#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ADAMTS20	80070	hgsc.bcm.edu;ucsc.edu	37	12	43825141	43825141	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr12:43825141C>T	ENST00000389420.3	-	22	3254	c.3255G>A	c.(3253-3255)tgG>tgA	p.W1085*	ADAMTS20_ENST00000395541.2_Nonsense_Mutation_p.W239*|ADAMTS20_ENST00000553158.1_Nonsense_Mutation_p.W1085*	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	1085	TSP type-1 6. {ECO:0000255|PROSITE- ProRule:PRU00210}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		TCACAGGACCCCATGGTCCTA	0.388																																																	0													99.0	92.0	94.0					12																	43825141		2203	4300	6503	SO:0001587	stop_gained	80070			AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.3255G>A	12.37:g.43825141C>T	ENSP00000374071:p.Trp1085*		A6NNC9|J3QT00	Nonsense_Mutation	SNP	ENST00000389420.3	37	CCDS31778.2	.	.	.	.	.	.	.	.	.	.	c	40	8.458666	0.98820	.	.	ENSG00000173157	ENST00000389420;ENST00000549670;ENST00000395541;ENST00000553158;ENST00000389417	.	.	.	4.61	3.68	0.42216	.	0.000000	0.47852	D	0.000205	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.3764	0.66881	0.1496:0.8504:0.0:0.0	.	.	.	.	X	1085;251;239;1085;1085	.	ENSP00000374068:W1085X	W	-	3	0	ADAMTS20	42111408	1.000000	0.71417	0.990000	0.47175	0.967000	0.64934	5.620000	0.67736	1.165000	0.42670	0.651000	0.88453	TGG		0.388	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1		NM_025003	
ARSD	414	hgsc.bcm.edu	37	X	2832696	2832696	+	Intron	SNP	T	T	C	rs113031742		TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chrX:2832696T>C	ENST00000381154.1	-	6	1076				ARSD_ENST00000217890.6_5'UTR	NM_001669.3	NP_001660.2	P51689	ARSD_HUMAN	arylsulfatase D						cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			large_intestine(3)|lung(3)	6		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GCAGCCTCACTGGTCCTCTCC	0.423																																																	0													111.0	103.0	106.0					X																	2832696		2203	4300	6503	SO:0001627	intron_variant	414			X83572	CCDS35196.1	Xp22.3	2013-02-14			ENSG00000006756	ENSG00000006756		"""Arylsulfatase family"""	717	protein-coding gene	gene with protein product		300002				7720070	Standard	NM_001669		Approved		uc004cqy.3	P51689	OTTHUMG00000021077	ENST00000381154.1:c.1000+900A>G	X.37:g.2832696T>C			Q9UHJ8	Silent	SNP	ENST00000381154.1	37	CCDS35196.1																																																																																				0.423	ARSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055636.1			
TMEM260	54916	hgsc.bcm.edu	37	14	57113992	57113992	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr14:57113992A>G	ENST00000261556.6	+	16	2023	c.1901A>G	c.(1900-1902)gAg>gGg	p.E634G	RP11-1085N6.2_ENST00000553800.1_RNA|RP11-1085N6.2_ENST00000555924.1_RNA|TMEM260_ENST00000536419.1_Missense_Mutation_p.E168G	NM_017799.3	NP_060269.3	Q9NX78	TM260_HUMAN	transmembrane protein 260	634						integral component of membrane (GO:0016021)											TTACAAAAGGAGCACCCAGTG	0.393																																																	0													49.0	46.0	47.0					14																	57113992		2203	4300	6503	SO:0001583	missense	54916			AK000399	CCDS9727.2	14q22.2	2013-03-08	2013-03-08	2013-03-08	ENSG00000070269	ENSG00000070269			20185	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 101"""	C14orf101			Standard	XR_245695		Approved	FLJ20392	uc001xcm.3	Q9NX78	OTTHUMG00000152337	ENST00000261556.6:c.1901A>G	14.37:g.57113992A>G	ENSP00000261556:p.Glu634Gly		A8KAN4|B3KPF5|Q86XE1	Missense_Mutation	SNP	ENST00000261556.6	37	CCDS9727.2	.	.	.	.	.	.	.	.	.	.	A	8.290	0.817536	0.16607	.	.	ENSG00000070269	ENST00000261556;ENST00000536419	T;T	0.47177	1.44;0.85	5.54	1.86	0.25419	.	0.832329	0.11342	N	0.573915	T	0.30135	0.0755	N	0.24115	0.695	0.09310	N	1	B	0.14012	0.009	B	0.11329	0.006	T	0.20706	-1.0267	10	0.34782	T	0.22	-2.0044	5.5053	0.16850	0.5811:0.2745:0.1445:0.0	.	634	Q9NX78	CN101_HUMAN	G	634;168	ENSP00000261556:E634G;ENSP00000438742:E168G	ENSP00000261556:E634G	E	+	2	0	C14orf101	56183745	0.681000	0.27614	0.013000	0.15412	0.481000	0.33189	1.982000	0.40638	0.158000	0.19367	0.533000	0.62120	GAG		0.393	TMEM260-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276924.1		NM_017799	
CCDC173	129881	hgsc.bcm.edu;ucsc.edu	37	2	170505754	170505754	+	Nonsense_Mutation	SNP	C	C	A	rs138449065	byFrequency	TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr2:170505754C>A	ENST00000447353.1	-	8	1360	c.1255G>T	c.(1255-1257)Gag>Tag	p.E419*		NM_001085447.1	NP_001078916.1	Q0VFZ6	CC173_HUMAN	coiled-coil domain containing 173	419																	CATTTTTTCTCCTTTTCATGT	0.328																																																	0													137.0	123.0	128.0					2																	170505754		1825	4093	5918	SO:0001587	stop_gained	0			BC015980, BC117445	CCDS46445.1	2q31.1	2012-08-07	2012-08-07	2012-08-07	ENSG00000154479	ENSG00000154479			25064	protein-coding gene	gene with protein product	"""hypothetical LOC129881"""		"""chromosome 2 open reading frame 77"""	C2orf77		12477932	Standard	NM_001085447		Approved	LOC129881	uc002ufe.2	Q0VFZ6	OTTHUMG00000154116	ENST00000447353.1:c.1255G>T	2.37:g.170505754C>A	ENSP00000391504:p.Glu419*		Q6PJF6	Nonsense_Mutation	SNP	ENST00000447353.1	37	CCDS46445.1	.	.	.	.	.	.	.	.	.	.	C	36	5.619337	0.96649	.	.	ENSG00000154479	ENST00000447353	.	.	.	5.28	4.4	0.53042	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	.	12.7011	0.57034	0.0:0.9184:0.0:0.0816	.	.	.	.	X	419	.	ENSP00000391504:E419X	E	-	1	0	C2orf77	170214000	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	2.305000	0.43664	1.217000	0.43442	0.467000	0.42956	GAG		0.328	CCDC173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333954.2		NM_001085447	
CALCR	799	hgsc.bcm.edu;ucsc.edu	37	7	93116284	93116284	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr7:93116284T>G	ENST00000394441.1	-	2	325	c.10A>C	c.(10-12)Aca>Cca	p.T4P	CALCR_ENST00000426151.1_Missense_Mutation_p.T4P|CALCR_ENST00000421592.1_Missense_Mutation_p.T4P|CALCR_ENST00000359558.2_Missense_Mutation_p.T22P|MIR489_ENST00000384923.1_RNA|CALCR_ENST00000360249.4_Missense_Mutation_p.T4P	NM_001164738.1	NP_001158210.1	P30988	CALCR_HUMAN	calcitonin receptor	22					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|response to glucocorticoid (GO:0051384)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcitonin binding (GO:0032841)|calcitonin receptor activity (GO:0004948)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(3)	45	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Pramlintide(DB01278)|Salmon Calcitonin(DB00017)	CTTGTAAATGTGAACCTCATT	0.313																																																	0													96.0	103.0	101.0					7																	93116284		2203	4300	6503	SO:0001583	missense	799			L00587	CCDS5631.1, CCDS55125.1	7q21.3	2012-08-10			ENSG00000004948	ENSG00000004948		"""GPCR / Class B : Calcitonin receptors"""	1440	protein-coding gene	gene with protein product		114131				1331173	Standard	NM_001742		Approved	CTR	uc003umw.2	P30988	OTTHUMG00000023599	ENST00000394441.1:c.10A>C	7.37:g.93116284T>G	ENSP00000377959:p.Thr4Pro		A4D1G6|F5H605|O14585|Q13941|Q5ZGL8|Q659U6|Q6DJU8|Q6T712	Missense_Mutation	SNP	ENST00000394441.1	37	CCDS5631.1	.	.	.	.	.	.	.	.	.	.	T	6.910	0.537475	0.13188	.	.	ENSG00000004948	ENST00000359558;ENST00000360249;ENST00000421592;ENST00000535783;ENST00000394441;ENST00000426151	T;T;T;T;T	0.50001	0.76;0.77;0.77;0.85;0.85	3.93	-5.9	0.02275	.	.	.	.	.	T	0.31199	0.0789	L	0.46157	1.445	0.09310	N	1	B;B	0.29805	0.0;0.257	B;B	0.29267	0.001;0.1	T	0.20538	-1.0272	9	0.45353	T	0.12	.	2.1434	0.03780	0.2209:0.0821:0.3521:0.345	.	22;4	F5H605;A4D1G6	.;.	P	22;4;4;4;4;4	ENSP00000352561:T22P;ENSP00000353385:T4P;ENSP00000399552:T4P;ENSP00000377959:T4P;ENSP00000389295:T4P	ENSP00000352561:T22P	T	-	1	0	CALCR	92954220	0.003000	0.15002	0.000000	0.03702	0.001000	0.01503	-0.523000	0.06230	-1.634000	0.01537	-1.139000	0.01908	ACA		0.313	CALCR-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254661.2		NM_001742	
CAMSAP1	157922	hgsc.bcm.edu;ucsc.edu	37	9	138703339	138703339	+	Missense_Mutation	SNP	G	G	A	rs570458407		TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr9:138703339G>A	ENST00000389532.4	-	17	4689	c.4625C>T	c.(4624-4626)aCg>aTg	p.T1542M	CAMSAP1_ENST00000409386.3_Missense_Mutation_p.T1553M|CAMSAP1_ENST00000483991.1_5'UTR|CAMSAP1_ENST00000312405.6_Missense_Mutation_p.T1264M	NM_015447.3	NP_056262.3	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein 1	1542	CKK. {ECO:0000255|PROSITE- ProRule:PRU00841}.				cytoskeleton organization (GO:0007010)|neuron projection development (GO:0031175)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|spectrin binding (GO:0030507)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(11)|lung(16)|ovary(3)|pancreas(1)|skin(1)	47				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		CTTTGGCCCCGTGCCAGTGAG	0.448																																																	0													170.0	136.0	148.0					9																	138703339		2203	4300	6503	SO:0001583	missense	157922			AJ519841	CCDS35176.2	9q34.3	2008-02-05			ENSG00000130559	ENSG00000130559			19946	protein-coding gene	gene with protein product		613774				12477932	Standard	NM_015447		Approved	FLJ31228, DKFZp434F195	uc004cgr.4	Q5T5Y3	OTTHUMG00000020918	ENST00000389532.4:c.4625C>T	9.37:g.138703339G>A	ENSP00000374183:p.Thr1542Met		A1L4L2|B2REB2|B2REB3|Q70W33|Q8NCY0|Q96E80|Q96FM3|Q9UFJ5	Missense_Mutation	SNP	ENST00000389532.4	37	CCDS35176.2	.	.	.	.	.	.	.	.	.	.	G	16.20	3.054613	0.55218	.	.	ENSG00000130559	ENST00000389532;ENST00000312405;ENST00000409386	T;T;T	0.17370	2.29;2.28;2.29	5.2	4.31	0.51392	PRC-barrel-like (1);Microtubule-binding calmodulin-regulated spectrin-associated, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.22898	0.0553	M	0.72118	2.19	0.80722	D	1	P;P	0.50943	0.94;0.859	B;B	0.41723	0.365;0.342	T	0.10245	-1.0638	10	0.87932	D	0	.	14.1102	0.65118	0.073:0.0:0.927:0.0	.	1542;1553	Q5T5Y3;Q5T5Y3-3	CAMP1_HUMAN;.	M	1542;1264;1553	ENSP00000374183:T1542M;ENSP00000312463:T1264M;ENSP00000386420:T1553M	ENSP00000312463:T1264M	T	-	2	0	CAMSAP1	137843160	1.000000	0.71417	0.985000	0.45067	0.979000	0.70002	7.864000	0.87037	1.329000	0.45376	0.561000	0.74099	ACG		0.448	CAMSAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055024.2		XM_351857	
CBLL1	79872	hgsc.bcm.edu	37	7	107395874	107395874	+	Silent	SNP	G	G	A			TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr7:107395874G>A	ENST00000440859.3	+	5	845	c.378G>A	c.(376-378)aaG>aaA	p.K126K	CBLL1_ENST00000222597.2_Silent_p.K125K|CBLL1_ENST00000415884.2_Intron	NM_001284291.1|NM_024814.2	NP_001271220.1|NP_079090.2	Q75N03	HAKAI_HUMAN	Cbl proto-oncogene-like 1, E3 ubiquitin protein ligase	126					negative regulation of cell adhesion (GO:0007162)|positive regulation of cell migration (GO:0030335)|positive regulation of endocytosis (GO:0045807)|protein ubiquitination (GO:0016567)|single organismal cell-cell adhesion (GO:0016337)	ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(3)|skin(3)	21						TTCCATGCAAGCATGTTTTTT	0.254																																																	0													115.0	118.0	117.0					7																	107395874		2203	4299	6502	SO:0001819	synonymous_variant	79872			AK026762	CCDS5747.1, CCDS64754.1	7q22.3	2013-07-09	2013-07-09		ENSG00000105879	ENSG00000105879		"""RING-type (C3HC4) zinc fingers"""	21225	protein-coding gene	gene with protein product	"""Casitas B-lineage lymphoma-like"""	606872	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence-like 1"""			11836526, 11944035	Standard	NM_001284291		Approved	HAKAI, FLJ23109, RNF188	uc003veq.3	Q75N03	OTTHUMG00000154809	ENST00000440859.3:c.378G>A	7.37:g.107395874G>A			B7ZM03|Q8TAJ4|Q9H5S6	Silent	SNP	ENST00000440859.3	37	CCDS5747.1																																																																																				0.254	CBLL1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337156.2		NM_024814	
CCDC144A	9720	hgsc.bcm.edu	37	17	16638643	16638644	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr17:16638643_16638644insT	ENST00000360524.8	+	12	3134_3135	c.3058_3059insT	c.(3058-3060)atgfs	p.M1020fs	RP11-219A15.1_ENST00000448331.3_Frame_Shift_Ins_p.M1020fs|CCDC144A_ENST00000456009.1_Frame_Shift_Ins_p.M740fs|CCDC144A_ENST00000443444.2_Frame_Shift_Ins_p.M1020fs|CCDC144A_ENST00000399273.1_Frame_Shift_Ins_p.M1020fs	NM_014695.1	NP_055510.1	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A	1020																	AACTGAACAAATGTACCAAATT	0.386																																																	0																																										SO:0001589	frameshift_variant	9720			BC133019	CCDS45621.1	17p11.2	2008-10-23			ENSG00000170160	ENSG00000170160			29072	protein-coding gene	gene with protein product						9628581, 11997339	Standard	NM_014695		Approved	KIAA0565, FLJ43983	uc002gqk.1	A2RUR9	OTTHUMG00000059178	ENST00000360524.8:c.3059dupT	17.37:g.16638644_16638644dupT	ENSP00000353717:p.Met1020fs		O60311|Q6ZU57	Frame_Shift_Ins	INS	ENST00000360524.8	37	CCDS45621.1																																																																																				0.386	CCDC144A-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000444093.1			
CRYBB3	1417	hgsc.bcm.edu;ucsc.edu	37	22	25597418	25597418	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr22:25597418G>C	ENST00000215855.2	+	2	135	c.55G>C	c.(55-57)Gac>Cac	p.D19H	CRYBB3_ENST00000404334.1_Missense_Mutation_p.D19H	NM_004076.3	NP_004067.1	P26998	CRBB3_HUMAN	crystallin, beta B3	19	N-terminal arm.				visual perception (GO:0007601)		structural constituent of eye lens (GO:0005212)			large_intestine(2)|lung(2)|prostate(1)	5						GAGCCATGGAGACCTTGGGGG	0.607																																																	0													66.0	68.0	67.0					22																	25597418		2203	4300	6503	SO:0001583	missense	1417				CCDS13830.1	22q11.23	2008-06-10			ENSG00000100053	ENSG00000100053			2400	protein-coding gene	gene with protein product		123630		CRYB3		8999933	Standard	NM_004076		Approved		uc003abo.2	P26998	OTTHUMG00000150869	ENST00000215855.2:c.55G>C	22.37:g.25597418G>C	ENSP00000215855:p.Asp19His		Q3B7S9|Q3T1B7|Q6ISK6|Q92965|Q9UH09	Missense_Mutation	SNP	ENST00000215855.2	37	CCDS13830.1	.	.	.	.	.	.	.	.	.	.	G	18.32	3.598967	0.66332	.	.	ENSG00000100053	ENST00000215855;ENST00000404334	T;T	0.79033	-0.94;-1.23	4.81	4.81	0.61882	.	0.309320	0.24039	U	0.042109	T	0.64046	0.2563	N	0.14661	0.345	0.25509	N	0.987473	B	0.12013	0.005	B	0.08055	0.003	T	0.57705	-0.7765	10	0.46703	T	0.11	.	15.3457	0.74334	0.0:0.0:1.0:0.0	.	19	P26998	CRBB3_HUMAN	H	19	ENSP00000215855:D19H;ENSP00000386123:D19H	ENSP00000215855:D19H	D	+	1	0	CRYBB3	23927418	1.000000	0.71417	0.949000	0.38748	0.991000	0.79684	8.017000	0.88712	2.201000	0.70794	0.655000	0.94253	GAC		0.607	CRYBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320352.1		NM_004076	
E2F5	1875	hgsc.bcm.edu;ucsc.edu	37	8	86118418	86118418	+	Silent	SNP	C	C	A			TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr8:86118418C>A	ENST00000416274.2	+	4	547	c.513C>A	c.(511-513)tcC>tcA	p.S171S	E2F5_ENST00000521429.1_5'UTR|E2F5_ENST00000519128.1_3'UTR|E2F5_ENST00000418930.2_Silent_p.S171S|E2F5_ENST00000517476.1_Silent_p.S10S|E2F5_ENST00000256117.5_Silent_p.S172S	NM_001083588.1|NM_001951.3	NP_001077057.1|NP_001942.2	Q15329	E2F5_HUMAN	E2F transcription factor 5, p130-binding	171	Dimerization. {ECO:0000255}.				gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			NS(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)	8						GTACATTTTCCTATGTAACTC	0.348																																																	0													175.0	171.0	172.0					8																	86118418		1867	4111	5978	SO:0001819	synonymous_variant	1875			X86097	CCDS47885.1, CCDS47886.1, CCDS55254.1	8q21.2	2004-01-29			ENSG00000133740	ENSG00000133740			3119	protein-coding gene	gene with protein product		600967				7892279	Standard	NM_001083588		Approved		uc003ycz.4	Q15329	OTTHUMG00000164785	ENST00000416274.2:c.513C>A	8.37:g.86118418C>A			E9PBN9|Q16601|Q92756	Silent	SNP	ENST00000416274.2	37	CCDS47885.1																																																																																				0.348	E2F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380274.1		NM_001951	
EGR2	1959	hgsc.bcm.edu	37	10	64573811	64573811	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr10:64573811G>C	ENST00000242480.3	-	2	912	c.587C>G	c.(586-588)aCc>aGc	p.T196S	EGR2_ENST00000493899.2_5'Flank|EGR2_ENST00000439032.1_Missense_Mutation_p.T196S|EGR2_ENST00000411732.1_Missense_Mutation_p.T146S	NM_000399.3|NM_001136177.1	NP_000390.2|NP_001129649.1	P11161	EGR2_HUMAN	early growth response 2	196					brain development (GO:0007420)|brain segmentation (GO:0035284)|cell death (GO:0008219)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|facial nerve structural organization (GO:0021612)|fat cell differentiation (GO:0045444)|learning or memory (GO:0007611)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein export from nucleus (GO:0006611)|protein sumoylation (GO:0016925)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of ossification (GO:0030278)|response to insulin (GO:0032868)|rhombomere 3 formation (GO:0021660)|rhombomere 5 formation (GO:0021666)|rhythmic behavior (GO:0007622)|Schwann cell differentiation (GO:0014037)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	36	Prostate(12;0.0297)|all_hematologic(501;0.228)					AGAGGAAGAGGTGGAGGTGGT	0.602																																																	0													99.0	95.0	96.0					10																	64573811		2203	4300	6503	SO:0001583	missense	1959			BC035625	CCDS7267.1, CCDS44409.1	10q21.1	2014-09-17	2009-04-23		ENSG00000122877	ENSG00000122877		"""Zinc fingers, C2H2-type"""	3239	protein-coding gene	gene with protein product	"""Krox-20 homolog, Drosophila"""	129010	"""early growth response 2 (Krox-20 homolog, Drosophila)"""	KROX20			Standard	NM_000399		Approved		uc001jmi.3	P11161	OTTHUMG00000018308	ENST00000242480.3:c.587C>G	10.37:g.64573811G>C	ENSP00000242480:p.Thr196Ser		B2R724|B3KRD7|Q68CZ5|Q8IV26|Q9UNA6	Missense_Mutation	SNP	ENST00000242480.3	37	CCDS7267.1	.	.	.	.	.	.	.	.	.	.	G	9.637	1.137896	0.21123	.	.	ENSG00000122877	ENST00000242480;ENST00000439032;ENST00000411732;ENST00000432380	T;T;T	0.11385	2.78;2.78;2.83	4.78	2.82	0.32997	.	0.655113	0.14238	N	0.332298	T	0.03305	0.0096	N	0.02315	-0.6	0.26154	N	0.980104	B;B	0.15930	0.015;0.001	B;B	0.11329	0.006;0.002	T	0.44034	-0.9354	10	0.02654	T	1	-5.366	7.2594	0.26195	0.0:0.1687:0.4839:0.3475	.	146;196	P11161-2;P11161	.;EGR2_HUMAN	S	196;196;146;209	ENSP00000242480:T196S;ENSP00000402040:T196S;ENSP00000387634:T146S	ENSP00000242480:T196S	T	-	2	0	EGR2	64243817	0.997000	0.39634	0.991000	0.47740	0.949000	0.60115	2.677000	0.46892	0.540000	0.28808	0.655000	0.94253	ACC		0.602	EGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048245.2		NM_000399	
ERCC4	2072	hgsc.bcm.edu;ucsc.edu	37	16	14041533	14041533	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr16:14041533G>T	ENST00000311895.7	+	11	2089	c.2080G>T	c.(2080-2082)Gag>Tag	p.E694*		NM_005236.2	NP_005227.1	Q92889	XPF_HUMAN	excision repair cross-complementation group 4	694	ERCC4.|Nuclease.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|negative regulation of telomere maintenance (GO:0032205)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair involved in interstrand cross-link repair (GO:1901255)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|nucleotide-excision repair, DNA incision, 5'-to lesion (GO:0006296)|resolution of meiotic recombination intermediates (GO:0000712)|response to UV (GO:0009411)|telomere maintenance (GO:0000723)|telomere maintenance via telomere shortening (GO:0010834)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	chromosome, telomeric region (GO:0000781)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleotide-excision repair factor 1 complex (GO:0000110)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	damaged DNA binding (GO:0003684)|endodeoxyribonuclease activity (GO:0004520)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(5)|lung(12)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	38						ATTTCGAAGTGAGCTTCCATC	0.468			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																														yes	Rec		Xeroderma pigmentosum (F)	16	16p13.3-p13.13	2072	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""		E	0													140.0	127.0	132.0					16																	14041533		2197	4300	6497	SO:0001587	stop_gained	2072	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	L76568	CCDS32390.1	16p13.3	2014-09-17	2014-03-07		ENSG00000175595	ENSG00000175595			3436	protein-coding gene	gene with protein product	"""xeroderma pigmentosum, complementation group F"""	133520	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""	XPF		9579555, 8887684	Standard	NM_005236		Approved	RAD1, FANCQ	uc002dce.2	Q92889	OTTHUMG00000048194	ENST00000311895.7:c.2080G>T	16.37:g.14041533G>T	ENSP00000310520:p.Glu694*		A5PKV6|A8K111|O00140|Q8TD83	Nonsense_Mutation	SNP	ENST00000311895.7	37	CCDS32390.1	.	.	.	.	.	.	.	.	.	.	G	39	7.432555	0.98282	.	.	ENSG00000175595	ENST00000311895;ENST00000389138	.	.	.	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-30.5689	18.5707	0.91135	0.0:0.0:1.0:0.0	.	.	.	.	X	694;682	.	ENSP00000310520:E694X	E	+	1	0	ERCC4	13949034	1.000000	0.71417	0.990000	0.47175	0.991000	0.79684	9.200000	0.95010	2.624000	0.88883	0.655000	0.94253	GAG		0.468	ERCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109634.2		NM_005236	
F5	2153	hgsc.bcm.edu	37	1	169510701	169510701	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr1:169510701G>T	ENST00000367797.3	-	13	3828	c.3627C>A	c.(3625-3627)agC>agA	p.S1209R	F5_ENST00000367796.3_Missense_Mutation_p.S1214R	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	1209	35 X 9 AA approximate tandem repeats of [TNP]-L-S-P-D-L-S-Q-T.|B.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	GAGTCGTGTGGCTGAGGTCTG	0.542																																																	0													200.0	216.0	210.0					1																	169510701		2203	4300	6503	SO:0001583	missense	2153			M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.3627C>A	1.37:g.169510701G>T	ENSP00000356771:p.Ser1209Arg		A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	ENST00000367797.3	37	CCDS1281.1	.	.	.	.	.	.	.	.	.	.	G	6.138	0.393686	0.11638	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	T;T	0.34859	1.34;1.34	4.25	-4.02	0.04034	.	1.353180	0.05384	U	0.537751	T	0.08044	0.0201	L	0.34521	1.04	0.19575	N	0.999961	B	0.06786	0.001	B	0.04013	0.001	T	0.23583	-1.0184	9	0.16896	T	0.51	0.0881	7.1427	0.25564	0.5713:0.1263:0.3024:0.0	.	1209	P12259	FA5_HUMAN	R	1209;1214	ENSP00000356771:S1209R;ENSP00000356770:S1214R	ENSP00000356770:S1214R	S	-	3	2	F5	167777325	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-1.699000	0.01906	-0.782000	0.04541	-0.308000	0.09152	AGC		0.542	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083712.1		NM_000130	
ERICH6B	220081	hgsc.bcm.edu	37	13	46170733	46170734	+	Frame_Shift_Ins	INS	-	-	T	rs142875900|rs375947127	byFrequency	TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr13:46170733_46170734insT	ENST00000298738.2	-	3	571_572	c.407_408insA	c.(406-408)gagfs	p.E136fs		NM_182542.2	NP_872348.2	Q5W0A0	ERI6B_HUMAN		136	Glu-rich.									breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)	5						GATActcttcctcctccagatg	0.48																																																	0																																										SO:0001589	frameshift_variant	220081																														ENST00000298738.2:c.408dupA	13.37:g.46170734_46170734dupT	ENSP00000298738:p.Glu136fs		Q96MB5	Frame_Shift_Ins	INS	ENST00000298738.2	37	CCDS45045.1																																																																																				0.480	FAM194B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044781.3			
FAM200B	285550	hgsc.bcm.edu;ucsc.edu	37	4	15688806	15688806	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr4:15688806A>C	ENST00000422728.2	+	2	1044	c.206A>C	c.(205-207)aAa>aCa	p.K69T	FAM200B_ENST00000504137.1_Intron	NM_001145191.1	NP_001138663.1	P0CF97	F200B_HUMAN	family with sequence similarity 200, member B	69							nucleic acid binding (GO:0003676)			endometrium(1)|kidney(1)	2						gattacttaaaatatggcttt	0.308																																																	0													40.0	33.0	35.0					4																	15688806		692	1585	2277	SO:0001583	missense	285550			BC048993	CCDS47028.1	4p15.32	2014-04-02			ENSG00000237765	ENSG00000237765			27740	protein-coding gene	gene with protein product	"""chromosome 4 open reading frame 53"""						Standard	NM_001145191		Approved	C4orf53	uc003gof.4	P0CF97	OTTHUMG00000160279	ENST00000422728.2:c.206A>C	4.37:g.15688806A>C	ENSP00000393017:p.Lys69Thr			Missense_Mutation	SNP	ENST00000422728.2	37	CCDS47028.1	.	.	.	.	.	.	.	.	.	.	A	15.21	2.767130	0.49574	.	.	ENSG00000237765	ENST00000422728	T	0.17370	2.28	3.35	3.35	0.38373	.	.	.	.	.	T	0.27866	0.0686	L	0.39898	1.24	0.22858	N	0.998645	D	0.71674	0.998	D	0.65233	0.933	T	0.03750	-1.1007	9	0.66056	D	0.02	.	8.4244	0.32720	1.0:0.0:0.0:0.0	.	69	P0CF97	F200B_HUMAN	T	69	ENSP00000393017:K69T	ENSP00000393017:K69T	K	+	2	0	FAM200B	15297904	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	2.727000	0.47311	1.767000	0.52121	0.528000	0.53228	AAA		0.308	FAM200B-005	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360100.1		NM_001145191	
FAM71D	161142	hgsc.bcm.edu	37	14	67671485	67671485	+	3'UTR	SNP	A	A	T	rs371800279|rs55981040	byFrequency	TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr14:67671485A>T	ENST00000556046.1	+	0	1132							Q8N9W8	FA71D_HUMAN	family with sequence similarity 71, member D							cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|large_intestine(1)|lung(9)|ovary(1)	13		all_hematologic(31;0.0116)		all cancers(60;0.00107)|BRCA - Breast invasive adenocarcinoma(234;0.00993)|OV - Ovarian serous cystadenocarcinoma(108;0.012)		CGAATAGCACAGACATCACAG	0.502													A|||	68	0.0135783	0.0015	0.0403	5008	,	,		19722	0.0		0.0348	False		,,,				2504	0.0031																0													137.0	123.0	128.0					14																	67671485		2203	4300	6503	SO:0001624	3_prime_UTR_variant	161142				CCDS9778.1	14q23.3	2007-11-20	2007-11-20	2007-11-20		ENSG00000172717			20101	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 54"""	C14orf54			Standard	NM_173526		Approved		uc001xja.2	Q8N9W8		ENST00000556046.1:c.*647A>T	14.37:g.67671485A>T			Q86VN4	Silent	SNP	ENST00000556046.1	37																																																																																					0.502	FAM71D-009	KNOWN	not_organism_supported|basic|appris_candidate	nonsense_mediated_decay	protein_coding	OTTHUMT00000412390.1		NM_173526	
FGF8	2253	hgsc.bcm.edu	37	10	103534502	103534502	+	Silent	SNP	G	G	A			TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr10:103534502G>A	ENST00000344255.3	-	4	290	c.291C>T	c.(289-291)gaC>gaT	p.D97D	FGF8_ENST00000346714.3_Silent_p.D68D|FGF8_ENST00000320185.2_Silent_p.D108D|FGF8_ENST00000485728.1_5'UTR|FGF8_ENST00000347978.2_Silent_p.D79D			P55075	FGF8_HUMAN	fibroblast growth factor 8 (androgen-induced)	97					anatomical structure morphogenesis (GO:0009653)|aorta morphogenesis (GO:0035909)|apoptotic process (GO:0006915)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in mesendoderm migration (GO:0090134)|cell proliferation in forebrain (GO:0021846)|corticotropin hormone secreting cell differentiation (GO:0060128)|dopaminergic neuron differentiation (GO:0071542)|dorsal/ventral axon guidance (GO:0033563)|embryonic hindlimb morphogenesis (GO:0035116)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain morphogenesis (GO:0048853)|forebrain neuron development (GO:0021884)|gastrulation (GO:0007369)|gonad development (GO:0008406)|heart looping (GO:0001947)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|lung morphogenesis (GO:0060425)|male genitalia development (GO:0030539)|MAPK cascade (GO:0000165)|mesodermal cell migration (GO:0008078)|mesonephros development (GO:0001823)|metanephros development (GO:0001656)|midbrain-hindbrain boundary development (GO:0030917)|motor neuron axon guidance (GO:0008045)|negative regulation of cardiac muscle tissue development (GO:0055026)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate morphogenesis (GO:0001839)|neuroepithelial cell differentiation (GO:0060563)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis (GO:0042476)|organ induction (GO:0001759)|otic vesicle formation (GO:0030916)|outflow tract septum morphogenesis (GO:0003148)|pallium development (GO:0021543)|patterning of blood vessels (GO:0001569)|pharyngeal system development (GO:0060037)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of mitosis (GO:0045840)|positive regulation of organ growth (GO:0046622)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|response to oxidative stress (GO:0006979)|signal transduction involved in regulation of gene expression (GO:0023019)|subpallium development (GO:0021544)|thyroid gland development (GO:0030878)|thyroid-stimulating hormone-secreting cell differentiation (GO:0060129)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|type 1 fibroblast growth factor receptor binding (GO:0005105)|type 2 fibroblast growth factor receptor binding (GO:0005111)			endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(2)	5		Colorectal(252;0.122)		Epithelial(162;3.94e-09)|all cancers(201;2.13e-07)		AGGGGTCGCCGTCCTCTGCCA	0.677																																																	0													74.0	64.0	67.0					10																	103534502		2203	4300	6503	SO:0001819	synonymous_variant	2253			D38752	CCDS7515.1, CCDS7516.1, CCDS7517.1, CCDS7518.1, CCDS73185.1	10q25-q26	2014-01-30			ENSG00000107831	ENSG00000107831		"""Endogenous ligands"""	3686	protein-coding gene	gene with protein product		600483				8595889	Standard	NM_033164		Approved	AIGF	uc001ktq.2	P55075	OTTHUMG00000018940	ENST00000344255.3:c.291C>T	10.37:g.103534502G>A			A1A514|Q14915|Q15766	Silent	SNP	ENST00000344255.3	37	CCDS7517.1																																																																																				0.677	FGF8-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049999.1		NM_006119, NM_033165	
FUCA2	2519	hgsc.bcm.edu;ucsc.edu	37	6	143825091	143825091	+	Nonsense_Mutation	SNP	G	G	C			TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr6:143825091G>C	ENST00000002165.6	-	3	766	c.711C>G	c.(709-711)taC>taG	p.Y237*	FUCA2_ENST00000438118.2_Intron|RP1-20N2.6_ENST00000610068.1_RNA|RP1-20N2.6_ENST00000589563.1_RNA|FUCA2_ENST00000367585.1_Intron|RP1-20N2.6_ENST00000593175.1_RNA|RP1-20N2.6_ENST00000593045.1_RNA|RP1-20N2.6_ENST00000590703.1_RNA|RP1-20N2.6_ENST00000415586.1_RNA|RP1-20N2.6_ENST00000591189.1_RNA|RP1-20N2.6_ENST00000591892.1_RNA|RP1-20N2.6_ENST00000589489.1_RNA	NM_032020.4	NP_114409.2	Q9BTY2	FUCO2_HUMAN	fucosidase, alpha-L- 2, plasma	237					fucose metabolic process (GO:0006004)|glycoside catabolic process (GO:0016139)|regulation of entry of bacterium into host cell (GO:2000535)|response to bacterium (GO:0009617)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-L-fucosidase activity (GO:0004560)|fucose binding (GO:0042806)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				OV - Ovarian serous cystadenocarcinoma(155;7.45e-06)|GBM - Glioblastoma multiforme(68;0.0142)		TGCTGTTCCAGTATTGATCCG	0.438																																																	0													77.0	71.0	73.0					6																	143825091		2203	4300	6503	SO:0001587	stop_gained	2519			BC003060	CCDS5200.1	6q24	2012-10-02			ENSG00000001036	ENSG00000001036	3.2.1.51		4008	protein-coding gene	gene with protein product		136820				6590153	Standard	NM_032020		Approved	MGC1314, dJ20N2.5	uc003qjm.3	Q9BTY2	OTTHUMG00000015728	ENST00000002165.6:c.711C>G	6.37:g.143825091G>C	ENSP00000002165:p.Tyr237*		E9PEB6|Q7Z6V1|Q7Z6Y2|Q8NBK4	Nonsense_Mutation	SNP	ENST00000002165.6	37	CCDS5200.1	.	.	.	.	.	.	.	.	.	.	G	33	5.212608	0.95069	.	.	ENSG00000001036	ENST00000002165	.	.	.	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.2836	13.8888	0.63726	0.0728:0.0:0.9272:0.0	.	.	.	.	X	237	.	ENSP00000002165:Y237X	Y	-	3	2	FUCA2	143866784	1.000000	0.71417	1.000000	0.80357	0.554000	0.35429	3.242000	0.51384	2.625000	0.88918	0.650000	0.86243	TAC		0.438	FUCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042521.2		NM_032020	
GRIN2B	2904	hgsc.bcm.edu	37	12	13906649	13906649	+	Silent	SNP	T	T	A			TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr12:13906649T>A	ENST00000609686.1	-	3	821	c.612A>T	c.(610-612)ctA>ctT	p.L204L		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	204					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	ACATGTCCAGTAGGAGGACCT	0.483																																																	0													135.0	132.0	133.0					12																	13906649		2203	4300	6503	SO:0001819	synonymous_variant	2904				CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.612A>T	12.37:g.13906649T>A			Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Silent	SNP	ENST00000609686.1	37	CCDS8662.1																																																																																				0.483	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268014.2			
IL17RC	84818	hgsc.bcm.edu	37	3	9960273	9960273	+	Missense_Mutation	SNP	G	G	C	rs112627391	byFrequency	TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr3:9960273G>C	ENST00000295981.3	+	5	876	c.658G>C	c.(658-660)Gtg>Ctg	p.V220L	IL17RC_ENST00000383812.4_Missense_Mutation_p.V149L|IL17RC_ENST00000416074.2_Missense_Mutation_p.V20L|IL17RC_ENST00000455057.1_Missense_Mutation_p.V149L|IL17RC_ENST00000413608.1_Missense_Mutation_p.V149L|RNU6-882P_ENST00000391025.1_RNA|IL17RC_ENST00000498214.1_3'UTR|IL17RC_ENST00000403601.3_Missense_Mutation_p.V149L	NM_153461.3	NP_703191	Q8NAC3	I17RC_HUMAN	interleukin 17 receptor C	220					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-17 receptor activity (GO:0030368)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						TGCTGCCCTTGTGCAGTTTGG	0.483													G|||	9	0.00179712	0.0068	0.0	5008	,	,		20094	0.0		0.0	False		,,,				2504	0.0																0								G	LEU/VAL,LEU/VAL,LEU/VAL,LEU/VAL,LEU/VAL,LEU/VAL	12,4394	19.1+/-41.9	0,12,2191	80.0	76.0	77.0		445,445,445,445,445,658	3.3	1.0	3	dbSNP_132	77	0,8600		0,0,4300	yes	missense,missense,missense,missense,missense,missense	IL17RC	NM_001203263.1,NM_001203264.1,NM_001203265.1,NM_032732.5,NM_153460.3,NM_153461.3	32,32,32,32,32,32	0,12,6491	CC,CG,GG		0.0,0.2724,0.0923	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	149/708,149/691,149/689,149/706,149/721,220/792	9960273	12,12994	2203	4300	6503	SO:0001583	missense	84818			BC006411	CCDS2590.1, CCDS2591.2, CCDS46746.1, CCDS56240.1, CCDS56241.1, CCDS74898.1	3p25.3	2008-02-05			ENSG00000163702	ENSG00000163702		"""Interleukins and interleukin receptors"""	18358	protein-coding gene	gene with protein product		610925				11706037	Standard	NM_153460		Approved	IL17-RL	uc003bua.3	Q8NAC3	OTTHUMG00000128648	ENST00000295981.3:c.658G>C	3.37:g.9960273G>C	ENSP00000295981:p.Val220Leu		E9PHG1|E9PHJ6|Q6UVY3|Q6UWD4|Q8NFS1|Q9BR97	Missense_Mutation	SNP	ENST00000295981.3	37	CCDS2590.1	8	0.003663003663003663	8	0.016260162601626018	0	0.0	0	0.0	0	0.0	G	9.792	1.178194	0.21787	0.002724	0.0	ENSG00000163702	ENST00000383812;ENST00000438091;ENST00000295981;ENST00000436503;ENST00000403601;ENST00000416074;ENST00000455057;ENST00000413608	T;T;T;T;T;T;T;T	0.14766	2.48;2.48;2.48;2.48;2.48;2.48;2.48;2.48	5.12	3.32	0.38043	.	0.286793	0.24960	N	0.034237	T	0.06280	0.0162	L	0.56769	1.78	0.22412	N	0.999123	B;B;B;B;B;B;B;B;B	0.24258	0.022;0.015;0.013;0.013;0.1;0.1;0.022;0.039;0.02	B;B;B;B;B;B;B;B;B	0.19391	0.025;0.009;0.011;0.011;0.017;0.017;0.025;0.008;0.023	T	0.14172	-1.0482	10	0.39692	T	0.17	-13.2673	7.1724	0.25726	0.1991:0.0:0.8009:0.0	.	149;20;149;149;149;149;149;220;149	Q8NAC3-4;F5H4Z2;E9PHG1;A8BWD5;E9PHJ6;A8BWC9;Q8NAC3-3;Q8NAC3;Q8NAC3-2	.;.;.;.;.;.;.;I17RC_HUMAN;.	L	149;124;220;124;149;20;149;149	ENSP00000373323:V149L;ENSP00000414609:V124L;ENSP00000295981:V220L;ENSP00000401128:V124L;ENSP00000384969:V149L;ENSP00000395315:V20L;ENSP00000407894:V149L;ENSP00000396064:V149L	ENSP00000295981:V220L	V	+	1	0	IL17RC	9935273	0.000000	0.05858	0.956000	0.39512	0.899000	0.52679	0.470000	0.22084	1.164000	0.42652	-0.263000	0.10527	GTG		0.483	IL17RC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250526.2		NM_032732	
KCNH8	131096	hgsc.bcm.edu;ucsc.edu	37	3	19492864	19492864	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr3:19492864T>A	ENST00000328405.2	+	10	2059	c.1793T>A	c.(1792-1794)gTt>gAt	p.V598D	KCNH8_ENST00000537696.1_3'UTR	NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	598					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						TCCATGGAAGTTCTTAAAGAC	0.448																																					NSCLC(124;1625 1765 8018 24930 42026)												0													81.0	82.0	82.0					3																	19492864		2203	4300	6503	SO:0001583	missense	131096			AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.1793T>A	3.37:g.19492864T>A	ENSP00000328813:p.Val598Asp		B7Z2I7|Q59GQ6	Missense_Mutation	SNP	ENST00000328405.2	37	CCDS2632.1	.	.	.	.	.	.	.	.	.	.	T	28.6	4.932920	0.92458	.	.	ENSG00000183960	ENST00000328405	D	0.94862	-3.54	5.49	5.49	0.81192	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.28946	U	0.013627	D	0.98182	0.9399	H	0.96080	3.765	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99620	1.0983	9	.	.	.	.	15.6034	0.76642	0.0:0.0:0.0:1.0	.	598	Q96L42	KCNH8_HUMAN	D	598	ENSP00000328813:V598D	.	V	+	2	0	KCNH8	19467868	1.000000	0.71417	0.940000	0.37924	0.980000	0.70556	8.040000	0.89188	2.096000	0.63516	0.383000	0.25322	GTT		0.448	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252139.2		NM_144633	
KRTAP10-3	386682	hgsc.bcm.edu	37	21	45978591	45978591	+	Missense_Mutation	SNP	G	G	A	rs79221051	byFrequency	TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr21:45978591G>A	ENST00000391620.1	-	1	52	c.8C>T	c.(7-9)aCg>aTg	p.T3M	TSPEAR_ENST00000323084.4_Intron|TSPEAR_ENST00000397916.1_Intron	NM_198696.2	NP_941969.2	P60369	KR103_HUMAN	keratin associated protein 10-3	3			T -> A (in dbSNP:rs452472). {ECO:0000269|PubMed:15489334}.			keratin filament (GO:0045095)				kidney(1)|lung(4)|prostate(1)|skin(1)	7						CATGGTAGACGTGGCCATGCT	0.647													.|||	646	0.128994	0.171	0.1282	5008	,	,		17637	0.005		0.175	False		,,,				2504	0.1534																0								G	,MET/THR	711,3695	281.1+/-275.7	54,603,1546	59.0	59.0	59.0		,8	1.5	0.0	21	dbSNP_131	59	1608,6992	289.6+/-299.4	151,1306,2843	no	intron,missense	TSPEAR,KRTAP10-3	NM_144991.2,NM_198696.2	,81	205,1909,4389	AA,AG,GG		18.6977,16.1371,17.8302	,benign	,3/222	45978591	2319,10687	2203	4300	6503	SO:0001583	missense	386682			AJ566383	CCDS42956.1	21q22.3	2007-10-05			ENSG00000212935	ENSG00000212935		"""Keratin associated proteins"""	22968	protein-coding gene	gene with protein product				KRTAP18-3			Standard	NM_198696		Approved	KAP10.3, KAP18.3	uc002zfj.1	P60369	OTTHUMG00000057628	ENST00000391620.1:c.8C>T	21.37:g.45978591G>A	ENSP00000375478:p.Thr3Met		A3KN67|Q70LJ4	Missense_Mutation	SNP	ENST00000391620.1	37	CCDS42956.1	290	0.13278388278388278	112	0.22764227642276422	50	0.13812154696132597	1	0.0017482517482517483	127	0.16754617414248021	g	2.833	-0.242255	0.05906	0.161371	0.186977	ENSG00000212935	ENST00000391620	T	0.06449	3.3	3.32	1.47	0.22746	.	.	.	.	.	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	B	0.06786	0.001	B	0.04013	0.001	T	0.43556	-0.9384	8	0.87932	D	0	.	7.1646	0.25683	0.2335:0.0:0.7665:0.0	.	3	P60369	KR103_HUMAN	M	3	ENSP00000375478:T3M	ENSP00000375478:T3M	T	-	2	0	KRTAP10-3	44803019	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.141000	0.16076	0.245000	0.21373	-0.265000	0.10407	ACG		0.647	KRTAP10-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128031.1			
LRP1B	53353	hgsc.bcm.edu	37	2	141259355	141259355	+	Silent	SNP	G	G	A	rs148504930		TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr2:141259355G>A	ENST00000389484.3	-	55	9722	c.8751C>T	c.(8749-8751)ggC>ggT	p.G2917G		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2917	LDL-receptor class A 20. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.G2917G(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CTGAACCATCGCCACAGTCAT	0.408										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												1	Substitution - coding silent(1)	prostate(1)						G		0,4406		0,0,2203	104.0	103.0	103.0		8751	-9.0	0.8	2	dbSNP_134	103	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	LRP1B	NM_018557.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		2917/4600	141259355	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	53353			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.8751C>T	2.37:g.141259355G>A			Q8WY29|Q8WY30|Q8WY31	Silent	SNP	ENST00000389484.3	37	CCDS2182.1																																																																																				0.408	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2		NM_018557	
MED14	9282	hgsc.bcm.edu	37	X	40526075	40526075	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chrX:40526075A>C	ENST00000324817.1	-	24	3280	c.3162T>G	c.(3160-3162)agT>agG	p.S1054R		NM_004229.3	NP_004220.2	O60244	MED14_HUMAN	mediator complex subunit 14	1054	Pro-rich.				androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(2)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TCAAAGCCCCACTGGGGGAGC	0.483																																																	0													25.0	23.0	24.0					X																	40526075		2201	4292	6493	SO:0001583	missense	9282			AB006651	CCDS14254.1	Xp11.4	2008-05-14	2007-07-30	2007-07-30	ENSG00000180182	ENSG00000180182			2370	protein-coding gene	gene with protein product		300182	"""cofactor required for Sp1 transcriptional activation, subunit 2, 150kDa"""	CXorf4, CRSP2		9989412, 9598311	Standard	NM_004229		Approved	EXLM1, CRSP150, TRAP170, RGR1, CSRP	uc004dex.4	O60244	OTTHUMG00000024107	ENST00000324817.1:c.3162T>G	X.37:g.40526075A>C	ENSP00000323720:p.Ser1054Arg		Q4KMR7|Q9UNB3	Missense_Mutation	SNP	ENST00000324817.1	37	CCDS14254.1	.	.	.	.	.	.	.	.	.	.	A	17.88	3.497202	0.64186	.	.	ENSG00000180182	ENST00000324817	.	.	.	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.66005	0.2746	L	0.47716	1.5	0.53688	D	0.999976	D	0.61697	0.99	D	0.69142	0.962	T	0.63310	-0.6666	9	0.27785	T	0.31	.	10.9003	0.47047	0.9238:0.0:0.0762:0.0	.	1054	O60244	MED14_HUMAN	R	1054	.	ENSP00000323720:S1054R	S	-	3	2	MED14	40411019	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	2.239000	0.43079	1.896000	0.54893	0.402000	0.26972	AGT		0.483	MED14-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060692.1		NM_004229	
NAA25	80018	hgsc.bcm.edu;ucsc.edu	37	12	112498998	112498998	+	Silent	SNP	A	A	G			TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr12:112498998A>G	ENST00000261745.4	-	12	1592	c.1344T>C	c.(1342-1344)caT>caC	p.H448H	RP1-267L14.3_ENST00000551125.1_RNA	NM_024953.3	NP_079229.2	Q14CX7	NAA25_HUMAN	N(alpha)-acetyltransferase 25, NatB auxiliary subunit	448						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(1)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	46						ATTCCAGTCCATGCTGGTACC	0.433																																																	0													109.0	86.0	94.0					12																	112498998		2203	4300	6503	SO:0001819	synonymous_variant	80018			AB054990	CCDS9159.1	12q24.13	2013-10-11	2010-01-14	2010-01-14		ENSG00000111300		"""N(alpha)-acetyltransferase subunits"""	25783	protein-coding gene	gene with protein product		612755	"""chromosome 12 open reading frame 30"""	C12orf30		19660095	Standard	NM_024953		Approved	FLJ13089	uc001ttm.3	Q14CX7	OTTHUMG00000169638	ENST00000261745.4:c.1344T>C	12.37:g.112498998A>G			A0JLU7|Q6MZH1|Q7Z4N6|Q9H911	Silent	SNP	ENST00000261745.4	37	CCDS9159.1																																																																																				0.433	NAA25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405205.1		NM_024953	
NEK5	341676	hgsc.bcm.edu;ucsc.edu	37	13	52649897	52649897	+	Silent	SNP	T	T	C	rs370748187		TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr13:52649897T>C	ENST00000355568.4	-	20	1933	c.1794A>G	c.(1792-1794)gaA>gaG	p.E598E		NM_199289.1	NP_954983.1	Q6P3R8	NEK5_HUMAN	NIMA-related kinase 5	598					positive regulation of cysteine-type endopeptidase activity (GO:2001056)|positive regulation of striated muscle cell differentiation (GO:0051155)		ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(11)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	39		Breast(56;0.00173)|Lung NSC(96;0.0168)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;3.7e-08)		GGCATACCTCTTCCTCTTGGA	0.303																																																	0								T		1,4397	2.1+/-5.4	0,1,2198	40.0	41.0	41.0		1794	2.6	1.0	13		41	0,8588		0,0,4294	no	coding-synonymous	NEK5	NM_199289.1		0,1,6492	CC,CT,TT		0.0,0.0227,0.0077		598/709	52649897	1,12985	2199	4294	6493	SO:0001819	synonymous_variant	341676			BC063885	CCDS31979.1	13q14.2	2012-11-15	2012-11-15		ENSG00000197168	ENSG00000197168			7748	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)-related kinase 5"""			9552363	Standard	XM_006719807		Approved		uc001vge.3	Q6P3R8	OTTHUMG00000016957	ENST00000355568.4:c.1794A>G	13.37:g.52649897T>C			Q5TAP5	Silent	SNP	ENST00000355568.4	37	CCDS31979.1																																																																																				0.303	NEK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045045.3		NM_199289	
NOTCH3	4854	hgsc.bcm.edu;ucsc.edu	37	19	15278141	15278141	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr19:15278141G>A	ENST00000263388.2	-	29	5356	c.5281C>T	c.(5281-5283)Cgc>Tgc	p.R1761C		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1761					forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			GGTGCCACGCGGATGTCAGCA	0.622																																																	0													144.0	108.0	120.0					19																	15278141		2203	4300	6503	SO:0001583	missense	4854			U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.5281C>T	19.37:g.15278141G>A	ENSP00000263388:p.Arg1761Cys		Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	ENST00000263388.2	37	CCDS12326.1	.	.	.	.	.	.	.	.	.	.	G	19.90	3.912364	0.72983	.	.	ENSG00000074181	ENST00000263388	D	0.83335	-1.71	4.26	4.26	0.50523	.	.	.	.	.	T	0.80518	0.4638	M	0.70842	2.15	0.80722	D	1	P	0.38800	0.648	B	0.36418	0.224	T	0.82914	-0.0221	9	0.66056	D	0.02	.	10.9122	0.47116	0.0:0.0:0.8119:0.1881	.	1761	Q9UM47	NOTC3_HUMAN	C	1761	ENSP00000263388:R1761C	ENSP00000263388:R1761C	R	-	1	0	NOTCH3	15139141	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	6.409000	0.73289	2.193000	0.70182	0.467000	0.42956	CGC		0.622	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1		NM_000435	
PCYT2	5833	hgsc.bcm.edu	37	17	79866843	79866843	+	Silent	SNP	G	G	T			TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr17:79866843G>T	ENST00000538936.2	-	3	357	c.249C>A	c.(247-249)atC>atA	p.I83I	PCYT2_ENST00000331285.3_Silent_p.I5I|PCYT2_ENST00000570388.1_Silent_p.I5I|PCYT2_ENST00000538721.2_Silent_p.I83I|PCYT2_ENST00000571105.1_Silent_p.I83I|PCYT2_ENST00000570391.1_Silent_p.I51I	NM_001256435.1|NM_002861.3	NP_001243364.1|NP_002852.1	Q99447	PCY2_HUMAN	phosphate cytidylyltransferase 2, ethanolamine	83					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)	ethanolamine-phosphate cytidylyltransferase activity (GO:0004306)			breast(2)|endometrium(1)|lung(4)|ovary(1)	8	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)		Lamivudine(DB00709)	CCACCCATTTGATGGCCTGCA	0.567																																																	0													126.0	125.0	125.0					17																	79866843		2203	4296	6499	SO:0001819	synonymous_variant	5833			D84307	CCDS11791.1, CCDS54178.1, CCDS58610.1, CCDS62364.1	17q25.3	2008-07-18				ENSG00000185813			8756	protein-coding gene	gene with protein product		602679				9083101	Standard	XM_005256386		Approved	ET	uc002kch.2	Q99447		ENST00000538936.2:c.249C>A	17.37:g.79866843G>T			B7Z7A5|B7ZAS0|F5H8B1|Q6IBM3|Q96G08	Silent	SNP	ENST00000538936.2	37	CCDS11791.1																																																																																				0.567	PCYT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439939.1		NM_002861	
PDS5A	23244	hgsc.bcm.edu;ucsc.edu	37	4	39905679	39905679	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr4:39905679G>A	ENST00000303538.8	-	12	1905	c.1366C>T	c.(1366-1368)Cag>Tag	p.Q456*	PDS5A_ENST00000503396.1_Nonsense_Mutation_p.Q456*	NM_001100399.1	NP_001093869.1			PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae)											breast(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(9)|lung(14)|prostate(3)|skin(1)|urinary_tract(1)	39						ATGCTGTTCTGATAATAAATA	0.328																																																	0													83.0	75.0	77.0					4																	39905679		1845	4103	5948	SO:0001587	stop_gained	23244			AF294791	CCDS47045.1, CCDS54759.1	4p14	2007-06-20			ENSG00000121892	ENSG00000121892			29088	protein-coding gene	gene with protein product		613200				11076961, 15855230	Standard	NM_001100399		Approved	KIAA0648, PIG54, SCC-112	uc003guv.4	Q29RF7	OTTHUMG00000160582	ENST00000303538.8:c.1366C>T	4.37:g.39905679G>A	ENSP00000303427:p.Gln456*			Nonsense_Mutation	SNP	ENST00000303538.8	37	CCDS47045.1	.	.	.	.	.	.	.	.	.	.	G	42	9.216978	0.99103	.	.	ENSG00000121892	ENST00000303538;ENST00000503396	.	.	.	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-8.3464	19.2273	0.93822	0.0:0.0:1.0:0.0	.	.	.	.	X	456	.	.	Q	-	1	0	PDS5A	39582074	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.869000	0.99810	2.557000	0.86248	0.591000	0.81541	CAG		0.328	PDS5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361287.1		NM_015200	
PLEKHG4B	153478	hgsc.bcm.edu	37	5	145006	145006	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr5:145006G>C	ENST00000283426.6	+	4	858	c.808G>C	c.(808-810)Gcc>Ccc	p.A270P	Y_RNA_ENST00000362670.1_RNA	NM_052909.3	NP_443141.3	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4B	270							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(1)|large_intestine(2)|lung(2)|prostate(3)|skin(3)	11			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		AGCTGCCCCTGCCGTCTCCCA	0.617																																																	0													56.0	53.0	54.0					5																	145006		2203	4300	6503	SO:0001583	missense	153478			BC008352	CCDS34124.1	5p15.33	2013-01-11			ENSG00000153404	ENSG00000153404		"""Pleckstrin homology (PH) domain containing"""	29399	protein-coding gene	gene with protein product						11572484	Standard	NM_052909		Approved	KIAA1909	uc003jak.2	Q96PX9	OTTHUMG00000161570	ENST00000283426.6:c.808G>C	5.37:g.145006G>C	ENSP00000283426:p.Ala270Pro			Missense_Mutation	SNP	ENST00000283426.6	37	CCDS34124.1	.	.	.	.	.	.	.	.	.	.	.	11.84	1.758076	0.31137	.	.	ENSG00000153404	ENST00000283426;ENST00000502646	T;T	0.60171	0.21;0.21	3.17	3.17	0.36434	.	.	.	.	.	T	0.71962	0.3402	M	0.76328	2.33	0.24876	N	0.992255	D	0.76494	0.999	D	0.66196	0.942	T	0.61078	-0.7135	9	0.41790	T	0.15	.	11.7907	0.52068	0.0:0.0:1.0:0.0	.	270	Q96PX9	PKH4B_HUMAN	P	270;184	ENSP00000283426:A270P;ENSP00000422493:A184P	ENSP00000283426:A270P	A	+	1	0	PLEKHG4B	198006	0.228000	0.23718	0.040000	0.18447	0.117000	0.20001	1.384000	0.34396	1.317000	0.45149	0.313000	0.20887	GCC		0.617	PLEKHG4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365359.1		NM_052909	
PLEKHG6	55200	hgsc.bcm.edu	37	12	6436888	6436888	+	Silent	SNP	G	G	A	rs376640639		TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr12:6436888G>A	ENST00000396988.3	+	15	2369	c.2139G>A	c.(2137-2139)ggG>ggA	p.G713G	PLEKHG6_ENST00000011684.7_Silent_p.G713G|PLEKHG6_ENST00000304581.8_Silent_p.G243G|PLEKHG6_ENST00000449001.2_Silent_p.G681G	NM_001144856.1	NP_001138328.1	Q3KR16	PKHG6_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 6	713						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(4)	23						AGTCCTCAGGGGAGGAGGAAG	0.647																																																	0													18.0	22.0	21.0					12																	6436888		2200	4292	6492	SO:0001819	synonymous_variant	55200			AK001527	CCDS8541.1, CCDS44808.1	12p13.31	2013-01-11			ENSG00000008323	ENSG00000008323		"""Pleckstrin homology (PH) domain containing"""	25562	protein-coding gene	gene with protein product		611743					Standard	NM_018173		Approved	FLJ10665	uc001qnr.3	Q3KR16	OTTHUMG00000168266	ENST00000396988.3:c.2139G>A	12.37:g.6436888G>A			Q3SWR1|Q8N1P1|Q8WYY1|Q9H8F4|Q9NVK9	Silent	SNP	ENST00000396988.3	37	CCDS8541.1																																																																																				0.647	PLEKHG6-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399031.1		NM_018173	
PSMD13	5719	hgsc.bcm.edu	37	11	244167	244167	+	Silent	SNP	C	C	T	rs1128320	byFrequency	TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr11:244167C>T	ENST00000532097.1	+	4	720	c.216C>T	c.(214-216)aaC>aaT	p.N72N	PSMD13_ENST00000352303.5_Silent_p.N72N|PSMD13_ENST00000431206.2_Silent_p.N74N	NM_002817.3	NP_002808.3	Q9UNM6	PSD13_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 13	72					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|meiosis I (GO:0007127)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)		p.N72N(1)|p.N74N(1)		NS(1)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	10		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;7.79e-27)|Epithelial(43;4e-26)|OV - Ovarian serous cystadenocarcinoma(40;6.02e-21)|BRCA - Breast invasive adenocarcinoma(625;3.93e-05)|Lung(200;0.112)|LUSC - Lung squamous cell carcinoma(625;0.129)		TCAGGGTGAACCCTTTGTCCC	0.418													T|||	4083	0.815296	0.8918	0.83	5008	,	,		16356	0.8036		0.7306	False		,,,				2504	0.8006																2	Substitution - coding silent(2)	large_intestine(2)						T	,	3855,551	224.3+/-240.5	1713,429,61	57.0	62.0	60.0		216,222	-2.1	1.0	11	dbSNP_86	60	6312,2288	364.1+/-333.4	2371,1570,359	no	coding-synonymous,coding-synonymous	PSMD13	NM_002817.3,NM_175932.2	,	4084,1999,420	TT,TC,CC		26.6047,12.5057,21.8284	,	72/377,74/379	244167	10167,2839	2203	4300	6503	SO:0001819	synonymous_variant	5719			AB009398	CCDS7692.1, CCDS44504.1	11p15.5	2008-05-22			ENSG00000185627	ENSG00000185627		"""Proteasome (prosome, macropain) subunits"""	9558	protein-coding gene	gene with protein product		603481				9714768, 8811196	Standard	NM_002817		Approved	p40.5, Rpn9	uc001loo.2	Q9UNM6	OTTHUMG00000119072	ENST00000532097.1:c.216C>T	11.37:g.244167C>T			B3KT15|O75831|Q53XU2|Q9UNV3	Silent	SNP	ENST00000532097.1	37	CCDS7692.1																																																																																				0.418	PSMD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239286.2		NM_002817	
PYROXD2	84795	hgsc.bcm.edu	37	10	100152266	100152266	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr10:100152266C>T	ENST00000370575.4	-	10	1033	c.985G>A	c.(985-987)Gat>Aat	p.D329N	MIR1287_ENST00000408492.1_RNA|PYROXD2_ENST00000483923.1_5'UTR	NM_032709.2	NP_116098.2	Q8N2H3	PYRD2_HUMAN	pyridine nucleotide-disulphide oxidoreductase domain 2	329							oxidoreductase activity (GO:0016491)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	12						TCTGTGCCATCTTCCAGCACA	0.567																																																	0													274.0	185.0	215.0					10																	100152266		2203	4300	6503	SO:0001583	missense	84795			AK074429	CCDS7474.1	10q24.2	2009-04-22	2009-04-22	2009-04-22	ENSG00000119943	ENSG00000119943			23517	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 33"""	C10orf33			Standard	NM_032709		Approved	FLJ23849	uc001kpc.3	Q8N2H3	OTTHUMG00000018877	ENST00000370575.4:c.985G>A	10.37:g.100152266C>T	ENSP00000359607:p.Asp329Asn		D3DR61|Q5TAA9|Q9BRQ1	Missense_Mutation	SNP	ENST00000370575.4	37	CCDS7474.1	.	.	.	.	.	.	.	.	.	.	C	13.47	2.248081	0.39697	.	.	ENSG00000119943	ENST00000370575	T	0.61859	0.07	5.0	4.1	0.47936	.	0.149804	0.64402	D	0.000016	T	0.47002	0.1422	L	0.39020	1.185	0.58432	D	0.999996	B	0.15141	0.012	B	0.12837	0.008	T	0.35649	-0.9780	10	0.34782	T	0.22	-6.7916	12.947	0.58376	0.0:0.9206:0.0:0.0794	.	329	Q8N2H3	PYRD2_HUMAN	N	329	ENSP00000359607:D329N	ENSP00000359607:D329N	D	-	1	0	PYROXD2	100142256	1.000000	0.71417	0.690000	0.30148	0.322000	0.28314	7.290000	0.78711	1.092000	0.41356	0.655000	0.94253	GAT		0.567	PYROXD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049782.2		NM_032709	
RNF216	54476	hgsc.bcm.edu;ucsc.edu	37	7	5781389	5781389	+	Intron	SNP	C	C	T			TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr7:5781389C>T	ENST00000425013.2	-	4	426				RNF216_ENST00000389902.3_Missense_Mutation_p.D87N	NM_207111.3|NM_207116.2	NP_996994.1|NP_996999.1	Q9NWF9	RN216_HUMAN	ring finger protein 216						apoptotic process (GO:0006915)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|regulation of defense response to virus by host (GO:0050691)|regulation of interferon-beta production (GO:0032648)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)		FBXL18/RNF216(2)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)|skin(1)|urinary_tract(4)	33		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)		CTTTTCAGATCTTGCCACTGG	0.368																																																	0													109.0	105.0	106.0					7																	5781389		2203	4299	6502	SO:0001627	intron_variant	54476			AY062174	CCDS34594.1, CCDS34595.1	7p22.1	2014-02-12	2007-08-20		ENSG00000011275	ENSG00000011275		"""RING-type (C3HC4) zinc fingers"""	21698	protein-coding gene	gene with protein product		609948					Standard	NM_207111		Approved	TRIAD3, UBCE7IP1, ZIN	uc003sox.2	Q9NWF9	OTTHUMG00000155500	ENST00000425013.2:c.202-114G>A	7.37:g.5781389C>T			Q6Y691|Q75ML7|Q7Z2H7|Q7Z7C1|Q8NHW7|Q9NYT1	Missense_Mutation	SNP	ENST00000425013.2	37	CCDS34595.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.58|18.58	3.655252|3.655252	0.67472|0.67472	.|.	.|.	ENSG00000011275|ENSG00000011275	ENST00000389902|ENST00000458425	T|.	0.50277|.	0.75|.	5.87|5.87	5.87|5.87	0.94306|0.94306	.|.	0.148382|.	0.48767|.	D|.	0.000172|.	T|T	0.63094|0.63094	0.2482|0.2482	L|L	0.43152|0.43152	1.355|1.355	0.34896|0.34896	D|D	0.746026|0.746026	P|.	0.49559|.	0.925|.	P|.	0.52159|.	0.691|.	T|T	0.65784|0.65784	-0.6084|-0.6084	9|5	.|.	.|.	.|.	-21.8485|-21.8485	17.7375|17.7375	0.88397|0.88397	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	87|.	Q9NWF9-1|.	.|.	N|K	87|87	ENSP00000374552:D87N|.	.|.	D|E	-|-	1|1	0|0	RNF216|RNF216	5747915|5747915	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.119000|1.119000	0.31258|0.31258	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GAT|GAA		0.368	RNF216-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000340374.1		NM_207111	
SAGE1	55511	hgsc.bcm.edu;ucsc.edu	37	X	134991924	134991924	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chrX:134991924G>T	ENST00000370709.3	+	13	1709	c.1709G>T	c.(1708-1710)aGt>aTt	p.S570I	SAGE1_ENST00000324447.3_Missense_Mutation_p.S570I|SAGE1_ENST00000537770.1_Missense_Mutation_p.S194I|SAGE1_ENST00000535938.1_Missense_Mutation_p.S570I			Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1	570						nucleus (GO:0005634)				breast(5)|endometrium(5)|large_intestine(10)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	55	Acute lymphoblastic leukemia(192;0.000127)					CCGGCCATGAGTACCAGGGAT	0.413																																																	0													147.0	126.0	134.0					X																	134991924		2203	4300	6503	SO:0001583	missense	55511			AJ278111	CCDS14652.1	Xq26	2009-03-25			ENSG00000181433	ENSG00000181433			30369	protein-coding gene	gene with protein product	"""cancer/testis antigen 14"""	300359				10919659	Standard	NM_018666		Approved	SAGE, CT14	uc004ezh.3	Q9NXZ1	OTTHUMG00000022496	ENST00000370709.3:c.1709G>T	X.37:g.134991924G>T	ENSP00000359743:p.Ser570Ile		Q5JNW0	Missense_Mutation	SNP	ENST00000370709.3	37	CCDS14652.1	.	.	.	.	.	.	.	.	.	.	G	5.150	0.213269	0.09757	.	.	ENSG00000181433	ENST00000324447;ENST00000535938;ENST00000537770;ENST00000370709	T;T;T;T	0.35789	1.36;1.36;1.29;1.36	0.495	0.495	0.16890	.	0.137335	0.49305	U	0.000155	T	0.37210	0.0995	N	0.24115	0.695	0.09310	N	1	D;P	0.55605	0.972;0.845	D;P	0.66351	0.943;0.55	T	0.10965	-1.0607	9	0.51188	T	0.08	.	.	.	.	.	194;570	F5H2Z8;Q9NXZ1	.;SAGE1_HUMAN	I	570;570;194;570	ENSP00000323191:S570I;ENSP00000445959:S570I;ENSP00000438276:S194I;ENSP00000359743:S570I	ENSP00000323191:S570I	S	+	2	0	SAGE1	134819590	0.048000	0.20356	0.009000	0.14445	0.008000	0.06430	0.856000	0.27818	0.494000	0.27859	0.263000	0.19301	AGT		0.413	SAGE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058448.1		NM_018666	
ZBED9	114821	hgsc.bcm.edu	37	6	28543264	28543264	+	Silent	SNP	C	C	T	rs17336532	byFrequency	TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr6:28543264C>T	ENST00000452236.2	-	3	1835	c.1218G>A	c.(1216-1218)ttG>ttA	p.L406L	SCAND3_ENST00000530247.1_5'Flank	NM_052923.1	NP_443155.1														NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						TTAATGACCGCAAAAAAGTTA	0.373													C|||	892	0.178115	0.1899	0.1729	5008	,	,		19492	0.1419		0.173	False		,,,				2504	0.2086																0								C		786,3614	288.1+/-279.7	64,658,1478	47.0	50.0	49.0		1218	3.5	1.0	6	dbSNP_123	49	1767,6833	311.6+/-310.4	184,1399,2717	no	coding-synonymous	SCAND3	NM_052923.1		248,2057,4195	TT,TC,CC		20.5465,17.8636,19.6385		406/1326	28543264	2553,10447	2200	4300	6500	SO:0001819	synonymous_variant	114821																														ENST00000452236.2:c.1218G>A	6.37:g.28543264C>T				Silent	SNP	ENST00000452236.2	37	CCDS34355.1																																																																																				0.373	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000043551.3			
SDHA	6389	hgsc.bcm.edu	37	5	236653	236653	+	Silent	SNP	C	C	A	rs75091805	byFrequency	TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr5:236653C>A	ENST00000264932.6	+	10	1486	c.1371C>A	c.(1369-1371)ctC>ctA	p.L457L	SDHA_ENST00000510361.1_Silent_p.L409L|SDHA_ENST00000504309.1_Silent_p.L457L	NM_004168.2	NP_004159.2	P31040	SDHA_HUMAN	succinate dehydrogenase complex, subunit A, flavoprotein (Fp)	457					cellular metabolic process (GO:0044237)|nervous system development (GO:0007399)|oxidation-reduction process (GO:0055114)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|liver(2)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	40			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	CAAACTCGCTCTTGGACCTGG	0.587									Familial Paragangliomas																																								0													91.0	82.0	85.0					5																	236653		2203	4300	6503	SO:0001819	synonymous_variant	6389	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss	BC001380	CCDS3853.1	5p15	2014-09-17			ENSG00000073578	ENSG00000073578		"""Mitochondrial respiratory chain complex / Complex II"""	10680	protein-coding gene	gene with protein product		600857		SDH2		7798181	Standard	XM_005248329		Approved	FP, SDHF	uc003jao.4	P31040	OTTHUMG00000090275	ENST00000264932.6:c.1371C>A	5.37:g.236653C>A			A8K5J6|B4DJ60|E9PBJ5|Q16395|Q59GW8|Q8IW48|Q9UMY5	Silent	SNP	ENST00000264932.6	37	CCDS3853.1	222	0.10164835164835165	47	0.09552845528455285	42	0.11602209944751381	74	0.12937062937062938	59	0.07783641160949868	g	4.415	0.076790	0.08485	.	.	ENSG00000073578	ENST00000515815	.	.	.	5.01	-1.79	0.07932	.	.	.	.	.	T	0.00724	0.0024	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.03043	-1.1079	4	.	.	.	.	7.9398	0.29952	0.0:0.2923:0.4778:0.2299	.	.	.	.	Y	9	.	.	S	+	2	0	SDHA	289653	0.041000	0.20044	0.041000	0.18516	0.432000	0.31715	-0.842000	0.04354	-0.318000	0.08665	0.650000	0.86243	TCT		0.587	SDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206599.1		NM_004168	
SLC36A3	285641	hgsc.bcm.edu;ucsc.edu	37	5	150666901	150666901	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr5:150666901A>G	ENST00000335230.3	-	6	1025	c.614T>C	c.(613-615)tTt>tCt	p.F205S	SLC36A3_ENST00000377713.3_Missense_Mutation_p.F246S	NM_181774.3	NP_861439.3	Q495N2	S36A3_HUMAN	solute carrier family 36, member 3	205						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|skin(1)|stomach(2)|urinary_tract(2)	21		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GTTCTGGATAAACACCAACAG	0.512																																																	0													164.0	153.0	157.0					5																	150666901		2203	4300	6503	SO:0001583	missense	285641			AY162215	CCDS4314.1, CCDS47316.1	5q33.1	2013-07-17	2013-07-17		ENSG00000186334	ENSG00000186334		"""Solute carriers"""	19659	protein-coding gene	gene with protein product		608332				12809675	Standard	NM_181774		Approved	PAT3, TRAMD2, tramdorin2	uc003ltw.2	Q495N2	OTTHUMG00000130128	ENST00000335230.3:c.614T>C	5.37:g.150666901A>G	ENSP00000334750:p.Phe205Ser		Q495N3|Q6ZMU7|Q6ZRU4|Q7Z6B4	Missense_Mutation	SNP	ENST00000335230.3	37	CCDS4314.1	.	.	.	.	.	.	.	.	.	.	A	28.1	4.889987	0.91889	.	.	ENSG00000186334	ENST00000335230;ENST00000377713	T;T	0.02787	4.16;4.16	4.86	4.86	0.63082	.	0.156110	0.56097	D	0.000021	T	0.08582	0.0213	L	0.55743	1.74	0.49051	D	0.99974	B;P;B	0.36974	0.164;0.576;0.088	B;P;B	0.50440	0.138;0.641;0.087	T	0.23726	-1.0180	10	0.37606	T	0.19	.	14.3302	0.66550	1.0:0.0:0.0:0.0	.	246;205;190	Q495N2-3;Q495N2;Q495N2-2	.;S36A3_HUMAN;.	S	205;246	ENSP00000334750:F205S;ENSP00000366942:F246S	ENSP00000334750:F205S	F	-	2	0	SLC36A3	150647094	1.000000	0.71417	0.958000	0.39756	0.986000	0.74619	6.536000	0.73842	2.054000	0.61138	0.533000	0.62120	TTT		0.512	SLC36A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252436.1		NM_181774	
SLC4A10	57282	hgsc.bcm.edu;ucsc.edu	37	2	162821636	162821636	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr2:162821636T>G	ENST00000446997.1	+	23	3205	c.3112T>G	c.(3112-3114)Ttg>Gtg	p.L1038V	SLC4A10_ENST00000375514.5_Missense_Mutation_p.L1019V|SLC4A10_ENST00000421911.1_Missense_Mutation_p.L1038V|SLC4A10_ENST00000415876.2_Missense_Mutation_p.L1008V|SLC4A10_ENST00000272716.5_Missense_Mutation_p.L1008V	NM_001178015.1	NP_001171486.1	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate transporter, member 10	1038					bicarbonate transport (GO:0015701)|chloride transport (GO:0006821)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|symporter activity (GO:0015293)			endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(35)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60					Sodium bicarbonate(DB01390)	GTTGGATGATTTGATGCCCGA	0.343																																																	0													84.0	79.0	80.0					2																	162821636		1817	4088	5905	SO:0001583	missense	57282				CCDS46438.1, CCDS54411.1, CCDS54412.1	2q24.2	2013-05-22	2008-09-15		ENSG00000144290	ENSG00000144290		"""Solute carriers"""	13811	protein-coding gene	gene with protein product		605556	"""solute carrier family 4, sodium bicarbonate transporter-like, member 10"""			10964153, 18319254	Standard	NM_022058		Approved	NBCn2, NCBE	uc002ubx.4	Q6U841	OTTHUMG00000153938	ENST00000446997.1:c.3112T>G	2.37:g.162821636T>G	ENSP00000393066:p.Leu1038Val		B7Z1R0|B7Z2J0|B7ZLC5|B9EG69|F8W675|Q4ZFX6|Q8TCP2|Q9HCQ6	Missense_Mutation	SNP	ENST00000446997.1	37	CCDS54411.1	.	.	.	.	.	.	.	.	.	.	T	11.16	1.557109	0.27827	.	.	ENSG00000144290	ENST00000375514;ENST00000415876;ENST00000272716;ENST00000449513;ENST00000446997;ENST00000421911;ENST00000415711	T;T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07;-0.07	5.93	4.78	0.61160	.	0.000000	0.64402	D	0.000002	T	0.67373	0.2886	L	0.46741	1.465	0.80722	D	1	D;D;P	0.89917	1.0;1.0;0.796	D;D;B	0.91635	0.999;0.999;0.415	T	0.65668	-0.6112	10	0.02654	T	1	.	11.8185	0.52224	0.0:0.0681:0.0:0.9319	.	1019;1008;1038	F8W675;Q6U841-2;Q6U841	.;.;S4A10_HUMAN	V	1019;1008;1008;1007;1038;1038;1037	ENSP00000364664:L1019V;ENSP00000395797:L1008V;ENSP00000272716:L1008V;ENSP00000393066:L1038V;ENSP00000404486:L1038V	ENSP00000272716:L1008V	L	+	1	2	SLC4A10	162529882	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	2.747000	0.47475	1.066000	0.40716	0.533000	0.62120	TTG		0.343	SLC4A10-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333090.1		NM_022058	
SLITRK4	139065	hgsc.bcm.edu	37	X	142718802	142718802	+	Silent	SNP	G	G	C	rs199783133		TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chrX:142718802G>C	ENST00000381779.4	-	2	348	c.123C>G	c.(121-123)gtC>gtG	p.V41V	SLITRK4_ENST00000338017.4_Silent_p.V41V|SLITRK4_ENST00000356928.1_Silent_p.V41V	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	41						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					TCTCACAGTTGACATAGAGCA	0.373													G|||	1	0.000264901	0.0	0.0	3775	,	,		13083	0.001		0.0	False		,,,				2504	0.0																0													71.0	66.0	68.0					X																	142718802		2203	4300	6503	SO:0001819	synonymous_variant	139065			BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.123C>G	X.37:g.142718802G>C			Q5JXG3|Q8TCM8|Q96DL3	Silent	SNP	ENST00000381779.4	37	CCDS14679.1																																																																																				0.373	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058617.1		NM_173078	
SPDYE4	388333	hgsc.bcm.edu	37	17	8660584	8660584	+	Silent	SNP	G	G	C			TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr17:8660584G>C	ENST00000328794.6	-	2	512	c.336C>G	c.(334-336)ctC>ctG	p.L112L		NM_001128076.1	NP_001121548.1	A6NLX3	SPDE4_HUMAN	speedy/RINGO cell cycle regulator family member E4	112										breast(1)|endometrium(2)|kidney(1)	4						TCCTACCAAGGAGCCTGTTGA	0.498																																																	0													37.0	41.0	40.0					17																	8660584		692	1591	2283	SO:0001819	synonymous_variant	388333			BC146949	CCDS45609.1	17p13.1	2013-05-08	2013-05-08			ENSG00000183318		"""Speedy homologs"""	35463	protein-coding gene	gene with protein product			"""speedy homolog E4 (Xenopus laevis)"""				Standard	NM_001128076		Approved		uc010cnz.1	A6NLX3		ENST00000328794.6:c.336C>G	17.37:g.8660584G>C			B2RUZ6	Silent	SNP	ENST00000328794.6	37	CCDS45609.1																																																																																				0.498	SPDYE4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442494.1		NM_001128076	
STXBP2	6813	hgsc.bcm.edu	37	19	7707347	7707347	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr19:7707347A>C	ENST00000221283.5	+	10	858	c.827A>C	c.(826-828)gAg>gCg	p.E276A	STXBP2_ENST00000441779.2_Missense_Mutation_p.E287A|STXBP2_ENST00000414284.2_Missense_Mutation_p.E273A	NM_006949.2	NP_008880.2	Q15833	STXB2_HUMAN	syntaxin binding protein 2	276					leukocyte mediated cytotoxicity (GO:0001909)|neutrophil degranulation (GO:0043312)|protein transport (GO:0015031)|regulation of mast cell degranulation (GO:0043304)|vesicle docking involved in exocytosis (GO:0006904)	azurophil granule (GO:0042582)|cytolytic granule (GO:0044194)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin-3 binding (GO:0030348)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	23						GAGGCGCGGGAGAAGGCCGTC	0.642																																																	0													146.0	147.0	147.0					19																	7707347		2203	4300	6503	SO:0001583	missense	6813			U63533	CCDS12181.1, CCDS45948.1, CCDS62522.1	19p13.3-p13.2	2014-09-17				ENSG00000076944			11445	protein-coding gene	gene with protein product		601717				8921365	Standard	NM_001127396		Approved	UNC18B, Hunc18b	uc010xjr.3	Q15833		ENST00000221283.5:c.827A>C	19.37:g.7707347A>C	ENSP00000221283:p.Glu276Ala		B4E175|E7EQD5|Q9BU65	Missense_Mutation	SNP	ENST00000221283.5	37	CCDS12181.1	.	.	.	.	.	.	.	.	.	.	A	10.89	1.477204	0.26511	.	.	ENSG00000076944	ENST00000221283;ENST00000414284;ENST00000441779;ENST00000543902	T;T;T	0.77229	-1.08;-1.08;-1.08	4.38	3.35	0.38373	.	0.180483	0.46758	D	0.000266	T	0.77818	0.4187	M	0.84082	2.675	0.35762	D	0.820221	P;B;P;P	0.45768	0.866;0.013;0.837;0.866	B;B;B;B	0.42959	0.403;0.063;0.281;0.403	T	0.80728	-0.1253	10	0.48119	T	0.1	-5.7437	8.6017	0.33749	0.8279:0.0:0.0:0.1721	.	287;242;273;276	E7EQD5;B4DY46;Q15833-2;Q15833	.;.;.;STXB2_HUMAN	A	276;273;287;276	ENSP00000221283:E276A;ENSP00000409471:E273A;ENSP00000413606:E287A	ENSP00000221283:E276A	E	+	2	0	STXBP2	7613347	1.000000	0.71417	0.875000	0.34327	0.012000	0.07955	1.788000	0.38714	0.622000	0.30249	0.482000	0.46254	GAG		0.642	STXBP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460963.1		NM_006949	
TET2	54790	hgsc.bcm.edu	37	4	106155681	106155681	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr4:106155681C>A	ENST00000540549.1	+	3	1442	c.582C>A	c.(580-582)gaC>gaA	p.D194E	TET2_ENST00000545826.1_Missense_Mutation_p.D194E|TET2_ENST00000413648.2_Missense_Mutation_p.D194E|TET2_ENST00000380013.4_Missense_Mutation_p.D194E|TET2_ENST00000394764.1_Missense_Mutation_p.D194E|TET2_ENST00000305737.2_Missense_Mutation_p.D194E|TET2_ENST00000513237.1_Missense_Mutation_p.D215E			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	194					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		ATTACCATGACAAGAACATTG	0.423			"""Mis N, F"""		MDS																																			Rec	yes		4	4q24	54790	tet oncogene family member 2		L	0													74.0	59.0	64.0					4																	106155681		2203	4300	6503	SO:0001583	missense	54790			AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.582C>A	4.37:g.106155681C>A	ENSP00000442788:p.Asp194Glu		B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Missense_Mutation	SNP	ENST00000540549.1	37	CCDS47120.1	.	.	.	.	.	.	.	.	.	.	C	7.523	0.657148	0.14580	.	.	ENSG00000168769	ENST00000305737;ENST00000540549;ENST00000545826;ENST00000513237;ENST00000380013;ENST00000394764;ENST00000413648;ENST00000535110	T;T;T;T;T;T;T	0.04083	3.71;4.41;3.71;4.4;4.41;3.71;3.73	5.19	2.47	0.30058	.	1.191550	0.06634	U	0.759784	T	0.04952	0.0133	L	0.27053	0.805	0.21355	N	0.999717	B;B;B	0.16396	0.001;0.001;0.017	B;B;B	0.15052	0.002;0.002;0.012	T	0.44143	-0.9347	10	0.72032	D	0.01	.	7.5298	0.27677	0.0:0.7123:0.1366:0.1512	.	215;194;194	E7EQS8;Q6N021;Q6N021-2	.;TET2_HUMAN;.	E	194;194;194;215;194;194;194;194	ENSP00000306705:D194E;ENSP00000442788:D194E;ENSP00000442867:D194E;ENSP00000425443:D215E;ENSP00000369351:D194E;ENSP00000378245:D194E;ENSP00000391448:D194E	ENSP00000265149:D194E	D	+	3	2	TET2	106375130	1.000000	0.71417	0.011000	0.14972	0.075000	0.17131	1.273000	0.33121	0.191000	0.20236	-0.150000	0.13652	GAC		0.423	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253952.2		NM_017628	
DCSTAMP	81501	hgsc.bcm.edu	37	8	105361354	105361354	+	Missense_Mutation	SNP	G	G	C	rs67114147	byFrequency	TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr8:105361354G>C	ENST00000297581.2	+	2	623	c.574G>C	c.(574-576)Gaa>Caa	p.E192Q	DCSTAMP_ENST00000517991.1_Missense_Mutation_p.E192Q|DPYS_ENST00000521601.1_Intron	NM_030788.3	NP_110415.1	Q9H295	DCSTP_HUMAN	dendrocyte expressed seven transmembrane protein	192					cellular response to interleukin-4 (GO:0071353)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to tumor necrosis factor (GO:0071356)|membrane fusion (GO:0061025)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cell growth (GO:0030308)|osteoclast differentiation (GO:0030316)|osteoclast fusion (GO:0072675)|positive regulation of bone resorption (GO:0045780)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of monocyte differentiation (GO:0045657)	cell surface (GO:0009986)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)											CAGCAAAGGGGAAGTCCTGAG	0.522													G|||	583	0.116414	0.0605	0.1859	5008	,	,		18345	0.1319		0.1272	False		,,,				2504	0.1155																0								G	GLN/GLU	350,4056	178.3+/-207.1	18,314,1871	104.0	96.0	99.0		574	-1.9	0.0	8	dbSNP_130	99	1136,7464	231.0+/-265.1	82,972,3246	yes	missense	TM7SF4	NM_030788.2	29	100,1286,5117	CC,CG,GG		13.2093,7.9437,11.4255	benign	192/471	105361354	1486,11520	2203	4300	6503	SO:0001583	missense	0			AF305068	CCDS6301.1, CCDS59111.1	8q22.3	2012-08-10	2012-03-27	2012-03-27	ENSG00000164935	ENSG00000164935			18549	protein-coding gene	gene with protein product	"""Dendritic cells (DC)-specific transmembrane protein"", ""IL-Four INDuced"""	605933	"""transmembrane 7 superfamily member 4"""	TM7SF4		11169400, 11345591	Standard	NM_030788		Approved	DC-STAMP, FIND	uc003ylx.2	Q9H295	OTTHUMG00000164890	ENST00000297581.2:c.574G>C	8.37:g.105361354G>C	ENSP00000297581:p.Glu192Gln		B7ZVW2|E7ESG0|Q2M2D5	Missense_Mutation	SNP	ENST00000297581.2	37	CCDS6301.1	259	0.11858974358974358	34	0.06910569105691057	72	0.19889502762430938	56	0.0979020979020979	97	0.1279683377308707	G	9.109	1.006175	0.19199	0.079437	0.132093	ENSG00000164935	ENST00000297581;ENST00000517991	T	0.33216	1.42	5.53	-1.86	0.07760	.	0.517494	0.23175	N	0.051088	T	0.00039	0.0001	L	0.34521	1.04	0.54753	P	1.2000000000012001E-5	B	0.21071	0.051	B	0.16722	0.016	T	0.33727	-0.9857	8	.	.	.	-1.1699	11.861	0.52465	0.0768:0.5286:0.3946:0.0	.	192	Q9H295	TM7S4_HUMAN	Q	192	ENSP00000297581:E192Q	.	E	+	1	0	TM7SF4	105430530	0.138000	0.22547	0.010000	0.14722	0.873000	0.50193	-0.341000	0.07811	-0.817000	0.04335	0.561000	0.74099	GAA		0.522	DCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380810.1		NM_030788	
TUFT1	7286	hgsc.bcm.edu;ucsc.edu	37	1	151512886	151512886	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr1:151512886C>T	ENST00000368849.3	+	1	106	c.44C>T	c.(43-45)cCa>cTa	p.P15L	RP11-74C1.4_ENST00000434112.1_RNA|TUFT1_ENST00000538902.1_5'UTR|TUFT1_ENST00000353024.3_Missense_Mutation_p.P15L|TUFT1_ENST00000368848.2_Missense_Mutation_p.P15L|TUFT1_ENST00000392712.3_Missense_Mutation_p.P15L	NM_020127.2	NP_064512.1	Q9NNX1	TUFT1_HUMAN	tuftelin 1	15					bone mineralization (GO:0030282)|odontogenesis (GO:0042476)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	structural constituent of tooth enamel (GO:0030345)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)	13	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			GACGTGCACCCAGAGGACCAG	0.627																																																	0													161.0	146.0	151.0					1																	151512886		2203	4300	6503	SO:0001583	missense	7286			AF254260	CCDS1000.1, CCDS44223.1	1q21	2008-02-05			ENSG00000143367	ENSG00000143367			12422	protein-coding gene	gene with protein product		600087				7919663	Standard	NM_020127		Approved		uc001eyl.3	Q9NNX1	OTTHUMG00000012536	ENST00000368849.3:c.44C>T	1.37:g.151512886C>T	ENSP00000357842:p.Pro15Leu		B2RD57|D3DV21|D3DV22|Q5T384|Q5T385|Q9BU28|Q9H5L1	Missense_Mutation	SNP	ENST00000368849.3	37	CCDS1000.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.749723	0.89753	.	.	ENSG00000143367	ENST00000368849;ENST00000392712;ENST00000353024;ENST00000368848;ENST00000544350;ENST00000507671	T;T;T;T	0.51071	2.29;0.83;0.75;0.72	4.96	4.96	0.65561	.	0.391289	0.27349	N	0.019775	T	0.44561	0.1299	L	0.53249	1.67	0.80722	D	1	D;B	0.55172	0.97;0.207	P;B	0.51657	0.676;0.11	T	0.45760	-0.9239	10	0.59425	D	0.04	-12.3587	13.5748	0.61868	0.0:1.0:0.0:0.0	.	15;15	Q9NNX1-2;Q9NNX1	.;TUFT1_HUMAN	L	15	ENSP00000357842:P15L;ENSP00000376476:P15L;ENSP00000343781:P15L;ENSP00000357841:P15L	ENSP00000343781:P15L	P	+	2	0	TUFT1	149779510	0.979000	0.34478	1.000000	0.80357	0.978000	0.69477	3.347000	0.52200	2.564000	0.86499	0.561000	0.74099	CCA		0.627	TUFT1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035022.1		NM_020127	
WAC	51322	hgsc.bcm.edu;ucsc.edu	37	10	28897283	28897283	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr10:28897283T>G	ENST00000354911.4	+	8	1249	c.1088T>G	c.(1087-1089)cTt>cGt	p.L363R	WAC_ENST00000428935.1_Missense_Mutation_p.L318R|WAC_ENST00000375664.4_Missense_Mutation_p.L318R|WAC_ENST00000375646.1_Missense_Mutation_p.L215R|WAC_ENST00000347934.4_Missense_Mutation_p.L260R	NM_016628.4	NP_057712.2	Q9BTA9	WAC_HUMAN	WW domain containing adaptor with coiled-coil	363					cellular response to DNA damage stimulus (GO:0006974)|G1 DNA damage checkpoint (GO:0044783)|histone H2B conserved C-terminal lysine ubiquitination (GO:0071894)|histone monoubiquitination (GO:0010390)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	chromatin binding (GO:0003682)|RNA polymerase II core binding (GO:0000993)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|urinary_tract(1)	32						CCAAATCTTCTTAGACAATTG	0.428																																																	0													66.0	60.0	62.0					10																	28897283		2203	4300	6503	SO:0001583	missense	51322			AK055852	CCDS7159.1, CCDS7160.1, CCDS7161.1	10p12.1	2007-05-17	2003-03-19		ENSG00000095787	ENSG00000095787			17327	protein-coding gene	gene with protein product		615049	"""WW domain-containing adaptor with coiled coil"""			11827461	Standard	NR_024557		Approved	Wwp4, FLJ31290, PRO1741, BM-016, MGC10753	uc001iuf.3	Q9BTA9	OTTHUMG00000017872	ENST00000354911.4:c.1088T>G	10.37:g.28897283T>G	ENSP00000346986:p.Leu363Arg		A8K2A9|C9JBT9|D3DRW5|D3DRW6|D3DRW7|Q53EN9|Q5JU75|Q5JU77|Q5VXK0|Q5VXK2|Q8TCK1|Q96DP3|Q96FW6|Q96JI3	Missense_Mutation	SNP	ENST00000354911.4	37	CCDS7159.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.082361	0.76528	.	.	ENSG00000095787	ENST00000375664;ENST00000375646;ENST00000347934;ENST00000354911;ENST00000428935;ENST00000424454	T;T;T;T;T	0.53857	1.16;1.66;1.71;1.16;0.6	5.47	5.47	0.80525	.	0.113921	0.64402	D	0.000013	T	0.59390	0.2190	L	0.29908	0.895	0.52099	D	0.999942	D;D;D;P	0.69078	0.997;0.99;0.994;0.526	D;P;P;P	0.65010	0.931;0.885;0.855;0.561	T	0.57682	-0.7769	10	0.34782	T	0.22	-11.3862	15.8499	0.78921	0.0:0.0:0.0:1.0	.	318;260;363;318	Q9BTA9-2;Q9BTA9-5;Q9BTA9;Q9BTA9-3	.;.;WAC_HUMAN;.	R	318;215;260;363;318;318	ENSP00000364816:L318R;ENSP00000364797:L215R;ENSP00000311106:L260R;ENSP00000346986:L363R;ENSP00000399706:L318R	ENSP00000311106:L260R	L	+	2	0	WAC	28937289	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.618000	0.83043	2.203000	0.70933	0.482000	0.46254	CTT		0.428	WAC-017	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000047371.1		NM_100264	
XPA	7507	hgsc.bcm.edu;ucsc.edu	37	9	100437766	100437766	+	Silent	SNP	C	C	T	rs200584154		TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr9:100437766C>T	ENST00000375128.4	-	6	841	c.777G>A	c.(775-777)aaG>aaA	p.K259K	XPA_ENST00000485042.1_5'UTR	NM_000380.3	NP_000371.1	P23025	XPA_HUMAN	xeroderma pigmentosum, complementation group A	259					DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|response to oxidative stress (GO:0006979)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercellular bridge (GO:0045171)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(4)|large_intestine(1)|lung(4)|prostate(1)	11		Acute lymphoblastic leukemia(62;0.158)				TAGTACAAGTCTTACGGTACA	0.363			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																														yes	Rec		Xeroderma pigmentosum (A)	9	9q22.3	7507	"""xeroderma pigmentosum, complementation group A"""		E	0													191.0	159.0	170.0					9																	100437766		2202	4300	6502	SO:0001819	synonymous_variant	7507	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	D14533	CCDS6729.1	9q22.3	2014-09-17			ENSG00000136936	ENSG00000136936			12814	protein-coding gene	gene with protein product		611153					Standard	NM_000380		Approved	XPAC, XP1	uc004axr.4	P23025	OTTHUMG00000020330	ENST00000375128.4:c.777G>A	9.37:g.100437766C>T			Q5T1U9|Q6LCW7|Q6LD02	Silent	SNP	ENST00000375128.4	37	CCDS6729.1																																																																																				0.363	XPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053332.1		NM_000380	
ZFAT	57623	hgsc.bcm.edu;ucsc.edu	37	8	135613761	135613761	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr8:135613761C>T	ENST00000377838.3	-	6	2375	c.2201G>A	c.(2200-2202)cGg>cAg	p.R734Q	ZFAT_ENST00000520214.1_Missense_Mutation_p.R722Q|ZFAT_ENST00000429442.2_Missense_Mutation_p.R722Q|ZFAT_ENST00000520356.1_Missense_Mutation_p.R722Q|ZFAT-AS1_ENST00000505776.1_RNA|ZFAT_ENST00000523399.1_Missense_Mutation_p.R672Q|ZFAT_ENST00000520727.1_Missense_Mutation_p.R722Q	NM_001174157.1|NM_020863.3	NP_001167628.1|NP_065914.2	Q9P243	ZFAT_HUMAN	zinc finger and AT hook domain containing	734					hematopoietic progenitor cell differentiation (GO:0002244)|spongiotrophoblast layer development (GO:0060712)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(9)|large_intestine(8)|lung(16)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			CTTCCGGATCCGCTCACACAA	0.537																																																	0													88.0	90.0	90.0					8																	135613761		2031	4189	6220	SO:0001583	missense	57623			BC025423	CCDS43768.1, CCDS47924.1, CCDS43768.2, CCDS55275.1, CCDS55276.1	8q24.23	2008-06-05	2008-01-25	2008-01-25	ENSG00000066827	ENSG00000066827		"""Zinc fingers, C2H2-type"""	19899	protein-coding gene	gene with protein product		610931	"""zinc finger protein 406"""	ZNF406, ZFAT1		10819331, 18329245	Standard	NM_020863		Approved	KIAA1485	uc003yup.3	Q9P243	OTTHUMG00000164321	ENST00000377838.3:c.2201G>A	8.37:g.135613761C>T	ENSP00000367069:p.Arg734Gln		B7ZL15|E9PER3|Q3MIM5|Q6PJ01|Q75PJ6|Q75PJ7|Q75PJ9|Q86X64	Missense_Mutation	SNP	ENST00000377838.3	37	CCDS47924.1	.	.	.	.	.	.	.	.	.	.	C	14.76	2.631549	0.46944	.	.	ENSG00000066827	ENST00000520356;ENST00000520727;ENST00000429442;ENST00000377838;ENST00000520214;ENST00000318135;ENST00000523399;ENST00000398946	T;T;T;T;T;T	0.11495	2.86;2.84;2.83;2.79;2.84;2.77	5.93	5.93	0.95920	.	0.056511	0.64402	D	0.000006	T	0.25717	0.0626	M	0.74389	2.26	0.40175	D	0.977228	D;D;P;P	0.71674	0.998;0.99;0.953;0.73	P;P;B;B	0.54759	0.76;0.561;0.382;0.065	T	0.00649	-1.1627	10	0.66056	D	0.02	-35.3065	12.6167	0.56580	0.0:0.9251:0.0:0.0749	.	672;722;722;734	E9PER3;E9PBN4;Q9P243-3;Q9P243	.;.;.;ZFAT_HUMAN	Q	722;722;722;734;722;621;672;722	ENSP00000427879:R722Q;ENSP00000427831:R722Q;ENSP00000394501:R722Q;ENSP00000367069:R734Q;ENSP00000428483:R722Q;ENSP00000429091:R672Q	ENSP00000326997:R621Q	R	-	2	0	ZFAT	135682943	1.000000	0.71417	0.987000	0.45799	0.894000	0.52154	1.157000	0.31724	2.815000	0.96918	0.561000	0.74099	CGG		0.537	ZFAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378272.1		NM_001029939	
ZNF717	100131827	hgsc.bcm.edu	37	3	75786620	75786620	+	Silent	SNP	G	G	A	rs144106206		TCGA-BP-4781-01A-01D-1373-10	TCGA-BP-4781-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	9c2726a8-ef24-4653-80c3-247a9c2a0608	ecd9132b-830c-48a8-ba7f-1da213c154b4	g.chr3:75786620G>A	ENST00000478296.1	-	4	2280	c.2004C>T	c.(2002-2004)ttC>ttT	p.F668F	ZNF717_ENST00000422325.1_Silent_p.F718F|MIR4273_ENST00000582824.1_RNA|ZNF717_ENST00000400845.3_Silent_p.F711F|ZNF717_ENST00000491507.1_Intron|ZNF717_ENST00000477374.1_Intron			Q9BY31	ZN717_HUMAN	zinc finger protein 717	708					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(6)|endometrium(3)|lung(2)|ovary(1)|stomach(7)	19						TGATGCTTCTGAAGATTTGCC	0.408																																																	0													17.0	16.0	17.0					3																	75786620		653	1493	2146	SO:0001819	synonymous_variant	100131827			AF226994		3p12.3	2013-01-08			ENSG00000227124	ENSG00000227124		"""Zinc fingers, C2H2-type"", ""-"""	29448	protein-coding gene	gene with protein product			"""zinc finger protein 838"""	ZNF838			Standard	NM_001128223		Approved	X17	uc011bgi.2	Q9BY31	OTTHUMG00000158965	ENST00000478296.1:c.2004C>T	3.37:g.75786620G>A				Silent	SNP	ENST00000478296.1	37																																																																																					0.408	ZNF717-002	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000352764.2		NM_001128223	
