#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
PHYKPL	85007	hgsc.bcm.edu	37	5	177649405	177649406	+	Frame_Shift_Ins	INS	-	-	G	rs147023998		TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr5:177649405_177649406insG	ENST00000308158.5	-	8	1111_1112	c.877_878insC	c.(877-879)cagfs	p.Q293fs	PHYKPL_ENST00000481811.1_Intron	NM_153373.2	NP_699204.1	Q8IUZ5	AT2L2_HUMAN	5-phosphohydroxy-L-lysine phospho-lyase	293						mitochondrion (GO:0005739)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)									L-Alanine(DB00160)	CGCCACAGGCTGGGTTGCGGCC	0.594																																																	0																																										SO:0001589	frameshift_variant	85007			BC037567	CCDS4434.1	5q35.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000175309	ENSG00000175309	4.2.3.134		28249	protein-coding gene	gene with protein product	"""5-phosphonooxy-L-lysine phospho-lyase"""	614683	"""alanine-glyoxylate aminotransferase 2-like 2"""	AGXT2L2		22241472	Standard	NM_153373		Approved	MGC15875	uc003miz.3	Q8IUZ5	OTTHUMG00000130892	ENST00000308158.5:c.878dupC	5.37:g.177649408_177649408dupG	ENSP00000310978:p.Gln293fs		A8K7P6|B3KN36|D3DWP9|Q8WYS6|Q96HW8	Frame_Shift_Ins	INS	ENST00000308158.5	37	CCDS4434.1																																																																																				0.594	PHYKPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253477.1		NM_032921	
AIM1	202	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	107009363	107009363	+	Silent	SNP	T	T	C			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr6:107009363T>C	ENST00000369066.3	+	18	5389	c.4902T>C	c.(4900-4902)tgT>tgC	p.C1634C	AIM1_ENST00000535438.1_Silent_p.C453C	NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)		p.C1634C(1)		breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		AAGAAGGATGTATCAAATGCA	0.453																																																	1	Substitution - coding silent(1)	kidney(1)											96.0	99.0	98.0					6																	107009363		2203	4300	6503	SO:0001819	synonymous_variant	202			U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.4902T>C	6.37:g.107009363T>C			Q6P2P0|Q9BTM3	Silent	SNP	ENST00000369066.3	37	CCDS34506.1																																																																																				0.453	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1			
ARHGAP10	79658	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	148861016	148861016	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr4:148861016T>A	ENST00000336498.3	+	14	1508	c.1269T>A	c.(1267-1269)agT>agA	p.S423R	ARHGAP10_ENST00000414545.2_Missense_Mutation_p.S72R	NM_024605.3	NP_078881.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 10	1188					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)	p.S423R(1)		autonomic_ganglia(2)|endometrium(5)|kidney(2)|large_intestine(4)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	33	all_hematologic(180;0.151)	Renal(17;0.0166)		GBM - Glioblastoma multiforme(119;0.0423)		TGGGGGTGAGTTCAAAGGTCC	0.353																																																	1	Substitution - Missense(1)	kidney(1)											246.0	248.0	248.0					4																	148861016		2203	4300	6503	SO:0001583	missense	79658			BC047914	CCDS34075.1	4q31.23	2013-09-20			ENSG00000071205	ENSG00000071205		"""Rho GTPase activating proteins"""	26099	protein-coding gene	gene with protein product		609746				8288572	Standard	NM_024605		Approved	FLJ20896, FLJ41791, GRAF2	uc003ilf.3	A1A4S6	OTTHUMG00000161460	ENST00000336498.3:c.1269T>A	4.37:g.148861016T>A	ENSP00000336923:p.Ser423Arg		Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	ENST00000336498.3	37	CCDS34075.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	21.8|21.8	4.195472|4.195472	0.78902|0.78902	.|.	.|.	ENSG00000071205|ENSG00000071205	ENST00000507661|ENST00000336498;ENST00000414545	.|T;T	.|0.18174	.|2.23;2.23	5.58|5.58	4.4|4.4	0.53042|0.53042	.|Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	.|0.076080	.|0.85682	.|D	.|0.000000	T|T	0.35248|0.35248	0.0925|0.0925	L|L	0.55481|0.55481	1.735|1.735	0.58432|0.58432	D|D	0.999998|0.999998	.|D;D	.|0.76494	.|0.999;0.971	.|D;P	.|0.83275	.|0.996;0.893	T|T	0.05162|0.05162	-1.0902|-1.0902	5|10	.|0.87932	.|D	.|0	.|.	11.2722|11.2722	0.49147|0.49147	0.0:0.0717:0.0:0.9283|0.0:0.0717:0.0:0.9283	.|.	.|72;423	.|E7EUW5;A1A4S6	.|.;RHG10_HUMAN	I|R	101|423;72	.|ENSP00000336923:S423R;ENSP00000406624:S72R	.|ENSP00000336923:S423R	F|S	+|+	1|3	0|2	ARHGAP10|ARHGAP10	149080466|149080466	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	3.845000|3.845000	0.55880|0.55880	0.956000|0.956000	0.37904|0.37904	0.533000|0.533000	0.62120|0.62120	TTC|AGT		0.353	ARHGAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365005.1		NM_024605	
OTOGL	283310	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	80650146	80650146	+	Silent	SNP	A	A	C			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr12:80650146A>C	ENST00000547103.1	+	16	1596	c.1590A>C	c.(1588-1590)atA>atC	p.I530I	OTOGL_ENST00000458043.2_Silent_p.I530I			Q3ZCN5	OTOGL_HUMAN	otogelin-like	530	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.				L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)	p.I530I(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						TTCAGTCTATAACTCTGATTC	0.428																																																	1	Substitution - coding silent(1)	kidney(1)											88.0	79.0	81.0					12																	80650146		1861	4103	5964	SO:0001819	synonymous_variant	0			AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.1590A>C	12.37:g.80650146A>C			F8W0C3|Q495U8|Q8N8G5|Q8NC28	Silent	SNP	ENST00000547103.1	37																																																																																					0.428	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000407438.1		NM_173591	
BPIFB3	359710	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	31657707	31657707	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr20:31657707G>A	ENST00000375494.3	+	11	1163	c.1163G>A	c.(1162-1164)cGt>cAt	p.R388H		NM_182658.1	NP_872599.1	P59826	BPIB3_HUMAN	BPI fold containing family B, member 3	388					innate immune response (GO:0045087)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)	p.R388H(1)									ATGACTGTGCGTGCCCAGCTG	0.577																																																	1	Substitution - Missense(1)	kidney(1)											251.0	226.0	234.0					20																	31657707		2203	4300	6503	SO:0001583	missense	0			AF549189	CCDS13212.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186190	ENSG00000186190		"""BPI fold containing"""	16178	protein-coding gene	gene with protein product		615717	"""chromosome 20 open reading frame 185"""	C20orf185		11971875, 21787333	Standard	NM_182658		Approved	dJ726C3.4, LPLUNC3, RYA3	uc002wym.1	P59826	OTTHUMG00000032234	ENST00000375494.3:c.1163G>A	20.37:g.31657707G>A	ENSP00000364643:p.Arg388His		Q5TDX7	Missense_Mutation	SNP	ENST00000375494.3	37	CCDS13212.1	.	.	.	.	.	.	.	.	.	.	G	7.398	0.632221	0.14322	.	.	ENSG00000186190	ENST00000375494	T	0.06933	3.24	4.34	2.07	0.26955	.	0.456780	0.20154	N	0.098085	T	0.04770	0.0129	N	0.22421	0.69	0.20975	N	0.999811	P	0.36438	0.553	B	0.33392	0.163	T	0.35649	-0.9780	10	0.44086	T	0.13	-1.5609	4.9289	0.13907	0.7064:0.0:0.2936:0.0	.	388	P59826	BPIB3_HUMAN	H	388	ENSP00000364643:R388H	ENSP00000364643:R388H	R	+	2	0	BPIFB3	31121368	0.805000	0.28982	0.589000	0.28718	0.006000	0.05464	0.840000	0.27600	0.318000	0.23185	0.591000	0.81541	CGT		0.577	BPIFB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078654.2		NM_182658	
C2orf69	205327	hgsc.bcm.edu;ucsc.edu	37	2	200790244	200790244	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr2:200790244delA	ENST00000319974.5	+	2	976	c.793delA	c.(793-795)aaafs	p.K265fs	C2orf69_ENST00000491721.1_Intron	NM_153689.5	NP_710156.3	Q8N8R5	CB069_HUMAN	chromosome 2 open reading frame 69	265						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(2)|stomach(1)|urinary_tract(1)	11						TGGATTCAGTAAAGGTTGTGT	0.348																																																	0													79.0	80.0	80.0					2																	200790244		1849	4092	5941	SO:0001589	frameshift_variant	205327				CCDS46482.1	2q33.1	2008-08-08			ENSG00000178074	ENSG00000178074			26799	protein-coding gene	gene with protein product	"""hypothetical protein FLJ38973"""					12477932	Standard	NM_153689		Approved	FLJ38973	uc010zhb.2	Q8N8R5	OTTHUMG00000154480	ENST00000319974.5:c.793delA	2.37:g.200790244delA	ENSP00000312770:p.Lys265fs		Q8NE30	Frame_Shift_Del	DEL	ENST00000319974.5	37	CCDS46482.1																																																																																				0.348	C2orf69-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335446.1		NM_153689	
CDC42BPB	9578	broad.mit.edu	37	14	103418834	103418834	+	Splice_Site	SNP	C	C	A			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr14:103418834C>A	ENST00000361246.2	-	24	3461		c.e24+1			NM_006035.3	NP_006026.3			CDC42 binding protein kinase beta (DMPK-like)									p.?(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(11)|liver(1)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	49		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		ACGACACTCACCCTCGCAGGC	0.637																																																	1	Unknown(1)	kidney(1)											76.0	67.0	70.0					14																	103418834		2202	4298	6500	SO:0001630	splice_region_variant	9578			AF128625	CCDS9978.1	14q32.32	2010-05-12	2001-11-28		ENSG00000198752	ENSG00000198752			1738	protein-coding gene	gene with protein product		614062	"""CDC42-binding protein kinase beta (DMPK-like)"""			10198171	Standard	NM_006035		Approved	MRCKB, KIAA1124	uc001ymi.1	Q9Y5S2		ENST00000361246.2:c.3172+1G>T	14.37:g.103418834C>A				Splice_Site	SNP	ENST00000361246.2	37	CCDS9978.1	.	.	.	.	.	.	.	.	.	.	C	30	5.049847	0.93740	.	.	ENSG00000198752	ENST00000361246;ENST00000541396	.	.	.	5.66	5.66	0.87406	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.108	0.97899	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CDC42BPB	102488587	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	7.681000	0.84073	2.828000	0.97474	0.655000	0.94253	.		0.637	CDC42BPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415711.1		NM_006035	Intron
CDK5RAP2	55755	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	123292386	123292386	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr9:123292386C>G	ENST00000349780.4	-	8	874	c.695G>C	c.(694-696)aGc>aCc	p.S232T	CDK5RAP2_ENST00000360190.4_Missense_Mutation_p.S232T|CDK5RAP2_ENST00000359309.3_Missense_Mutation_p.S232T|CDK5RAP2_ENST00000360822.3_Missense_Mutation_p.S232T	NM_018249.4	NP_060719.4	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	232					brain development (GO:0007420)|centrosome organization (GO:0051297)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of centriole replication (GO:0046600)|negative regulation of neuron differentiation (GO:0045665)|neurogenesis (GO:0022008)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of spindle checkpoint (GO:0090231)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)	p.S232T(1)		breast(6)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	58						AGCTTCTTTGCTCTTCAAAGA	0.413																																																	1	Substitution - Missense(1)	kidney(1)											118.0	106.0	110.0					9																	123292386		2203	4300	6503	SO:0001583	missense	55755			BK005504	CCDS6823.1, CCDS43871.1, CCDS75888.1	9q33.3	2014-02-21			ENSG00000136861	ENSG00000136861			18672	protein-coding gene	gene with protein product	"""centrosomin"""	608201	"""microcephaly, primary autosomal recessive 3"""	MCPH3		10721722, 17764569, 24466316	Standard	NM_018249		Approved	C48, FLJ10867, CEP215	uc004bkf.4	Q96SN8	OTTHUMG00000021043	ENST00000349780.4:c.695G>C	9.37:g.123292386C>G	ENSP00000343818:p.Ser232Thr		Q5JV18|Q7Z3L4|Q7Z3U1|Q7Z7I6|Q9BSW0|Q9H6J6|Q9HCD9|Q9NV90|Q9UIW9	Missense_Mutation	SNP	ENST00000349780.4	37	CCDS6823.1	.	.	.	.	.	.	.	.	.	.	C	13.41	2.227696	0.39399	.	.	ENSG00000136861	ENST00000360822;ENST00000359309;ENST00000349780;ENST00000360190;ENST00000345313	T;T;T;T	0.03951	3.87;3.75;3.84;3.75	5.3	3.19	0.36642	.	0.287956	0.29995	N	0.010667	T	0.05960	0.0155	L	0.33485	1.01	0.34313	D	0.685692	D;P;B;P	0.54207	0.965;0.932;0.03;0.941	P;P;B;P	0.50970	0.655;0.655;0.03;0.453	T	0.45056	-0.9287	10	0.22109	T	0.4	.	6.8224	0.23864	0.0:0.6793:0.0:0.3207	.	33;232;232;232	Q6MZT4;Q96SN8-2;Q96SN8-4;Q96SN8	.;.;.;CK5P2_HUMAN	T	232;232;232;232;234	ENSP00000354065:S232T;ENSP00000352258:S232T;ENSP00000343818:S232T;ENSP00000353317:S232T	ENSP00000341695:S234T	S	-	2	0	CDK5RAP2	122332207	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.872000	0.39549	1.220000	0.43490	0.563000	0.77884	AGC		0.413	CDK5RAP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055535.1		NM_018249	
CHD7	55636	broad.mit.edu;ucsc.edu	37	8	61768568	61768568	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr8:61768568G>A	ENST00000423902.2	+	33	7450	c.6971G>A	c.(6970-6972)tGt>tAt	p.C2324Y	CHD7_ENST00000524602.1_Intron|CHD7_ENST00000529472.1_3'UTR	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	2324					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.C2324Y(2)		NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			GACAACATCTGTGAAGCAGTG	0.433																																																	2	Substitution - Missense(2)	kidney(2)											39.0	38.0	39.0					8																	61768568		1860	4103	5963	SO:0001583	missense	55636			AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.6971G>A	8.37:g.61768568G>A	ENSP00000392028:p.Cys2324Tyr		D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Missense_Mutation	SNP	ENST00000423902.2	37	CCDS47865.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.027672	0.93518	.	.	ENSG00000171316	ENST00000307121;ENST00000423902	D	0.90676	-2.71	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	D	0.93086	0.7799	M	0.80332	2.49	0.80722	D	1	P	0.38922	0.651	B	0.43575	0.424	D	0.93302	0.6677	10	0.87932	D	0	-10.5943	20.1013	0.97878	0.0:0.0:1.0:0.0	.	2324	Q9P2D1	CHD7_HUMAN	Y	2324	ENSP00000392028:C2324Y	ENSP00000307304:C2324Y	C	+	2	0	CHD7	61931122	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.748000	0.94277	0.655000	0.94253	TGT		0.433	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383468.2		XM_098762	
DPPA3	359787	broad.mit.edu;hgsc.bcm.edu	37	12	7869602	7869602	+	Missense_Mutation	SNP	G	G	A	rs571145972		TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr12:7869602G>A	ENST00000345088.2	+	4	526	c.409G>A	c.(409-411)Gtg>Atg	p.V137M		NM_199286.2	NP_954980.1	Q6W0C5	DPPA3_HUMAN	developmental pluripotency associated 3	137					chromatin modification (GO:0016568)|embryonic cleavage (GO:0040016)|negative regulation of DNA demethylation (GO:1901536)|protection of DNA demethylation of female pronucleus (GO:0044726)|regulation of genetic imprinting (GO:2000653)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)	p.V137M(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(2)	8				Kidney(36;0.0887)		CAGTTTCTGCGTGTCTAATGG	0.378													G|||	1	0.000199681	0.0	0.0	5008	,	,		-128	0.0		0.0	False		,,,				2504	0.001																1	Substitution - Missense(1)	kidney(1)											92.0	97.0	95.0					12																	7869602		2203	4300	6503	SO:0001583	missense	359787			AY317075	CCDS8582.1	12p13.31	2012-10-02			ENSG00000187569	ENSG00000187569			19199	protein-coding gene	gene with protein product		608408					Standard	NM_199286		Approved	Stella	uc001qtf.3	Q6W0C5	OTTHUMG00000168434	ENST00000345088.2:c.409G>A	12.37:g.7869602G>A	ENSP00000339250:p.Val137Met		Q0P5U3|Q6JZS6	Missense_Mutation	SNP	ENST00000345088.2	37	CCDS8582.1	.	.	.	.	.	.	.	.	.	.	G	2.024	-0.423942	0.04734	.	.	ENSG00000187569	ENST00000345088	T	0.45276	0.9	2.45	-0.626	0.11544	.	.	.	.	.	T	0.28764	0.0713	N	0.14661	0.345	0.09310	N	1	D	0.63880	0.993	P	0.49683	0.619	T	0.16482	-1.0401	9	0.41790	T	0.15	.	5.7928	0.18369	0.1712:0.5325:0.2963:0.0	.	137	Q6W0C5	DPPA3_HUMAN	M	137	ENSP00000339250:V137M	ENSP00000339250:V137M	V	+	1	0	DPPA3	7760869	0.022000	0.18835	0.000000	0.03702	0.008000	0.06430	-0.121000	0.10643	-0.160000	0.11002	-0.448000	0.05591	GTG		0.378	DPPA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399718.1		NM_199286	
ESPL1	9700	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	53662902	53662902	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr12:53662902A>G	ENST00000257934.4	+	3	267	c.176A>G	c.(175-177)cAg>cGg	p.Q59R	ESPL1_ENST00000552462.1_Missense_Mutation_p.Q59R	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	59					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)	p.Q59R(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						GCTTGCAACCAGCAGCTGACT	0.577																																					Colon(53;1069 1201 2587 5382)												1	Substitution - Missense(1)	kidney(1)											87.0	81.0	83.0					12																	53662902		2203	4300	6503	SO:0001583	missense	9700			D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.176A>G	12.37:g.53662902A>G	ENSP00000257934:p.Gln59Arg			Missense_Mutation	SNP	ENST00000257934.4	37	CCDS8852.1	.	.	.	.	.	.	.	.	.	.	A	28.0	4.882674	0.91740	.	.	ENSG00000135476	ENST00000257934;ENST00000552462	T;T	0.14640	2.49;2.49	4.81	4.81	0.61882	.	0.139417	0.49305	D	0.000158	T	0.28995	0.0720	M	0.70595	2.14	0.37850	D	0.929346	D	0.57257	0.979	P	0.54270	0.747	T	0.19679	-1.0298	10	0.72032	D	0.01	.	13.7716	0.63029	1.0:0.0:0.0:0.0	.	59	Q14674	ESPL1_HUMAN	R	59	ENSP00000257934:Q59R;ENSP00000449831:Q59R	ENSP00000257934:Q59R	Q	+	2	0	ESPL1	51949169	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.936000	0.75892	2.147000	0.66899	0.533000	0.62120	CAG		0.577	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406899.2		NM_012291	
FABP1	2168	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	88425757	88425757	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr2:88425757G>C	ENST00000295834.3	-	2	276	c.178C>G	c.(178-180)Caa>Gaa	p.Q60E	FABP1_ENST00000393750.3_Missense_Mutation_p.Q60E|FABP1_ENST00000495375.1_5'UTR	NM_001443.2	NP_001434.1	P07148	FABPL_HUMAN	fatty acid binding protein 1, liver	60					cellular lipid metabolic process (GO:0044255)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|intestinal absorption (GO:0050892)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of hydrolase activity (GO:0051345)|small molecule metabolic process (GO:0044281)	apical cortex (GO:0045179)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|peroxisomal matrix (GO:0005782)	antioxidant activity (GO:0016209)|bile acid binding (GO:0032052)|chromatin binding (GO:0003682)|drug binding (GO:0008144)|fatty acid binding (GO:0005504)|long-chain fatty acid transporter activity (GO:0005324)|phospholipid binding (GO:0005543)	p.Q60E(1)		kidney(1)|large_intestine(1)|lung(2)|prostate(1)|stomach(1)	6						AATTCGTTTTGGATCACTTTG	0.517																																																	1	Substitution - Missense(1)	kidney(1)											326.0	276.0	293.0					2																	88425757		2203	4300	6503	SO:0001583	missense	2168			M10617	CCDS2001.1	2p11	2013-03-01			ENSG00000163586	ENSG00000163586		"""Fatty acid binding protein family"""	3555	protein-coding gene	gene with protein product		134650				3012800, 17698986	Standard	NM_001443		Approved	L-FABP	uc002sst.2	P07148	OTTHUMG00000130312	ENST00000295834.3:c.178C>G	2.37:g.88425757G>C	ENSP00000295834:p.Gln60Glu			Missense_Mutation	SNP	ENST00000295834.3	37	CCDS2001.1	.	.	.	.	.	.	.	.	.	.	G	1.443	-0.567064	0.03910	.	.	ENSG00000163586	ENST00000295834;ENST00000393750	T;T	0.13196	2.61;2.61	5.81	1.67	0.24075	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	1.295960	0.04477	N	0.377066	T	0.07279	0.0184	N	0.04063	-0.285	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.37244	-0.9714	10	0.17832	T	0.49	.	9.3455	0.38107	0.0:0.1466:0.4296:0.4238	.	60;60	A8MW49;P07148	.;FABPL_HUMAN	E	60	ENSP00000295834:Q60E;ENSP00000377351:Q60E	ENSP00000295834:Q60E	Q	-	1	0	FABP1	88206872	0.000000	0.05858	0.141000	0.22245	0.028000	0.11728	-0.544000	0.06077	0.321000	0.23259	-0.269000	0.10298	CAA		0.517	FABP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252660.1		NM_001443	
FASN	2194	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	80039936	80039936	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr17:80039936T>G	ENST00000306749.2	-	36	6330	c.6112A>C	c.(6112-6114)Aat>Cat	p.N2038H	FASN_ENST00000579758.1_5'UTR	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	2038	Beta-ketoacyl reductase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.N2038H(1)		central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	ATGGCGGAATTGGCAAAGCCG	0.647																																					Colon(59;314 1043 11189 28578 32273)												1	Substitution - Missense(1)	kidney(1)											90.0	89.0	89.0					17																	80039936		2202	4298	6500	SO:0001583	missense	2194			U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.6112A>C	17.37:g.80039936T>G	ENSP00000304592:p.Asn2038His		Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	ENST00000306749.2	37	CCDS11801.1	.	.	.	.	.	.	.	.	.	.	T	15.64	2.892760	0.52121	.	.	ENSG00000169710	ENST00000306749	T	0.46451	0.87	4.6	4.6	0.57074	Polyketide synthase/Fatty acid synthase, KR (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.78272	0.4257	H	0.99312	4.51	0.80722	D	1	D	0.64830	0.994	D	0.71414	0.973	D	0.87401	0.2369	10	0.87932	D	0	-48.3797	13.9596	0.64170	0.0:0.0:0.0:1.0	.	2038	P49327	FAS_HUMAN	H	2038	ENSP00000304592:N2038H	ENSP00000304592:N2038H	N	-	1	0	FASN	77633225	1.000000	0.71417	1.000000	0.80357	0.024000	0.10985	7.469000	0.80959	1.707000	0.51288	0.260000	0.18958	AAT		0.647	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1		NM_004104	
FLNA	2316	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	153594983	153594983	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chrX:153594983T>G	ENST00000369850.3	-	7	1248	c.1012A>C	c.(1012-1014)Aag>Cag	p.K338Q	FLNA_ENST00000344736.4_Missense_Mutation_p.K338Q|FLNA_ENST00000422373.1_Missense_Mutation_p.K338Q|FLNA_ENST00000360319.4_Missense_Mutation_p.K338Q	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	338					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)	p.K338Q(1)		breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GTGCGGTTCTTGTCGTTATTG	0.622																																																	1	Substitution - Missense(1)	kidney(1)											104.0	112.0	109.0					X																	153594983		2044	4156	6200	SO:0001583	missense	2316			X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.1012A>C	X.37:g.153594983T>G	ENSP00000358866:p.Lys338Gln		E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	SNP	ENST00000369850.3	37	CCDS48194.1	.	.	.	.	.	.	.	.	.	.	T	10.59	1.392830	0.25118	.	.	ENSG00000196924	ENST00000360319;ENST00000369852;ENST00000422373;ENST00000369850;ENST00000344736	D;D;D;D	0.85258	-1.96;-1.96;-1.96;-1.96	5.01	5.01	0.66863	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.90601	0.7053	M	0.71036	2.16	0.80722	D	1	D;B	0.59357	0.985;0.319	D;P	0.63957	0.92;0.457	D	0.91621	0.5311	10	0.87932	D	0	.	13.5606	0.61786	0.0:0.0:0.0:1.0	.	338;338	P21333-2;P21333	.;FLNA_HUMAN	Q	338;311;338;338;338	ENSP00000353467:K338Q;ENSP00000416926:K338Q;ENSP00000358866:K338Q;ENSP00000358863:K338Q	ENSP00000358863:K338Q	K	-	1	0	FLNA	153248177	1.000000	0.71417	0.998000	0.56505	0.129000	0.20672	7.855000	0.86950	1.661000	0.50771	0.427000	0.28365	AAG		0.622	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058942.3			
FNDC3A	22862	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	49776041	49776041	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr13:49776041A>T	ENST00000492622.2	+	24	3398	c.3093A>T	c.(3091-3093)gaA>gaT	p.E1031D	FNDC3A_ENST00000398316.3_Missense_Mutation_p.E975D|FNDC3A_ENST00000541916.1_Missense_Mutation_p.E1031D	NM_001079673.1	NP_001073141.1	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A	1031	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				fertilization (GO:0009566)|Sertoli cell development (GO:0060009)|single organismal cell-cell adhesion (GO:0016337)|spermatid development (GO:0007286)	acrosomal vesicle (GO:0001669)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle membrane (GO:0012506)	poly(A) RNA binding (GO:0044822)	p.E1031D(1)		endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|prostate(5)|skin(2)|urinary_tract(1)	41		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)		AAGCTGGGGAAGGTCCCCTCT	0.358																																																	1	Substitution - Missense(1)	kidney(1)											83.0	85.0	84.0					13																	49776041		2203	4300	6503	SO:0001583	missense	22862			AB023187	CCDS9413.2, CCDS41886.1	13q14.12	2013-02-11	2005-01-20	2005-01-22	ENSG00000102531	ENSG00000102531		"""Fibronectin type III domain containing"""	20296	protein-coding gene	gene with protein product		615794	"""fibronectin type III domain containing 3"""	FNDC3			Standard	NM_001079673		Approved	bA203I16.5, KIAA0970	uc001vcm.3	Q9Y2H6	OTTHUMG00000016911	ENST00000492622.2:c.3093A>T	13.37:g.49776041A>T	ENSP00000417257:p.Glu1031Asp		B4DYG1|Q5HYC9|Q5JVF8|Q5JVF9|Q6EVH3|Q6EVH4|Q6N020|Q6P9D5|Q6ZME4|Q9H1W1	Missense_Mutation	SNP	ENST00000492622.2	37	CCDS41886.1	.	.	.	.	.	.	.	.	.	.	A	17.26	3.344323	0.61073	.	.	ENSG00000102531	ENST00000492622;ENST00000337156;ENST00000541916;ENST00000398316	T;T;T	0.54675	0.56;0.56;0.56	6.16	3.74	0.42951	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000002	T	0.44891	0.1315	L	0.60957	1.885	0.58432	D	0.999998	P;P	0.40794	0.729;0.592	B;B	0.40134	0.32;0.241	T	0.23762	-1.0179	10	0.15499	T	0.54	-21.3373	8.4645	0.32947	0.7912:0.0:0.2088:0.0	.	975;1031	Q9Y2H6-2;Q9Y2H6	.;FND3A_HUMAN	D	1031;967;1031;975	ENSP00000417257:E1031D;ENSP00000441831:E1031D;ENSP00000381362:E975D	ENSP00000338579:E967D	E	+	3	2	FNDC3A	48674042	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.537000	0.53590	0.563000	0.29222	-0.297000	0.09499	GAA		0.358	FNDC3A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354845.2		NM_014923	
FRG1B	284802	broad.mit.edu	37	20	29624070	29624070	+	Missense_Mutation	SNP	G	G	A	rs113131305	byFrequency	TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr20:29624070G>A	ENST00000278882.3	+	4	474	c.94G>A	c.(94-96)Gct>Act	p.A32T	FRG1B_ENST00000358464.4_Missense_Mutation_p.A32T|FRG1B_ENST00000439954.2_Missense_Mutation_p.A37T			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	32								p.A32T(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GCAGTTTATGGCTGTCAAATT	0.279													.|||	3	0.000599042	0.0	0.0	5008	,	,		18542	0.001		0.002	False		,,,				2504	0.0																2	Substitution - Missense(2)	kidney(2)																																								SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.94G>A	20.37:g.29624070G>A	ENSP00000278882:p.Ala32Thr		C4AME5	Missense_Mutation	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	g	13.90	2.374450	0.42105	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.48522	0.81	1.91	1.91	0.25777	.	0.171467	0.50627	D	0.000119	T	0.51601	0.1684	.	.	.	0.43304	D	0.995305	P	0.35894	0.526	P	0.47470	0.548	T	0.56300	-0.8002	9	0.56958	D	0.05	.	9.8627	0.41125	0.0:0.0:1.0:0.0	.	37	F5H5R5	.	T	32;37;32	ENSP00000408863:A37T	ENSP00000278882:A32T	A	+	1	0	FRG1B	28237731	1.000000	0.71417	0.999000	0.59377	0.324000	0.28378	7.759000	0.85235	1.383000	0.46405	0.184000	0.17185	GCT		0.279	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2		NR_003579	
GALNT10	55568	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	153796478	153796478	+	Silent	SNP	G	G	A			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr5:153796478G>A	ENST00000297107.6	+	12	1895	c.1758G>A	c.(1756-1758)caG>caA	p.Q586Q	SAP30L-AS1_ENST00000519727.1_RNA|GALNT10_ENST00000377661.2_Silent_p.Q524Q|SAP30L-AS1_ENST00000524264.1_RNA|GALNT10_ENST00000377657.3_Silent_p.Q259Q	NM_198321.3	NP_938080.1	Q86SR1	GLT10_HUMAN	polypeptide N-acetylgalactosaminyltransferase 10	586	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.Q586Q(1)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(12)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	32	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)|all_hematologic(541;0.21)	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)			TCACCCAGCAGTGGCTGTTTG	0.537																																																	1	Substitution - coding silent(1)	kidney(1)											149.0	137.0	141.0					5																	153796478		2203	4300	6503	SO:0001819	synonymous_variant	55568			AK023782	CCDS4325.1	5q34	2014-03-13	2014-03-13		ENSG00000164574	ENSG00000164574	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19873	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 10"""	608043	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10)"""			12417297	Standard	NM_198321		Approved	GalNAc-T10	uc003lvh.3	Q86SR1	OTTHUMG00000130145	ENST00000297107.6:c.1758G>A	5.37:g.153796478G>A			B3KXC9|Q6IN56|Q86VP8|Q8IXJ2|Q8TEJ2|Q96IV2|Q9H8E1|Q9Y4M4	Silent	SNP	ENST00000297107.6	37	CCDS4325.1																																																																																				0.537	GALNT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252453.1		NM_198321	
CCDC121	79635	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	27851883	27851883	+	5'Flank	SNP	C	C	A			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr2:27851883C>A	ENST00000324364.3	-	0	0				RP11-158I13.2_ENST00000505973.1_RNA|GPN1_ENST00000264718.3_De_novo_Start_InFrame|GPN1_ENST00000503738.1_Intron|GPN1_ENST00000610189.1_5'Flank|GPN1_ENST00000515877.1_Intron|CCDC121_ENST00000394775.3_5'Flank|GPN1_ENST00000407583.3_Intron|GPN1_ENST00000424214.1_Intron|GPN1_ENST00000458167.2_Intron|ZNF512_ENST00000556601.1_Intron	NM_024584.4	NP_078860.2	Q6ZUS5	CC121_HUMAN	coiled-coil domain containing 121											breast(1)|endometrium(3)|large_intestine(2)|lung(6)|prostate(2)	14	Acute lymphoblastic leukemia(172;0.155)					TTTCTCTACCCATGCGGTGTC	0.647																																																	0													31.0	35.0	34.0					2																	27851883		2202	4300	6502	SO:0001631	upstream_gene_variant	11321			AK125354	CCDS1759.1, CCDS46247.1	2p23.2	2008-02-05			ENSG00000176714	ENSG00000176714			25833	protein-coding gene	gene with protein product							Standard	NM_024584		Approved	FLJ43364, FLJ13646	uc002rld.3	Q6ZUS5	OTTHUMG00000128427		2.37:g.27851883C>A	Exception_encountered		B3KW66|J3KQZ8|Q9H8G6	RNA	SNP	ENST00000324364.3	37	CCDS1759.1																																																																																				0.647	CCDC121-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250215.1		NM_024584	
GPR112	139378	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	135441605	135441605	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chrX:135441605delA	ENST00000394143.1	+	11	7426	c.7135delA	c.(7135-7137)aaafs	p.K2380fs	GPR112_ENST00000370652.1_Frame_Shift_Del_p.K2380fs|GPR112_ENST00000287534.4_Intron|GPR112_ENST00000394141.1_Frame_Shift_Del_p.K2175fs|GPR112_ENST00000412101.1_Frame_Shift_Del_p.K2175fs	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	2380					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					CGTTGCAGTGAAAAAACTAGG	0.333																																																	0													84.0	74.0	78.0					X																	135441605		2203	4300	6503	SO:0001589	frameshift_variant	139378			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.7135delA	X.37:g.135441605delA	ENSP00000377699:p.Lys2380fs		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Frame_Shift_Del	DEL	ENST00000394143.1	37	CCDS35409.1																																																																																				0.333	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			
GRIA2	2891	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	158257620	158257620	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr4:158257620C>G	ENST00000264426.9	+	11	1844	c.1565C>G	c.(1564-1566)tCt>tGt	p.S522C	GRIA2_ENST00000393815.2_Missense_Mutation_p.S475C|GRIA2_ENST00000296526.7_Missense_Mutation_p.S522C|GRIA2_ENST00000449365.1_Missense_Mutation_p.S475C|GRIA2_ENST00000507898.1_Missense_Mutation_p.S475C	NM_001083619.1	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2	522					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.S522C(2)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(2)|lung(32)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	79	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	CTCGGGATATCTATCATGATC	0.418																																																	2	Substitution - Missense(2)	kidney(2)											202.0	197.0	198.0					4																	158257620		2203	4300	6503	SO:0001583	missense	2891				CCDS3797.1, CCDS43274.1, CCDS43275.1	4q32.1	2012-08-29			ENSG00000120251	ENSG00000120251		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4572	protein-coding gene	gene with protein product		138247		GLUR2		1311100	Standard	NM_001083619		Approved	GluA2, GLURB	uc003ipl.4	P42262	OTTHUMG00000133836	ENST00000264426.9:c.1565C>G	4.37:g.158257620C>G	ENSP00000264426:p.Ser522Cys		A8MT92|I6L997|Q96FP6	Missense_Mutation	SNP	ENST00000264426.9	37	CCDS43274.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.111810	0.77210	.	.	ENSG00000120251	ENST00000507898;ENST00000393815;ENST00000296526;ENST00000264426;ENST00000449365	T;T;T;T;T	0.39229	1.09;1.09;1.09;1.09;1.09	5.46	5.46	0.80206	Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	T	0.70552	0.3237	M	0.84511	2.7	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.947;0.999;0.987	T	0.74870	-0.3517	10	0.87932	D	0	.	19.6635	0.95885	0.0:1.0:0.0:0.0	.	522;522;475	P42262;P42262-2;A8MT92	GRIA2_HUMAN;.;.	C	475;475;522;522;475	ENSP00000426845:S475C;ENSP00000377403:S475C;ENSP00000296526:S522C;ENSP00000264426:S522C;ENSP00000389837:S475C	ENSP00000264426:S522C	S	+	2	0	GRIA2	158477070	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	7.776000	0.85560	2.720000	0.93068	0.655000	0.94253	TCT		0.418	GRIA2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000258367.2			
GTPBP2	54676	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	43592645	43592645	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr6:43592645A>T	ENST00000307126.5	-	6	859	c.860T>A	c.(859-861)gTc>gAc	p.V287D	GTPBP2_ENST00000476510.1_5'UTR|GTPBP2_ENST00000307114.7_Missense_Mutation_p.V199D	NM_019096.3	NP_061969.3			GTP binding protein 2									p.V287D(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(3)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(18;9.36e-06)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000501)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0826)|OV - Ovarian serous cystadenocarcinoma(102;0.167)			GTTGGCACTGACGAGGAGCAG	0.572																																					GBM(116;405 1620 28302 32150 44768)												1	Substitution - Missense(1)	kidney(1)											164.0	132.0	143.0					6																	43592645		2203	4300	6503	SO:0001583	missense	54676			AB024574	CCDS4903.1, CCDS69124.1	6p21	2008-07-28			ENSG00000172432	ENSG00000172432			4670	protein-coding gene	gene with protein product		607434				10833435, 11054535	Standard	NM_019096		Approved		uc003ovs.3	Q9BX10	OTTHUMG00000014744	ENST00000307126.5:c.860T>A	6.37:g.43592645A>T	ENSP00000303997:p.Val287Asp			Missense_Mutation	SNP	ENST00000307126.5	37	CCDS4903.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.4|24.4	4.528792|4.528792	0.85706|0.85706	.|.	.|.	ENSG00000172432|ENSG00000172432	ENST00000442748|ENST00000307126;ENST00000307114	.|T;T	.|0.77877	.|-1.13;-1.13	5.41|5.41	5.41|5.41	0.78517|0.78517	.|Protein synthesis factor, GTP-binding (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.91222|0.91222	0.7234|0.7234	H|H	0.97587|0.97587	4.035|4.035	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;0.997	.|D;D	.|0.77004	.|0.989;0.959	D|D	0.94314|0.94314	0.7548|0.7548	5|10	.|0.87932	.|D	.|0	-22.8167|-22.8167	15.4369|15.4369	0.75155|0.75155	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|279;287	.|Q9BX10-4;Q9BX10	.|.;GTPB2_HUMAN	T|D	253|287;199	.|ENSP00000303997:V287D;ENSP00000304893:V199D	.|ENSP00000304893:V199D	S|V	-|-	1|2	0|0	GTPBP2|GTPBP2	43700623|43700623	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.518000|7.518000	0.81795|0.81795	2.039000|2.039000	0.60335|0.60335	0.454000|0.454000	0.30748|0.30748	TCA|GTC		0.572	GTPBP2-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040679.1			
H2AFY2	55506	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	71868913	71868913	+	Silent	SNP	G	G	A	rs41277966	byFrequency	TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr10:71868913G>A	ENST00000373255.4	+	8	1167	c.903G>A	c.(901-903)gcG>gcA	p.A301A	AIFM2_ENST00000373248.1_Intron	NM_018649.2	NP_061119.1	Q9P0M6	H2AW_HUMAN	H2A histone family, member Y2	301	Macro. {ECO:0000255|PROSITE- ProRule:PRU00490}.				brain development (GO:0007420)|chromatin modification (GO:0016568)|dosage compensation (GO:0007549)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901837)|nucleosome assembly (GO:0006334)	Barr body (GO:0001740)|extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|transcription regulatory region DNA binding (GO:0044212)	p.A301A(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(4)|skin(1)	15						TGTCAGCGGCGGAGGACAAGA	0.532													G|||	2	0.000399361	0.0	0.0029	5008	,	,		18732	0.0		0.0	False		,,,				2504	0.0																1	Substitution - coding silent(1)	kidney(1)						G		1,4405	2.1+/-5.4	0,1,2202	74.0	68.0	70.0		903	-11.9	0.1	10	dbSNP_127	70	6,8594	5.0+/-18.6	0,6,4294	no	coding-synonymous	H2AFY2	NM_018649.2		0,7,6496	AA,AG,GG		0.0698,0.0227,0.0538		301/373	71868913	7,12999	2203	4300	6503	SO:0001819	synonymous_variant	55506			AF336304	CCDS7296.1	10q22.1	2011-01-27			ENSG00000099284	ENSG00000099284		"""Histones / Replication-independent"""	14453	protein-coding gene	gene with protein product						11331621, 11262398	Standard	NM_018649		Approved	macroH2A2	uc001jqm.3	Q9P0M6	OTTHUMG00000018396	ENST00000373255.4:c.903G>A	10.37:g.71868913G>A			Q5SQT2	Silent	SNP	ENST00000373255.4	37	CCDS7296.1																																																																																				0.532	H2AFY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048480.2		NM_018649	
HSPH1	10808	broad.mit.edu	37	13	31712675	31712675	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr13:31712675C>T	ENST00000320027.5	-	17	2583	c.2239G>A	c.(2239-2241)Gaa>Aaa	p.E747K	HSPH1_ENST00000445273.2_Missense_Mutation_p.E749K|HSPH1_ENST00000429785.2_Missense_Mutation_p.E566K|HSPH1_ENST00000380406.5_Missense_Mutation_p.E706K|HSPH1_ENST00000380405.4_Missense_Mutation_p.E703K	NM_006644.2	NP_006635.2	Q92598	HS105_HUMAN	heat shock 105kDa/110kDa protein 1	747					chaperone mediated protein folding requiring cofactor (GO:0051085)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of NK T cell activation (GO:0051135)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)	p.E747K(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27		Lung SC(185;0.0257)		all cancers(112;0.00385)|Epithelial(112;0.0328)|OV - Ovarian serous cystadenocarcinoma(117;0.0375)|GBM - Glioblastoma multiforme(144;0.125)		TTTTTCATTTCAGACTCATCA	0.343																																																	1	Substitution - Missense(1)	kidney(1)											160.0	150.0	154.0					13																	31712675		2203	4300	6503	SO:0001583	missense	10808			AB003333	CCDS9340.1, CCDS66525.1, CCDS73559.1	13q12.2-q13.3	2011-09-02			ENSG00000120694	ENSG00000120694		"""Heat shock proteins / HSP70"""	16969	protein-coding gene	gene with protein product		610703				9610721, 9931472	Standard	XM_005266236		Approved	HSP105B, KIAA0201, HSP105A, NY-CO-25	uc001utj.3	Q92598	OTTHUMG00000016685	ENST00000320027.5:c.2239G>A	13.37:g.31712675C>T	ENSP00000318687:p.Glu747Lys		B4DYH1|O95739|Q5TBM6|Q5TBM7|Q5TBM8|Q9UPC4	Missense_Mutation	SNP	ENST00000320027.5	37	CCDS9340.1	.	.	.	.	.	.	.	.	.	.	C	36	5.747833	0.96882	.	.	ENSG00000120694	ENST00000435381;ENST00000320027;ENST00000380405;ENST00000380406;ENST00000445273;ENST00000380363;ENST00000429785	T;T;T;T;T;T	0.20463	2.07;2.07;2.07;2.07;2.07;2.07	6.08	6.08	0.98989	.	0.065748	0.64402	D	0.000006	T	0.48295	0.1492	M	0.73962	2.25	0.80722	D	1	P;D;P;P;P	0.55172	0.864;0.97;0.864;0.837;0.864	P;P;P;P;P	0.61201	0.597;0.885;0.52;0.642;0.52	T	0.38929	-0.9638	10	0.87932	D	0	-34.4847	20.6721	0.99693	0.0:1.0:0.0:0.0	.	566;706;749;703;747	B4DY72;Q92598-3;B4DYH1;Q92598-2;Q92598	.;.;.;.;HS105_HUMAN	K	11;747;703;706;749;33;566	ENSP00000408991:E11K;ENSP00000318687:E747K;ENSP00000369768:E703K;ENSP00000369769:E706K;ENSP00000396090:E749K;ENSP00000388778:E566K	ENSP00000318687:E747K	E	-	1	0	HSPH1	30610675	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.487000	0.81328	2.894000	0.99253	0.591000	0.81541	GAA		0.343	HSPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044384.1			
IL31RA	133396	broad.mit.edu;hgsc.bcm.edu	37	5	55203210	55203210	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr5:55203210T>C	ENST00000447346.2	+	10	1341	c.1276T>C	c.(1276-1278)Tat>Cat	p.Y426H	IL31RA_ENST00000396834.1_Missense_Mutation_p.Y407H|IL31RA_ENST00000490985.1_Missense_Mutation_p.Y284H|IL31RA_ENST00000354961.4_Missense_Mutation_p.Y407H|IL31RA_ENST00000297015.3_Missense_Mutation_p.Y284H|IL31RA_ENST00000359040.5_Missense_Mutation_p.Y426H|IL31RA_ENST00000396836.2_Missense_Mutation_p.Y426H	NM_001242636.1|NM_139017.5	NP_001229565.1|NP_620586.3	Q8NI17	IL31R_HUMAN	interleukin 31 receptor A	394	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|homeostatic process (GO:0042592)|JAK-STAT cascade (GO:0007259)|macrophage differentiation (GO:0030225)|MAPK cascade (GO:0000165)|monocyte differentiation (GO:0030224)|negative regulation of apoptotic process (GO:0043066)|negative regulation of macrophage activation (GO:0043031)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cytokine binding (GO:0019955)|cytokine receptor activity (GO:0004896)|protein kinase binding (GO:0019901)|transcription coactivator activity (GO:0003713)	p.Y426H(1)		endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|stomach(1)	21		Lung NSC(810;6.93e-05)|Prostate(74;0.00741)|Breast(144;0.0544)|Ovarian(174;0.223)				TTTCTGGTGCTATAACATCTC	0.423																																																	1	Substitution - Missense(1)	kidney(1)											91.0	85.0	87.0					5																	55203210		2203	4300	6503	SO:0001583	missense	133396			AY499339	CCDS3970.2, CCDS56365.1, CCDS56366.1, CCDS56367.1, CCDS75244.1, CCDS75245.1	5q11.2	2013-02-11			ENSG00000164509	ENSG00000164509		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	18969	protein-coding gene	gene with protein product		609510				15184896, 11877449	Standard	NM_139017		Approved	CRL3, GLM-R, CRL, Glmr, IL-31RA	uc003jql.3	Q8NI17	OTTHUMG00000097045	ENST00000447346.2:c.1276T>C	5.37:g.55203210T>C	ENSP00000415900:p.Tyr426His		A6NIF8|Q2TBA1|Q6EBC3|Q6EBC4|Q6EBC5|Q6EBC6|Q6UWL8|Q8WYJ0	Missense_Mutation	SNP	ENST00000447346.2	37	CCDS3970.2	.	.	.	.	.	.	.	.	.	.	T	22.4	4.286168	0.80803	.	.	ENSG00000164509	ENST00000396836;ENST00000396834;ENST00000447346;ENST00000359040;ENST00000297015;ENST00000490985;ENST00000354961	D;D;D;D;D;D;D	0.83250	-1.7;-1.7;-1.7;-1.7;-1.7;-1.7;-1.7	5.87	5.87	0.94306	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.90823	0.7118	M	0.81341	2.54	0.49798	D	0.999829	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.998;0.999;0.999;0.999;0.999	D	0.91793	0.5445	10	0.87932	D	0	-1.7349	12.9575	0.58438	0.0:0.0:0.0:1.0	.	394;426;407;426;426	Q8NI17;Q8NI17-5;Q8NI17-3;Q8NI17-2;Q8NI17-8	IL31R_HUMAN;.;.;.;.	H	426;407;426;426;284;284;407	ENSP00000380048:Y426H;ENSP00000380046:Y407H;ENSP00000415900:Y426H;ENSP00000351935:Y426H;ENSP00000297015:Y284H;ENSP00000427533:Y284H;ENSP00000347047:Y407H	ENSP00000297015:Y284H	Y	+	1	0	IL31RA	55238967	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	4.284000	0.58983	2.371000	0.80710	0.533000	0.62120	TAT		0.423	IL31RA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214148.1		NM_139017	
VWA8	23078	hgsc.bcm.edu	37	13	42273315	42273324	+	Frame_Shift_Del	DEL	GTCCACAAAG	GTCCACAAAG	-	rs76787766		TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	GTCCACAAAG	GTCCACAAAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr13:42273315_42273324delGTCCACAAAG	ENST00000379310.3	-	29	3515_3524	c.3447_3456delCTTTGTGGAC	c.(3445-3456)ttctttgtggacfs	p.FFVD1149fs		NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	1149						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.D1152Y(1)									TATCAAAAAAGTCCACAAAGAAGCCACTTT	0.433																																																	1	Substitution - Missense(1)	endometrium(1)																																								SO:0001589	frameshift_variant	0			AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.3447_3456delCTTTGTGGAC	13.37:g.42273315_42273324delGTCCACAAAG	ENSP00000368612:p.Phe1149fs		O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	Frame_Shift_Del	DEL	ENST00000379310.3	37	CCDS41881.1																																																																																				0.433	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354828.2		NM_015058	
KLHDC10	23008	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	129761893	129761893	+	Splice_Site	SNP	G	G	A			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr7:129761893G>A	ENST00000335420.5	+	5	764		c.e5-1			NM_014997.3	NP_055812.1	Q6PID8	KLD10_HUMAN	kelch domain containing 10							cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.?(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|liver(2)|lung(10)|prostate(1)	17						TTGTTATCCAGGCTATGGCCA	0.393																																																	1	Unknown(1)	kidney(1)											98.0	79.0	85.0					7																	129761893		2203	4300	6503	SO:0001630	splice_region_variant	23008				CCDS5815.1	7q32.2	2008-08-20			ENSG00000128607	ENSG00000128607			22194	protein-coding gene	gene with protein product	"""scruin like at the midline homolog (Drosophila)"""	615152					Standard	NM_014997		Approved	KIAA0265, slim	uc003vpj.2	Q6PID8	OTTHUMG00000157654	ENST00000335420.5:c.631-1G>A	7.37:g.129761893G>A			Q86Y99|Q92554	Splice_Site	SNP	ENST00000335420.5	37	CCDS5815.1	.	.	.	.	.	.	.	.	.	.	G	18.53	3.644885	0.67358	.	.	ENSG00000128607	ENST00000335420;ENST00000468226	.	.	.	5.47	5.47	0.80525	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.3173	0.90225	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KLHDC10	129549129	1.000000	0.71417	0.998000	0.56505	0.545000	0.35147	9.841000	0.99482	2.553000	0.86117	0.655000	0.94253	.		0.393	KLHDC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349347.2			Intron
LCP1	3936	hgsc.bcm.edu	37	13	46717458	46717459	+	Frame_Shift_Ins	INS	-	-	G	rs143399162|rs199851535		TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr13:46717458_46717459insG	ENST00000398576.2	-	15	1722_1723	c.1334_1335insC	c.(1333-1335)ccgfs	p.P445fs	LCP1_ENST00000435666.2_5'Flank|LCP1_ENST00000323076.2_Frame_Shift_Ins_p.P445fs			P13796	PLSL_HUMAN	lymphocyte cytosolic protein 1 (L-plastin)	445	Actin-binding 2.|CH 3. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|organ regeneration (GO:0031100)|protein kinase A signaling (GO:0010737)|regulation of intracellular protein transport (GO:0033157)|T cell activation involved in immune response (GO:0002286)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|actin filament bundle (GO:0032432)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)			breast(2)|kidney(1)|large_intestine(6)|lung(18)|ovary(4)|prostate(2)|skin(1)	34		Lung NSC(96;1.27e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.39e-05)		TGGGGTATGGCGGTTTGTTTAC	0.426			T	BCL6	NHL																																			Dom	yes		13	13q14.1-q14.3	3936	lymphocyte cytosolic protein 1 (L-plastin)		L	0																																										SO:0001589	frameshift_variant	3936			M22300	CCDS9403.1	13q14.3	2013-01-10			ENSG00000136167	ENSG00000136167		"""EF-hand domain containing"""	6528	protein-coding gene	gene with protein product	"""plastin 2"""	153430				2111166	Standard	NM_002298		Approved	PLS2, CP64, L-PLASTIN, LC64P	uc001vba.4	P13796	OTTHUMG00000016864	ENST00000398576.2:c.1335dupC	13.37:g.46717460_46717460dupG	ENSP00000381581:p.Pro445fs		B2R613|B4DUA0|Q5TBN4	Frame_Shift_Ins	INS	ENST00000398576.2	37	CCDS9403.1																																																																																				0.426	LCP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044800.3		NM_002298	
MIR31HG	554202	broad.mit.edu	37	9	21455929	21455929	+	RNA	SNP	G	G	T			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr9:21455929G>T	ENST00000304425.3	-	0	456					NR_027054.1				MIR31 host gene (non-protein coding)									p.S3S(1)									GGTATTTCCAGGAATCCATCT	0.483																																																	1	Substitution - coding silent(1)	kidney(1)																																										0			AK124391		9p21.3	2014-07-18			ENSG00000171889	ENSG00000171889		"""-"""	37187	non-coding RNA	RNA, long non-coding						15364902, 22289355, 24631686	Standard	NR_027054		Approved	LOC554202	uc003zpe.2		OTTHUMG00000019681		9.37:g.21455929G>T				RNA	SNP	ENST00000304425.3	37																																																																																					0.483	MIR31HG-001	KNOWN	basic	sense_overlapping	sense_overlapping	OTTHUMT00000051910.1		NR_027054	
METTL4	64863	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	2547514	2547514	+	Nonsense_Mutation	SNP	G	G	C			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr18:2547514G>C	ENST00000574538.1	-	6	1689	c.914C>G	c.(913-915)tCa>tGa	p.S305*	METTL4_ENST00000319888.6_Nonsense_Mutation_p.S305*	NM_022840.3	NP_073751.3	Q8N3J2	METL4_HUMAN	methyltransferase like 4	305					nucleobase-containing compound metabolic process (GO:0006139)		methyltransferase activity (GO:0008168)|nucleic acid binding (GO:0003676)	p.S305*(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	17						TTGCAGGGGTGACAAATAACT	0.383																																																	1	Substitution - Nonsense(1)	kidney(1)											52.0	50.0	51.0					18																	2547514		2203	4300	6503	SO:0001587	stop_gained	64863				CCDS11826.1	18p11.31	2008-02-05			ENSG00000101574	ENSG00000101574			24726	protein-coding gene	gene with protein product						12477932	Standard	NM_022840		Approved	FLJ23017, HsT661	uc002klh.4	Q8N3J2	OTTHUMG00000131482	ENST00000574538.1:c.914C>G	18.37:g.2547514G>C	ENSP00000458290:p.Ser305*		B2RNA1|Q2TAA7|Q9H5U9	Nonsense_Mutation	SNP	ENST00000574538.1	37	CCDS11826.1	.	.	.	.	.	.	.	.	.	.	G	32	5.171650	0.94807	.	.	ENSG00000101574	ENST00000319888	.	.	.	5.57	5.57	0.84162	.	0.060753	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	1.583	19.9024	0.96993	0.0:0.0:1.0:0.0	.	.	.	.	X	305	.	ENSP00000320349:S305X	S	-	2	0	METTL4	2537514	1.000000	0.71417	0.985000	0.45067	0.919000	0.55068	6.911000	0.75746	2.775000	0.95449	0.650000	0.86243	TCA		0.383	METTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254326.3		NM_022840	
MFHAS1	9258	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	8747924	8747924	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr8:8747924A>G	ENST00000276282.6	-	1	3231	c.2645T>C	c.(2644-2646)aTt>aCt	p.I882T		NM_004225.2	NP_004216.2	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified sequence 1	882								p.I882T(1)		endometrium(1)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|stomach(1)	21		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		GCTATATTCAATCTGCAACTG	0.483																																					Melanoma(103;1201 2045 17515 28966)												1	Substitution - Missense(1)	kidney(1)											70.0	67.0	68.0					8																	8747924		2203	4300	6503	SO:0001583	missense	9258			AB016816	CCDS34844.1	8p23.1	2014-03-07			ENSG00000147324	ENSG00000147324			16982	protein-coding gene	gene with protein product	"""leucine rich repeat containing 65"", ""malignant fibrous histiocytoma-amplified sequences with leucine-rich tandem repeats 1"""	605352				9973190	Standard	NM_004225		Approved	MASL1, LRRC65	uc003wsj.1	Q9Y4C4	OTTHUMG00000163676	ENST00000276282.6:c.2645T>C	8.37:g.8747924A>G	ENSP00000276282:p.Ile882Thr		Q96CI0	Missense_Mutation	SNP	ENST00000276282.6	37	CCDS34844.1	.	.	.	.	.	.	.	.	.	.	A	14.78	2.637319	0.47049	.	.	ENSG00000147324	ENST00000276282	T	0.46063	0.88	5.04	3.87	0.44632	.	0.062122	0.64402	D	0.000011	T	0.40015	0.1100	L	0.56769	1.78	0.54753	D	0.999984	B	0.18013	0.025	B	0.24394	0.053	T	0.30208	-0.9986	10	0.56958	D	0.05	.	10.6114	0.45423	0.8562:0.0:0.0:0.1437	.	882	Q9Y4C4	MFHA1_HUMAN	T	882	ENSP00000276282:I882T	ENSP00000276282:I882T	I	-	2	0	MFHAS1	8785334	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	6.870000	0.75526	0.934000	0.37316	0.533000	0.62120	ATT		0.483	MFHAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374724.2		NM_004225	
MUC5B	727897	hgsc.bcm.edu	37	11	1258286	1258286	+	Silent	SNP	C	C	T	rs77996005	byFrequency	TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr11:1258286C>T	ENST00000529681.1	+	25	3247	c.3189C>T	c.(3187-3189)gaC>gaT	p.D1063D	MUC5B_ENST00000447027.1_Silent_p.D1066D	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	1063	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCTGCCCGGACGCCCTGGCAC	0.667																																																	0													40.0	58.0	52.0					11																	1258286		2084	4187	6271	SO:0001819	synonymous_variant	727897			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.3189C>T	11.37:g.1258286C>T			O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	CCDS44515.2																																																																																				0.667	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2		XM_001126093	
NALCN	259232	broad.mit.edu;hgsc.bcm.edu	37	13	101720364	101720364	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr13:101720364G>A	ENST00000251127.6	-	39	4433	c.4352C>T	c.(4351-4353)tCc>tTc	p.S1451F		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	1451					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)	p.S1451F(1)		NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					ATAAAACAAGGAGAAATTCTC	0.318																																																	1	Substitution - Missense(1)	kidney(1)											93.0	91.0	92.0					13																	101720364		2203	4300	6503	SO:0001583	missense	259232			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.4352C>T	13.37:g.101720364G>A	ENSP00000251127:p.Ser1451Phe		Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	ENST00000251127.6	37	CCDS9498.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.468153	0.84533	.	.	ENSG00000102452	ENST00000251127	D	0.97831	-4.56	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	D	0.98378	0.9461	L	0.56199	1.76	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99505	1.0954	10	0.87932	D	0	.	20.2789	0.98501	0.0:0.0:1.0:0.0	.	1451	Q8IZF0	NALCN_HUMAN	F	1451	ENSP00000251127:S1451F	ENSP00000251127:S1451F	S	-	2	0	NALCN	100518365	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.476000	0.97823	2.788000	0.95919	0.650000	0.86243	TCC		0.318	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2		NM_052867	
NMNAT3	349565	hgsc.bcm.edu;ucsc.edu	37	3	139279902	139279902	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr3:139279902delT	ENST00000296202.7	-	6	1090	c.709delA	c.(709-711)agtfs	p.S237fs	NMNAT3_ENST00000413939.2_Frame_Shift_Del_p.S148fs|NMNAT3_ENST00000511444.1_3'UTR|RP11-319G6.1_ENST00000381790.3_RNA|NMNAT3_ENST00000339837.5_Frame_Shift_Del_p.S200fs|NMNAT3_ENST00000406164.1_Frame_Shift_Del_p.S200fs|NMNAT3_ENST00000406824.1_Frame_Shift_Del_p.S127fs|NMNAT3_ENST00000507242.1_5'Flank|RP11-319G6.1_ENST00000515247.1_RNA			Q96T66	NMNA3_HUMAN	nicotinamide nucleotide adenylyltransferase 3	237					NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|nicotinamide-nucleotide adenylyltransferase activity (GO:0000309)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)			endometrium(2)|kidney(1)|large_intestine(2)|lung(4)	9						TTCCAGGTACTGCCCTTGGTG	0.572																																																	0													218.0	179.0	192.0					3																	139279902		2203	4300	6503	SO:0001589	frameshift_variant	349565			AF345564	CCDS3111.1, CCDS56282.1	3q23	2013-09-20			ENSG00000163864	ENSG00000163864			20989	protein-coding gene	gene with protein product		608702				12574164	Standard	NM_178177		Approved	PNAT3	uc003etk.3	Q96T66	OTTHUMG00000159951	ENST00000296202.7:c.709delA	3.37:g.139279902delT	ENSP00000296202:p.Ser237fs		B3KVR6|D3DNF2|D3DNF3|Q8N4G1	Frame_Shift_Del	DEL	ENST00000296202.7	37																																																																																					0.572	NMNAT3-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000358469.1		NM_178177	
P2RY14	9934	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	150931635	150931635	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr3:150931635A>G	ENST00000309170.3	-	3	782	c.470T>C	c.(469-471)aTt>aCt	p.I157T	P2RY14_ENST00000424796.2_Missense_Mutation_p.I157T|MED12L_ENST00000273432.4_Intron|MED12L_ENST00000474524.1_Intron	NM_001081455.1|NM_014879.3	NP_001074924.1|NP_055694.3	Q15391	P2Y14_HUMAN	purinergic receptor P2Y, G-protein coupled, 14	157					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|UDP-activated nucleotide receptor activity (GO:0045029)	p.I157T(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(1)	20			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			GGTGAGAATAATATTTGGAAC	0.413																																																	1	Substitution - Missense(1)	kidney(1)											133.0	122.0	126.0					3																	150931635		2203	4300	6503	SO:0001583	missense	9934			D13626	CCDS3156.1	3q21-q25	2012-08-08	2004-07-12	2004-07-14	ENSG00000174944	ENSG00000174944		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	16442	protein-coding gene	gene with protein product		610116	"""G protein-coupled receptor 105"""	GPR105			Standard	NM_014879		Approved	KIAA0001	uc003eys.1	Q15391	OTTHUMG00000159859	ENST00000309170.3:c.470T>C	3.37:g.150931635A>G	ENSP00000308361:p.Ile157Thr		Q8IYT7	Missense_Mutation	SNP	ENST00000309170.3	37	CCDS3156.1	.	.	.	.	.	.	.	.	.	.	A	7.678	0.688403	0.14973	.	.	ENSG00000174944	ENST00000309170;ENST00000424796	T;T	0.37235	1.21;1.21	5.9	3.47	0.39725	GPCR, rhodopsin-like superfamily (1);	0.386006	0.26255	N	0.025439	T	0.30696	0.0773	L	0.36672	1.1	0.33045	D	0.532048	B	0.18968	0.032	B	0.20955	0.032	T	0.34378	-0.9831	10	0.72032	D	0.01	-5.3761	13.3185	0.60421	0.6243:0.3757:0.0:0.0	.	157	Q15391	P2Y14_HUMAN	T	157	ENSP00000308361:I157T;ENSP00000408733:I157T	ENSP00000308361:I157T	I	-	2	0	P2RY14	152414325	0.930000	0.31532	0.575000	0.28536	0.121000	0.20230	2.110000	0.41873	0.456000	0.26937	0.528000	0.53228	ATT		0.413	P2RY14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357789.1		NM_014879	
PLXDC2	84898	broad.mit.edu;hgsc.bcm.edu	37	10	20465933	20465933	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr10:20465933C>G	ENST00000377252.4	+	8	1730	c.889C>G	c.(889-891)Cga>Gga	p.R297G	PLXDC2_ENST00000377242.3_Missense_Mutation_p.R248G|PLXDC2_ENST00000377238.2_3'UTR	NM_001282736.1|NM_032812.7	NP_001269665.1|NP_116201.7	Q6UX71	PXDC2_HUMAN	plexin domain containing 2	297					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.R297G(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(9)|ovary(2)|skin(3)|stomach(1)	34						TCTAGATGTTCGAAGAAGAAC	0.323																																																	1	Substitution - Missense(1)	kidney(1)											75.0	78.0	77.0					10																	20465933		2203	4300	6503	SO:0001583	missense	84898			AF378757	CCDS7132.1, CCDS60497.1	10p12.33	2006-04-12			ENSG00000120594	ENSG00000120594			21013	protein-coding gene	gene with protein product	"""tumor endothelial marker 7-related precursor"""	606827				11559528	Standard	NM_001282736		Approved	TEM7R, FLJ14623	uc001iqg.1	Q6UX71	OTTHUMG00000017781	ENST00000377252.4:c.889C>G	10.37:g.20465933C>G	ENSP00000366460:p.Arg297Gly		Q96E59|Q96PD9|Q96SU9	Missense_Mutation	SNP	ENST00000377252.4	37	CCDS7132.1	.	.	.	.	.	.	.	.	.	.	C	19.52	3.843534	0.71488	.	.	ENSG00000120594	ENST00000377252;ENST00000377242;ENST00000377238;ENST00000536022	T;T	0.76448	-1.02;-1.02	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	D	0.86736	0.6004	M	0.61703	1.905	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.75020	0.985;0.968	D	0.85916	0.1443	10	0.48119	T	0.1	.	18.7065	0.91640	0.0:1.0:0.0:0.0	.	248;297	Q6UX71-2;Q6UX71	.;PXDC2_HUMAN	G	297;248;160;283	ENSP00000366460:R297G;ENSP00000366450:R248G	ENSP00000366446:R160G	R	+	1	2	PLXDC2	20505939	0.997000	0.39634	1.000000	0.80357	0.982000	0.71751	3.420000	0.52735	2.703000	0.92315	0.655000	0.94253	CGA		0.323	PLXDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047101.2		NM_032812	
PCGF6	84108	broad.mit.edu	37	10	105110747	105110747	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr10:105110747G>T	ENST00000369847.3	-	1	144	c.77C>A	c.(76-78)cCg>cAg	p.P26Q	PCGF6_ENST00000337211.4_Missense_Mutation_p.P26Q|PCGF6_ENST00000490296.1_5'UTR	NM_001011663.1	NP_001011663.1	Q9BYE7	PCGF6_HUMAN	polycomb group ring finger 6	26	Pro-rich.				negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.P26Q(2)		autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(3)	8		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;2.57e-09)|all cancers(201;7.21e-08)|BRCA - Breast invasive adenocarcinoma(275;0.205)		gacaggaggcggaggcggCAA	0.741																																																	2	Substitution - Missense(2)	kidney(2)											6.0	8.0	7.0					10																	105110747		1558	3107	4665	SO:0001583	missense	84108			AB047006	CCDS7546.1, CCDS31275.1	10q24.33	2013-01-09	2005-01-17	2005-01-19	ENSG00000156374	ENSG00000156374		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	21156	protein-coding gene	gene with protein product		607816	"""ring finger protein 134"""	RNF134		12167161	Standard	NM_032154		Approved	MBLR	uc001kwt.3	Q9BYE7	OTTHUMG00000018982	ENST00000369847.3:c.77C>A	10.37:g.105110747G>T	ENSP00000358862:p.Pro26Gln		A8K3R4|Q5SYD1|Q5SYD6|Q96ID9|Q96SJ1	Missense_Mutation	SNP	ENST00000369847.3	37	CCDS31275.1	.	.	.	.	.	.	.	.	.	.	G	10.62	1.402044	0.25291	.	.	ENSG00000156374	ENST00000369847;ENST00000337211	T;T	0.33438	1.48;1.41	4.14	4.14	0.48551	.	0.000000	0.45606	D	0.000357	T	0.21062	0.0507	N	0.19112	0.55	0.09310	N	1	B;B	0.19445	0.036;0.021	B;B	0.20184	0.028;0.012	T	0.22417	-1.0217	10	0.72032	D	0.01	.	12.1078	0.53821	0.0:0.0:1.0:0.0	.	26;26	Q9BYE7-3;Q9BYE7	.;PCGF6_HUMAN	Q	26	ENSP00000358862:P26Q;ENSP00000338845:P26Q	ENSP00000338845:P26Q	P	-	2	0	PCGF6	105100737	0.982000	0.34865	0.087000	0.20705	0.033000	0.12548	2.341000	0.43983	2.300000	0.77407	0.491000	0.48974	CCG		0.741	PCGF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050132.1		NM_032154	
RINL	126432	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	39360226	39360226	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr19:39360226C>G	ENST00000591812.1	-	10	1547	c.1461G>C	c.(1459-1461)gaG>gaC	p.E487D	CTC-360G5.6_ENST00000593830.1_RNA|RINL_ENST00000598904.1_Missense_Mutation_p.E373D|RINL_ENST00000340740.3_Missense_Mutation_p.E373D|RINL_ENST00000602238.1_5'Flank			Q6ZS11	RINL_HUMAN	Ras and Rab interactor-like	487	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.				endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)	actin cytoskeleton (GO:0015629)|cytoplasmic vesicle (GO:0031410)|ruffle (GO:0001726)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)	p.E373D(1)		endometrium(3)|kidney(4)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)|urinary_tract(2)	17						CTCCCCGCAGCTCATCTGGAT	0.627											OREG0025454	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - Missense(1)	kidney(1)											53.0	59.0	57.0					19																	39360226		2203	4300	6503	SO:0001583	missense	126432			AK127808	CCDS12522.1, CCDS59386.1	19q13.2	2010-07-13			ENSG00000187994	ENSG00000187994			24795	protein-coding gene	gene with protein product							Standard	NM_001195833		Approved	FLJ45909	uc010xuo.2	Q6ZS11		ENST00000591812.1:c.1461G>C	19.37:g.39360226C>G	ENSP00000467107:p.Glu487Asp	885	B4DPG5	Missense_Mutation	SNP	ENST00000591812.1	37	CCDS59386.1	.	.	.	.	.	.	.	.	.	.	C	15.62	2.887887	0.52014	.	.	ENSG00000187994	ENST00000340740;ENST00000536520	T	0.29655	1.56	5.27	0.784	0.18578	Vacuolar sorting protein 9 (2);	0.058285	0.64402	D	0.000002	T	0.38585	0.1046	L	0.47716	1.5	0.27208	N	0.959993	D;D	0.71674	0.998;0.995	D;D	0.79108	0.992;0.949	T	0.20438	-1.0275	10	0.21540	T	0.41	-31.0686	6.8674	0.24100	0.0:0.6261:0.0:0.3739	.	487;373	B4DPG5;Q6ZS11	.;RINL_HUMAN	D	373	ENSP00000340369:E373D	ENSP00000340369:E373D	E	-	3	2	RINL	44052066	0.991000	0.36638	0.846000	0.33378	0.800000	0.45204	0.313000	0.19415	0.320000	0.23234	0.462000	0.41574	GAG		0.627	RINL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460433.1		NM_198445	
SCNN1B	6338	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	23359975	23359975	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr16:23359975G>A	ENST00000343070.2	+	2	231	c.55G>A	c.(55-57)Ggc>Agc	p.G19S	SCNN1B_ENST00000307331.5_Missense_Mutation_p.G64S|SCNN1B_ENST00000568085.1_Missense_Mutation_p.G19S|SCNN1B_ENST00000568923.1_Missense_Mutation_p.G19S|SCNN1B_ENST00000569789.1_3'UTR	NM_000336.2	NP_000327.2	P51168	SCNNB_HUMAN	sodium channel, non-voltage-gated 1, beta subunit	19					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|WW domain binding (GO:0050699)	p.G19S(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)	GAAGGGCCCCGGCTACACGTA	0.602																																																	1	Substitution - Missense(1)	kidney(1)											56.0	49.0	51.0					16																	23359975		2197	4300	6497	SO:0001583	missense	6338			X87159	CCDS10609.1	16p12.2-p12.1	2012-02-28	2012-02-28		ENSG00000168447	ENSG00000168447		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10600	protein-coding gene	gene with protein product	"""Liddle syndrome"""	600760	"""sodium channel, nonvoltage-gated 1, beta"", ""sodium channel, non-voltage-gated 1, beta"""				Standard	NM_000336		Approved	ENaCbeta	uc002dln.3	P51168	OTTHUMG00000131608	ENST00000343070.2:c.55G>A	16.37:g.23359975G>A	ENSP00000345751:p.Gly19Ser		C5HTZ2|O60891|Q96KG2|Q9UJ32|Q9UMU5	Missense_Mutation	SNP	ENST00000343070.2	37	CCDS10609.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.917948	0.92249	.	.	ENSG00000168447	ENST00000343070;ENST00000307331	T;T	0.69435	-0.36;-0.4	4.91	4.91	0.64330	.	0.159872	0.43416	D	0.000568	T	0.72423	0.3458	N	0.22421	0.69	0.50039	D	0.999846	D	0.89917	1.0	D	0.91635	0.999	T	0.76796	-0.2827	10	0.66056	D	0.02	-11.2674	17.0902	0.86620	0.0:0.0:1.0:0.0	.	19	P51168	SCNNB_HUMAN	S	19;64	ENSP00000345751:G19S;ENSP00000302874:G64S	ENSP00000302874:G64S	G	+	1	0	SCNN1B	23267476	1.000000	0.71417	0.959000	0.39883	0.987000	0.75469	5.507000	0.66999	2.258000	0.74832	0.561000	0.74099	GGC		0.602	SCNN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254495.2			
SETD2	29072	broad.mit.edu	37	3	47161671	47161671	+	Splice_Site	SNP	C	C	G			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr3:47161671C>G	ENST00000409792.3	-	3	4497		c.e3+1			NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2						angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)	p.?(2)		breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		ATTAGACTTACCTTTCTGTTA	0.323			"""N, F, S, Mis"""		clear cell renal carcinoma																																			Rec	yes		3	3p21.31	29072	SET domain containing 2		E	2	Unknown(2)	kidney(2)											52.0	53.0	52.0					3																	47161671		2203	4298	6501	SO:0001630	splice_region_variant	29072			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.4454+1G>C	3.37:g.47161671C>G			O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Splice_Site	SNP	ENST00000409792.3	37	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	C	23.8	4.454497	0.84209	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792	.	.	.	5.18	5.18	0.71444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.871	0.92315	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SETD2	47136675	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.651000	0.83577	2.690000	0.91761	0.563000	0.77884	.		0.323	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2		NM_014159	Intron
SEC61A1	29927	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	127785928	127785928	+	Silent	SNP	C	C	T			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr3:127785928C>T	ENST00000243253.3	+	9	1093	c.909C>T	c.(907-909)gtC>gtT	p.V303V	SEC61A1_ENST00000424880.2_Silent_p.V183V|SEC61A1_ENST00000464451.1_Silent_p.V309V|RUVBL1_ENST00000464873.1_Intron|SEC61A1_ENST00000483956.1_3'UTR	NM_013336.3	NP_037468.1	P61619	S61A1_HUMAN	Sec61 alpha 1 subunit (S. cerevisiae)	303					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell growth (GO:0016049)|endoplasmic reticulum organization (GO:0007029)|posttranslational protein targeting to membrane (GO:0006620)|protein targeting to ER (GO:0045047)|response to interferon-gamma (GO:0034341)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	ribosome binding (GO:0043022)	p.V303V(1)		central_nervous_system(1)|kidney(1)|large_intestine(5)|liver(1)|lung(8)|ovary(1)|prostate(4)	21						ACCTTTATGTCATCTCCCAAA	0.537																																																	1	Substitution - coding silent(1)	kidney(1)											231.0	185.0	201.0					3																	127785928		2203	4300	6503	SO:0001819	synonymous_variant	29927			AF077032	CCDS3046.1	3q21.3	2008-02-05			ENSG00000058262	ENSG00000058262			18276	protein-coding gene	gene with protein product		609213					Standard	NM_013336		Approved		uc003ekb.3	P61619	OTTHUMG00000159624	ENST00000243253.3:c.909C>T	3.37:g.127785928C>T			P38378|P57726|Q5JPF8|Q8N0Z4|Q8N3U3|Q8NC71|Q9BU16|Q9Y2R3	Silent	SNP	ENST00000243253.3	37	CCDS3046.1																																																																																				0.537	SEC61A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356541.2		NM_013336	
SPIN3	169981	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	57020792	57020794	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	GAG	GAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chrX:57020792_57020794delGAG	ENST00000374919.3	-	2	909_911	c.587_589delCTC	c.(586-591)cctctg>ctg	p.P196del		NM_001010862.2	NP_001010862.2	Q5JUX0	SPIN3_HUMAN	spindlin family, member 3	196					gamete generation (GO:0007276)					central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)	4						CTCTCTGCCAGAGGAGAATCATT	0.448																																																	0																																										SO:0001651	inframe_deletion	169981			AL832091	CCDS43963.1	Xp11.22	2008-02-05			ENSG00000204271	ENSG00000204271			27272	protein-coding gene	gene with protein product							Standard	NM_001010862		Approved		uc004dux.1	Q5JUX0	OTTHUMG00000021677	ENST00000374919.3:c.587_589delCTC	X.37:g.57020795_57020797delGAG	ENSP00000364054:p.Pro196del		B2RUW3|B7Z8W2|Q8N5D9	In_Frame_Del	DEL	ENST00000374919.3	37	CCDS43963.1																																																																																				0.448	SPIN3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056908.1		XM_093024	
SYCP2L	221711	broad.mit.edu;ucsc.edu	37	6	10898272	10898272	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr6:10898272G>A	ENST00000283141.6	+	5	661	c.365G>A	c.(364-366)gGa>gAa	p.G122E	SYCP2L_ENST00000543878.1_5'UTR|RP11-637O19.3_ENST00000480294.1_3'UTR	NM_001040274.2	NP_001035364.2	Q5T4T6	SYC2L_HUMAN	synaptonemal complex protein 2-like	122						nucleus (GO:0005634)		p.G122E(1)		breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	36	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)	Epithelial(50;0.239)			AGAACAACAGGAATTCTGACC	0.418																																																	1	Substitution - Missense(1)	kidney(1)											110.0	107.0	108.0					6																	10898272		1899	4126	6025	SO:0001583	missense	221711			AK128130	CCDS43423.1	6p24.2	2008-11-06	2007-07-02	2007-07-02	ENSG00000153157	ENSG00000153157			21537	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 177"""	C6orf177			Standard	NM_001040274		Approved	dJ62D2.1, NO145	uc003mzo.3	Q5T4T6	OTTHUMG00000014250	ENST00000283141.6:c.365G>A	6.37:g.10898272G>A	ENSP00000283141:p.Gly122Glu		A6NDS5|Q08GK5|Q6ZRM2|Q96EJ2	Missense_Mutation	SNP	ENST00000283141.6	37	CCDS43423.1	.	.	.	.	.	.	.	.	.	.	G	0.056	-1.237403	0.01493	.	.	ENSG00000153157	ENST00000283141	T	0.14893	2.47	5.36	2.56	0.30785	.	1.347960	0.04580	N	0.394777	T	0.03564	0.0102	L	0.38953	1.18	0.09310	N	1	B	0.14438	0.01	B	0.13407	0.009	T	0.39143	-0.9628	10	0.12766	T	0.61	-1.8107	4.0784	0.09914	0.346:0.0:0.5008:0.1531	.	122	Q5T4T6	SYC2L_HUMAN	E	122	ENSP00000283141:G122E	ENSP00000283141:G122E	G	+	2	0	SYCP2L	11006258	0.000000	0.05858	0.014000	0.15608	0.021000	0.10359	-0.804000	0.04535	0.219000	0.20840	-0.262000	0.10625	GGA		0.418	SYCP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039845.3		NM_194299	
TYW1	55253	broad.mit.edu;hgsc.bcm.edu	37	7	66703498	66703498	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr7:66703498G>T	ENST00000359626.5	+	16	2345	c.2181G>T	c.(2179-2181)aaG>aaT	p.K727N		NM_018264.2	NP_060734.2	Q9NV66	TYW1_HUMAN	tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)	727					tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity (GO:0016491)	p.K727N(1)		breast(1)|endometrium(8)|kidney(10)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(3)|stomach(2)|urinary_tract(2)	46		Lung NSC(55;0.0846)|all_lung(88;0.183)				ACAAATCAAAGGCTATTTCTG	0.423																																																	1	Substitution - Missense(1)	kidney(1)											60.0	57.0	58.0					7																	66703498		2203	4298	6501	SO:0001583	missense	55253			AK001762	CCDS5538.1	7q11.21	2007-11-29	2007-11-29	2007-11-29	ENSG00000198874	ENSG00000198874			25598	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 1 homolog A (S. cerevisiae)"""	611243	"""radical S-adenosyl methionine and flavodoxin domains 1"""	RSAFD1		16162496, 17150819	Standard	NM_018264		Approved	FLJ10900, MGC23001, MGC60291, YPL207W, TYW1A	uc003tvn.4	Q9NV66	OTTHUMG00000129723	ENST00000359626.5:c.2181G>T	7.37:g.66703498G>T	ENSP00000352645:p.Lys727Asn		Q6PJG8|Q75MG8|Q75MN3|Q86V12|Q8IVS7|Q9H9C4	Missense_Mutation	SNP	ENST00000359626.5	37	CCDS5538.1	.	.	.	.	.	.	.	.	.	.	G	15.99	2.994261	0.54041	.	.	ENSG00000198874	ENST00000359626	T	0.21361	2.01	3.74	1.89	0.25635	.	0.074394	0.52532	U	0.000064	T	0.30696	0.0773	M	0.76727	2.345	0.44652	D	0.997633	P	0.48640	0.913	P	0.50352	0.638	T	0.03784	-1.1004	10	0.72032	D	0.01	.	7.2557	0.26175	0.2273:0.0:0.7727:0.0	.	727	Q9NV66	TYW1_HUMAN	N	727	ENSP00000352645:K727N	ENSP00000352645:K727N	K	+	3	2	TYW1	66340933	1.000000	0.71417	0.203000	0.23512	0.839000	0.47603	2.290000	0.43531	0.259000	0.21709	0.405000	0.27470	AAG		0.423	TYW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251932.2		NM_018264	
UNC13A	23025	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	17760372	17760372	+	Silent	SNP	G	G	A	rs551065041		TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr19:17760372G>A	ENST00000519716.2	-	13	1463	c.1464C>T	c.(1462-1464)atC>atT	p.I488I	UNC13A_ENST00000551649.1_Silent_p.I488I|UNC13A_ENST00000550896.1_Silent_p.I488I|UNC13A_ENST00000252773.7_Silent_p.I488I|UNC13A_ENST00000552293.1_Silent_p.I488I|UNC13A_ENST00000428389.2_Silent_p.I576I	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	488					beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)	p.I488I(1)|p.I576I(1)		breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						GCATGCTGTCGATGATGATGA	0.567																																																	2	Substitution - coding silent(2)	kidney(2)											147.0	152.0	150.0					19																	17760372		2107	4228	6335	SO:0001819	synonymous_variant	23025			AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.1464C>T	19.37:g.17760372G>A			E5RHY9	Silent	SNP	ENST00000519716.2	37	CCDS46013.2																																																																																				0.567	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376169.2		XM_038604	
VHL	7428	broad.mit.edu;hgsc.bcm.edu	37	3	10183788	10183788	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina Miseq			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr3:10183788C>T	ENST00000256474.2	+	1	1097	c.257C>T	c.(256-258)cCc>cTc	p.P86L	VHL_ENST00000345392.2_Missense_Mutation_p.P86L|snoU13_ENST00000458986.1_RNA	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	86			P -> A (in VHLD; type I). {ECO:0000269|PubMed:8956040}.|P -> H (in VHLD).|P -> L (in VHLD; type I). {ECO:0000269|PubMed:8956040}.|P -> R (in VHLD; type I). {ECO:0000269|PubMed:9829911}.|P -> S (in VHLD). {ECO:0000269|PubMed:17344846, ECO:0000269|PubMed:9829912}.		cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.P86L(4)|p.P86H(3)|p.P86fs*72(2)|p.S72_V87>L(1)|p.R60fs*35(1)|p.V84_E94>E(1)|p.V87fs*45(1)|p.V84fs*69(1)|p.P86R(1)|p.L85fs*44(1)|p.V84fs*72(1)|p.V84_P86del(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GTCGTGCTGCCCGTATGGCTC	0.716		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	18	Substitution - Missense(8)|Deletion - Frameshift(6)|Complex - deletion inframe(2)|Deletion - In frame(1)|Insertion - Frameshift(1)	kidney(17)|soft_tissue(1)	GRCh37	CM951275|CM982001	VHL	M							13.0	16.0	15.0					3																	10183788		2148	4203	6351	SO:0001583	missense	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.257C>T	3.37:g.10183788C>T	ENSP00000256474:p.Pro86Leu		B2RE45|Q13599|Q6PDA9	Missense_Mutation	SNP	ENST00000256474.2	37	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	C	33	5.249919	0.95305	.	.	ENSG00000134086	ENST00000256474;ENST00000345392	D;D	0.99841	-7.09;-7.09	5.43	5.43	0.79202	von Hippel-Lindau disease tumor suppressor,  beta domain (1);von Hippel-Lindau disease tumour suppressor, beta/alpha domain (2);	0.000000	0.85682	D	0.000000	D	0.99539	0.9835	L	0.34521	1.04	0.53688	D	0.999979	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.99793	1.1032	10	0.18710	T	0.47	-10.9244	16.8166	0.85735	0.0:1.0:0.0:0.0	.	86;86	P40337-2;P40337	.;VHL_HUMAN	L	86	ENSP00000256474:P86L;ENSP00000344757:P86L	ENSP00000256474:P86L	P	+	2	0	VHL	10158788	0.997000	0.39634	0.957000	0.39632	0.776000	0.43924	4.782000	0.62396	2.558000	0.86282	0.550000	0.68814	CCC		0.716	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
WASL	8976	hgsc.bcm.edu	37	7	123332871	123332871	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr7:123332871G>A	ENST00000223023.4	-	9	1209	c.877C>T	c.(877-879)Cct>Tct	p.P293S		NM_003941.2	NP_003932.3	O00401	WASL_HUMAN	Wiskott-Aldrich syndrome-like	293	Pro-rich.				actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cellular protein complex localization (GO:0034629)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane budding (GO:0006900)|mitotic nuclear division (GO:0007067)|nitric oxide metabolic process (GO:0046209)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of filopodium assembly (GO:0051491)|protein complex assembly (GO:0006461)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|response to bacterium (GO:0009617)|small molecule metabolic process (GO:0044281)|spindle localization (GO:0051653)|transcription, DNA-templated (GO:0006351)|vesicle organization (GO:0016050)|vesicle transport along actin filament (GO:0030050)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	small GTPase regulator activity (GO:0005083)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						ttgtgtggagggggaggagga	0.577																																																	0													47.0	52.0	50.0					7																	123332871		2197	4293	6490	SO:0001583	missense	8976			D88460	CCDS34743.1	7q31.3	2008-02-01			ENSG00000106299	ENSG00000106299			12735	protein-coding gene	gene with protein product		605056				9422512, 9322739	Standard	NM_003941		Approved	N-WASP, NWASP	uc003vkz.3	O00401	OTTHUMG00000157346	ENST00000223023.4:c.877C>T	7.37:g.123332871G>A	ENSP00000223023:p.Pro293Ser		A1JUI9|Q7Z746	Missense_Mutation	SNP	ENST00000223023.4	37	CCDS34743.1	.	.	.	.	.	.	.	.	.	.	G	16.88	3.245855	0.59103	.	.	ENSG00000106299	ENST00000223023	D	0.96265	-3.96	5.39	5.39	0.77823	Wiscott-Aldrich syndrome, C-terminal (1);	0.053823	0.85682	D	0.000000	D	0.93703	0.7988	N	0.20574	0.59	0.80722	D	1	D	0.55172	0.97	P	0.51895	0.683	D	0.90981	0.4827	10	0.02654	T	1	-1.297	19.209	0.93747	0.0:0.0:1.0:0.0	.	293	O00401	WASL_HUMAN	S	293	ENSP00000223023:P293S	ENSP00000223023:P293S	P	-	1	0	WASL	123120107	1.000000	0.71417	0.932000	0.37286	0.973000	0.67179	8.725000	0.91468	2.528000	0.85240	0.644000	0.83932	CCT		0.577	WASL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348522.1		NM_003941	
ZNF428	126299	broad.mit.edu	37	19	44112165	44112165	+	Missense_Mutation	SNP	G	G	T	rs151333697		TCGA-BP-5006-01A-01D-1462-08	TCGA-BP-5006-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	11fb962b-b4b8-46f4-bde4-3f87309e94f3	bab0bd83-abc3-4e81-a927-e65cf576777d	g.chr19:44112165G>T	ENST00000300811.3	-	3	617	c.171C>A	c.(169-171)gaC>gaA	p.D57E	SRRM5_ENST00000526798.1_Intron|SRRM5_ENST00000607544.1_Intron	NM_182498.3	NP_872304.2	Q96B54	ZN428_HUMAN	zinc finger protein 428	57	Glu-rich.						metal ion binding (GO:0046872)	p.D57E(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)	5		Prostate(69;0.0153)				ATTCAGGATCGTCAGTGGTct	0.637																																																	1	Substitution - Missense(1)	kidney(1)											28.0	20.0	23.0					19																	44112165		2169	4256	6425	SO:0001583	missense	126299			AY257197	CCDS12626.1	19q13.31	2008-05-02	2006-07-04	2006-07-04				"""Zinc fingers, C2H2-type"""	20804	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 37"""	C19orf37			Standard	NM_182498		Approved	MGC51082, Zfp428	uc002oxa.3	Q96B54		ENST00000300811.3:c.171C>A	19.37:g.44112165G>T	ENSP00000300811:p.Asp57Glu		O95054|Q6X3Y3	Missense_Mutation	SNP	ENST00000300811.3	37	CCDS12626.1	.	.	.	.	.	.	.	.	.	.	G	19.19	3.780521	0.70222	.	.	ENSG00000131116	ENST00000300811;ENST00000391964	.	.	.	4.77	-1.52	0.08637	.	0.000000	0.50627	D	0.000101	T	0.41949	0.1181	N	0.19112	0.55	0.27300	N	0.957598	D	0.61080	0.989	D	0.74674	0.984	T	0.42103	-0.9471	9	0.87932	D	0	0.8071	9.2458	0.37525	0.4979:0.0:0.5021:0.0	.	57	Q96B54	ZN428_HUMAN	E	57	.	ENSP00000300811:D57E	D	-	3	2	ZNF428	48804005	0.630000	0.27155	0.947000	0.38551	0.930000	0.56654	-0.635000	0.05471	-0.522000	0.06417	-0.440000	0.05779	GAC		0.637	ZNF428-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463349.1		NM_182498	
