#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ADCY9	115	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	4165079	4165079	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr16:4165079T>C	ENST00000294016.3	-	2	903	c.365A>G	c.(364-366)tAc>tGc	p.Y122C		NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	122					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)	p.Y122C(1)		breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						GAAGCCGATGTAGAAGAGCGC	0.627																																																	1	Substitution - Missense(1)	kidney(1)											62.0	69.0	67.0					16																	4165079		2197	4300	6497	SO:0001583	missense	115			AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.365A>G	16.37:g.4165079T>C	ENSP00000294016:p.Tyr122Cys		A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Missense_Mutation	SNP	ENST00000294016.3	37	CCDS32382.1	.	.	.	.	.	.	.	.	.	.	T	16.83	3.232572	0.58777	.	.	ENSG00000162104	ENST00000294016	T	0.76316	-1.01	5.44	4.32	0.51571	.	0.069256	0.64402	D	0.000014	D	0.85388	0.5685	M	0.73217	2.22	0.58432	D	0.999994	D	0.89917	1.0	D	0.67231	0.95	D	0.85797	0.1371	10	0.72032	D	0.01	.	11.711	0.51625	0.1326:0.0:0.0:0.8674	.	122	O60503	ADCY9_HUMAN	C	122	ENSP00000294016:Y122C	ENSP00000294016:Y122C	Y	-	2	0	ADCY9	4105080	1.000000	0.71417	0.790000	0.31976	0.954000	0.61252	6.134000	0.71689	0.880000	0.35969	0.454000	0.30748	TAC		0.627	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438076.1			
AEBP1	165	broad.mit.edu	37	7	44147521	44147521	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr7:44147521G>A	ENST00000223357.3	+	5	1158	c.853G>A	c.(853-855)Gag>Aag	p.E285K	MIR4649_ENST00000582839.1_RNA|AEBP1_ENST00000450684.2_5'Flank	NM_001129.3	NP_001120.3	Q8IUX7	AEBP1_HUMAN	AE binding protein 1	285	Pro-rich.				cell adhesion (GO:0007155)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.E285K(1)		NS(1)|breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(13)|upper_aerodigestive_tract(2)	33						AGCCCCGGAGGAGAGGATTGG	0.711																																																	1	Substitution - Missense(1)	kidney(1)											8.0	10.0	9.0					7																	44147521		2163	4230	6393	SO:0001583	missense	165			D86479	CCDS5476.1	7p	2008-07-18	2001-11-28		ENSG00000106624	ENSG00000106624			303	protein-coding gene	gene with protein product	"""aortic carboxypeptidase-like protein"", ""adipocyte enhancer binding protein 1"""	602981	"""AE-binding protein 1"""			8920928	Standard	NM_001129		Approved	ACLP	uc003tkb.4	Q8IUX7	OTTHUMG00000023362	ENST00000223357.3:c.853G>A	7.37:g.44147521G>A	ENSP00000223357:p.Glu285Lys		Q14113|Q59ER7|Q6ZSC7|Q7KZ79	Missense_Mutation	SNP	ENST00000223357.3	37	CCDS5476.1	.	.	.	.	.	.	.	.	.	.	G	13.69	2.313844	0.40996	.	.	ENSG00000106624	ENST00000223357	D	0.94931	-3.56	5.05	4.16	0.48862	.	5.266990	0.00166	N	0.000000	D	0.89347	0.6689	N	0.24115	0.695	0.80722	D	1	B	0.26400	0.148	B	0.19946	0.027	T	0.70274	-0.4917	10	0.07175	T	0.84	-2.4487	9.3715	0.38256	0.1004:0.0:0.8996:0.0	.	285	Q8IUX7	AEBP1_HUMAN	K	285	ENSP00000223357:E285K	ENSP00000223357:E285K	E	+	1	0	AEBP1	44114046	0.985000	0.35326	0.384000	0.26145	0.505000	0.33919	0.997000	0.29731	1.120000	0.41904	0.491000	0.48974	GAG		0.711	AEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250993.2		NM_001129	
AKR1B10	57016	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	134221461	134221461	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr7:134221461C>G	ENST00000359579.4	+	5	809	c.489C>G	c.(487-489)agC>agG	p.S163R	AKR1B10_ENST00000475559.1_3'UTR	NM_020299.4	NP_064695.3	O60218	AK1BA_HUMAN	aldo-keto reductase family 1, member B10 (aldose reductase)	163					cellular aldehyde metabolic process (GO:0006081)|daunorubicin metabolic process (GO:0044597)|digestion (GO:0007586)|doxorubicin metabolic process (GO:0044598)|farnesol catabolic process (GO:0016488)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|steroid metabolic process (GO:0008202)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	aldo-keto reductase (NADP) activity (GO:0004033)|geranylgeranyl reductase activity (GO:0045550)|indanol dehydrogenase activity (GO:0047718)|retinal dehydrogenase activity (GO:0001758)	p.S163R(1)		NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(9)|skin(5)	20						CCAATTTCAGCCACTTCCAGA	0.483																																																	1	Substitution - Missense(1)	kidney(1)											81.0	85.0	84.0					7																	134221461		2203	4300	6503	SO:0001583	missense	57016			AF052577	CCDS5832.1	7q33	2010-04-08			ENSG00000198074	ENSG00000198074		"""Aldo-keto reductases"""	382	protein-coding gene	gene with protein product	"""aldose reductase-like 1"", ""aldo-keto reductase family 1, member B11 (aldose reductase-like)"", ""aldose reductase-like peptide"", ""aldose reductase-related protein"", ""small intestine reductase"""	604707		AKR1B11		9765596, 9565553	Standard	NM_020299		Approved	AKR1B12, ARL-1, HIS, ARL1, HSI, ALDRLn	uc003vrr.3	O60218	OTTHUMG00000155356	ENST00000359579.4:c.489C>G	7.37:g.134221461C>G	ENSP00000352584:p.Ser163Arg		A4D1P1|O75890|Q6FHF3|Q8IWZ1	Missense_Mutation	SNP	ENST00000359579.4	37	CCDS5832.1	.	.	.	.	.	.	.	.	.	.	-	15.48	2.847427	0.51164	.	.	ENSG00000198074	ENST00000359579	T	0.19394	2.15	4.75	3.86	0.44501	NADP-dependent oxidoreductase domain (3);	0.044468	0.85682	D	0.000000	T	0.25232	0.0613	L	0.45051	1.395	0.31896	N	0.61658	B	0.24258	0.1	B	0.37731	0.257	T	0.33879	-0.9851	10	0.87932	D	0	.	12.2164	0.54408	0.0:0.916:0.0:0.084	.	163	O60218	AK1BA_HUMAN	R	163	ENSP00000352584:S163R	ENSP00000352584:S163R	S	+	3	2	AKR1B10	133872001	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.844000	0.48246	1.123000	0.41961	0.556000	0.70494	AGC		0.483	AKR1B10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339615.1		NM_020299	
ATE1	11101	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	123503288	123503288	+	Silent	SNP	C	C	T			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr10:123503288C>T	ENST00000224652.6	-	12	1549	c.1464G>A	c.(1462-1464)caG>caA	p.Q488Q	ATE1_ENST00000369043.3_Silent_p.Q488Q|ATE1_ENST00000535655.1_Silent_p.Q189Q|ATE1_ENST00000369040.3_Silent_p.Q392Q|ATE1_ENST00000540606.1_Silent_p.Q481Q|ATE1_ENST00000543447.1_Silent_p.Q373Q	NM_001001976.1	NP_001001976.1	O95260	ATE1_HUMAN	arginyltransferase 1	488					protein arginylation (GO:0016598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	arginyltransferase activity (GO:0004057)	p.Q488Q(2)		endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		all_neural(114;0.061)|Lung NSC(174;0.095)|all_lung(145;0.124)|Breast(234;0.212)				GGTCTTTCTGCTGTTTCTTAT	0.522																																																	2	Substitution - coding silent(2)	kidney(2)											119.0	101.0	107.0					10																	123503288		2203	4300	6503	SO:0001819	synonymous_variant	11101			AF079098	CCDS31299.1, CCDS31300.1, CCDS73211.1, CCDS73212.1, CCDS73213.1	10q26	2013-05-08			ENSG00000107669	ENSG00000107669	2.3.2.8		782	protein-coding gene	gene with protein product		607103				16002466, 16943202	Standard	XM_005269458		Approved		uc001lfq.3	O95260	OTTHUMG00000019178	ENST00000224652.6:c.1464G>A	10.37:g.123503288C>T			O95261|Q5SQQ3|Q8WW04	Silent	SNP	ENST00000224652.6	37	CCDS31300.1	.	.	.	.	.	.	.	.	.	.	C	4.785	0.145985	0.09134	.	.	ENSG00000107669	ENST00000423243	.	.	.	5.02	-2.34	0.06704	.	.	.	.	.	T	0.26955	0.0660	.	.	.	0.29869	N	0.826959	.	.	.	.	.	.	T	0.36625	-0.9740	4	.	.	.	.	4.268	0.10773	0.1036:0.4136:0.345:0.1378	.	.	.	.	T	485	.	.	A	-	1	0	ATE1	123493278	0.991000	0.36638	0.003000	0.11579	0.734000	0.41952	0.370000	0.20433	-0.065000	0.13021	-0.825000	0.03093	GCA		0.522	ATE1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			NM_001001976	
ATP7B	540	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	52511675	52511675	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr13:52511675C>T	ENST00000242839.4	-	18	3996	c.3840G>A	c.(3838-3840)atG>atA	p.M1280I	ATP7B_ENST00000344297.5_Missense_Mutation_p.M1073I|ATP7B_ENST00000400370.3_Missense_Mutation_p.M850I|ATP7B_ENST00000400366.3_Missense_Mutation_p.M1169I|ATP7B_ENST00000418097.2_Missense_Mutation_p.M1215I|ATP7B_ENST00000448424.2_Missense_Mutation_p.M1202I|ATP7B_ENST00000417240.2_Missense_Mutation_p.M491I	NM_000053.3	NP_000044.2	P35670	ATP7B_HUMAN	ATPase, Cu++ transporting, beta polypeptide	1280					cellular copper ion homeostasis (GO:0006878)|cellular zinc ion homeostasis (GO:0006882)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|intracellular copper ion transport (GO:0015680)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|response to copper ion (GO:0046688)|sequestering of calcium ion (GO:0051208)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|mitochondrion (GO:0005739)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper-exporting ATPase activity (GO:0004008)	p.M1280I(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(23)|ovary(1)|prostate(3)|skin(4)|stomach(2)	55		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)	Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	TGGCCACACCCATGTCTGCCT	0.627									Wilson disease																																								1	Substitution - Missense(1)	kidney(1)	GRCh37	CI051343	ATP7B	I							65.0	74.0	71.0					13																	52511675		2097	4210	6307	SO:0001583	missense	540	Familial Cancer Database		U11700	CCDS41892.1, CCDS45049.1, CCDS58293.1	13q14.3	2012-10-22	2005-11-29		ENSG00000123191	ENSG00000123191	3.6.3.4	"""ATPases / P-type"""	870	protein-coding gene	gene with protein product	"""Wilson disease"", ""copper pump 2"", ""copper-transporting ATPase 2"""	606882	"""ATPase, Cu++ transporting, beta polypeptide (Wilson disease)"""	WND		8298641, 8298639	Standard	NM_000053		Approved		uc001vfw.2	P35670	OTTHUMG00000017406	ENST00000242839.4:c.3840G>A	13.37:g.52511675C>T	ENSP00000242839:p.Met1280Ile		Q16318|Q16319|Q4U3V3|Q59FJ9|Q5T7X7	Missense_Mutation	SNP	ENST00000242839.4	37	CCDS41892.1	.	.	.	.	.	.	.	.	.	.	C	11.03	1.518417	0.27211	.	.	ENSG00000123191	ENST00000242839;ENST00000400366;ENST00000344297;ENST00000417240;ENST00000448424;ENST00000400370;ENST00000418097	D;D;D;D;D;D;D	0.99226	-5.59;-5.59;-5.59;-5.59;-5.59;-5.59;-5.59	4.73	0.652	0.17823	HAD-like domain (2);	0.196730	0.43110	D	0.000619	D	0.90573	0.7045	N	0.00142	-2.005	0.80722	D	1	B;B;B;B;B;B;B;B	0.14012	0.0;0.0;0.0;0.0;0.0;0.009;0.0;0.0	B;B;B;B;B;B;B;B	0.06405	0.001;0.0;0.0;0.0;0.0;0.002;0.0;0.0	T	0.83074	-0.0141	10	0.56958	D	0.05	-15.8188	2.7558	0.05292	0.3887:0.2966:0.2291:0.0855	.	1202;1232;1215;491;850;1169;1073;1280	E7ET55;B7ZLR4;F5H748;E7EQQ2;F5H562;P35670-3;P35670-2;P35670	.;.;.;.;.;.;.;ATP7B_HUMAN	I	1280;1169;1073;491;1202;850;1215	ENSP00000242839:M1280I;ENSP00000383217:M1169I;ENSP00000342559:M1073I;ENSP00000390360:M491I;ENSP00000416738:M1202I;ENSP00000383221:M850I;ENSP00000393343:M1215I	ENSP00000242839:M1280I	M	-	3	0	ATP7B	51409676	0.975000	0.34042	0.994000	0.49952	0.430000	0.31655	0.218000	0.17622	0.269000	0.21961	0.591000	0.81541	ATG		0.627	ATP7B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045981.1		NM_000053	
BIRC6	57448	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	32693017	32693017	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr2:32693017T>G	ENST00000421745.2	+	28	5752	c.5618T>G	c.(5617-5619)aTc>aGc	p.I1873S		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	1873					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)	p.I1845S(1)|p.I1873S(1)		NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					AGAGCCAAAATCCCATTAGGA	0.368																																					Pancreas(94;175 1509 16028 18060 45422)												2	Substitution - Missense(2)	kidney(2)											66.0	68.0	68.0					2																	32693017		2203	4300	6503	SO:0001583	missense	57448			AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.5618T>G	2.37:g.32693017T>G	ENSP00000393596:p.Ile1873Ser		Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	37	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	T	24.6	4.552725	0.86127	.	.	ENSG00000115760	ENST00000421745	D	0.82255	-1.59	5.9	5.9	0.94986	.	0.059642	0.64402	D	0.000003	D	0.90431	0.7004	M	0.70595	2.14	0.58432	D	0.999999	D	0.65815	0.995	D	0.72982	0.979	D	0.91345	0.5100	10	0.87932	D	0	.	16.378	0.83412	0.0:0.0:0.0:1.0	.	1873	Q9NR09	BIRC6_HUMAN	S	1873	ENSP00000393596:I1873S	ENSP00000393596:I1873S	I	+	2	0	BIRC6	32546521	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	7.846000	0.86887	2.277000	0.76020	0.529000	0.55759	ATC		0.368	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3		NM_016252	
C10orf107	219621	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	63520664	63520664	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr10:63520664C>T	ENST00000330194.2	+	6	760	c.455C>T	c.(454-456)aCt>aTt	p.T152I		NM_173554.2	NP_775825.1	Q8IVU9	CJ107_HUMAN	chromosome 10 open reading frame 107	152								p.T152I(1)		breast(1)|kidney(1)|lung(4)|prostate(1)|skin(1)	8	Prostate(12;0.016)					CAGCCAGAAACTGACACCTCA	0.408																																																	1	Substitution - Missense(1)	kidney(1)											106.0	101.0	102.0					10																	63520664		2203	4299	6502	SO:0001583	missense	219621			BC041932	CCDS7262.1	10q21.3	2012-06-01			ENSG00000183346	ENSG00000183346			28678	protein-coding gene	gene with protein product						12477932	Standard	NM_173554		Approved	bA63A2.1, Em:AC022398.2, MGC44593	uc010qik.2	Q8IVU9	OTTHUMG00000018295	ENST00000330194.2:c.455C>T	10.37:g.63520664C>T	ENSP00000328698:p.Thr152Ile		Q5T1B8	Missense_Mutation	SNP	ENST00000330194.2	37	CCDS7262.1	.	.	.	.	.	.	.	.	.	.	C	13.65	2.301045	0.40694	.	.	ENSG00000183346	ENST00000330194	.	.	.	6.17	-1.71	0.08133	.	0.822638	0.11054	N	0.604750	T	0.23846	0.0577	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.21143	-1.0254	9	0.56958	D	0.05	0.0025	5.6248	0.17477	0.2338:0.2862:0.4132:0.0668	.	152	Q8IVU9	CJ107_HUMAN	I	152	.	ENSP00000328698:T152I	T	+	2	0	C10orf107	63190670	0.002000	0.14202	0.001000	0.08648	0.137000	0.21094	-0.028000	0.12350	-0.141000	0.11374	-0.182000	0.12963	ACT		0.408	C10orf107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048228.2		NM_173554	
C11orf73	51501	broad.mit.edu;hgsc.bcm.edu	37	11	86048459	86048459	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr11:86048459G>A	ENST00000278483.3	+	3	533	c.307G>A	c.(307-309)Gtc>Atc	p.V103I	C11orf73_ENST00000533986.1_Missense_Mutation_p.V103I|C11orf73_ENST00000530208.1_3'UTR	NM_016401.3	NP_057485.2	Q53FT3	HIKES_HUMAN	chromosome 11 open reading frame 73	103					cellular response to heat (GO:0034605)|Golgi organization (GO:0007030)|lung development (GO:0030324)|protein import into nucleus (GO:0006606)|protein transport (GO:0015031)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)	Hsp70 protein binding (GO:0030544)|protein transporter activity (GO:0008565)	p.V103I(1)		kidney(1)|large_intestine(1)|urinary_tract(1)	3		Acute lymphoblastic leukemia(157;1.17e-07)|all_hematologic(158;0.000556)				CATGAATATTGTCCGAACTCC	0.393																																																	1	Substitution - Missense(1)	kidney(1)											171.0	160.0	164.0					11																	86048459		2202	4299	6501	SO:0001583	missense	51501			BC015991	CCDS8275.1	11q14.2	2013-03-12			ENSG00000149196	ENSG00000149196			26938	protein-coding gene	gene with protein product		614908				11042152, 22541429	Standard	NM_016401		Approved	HSPC138, HSPC179, Hikeshi, OPI10	uc001pbu.3	Q53FT3	OTTHUMG00000167212	ENST00000278483.3:c.307G>A	11.37:g.86048459G>A	ENSP00000278483:p.Val103Ile		Q8WVE8|Q9NVQ2|Q9NZZ1|Q9P022|Q9P0N1	Missense_Mutation	SNP	ENST00000278483.3	37	CCDS8275.1	.	.	.	.	.	.	.	.	.	.	G	10.93	1.489353	0.26686	.	.	ENSG00000149196	ENST00000533986;ENST00000278483	T;T	0.42900	0.97;0.96	5.15	3.24	0.37175	.	0.324544	0.26824	N	0.022320	T	0.18964	0.0455	N	0.08118	0	0.25909	N	0.983258	B;B	0.10296	0.0;0.003	B;B	0.09377	0.003;0.004	T	0.14476	-1.0471	9	.	.	.	-12.3005	6.9504	0.24542	0.1742:0.254:0.5718:0.0	.	103;103	Q53FT3;E9PPG8	CK073_HUMAN;.	I	103	ENSP00000432699:V103I;ENSP00000278483:V103I	.	V	+	1	0	C11orf73	85726107	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.487000	0.45268	1.300000	0.44818	0.555000	0.69702	GTC		0.393	C11orf73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393747.1		NM_016401	
C12orf74	338809	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	93100735	93100735	+	Missense_Mutation	SNP	T	T	G	rs183080897	byFrequency	TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr12:93100735T>G	ENST00000397833.3	+	2	779	c.328T>G	c.(328-330)Tct>Gct	p.S110A	C12orf74_ENST00000544406.2_Missense_Mutation_p.S110A	NM_001037671.3|NM_001178097.2	NP_001032760.1|NP_001171568.1	Q32Q52	CL074_HUMAN	chromosome 12 open reading frame 74	110								p.S110A(1)		kidney(1)|large_intestine(2)|lung(4)|prostate(1)|urinary_tract(2)	10						AAGATTGACCTCTGAACCTGA	0.542																																																	1	Substitution - Missense(1)	kidney(1)											67.0	72.0	70.0					12																	93100735		1948	4152	6100	SO:0001583	missense	338809			BC043363	CCDS41819.1, CCDS53818.1	12q22	2012-08-16			ENSG00000214215	ENSG00000214215			27887	protein-coding gene	gene with protein product						12477932	Standard	NM_001037671		Approved		uc001tch.2	Q32Q52	OTTHUMG00000170105	ENST00000397833.3:c.328T>G	12.37:g.93100735T>G	ENSP00000380933:p.Ser110Ala		F5H4P0	Missense_Mutation	SNP	ENST00000397833.3	37	CCDS41819.1	.	.	.	.	.	.	.	.	.	.	T	2.935	-0.220250	0.06061	.	.	ENSG00000214215	ENST00000397833;ENST00000544406	.	.	.	4.68	-1.43	0.08884	.	.	.	.	.	T	0.17238	0.0414	N	0.14661	0.345	0.09310	N	1	B;B	0.16396	0.017;0.017	B;B	0.21151	0.033;0.033	T	0.22800	-1.0206	8	0.48119	T	0.1	.	1.6343	0.02739	0.1806:0.4174:0.1831:0.219	.	110;110	F5H4P0;Q32Q52	.;CL074_HUMAN	A	110	.	ENSP00000380933:S110A	S	+	1	0	C12orf74	91624866	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.121000	0.15667	-0.107000	0.12088	-0.609000	0.04063	TCT		0.542	C12orf74-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407285.1		NM_001037671	
LACC1	144811	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	44458052	44458052	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr13:44458052C>A	ENST00000441843.1	+	4	1372	c.887C>A	c.(886-888)gCa>gAa	p.A296E	LACC1_ENST00000325686.6_Missense_Mutation_p.A296E	NM_001128303.1	NP_001121775.1	Q8IV20	LACC1_HUMAN	laccase (multicopper oxidoreductase) domain containing 1	296								p.A296E(1)									GTCAAAAAAGCATGTGGGGTT	0.368																																																	1	Substitution - Missense(1)	kidney(1)											102.0	99.0	100.0					13																	44458052		2203	4300	6503	SO:0001583	missense	0			AK096044	CCDS9391.1	13q14.11	2012-05-11	2011-08-09	2011-08-09	ENSG00000179630	ENSG00000179630			26789	protein-coding gene	gene with protein product		613409	"""chromosome 13 open reading frame 31"""	C13orf31		16740638, 22504414	Standard	NM_153218		Approved	FLJ38725	uc010acg.3	Q8IV20	OTTHUMG00000016826	ENST00000441843.1:c.887C>A	13.37:g.44458052C>A	ENSP00000391747:p.Ala296Glu		A2A3Z6|Q8N8X5	Missense_Mutation	SNP	ENST00000441843.1	37	CCDS9391.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.478383	0.84747	.	.	ENSG00000179630	ENST00000441843;ENST00000325686	T;T	0.46063	0.88;0.88	5.8	5.8	0.92144	.	0.051854	0.85682	D	0.000000	T	0.64713	0.2623	M	0.71920	2.185	0.58432	D	0.999991	D	0.76494	0.999	D	0.73380	0.98	T	0.59825	-0.7381	10	0.34782	T	0.22	-17.1621	19.0512	0.93046	0.0:1.0:0.0:0.0	.	296	Q8IV20	LACC1_HUMAN	E	296	ENSP00000391747:A296E;ENSP00000317619:A296E	ENSP00000317619:A296E	A	+	2	0	LACC1	43356052	0.995000	0.38212	1.000000	0.80357	0.998000	0.95712	1.419000	0.34793	2.735000	0.93741	0.655000	0.94253	GCA		0.368	LACC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044726.3		NM_153218	
GAS8	2622	hgsc.bcm.edu	37	16	90095596	90095597	+	Intron	DNP	AT	AT	GC	rs61118444|rs55742939|rs71137702	byFrequency	TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	A|T	A|T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr16:90095596_90095597AT>GC	ENST00000268699.4	+	2	212				GAS8_ENST00000540721.1_Intron|GAS8_ENST00000536122.1_Intron|C16orf3_ENST00000408886.2_Missense_Mutation_p.I52A	NM_001481.2	NP_001472.1	O95995	GAS8_HUMAN	growth arrest-specific 8						cellular protein localization (GO:0034613)|negative regulation of cell proliferation (GO:0008285)|sperm motility (GO:0030317)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile cilium (GO:0031514)				endometrium(3)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.029)		ggggcaggctatggggcagcct	0.663																																																	0																																										SO:0001627	intron_variant	750			AF050079	CCDS10992.1, CCDS67101.1, CCDS73932.1	16q24.3	2014-07-18	2003-01-16	2003-01-17	ENSG00000141013	ENSG00000141013			4166	protein-coding gene	gene with protein product		605178	"""growth arrest-specific 11"""	GAS11		9790751	Standard	NM_001481		Approved		uc002fqi.1	O95995	OTTHUMG00000138988	Exception_encountered	16.37:g.90095596_90095597delinsGC			B2RCT1|B7Z4U1|G3V1L5|Q2M234	Missense_Mutation	SNP	ENST00000268699.4	37	CCDS10992.1																																																																																				0.663	GAS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272877.2			
CAPN9	10753	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	230891141	230891141	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr1:230891141A>G	ENST00000271971.2	+	2	385	c.272A>G	c.(271-273)cAg>cGg	p.Q91R	CAPN9_ENST00000366666.2_Intron|CAPN9_ENST00000354537.1_Missense_Mutation_p.Q91R|RP11-99J16__A.2_ENST00000412344.1_RNA	NM_006615.2	NP_006606.1	O14815	CAN9_HUMAN	calpain 9	91	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				digestion (GO:0007586)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)	p.Q91R(2)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	25	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)				GATATCTGCCAGGGAGAGCTG	0.547																																																	2	Substitution - Missense(2)	kidney(2)											74.0	73.0	73.0					1																	230891141		2203	4300	6503	SO:0001583	missense	10753			AF022799	CCDS1586.1, CCDS31053.1	1q42.11-q42.3	2013-01-10	2004-11-11		ENSG00000135773	ENSG00000135773		"""EF-hand domain containing"""	1486	protein-coding gene	gene with protein product	"""novel calpain large subunit-4"""	606401	"""calpain 9 (nCL-4)"""			9524069, 10835488	Standard	XM_005273010		Approved	nCL-4, GC36	uc001htz.1	O14815	OTTHUMG00000037779	ENST00000271971.2:c.272A>G	1.37:g.230891141A>G	ENSP00000271971:p.Gln91Arg		B1APS1|B1AQI0|Q9NS74	Missense_Mutation	SNP	ENST00000271971.2	37	CCDS1586.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.422434	0.83559	.	.	ENSG00000135773	ENST00000271971;ENST00000354537	T;T	0.31769	1.48;1.48	5.07	5.07	0.68467	Peptidase C2, calpain, catalytic domain (3);	0.000000	0.85682	D	0.000000	T	0.74481	0.3722	H	0.99682	4.7	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.87578	0.997;0.998	D	0.86666	0.1907	10	0.87932	D	0	.	14.8282	0.70130	1.0:0.0:0.0:0.0	.	91;91	O14815-2;O14815	.;CAN9_HUMAN	R	91	ENSP00000271971:Q91R;ENSP00000346538:Q91R	ENSP00000271971:Q91R	Q	+	2	0	CAPN9	228957764	1.000000	0.71417	1.000000	0.80357	0.802000	0.45316	8.922000	0.92789	1.905000	0.55150	0.533000	0.62120	CAG		0.547	CAPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092179.1		NM_006615	
CCDC129	223075	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	31683360	31683360	+	Silent	SNP	C	C	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr7:31683360C>A	ENST00000407970.3	+	11	2414	c.2376C>A	c.(2374-2376)atC>atA	p.I792I	CCDC129_ENST00000319386.3_Silent_p.I644I|CCDC129_ENST00000409210.1_Silent_p.I700I|CCDC129_ENST00000451887.2_Silent_p.I818I	NM_001257967.1|NM_194300.3	NP_001244896.1|NP_919276.2	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	792								p.I644I(1)|p.I792I(1)		cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(31)	44						TCTCTAGTATCTGCCCAATGG	0.562																																																	2	Substitution - coding silent(2)	kidney(2)											80.0	69.0	73.0					7																	31683360		2203	4300	6503	SO:0001819	synonymous_variant	223075			AK128026	CCDS5435.2, CCDS59050.1, CCDS75577.1	7p14.3	2006-08-21			ENSG00000180347	ENSG00000180347			27363	protein-coding gene	gene with protein product						14702039	Standard	NM_001257967		Approved	FLJ38344	uc011kad.1	Q6ZRS4	OTTHUMG00000128611	ENST00000407970.3:c.2376C>A	7.37:g.31683360C>A			A2RU17|B3KTI9|B4DHB0|B4E2R1|F5H3V5	Silent	SNP	ENST00000407970.3	37	CCDS5435.2																																																																																				0.562	CCDC129-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318975.1		NM_194300	
CDH1	999	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	68862136	68862136	+	Silent	SNP	C	C	T			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr16:68862136C>T	ENST00000261769.5	+	14	2415	c.2224C>T	c.(2224-2226)Ctg>Ttg	p.L742L	CDH1_ENST00000562836.1_3'UTR|CDH1_ENST00000422392.2_Silent_p.L681L	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	742					adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.L742L(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		AGAGCCCTTACTGCCCCCAGA	0.522			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																														yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	1	Substitution - coding silent(1)	kidney(1)											115.0	106.0	109.0					16																	68862136		2198	4300	6498	SO:0001819	synonymous_variant	999	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.2224C>T	16.37:g.68862136C>T			A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Silent	SNP	ENST00000261769.5	37	CCDS10869.1																																																																																				0.522	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268897.2		NM_004360	
COBL	23242	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	51261213	51261213	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr7:51261213T>A	ENST00000265136.7	-	3	484	c.319A>T	c.(319-321)Att>Ttt	p.I107F	COBL_ENST00000441453.1_Missense_Mutation_p.I107F|COBL_ENST00000395542.2_Missense_Mutation_p.I107F|COBL_ENST00000395540.2_Missense_Mutation_p.I107F	NM_015198.3	NP_056013.2	O75128	COBL_HUMAN	cordon-bleu WH2 repeat protein	107					actin filament network formation (GO:0051639)|actin filament polymerization (GO:0030041)|collateral sprouting in absence of injury (GO:0048669)|digestive tract development (GO:0048565)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|liver development (GO:0001889)|neural tube closure (GO:0001843)|notochord development (GO:0030903)|positive regulation of dendrite development (GO:1900006)|somite specification (GO:0001757)	actin filament (GO:0005884)|axon (GO:0030424)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic growth cone (GO:0044294)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)	p.I107F(1)		NS(2)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(26)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Glioma(55;0.08)					GAAGACCGAATTTCAAGGGCA	0.413																																					NSCLC(189;2119 2138 12223 30818 34679)												1	Substitution - Missense(1)	kidney(1)											95.0	85.0	89.0					7																	51261213		2203	4300	6503	SO:0001583	missense	23242			AB014533	CCDS34637.1, CCDS75601.1, CCDS75602.1	7p12.2-p12.1	2012-12-07	2012-12-07		ENSG00000106078	ENSG00000106078			22199	protein-coding gene	gene with protein product		610317	"""cordon-bleu homolog (mouse)"""				Standard	NM_015198		Approved	KIAA0633	uc003tpr.4	O75128	OTTHUMG00000155999	ENST00000265136.7:c.319A>T	7.37:g.51261213T>A	ENSP00000265136:p.Ile107Phe		A4D257|A7E2B0|B7ZLW9|B9EGF8|Q2T9J3|Q504Y4|Q86XA7|Q8N304|Q8TCM1	Missense_Mutation	SNP	ENST00000265136.7	37	CCDS34637.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.28|18.28	3.589225|3.589225	0.66105|0.66105	.|.	.|.	ENSG00000106078|ENSG00000106078	ENST00000265136;ENST00000395542;ENST00000395540;ENST00000441453;ENST00000449281|ENST00000452534	T;T|.	0.12147|.	2.72;2.71|.	5.58|5.58	2.0|2.0	0.26442|0.26442	Cordon-bleu domain (1);|.	0.000000|.	0.40385|.	N|.	0.001108|.	T|T	0.47078|0.47078	0.1426|0.1426	L|L	0.54323|0.54323	1.7|1.7	0.37104|0.37104	D|D	0.900017|0.900017	D;P;D;P;D|.	0.65815|.	0.97;0.692;0.97;0.891;0.995|.	P;B;P;P;D|.	0.62955|.	0.775;0.23;0.775;0.763;0.909|.	T|T	0.47262|0.47262	-0.9131|-0.9131	10|5	0.66056|.	D|.	0.02|.	.|.	1.4596|1.4596	0.02393|0.02393	0.1235:0.2938:0.2541:0.3286|0.1235:0.2938:0.2541:0.3286	.|.	107;107;107;107;107|.	O75128-3;O75128-5;O75128-7;O75128;O75128-2|.	.;.;.;COBL_HUMAN;.|.	F|I	107;107;107;107;91|25	ENSP00000265136:I107F;ENSP00000378912:I107F|.	ENSP00000265136:I107F|.	I|N	-|-	1|2	0|0	COBL|COBL	51228707|51228707	0.998000|0.998000	0.40836|0.40836	0.987000|0.987000	0.45799|0.45799	0.962000|0.962000	0.63368|0.63368	0.356000|0.356000	0.20181|0.20181	0.397000|0.397000	0.25310|0.25310	0.533000|0.533000	0.62120|0.62120	ATT|AAT		0.413	COBL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000342682.1		NM_015198	
COL5A2	1290	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	189906379	189906379	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr2:189906379T>C	ENST00000374866.3	-	50	3840	c.3566A>G	c.(3565-3567)aAc>aGc	p.N1189S		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	1189					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)	p.N1189S(1)		NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			TGGCCCAGGGTTTCCTTCTTT	0.468																																																	1	Substitution - Missense(1)	kidney(1)											117.0	115.0	116.0					2																	189906379		2203	4300	6503	SO:0001583	missense	1290			Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.3566A>G	2.37:g.189906379T>C	ENSP00000364000:p.Asn1189Ser		P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Missense_Mutation	SNP	ENST00000374866.3	37	CCDS33350.1	.	.	.	.	.	.	.	.	.	.	T	6.554	0.470411	0.12461	.	.	ENSG00000204262	ENST00000374866;ENST00000452536	D	0.93426	-3.22	5.72	3.36	0.38483	.	0.110902	0.39615	N	0.001316	T	0.80507	0.4636	N	0.04297	-0.235	0.28025	N	0.934371	B;B	0.14438	0.001;0.01	B;B	0.15052	0.006;0.012	T	0.66352	-0.5945	10	0.07325	T	0.83	.	8.8748	0.35339	0.0:0.2121:0.0:0.7879	.	829;1189	Q5PR22;P05997	.;CO5A2_HUMAN	S	1189;829	ENSP00000364000:N1189S	ENSP00000364000:N1189S	N	-	2	0	COL5A2	189614624	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.830000	0.48136	1.103000	0.41568	0.528000	0.53228	AAC		0.468	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1		NM_000393	
CUBN	8029	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	17151661	17151661	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr10:17151661A>T	ENST00000377833.4	-	10	1154	c.1089T>A	c.(1087-1089)gaT>gaA	p.D363E		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	363	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.D363E(1)		breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AGCATGAGGCATCTGGGTGGC	0.453																																																	1	Substitution - Missense(1)	kidney(1)											184.0	127.0	146.0					10																	17151661		2203	4300	6503	SO:0001583	missense	8029			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.1089T>A	10.37:g.17151661A>T	ENSP00000367064:p.Asp363Glu		B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	A	0.001	-3.810101	0.00004	.	.	ENSG00000107611	ENST00000377833	D	0.89875	-2.58	5.64	-11.3	0.00108	EGF domain, merozoite surface protein 1-like (1);Growth factor, receptor (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	1.079030	0.07326	N	0.878349	T	0.71013	0.3290	N	0.25426	0.745	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.68815	-0.5309	10	0.02654	T	1	.	1.5415	0.02556	0.1641:0.2739:0.2634:0.2986	.	363	O60494	CUBN_HUMAN	E	363	ENSP00000367064:D363E	ENSP00000367064:D363E	D	-	3	2	CUBN	17191667	0.000000	0.05858	0.000000	0.03702	0.046000	0.14306	-2.865000	0.00724	-8.331000	0.00000	-2.052000	0.00405	GAT		0.453	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1		NM_001081	
FBN2	2201	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	127714472	127714472	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr5:127714472G>A	ENST00000508053.1	-	18	2689	c.1715C>T	c.(1714-1716)gCa>gTa	p.A572V	FBN2_ENST00000511489.1_5'Flank|FBN2_ENST00000262464.4_Missense_Mutation_p.A572V|FBN2_ENST00000508989.1_Missense_Mutation_p.A539V			P35556	FBN2_HUMAN	fibrillin 2	572	EGF-like 7; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.A572V(2)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		ACCAATGCATGCTTGCTTGGT	0.378																																																	2	Substitution - Missense(2)	kidney(2)											97.0	91.0	93.0					5																	127714472		2203	4300	6503	SO:0001583	missense	2201			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.1715C>T	5.37:g.127714472G>A	ENSP00000424571:p.Ala572Val		B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	G	18.07	3.540921	0.65085	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000508989	D;D;D	0.92149	-2.98;-2.98;-2.98	4.26	4.26	0.50523	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.080793	0.49916	D	0.000135	D	0.91566	0.7336	N	0.12569	0.235	0.50313	D	0.999863	D;D	0.69078	0.973;0.997	P;D	0.70716	0.846;0.97	D	0.92543	0.6043	10	0.48119	T	0.1	.	17.9883	0.89161	0.0:0.0:1.0:0.0	.	539;572	D6RJI3;P35556	.;FBN2_HUMAN	V	572;572;539	ENSP00000262464:A572V;ENSP00000424571:A572V;ENSP00000425596:A539V	ENSP00000262464:A572V	A	-	2	0	FBN2	127742371	1.000000	0.71417	0.998000	0.56505	0.978000	0.69477	4.185000	0.58330	2.654000	0.90174	0.655000	0.94253	GCA		0.378	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2		NM_001999	
FXYD5	53827	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	35651641	35651641	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr19:35651641C>A	ENST00000342879.3	+	4	1007	c.229C>A	c.(229-231)Caa>Aaa	p.Q77K	FXYD5_ENST00000541435.2_Missense_Mutation_p.Q77K|FXYD5_ENST00000423817.3_Missense_Mutation_p.Q77K|FXYD5_ENST00000590686.1_Missense_Mutation_p.Q77K|FXYD5_ENST00000543307.1_Missense_Mutation_p.Q77K|FXYD5_ENST00000591716.2_3'UTR|FXYD5_ENST00000392219.2_Missense_Mutation_p.Q77K|FXYD5_ENST00000588699.1_Missense_Mutation_p.Q77K			Q96DB9	FXYD5_HUMAN	FXYD domain containing ion transport regulator 5	77					microvillus assembly (GO:0030033)|negative regulation of calcium-dependent cell-cell adhesion (GO:0046588)	integral component of membrane (GO:0016021)	actin binding (GO:0003779)|cadherin binding (GO:0045296)|ion channel activity (GO:0005216)	p.Q77K(2)		endometrium(2)|kidney(1)|large_intestine(3)|lung(3)	9	all_lung(56;9.4e-09)|Lung NSC(56;1.4e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.75e-22)|OV - Ovarian serous cystadenocarcinoma(14;3.17e-20)|all cancers(14;7.07e-19)|LUSC - Lung squamous cell carcinoma(66;0.0221)			CCAGACCCAGCAACTGGAAGG	0.532																																																	2	Substitution - Missense(2)	kidney(2)											165.0	162.0	163.0					19																	35651641		2203	4300	6503	SO:0001583	missense	53827			AF161462	CCDS12447.1	19q13.12	2008-02-05	2002-01-14		ENSG00000089327	ENSG00000089327			4029	protein-coding gene	gene with protein product	"""dysadherin"""	606669	"""FXYD domain-containing ion transport regulator 5"""				Standard	NM_144779		Approved	OIT2	uc002nyg.2	Q96DB9	OTTHUMG00000048092	ENST00000342879.3:c.229C>A	19.37:g.35651641C>A	ENSP00000344254:p.Gln77Lys		B7WNZ8|Q6UW44|Q9HC34|Q9P039	Missense_Mutation	SNP	ENST00000342879.3	37	CCDS12447.1	.	.	.	.	.	.	.	.	.	.	C	0.033	-1.322610	0.01320	.	.	ENSG00000089327	ENST00000543307;ENST00000392219;ENST00000541435;ENST00000342879;ENST00000423817	T;T;T;T;T	0.69561	-0.41;0.63;0.63;0.63;0.63	3.33	2.27	0.28462	.	2.151060	0.01915	N	0.040093	T	0.56775	0.2008	L	0.29908	0.895	0.09310	N	0.999991	B;B	0.18461	0.028;0.003	B;B	0.12837	0.008;0.004	T	0.41822	-0.9487	10	0.37606	T	0.19	2.3377	7.9036	0.29748	0.2454:0.7546:0.0:0.0	.	77;77	F5H4X8;Q96DB9	.;FXYD5_HUMAN	K	77	ENSP00000444839:Q77K;ENSP00000376053:Q77K;ENSP00000443390:Q77K;ENSP00000344254:Q77K;ENSP00000393848:Q77K	ENSP00000344254:Q77K	Q	+	1	0	FXYD5	40343481	0.006000	0.16342	0.013000	0.15412	0.012000	0.07955	0.699000	0.25586	0.961000	0.38030	0.561000	0.74099	CAA		0.532	FXYD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109443.1		NM_014164	
GALNT5	11227	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	158115425	158115425	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr2:158115425delT	ENST00000259056.4	+	1	1316	c.831delT	c.(829-831)cctfs	p.P277fs		NM_014568.1	NP_055383.1	Q7Z7M9	GALT5_HUMAN	polypeptide N-acetylgalactosaminyltransferase 5	277					cellular protein metabolic process (GO:0044267)|glycosaminoglycan biosynthetic process (GO:0006024)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(4)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	56						CGAGTCTTCCTTTTCCTAAGT	0.428																																																	0													75.0	74.0	74.0					2																	158115425		2203	4300	6503	SO:0001589	frameshift_variant	11227			AJ245539	CCDS2203.1	2q24.1	2014-03-13	2014-03-13		ENSG00000136542	ENSG00000136542	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4127	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 5"""	615129	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)"""			10545594	Standard	NM_014568		Approved	GalNAc-T5	uc002tzg.3	Q7Z7M9	OTTHUMG00000131965	ENST00000259056.4:c.831delT	2.37:g.158115425delT	ENSP00000259056:p.Pro277fs		A5PKZ1|Q9UGK7|Q9UHL6	Frame_Shift_Del	DEL	ENST00000259056.4	37	CCDS2203.1																																																																																				0.428	GALNT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254925.2		NM_014568	
LHX6	26468	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	124975917	124975917	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr9:124975917G>A	ENST00000373755.2	-	7	1043	c.935C>T	c.(934-936)gCg>gTg	p.A312V	LHX6_ENST00000373754.2_Missense_Mutation_p.A312V|LHX6_ENST00000394319.4_Missense_Mutation_p.A341V|LHX6_ENST00000340587.3_Missense_Mutation_p.A341V|LHX6_ENST00000464484.2_5'UTR|LHX6_ENST00000541397.2_Missense_Mutation_p.A330V|LHX6_ENST00000482062.1_5'UTR|LHX6_ENST00000559895.1_Missense_Mutation_p.A125V	NM_001242334.1	NP_001229263.1	Q9UPM6	LHX6_HUMAN	LIM homeobox 6	312					cell maturation (GO:0048469)|cerebral cortex GABAergic interneuron migration (GO:0021853)|cerebral cortex radially oriented cell migration (GO:0021799)|cerebral cortex tangential migration (GO:0021800)|forebrain neuron fate commitment (GO:0021877)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.A341V(2)		endometrium(2)|kidney(1)|large_intestine(5)	8						GACCATGCGCGCCCGCTCGGG	0.736																																																	2	Substitution - Missense(2)	kidney(2)											21.0	31.0	28.0					9																	124975917		2202	4298	6500	SO:0001583	missense	26468			AB031041	CCDS6837.2, CCDS6838.2, CCDS56583.1, CCDS56584.1, CCDS59144.1	9q33.2	2011-06-20			ENSG00000106852	ENSG00000106852		"""Homeoboxes / LIM class"""	21735	protein-coding gene	gene with protein product		608215				10393337	Standard	NM_014368		Approved	LHX6.1	uc004blx.4	Q9UPM6	OTTHUMG00000020601	ENST00000373755.2:c.935C>T	9.37:g.124975917G>A	ENSP00000362860:p.Ala312Val		A6PVQ1|A6PVQ2|A8K1B2|B7Z4D0|H0YN76|Q5T7S7|Q5T7S8|Q9NTK3|Q9UPM5	Missense_Mutation	SNP	ENST00000373755.2	37	CCDS56583.1	.	.	.	.	.	.	.	.	.	.	G	35	5.534838	0.96460	.	.	ENSG00000106852	ENST00000373755;ENST00000373754;ENST00000394319;ENST00000340587;ENST00000541397	D;D;D;D;D	0.87809	-2.27;-2.3;-2.16;-2.17;-2.2	5.58	4.67	0.58626	.	0.000000	0.85682	D	0.000000	T	0.81108	0.4754	L	0.27053	0.805	0.80722	D	1	P;P;P	0.49783	0.731;0.928;0.824	B;B;B	0.42163	0.139;0.378;0.27	T	0.81337	-0.0978	10	0.41790	T	0.15	.	15.7084	0.77606	0.0:0.1368:0.8632:0.0	.	312;341;341	Q9UPM6;Q9UPM6-4;Q9UPM6-3	LHX6_HUMAN;.;.	V	312;312;341;341;330	ENSP00000362860:A312V;ENSP00000362859:A312V;ENSP00000377854:A341V;ENSP00000340137:A341V;ENSP00000441464:A330V	ENSP00000340137:A341V	A	-	2	0	LHX6	124015738	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.296000	0.72751	1.330000	0.45394	0.650000	0.86243	GCG		0.736	LHX6-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053924.2		NM_014368	
MAMDC4	158056	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	139748706	139748706	+	Silent	SNP	C	C	T			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr9:139748706C>T	ENST00000317446.2	+	7	764	c.714C>T	c.(712-714)aaC>aaT	p.N238N	MAMDC4_ENST00000485732.1_3'UTR|MAMDC4_ENST00000445819.1_Silent_p.N238N	NM_206920.2	NP_996803.2			MAM domain containing 4									p.N238N(2)		breast(4)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	19	all_cancers(76;0.0763)|all_epithelial(76;0.198)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		ACTGCCAGAACAAGGTCTGCG	0.672																																																	2	Substitution - coding silent(2)	kidney(2)											25.0	27.0	26.0					9																	139748706		2193	4296	6489	SO:0001819	synonymous_variant	158056			AL834531	CCDS7010.1	9q34.3	2013-10-21			ENSG00000177943	ENSG00000177943			24083	protein-coding gene	gene with protein product	"""apical early endosomal glycoprotein precursor"", ""endotubin"""					7829488	Standard	NM_206920		Approved	AEGP, DKFZp434M1411	uc004cjs.3	Q6UXC1	OTTHUMG00000020951	ENST00000317446.2:c.714C>T	9.37:g.139748706C>T				Silent	SNP	ENST00000317446.2	37	CCDS7010.1	.	.	.	.	.	.	.	.	.	.	.	5.405	0.259952	0.10239	.	.	ENSG00000177943	ENST00000413647	.	.	.	4.48	2.64	0.31445	.	.	.	.	.	.	.	.	.	.	.	0.21499	N	0.99967	.	.	.	.	.	.	.	.	.	.	.	.	.	-45.2408	7.1563	0.25639	0.0:0.7194:0.0:0.2806	.	.	.	.	X	220	.	.	Q	+	1	0	MAMDC4	138868527	0.002000	0.14202	0.052000	0.19188	0.727000	0.41649	0.010000	0.13242	0.522000	0.28464	-0.291000	0.09656	CAA		0.672	MAMDC4-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254642.3		NM_206920	
MBD4	8930	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	129152917	129152917	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr3:129152917A>G	ENST00000249910.1	-	4	1439	c.1264T>C	c.(1264-1266)Tat>Cat	p.Y422H	MBD4_ENST00000503197.1_Missense_Mutation_p.Y422H|MBD4_ENST00000393278.2_Missense_Mutation_p.Y104H|MBD4_ENST00000507208.1_Missense_Mutation_p.Y422H|MBD4_ENST00000429544.2_Missense_Mutation_p.Y416H|MBD4_ENST00000509587.1_5'UTR	NM_003925.1	NP_003916.1	O95243	MBD4_HUMAN	methyl-CpG binding domain protein 4	422					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)	p.Y422H(1)		NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)	22						TCTTTGTTATATTTGCTGGAA	0.368								Base excision repair (BER), DNA glycosylases																																									1	Substitution - Missense(1)	kidney(1)											181.0	176.0	177.0					3																	129152917		2203	4300	6503	SO:0001583	missense	8930			AF072250	CCDS3058.1, CCDS63766.1, CCDS63767.1, CCDS63768.1, CCDS63769.1	3q21.3	2004-03-02			ENSG00000129071	ENSG00000129071			6919	protein-coding gene	gene with protein product		603574				9774669, 10097147	Standard	NM_003925		Approved	MED1	uc003emh.2	O95243	OTTHUMG00000159463	ENST00000249910.1:c.1264T>C	3.37:g.129152917A>G	ENSP00000249910:p.Tyr422His		B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Missense_Mutation	SNP	ENST00000249910.1	37	CCDS3058.1	.	.	.	.	.	.	.	.	.	.	A	10.67	1.416325	0.25552	.	.	ENSG00000129071	ENST00000429544;ENST00000249910;ENST00000503197;ENST00000393278;ENST00000507208	D;D;D;T;D	0.93076	-2.96;-2.95;-3.16;1.44;-3.15	5.71	4.57	0.56435	.	0.436856	0.25674	N	0.029047	D	0.89556	0.6749	L	0.55103	1.725	0.30353	N	0.784601	P;B;P;B;P	0.39737	0.558;0.233;0.685;0.328;0.558	B;B;B;B;B	0.39027	0.148;0.066;0.288;0.104;0.208	D	0.85319	0.1083	10	0.20519	T	0.43	-15.7169	9.0611	0.36436	0.8606:0.0:0.1394:0.0	.	422;104;416;422;422	E9PEE4;Q2MD36;O95243-2;O95243-3;O95243	.;.;.;.;MBD4_HUMAN	H	416;422;422;104;422	ENSP00000394080:Y416H;ENSP00000249910:Y422H;ENSP00000424873:Y422H;ENSP00000376959:Y104H;ENSP00000422327:Y422H	ENSP00000249910:Y422H	Y	-	1	0	MBD4	130635607	0.997000	0.39634	0.969000	0.41365	0.955000	0.61496	2.193000	0.42658	2.197000	0.70478	0.529000	0.55759	TAT		0.368	MBD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355529.1		NM_003925	
MOB2	81532	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	1491652	1491652	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr11:1491652A>T	ENST00000329957.6	-	5	746	c.557T>A	c.(556-558)cTg>cAg	p.L186Q	MOB2_ENST00000526462.1_5'UTR	NM_001172223.1	NP_001165694.1	Q70IA6	MOB2_HUMAN	MOB kinase activator 2	155					actin cytoskeleton organization (GO:0030036)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein phosphorylation (GO:0001934)	cytoplasm (GO:0005737)|neuron projection terminus (GO:0044306)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.L186Q(2)		breast(1)|kidney(2)|lung(1)	4						GATGTGTGCCAGCACGTGGAA	0.582																																																	2	Substitution - Missense(2)	kidney(2)											106.0	116.0	113.0					11																	1491652		2127	4226	6353	SO:0001583	missense	81532				CCDS53591.1	11p15.5	2011-09-28			ENSG00000182208	ENSG00000182208		"""MOB kinase activators"""	24904	protein-coding gene	gene with protein product	"""MOB2 Mps One Binder homolog (yeast)"""	611969				11223154, 15067004	Standard	NM_053005		Approved	HCCA2	uc010qwz.2	Q70IA6	OTTHUMG00000165545	ENST00000329957.6:c.557T>A	11.37:g.1491652A>T	ENSP00000328694:p.Leu186Gln		B4DKP3|Q96M67	Missense_Mutation	SNP	ENST00000329957.6	37	CCDS53591.1	.	.	.	.	.	.	.	.	.	.	A	16.42	3.117017	0.56505	.	.	ENSG00000182208	ENST00000329957	.	.	.	4.05	4.05	0.47172	.	0.000000	0.64402	D	0.000004	T	0.76948	0.4059	M	0.76002	2.32	0.80722	D	1	D;D	0.69078	0.997;0.996	D;D	0.73380	0.98;0.941	T	0.80301	-0.1440	9	0.72032	D	0.01	-16.5387	13.1663	0.59573	1.0:0.0:0.0:0.0	.	186;155	E9PDA5;Q70IA6	.;MOB2_HUMAN	Q	186	.	ENSP00000328694:L186Q	L	-	2	0	AC091196.1	1448228	1.000000	0.71417	0.999000	0.59377	0.233000	0.25261	8.533000	0.90617	1.712000	0.51347	0.379000	0.24179	CTG		0.582	MOB2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000384770.1		NM_053005	
MON2	23041	broad.mit.edu	37	12	62887719	62887719	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr12:62887719T>A	ENST00000393632.2	+	3	591	c.200T>A	c.(199-201)gTt>gAt	p.V67D	MON2_ENST00000393629.2_Missense_Mutation_p.V67D|MON2_ENST00000280379.6_Missense_Mutation_p.V67D|MON2_ENST00000393630.3_Missense_Mutation_p.V67D|MON2_ENST00000546600.1_Missense_Mutation_p.V67D|MON2_ENST00000549378.1_Intron|MON2_ENST00000552115.1_Missense_Mutation_p.V67D|MON2_ENST00000552738.1_Missense_Mutation_p.V67D	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	67					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.V67D(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		AGCTCAGAGGTTGTACAGCCT	0.338																																																	1	Substitution - Missense(1)	kidney(1)											90.0	77.0	81.0					12																	62887719		2203	4300	6503	SO:0001583	missense	23041				CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.200T>A	12.37:g.62887719T>A	ENSP00000377252:p.Val67Asp		A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Missense_Mutation	SNP	ENST00000393632.2	37	CCDS31849.1	.	.	.	.	.	.	.	.	.	.	T	31	5.072183	0.93950	.	.	ENSG00000061987	ENST00000393632;ENST00000393630;ENST00000280379;ENST00000546600;ENST00000552738;ENST00000393629;ENST00000552115	T;T;T;T;T;T;T	0.69561	-0.25;-0.41;-0.41;-0.25;-0.25;-0.41;1.24	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.76492	0.3995	L	0.52573	1.65	0.80722	D	1	D;D;D;D	0.71674	0.998;0.994;0.997;0.998	P;D;D;D	0.66847	0.854;0.947;0.921;0.931	T	0.75608	-0.3259	9	.	.	.	-16.9571	15.8953	0.79329	0.0:0.0:0.0:1.0	.	67;67;67;67	B9EGP5;F8VWA6;F8W1Z6;Q7Z3U7-4	.;.;.;.	D	67	ENSP00000377252:V67D;ENSP00000377250:V67D;ENSP00000280379:V67D;ENSP00000447407:V67D;ENSP00000449215:V67D;ENSP00000377249:V67D;ENSP00000446635:V67D	.	V	+	2	0	MON2	61173986	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.040000	0.89188	2.163000	0.67991	0.482000	0.46254	GTT		0.338	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406767.3		NM_015026	
ANKRD30BL	554226	broad.mit.edu	37	2	132911119	132911119	+	Intron	SNP	T	T	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr2:132911119T>A	ENST00000409867.1	-	4	864				ANKRD30BL_ENST00000470729.1_Intron|RNU6-1132P_ENST00000459214.1_RNA			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						CCTTTAAATGTAAACACTTAG	0.373																																																	0																																										SO:0001627	intron_variant	0					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.614+1115A>T	2.37:g.132911119T>A			B8ZZL7	RNA	SNP	ENST00000409867.1	37																																																																																					0.373	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331353.2		NR_027019	
OR3A1	4994	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	3195183	3195183	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr17:3195183G>A	ENST00000323404.1	-	1	693	c.694C>T	c.(694-696)Cgc>Tgc	p.R232C	RP11-64J4.2_ENST00000573491.1_RNA	NM_002550.2	NP_002541.2	P47881	OR3A1_HUMAN	olfactory receptor, family 3, subfamily A, member 1	232					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R232C(2)		central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	20						TCTACAGAGCGAATTCGCAGG	0.493																																					GBM(20;287 516 18743 28660 36594)												2	Substitution - Missense(2)	large_intestine(1)|kidney(1)											65.0	62.0	63.0					17																	3195183		2203	4300	6503	SO:0001583	missense	4994			X80391	CCDS11023.1	17p13.3	2012-08-09			ENSG00000180090	ENSG00000180090		"""GPCR / Class A : Olfactory receptors"""	8282	protein-coding gene	gene with protein product						8921386, 8647456	Standard	NM_002550		Approved	OLFRA03, OR40, OR17-40	uc002fvh.1	P47881	OTTHUMG00000090642	ENST00000323404.1:c.694C>T	17.37:g.3195183G>A	ENSP00000313803:p.Arg232Cys		Q4VB06|Q6IFM4	Missense_Mutation	SNP	ENST00000323404.1	37	CCDS11023.1	.	.	.	.	.	.	.	.	.	.	G	6.027	0.373265	0.11409	.	.	ENSG00000180090	ENST00000323404	T	0.40225	1.04	5.01	5.01	0.66863	GPCR, rhodopsin-like superfamily (1);	0.127459	0.36374	N	0.002621	T	0.45155	0.1328	M	0.76938	2.355	0.09310	N	1	B	0.30439	0.279	B	0.29524	0.103	T	0.50074	-0.8870	10	0.66056	D	0.02	-11.7715	12.4902	0.55895	0.0:0.0:0.8329:0.1671	.	232	P47881	OR3A1_HUMAN	C	232	ENSP00000313803:R232C	ENSP00000313803:R232C	R	-	1	0	OR3A1	3141933	0.019000	0.18553	0.008000	0.14137	0.015000	0.08874	1.259000	0.32956	2.753000	0.94483	0.650000	0.86243	CGC		0.493	OR3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207302.2			
PARP11	57097	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	3939160	3939160	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr12:3939160A>T	ENST00000228820.4	-	2	187	c.43T>A	c.(43-45)Tta>Ata	p.L15I	PARP11_ENST00000427057.2_5'UTR|PARP11_ENST00000397096.2_Missense_Mutation_p.L8I|PARP11_ENST00000447133.3_5'UTR	NM_020367.4	NP_065100.2	Q9NR21	PAR11_HUMAN	poly (ADP-ribose) polymerase family, member 11	8	WWE. {ECO:0000255|PROSITE- ProRule:PRU00248}.						NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.L8I(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	17			all cancers(3;1.58e-07)|OV - Ovarian serous cystadenocarcinoma(31;0.00287)|GBM - Glioblastoma multiforme(3;0.0141)|COAD - Colon adenocarcinoma(12;0.0264)			TTAGAAAATAATTCTTCTGCT	0.373																																																	1	Substitution - Missense(1)	kidney(1)											124.0	114.0	117.0					12																	3939160		2203	4300	6503	SO:0001583	missense	57097			AF263540	CCDS8523.2, CCDS66281.1	12p13.3	2014-01-28	2004-08-25	2004-08-26	ENSG00000111224	ENSG00000111224		"""Poly (ADP-ribose) polymerases"""	1186	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 6"""	C12orf6		15273990	Standard	NM_001286522		Approved		uc001qml.2	Q9NR21	OTTHUMG00000156442	ENST00000228820.4:c.43T>A	12.37:g.3939160A>T	ENSP00000228820:p.Leu15Ile		B4DRQ0|Q68DS1|Q8N5Y9	Missense_Mutation	SNP	ENST00000228820.4	37	CCDS8523.2	.	.	.	.	.	.	.	.	.	.	A	7.105	0.574914	0.13623	.	.	ENSG00000111224	ENST00000397096;ENST00000228820	T;T	0.30448	1.53;2.75	5.52	1.77	0.24775	.	0.529823	0.20011	N	0.101129	T	0.11580	0.0282	N	0.08118	0	0.40151	D	0.976942	B;B	0.09022	0.002;0.001	B;B	0.09377	0.004;0.002	T	0.13899	-1.0492	10	0.21014	T	0.42	.	2.4259	0.04459	0.4697:0.304:0.08:0.1463	.	15;8	Q9NR21-4;Q9NR21	.;PAR11_HUMAN	I	8;15	ENSP00000380284:L8I;ENSP00000228820:L15I	ENSP00000228820:L15I	L	-	1	2	PARP11	3809421	0.853000	0.29707	0.276000	0.24689	0.040000	0.13550	0.439000	0.21575	0.147000	0.19030	0.460000	0.39030	TTA		0.373	PARP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344213.1			
RANBP2	5903	broad.mit.edu	37	2	109382975	109382975	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr2:109382975G>C	ENST00000283195.6	+	20	6106	c.5980G>C	c.(5980-5982)Ggt>Cgt	p.G1994R		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	1994					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.G1994R(2)	RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						AAACACTTCCGGTGACTTTGA	0.393																																																	2	Substitution - Missense(2)	kidney(2)											65.0	75.0	72.0					2																	109382975		1979	3965	5944	SO:0001583	missense	5903			D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.5980G>C	2.37:g.109382975G>C	ENSP00000283195:p.Gly1994Arg		Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	ENST00000283195.6	37	CCDS2079.1	.	.	.	.	.	.	.	.	.	.	G	0.218	-1.031157	0.02029	.	.	ENSG00000153201	ENST00000409491;ENST00000283195	T	0.27104	1.69	5.64	-0.268	0.12934	.	.	.	.	.	T	0.12817	0.0311	N	0.22421	0.69	0.09310	N	1	B	0.25521	0.128	B	0.22386	0.039	T	0.28235	-1.0050	9	0.29301	T	0.29	-7.7395	2.2814	0.04115	0.1868:0.0961:0.3805:0.3366	.	1994	P49792	RBP2_HUMAN	R	1018;1994	ENSP00000283195:G1994R	ENSP00000283195:G1994R	G	+	1	0	RANBP2	108749407	0.675000	0.27558	0.049000	0.19019	0.197000	0.23852	1.246000	0.32803	0.021000	0.15133	-0.319000	0.08680	GGT		0.393	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1		NM_006267	
RNF32	140545	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	156450264	156450264	+	Silent	SNP	C	C	T			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr7:156450264C>T	ENST00000405335.1	+	6	856	c.447C>T	c.(445-447)caC>caT	p.H149H	RNF32_ENST00000343665.4_Intron|RNF32_ENST00000317955.5_Silent_p.H149H|RNF32_ENST00000480011.1_3'UTR|AC005534.8_ENST00000455709.1_RNA|RNF32_ENST00000432459.2_Silent_p.H149H|RNF32_ENST00000392743.2_Silent_p.H149H|RNF32_ENST00000311822.8_Silent_p.H149H|RNF32_ENST00000392741.2_Silent_p.H149H			Q9H0A6	RNF32_HUMAN	ring finger protein 32	149						aggresome (GO:0016235)|endosome (GO:0005768)	zinc ion binding (GO:0008270)	p.H149H(2)		cervix(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(2)	15	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00291)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		ATGTGTTCCACAAAGTAAGTC	0.473																																																	2	Substitution - coding silent(2)	kidney(2)											200.0	177.0	185.0					7																	156450264		2203	4300	6503	SO:0001819	synonymous_variant	140545				CCDS5944.1	7q36	2013-08-05			ENSG00000105982	ENSG00000105982		"""RING-type (C3HC4) zinc fingers"""	17118	protein-coding gene	gene with protein product		610241				11890671	Standard	NM_001184996		Approved	FKSG33, HSD15, LMBR2	uc003wmr.3	Q9H0A6	OTTHUMG00000151440	ENST00000405335.1:c.447C>T	7.37:g.156450264C>T			Q6FIB3|Q6X7T4|Q8N6V8|Q8TDG0|Q96BM5|Q9Y6U1	Silent	SNP	ENST00000405335.1	37	CCDS5944.1																																																																																				0.473	RNF32-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322660.2		NM_030936	
RXRB	6257	broad.mit.edu	37	6	33168094	33168094	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr6:33168094delC	ENST00000374680.3	-	1	371	c.160delG	c.(160-162)gcafs	p.A54fs	RXRB_ENST00000544186.1_Intron|RXRB_ENST00000413614.2_Frame_Shift_Del_p.W40fs|SLC39A7_ENST00000374677.3_5'Flank|RXRB_ENST00000374685.4_Frame_Shift_Del_p.A54fs|RNY4P10_ENST00000365571.1_RNA|SLC39A7_ENST00000374675.3_5'Flank	NM_001270401.1|NM_021976.4	NP_001257330.1|NP_068811.1	P28702	RXRB_HUMAN	retinoid X receptor, beta	54	Modulating. {ECO:0000250}.				cardiac muscle cell proliferation (GO:0060038)|cellular response to retinoic acid (GO:0071300)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|maternal placenta development (GO:0001893)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	9-cis retinoic acid receptor activity (GO:0004886)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(1)|skin(2)	15					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Tazarotene(DB00799)|Tretinoin(DB00755)	TCTccgcctgccaccgccgcc	0.741																																																	0													4.0	6.0	5.0					6																	33168094		1357	2451	3808	SO:0001589	frameshift_variant	6257			M84820	CCDS4768.1, CCDS59007.1	6p21.3	2013-01-16			ENSG00000204231	ENSG00000204231		"""Nuclear hormone receptors"""	10478	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 2"""	180246				8257090	Standard	NM_021976		Approved	NR2B2, H-2RIIBP, RCoR-1	uc003odc.4	P28702	OTTHUMG00000031298	ENST00000374680.3:c.160delG	6.37:g.33168094delC	ENSP00000363812:p.Ala54fs		P28703|Q59G65|Q5JP92|Q5STQ1	Frame_Shift_Del	DEL	ENST00000374680.3	37	CCDS4768.1																																																																																				0.741	RXRB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076642.2		NM_021976	
SDK2	54549	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	71429905	71429905	+	Silent	SNP	C	C	T	rs142980422		TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr17:71429905C>T	ENST00000392650.3	-	10	1278	c.1278G>A	c.(1276-1278)tcG>tcA	p.S426S	SDK2_ENST00000388726.3_Silent_p.S426S	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	426	Ig-like C2-type 5.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.S426S(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						GGGGCGCCCCCGAGGTCTCAC	0.567													C|||	1	0.000199681	0.0	0.0	5008	,	,		17326	0.0		0.001	False		,,,				2504	0.0																1	Substitution - coding silent(1)	kidney(1)											48.0	37.0	41.0					17																	71429905		2203	4300	6503	SO:0001819	synonymous_variant	54549			AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.1278G>A	17.37:g.71429905C>T			A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Silent	SNP	ENST00000392650.3	37	CCDS45769.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	10.20	1.283614	0.23392	.	.	ENSG00000069188	ENST00000416616	.	.	.	4.8	0.197	0.15164	.	.	.	.	.	T	0.42200	0.1192	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.24693	-1.0153	4	.	.	.	.	1.916	0.03297	0.1267:0.4259:0.1243:0.3231	.	.	.	.	R	331	.	.	G	-	1	0	SDK2	68941500	0.001000	0.12720	0.999000	0.59377	0.931000	0.56810	-1.934000	0.01552	0.181000	0.19994	-0.379000	0.06801	GGG		0.567	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2		NM_019064	
SEC63	11231	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	108227661	108227661	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr6:108227661G>A	ENST00000369002.4	-	10	1131	c.952C>T	c.(952-954)Ctt>Ttt	p.L318F		NM_007214.4	NP_009145.1	Q9UGP8	SEC63_HUMAN	SEC63 homolog (S. cerevisiae)	318	SEC63 1.				liver development (GO:0001889)|multicellular organismal aging (GO:0010259)|nitrogen compound metabolic process (GO:0006807)|posttranslational protein targeting to membrane (GO:0006620)|posttranslational protein targeting to membrane, translocation (GO:0031204)|protein targeting to membrane (GO:0006612)|renal system development (GO:0072001)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)	p.L318F(1)		endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(87;5.35e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0294)		BRCA - Breast invasive adenocarcinoma(108;0.0079)|Epithelial(106;0.0356)|all cancers(137;0.0525)|OV - Ovarian serous cystadenocarcinoma(136;0.054)		CCTTCTTCAAGGGTCTCAGGA	0.393																																																	1	Substitution - Missense(1)	kidney(1)											108.0	114.0	112.0					6																	108227661		2203	4300	6503	SO:0001583	missense	11231			BC048287	CCDS5061.1	6q21	2011-09-05	2006-09-12		ENSG00000025796	ENSG00000025796		"""Heat shock proteins / DNAJ (HSP40)"""	21082	protein-coding gene	gene with protein product		608648	"""SEC63-like (S. cerevisiae)"""			10219736, 10543453	Standard	NM_007214		Approved	SEC63L, PRO2507, ERdj2, DNAJC23	uc003psc.4	Q9UGP8	OTTHUMG00000015316	ENST00000369002.4:c.952C>T	6.37:g.108227661G>A	ENSP00000357998:p.Leu318Phe		O95380|Q5THN4|Q86VS9|Q8IWL0|Q9NTE0	Missense_Mutation	SNP	ENST00000369002.4	37	CCDS5061.1	.	.	.	.	.	.	.	.	.	.	G	19.35	3.810832	0.70797	.	.	ENSG00000025796	ENST00000369002;ENST00000423697	T	0.73152	-0.72	5.36	5.36	0.76844	Sec63 domain (3);	0.064410	0.64402	D	0.000011	T	0.79569	0.4468	M	0.76170	2.325	0.58432	D	0.999999	D;D	0.71674	0.998;0.993	D;D	0.78314	0.991;0.911	T	0.81602	-0.0858	10	0.72032	D	0.01	-12.9498	12.7673	0.57399	0.0755:0.0:0.9245:0.0	.	318;318	Q9UGP8;B3KQF0	SEC63_HUMAN;.	F	318;178	ENSP00000357998:L318F	ENSP00000357998:L318F	L	-	1	0	SEC63	108334354	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.988000	0.49386	2.663000	0.90544	0.467000	0.42956	CTT		0.393	SEC63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041705.4		NM_007214	
SERPINE2	5270	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	224866441	224866441	+	Silent	SNP	C	C	T			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr2:224866441C>T	ENST00000258405.4	-	2	419	c.177G>A	c.(175-177)gcG>gcA	p.A59A	SERPINE2_ENST00000409304.1_Silent_p.A59A|SERPINE2_ENST00000447280.2_Silent_p.A71A|SERPINE2_ENST00000409840.3_Silent_p.A59A	NM_001136528.1|NM_006216.3	NP_001130000.1|NP_006207.1	P07093	GDN_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2	59					blood coagulation (GO:0007596)|cerebellar granular layer morphogenesis (GO:0021683)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|innervation (GO:0060384)|long-term synaptic potentiation (GO:0060291)|mating plug formation (GO:0042628)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of plasminogen activation (GO:0010757)|negative regulation of platelet activation (GO:0010544)|negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein processing (GO:0010955)|negative regulation of proteolysis (GO:0045861)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of sodium ion transport (GO:0010766)|positive regulation of astrocyte differentiation (GO:0048711)|regulation of cell migration (GO:0030334)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of timing of cell differentiation (GO:0048505)|secretion by cell (GO:0032940)|secretory granule organization (GO:0033363)|seminal vesicle epithelium development (GO:0061108)	cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extrinsic component of external side of plasma membrane (GO:0031232)|neuromuscular junction (GO:0031594)|platelet alpha granule (GO:0031091)|vesicle (GO:0031982)	glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.A59A(1)|p.A71A(1)		breast(2)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)	17		Renal(207;0.025)|all_lung(227;0.0586)|Lung NSC(271;0.0682)|all_hematologic(139;0.0797)		Epithelial(121;5.68e-10)|all cancers(144;1.9e-07)|Lung(261;0.0088)|LUSC - Lung squamous cell carcinoma(224;0.00902)		CCAGGACCGACGCAATCCCAT	0.562																																																	2	Substitution - coding silent(2)	kidney(2)											100.0	92.0	95.0					2																	224866441		2203	4300	6503	SO:0001819	synonymous_variant	5270			M17783	CCDS2460.1, CCDS46525.1, CCDS46526.1	2q36.1	2014-02-18	2005-08-18		ENSG00000135919	ENSG00000135919		"""Serine (or cysteine) peptidase inhibitors"""	8951	protein-coding gene	gene with protein product	"""glial-derived nexin 1"""	177010	"""serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2"""	PI7		7665170, 24172014	Standard	NM_006216		Approved	PN1, GDN, PNI, nexin	uc002vnu.2	P07093	OTTHUMG00000133163	ENST00000258405.4:c.177G>A	2.37:g.224866441C>T			B2R6A4|B4DIF2|Q53S15|Q5D0C4	Silent	SNP	ENST00000258405.4	37	CCDS2460.1																																																																																				0.562	SERPINE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256865.2		NM_006216	
SLC22A4	6583	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	131671519	131671519	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr5:131671519T>A	ENST00000200652.3	+	8	1444	c.1270T>A	c.(1270-1272)Ttc>Atc	p.F424I	AC034220.3_ENST00000437091.1_RNA|AC034220.3_ENST00000417795.1_RNA	NM_003059.2	NP_003050.2	Q9H015	S22A4_HUMAN	solute carrier family 22 (organic cation/zwitterion transporter), member 4	424					body fluid secretion (GO:0007589)|carnitine metabolic process (GO:0009437)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cation transmembrane transport (GO:0098655)|organic cation transport (GO:0015695)|quaternary ammonium group transport (GO:0015697)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|triglyceride metabolic process (GO:0006641)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|carnitine transmembrane transporter activity (GO:0015226)|cation:cation antiporter activity (GO:0015491)|nucleotide binding (GO:0000166)|PDZ domain binding (GO:0030165)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|secondary active organic cation transmembrane transporter activity (GO:0008513)|symporter activity (GO:0015293)	p.F424I(1)		endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|urinary_tract(1)	16		all_cancers(142;0.0752)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Amiloride(DB00594)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Choline(DB00122)|Cimetidine(DB00501)|Clonidine(DB00575)|Desipramine(DB01151)|Guanidine(DB00536)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|L-Arginine(DB00125)|L-Carnitine(DB00583)|L-Lysine(DB00123)|Levofloxacin(DB01137)|Mepyramine(DB06691)|Nicotine(DB00184)|Ofloxacin(DB01165)|Procainamide(DB01035)|Quinidine(DB00908)|Quinine(DB00468)|Spermine(DB00127)|Testosterone(DB00624)|Tiotropium(DB01409)|Verapamil(DB00661)	AGATTATTACTTCTTATCCAT	0.408																																																	1	Substitution - Missense(1)	kidney(1)											187.0	190.0	189.0					5																	131671519		2203	4300	6503	SO:0001583	missense	6583			AB007448	CCDS4153.1	5q23.3	2013-07-18	2013-07-18		ENSG00000197208	ENSG00000197208		"""Solute carriers"""	10968	protein-coding gene	gene with protein product		604190	"""solute carrier family 22 (organic cation/ergothioneine transporter), member 4"""			9426230, 15795384	Standard	NM_003059		Approved	OCTN1, MGC34546	uc003kwq.3	Q9H015	OTTHUMG00000059648	ENST00000200652.3:c.1270T>A	5.37:g.131671519T>A	ENSP00000200652:p.Phe424Ile		O14546	Missense_Mutation	SNP	ENST00000200652.3	37	CCDS4153.1	.	.	.	.	.	.	.	.	.	.	T	5.030	0.191140	0.09547	.	.	ENSG00000197208	ENST00000200652	T	0.57595	0.39	5.33	1.37	0.22104	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.678925	0.15860	N	0.241067	T	0.23532	0.0569	N	0.03917	-0.325	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.19484	-1.0304	10	0.18710	T	0.47	.	6.5722	0.22545	0.3186:0.0:0.392:0.2894	.	424	Q9H015	S22A4_HUMAN	I	424	ENSP00000200652:F424I	ENSP00000200652:F424I	F	+	1	0	SLC22A4	131699418	0.000000	0.05858	0.475000	0.27278	0.385000	0.30292	-0.425000	0.07017	0.002000	0.14630	0.519000	0.50382	TTC		0.408	SLC22A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132661.1		NM_003059	
SLC7A3	84889	broad.mit.edu;hgsc.bcm.edu	37	X	70148386	70148386	+	Silent	SNP	G	G	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chrX:70148386G>A	ENST00000374299.3	-	4	771	c.627C>T	c.(625-627)ttC>ttT	p.F209F	SLC7A3_ENST00000298085.4_Silent_p.F209F			Q8WY07	CTR3_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 3	209					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	arginine transmembrane transporter activity (GO:0015181)|L-lysine transmembrane transporter activity (GO:0015189)	p.F209F(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(9)|ovary(1)|urinary_tract(1)	31	Renal(35;0.156)				L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	CCCCCTTAACGAAGCCAGAGA	0.512																																																	1	Substitution - coding silent(1)	kidney(1)											67.0	48.0	55.0					X																	70148386		2203	4300	6503	SO:0001819	synonymous_variant	84889			AF320612	CCDS14404.1	Xq12	2013-05-22			ENSG00000165349	ENSG00000165349		"""Solute carriers"""	11061	protein-coding gene	gene with protein product		300443				11591158	Standard	NM_001048164		Approved	CAT-3, ATRC3, FLJ14541	uc004dyn.3	Q8WY07	OTTHUMG00000021780	ENST00000374299.3:c.627C>T	X.37:g.70148386G>A			D3DVU7|Q5JQR2|Q8N185|Q8NCA7|Q96SZ7	Silent	SNP	ENST00000374299.3	37	CCDS14404.1																																																																																				0.512	SLC7A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057080.1		NM_032803	
SSH2	85464	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	27999019	27999019	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr17:27999019T>G	ENST00000269033.3	-	8	813	c.662A>C	c.(661-663)aAt>aCt	p.N221T	SSH2_ENST00000540801.1_Missense_Mutation_p.N248T|SSH2_ENST00000324677.7_5'Flank|RP11-68I3.2_ENST00000581474.1_RNA	NM_001282129.1|NM_033389.2	NP_001269058.1|NP_203747.2	Q76I76	SSH2_HUMAN	slingshot protein phosphatase 2	221					actin cytoskeleton organization (GO:0030036)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.N221T(1)	SSH2/SUZ12(2)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						ATTCCATTCATTGACTGAGGA	0.468																																																	1	Substitution - Missense(1)	kidney(1)											243.0	201.0	216.0					17																	27999019		2203	4300	6503	SO:0001583	missense	85464			AB072359	CCDS11253.1, CCDS74024.1	17q11.2	2013-03-05	2013-03-05		ENSG00000141298	ENSG00000141298		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30580	protein-coding gene	gene with protein product		606779	"""slingshot homolog 2 (Drosophila)"""			11832213, 11214970	Standard	XM_005258059		Approved	KIAA1725	uc002heo.1	Q76I76	OTTHUMG00000132752	ENST00000269033.3:c.662A>C	17.37:g.27999019T>G	ENSP00000269033:p.Asn221Thr		Q8TDB5|Q8WYL1|Q8WYL2|Q96F40|Q96H36|Q9C0D8	Missense_Mutation	SNP	ENST00000269033.3	37	CCDS11253.1	.	.	.	.	.	.	.	.	.	.	T	19.95	3.920932	0.73213	.	.	ENSG00000141298	ENST00000269033;ENST00000540801;ENST00000394848	T;T	0.38887	1.11;1.11	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.50188	0.1601	M	0.75615	2.305	0.80722	D	1	B;P;B	0.35575	0.118;0.51;0.03	B;B;B	0.39152	0.16;0.292;0.077	T	0.56117	-0.8032	10	0.87932	D	0	-17.4523	15.8991	0.79359	0.0:0.0:0.0:1.0	.	248;221;221	F5H527;Q76I76-4;Q76I76	.;.;SSH2_HUMAN	T	221;248;221	ENSP00000269033:N221T;ENSP00000444743:N248T	ENSP00000269033:N221T	N	-	2	0	SSH2	25023145	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.023000	0.88764	2.151000	0.67156	0.421000	0.28195	AAT		0.468	SSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256116.1		NM_033389	
TAS1R2	80834	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	19167003	19167003	+	Missense_Mutation	SNP	G	G	A	rs201628216		TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr1:19167003G>A	ENST00000375371.3	-	6	1631	c.1610C>T	c.(1609-1611)gCc>gTc	p.A537V		NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	537					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)	p.A537V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	ATTCGGGCAGGCCTGGCATTC	0.587																																																	1	Substitution - Missense(1)	kidney(1)											46.0	49.0	48.0					1																	19167003		2203	4299	6502	SO:0001583	missense	80834				CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.1610C>T	1.37:g.19167003G>A	ENSP00000364520:p.Ala537Val		Q5TZ19	Missense_Mutation	SNP	ENST00000375371.3	37	CCDS187.1	.	.	.	.	.	.	.	.	.	.	G	10.46	1.356892	0.24598	.	.	ENSG00000179002	ENST00000375371	D	0.89875	-2.58	5.48	2.28	0.28536	GPCR, family 3, conserved site (1);GPCR, family 3, nine cysteines domain (1);	1.068390	0.07306	N	0.874991	T	0.80859	0.4704	N	0.21324	0.655	0.09310	N	1	B	0.30146	0.27	B	0.28916	0.096	T	0.68907	-0.5285	10	0.31617	T	0.26	.	8.026	0.30438	0.0827:0.0:0.6877:0.2296	.	537	Q8TE23	TS1R2_HUMAN	V	537	ENSP00000364520:A537V	ENSP00000364520:A537V	A	-	2	0	TAS1R2	19039590	0.000000	0.05858	0.996000	0.52242	0.078000	0.17371	0.243000	0.18106	1.321000	0.45227	-0.140000	0.14226	GCC		0.587	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000006953.1			
TEX11	56159	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	69825332	69825332	+	Silent	SNP	C	C	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chrX:69825332C>A	ENST00000395889.2	-	25	2186	c.2031G>T	c.(2029-2031)ctG>ctT	p.L677L	TEX11_ENST00000374333.2_Silent_p.L662L|TEX11_ENST00000344304.3_Silent_p.L677L|TEX11_ENST00000374320.2_Silent_p.L352L	NM_001003811.1	NP_001003811.1	Q8IYF3	TEX11_HUMAN	testis expressed 11	677					chiasma assembly (GO:0051026)|fertilization (GO:0009566)|male gonad development (GO:0008584)|male meiosis chromosome segregation (GO:0007060)|meiotic gene conversion (GO:0006311)|negative regulation of apoptotic process (GO:0043066)|reciprocal meiotic recombination (GO:0007131)|resolution of meiotic recombination intermediates (GO:0000712)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)		p.L662L(1)		breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(13)|ovary(3)|prostate(3)|skin(3)	48	Renal(35;0.156)					TCCGTGCAATCAGAATTACTT	0.388																																																	1	Substitution - coding silent(1)	kidney(1)											117.0	96.0	103.0					X																	69825332		2203	4300	6503	SO:0001819	synonymous_variant	56159			AF285594	CCDS35323.1, CCDS43968.1	Xp11	2008-02-05	2007-03-13		ENSG00000120498	ENSG00000120498			11733	protein-coding gene	gene with protein product		300311	"""testis expressed sequence 11"""			11279525	Standard	NM_001003811		Approved	TSGA3, TGC1	uc004dyl.3	Q8IYF3	OTTHUMG00000021782	ENST00000395889.2:c.2031G>T	X.37:g.69825332C>A			A8K8V6|Q5JQQ8|Q96LZ4|Q96M47|Q9BXU6	Silent	SNP	ENST00000395889.2	37	CCDS35323.1																																																																																				0.388	TEX11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359072.1			
THBS1	7057	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	39877708	39877708	+	Missense_Mutation	SNP	T	T	C	rs367660638		TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr15:39877708T>C	ENST00000260356.5	+	7	1229	c.1064T>C	c.(1063-1065)aTc>aCc	p.I355T		NM_003246.2	NP_003237.2	P07996	TSP1_HUMAN	thrombospondin 1	355	VWFC. {ECO:0000255|PROSITE- ProRule:PRU00220}.				activation of MAPK activity (GO:0000187)|behavioral response to pain (GO:0048266)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to tumor necrosis factor (GO:0071356)|chronic inflammatory response (GO:0002544)|endocardial cushion development (GO:0003197)|engulfment of apoptotic cell (GO:0043652)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|immune response (GO:0006955)|negative regulation of angiogenesis (GO:0016525)|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002581)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cGMP-mediated signaling (GO:0010754)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell antigen processing and presentation (GO:0002605)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of plasminogen activation (GO:0010757)|outflow tract morphogenesis (GO:0003151)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of translation (GO:0045727)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to magnesium ion (GO:0032026)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|response to unfolded protein (GO:0006986)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|sarcoplasmic reticulum (GO:0016529)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|collagen V binding (GO:0070052)|fibrinogen binding (GO:0070051)|fibroblast growth factor binding (GO:0017134)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|proteoglycan binding (GO:0043394)|transforming growth factor beta binding (GO:0050431)	p.I355T(1)		breast(1)|central_nervous_system(3)|endometrium(8)|kidney(5)|large_intestine(15)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	53		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)		TCCTGCCCCATCATGCCCTGC	0.498																																																	1	Substitution - Missense(1)	kidney(1)						T	THR/ILE	0,4400		0,0,2200	255.0	168.0	198.0		1064	5.9	1.0	15		198	2,8592	2.2+/-6.3	0,2,4295	no	missense	THBS1	NM_003246.2	89	0,2,6495	CC,CT,TT		0.0233,0.0,0.0154	benign	355/1171	39877708	2,12992	2200	4297	6497	SO:0001583	missense	7057				CCDS32194.1	15q15	2009-04-08			ENSG00000137801	ENSG00000137801			11785	protein-coding gene	gene with protein product	"""thrombospondin-1p180"""	188060				2341158, 2335352	Standard	NM_003246		Approved	TSP1, THBS, TSP, THBS-1, TSP-1	uc001zkh.3	P07996	OTTHUMG00000133665	ENST00000260356.5:c.1064T>C	15.37:g.39877708T>C	ENSP00000260356:p.Ile355Thr		A8K6H4|B4E3J7|B9EGH6|Q15667|Q59E99	Missense_Mutation	SNP	ENST00000260356.5	37	CCDS32194.1	.	.	.	.	.	.	.	.	.	.	T	14.66	2.600336	0.46423	0.0	2.33E-4	ENSG00000137801	ENST00000260356	T	0.70986	-0.53	5.86	5.86	0.93980	von Willebrand factor, type C (4);	0.000000	0.34002	N	0.004355	T	0.52484	0.1737	N	0.04787	-0.16	0.38880	D	0.956883	B	0.23185	0.081	B	0.27887	0.084	T	0.53344	-0.8452	10	0.27785	T	0.31	-14.8671	15.4256	0.75048	0.0:0.0:0.0:1.0	.	355	P07996	TSP1_HUMAN	T	355	ENSP00000260356:I355T	ENSP00000260356:I355T	I	+	2	0	THBS1	37665000	1.000000	0.71417	0.983000	0.44433	0.992000	0.81027	5.159000	0.64923	2.237000	0.73441	0.533000	0.62120	ATC		0.498	THBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257831.2		NM_003246	
TMEM165	55858	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	56277929	56277929	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr4:56277929T>C	ENST00000381334.5	+	2	589	c.356T>C	c.(355-357)aTc>aCc	p.I119T	TMEM165_ENST00000542052.1_Missense_Mutation_p.I56T|TMEM165_ENST00000506198.1_Intron|Y_RNA_ENST00000459077.1_RNA	NM_018475.4	NP_060945.2	Q9HC07	TM165_HUMAN	transmembrane protein 165	119					cellular calcium ion homeostasis (GO:0006874)|Golgi calcium ion transport (GO:0032472)|protein N-linked glycosylation (GO:0006487)|regulation of lysosomal lumen pH (GO:0035751)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)		p.I119T(1)		endometrium(1)|kidney(1)|large_intestine(2)	4	Lung NSC(11;0.00545)|Glioma(25;0.08)|all_neural(26;0.101)|all_epithelial(27;0.135)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0103)			ATAGCAGCCATCATGGCAATG	0.443																																																	1	Substitution - Missense(1)	kidney(1)											119.0	102.0	108.0					4																	56277929		2203	4300	6503	SO:0001583	missense	55858			AF183409	CCDS3499.1	4q12	2014-03-13			ENSG00000134851	ENSG00000134851			30760	protein-coding gene	gene with protein product	"""TPA regulated locus"""	614726				3202867, 22683087, 23575229	Standard	NM_018475		Approved	TMPT27, TPARL, GDT1	uc003hax.3	Q9HC07	OTTHUMG00000128735	ENST00000381334.5:c.356T>C	4.37:g.56277929T>C	ENSP00000370736:p.Ile119Thr		A8K3P8|B4DHW1|Q9BTN9|Q9NZ34	Missense_Mutation	SNP	ENST00000381334.5	37	CCDS3499.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.431414	0.83776	.	.	ENSG00000134851	ENST00000381334;ENST00000542052	D;D	0.82344	-1.6;-1.6	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.88470	0.6445	L	0.51422	1.61	0.80722	D	1	D;D	0.89917	0.995;1.0	D;D	0.97110	0.951;1.0	D	0.88293	0.2944	10	0.46703	T	0.11	-18.7599	15.6016	0.76628	0.0:0.0:0.0:1.0	.	56;119	B4DHW1;Q9HC07	.;TM165_HUMAN	T	119;56	ENSP00000370736:I119T;ENSP00000437816:I56T	ENSP00000370736:I119T	I	+	2	0	TMEM165	55972686	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.492000	0.81482	2.258000	0.74832	0.533000	0.62120	ATC		0.443	TMEM165-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250646.4		NM_018475	
TMX3	54495	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	66367641	66367641	+	Splice_Site	SNP	C	C	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr18:66367641C>A	ENST00000299608.2	-	6	709		c.e6+1		TMX3_ENST00000443099.2_Intron|TMX3_ENST00000562706.1_Splice_Site	NM_019022.3	NP_061895.3	Q96JJ7	TMX3_HUMAN	thioredoxin-related transmembrane protein 3						cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)	p.?(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	17						TAATAACTTACCCAGATACTC	0.264																																																	1	Unknown(1)	kidney(1)											85.0	90.0	89.0					18																	66367641		2202	4286	6488	SO:0001630	splice_region_variant	54495			BX647846	CCDS32840.1	18q22	2011-10-19	2009-02-23	2009-02-23		ENSG00000166479		"""Protein disulfide isomerases"""	24718	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 13"""		"""thioredoxin domain containing 10"""	TXNDC10		15623505	Standard	NM_019022		Approved	FLJ20793, KIAA1830, PDIA13	uc002lkf.3	Q96JJ7		ENST00000299608.2:c.392+1G>T	18.37:g.66367641C>A			B3KV75|Q52LT7|Q8N5J0|Q9NWJ9	Splice_Site	SNP	ENST00000299608.2	37	CCDS32840.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.174217	0.78452	.	.	ENSG00000166479	ENST00000299608;ENST00000544714	.	.	.	5.99	5.99	0.97316	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0212	0.92916	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TMX3	64518621	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.719000	0.84751	2.843000	0.97960	0.591000	0.81541	.		0.264	TMX3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420155.1		NM_019022	Intron
TNC	3371	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	117840239	117840239	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr9:117840239T>A	ENST00000350763.4	-	7	3068	c.2657A>T	c.(2656-2658)aAa>aTa	p.K886I	TNC_ENST00000535648.1_Missense_Mutation_p.K886I|TNC_ENST00000345230.3_Missense_Mutation_p.K886I|TNC_ENST00000340094.3_Missense_Mutation_p.K886I|TNC_ENST00000537320.1_Missense_Mutation_p.K886I|TNC_ENST00000346706.3_Missense_Mutation_p.K886I|TNC_ENST00000341037.4_Missense_Mutation_p.K886I|TNC_ENST00000423613.2_Missense_Mutation_p.K886I|TNC_ENST00000542877.1_Missense_Mutation_p.K886I	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	886	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)	p.K886I(1)		NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						GAAGGTCTCTTTGGCTGGGTT	0.498																																																	1	Substitution - Missense(1)	kidney(1)											127.0	109.0	115.0					9																	117840239		2203	4300	6503	SO:0001583	missense	3371				CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.2657A>T	9.37:g.117840239T>A	ENSP00000265131:p.Lys886Ile		C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Missense_Mutation	SNP	ENST00000350763.4	37	CCDS6811.1	.	.	.	.	.	.	.	.	.	.	T	13.56	2.274612	0.40194	.	.	ENSG00000041982	ENST00000340094;ENST00000535648;ENST00000346706;ENST00000345230;ENST00000350763;ENST00000442945;ENST00000341037;ENST00000423613;ENST00000537320;ENST00000542877	T;T;T;T;T;T;T;T;T	0.53423	0.62;3.66;0.87;3.66;3.66;3.66;3.66;3.66;3.66	5.48	1.73	0.24493	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.491231	0.23748	N	0.044945	T	0.27629	0.0679	N	0.16903	0.455	0.30103	N	0.807281	B;B	0.22211	0.066;0.003	B;B	0.20184	0.028;0.011	T	0.13872	-1.0493	10	0.52906	T	0.07	.	6.4719	0.22013	0.0:0.1374:0.3759:0.4866	.	886;886	E9PC84;P24821	.;TENA_HUMAN	I	886	ENSP00000344400:K886I;ENSP00000438152:K886I;ENSP00000344555:K886I;ENSP00000345861:K886I;ENSP00000265131:K886I;ENSP00000339553:K886I;ENSP00000411406:K886I;ENSP00000443478:K886I;ENSP00000442242:K886I	ENSP00000344400:K886I	K	-	2	0	TNC	116880060	0.005000	0.15991	0.990000	0.47175	0.817000	0.46193	-0.065000	0.11617	0.104000	0.17725	0.533000	0.62120	AAA		0.498	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055418.2		NM_002160	
LOC101929232	101929232	broad.mit.edu	37	15	29083900	29083900	+	IGR	SNP	A	A	G			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr15:29083900A>G								RP11-578F21.12 (30456 upstream) : GOLGA6L7P (6206 downstream)																							AAAAATGAAGACGAAACTCCT	0.413																																																	0																																										SO:0001628	intergenic_variant	0																															15.37:g.29083900A>G				RNA	SNP		37																																																																																				0	0.413									
VHL	7428	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	10191611	10191612	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	AC	AC	AC	-	AC	AC	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr3:10191611_10191612delAC	ENST00000256474.2	+	3	1444_1445	c.604_605delAC	c.(604-606)acafs	p.T202fs	VHL_ENST00000345392.2_Frame_Shift_Del_p.T161fs|VHL_ENST00000477538.1_3'UTR	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	202					cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.T202fs*11(1)|p.E199fs*14(1)|p.L198fs*11(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GGAGCGGCTGACACAGGAGCGC	0.475		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	3	Deletion - Frameshift(3)	kidney(3)																																								SO:0001589	frameshift_variant	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.604_605delAC	3.37:g.10191613_10191614delAC	ENSP00000256474:p.Thr202fs		B2RE45|Q13599|Q6PDA9	Frame_Shift_Del	DEL	ENST00000256474.2	37	CCDS2597.1																																																																																				0.475	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
ZBTB41	360023	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	197159944	197159944	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr1:197159944G>T	ENST00000367405.4	-	3	1414	c.1346C>A	c.(1345-1347)gCa>gAa	p.A449E	ZBTB41_ENST00000467322.1_5'UTR	NM_194314.2	NP_919290.2	Q5SVQ8	ZBT41_HUMAN	zinc finger and BTB domain containing 41	449					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A449E(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(11)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	40						AAATTCTTGTGCATTTTCAGG	0.264																																																	1	Substitution - Missense(1)	kidney(1)											35.0	36.0	36.0					1																	197159944		2190	4270	6460	SO:0001583	missense	360023				CCDS30960.1	1q31.3	2013-01-08			ENSG00000177888	ENSG00000177888		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	24819	protein-coding gene	gene with protein product							Standard	NM_194314		Approved	FRBZ1, FLJ36199, DKFZp686C06120, ZNF924	uc001gtx.1	Q5SVQ8	OTTHUMG00000036275	ENST00000367405.4:c.1346C>A	1.37:g.197159944G>T	ENSP00000356375:p.Ala449Glu		A2RUA8|Q6MZT8|Q6ZR25|Q7Z4T1|Q8IZ99	Missense_Mutation	SNP	ENST00000367405.4	37	CCDS30960.1	.	.	.	.	.	.	.	.	.	.	G	15.78	2.934113	0.52866	.	.	ENSG00000177888	ENST00000367405	T	0.05447	3.44	5.89	4.98	0.66077	Zinc finger, C2H2 (1);	0.530450	0.15296	N	0.269888	T	0.05547	0.0146	N	0.25286	0.73	0.34264	D	0.680194	B	0.34214	0.442	B	0.34991	0.193	T	0.16364	-1.0405	10	0.62326	D	0.03	.	9.0674	0.36471	0.1602:0.0:0.8398:0.0	.	449	Q5SVQ8	ZBT41_HUMAN	E	449	ENSP00000356375:A449E	ENSP00000356375:A449E	A	-	2	0	ZBTB41	195426567	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.935000	0.56560	2.801000	0.96364	0.650000	0.86243	GCA		0.264	ZBTB41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088249.2		NM_194314	
ZFYVE26	23503	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	68270971	68270971	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr14:68270971G>T	ENST00000347230.4	-	9	1420	c.1282C>A	c.(1282-1284)Cca>Aca	p.P428T	ZFYVE26_ENST00000555452.1_Missense_Mutation_p.P428T	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	428					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)	p.P428T(1)		NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		TCTCTCTTTGGTATGGGGTTG	0.458																																																	1	Substitution - Missense(1)	kidney(1)											121.0	99.0	106.0					14																	68270971		2203	4300	6503	SO:0001583	missense	23503			AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.1282C>A	14.37:g.68270971G>T	ENSP00000251119:p.Pro428Thr		B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	ENST00000347230.4	37	CCDS9788.1	.	.	.	.	.	.	.	.	.	.	G	12.20	1.865336	0.32977	.	.	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000555452	T;T	0.28895	1.74;1.59	5.79	4.89	0.63831	.	0.170976	0.52532	D	0.000067	T	0.49508	0.1561	L	0.52364	1.645	0.44880	D	0.997892	D;D;B	0.69078	0.997;0.997;0.18	D;D;B	0.65443	0.935;0.913;0.03	T	0.52675	-0.8544	10	0.72032	D	0.01	-6.8101	16.7919	0.85591	0.0:0.129:0.871:0.0	.	428;428;428	Q68DK2-4;G3V2D8;Q68DK2	.;.;ZFY26_HUMAN	T	428;407;428	ENSP00000251119:P428T;ENSP00000450603:P428T	ENSP00000251119:P428T	P	-	1	0	ZFYVE26	67340724	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.293000	0.51779	1.438000	0.47492	0.561000	0.74099	CCA		0.458	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2		NM_015346	
ZNF782	158431	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	99581317	99581317	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4977-01A-01D-1462-08	TCGA-BP-4977-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7c3bf7c1-07d9-4540-9a5e-614fd60b63ec	1a98cd70-7661-4e02-8d83-30b08d24ceac	g.chr9:99581317T>C	ENST00000481138.1	-	6	1649	c.988A>G	c.(988-990)Aga>Gga	p.R330G	ZNF782_ENST00000466833.1_5'Flank|ZNF782_ENST00000535338.1_Missense_Mutation_p.R198G	NM_001001662.1	NP_001001662.1	Q6ZMW2	ZN782_HUMAN	zinc finger protein 782	330					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R330G(1)		NS(1)|endometrium(2)|kidney(2)|large_intestine(12)|lung(8)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)	33		Acute lymphoblastic leukemia(62;0.0527)				GCATGAGTTCTCTGATGCACT	0.398																																																	1	Substitution - Missense(1)	kidney(1)											140.0	132.0	135.0					9																	99581317		2203	4300	6503	SO:0001583	missense	158431			AK131468	CCDS35075.1	9q22.33	2013-01-08			ENSG00000196597	ENSG00000196597		"""Zinc fingers, C2H2-type"", ""-"""	33110	protein-coding gene	gene with protein product							Standard	NM_001001662		Approved	FLJ16636	uc004awp.1	Q6ZMW2	OTTHUMG00000020310	ENST00000481138.1:c.988A>G	9.37:g.99581317T>C	ENSP00000419397:p.Arg330Gly		B2RNR0	Missense_Mutation	SNP	ENST00000481138.1	37	CCDS35075.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.81|10.81	1.454305|1.454305	0.26161|0.26161	.|.	.|.	ENSG00000196597|ENSG00000196597	ENST00000289032|ENST00000481138;ENST00000535338	.|T;T	.|0.19105	.|2.17;2.17	3.52|3.52	1.2|1.2	0.21068|0.21068	.|Zinc finger, C2H2-type/integrase, DNA-binding (1);	.|0.742875	.|0.11080	.|N	.|0.601902	T|T	0.18215|0.18215	0.0437|0.0437	L|L	0.55834|0.55834	1.745|1.745	0.22366|0.22366	N|N	0.999161|0.999161	.|B	.|0.06786	.|0.001	.|B	.|0.01281	.|0.0	T|T	0.28170|0.28170	-1.0052|-1.0052	5|9	.|.	.|.	.|.	.|.	6.6217|6.6217	0.22806|0.22806	0.0:0.2143:0.0:0.7857|0.0:0.2143:0.0:0.7857	.|.	.|330	.|Q6ZMW2	.|ZN782_HUMAN	G|G	318|330;198	.|ENSP00000419397:R330G;ENSP00000440624:R198G	.|.	E|R	-|-	2|1	0|2	ZNF782|ZNF782	98621138|98621138	0.000000|0.000000	0.05858|0.05858	0.014000|0.014000	0.15608|0.15608	0.011000|0.011000	0.07611|0.07611	-0.388000|-0.388000	0.07352|0.07352	0.247000|0.247000	0.21414|0.21414	-0.287000|-0.287000	0.09952|0.09952	GAG|AGA		0.398	ZNF782-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356810.1		NM_001001662	
