218328:R1083S	.|ENSP00000218328:R1083S	E|R	-|-	1|3	0|2	HUWE1|HUWE1	53639003|53639003	0.855000|0.855000	0.29742|0.29742	0.829000|0.829000	0.32907|0.32907	0.826000|0.826000	0.46750|0.46750	-0.184000|-0.184000	0.09698|0.09698	-0.623000|-0.623000	0.05618|0.05618	-0.926000|-0.926000	0.02714|0.02714	GAG|AGG		0.527	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1		XM_497119	
IDH3G	3421	hgsc.bcm.edu	37	X	153055662	153055662	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chrX:153055662T>A	ENST00000217901.5	-	4	417	c.221A>T	c.(220-222)aAg>aTg	p.K74M	IDH3G_ENST00000427365.2_Missense_Mutation_p.K16M|IDH3G_ENST00000497043.1_5'UTR|IDH3G_ENST00000370093.1_Missense_Mutation_p.K74M|IDH3G_ENST00000370092.3_Missense_Mutation_p.K74M	NM_004135.3	NP_004126.1	P51553	IDH3G_HUMAN	isocitrate dehydrogenase 3 (NAD+) gamma	74					carbohydrate metabolic process (GO:0005975)|cellular metabolic process (GO:0044237)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|isocitrate dehydrogenase (NAD+) activity (GO:0004449)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|prostate(1)	17	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					GAAGACGGACTTGACATGCAG	0.637																																																	0													106.0	77.0	87.0					X																	153055662		2203	4300	6503	SO:0001583	missense	3421				CCDS14730.1, CCDS44019.1	Xq28	2008-02-05			ENSG00000067829	ENSG00000067829	1.1.1.41		5386	protein-coding gene	gene with protein product		300089				9286695	Standard	NM_004135		Approved		uc004fip.4	P51553	OTTHUMG00000024219	ENST00000217901.5:c.221A>T	X.37:g.153055662T>A	ENSP00000217901:p.Lys74Met		E9PDD5|Q9BUU5	Missense_Mutation	SNP	ENST00000217901.5	37	CCDS14730.1	.	.	.	.	.	.	.	.	.	.	T	12.68	2.011858	0.35511	.	.	ENSG00000067829	ENST00000370092;ENST00000217901;ENST00000370093;ENST00000427365;ENST00000444450	T;T;T;T;T	0.68765	-0.35;-0.35;-0.35;-0.35;-0.35	4.72	4.72	0.59763	Isopropylmalate dehydrogenase-like domain (2);	0.100855	0.64402	D	0.000002	T	0.78978	0.4369	M	0.72894	2.215	0.39463	D	0.96759	D;D	0.76494	0.999;0.999	D;D	0.72075	0.968;0.976	T	0.80723	-0.1255	10	0.46703	T	0.11	.	12.5502	0.56222	0.0:0.0:0.0:1.0	.	74;74	E9PDD5;P51553	.;IDH3G_HUMAN	M	74;74;74;16;51	ENSP00000359110:K74M;ENSP00000217901:K74M;ENSP00000359111:K74M;ENSP00000408529:K16M;ENSP00000401862:K51M	ENSP00000217901:K74M	K	-	2	0	IDH3G	152708856	1.000000	0.71417	0.991000	0.47740	0.050000	0.14768	2.203000	0.42752	1.670000	0.50864	0.430000	0.28490	AAG		0.637	IDH3G-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061084.27			
IFFO2	126917	hgsc.bcm.edu	37	1	19236957	19236957	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr1:19236957C>A	ENST00000455833.2	-	8	1680	c.1327G>T	c.(1327-1329)Gcc>Tcc	p.A443S	RP13-279N23.2_ENST00000494072.3_Missense_Mutation_p.G221V	NM_001136265.1	NP_001129737.1	Q5TF58	IFFO2_HUMAN	intermediate filament family orphan 2	443						intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)	2						TTGGCTGTGGCCAGCTCGAGC	0.582																																																	0													106.0	103.0	104.0					1																	19236957		692	1591	2283	SO:0001583	missense	126917			AK024480, AL080251	CCDS44076.1	1p36.13	2013-10-11			ENSG00000169991	ENSG00000169991		"""Intermediate filament family orphans"""	27006	protein-coding gene	gene with protein product						14702039	Standard	NM_001136265		Approved		uc001bbd.2	Q5TF58	OTTHUMG00000002499	ENST00000455833.2:c.1327G>T	1.37:g.19236957C>A	ENSP00000387941:p.Ala443Ser		Q9H7K0	Missense_Mutation	SNP	ENST00000455833.2	37	CCDS44076.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.5|26.5	4.747261|4.747261	0.89663|0.89663	.|.	.|.	ENSG00000169991|ENSG00000169991	ENST00000304963;ENST00000455833;ENST00000355609|ENST00000416166	D;T|.	0.88664|.	-2.41;2.52|.	4.32|4.32	4.32|4.32	0.51571|0.51571	Filament (1);|.	0.052058|.	0.85682|.	D|.	0.000000|.	T|T	0.69967|0.69967	0.3170|0.3170	L|L	0.56769|0.56769	1.78|1.78	0.51233|0.51233	D|D	0.999915|0.999915	D|.	0.69078|.	0.997|.	D|.	0.80764|.	0.994|.	T|T	0.68930|0.68930	-0.5279|-0.5279	10|5	0.62326|.	D|.	0.03|.	.|.	15.9368|15.9368	0.79717|0.79717	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	443|.	Q5TF58|.	IFFO2_HUMAN|.	S|C	387;443;14|184	ENSP00000387941:A443S;ENSP00000347820:A14S|.	ENSP00000305144:A387S|.	A|W	-|-	1|3	0|0	IFFO2|IFFO2	19109544|19109544	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.977000|0.977000	0.68977|0.68977	7.646000|7.646000	0.83445|0.83445	2.414000|2.414000	0.81942|0.81942	0.655000|0.655000	0.94253|0.94253	GCC|TGG		0.582	IFFO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007099.2		NM_001136265	
KCNAB3	9196	hgsc.bcm.edu	37	17	7827771	7827771	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr17:7827771A>T	ENST00000303790.2	-	9	672	c.673T>A	c.(673-675)Tac>Aac	p.Y225N		NM_004732.3	NP_004723.2	O43448	KCAB3_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 3	225					potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|endometrium(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)	8		Prostate(122;0.157)				GTCCCCCAGTATAGGGCCAGG	0.552																																																	0													102.0	88.0	93.0					17																	7827771		2203	4300	6503	SO:0001583	missense	9196			AF016411	CCDS11124.1	17p13.1	2006-11-29			ENSG00000170049	ENSG00000170049		"""Potassium channels"", ""Aldo-keto reductases"""	6230	protein-coding gene	gene with protein product		604111				9857044	Standard	NM_004732		Approved	AKR6A9, KCNA3B	uc002gjm.2	O43448	OTTHUMG00000108170	ENST00000303790.2:c.673T>A	17.37:g.7827771A>T	ENSP00000302719:p.Tyr225Asn		Q4VAW0	Missense_Mutation	SNP	ENST00000303790.2	37	CCDS11124.1	.	.	.	.	.	.	.	.	.	.	A	25.6	4.650966	0.87958	.	.	ENSG00000170049	ENST00000303790	T	0.25579	1.79	5.69	5.69	0.88448	NADP-dependent oxidoreductase domain (3);	0.000000	0.85682	D	0.000000	T	0.67050	0.2852	H	0.97635	4.045	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80195	-0.1483	10	0.87932	D	0	.	15.9373	0.79720	1.0:0.0:0.0:0.0	.	225	O43448	KCAB3_HUMAN	N	225	ENSP00000302719:Y225N	ENSP00000302719:Y225N	Y	-	1	0	KCNAB3	7768496	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.339000	0.96797	2.173000	0.68751	0.459000	0.35465	TAC		0.552	KCNAB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226974.1		NM_004732	
KIAA1211	57482	hgsc.bcm.edu	37	4	57182389	57182389	+	Silent	SNP	C	C	T			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr4:57182389C>T	ENST00000504228.1	+	6	2826	c.2721C>T	c.(2719-2721)ccC>ccT	p.P907P	KIAA1211_ENST00000541073.1_Silent_p.P900P|KIAA1211_ENST00000264229.6_Silent_p.P907P			Q6ZU35	K1211_HUMAN	KIAA1211	907										endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					CATCCCTCCCCCAAGAGCGGA	0.682																																																	0													36.0	48.0	44.0					4																	57182389		2121	4248	6369	SO:0001819	synonymous_variant	57482			AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.2721C>T	4.37:g.57182389C>T			Q9NTE2|Q9NTP8|Q9ULK9	Silent	SNP	ENST00000504228.1	37	CCDS43230.1																																																																																				0.682	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362097.2		NM_020722	
KIAA1217	56243	hgsc.bcm.edu	37	10	24832825	24832825	+	Silent	SNP	G	G	A			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr10:24832825G>A	ENST00000376454.3	+	19	4656	c.4626G>A	c.(4624-4626)gaG>gaA	p.E1542E	KIAA1217_ENST00000396446.1_Intron|KIAA1217_ENST00000458595.1_Intron|KIAA1217_ENST00000376462.1_Intron|KIAA1217_ENST00000307544.6_Intron|KIAA1217_ENST00000376451.2_Silent_p.E1225E|KIAA1217_ENST00000376452.3_Intron|KIAA1217_ENST00000396445.1_Intron	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	1542					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						ACAGAACGGAGCTGAACAAGT	0.493																																																	0													80.0	78.0	79.0					10																	24832825		2203	4300	6503	SO:0001819	synonymous_variant	56243			BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.4626G>A	10.37:g.24832825G>A			A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Silent	SNP	ENST00000376454.3	37	CCDS31165.1																																																																																				0.493	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047223.2		NM_019590	
LAMC3	10319	hgsc.bcm.edu	37	9	133942399	133942399	+	Silent	SNP	C	C	T			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr9:133942399C>T	ENST00000361069.4	+	14	2533	c.2400C>T	c.(2398-2400)ctC>ctT	p.L800L	LAMC3_ENST00000480883.1_Intron	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	800	Laminin EGF-like 7. {ECO:0000255|PROSITE- ProRule:PRU00460}.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		CGCTGGGGCTCTTTGGGCACC	0.652																																																	0													49.0	49.0	49.0					9																	133942399		2203	4300	6503	SO:0001819	synonymous_variant	10319			AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.2400C>T	9.37:g.133942399C>T			B1APX9|B1APY0|Q59H72	Silent	SNP	ENST00000361069.4	37	CCDS6938.1																																																																																				0.652	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054717.3		NM_006059	
LRP12	29967	hgsc.bcm.edu;ucsc.edu	37	8	105503566	105503566	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr8:105503566C>T	ENST00000276654.5	-	7	2023	c.1915G>A	c.(1915-1917)Gag>Aag	p.E639K	LRP12_ENST00000424843.2_Missense_Mutation_p.E620K|LRP12_ENST00000518375.1_5'UTR	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	639					endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			TGATTTCTCTCAGGTTCTCTA	0.438																																																	0													84.0	81.0	82.0					8																	105503566		2203	4300	6503	SO:0001583	missense	29967			AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.1915G>A	8.37:g.105503566C>T	ENSP00000276654:p.Glu639Lys		A8K137|B4DRQ2	Missense_Mutation	SNP	ENST00000276654.5	37	CCDS6303.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.597127	0.87055	.	.	ENSG00000147650	ENST00000424843;ENST00000276654	D;D	0.84873	-1.91;-1.83	6.02	6.02	0.97574	.	0.172461	0.52532	D	0.000080	T	0.78483	0.4290	N	0.19112	0.55	0.80722	D	1	P;P	0.40731	0.728;0.608	B;B	0.39339	0.297;0.156	T	0.75593	-0.3264	10	0.23891	T	0.37	-23.0801	20.5373	0.99239	0.0:1.0:0.0:0.0	.	620;639	Q9Y561-2;Q9Y561	.;LRP12_HUMAN	K	620;639	ENSP00000399148:E620K;ENSP00000276654:E639K	ENSP00000276654:E639K	E	-	1	0	LRP12	105572742	1.000000	0.71417	0.971000	0.41717	0.949000	0.60115	5.522000	0.67092	2.857000	0.98124	0.650000	0.86243	GAG		0.438	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380821.1		NM_013437	
KMT2D	8085	hgsc.bcm.edu	37	12	49433132	49433132	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr12:49433132T>C	ENST00000301067.7	-	33	8238	c.8239A>G	c.(8239-8241)Agc>Ggc	p.S2747G	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	2747					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										CCCACAAGGCTGCTCTTGTCC	0.592																																																	0													25.0	30.0	28.0					12																	49433132		1916	4128	6044	SO:0001583	missense	8085			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.8239A>G	12.37:g.49433132T>C	ENSP00000301067:p.Ser2747Gly		O14687	Missense_Mutation	SNP	ENST00000301067.7	37	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	T	7.252	0.603342	0.14002	.	.	ENSG00000167548	ENST00000301067	T	0.79749	-1.3	5.47	4.3	0.51218	.	0.370314	0.19963	N	0.102166	T	0.71367	0.3331	L	0.39898	1.24	0.23238	N	0.998066	B	0.02656	0.0	B	0.04013	0.001	T	0.64334	-0.6432	10	0.87932	D	0	.	8.491	0.33100	0.0:0.0916:0.0:0.9084	.	2747	O14686	MLL2_HUMAN	G	2747	ENSP00000301067:S2747G	ENSP00000301067:S2747G	S	-	1	0	MLL2	47719399	0.052000	0.20516	0.970000	0.41538	0.145000	0.21501	0.908000	0.28545	2.212000	0.71576	0.533000	0.62120	AGC		0.592	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2			
MYF6	4618	hgsc.bcm.edu	37	12	81101767	81101767	+	Missense_Mutation	SNP	C	C	A	rs138296448	byFrequency	TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr12:81101767C>A	ENST00000228641.3	+	1	491	c.269C>A	c.(268-270)gCc>gAc	p.A90D		NM_002469.2	NP_002460.1	P23409	MYF6_HUMAN	myogenic factor 6 (herculin)	90			A -> D (in CNM3; dbSNP:rs138296448). {ECO:0000269|Ref.7}.		muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle tissue morphogenesis (GO:0060415)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle tissue development (GO:0007519)|skeletal muscle tissue regeneration (GO:0043403)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A90V(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|skin(1)	26						AGAAAATCTGCCCCCACTGAC	0.622													C|||	2	0.000399361	0.0	0.0	5008	,	,		15255	0.0		0.002	False		,,,				2504	0.0																1	Substitution - Missense(1)	central_nervous_system(1)	GRCh37	CM983940	MYF6	M	rs138296448	C	ASP/ALA	3,4403	6.2+/-15.9	0,3,2200	33.0	39.0	37.0		269	5.6	1.0	12	dbSNP_134	37	17,8583	11.9+/-42.8	0,17,4283	yes	missense	MYF6	NM_002469.2	126	0,20,6483	AA,AC,CC		0.1977,0.0681,0.1538	probably-damaging	90/243	81101767	20,12986	2203	4300	6503	SO:0001583	missense	4618				CCDS9019.1	12q21	2013-05-21				ENSG00000111046		"""Basic helix-loop-helix proteins"""	7566	protein-coding gene	gene with protein product	"""muscle-specific regulatory factor 4"""	159991				8978788	Standard	NM_002469		Approved	MRF4, bHLHc4	uc001szf.2	P23409		ENST00000228641.3:c.269C>A	12.37:g.81101767C>A	ENSP00000228641:p.Ala90Asp		B2R898|Q53X80|Q6FHI9	Missense_Mutation	SNP	ENST00000228641.3	37	CCDS9019.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	21.9	4.211323	0.79240	6.81E-4	0.001977	ENSG00000111046	ENST00000228641	T	0.78364	-1.17	5.62	5.62	0.85841	Myogenic basic muscle-specific protein (2);Helix-loop-helix DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.86932	0.6052	L	0.60455	1.87	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.86855	0.2026	10	0.59425	D	0.04	-15.8183	19.6517	0.95819	0.0:1.0:0.0:0.0	.	90	P23409	MYF6_HUMAN	D	90	ENSP00000228641:A90D	ENSP00000228641:A90D	A	+	2	0	MYF6	79625898	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.459000	0.80802	2.662000	0.90505	0.655000	0.94253	GCC		0.622	MYF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407756.1		NM_002469	
NEUROD1	4760	hgsc.bcm.edu	37	2	182542619	182542619	+	Silent	SNP	G	G	C			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr2:182542619G>C	ENST00000295108.3	-	2	1426	c.969C>G	c.(967-969)gcC>gcG	p.A323A	NEUROD1_ENST00000496876.1_Intron|CERKL_ENST00000479558.1_Intron	NM_002500.4	NP_002491.2	Q13562	NDF1_HUMAN	neuronal differentiation 1	323					amacrine cell differentiation (GO:0035881)|anterior/posterior pattern specification (GO:0009952)|cellular response to glucose stimulus (GO:0071333)|cerebellum development (GO:0021549)|dentate gyrus development (GO:0021542)|embryonic organ morphogenesis (GO:0048562)|endocrine pancreas development (GO:0031018)|enteroendocrine cell differentiation (GO:0035883)|glucose homeostasis (GO:0042593)|inner ear development (GO:0048839)|insulin secretion (GO:0030073)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neurogenesis (GO:0022008)|nitric oxide mediated signal transduction (GO:0007263)|nucleocytoplasmic transport (GO:0006913)|pancreatic A cell fate commitment (GO:0003326)|pancreatic PP cell fate commitment (GO:0003329)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle arrest (GO:0071156)|regulation of insulin secretion (GO:0050796)|regulation of intestinal epithelial structure maintenance (GO:0060730)|response to drug (GO:0042493)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|protein heterodimerization activity (GO:0046982)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25			OV - Ovarian serous cystadenocarcinoma(117;0.088)			CGCAGCGAGGGGCAGCGGTGC	0.507																																																	0													91.0	92.0	92.0					2																	182542619		2203	4300	6503	SO:0001819	synonymous_variant	4760			U50823	CCDS2283.1	2q32	2013-05-21	2012-02-22		ENSG00000162992	ENSG00000162992		"""Basic helix-loop-helix proteins"""	7762	protein-coding gene	gene with protein product	"""beta-cell E-box transactivator 2"", ""neurogenic helix-loop-helix protein NEUROD"""	601724	"""neurogenic differentiation 1"""	NEUROD		7754368, 8786144	Standard	NM_002500		Approved	BETA2, BHF-1, NeuroD, bHLHa3, MODY6	uc002uof.4	Q13562	OTTHUMG00000132583	ENST00000295108.3:c.969C>G	2.37:g.182542619G>C			B2R9I8|F1T0E1|O00343|Q13340|Q5U095|Q96TH0|Q99455|Q9UEC8	Silent	SNP	ENST00000295108.3	37	CCDS2283.1																																																																																				0.507	NEUROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255792.2		NM_002500	
NPC1L1	29881	hgsc.bcm.edu	37	7	44579311	44579311	+	Missense_Mutation	SNP	C	C	G	rs371689322		TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr7:44579311C>G	ENST00000289547.4	-	2	740	c.685G>C	c.(685-687)Gtg>Ctg	p.V229L	NPC1L1_ENST00000546276.1_Missense_Mutation_p.V229L|NPC1L1_ENST00000381160.3_Missense_Mutation_p.V229L|NPC1L1_ENST00000423141.1_Missense_Mutation_p.V229L	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	229					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)	p.V229M(2)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	CCACTCCCCACGGCCTGGCCA	0.607																																																	2	Substitution - Missense(2)	upper_aerodigestive_tract(1)|central_nervous_system(1)											73.0	69.0	70.0					7																	44579311		2203	4300	6503	SO:0001583	missense	29881				CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.685G>C	7.37:g.44579311C>G	ENSP00000289547:p.Val229Leu		A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Missense_Mutation	SNP	ENST00000289547.4	37	CCDS5491.1	.	.	.	.	.	.	.	.	.	.	c	0.238	-1.016094	0.02078	.	.	ENSG00000015520	ENST00000289547;ENST00000381160;ENST00000546276;ENST00000423141	D;D;D;D	0.89875	-2.58;-2.58;-2.58;-2.58	5.04	1.1	0.20463	.	1.728030	0.03144	N	0.166995	T	0.75243	0.3823	N	0.02916	-0.46	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.63466	-0.6631	10	0.26408	T	0.33	-0.4081	6.99	0.24750	0.1688:0.4695:0.3617:0.0	.	229;229;229;229	B7ZLE6;Q9UHC9-3;Q17RV5;D3DVK9	.;.;.;.	L	229	ENSP00000289547:V229L;ENSP00000370552:V229L;ENSP00000438033:V229L;ENSP00000404670:V229L	ENSP00000289547:V229L	V	-	1	0	NPC1L1	44545836	0.000000	0.05858	0.000000	0.03702	0.090000	0.18270	-0.193000	0.09573	-0.077000	0.12752	-0.519000	0.04390	GTG		0.607	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251256.1		NM_013389	
NXF2B	728343	hgsc.bcm.edu	37	X	101615546	101615546	+	Silent	SNP	C	C	T	rs373516573		TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chrX:101615546C>T	ENST00000372750.1	-	27	2656	c.1857G>A	c.(1855-1857)gcG>gcA	p.A619A	NXF2B_ENST00000457521.2_Silent_p.A619A|NXF2B_ENST00000372749.1_Silent_p.A619A|NXF2B_ENST00000412230.2_Silent_p.A619A|NXF2B_ENST00000372752.1_3'UTR			Q9GZY0	NXF2_HUMAN	nuclear RNA export factor 2B	619	TAP-C. {ECO:0000255|PROSITE- ProRule:PRU00611}.				mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nuclear RNA export factor complex (GO:0042272)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|kidney(1)|lung(4)|ovary(1)	7						TGAAGGCCTCCGCGGGGATCT	0.522																																																	0													205.0	158.0	175.0					X																	101615546		1986	3348	5334	SO:0001819	synonymous_variant	728343				CCDS43979.1	Xq22.1	2013-05-14			ENSG00000185945	ENSG00000269437			23984	protein-coding gene	gene with protein product						16382448	Standard	NM_001099686		Approved	bA353J17.1		Q9GZY0	OTTHUMG00000154920	ENST00000372750.1:c.1857G>A	X.37:g.101615546C>T			Q9BXU4|Q9NSS1|Q9NX66	Silent	SNP	ENST00000372750.1	37	CCDS43979.1																																																																																				0.522	NXF2B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058979.1			
ODF2L	57489	hgsc.bcm.edu	37	1	86851139	86851139	+	Splice_Site	SNP	A	A	C			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr1:86851139A>C	ENST00000359242.3	-	3	528		c.e3+1		ODF2L_ENST00000294678.2_Splice_Site|ODF2L_ENST00000370566.3_Splice_Site|ODF2L_ENST00000370567.1_Splice_Site|ODF2L_ENST00000394731.1_Intron|ODF2L_ENST00000317336.7_Splice_Site	NM_001007022.2	NP_001007023.2	Q9ULJ1	ODF2L_HUMAN	outer dense fiber of sperm tails 2-like							centrosome (GO:0005813)				endometrium(2)|kidney(2)|large_intestine(10)|lung(6)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	24				all cancers(265;0.0313)|Epithelial(280;0.0611)		TAAGTCACTCACATTTTCAAA	0.318																																																	0													48.0	47.0	47.0					1																	86851139		2202	4295	6497	SO:0001630	splice_region_variant	57489				CCDS30763.1, CCDS41354.1, CCDS30763.2, CCDS41354.2, CCDS53339.1	1p22.3	2008-02-05			ENSG00000122417	ENSG00000122417			29225	protein-coding gene	gene with protein product						10574462	Standard	NM_020729		Approved	KIAA1229	uc001dll.2	Q9ULJ1	OTTHUMG00000010080	ENST00000359242.3:c.246+1T>G	1.37:g.86851139A>C			A8MU56|B4E037|Q05C40|Q5BJG5|Q5TBX3|Q5TBX4|Q86X31	Splice_Site	SNP	ENST00000359242.3	37	CCDS41354.2	.	.	.	.	.	.	.	.	.	.	A	17.73	3.461494	0.63513	.	.	ENSG00000122417	ENST00000441121;ENST00000370566;ENST00000359242;ENST00000317336;ENST00000370567;ENST00000294678;ENST00000465959	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.4069	0.55445	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ODF2L	86623727	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.557000	0.60782	2.239000	0.73571	0.529000	0.55759	.		0.318	ODF2L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027873.2			Intron
OR10H1	26539	hgsc.bcm.edu	37	19	15918527	15918527	+	Silent	SNP	G	G	A			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr19:15918527G>A	ENST00000334920.2	-	1	409	c.321C>T	c.(319-321)ttC>ttT	p.F107F		NM_013940.2	NP_039228.1	Q9Y4A9	O10H1_HUMAN	olfactory receptor, family 10, subfamily H, member 1	107						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|skin(2)|urinary_tract(1)	29						GGGTGAAGCCGAAGCTGAAGG	0.647																																																	0													33.0	32.0	32.0					19																	15918527		2202	4277	6479	SO:0001819	synonymous_variant	26539			AC004510	CCDS12335.1	19p13.1	2012-08-09				ENSG00000186723		"""GPCR / Class A : Olfactory receptors"""	8172	protein-coding gene	gene with protein product							Standard	NM_013940		Approved		uc002nbq.2	Q9Y4A9		ENST00000334920.2:c.321C>T	19.37:g.15918527G>A			Q6IFQ2|Q96R59	Silent	SNP	ENST00000334920.2	37	CCDS12335.1																																																																																				0.647	OR10H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460364.1			
OR5T2	219464	hgsc.bcm.edu;ucsc.edu	37	11	56000108	56000108	+	Missense_Mutation	SNP	T	T	G	rs370158686		TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr11:56000108T>G	ENST00000313264.4	-	1	629	c.554A>C	c.(553-555)aAt>aCt	p.N185T		NM_001004746.1	NP_001004746.1	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T, member 2	185						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(3)	41	Esophageal squamous(21;0.00448)					ATAGGAAGCATTGATGAGTGG	0.438																																																	0								T	THR/ASN	0,4402		0,0,2201	210.0	179.0	190.0		554	-0.4	0.0	11		190	1,8591	1.2+/-3.3	0,1,4295	no	missense	OR5T2	NM_001004746.1	65	0,1,6496	GG,GT,TT		0.0116,0.0,0.0077	benign	185/360	56000108	1,12993	2201	4296	6497	SO:0001583	missense	219464			AB065838	CCDS31523.1	11q11	2012-08-09			ENSG00000181718	ENSG00000181718		"""GPCR / Class A : Olfactory receptors"""	15296	protein-coding gene	gene with protein product							Standard	NM_001004746		Approved		uc010rjc.2	Q8NGG2	OTTHUMG00000166851	ENST00000313264.4:c.554A>C	11.37:g.56000108T>G	ENSP00000323688:p.Asn185Thr		B9EGX5|Q6IFC8	Missense_Mutation	SNP	ENST00000313264.4	37	CCDS31523.1	.	.	.	.	.	.	.	.	.	.	t	0.013	-1.634617	0.00806	0.0	1.16E-4	ENSG00000181718	ENST00000313264	T	0.00392	7.58	5.07	-0.404	0.12396	GPCR, rhodopsin-like superfamily (1);	0.370475	0.19029	N	0.124609	T	0.00073	0.0002	N	0.00142	-2.005	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.19516	-1.0303	10	0.19590	T	0.45	.	6.0865	0.19970	0.4219:0.0:0.4476:0.1305	.	185	Q8NGG2	OR5T2_HUMAN	T	185	ENSP00000323688:N185T	ENSP00000323688:N185T	N	-	2	0	OR5T2	55756684	0.000000	0.05858	0.003000	0.11579	0.108000	0.19459	-0.071000	0.11505	-0.271000	0.09272	-0.384000	0.06662	AAT		0.438	OR5T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391598.1		NM_001004746	
PAK3	5063	hgsc.bcm.edu	37	X	110406199	110406199	+	Silent	SNP	T	T	C			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chrX:110406199T>C	ENST00000372010.1	+	10	1012	c.570T>C	c.(568-570)gaT>gaC	p.D190D	PAK3_ENST00000446737.1_Silent_p.D175D|PAK3_ENST00000518291.1_Silent_p.D211D|PAK3_ENST00000360648.4_Silent_p.D211D|PAK3_ENST00000262836.4_Silent_p.D190D|PAK3_ENST00000372007.5_Silent_p.D175D|PAK3_ENST00000417227.1_Silent_p.D196D|PAK3_ENST00000519681.1_Silent_p.D196D|PAK3_ENST00000425146.1_Silent_p.D175D			O75914	PAK3_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 3	190	Linker.|Poly-Glu.				activation of MAPK activity (GO:0000187)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|dendritic spine morphogenesis (GO:0060997)|MAPK cascade (GO:0000165)|regulation of actin filament polymerization (GO:0030833)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	41						aagaagaagatgaagaggaag	0.408										TSP Lung(19;0.15)																																							0													130.0	118.0	122.0					X																	110406199		2203	4299	6502	SO:0001819	synonymous_variant	5063			AF068864	CCDS14554.1, CCDS48151.1, CCDS48152.1, CCDS48153.1	Xq22.3	2008-06-17	2008-06-17		ENSG00000077264	ENSG00000077264			8592	protein-coding gene	gene with protein product		300142	"""mental retardation, X-linked 47"", ""p21 (CDKN1A)-activated kinase 3"""	MRX30, MRX47		8826460, 9731525	Standard	NM_002578		Approved	hPAK3, bPAK	uc010npv.1	O75914	OTTHUMG00000022202	ENST00000372010.1:c.570T>C	X.37:g.110406199T>C			A8K389|B1GX77|B1GX78|B1GX79|Q5JWX1|Q5JWX2|Q7Z2D6|Q7Z2E4|Q7Z3Z8|Q8WWK5|Q8WX23|Q9P0J8	Silent	SNP	ENST00000372010.1	37	CCDS48153.1																																																																																				0.408	PAK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057918.1		NM_002578	
PARP4	143	hgsc.bcm.edu	37	13	25016008	25016008	+	Silent	SNP	C	C	T	rs59195808	byFrequency	TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr13:25016008C>T	ENST00000381989.3	-	30	3747	c.3642G>A	c.(3640-3642)gaG>gaA	p.E1214E		NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	1214					cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		CTTCTTGGGGCTCCCCCTGCC	0.433																																																	0													50.0	52.0	52.0					13																	25016008		2203	4298	6501	SO:0001819	synonymous_variant	143			AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.3642G>A	13.37:g.25016008C>T			O75903|Q14682|Q5QNZ9|Q9H1M6	Silent	SNP	ENST00000381989.3	37	CCDS9307.1																																																																																				0.433	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044189.1		NM_006437	
PBRM1	55193	hgsc.bcm.edu;ucsc.edu	37	3	52651292	52651292	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr3:52651292C>A	ENST00000296302.7	-	14	1805	c.1804G>T	c.(1804-1806)Gag>Tag	p.E602*	PBRM1_ENST00000337303.4_Nonsense_Mutation_p.E602*|PBRM1_ENST00000394830.3_Nonsense_Mutation_p.E602*|PBRM1_ENST00000409057.1_Nonsense_Mutation_p.E602*|PBRM1_ENST00000409767.1_Nonsense_Mutation_p.E617*|PBRM1_ENST00000410007.1_Nonsense_Mutation_p.E602*|PBRM1_ENST00000356770.4_Nonsense_Mutation_p.E570*|PBRM1_ENST00000409114.3_Nonsense_Mutation_p.E617*			Q86U86	PB1_HUMAN	polybromo 1	602	Bromo 4. {ECO:0000255|PROSITE- ProRule:PRU00035}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		GAGCCCTCCTCATTATAGTGC	0.463			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	0													79.0	72.0	74.0					3																	52651292		2203	4300	6503	SO:0001587	stop_gained	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.1804G>T	3.37:g.52651292C>A	ENSP00000296302:p.Glu602*		A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Nonsense_Mutation	SNP	ENST00000296302.7	37		.	.	.	.	.	.	.	.	.	.	C	39	7.692570	0.98438	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	.	.	.	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-24.2166	19.919	0.97077	0.0:1.0:0.0:0.0	.	.	.	.	X	570;602;602;602;602;602;617;617;602;561	.	ENSP00000296302:E602X	E	-	1	0	PBRM1	52626332	1.000000	0.71417	0.999000	0.59377	0.946000	0.59487	7.818000	0.86416	2.707000	0.92482	0.655000	0.94253	GAG		0.463	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	
PLXNA3	55558	hgsc.bcm.edu	37	X	153699461	153699461	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chrX:153699461T>A	ENST00000369682.3	+	31	5345	c.5170T>A	c.(5170-5172)Ttc>Atc	p.F1724I		NM_017514.3	NP_059984.3	P51805	PLXA3_HUMAN	plexin A3	1724					axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|hippocampus development (GO:0021766)|multicellular organismal development (GO:0007275)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|positive regulation of cytoskeleton organization (GO:0051495)|pyramidal neuron development (GO:0021860)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|trigeminal nerve structural organization (GO:0021637)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	48	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GCCGCTGCGCTTCTGGGTGAA	0.597																																																	0													90.0	80.0	83.0					X																	153699461		2203	4300	6503	SO:0001583	missense	55558			X74609	CCDS14752.1	Xq28	2008-02-05			ENSG00000130827	ENSG00000130827		"""Plexins"""	9101	protein-coding gene	gene with protein product		300022		PLXN4		8248200, 8733135	Standard	NM_017514		Approved	SEX, XAP-6, 6.3, Plxn3	uc004flm.3	P51805	OTTHUMG00000033290	ENST00000369682.3:c.5170T>A	X.37:g.153699461T>A	ENSP00000358696:p.Phe1724Ile		Q5HY36	Missense_Mutation	SNP	ENST00000369682.3	37	CCDS14752.1	.	.	.	.	.	.	.	.	.	.	T	32	5.113717	0.94339	.	.	ENSG00000130827	ENST00000369682	T	0.24723	1.84	5.39	5.39	0.77823	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.61022	0.2314	M	0.93720	3.45	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.72090	-0.4395	10	0.87932	D	0	.	13.4017	0.60887	0.0:0.0:0.0:1.0	.	1724	P51805	PLXA3_HUMAN	I	1724	ENSP00000358696:F1724I	ENSP00000358696:F1724I	F	+	1	0	PLXNA3	153352655	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	8.033000	0.88852	1.807000	0.52817	0.430000	0.28490	TTC		0.597	PLXNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081634.1		NM_017514	
PROK2	60675	hgsc.bcm.edu	37	3	71830711	71830711	+	Silent	SNP	G	G	A			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr3:71830711G>A	ENST00000295619.3	-	2	137	c.129C>T	c.(127-129)ggC>ggT	p.G43G	PROK2_ENST00000353065.3_Silent_p.G43G	NM_001126128.1	NP_001119600.1	Q9HC23	PROK2_HUMAN	prokineticin 2	43					activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|cell proliferation (GO:0008283)|chemotaxis (GO:0006935)|circadian rhythm (GO:0007623)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of apoptotic process (GO:0043066)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of smooth muscle contraction (GO:0045987)|sensory perception of pain (GO:0019233)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)	G-protein coupled receptor binding (GO:0001664)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	6		Prostate(10;0.00899)		BRCA - Breast invasive adenocarcinoma(55;1.89e-05)|Epithelial(33;0.000173)|LUSC - Lung squamous cell carcinoma(21;0.00168)|Lung(16;0.00306)		CACAGCACATGCCTCCACCAC	0.433																																																	0													99.0	88.0	92.0					3																	71830711		2203	4300	6503	SO:0001819	synonymous_variant	60675			AF333025	CCDS2916.1, CCDS46868.1	3p21.1	2013-02-28			ENSG00000163421	ENSG00000163421		"""Endogenous ligands"""	18455	protein-coding gene	gene with protein product	"""protein Bv8 homolog"""	607002				11054548, 11259612	Standard	NM_021935		Approved	PK2, BV8, MIT1, KAL4	uc003dpa.4	Q9HC23	OTTHUMG00000158809	ENST00000295619.3:c.129C>T	3.37:g.71830711G>A			Q53Z79|Q6ISR0	Silent	SNP	ENST00000295619.3	37	CCDS46868.1																																																																																				0.433	PROK2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352302.1		NM_001126128	
PRTG	283659	hgsc.bcm.edu;ucsc.edu	37	15	55912369	55912369	+	Silent	SNP	T	T	A			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr15:55912369T>A	ENST00000389286.4	-	20	3341	c.3294A>T	c.(3292-3294)acA>acT	p.T1098T		NM_173814.4	NP_776175.2			protogenin									p.T1098T(1)		breast(1)|endometrium(6)|kidney(4)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		AGAAGCTGGTTGTCTGACCTG	0.498																																																	1	Substitution - coding silent(1)	kidney(1)											111.0	110.0	110.0					15																	55912369		1889	4111	6000	SO:0001819	synonymous_variant	283659			AK098622	CCDS42040.1	15q21.3	2013-02-11	2010-06-24		ENSG00000166450	ENSG00000166450		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26373	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 5"""	613261	"""protogenin homolog (Gallus gallus)"""				Standard	NM_173814		Approved	FLJ25756, IGDCC5	uc002adg.3	Q2VWP7		ENST00000389286.4:c.3294A>T	15.37:g.55912369T>A				Silent	SNP	ENST00000389286.4	37	CCDS42040.1																																																																																				0.498	PRTG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419357.1		NM_173814	
RCOR3	55758	hgsc.bcm.edu	37	1	211447566	211447566	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr1:211447566G>A	ENST00000367005.4	+	3	283	c.142G>A	c.(142-144)Gca>Aca	p.A48T	RCOR3_ENST00000419091.2_Missense_Mutation_p.A106T|RCOR3_ENST00000367006.4_Missense_Mutation_p.A106T|RCOR3_ENST00000452621.2_Missense_Mutation_p.A106T	NM_018254.3	NP_060724.1	Q9P2K3	RCOR3_HUMAN	REST corepressor 3	48	ELM2. {ECO:0000255|PROSITE- ProRule:PRU00512}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.00961)|all cancers(67;0.0999)|Epithelial(68;0.171)		TGAATACATTGCAATTGCAAA	0.308																																																	0													73.0	65.0	68.0					1																	211447566		2203	4300	6503	SO:0001583	missense	55758			AK001738	CCDS31016.1, CCDS44312.1, CCDS44313.1, CCDS44314.1	1q32.3	2008-02-05			ENSG00000117625	ENSG00000117625			25594	protein-coding gene	gene with protein product						10718198	Standard	NM_018254		Approved	FLJ10876	uc010psw.2	Q9P2K3	OTTHUMG00000036996	ENST00000367005.4:c.142G>A	1.37:g.211447566G>A	ENSP00000355972:p.Ala48Thr		B3KYA2|B4DYY7|Q5VT47|Q7L9I5|Q8N5U3|Q9NV83	Missense_Mutation	SNP	ENST00000367005.4	37	CCDS31016.1	.	.	.	.	.	.	.	.	.	.	G	15.30	2.792946	0.50102	.	.	ENSG00000117625	ENST00000534478;ENST00000533469;ENST00000367006;ENST00000452621;ENST00000419091;ENST00000367005	T;T;T;T;T;T	0.51071	0.72;0.72;0.72;0.72;0.72;0.72	5.58	5.58	0.84498	ELM2 domain (2);	0.000000	0.85682	D	0.000000	T	0.53899	0.1825	N	0.20845	0.615	0.80722	D	1	D;B;B;B	0.71674	0.998;0.016;0.094;0.082	D;B;B;B	0.81914	0.995;0.042;0.07;0.036	T	0.42327	-0.9458	10	0.13853	T	0.58	-15.3456	19.9211	0.97085	0.0:0.0:1.0:0.0	.	106;48;106;106	Q9P2K3-3;Q9P2K3;Q9P2K3-2;Q9P2K3-4	.;RCOR3_HUMAN;.;.	T	48;48;106;106;106;48	ENSP00000436057:A48T;ENSP00000436838:A48T;ENSP00000355973:A106T;ENSP00000398558:A106T;ENSP00000413929:A106T;ENSP00000355972:A48T	ENSP00000355972:A48T	A	+	1	0	RCOR3	209514189	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.797000	0.85911	2.782000	0.95742	0.585000	0.79938	GCA		0.308	RCOR3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089821.1		NM_018254	
RGAG4	340526	hgsc.bcm.edu	37	X	71349973	71349973	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chrX:71349973G>C	ENST00000545866.1	-	1	1785	c.1418C>G	c.(1417-1419)aCc>aGc	p.T473S	RGAG4_ENST00000609883.1_Missense_Mutation_p.T473S|NHSL2_ENST00000540800.1_Intron	NM_001024455.3	NP_001019626.1	Q5HYW3	RGAG4_HUMAN	retrotransposon gag domain containing 4	473										cervix(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|skin(1)	24	Renal(35;0.156)					GTGAACAAAGGTCGGCTCCAT	0.562																																																	0													132.0	133.0	133.0					X																	71349973		2165	4230	6395	SO:0001583	missense	340526			AB082532	CCDS55446.1	Xq13.1	2008-02-05			ENSG00000242732	ENSG00000242732			29430	protein-coding gene	gene with protein product						12056414, 15716091, 16093683	Standard	NM_001024455		Approved	KIAA2001, Mar5, Mart5	uc004eaj.2	Q5HYW3	OTTHUMG00000021808	ENST00000545866.1:c.1418C>G	X.37:g.71349973G>C	ENSP00000441366:p.Thr473Ser		A7E2W7|Q8NCM4|Q9NPX1	Missense_Mutation	SNP	ENST00000545866.1	37	CCDS55446.1	.	.	.	.	.	.	.	.	.	.	G	11.72	1.722158	0.30503	.	.	ENSG00000242732	ENST00000545866;ENST00000479991	T;T	0.52983	0.64;0.64	3.87	2.84	0.33178	.	.	.	.	.	T	0.24236	0.0587	N	0.14661	0.345	0.09310	N	1	B	0.15930	0.015	B	0.08055	0.003	T	0.16305	-1.0407	8	.	.	.	0.14	2.0754	0.03623	0.2417:0.0:0.4658:0.2925	.	473	Q5HYW3	RGAG4_HUMAN	S	473	ENSP00000441366:T473S;ENSP00000418667:T473S	.	T	-	2	0	RGAG4	71266698	0.011000	0.17503	0.001000	0.08648	0.148000	0.21650	2.039000	0.41193	0.734000	0.32515	0.500000	0.49745	ACC		0.562	RGAG4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057171.1		NM_001024455	
SETD2	29072	hgsc.bcm.edu;ucsc.edu	37	3	47144909	47144909	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr3:47144909A>G	ENST00000409792.3	-	7	4886	c.4844T>C	c.(4843-4845)aTa>aCa	p.I1615T		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1615	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		AGTGGCATCTATTATCTGGGA	0.323			"""N, F, S, Mis"""		clear cell renal carcinoma																																			Rec	yes		3	3p21.31	29072	SET domain containing 2		E	0													132.0	126.0	128.0					3																	47144909		2203	4300	6503	SO:0001583	missense	29072			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.4844T>C	3.37:g.47144909A>G	ENSP00000386759:p.Ile1615Thr		O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	37	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	A	24.2	4.510635	0.85389	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792	D	0.84298	-1.83	5.83	5.83	0.93111	SET domain (3);	0.000000	0.64402	D	0.000010	D	0.95364	0.8495	H	0.98218	4.175	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.96940	0.9687	10	0.87932	D	0	.	14.7708	0.69675	1.0:0.0:0.0:0.0	.	1615;1615	F2Z317;Q9BYW2	.;SETD2_HUMAN	T	1615	ENSP00000386759:I1615T	ENSP00000386759:I1615T	I	-	2	0	SETD2	47119913	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	8.890000	0.92477	2.240000	0.73641	0.528000	0.53228	ATA		0.323	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2		NM_014159	
SNAPC1	6617	hgsc.bcm.edu;ucsc.edu	37	14	62234060	62234060	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr14:62234060T>A	ENST00000216294.4	+	3	523	c.419T>A	c.(418-420)aTg>aAg	p.M140K	RP11-618G20.1_ENST00000555937.1_RNA	NM_003082.3	NP_003073.1	Q16533	SNPC1_HUMAN	small nuclear RNA activating complex, polypeptide 1, 43kDa	140	SNAPC3-binding.				gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)	13				OV - Ovarian serous cystadenocarcinoma(108;0.0639)|BRCA - Breast invasive adenocarcinoma(234;0.186)		TTTACAGCAATGCCCAAATTG	0.313																																					NSCLC(27;223 907 37180 39193 46568)												0													90.0	89.0	89.0					14																	62234060		2203	4300	6503	SO:0001583	missense	6617			Z47542	CCDS9755.1	14q22	2008-08-11	2002-08-29		ENSG00000023608	ENSG00000023608			11134	protein-coding gene	gene with protein product		600591	"""small nuclear RNA activating complex, polypeptide 1, 43kD"""			9644240	Standard	NM_003082		Approved	SNAP43, PTFgamma	uc001xft.3	Q16533	OTTHUMG00000140343	ENST00000216294.4:c.419T>A	14.37:g.62234060T>A	ENSP00000216294:p.Met140Lys			Missense_Mutation	SNP	ENST00000216294.4	37	CCDS9755.1	.	.	.	.	.	.	.	.	.	.	T	24.4	4.529346	0.85706	.	.	ENSG00000023608	ENST00000216294	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.78259	0.4255	M	0.76574	2.34	0.80722	D	1	D	0.76494	0.999	D	0.70935	0.971	T	0.76269	-0.3021	9	0.32370	T	0.25	-25.836	16.8222	0.85835	0.0:0.0:0.0:1.0	.	140	Q16533	SNPC1_HUMAN	K	140	.	ENSP00000216294:M140K	M	+	2	0	SNAPC1	61303813	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.329000	0.59260	2.371000	0.80710	0.533000	0.62120	ATG		0.313	SNAPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276976.2		NM_003082	
SPATA21	374955	hgsc.bcm.edu	37	1	16725989	16725989	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr1:16725989T>C	ENST00000335496.1	-	12	1684	c.1202A>G	c.(1201-1203)cAg>cGg	p.Q401R	SPATA21_ENST00000466212.1_5'UTR|SPATA21_ENST00000540400.1_Missense_Mutation_p.Q378R	NM_198546.1	NP_940948.1	Q7Z572	SPT21_HUMAN	spermatogenesis associated 21	401							calcium ion binding (GO:0005509)	p.Q401R(1)		breast(1)|endometrium(2)|lung(8)|ovary(2)|pancreas(3)|stomach(1)|urinary_tract(2)	19		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.15e-05)|BRCA - Breast invasive adenocarcinoma(304;4.2e-05)|Kidney(64;0.000183)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.0122)|READ - Rectum adenocarcinoma(331;0.0651)		GCAGGGCACCTGGGCATAGGG	0.597																																																	1	Substitution - Missense(1)	ovary(1)											58.0	49.0	52.0					1																	16725989		2203	4300	6503	SO:0001583	missense	374955				CCDS172.1	1p36.13	2013-01-10			ENSG00000187144	ENSG00000187144		"""EF-hand domain containing"""	28026	protein-coding gene	gene with protein product							Standard	NM_198546		Approved	spergen-2, spergen2	uc001ayn.3	Q7Z572	OTTHUMG00000002312	ENST00000335496.1:c.1202A>G	1.37:g.16725989T>C	ENSP00000335612:p.Gln401Arg		B9EK40|F5GXP5	Missense_Mutation	SNP	ENST00000335496.1	37	CCDS172.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.980489	0.74474	.	.	ENSG00000187144	ENST00000491418;ENST00000335496;ENST00000540400	T;T;T	0.68181	0.75;-0.31;-0.31	5.11	5.11	0.69529	.	0.119203	0.38436	N	0.001699	T	0.76271	0.3964	L	0.55481	1.735	0.35657	D	0.812235	D;D	0.89917	0.998;1.0	D;D	0.78314	0.978;0.991	T	0.82090	-0.0629	10	0.56958	D	0.05	-13.1176	11.4757	0.50297	0.0:0.0:0.0:1.0	.	378;401	F5GXP5;Q7Z572	.;SPT21_HUMAN	R	109;401;378	ENSP00000420753:Q109R;ENSP00000335612:Q401R;ENSP00000440046:Q378R	ENSP00000335612:Q401R	Q	-	2	0	SPATA21	16598576	0.998000	0.40836	1.000000	0.80357	0.855000	0.48748	3.428000	0.52792	2.279000	0.76181	0.459000	0.35465	CAG		0.597	SPATA21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000006677.2		NM_198546	
SSTR1	6751	hgsc.bcm.edu	37	14	38679408	38679409	+	Frame_Shift_Ins	INS	-	-	TG			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr14:38679408_38679409insTG	ENST00000267377.2	+	3	1431_1432	c.814_815insTG	c.(814-816)atgfs	p.M272fs		NM_001049.2	NP_001040.1	P30872	SSR1_HUMAN	somatostatin receptor 1	272					cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cerebellum development (GO:0021549)|digestion (GO:0007586)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glutamate receptor signaling pathway (GO:0007215)|negative regulation of cell proliferation (GO:0008285)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00444)	Octreotide(DB00104)|Pasireotide(DB06663)	GATCACCTTAATGGTGATGATG	0.564																																																	0																																										SO:0001589	frameshift_variant	6751				CCDS9666.1	14q13	2012-08-08			ENSG00000139874	ENSG00000139874		"""GPCR / Class A : Somatostatin receptors"""	11330	protein-coding gene	gene with protein product		182451				8449518	Standard	NM_001049		Approved		uc001wul.1	P30872	OTTHUMG00000140249	ENST00000267377.2:c.815_816dupTG	14.37:g.38679409_38679410dupTG	ENSP00000267377:p.Met272fs			Frame_Shift_Ins	INS	ENST00000267377.2	37	CCDS9666.1																																																																																				0.564	SSTR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409930.2			
TBC1D1	23216	hgsc.bcm.edu	37	4	38016542	38016542	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr4:38016542A>G	ENST00000261439.4	+	3	1185	c.830A>G	c.(829-831)cAc>cGc	p.H277R	TBC1D1_ENST00000508802.1_Missense_Mutation_p.H277R	NM_001253914.1|NM_001253915.1|NM_015173.3	NP_001240843.1|NP_001240844.1|NP_055988.2	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1	277	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				membrane organization (GO:0061024)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(3)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	36						ATTAGCGGACACAATATTGTG	0.532																																																	0													47.0	50.0	49.0					4																	38016542		2203	4300	6503	SO:0001583	missense	23216			AB029031	CCDS33972.1, CCDS58897.1	4p14	2013-07-09			ENSG00000065882	ENSG00000065882			11578	protein-coding gene	gene with protein product		609850				10965142, 18258599	Standard	NM_015173		Approved	TBC, TBC1, KIAA1108	uc003gtb.3	Q86TI0	OTTHUMG00000150302	ENST00000261439.4:c.830A>G	4.37:g.38016542A>G	ENSP00000261439:p.His277Arg		B7Z3D9|E9PGH8|Q96K82|Q9UPP4	Missense_Mutation	SNP	ENST00000261439.4	37	CCDS33972.1	.	.	.	.	.	.	.	.	.	.	A	1.621	-0.521517	0.04171	.	.	ENSG00000065882	ENST00000508802;ENST00000261439;ENST00000446803	T;T;T	0.18174	3.6;3.99;2.23	5.65	3.11	0.35812	Phosphotyrosine interaction domain (1);	0.101745	0.43416	N	0.000575	T	0.07143	0.0181	N	0.08118	0	0.80722	D	1	B;B;B	0.26809	0.001;0.16;0.001	B;B;B	0.23150	0.005;0.044;0.005	T	0.30736	-0.9968	10	0.12103	T	0.63	-22.4534	8.897	0.35470	0.8062:0.1274:0.0664:0.0	.	277;277;277	B9A6J6;E9PGH8;Q86TI0	.;.;TBCD1_HUMAN	R	277;277;148	ENSP00000423651:H277R;ENSP00000261439:H277R;ENSP00000396877:H148R	ENSP00000261439:H277R	H	+	2	0	TBC1D1	37692937	0.214000	0.23563	0.151000	0.22473	0.019000	0.09904	0.921000	0.28718	0.461000	0.27071	-0.461000	0.05368	CAC		0.532	TBC1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317443.2		NM_015173	
TEX2	55852	hgsc.bcm.edu	37	17	62290991	62290991	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr17:62290991G>C	ENST00000583097.1	-	2	759	c.587C>G	c.(586-588)tCg>tGg	p.S196W	TEX2_ENST00000258991.3_Missense_Mutation_p.S196W|TEX2_ENST00000584379.1_Missense_Mutation_p.S196W			Q8IWB9	TEX2_HUMAN	testis expressed 2	196					signal transduction (GO:0007165)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)				breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		CACCTCGGTCGACAGGGACTT	0.547																																																	0													61.0	60.0	61.0					17																	62290991		2203	4300	6503	SO:0001583	missense	55852			AB051525	CCDS11658.1, CCDS74131.1	17q23.3	2007-03-13	2007-03-13			ENSG00000136478			30884	protein-coding gene	gene with protein product	"""transmembrane protein 96"""		"""testis expressed sequence 2"""			11214970	Standard	XM_005257507		Approved	HT008, TMEM96, KIAA1738	uc002jee.3	Q8IWB9		ENST00000583097.1:c.587C>G	17.37:g.62290991G>C	ENSP00000462665:p.Ser196Trp		Q6AHZ5|Q8N3L0|Q9C0C5	Missense_Mutation	SNP	ENST00000583097.1	37		.	.	.	.	.	.	.	.	.	.	G	11.24	1.579973	0.28180	.	.	ENSG00000136478	ENST00000258991	T	0.58652	0.32	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.76147	0.3947	M	0.63843	1.955	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.75997	-0.3120	10	0.87932	D	0	-11.4117	20.5568	0.99304	0.0:0.0:1.0:0.0	.	196;196	Q8IWB9-2;Q8IWB9	.;TEX2_HUMAN	W	196	ENSP00000258991:S196W	ENSP00000258991:S196W	S	-	2	0	TEX2	59644723	1.000000	0.71417	0.971000	0.41717	0.630000	0.37929	9.476000	0.97823	2.861000	0.98227	0.655000	0.94253	TCG		0.547	TEX2-003	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000443745.1		NM_018469	
TOP3B	8940	hgsc.bcm.edu	37	22	22318352	22318352	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr22:22318352C>A	ENST00000398793.2	-	11	1581	c.1147G>T	c.(1147-1149)Gac>Tac	p.D383Y	TOP3B_ENST00000357179.5_Missense_Mutation_p.D383Y|TOP3B_ENST00000413067.2_Missense_Mutation_p.D112Y	NM_003935.3	NP_003926.1	O95985	TOP3B_HUMAN	topoisomerase (DNA) III beta	383					chromosome segregation (GO:0007059)|DNA topological change (GO:0006265)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA topoisomerase activity (GO:0003916)|DNA topoisomerase type I activity (GO:0003917)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(4)|lung(9)|ovary(1)	26	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.145)		TCGCCGGCGTCATGGCCTTTC	0.612																																																	0													75.0	75.0	75.0					22																	22318352		2203	4300	6503	SO:0001583	missense	8940			AF017146	CCDS13797.1	22q11.22	2011-05-24			ENSG00000100038	ENSG00000100038			11993	protein-coding gene	gene with protein product		603582				9786842, 9074928	Standard	XM_005261811		Approved		uc002zvs.3	O95985	OTTHUMG00000167438	ENST00000398793.2:c.1147G>T	22.37:g.22318352C>A	ENSP00000381773:p.Asp383Tyr		A0M8Q3|Q9BUP5	Missense_Mutation	SNP	ENST00000398793.2	37	CCDS13797.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.01|18.01	3.528824|3.528824	0.64860|0.64860	.|.	.|.	ENSG00000100038|ENSG00000100038	ENST00000357179;ENST00000398793;ENST00000413067|ENST00000457270	T;T;T|.	0.22539|.	1.95;1.95;1.95|.	4.71|4.71	4.71|4.71	0.59529|0.59529	DNA topoisomerase, type IA, core domain (1);DNA topoisomerase, type IA, central region, subdomain 3 (1);DNA topoisomerase, type IA, central (1);DNA topoisomerase, type IA, DNA-binding (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.88153|0.88153	0.6360|0.6360	H|H	0.97186|0.97186	3.955|3.955	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.999;0.997|.	D|D	0.92348|0.92348	0.5887|0.5887	10|5	0.87932|.	D|.	0|.	.|.	17.8567|17.8567	0.88765|0.88765	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	383;383|.	O95985;O95985-2|.	TOP3B_HUMAN;.|.	Y|I	383;383;112|177	ENSP00000349705:D383Y;ENSP00000381773:D383Y;ENSP00000393118:D112Y|.	ENSP00000349705:D383Y|.	D|M	-|-	1|3	0|0	TOP3B|TOP3B	20648352|20648352	1.000000|1.000000	0.71417|0.71417	0.982000|0.982000	0.44146|0.44146	0.196000|0.196000	0.23810|0.23810	7.284000|7.284000	0.78650|0.78650	2.462000|2.462000	0.83206|0.83206	0.561000|0.561000	0.74099|0.74099	GAC|ATG		0.612	TOP3B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320251.1		NM_003935	
TRIML2	205860	hgsc.bcm.edu	37	4	189026066	189026066	+	Silent	SNP	C	C	T			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr4:189026066C>T	ENST00000512729.1	-	2	434	c.60G>A	c.(58-60)ttG>ttA	p.L20L	TRIML2_ENST00000326754.3_Silent_p.L20L|TRIML2_ENST00000502707.1_5'Flank|TRIML2_ENST00000536972.1_Silent_p.L70L	NM_173553.1	NP_775824.1	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2	20					protein ubiquitination (GO:0016567)|response to retinoic acid (GO:0032526)		ligase activity (GO:0016874)			central_nervous_system(2)|kidney(1)|large_intestine(7)|lung(25)|prostate(3)|urinary_tract(1)	39		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)		TCGATGTGTTCAATATTTCCT	0.393																																																	0													172.0	163.0	166.0					4																	189026066		2203	4300	6503	SO:0001819	synonymous_variant	205860			AK098667	CCDS3850.1	4q35.2	2014-02-12	2007-12-14		ENSG00000179046	ENSG00000179046			26378	protein-coding gene	gene with protein product	"""SPRY domain containing 6"""						Standard	NM_173553		Approved	FLJ25801, SPRYD6	uc003izl.2	Q8N7C3	OTTHUMG00000160225	ENST00000512729.1:c.60G>A	4.37:g.189026066C>T			B7Z6J6	Silent	SNP	ENST00000512729.1	37	CCDS3850.1																																																																																				0.393	TRIML2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000359733.1		NM_173553	
VPS13B	157680	hgsc.bcm.edu;ucsc.edu	37	8	100479735	100479735	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr8:100479735G>A	ENST00000358544.2	+	24	3650	c.3539G>A	c.(3538-3540)gGt>gAt	p.G1180D	VPS13B_ENST00000395996.1_Missense_Mutation_p.G1180D|VPS13B_ENST00000357162.2_Missense_Mutation_p.G1180D	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	1180					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			GAACCTATGGGTTGCACCTCC	0.443																																					Colon(161;2205 2542 7338 31318)												0													248.0	222.0	231.0					8																	100479735		2203	4300	6503	SO:0001583	missense	157680			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.3539G>A	8.37:g.100479735G>A	ENSP00000351346:p.Gly1180Asp		C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.877581	0.91664	.	.	ENSG00000132549	ENST00000357162;ENST00000358544;ENST00000395996	T;T;T	0.54071	0.59;0.59;0.59	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.71082	0.3298	L	0.56769	1.78	0.80722	D	1	D;D;D;D	0.89917	0.998;0.999;1.0;1.0	D;D;D;D	0.91635	0.967;0.983;0.999;0.992	T	0.70475	-0.4861	10	0.52906	T	0.07	.	19.6505	0.95798	0.0:0.0:1.0:0.0	.	1179;1180;1180;1180	Q7Z7G8-6;Q7Z7G8-2;Q7Z7G8;Q7Z7G8-3	.;.;VP13B_HUMAN;.	D	1180	ENSP00000349685:G1180D;ENSP00000351346:G1180D;ENSP00000379318:G1180D	ENSP00000349685:G1180D	G	+	2	0	VPS13B	100548911	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.224000	0.95209	2.636000	0.89361	0.561000	0.74099	GGT		0.443	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1		NM_184042	
ZNF554	115196	hgsc.bcm.edu;ucsc.edu	37	19	2833757	2833757	+	Missense_Mutation	SNP	A	A	G	rs377370056		TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr19:2833757A>G	ENST00000317243.5	+	5	722	c.524A>G	c.(523-525)aAt>aGt	p.N175S	ZNF554_ENST00000591265.1_3'UTR	NM_001102651.1	NP_001096121.1	Q86TJ5	ZN554_HUMAN	zinc finger protein 554	175					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|liver(3)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGTGGTATAAATATGATAAAG	0.453																																																	0													76.0	78.0	77.0					19																	2833757		1860	4105	5965	SO:0001583	missense	115196			AK027860	CCDS42462.1	19p13.3	2013-09-20			ENSG00000172006	ENSG00000172006		"""Zinc fingers, C2H2-type"", ""-"""	26629	protein-coding gene	gene with protein product						12477932	Standard	NM_001102651		Approved	FLJ34817	uc002lwm.2	Q86TJ5	OTTHUMG00000180493	ENST00000317243.5:c.524A>G	19.37:g.2833757A>G	ENSP00000321132:p.Asn175Ser		Q8NAT3|Q9BWN3	Missense_Mutation	SNP	ENST00000317243.5	37	CCDS42462.1	.	.	.	.	.	.	.	.	.	.	A	0.016	-1.519310	0.00967	.	.	ENSG00000172006	ENST00000317243	T	0.06142	3.34	2.46	-2.42	0.06542	.	.	.	.	.	T	0.03011	0.0089	N	0.19112	0.55	0.21064	N	0.999794	B	0.02656	0.0	B	0.04013	0.001	T	0.47935	-0.9078	9	0.07990	T	0.79	.	4.5054	0.11885	0.4574:0.1768:0.3658:0.0	.	175	Q86TJ5	ZN554_HUMAN	S	175	ENSP00000321132:N175S	ENSP00000321132:N175S	N	+	2	0	ZNF554	2784757	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.961000	0.01516	-0.615000	0.05679	-1.181000	0.01715	AAT		0.453	ZNF554-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451598.3		NM_152303	
ZNF804B	219578	hgsc.bcm.edu;ucsc.edu	37	7	88964196	88964196	+	Missense_Mutation	SNP	T	T	A	rs801840	byFrequency	TCGA-BP-4774-01A-01D-1366-10	TCGA-BP-4774-11A-01D-1367-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	4034d194-0264-4594-a86f-a79daf5aca3f	ca015746-b3f1-488e-88e2-e0eed1ac69d6	g.chr7:88964196T>A	ENST00000333190.4	+	4	2509	c.1900T>A	c.(1900-1902)Ttt>Att	p.F634I		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	634			F -> I (in dbSNP:rs801840). {ECO:0000269|PubMed:12690205}.				metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			CATCTCTAGGTTTAAAAAGCA	0.418										HNSCC(36;0.09)			A|||	2607	0.520567	0.7738	0.3415	5008	,	,		19885	0.7153		0.2346	False		,,,				2504	0.3988																0								A	ILE/PHE	3011,1395	456.1+/-351.2	1021,969,213	80.0	84.0	83.0		1900	4.3	0.7	7	dbSNP_86	83	2036,6564	719.1+/-406.2	234,1568,2498	yes	missense	ZNF804B	NM_181646.2	21	1255,2537,2711	AA,AT,TT		23.6744,31.6614,38.8052	benign	634/1350	88964196	5047,7959	2203	4300	6503	SO:0001583	missense	219578			AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.1900T>A	7.37:g.88964196T>A	ENSP00000329638:p.Phe634Ile		B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	ENST00000333190.4	37	CCDS5613.1	1073	0.4913003663003663	374	0.7601626016260162	130	0.35911602209944754	390	0.6818181818181818	179	0.23614775725593667	A	6.795	0.515659	0.12944	0.683386	0.236744	ENSG00000182348	ENST00000333190	T	0.04015	3.73	5.48	4.33	0.51752	.	0.169739	0.42294	D	0.000738	T	0.00012	0.0000	N	0.03608	-0.345	0.58432	P	1.0000000000287557E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.06643	-1.0815	9	0.51188	T	0.08	-4.6357	7.8499	0.29448	0.8102:0.0:0.0666:0.1232	rs801840;rs1721758;rs56634318;rs801840	634	A4D1E1	Z804B_HUMAN	I	634	ENSP00000329638:F634I	ENSP00000329638:F634I	F	+	1	0	ZNF804B	88802132	1.000000	0.71417	0.702000	0.30337	0.028000	0.11728	3.085000	0.50151	0.518000	0.28383	-0.265000	0.10407	TTT		0.418	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2		NM_181646	
