#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
DNAJC16	23341	hgsc.bcm.edu	37	1	15894410	15894410	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr1:15894410G>A	ENST00000375847.3	+	15	2251	c.2087G>A	c.(2086-2088)gGt>gAt	p.G696D	RP4-680D5.8_ENST00000606186.1_RNA|DNAJC16_ENST00000375849.1_Intron|DNAJC16_ENST00000483270.1_3'UTR	NM_015291.2	NP_056106.1	Q9Y2G8	DJC16_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 16	696					cell redox homeostasis (GO:0045454)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(7)|urinary_tract(1)	18		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00173)|all_lung(284;0.00459)|Lung NSC(340;0.00499)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		GACTACACTGGTTATGTACTG	0.443																																					p.G696D		Atlas-SNP	.											.	DNAJC16	59	.	0			c.G2087A						PASS	.						148.0	134.0	139.0					1																	15894410		2203	4300	6503	SO:0001583	missense	23341	exon15			ACACTGGTTATGT	AB023179	CCDS30606.1, CCDS72710.1	1p36.1	2011-09-02			ENSG00000116138	ENSG00000116138		"""Heat shock proteins / DNAJ (HSP40)"""	29157	protein-coding gene	gene with protein product							Standard	NM_015291		Approved	KIAA0962	uc001aws.3	Q9Y2G8	OTTHUMG00000002358	ENST00000375847.3:c.2087G>A	chr1.hg19:g.15894410G>A	ENSP00000365007:p.Gly696Asp	162.0	0.0	.		123.0	26.0	.	NM_015291	Q68D57|Q86X32|Q8N5P4	Missense_Mutation	SNP	ENST00000375847.3	hg19	CCDS30606.1	.	.	.	.	.	.	.	.	.	.	G	31	5.059726	0.93846	.	.	ENSG00000116138	ENST00000375847	D	0.94417	-3.42	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	D	0.97173	0.9076	M	0.76170	2.325	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97352	0.9964	10	0.87932	D	0	-20.3895	18.8118	0.92061	0.0:0.0:1.0:0.0	.	696	Q9Y2G8	DJC16_HUMAN	D	696	ENSP00000365007:G696D	ENSP00000365007:G696D	G	+	2	0	DNAJC16	15766997	1.000000	0.71417	0.501000	0.27601	0.987000	0.75469	9.238000	0.95380	2.790000	0.95986	0.655000	0.94253	GGT	.	.	.	none		0.443	DNAJC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006764.1	NM_015291	
BAI2	576	hgsc.bcm.edu	37	1	32203282	32203282	+	Silent	SNP	G	G	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr1:32203282G>A	ENST00000373658.3	-	19	3188	c.2847C>T	c.(2845-2847)acC>acT	p.T949T	BAI2_ENST00000440175.2_Silent_p.T591T|BAI2_ENST00000398542.1_Silent_p.T882T|BAI2_ENST00000373655.2_Silent_p.T949T|BAI2_ENST00000257070.4_Silent_p.T949T|BAI2_ENST00000398547.1_Silent_p.T882T|BAI2_ENST00000398538.1_Silent_p.T937T|BAI2_ENST00000527361.1_Silent_p.T949T|BAI2_ENST00000398556.3_Silent_p.T897T|BAI2_ENST00000465256.1_5'Flank	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	949					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		TGGCGAGCAGGGTGAGCAGCG	0.667																																					p.T949T		Atlas-SNP	.											.	BAI2	128	.	0			c.C2847T						PASS	.						40.0	39.0	39.0					1																	32203282		2202	4299	6501	SO:0001819	synonymous_variant	576	exon19			GAGCAGGGTGAGC	AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.2847C>T	chr1.hg19:g.32203282G>A		59.0	0.0	.		56.0	22.0	.	NM_001703	B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Silent	SNP	ENST00000373658.3	hg19	CCDS346.2																																																																																			.	.	.	none		0.667	BAI2-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000381838.1	NM_001703	
ABCA4	24	hgsc.bcm.edu	37	1	94502837	94502837	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr1:94502837C>A	ENST00000370225.3	-	25	3763	c.3677G>T	c.(3676-3678)gGt>gTt	p.G1226V		NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	1226					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		AAGTTCTTGACCAATGCACTC	0.478																																					p.G1226V		Atlas-SNP	.											.	ABCA4	275	.	0			c.G3677T						PASS	.						120.0	117.0	118.0					1																	94502837		2203	4300	6503	SO:0001583	missense	24	exon25			TCTTGACCAATGC	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.3677G>T	chr1.hg19:g.94502837C>A	ENSP00000359245:p.Gly1226Val	161.0	0.0	.		80.0	14.0	.	NM_000350	O15112|O60438|O60915|Q0QD48|Q4LE31	Missense_Mutation	SNP	ENST00000370225.3	hg19	CCDS747.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.522436	0.85600	.	.	ENSG00000198691	ENST00000546054;ENST00000370225	T	0.80123	-1.34	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	D	0.90954	0.7156	H	0.96080	3.765	0.80722	D	1	D	0.56746	0.977	P	0.55011	0.766	D	0.93070	0.6482	10	0.87932	D	0	.	19.5916	0.95514	0.0:1.0:0.0:0.0	.	1226	P78363	ABCA4_HUMAN	V	18;1226	ENSP00000359245:G1226V	ENSP00000359245:G1226V	G	-	2	0	ABCA4	94275425	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	7.320000	0.79064	2.861000	0.98227	0.655000	0.94253	GGT	.	.	.	none		0.478	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350	
KCNA2	3737	hgsc.bcm.edu	37	1	111146524	111146524	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr1:111146524C>A	ENST00000485317.1	-	3	1554	c.881G>T	c.(880-882)cGt>cTt	p.R294L	KCNA2_ENST00000316361.4_Missense_Mutation_p.R294L|KCNA2_ENST00000440270.1_Missense_Mutation_p.R294L|KCNA2_ENST00000369770.3_Missense_Mutation_p.R294L|KCNA2_ENST00000525120.1_5'Flank			P16389	KCNA2_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 2	294					optic nerve structural organization (GO:0021633)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	juxtaparanode region of axon (GO:0044224)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	32		all_cancers(81;5.55e-06)|all_epithelial(167;1.87e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Colorectal(144;0.00878)|Lung(183;0.0234)|all cancers(265;0.0492)|Epithelial(280;0.0529)|COAD - Colon adenocarcinoma(174;0.131)|LUSC - Lung squamous cell carcinoma(189;0.133)|READ - Rectum adenocarcinoma(129;0.191)	Dalfampridine(DB06637)	CCGGATGACACGGAGGATGGC	0.537																																					p.R294L	Pancreas(18;568 735 10587 23710 36357)	Atlas-SNP	.											.	KCNA2	61	.	0			c.G881T						PASS	.						102.0	103.0	103.0					1																	111146524		2203	4300	6503	SO:0001583	missense	3737	exon3			ATGACACGGAGGA	L02752	CCDS827.1, CCDS55625.1	1p13	2012-07-05			ENSG00000177301	ENSG00000177301		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6220	protein-coding gene	gene with protein product		176262				16382104	Standard	NM_004974		Approved	Kv1.2, HK4	uc009wfw.3	P16389	OTTHUMG00000011567	ENST00000485317.1:c.881G>T	chr1.hg19:g.111146524C>A	ENSP00000433109:p.Arg294Leu	170.0	0.0	.		92.0	33.0	.	NM_001204269	Q86XG6	Missense_Mutation	SNP	ENST00000485317.1	hg19	CCDS827.1	.	.	.	.	.	.	.	.	.	.	C	16.76	3.212566	0.58452	.	.	ENSG00000177301	ENST00000369770;ENST00000485317;ENST00000440270;ENST00000316361	D;D;D;D	0.99005	-4.93;-5.32;-5.32;-5.32	5.87	5.87	0.94306	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99704	0.9887	H	0.98818	4.34	0.80722	D	1	D;D	0.71674	0.998;0.962	D;P	0.71414	0.973;0.748	D	0.97484	1.0049	10	0.87932	D	0	.	20.2182	0.98305	0.0:1.0:0.0:0.0	.	294;294	Q86XG6;P16389	.;KCNA2_HUMAN	L	294	ENSP00000358785:R294L;ENSP00000433109:R294L;ENSP00000415257:R294L;ENSP00000314520:R294L	ENSP00000314520:R294L	R	-	2	0	KCNA2	110948047	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	7.770000	0.85390	2.785000	0.95823	0.655000	0.94253	CGT	.	.	.	none		0.537	KCNA2-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128001.2	NM_004974	
SPAG17	200162	hgsc.bcm.edu	37	1	118535132	118535132	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr1:118535132A>T	ENST00000336338.5	-	36	5383	c.5318T>A	c.(5317-5319)gTc>gAc	p.V1773D		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1773						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		ATTCTTTATGACCTCATGCTG	0.473																																					p.V1773D		Atlas-SNP	.											.	SPAG17	263	.	0			c.T5318A						PASS	.						116.0	112.0	113.0					1																	118535132		2203	4300	6503	SO:0001583	missense	200162	exon36			TTTATGACCTCAT		CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.5318T>A	chr1.hg19:g.118535132A>T	ENSP00000337804:p.Val1773Asp	174.0	0.0	.		100.0	25.0	.	NM_206996	Q8NAZ1|Q9NT21	Missense_Mutation	SNP	ENST00000336338.5	hg19	CCDS899.1	.	.	.	.	.	.	.	.	.	.	A	18.16	3.562988	0.65538	.	.	ENSG00000155761	ENST00000336338;ENST00000437255	T	0.19105	2.17	5.38	3.1	0.35709	.	0.311094	0.33854	N	0.004486	T	0.13329	0.0323	L	0.54323	1.7	0.41943	D	0.990622	P	0.47677	0.899	P	0.48227	0.571	T	0.02301	-1.1180	10	0.66056	D	0.02	.	5.9646	0.19318	0.6602:0.0:0.3398:0.0	.	1773	Q6Q759	SPG17_HUMAN	D	1773;253	ENSP00000337804:V1773D	ENSP00000337804:V1773D	V	-	2	0	SPAG17	118336655	1.000000	0.71417	0.993000	0.49108	0.946000	0.59487	3.048000	0.49862	0.886000	0.36113	-0.250000	0.11733	GTC	.	.	.	none		0.473	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033723.1	NM_206996	
FMO4	2329	hgsc.bcm.edu	37	1	171303684	171303684	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr1:171303684T>C	ENST00000367749.3	+	8	1292	c.962T>C	c.(961-963)aTt>aCt	p.I321T		NM_002022.1	NP_002013.1	P31512	FMO4_HUMAN	flavin containing monooxygenase 4	321					drug catabolic process (GO:0042737)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	33	all_cancers(6;3.9e-08)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					GAAGAAAACATTGATGTTGTG	0.368																																					p.I321T	Pancreas(24;816 862 7754 7993 32832)	Atlas-SNP	.											.	FMO4	64	.	0			c.T962C						PASS	.						92.0	95.0	94.0					1																	171303684		2203	4300	6503	SO:0001583	missense	2329	exon8			AAAACATTGATGT	BC002780	CCDS1295.1	1q24.3	2011-08-04			ENSG00000076258	ENSG00000076258	1.14.13.8		3772	protein-coding gene	gene with protein product		136131		FMO2		8311461	Standard	NM_002022		Approved		uc001gho.3	P31512	OTTHUMG00000035506	ENST00000367749.3:c.962T>C	chr1.hg19:g.171303684T>C	ENSP00000356723:p.Ile321Thr	124.0	0.0	.		79.0	31.0	.	NM_002022	Q53XR0	Missense_Mutation	SNP	ENST00000367749.3	hg19	CCDS1295.1	.	.	.	.	.	.	.	.	.	.	T	18.64	3.668252	0.67814	.	.	ENSG00000076258	ENST00000367749	T	0.56941	0.43	5.63	4.47	0.54385	.	0.249916	0.40144	N	0.001171	T	0.72170	0.3427	M	0.93978	3.48	0.41142	D	0.985967	D	0.69078	0.997	D	0.77557	0.99	T	0.80176	-0.1491	10	0.87932	D	0	-9.0886	12.3662	0.55230	0.0:0.0:0.1412:0.8588	.	321	P31512	FMO4_HUMAN	T	321	ENSP00000356723:I321T	ENSP00000356723:I321T	I	+	2	0	FMO4	169570308	1.000000	0.71417	0.246000	0.24233	0.910000	0.53928	6.102000	0.71486	0.918000	0.36919	0.528000	0.53228	ATT	.	.	.	none		0.368	FMO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086223.1	NM_002022	
CEP350	9857	hgsc.bcm.edu	37	1	180063597	180063597	+	Missense_Mutation	SNP	A	A	T	rs573430116		TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr1:180063597A>T	ENST00000367607.3	+	34	8775	c.8357A>T	c.(8356-8358)cAg>cTg	p.Q2786L	CEP350_ENST00000490141.1_3'UTR	NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	2786					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						CTTAGCAATCAGGAGCTTCTT	0.388																																					p.Q2786L		Atlas-SNP	.											.	CEP350	418	.	0			c.A8357T						PASS	.						59.0	59.0	59.0					1																	180063597		2203	4300	6503	SO:0001583	missense	9857	exon34			GCAATCAGGAGCT	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.8357A>T	chr1.hg19:g.180063597A>T	ENSP00000356579:p.Gln2786Leu	37.0	0.0	.		47.0	16.0	.	NM_014810	O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	ENST00000367607.3	hg19	CCDS1336.1	.	.	.	.	.	.	.	.	.	.	A	17.39	3.377132	0.61735	.	.	ENSG00000135837	ENST00000367607;ENST00000417046	T	0.61859	0.07	5.31	5.31	0.75309	.	0.000000	0.44902	D	0.000414	T	0.70657	0.3249	M	0.72118	2.19	0.45662	D	0.998587	D;P	0.60160	0.987;0.935	D;P	0.67725	0.953;0.614	T	0.72007	-0.4420	9	.	.	.	.	9.4328	0.38620	0.9192:0.0:0.0808:0.0	.	2786;2786	E7EU22;Q5VT06	.;CE350_HUMAN	L	2786;250	ENSP00000356579:Q2786L	.	Q	+	2	0	CEP350	178330220	1.000000	0.71417	0.993000	0.49108	0.935000	0.57460	2.342000	0.43992	2.126000	0.65437	0.482000	0.46254	CAG	.	.	.	none		0.388	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810	
ADAM17	6868	hgsc.bcm.edu	37	2	9630624	9630624	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr2:9630624C>T	ENST00000310823.3	-	19	2339	c.2157G>A	c.(2155-2157)atG>atA	p.M719I	IAH1_ENST00000545602.1_Intron	NM_003183.4	NP_003174.3	P78536	ADA17_HUMAN	ADAM metallopeptidase domain 17	719					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell motility (GO:0048870)|collagen catabolic process (GO:0030574)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|germinal center formation (GO:0002467)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil mediated immunity (GO:0002446)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of chemokine production (GO:0032722)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|proteolysis (GO:0006508)|regulation of mast cell apoptotic process (GO:0033025)|response to drug (GO:0042493)|response to high density lipoprotein particle (GO:0055099)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|wound healing, spreading of epidermal cells (GO:0035313)	actin cytoskeleton (GO:0015629)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|interleukin-6 receptor binding (GO:0005138)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|Notch binding (GO:0005112)|PDZ domain binding (GO:0030165)|zinc ion binding (GO:0008270)			breast(1)|cervix(4)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)	28	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.225)		ATGCAGAATCCATGCTGCTCA	0.537																																					p.M719I		Atlas-SNP	.											.	ADAM17	61	.	0			c.G2157A						PASS	.						54.0	51.0	52.0					2																	9630624		2203	4300	6503	SO:0001583	missense	6868	exon19			AGAATCCATGCTG	U69611	CCDS1665.1	2p25	2010-08-05	2008-07-31		ENSG00000151694	ENSG00000151694		"""ADAM metallopeptidase domain containing"", ""CD molecules"""	195	protein-coding gene	gene with protein product		603639	"""tumor necrosis factor, alpha, converting enzyme"""	TACE		9034190, 9574564	Standard	NM_003183		Approved	cSVP, CD156B	uc002qzu.3	P78536	OTTHUMG00000090425	ENST00000310823.3:c.2157G>A	chr2.hg19:g.9630624C>T	ENSP00000309968:p.Met719Ile	50.0	0.0	.		55.0	11.0	.	NM_003183	O60226	Missense_Mutation	SNP	ENST00000310823.3	hg19	CCDS1665.1	.	.	.	.	.	.	.	.	.	.	C	9.835	1.189343	0.21954	.	.	ENSG00000151694	ENST00000310823	T	0.19806	2.12	5.46	5.46	0.80206	.	0.145332	0.64402	N	0.000007	T	0.14399	0.0348	N	0.12182	0.205	0.80722	D	1	B;B;B	0.13145	0.0;0.007;0.007	B;B;B	0.12156	0.0;0.007;0.007	T	0.11792	-1.0573	10	0.19590	T	0.45	.	19.3715	0.94490	0.0:1.0:0.0:0.0	.	438;719;719	Q53RS1;B2RNB2;P78536	.;.;ADA17_HUMAN	I	719	ENSP00000309968:M719I	ENSP00000309968:M719I	M	-	3	0	ADAM17	9548075	1.000000	0.71417	1.000000	0.80357	0.113000	0.19764	2.684000	0.46951	2.570000	0.86706	0.456000	0.33151	ATG	.	.	.	none		0.537	ADAM17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206857.1		
TTC7A	57217	hgsc.bcm.edu	37	2	47300864	47300864	+	Silent	SNP	C	C	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr2:47300864C>T	ENST00000319190.5	+	20	2747	c.2379C>T	c.(2377-2379)ggC>ggT	p.G793G	TTC7A_ENST00000263737.6_Silent_p.G439G|RP11-761B3.1_ENST00000422269.1_Intron|AC073283.7_ENST00000421759.1_RNA|TTC7A_ENST00000394850.2_Silent_p.G817G|C2orf61_ENST00000464527.2_Intron|TTC7A_ENST00000409245.1_Silent_p.G759G	NM_020458.2	NP_065191.2	Q9ULT0	TTC7A_HUMAN	tetratricopeptide repeat domain 7A	793					cellular iron ion homeostasis (GO:0006879)|hemopoiesis (GO:0030097)					breast(4)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	25		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)			GTCGGCTGGGCCACAAGAGCT	0.652																																					p.G793G		Atlas-SNP	.											.	TTC7A	80	.	0			c.C2379T						PASS	.						66.0	61.0	63.0					2																	47300864		2203	4300	6503	SO:0001819	synonymous_variant	57217	exon20			GCTGGGCCACAAG	AB032966	CCDS33193.1, CCDS74510.1, CCDS74511.1	2p16.3	2013-01-10	2004-06-02	2004-06-02	ENSG00000068724	ENSG00000068724		"""Tetratricopeptide (TTC) repeat domain containing"""	19750	protein-coding gene	gene with protein product		609332	"""tetratricopeptide repeat domain 7"""	TTC7		10574461	Standard	XM_005264439		Approved	KIAA1140	uc002rvo.3	Q9ULT0	OTTHUMG00000153121	ENST00000319190.5:c.2379C>T	chr2.hg19:g.47300864C>T		111.0	0.0	.		62.0	24.0	.	NM_020458	Q6PIX4|Q8ND67|Q9BUS3	Silent	SNP	ENST00000319190.5	hg19	CCDS33193.1																																																																																			.	.	.	none		0.652	TTC7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329667.2	XM_372927	
SPTBN1	6711	hgsc.bcm.edu	37	2	54876308	54876308	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr2:54876308A>G	ENST00000356805.4	+	25	5464	c.5183A>G	c.(5182-5184)cAg>cGg	p.Q1728R	SPTBN1_ENST00000333896.5_Missense_Mutation_p.Q1715R	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	1728	Interaction with ANK2.				actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			GAACTGGGACAGGACTATGAG	0.552																																					p.Q1728R		Atlas-SNP	.											.	SPTBN1	378	.	0			c.A5183G						PASS	.						82.0	70.0	74.0					2																	54876308		2203	4300	6503	SO:0001583	missense	6711	exon25			TGGGACAGGACTA		CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.5183A>G	chr2.hg19:g.54876308A>G	ENSP00000349259:p.Gln1728Arg	75.0	0.0	.		74.0	4.0	.	NM_003128	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Missense_Mutation	SNP	ENST00000356805.4	hg19	CCDS33198.1	.	.	.	.	.	.	.	.	.	.	A	28.6	4.936737	0.92458	.	.	ENSG00000115306	ENST00000356805;ENST00000333896	T;T	0.48201	0.82;0.82	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.73385	0.3580	M	0.86343	2.81	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.83275	0.985;0.996	T	0.77840	-0.2438	10	0.59425	D	0.04	.	16.2826	0.82703	1.0:0.0:0.0:0.0	.	1715;1728	Q01082-3;Q01082	.;SPTB2_HUMAN	R	1728;1715	ENSP00000349259:Q1728R;ENSP00000334156:Q1715R	ENSP00000334156:Q1715R	Q	+	2	0	SPTBN1	54729812	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.281000	0.95811	2.253000	0.74438	0.454000	0.30748	CAG	.	.	.	none		0.552	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3		
IL1R2	7850	hgsc.bcm.edu	37	2	102626224	102626224	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr2:102626224G>T	ENST00000332549.3	+	3	497	c.268G>T	c.(268-270)Gac>Tac	p.D90Y	IL1R2_ENST00000393414.2_Missense_Mutation_p.D90Y|IL1R2_ENST00000441002.1_Missense_Mutation_p.D90Y	NM_004633.3	NP_004624.1	P27930	IL1R2_HUMAN	interleukin 1 receptor, type II	90	Ig-like C2-type 1.				cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)			breast(3)|endometrium(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)	28						GTGGGCCCAGGACGGTGCTCT	0.597																																					p.D90Y	Pancreas(106;189 1628 2302 5133 12295)	Atlas-SNP	.											.	IL1R2	58	.	0			c.G268T						PASS	.						139.0	147.0	145.0					2																	102626224		2203	4300	6503	SO:0001583	missense	7850	exon3			GCCCAGGACGGTG	X59770	CCDS2054.1, CCDS58719.1	2q12	2013-01-11			ENSG00000115590	ENSG00000115590		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5994	protein-coding gene	gene with protein product		147811		IL1RB		10191101, 1833184	Standard	NM_004633		Approved	CD121b	uc002tbm.3	P27930	OTTHUMG00000130695	ENST00000332549.3:c.268G>T	chr2.hg19:g.102626224G>T	ENSP00000330959:p.Asp90Tyr	359.0	1.0	.		270.0	85.0	.	NM_001261419	D3DVJ5|Q6LCE6|Q9UE68	Missense_Mutation	SNP	ENST00000332549.3	hg19	CCDS2054.1	.	.	.	.	.	.	.	.	.	.	G	11.68	1.711212	0.30322	.	.	ENSG00000115590	ENST00000332549;ENST00000393414;ENST00000457817;ENST00000441002	T;T;T;T	0.62788	0.0;0.0;0.0;0.0	5.8	4.92	0.64577	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.512100	0.21363	N	0.075776	T	0.59770	0.2218	M	0.76002	2.32	0.09310	N	1	B	0.16396	0.017	B	0.14023	0.01	T	0.57039	-0.7879	10	0.56958	D	0.05	.	7.7685	0.28993	0.0807:0.0:0.756:0.1633	.	90	P27930	IL1R2_HUMAN	Y	90	ENSP00000330959:D90Y;ENSP00000377066:D90Y;ENSP00000408415:D90Y;ENSP00000414611:D90Y	ENSP00000330959:D90Y	D	+	1	0	IL1R2	101992656	0.347000	0.24853	0.015000	0.15790	0.125000	0.20455	1.279000	0.33191	1.466000	0.48025	-0.268000	0.10319	GAC	.	.	.	none		0.597	IL1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253191.1	NM_004633	
SLC4A10	57282	hgsc.bcm.edu	37	2	162711596	162711597	+	Missense_Mutation	DNP	CT	CT	AG			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C|T	C|T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr2:162711596_162711597CT>AG	ENST00000446997.1	+	5	626_627	c.533_534CT>AG	c.(532-534)aCT>aAG	p.T178K	SLC4A10_ENST00000535165.1_Missense_Mutation_p.T178K|SLC4A10_ENST00000272716.5_Missense_Mutation_p.T178K|SLC4A10_ENST00000375514.5_Missense_Mutation_p.T189K|SLC4A10_ENST00000421911.1_Missense_Mutation_p.T178K|SLC4A10_ENST00000493021.1_3'UTR|SLC4A10_ENST00000415876.2_Missense_Mutation_p.T178K	NM_001178015.1	NP_001171486.1	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate transporter, member 10	178					bicarbonate transport (GO:0015701)|chloride transport (GO:0006821)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|symporter activity (GO:0015293)			endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(35)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60					Sodium bicarbonate(DB01390)	CTGAATGGAACTGTGTTGCTGG	0.396																																					p.T189N|p.T189T		Atlas-SNP	.											.	SLC4A10	309	.	0			c.C566A|c.T567G						PASS	.																																			SO:0001583	missense	57282	exon6			ATGGAACTGTGTT|TGGAACTGTGTTG		CCDS46438.1, CCDS54411.1, CCDS54412.1	2q24.2	2013-05-22	2008-09-15		ENSG00000144290	ENSG00000144290		"""Solute carriers"""	13811	protein-coding gene	gene with protein product		605556	"""solute carrier family 4, sodium bicarbonate transporter-like, member 10"""			10964153, 18319254	Standard	NM_022058		Approved	NBCn2, NCBE	uc002ubx.4	Q6U841	OTTHUMG00000153938	Exception_encountered	chr2.hg19:g.162711596_162711597delinsAG	ENSP00000393066:p.Thr178Lys	82.0|83.0	0.0	.		77.0|76.0	33.0	.	NM_001178016	B7Z1R0|B7Z2J0|B7ZLC5|B9EG69|F8W675|Q4ZFX6|Q8TCP2|Q9HCQ6	Missense_Mutation|Silent	SNP	ENST00000446997.1	hg19	CCDS54411.1																																																																																			.	.	.	none		0.396	SLC4A10-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333090.1	NM_022058	
UGT1A9	54600	hgsc.bcm.edu	37	2	234580748	234580748	+	Silent	SNP	T	T	C			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr2:234580748T>C	ENST00000354728.4	+	1	250	c.168T>C	c.(166-168)gtT>gtC	p.V56V	UGT1A1_ENST00000609637.1_Silent_p.V56V|UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A10_ENST00000373445.1_Intron			O60656	UD19_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A9	56					cellular glucuronidation (GO:0052695)|cellular lipid metabolic process (GO:0044255)|drug metabolic process (GO:0017144)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|metabolic process (GO:0008152)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of fatty acid metabolic process (GO:0045922)|retinoic acid metabolic process (GO:0042573)|small molecule metabolic process (GO:0044281)|xenobiotic glucuronidation (GO:0052697)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)	p.V56V(1)		breast(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	37		Breast(86;0.000766)|all_lung(227;0.00269)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0331)|Lung NSC(271;0.0459)|Lung SC(224;0.128)		Epithelial(121;1.26e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000436)|Lung(119;0.00347)|LUSC - Lung squamous cell carcinoma(224;0.00757)	Acetaminophen(DB00316)|Buprenorphine(DB00921)|Canagliflozin(DB08907)|Dabigatran etexilate(DB06695)|Dapagliflozin(DB06292)|Entacapone(DB00494)|Etodolac(DB00749)|Ezogabine(DB04953)|Flurbiprofen(DB00712)|Haloperidol(DB00502)|Human Serum Albumin(DB00062)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ketobemidone(DB06738)|Lumiracoxib(DB01283)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Nateglinide(DB00731)|Niflumic Acid(DB04552)|Oxazepam(DB00842)|Propofol(DB00818)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sulfamethoxazole(DB01015)|Tapentadol(DB06204)|Valproic Acid(DB00313)|Zileuton(DB00744)	ATGAGGTGGTTGTAGTCATGC	0.532																																					p.V56V		Atlas-SNP	.											UGT1A9,NS,carcinoma,0,1	UGT1A9	79	.	1	Substitution - coding silent(1)	kidney(1)	c.T168C						PASS	.						100.0	85.0	90.0					2																	234580748		2203	4300	6503	SO:0001819	synonymous_variant	54600	exon1			GGTGGTTGTAGTC	AF056188	CCDS2505.1	2q37	2010-03-05	2005-07-20		ENSG00000241119	ENSG00000241119		"""UDP glucuronosyltransferases"""	12541	other	complex locus constituent		606434	"""UDP glycosyltransferase 1 family, polypeptide A9"""			9295054, 1910331	Standard	NM_021027		Approved	HLUGP4, LUGP4, UGT1AI		O60656	OTTHUMG00000059124	ENST00000354728.4:c.168T>C	chr2.hg19:g.234580748T>C		107.0	1.0	.		96.0	4.0	.	NM_021027	B8K285|P36509|Q9HAX0	Silent	SNP	ENST00000354728.4	hg19	CCDS2505.1																																																																																			.	.	.	none		0.532	UGT1A9-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130995.1	NM_021027	
STAC	6769	hgsc.bcm.edu	37	3	36587768	36587768	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr3:36587768T>G	ENST00000273183.3	+	11	1496	c.1196T>G	c.(1195-1197)cTa>cGa	p.L399R	STAC_ENST00000457375.2_Missense_Mutation_p.L338R	NM_003149.1	NP_003140.1	Q99469	STAC_HUMAN	SH3 and cysteine rich domain	399					cellular response to heat (GO:0034605)|intracellular signal transduction (GO:0035556)|signal transduction (GO:0007165)	cytosol (GO:0005829)	metal ion binding (GO:0046872)			endometrium(5)|large_intestine(9)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(5)	32						CTTGATGTACTAGAAAACATC	0.493																																					p.L399R		Atlas-SNP	.											.	STAC	78	.	0			c.T1196G						PASS	.						151.0	131.0	138.0					3																	36587768		2203	4300	6503	SO:0001583	missense	6769	exon11			ATGTACTAGAAAA	D86640	CCDS2662.1	3p22.3	2007-06-08			ENSG00000144681	ENSG00000144681			11353	protein-coding gene	gene with protein product		602317	"""src homology three (SH3) and cysteine rich domain"""			8954993, 10393425	Standard	XM_006713308		Approved	STAC1	uc003cgh.1	Q99469	OTTHUMG00000130798	ENST00000273183.3:c.1196T>G	chr3.hg19:g.36587768T>G	ENSP00000273183:p.Leu399Arg	86.0	0.0	.		80.0	62.0	.	NM_003149	B2R8S8	Missense_Mutation	SNP	ENST00000273183.3	hg19	CCDS2662.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.126023	0.77436	.	.	ENSG00000144681	ENST00000273183;ENST00000457375;ENST00000544687	T;T	0.09445	2.98;2.98	5.17	5.17	0.71159	Src homology-3 domain (1);Variant SH3 (1);	0.074155	0.56097	D	0.000036	T	0.33904	0.0879	M	0.78801	2.425	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.10200	-1.0640	10	0.87932	D	0	.	13.5546	0.61751	0.0:0.0:0.0:1.0	.	338;399	E9PEA7;Q99469	.;STAC_HUMAN	R	399;338;331	ENSP00000273183:L399R;ENSP00000393713:L338R	ENSP00000273183:L399R	L	+	2	0	STAC	36562772	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	5.936000	0.70153	2.074000	0.62210	0.533000	0.62120	CTA	.	.	.	none		0.493	STAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253338.2	NM_003149	
SETD2	29072	hgsc.bcm.edu	37	3	47061276	47061276	+	Nonsense_Mutation	SNP	T	T	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr3:47061276T>A	ENST00000409792.3	-	19	7447	c.7405A>T	c.(7405-7407)Aaa>Taa	p.K2469*		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2469	Interaction with POLR2A.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TCTTTGCTTTTCTTTGCTAGT	0.428			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.K2469X		Atlas-SNP	.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2	721	.	0			c.A7405T						PASS	.						286.0	251.0	263.0					3																	47061276		2203	4300	6503	SO:0001587	stop_gained	29072	exon19			TGCTTTTCTTTGC	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.7405A>T	chr3.hg19:g.47061276T>A	ENSP00000386759:p.Lys2469*	151.0	1.0	.		85.0	72.0	.	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Nonsense_Mutation	SNP	ENST00000409792.3	hg19	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	T	48	14.332947	0.99790	.	.	ENSG00000181555	ENST00000451092;ENST00000409792	.	.	.	5.64	5.64	0.86602	.	0.000000	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.6824	0.77381	0.0:0.0:0.0:1.0	.	.	.	.	X	2469	.	ENSP00000386759:K2469X	K	-	1	0	SETD2	47036280	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.701000	0.84566	2.367000	0.80283	0.528000	0.53228	AAA	.	.	.	none		0.428	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
NPRL2	10641	hgsc.bcm.edu	37	3	50386372	50386372	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr3:50386372T>A	ENST00000232501.3	-	5	956	c.518A>T	c.(517-519)gAt>gTt	p.D173V	CYB561D2_ENST00000418577.1_5'Flank|NPRL2_ENST00000493465.1_5'Flank|ZMYND10_ENST00000231749.3_5'Flank|CYB561D2_ENST00000232508.5_5'Flank|XXcos-LUCA11.5_ENST00000606589.1_5'Flank|CYB561D2_ENST00000424512.1_5'Flank|CYB561D2_ENST00000425346.1_5'Flank	NM_006545.4	NP_006536.3	Q8WTW4	NPRL2_HUMAN	nitrogen permease regulator-like 2 (S. cerevisiae)	173					negative regulation of kinase activity (GO:0033673)|protein phosphorylation (GO:0006468)		GTPase activator activity (GO:0005096)|protein kinase activity (GO:0004672)			breast(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|urinary_tract(1)	11						GACAGGTACATCATACTCCTG	0.537																																					p.D173V		Atlas-SNP	.											NPRL2,NS,carcinoma,0,1	NPRL2	27	.	0			c.A518T						PASS	.						133.0	126.0	128.0					3																	50386372		2203	4300	6503	SO:0001583	missense	10641	exon5			GGTACATCATACT	AF040708	CCDS2826.1	3p21.3	2010-03-30	2010-03-30	2010-03-30	ENSG00000114388	ENSG00000114388			24969	protein-coding gene	gene with protein product		607072	"""tumor suppressor candidate 4"""	TUSC4		11085536	Standard	NM_006545		Approved	NPR2L, NPR2	uc003daj.1	Q8WTW4	OTTHUMG00000156864	ENST00000232501.3:c.518A>T	chr3.hg19:g.50386372T>A	ENSP00000232501:p.Asp173Val	165.0	1.0	.		149.0	107.0	.	NM_006545	A8K831|Q6FGS2|Q9Y249|Q9Y497	Missense_Mutation	SNP	ENST00000232501.3	hg19	CCDS2826.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.945242	0.73672	.	.	ENSG00000114388	ENST00000232501	.	.	.	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.72534	0.3472	M	0.80422	2.495	0.80722	D	1	P	0.51057	0.941	P	0.51016	0.656	T	0.73113	-0.4085	9	0.30854	T	0.27	-20.1441	15.7486	0.77967	0.0:0.0:0.0:1.0	.	173	Q8WTW4	NPRL2_HUMAN	V	173	.	ENSP00000232501:D173V	D	-	2	0	NPRL2	50361376	1.000000	0.71417	0.990000	0.47175	0.940000	0.58332	7.968000	0.87980	2.122000	0.65172	0.533000	0.62120	GAT	.	.	.	none		0.537	NPRL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346299.1	NM_006545	
BAP1	8314	hgsc.bcm.edu	37	3	52441190	52441190	+	Splice_Site	SNP	C	C	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr3:52441190C>T	ENST00000460680.1	-	7	1051	c.580G>A	c.(580-582)Ggg>Agg	p.G194R	BAP1_ENST00000296288.5_Splice_Site_p.G194R	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.?(1)		NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		TGGTGCCTACCATGGTCAATG	0.597			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.G194R	GBM(101;493 1458 7992 21037 25532)	Atlas-SNP	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	.	BAP1	371	.	1	Unknown(1)	eye(1)	c.G580A						PASS	.						59.0	57.0	58.0					3																	52441190		2203	4300	6503	SO:0001630	splice_region_variant	8314	exon7			GCCTACCATGGTC	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.580+1G>A	chr3.hg19:g.52441190C>T		66.0	0.0	.		52.0	34.0	.	NM_004656	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Missense_Mutation	SNP	ENST00000460680.1	hg19	CCDS2853.1	.	.	.	.	.	.	.	.	.	.	C	35	5.425433	0.96131	.	.	ENSG00000163930	ENST00000460680;ENST00000296288	T;T	0.66995	-0.24;-0.24	6.05	6.05	0.98169	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (3);	0.000000	0.85682	D	0.000000	D	0.86756	0.6009	M	0.91038	3.17	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87932	0.2711	10	0.66056	D	0.02	-7.544	20.6086	0.99469	0.0:1.0:0.0:0.0	.	194	Q92560	BAP1_HUMAN	R	194	ENSP00000417132:G194R;ENSP00000296288:G194R	ENSP00000296288:G194R	G	-	1	0	BAP1	52416230	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.783000	0.85696	2.880000	0.98712	0.655000	0.94253	GGG	.	.	.	none		0.597	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		Missense_Mutation
ZBTB11	27107	hgsc.bcm.edu	37	3	101378652	101378652	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr3:101378652G>C	ENST00000312938.4	-	6	2601	c.2021C>G	c.(2020-2022)aCa>aGa	p.T674R	Y_RNA_ENST00000364251.1_RNA	NM_014415.3	NP_055230.2	O95625	ZBT11_HUMAN	zinc finger and BTB domain containing 11	674					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						CTTTACACCTGTGTGCTTTAA	0.373																																					p.T674R		Atlas-SNP	.											.	ZBTB11	77	.	0			c.C2021G						PASS	.						118.0	117.0	117.0					3																	101378652		2203	4300	6503	SO:0001583	missense	27107	exon6			ACACCTGTGTGCT	U69274	CCDS2943.1	3q12.3	2013-01-09			ENSG00000066422	ENSG00000066422		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	16740	protein-coding gene	gene with protein product							Standard	NM_014415		Approved	ZNF-U69274, ZNF913	uc003dve.4	O95625	OTTHUMG00000159133	ENST00000312938.4:c.2021C>G	chr3.hg19:g.101378652G>C	ENSP00000326200:p.Thr674Arg	125.0	0.0	.		99.0	36.0	.	NM_014415	Q2NKP9	Missense_Mutation	SNP	ENST00000312938.4	hg19	CCDS2943.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.560004	0.86335	.	.	ENSG00000066422	ENST00000312938	T	0.25749	1.78	5.09	5.09	0.68999	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.054542	0.64402	D	0.000001	T	0.47838	0.1467	L	0.52206	1.635	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.48103	-0.9064	10	0.87932	D	0	-12.7873	18.48	0.90808	0.0:0.0:1.0:0.0	.	674	O95625	ZBT11_HUMAN	R	674	ENSP00000326200:T674R	ENSP00000326200:T674R	T	-	2	0	ZBTB11	102861342	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.181000	0.94874	2.387000	0.81309	0.491000	0.48974	ACA	.	.	.	none		0.373	ZBTB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353441.2	NM_014415	
KCTD8	386617	hgsc.bcm.edu	37	4	44450342	44450342	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr4:44450342C>T	ENST00000360029.3	-	1	482	c.199G>A	c.(199-201)Gac>Aac	p.D67N	AC131951.1_ENST00000584757.1_RNA	NM_198353.2	NP_938167.1	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerization domain containing 8	67	BTB.				protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)				central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(3)|upper_aerodigestive_tract(4)	41						AAAGTACTGTCCGGGACGCTG	0.682										HNSCC(17;0.042)																											p.D67N		Atlas-SNP	.											.	KCTD8	96	.	0			c.G199A						PASS	.						25.0	21.0	22.0					4																	44450342		2190	4277	6467	SO:0001583	missense	386617	exon1			TACTGTCCGGGAC	AK123347	CCDS3467.1	4p13	2013-06-20	2013-06-20		ENSG00000183783	ENSG00000183783			22394	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 8"""				Standard	NM_198353		Approved		uc003gwu.3	Q6ZWB6	OTTHUMG00000099409	ENST00000360029.3:c.199G>A	chr4.hg19:g.44450342C>T	ENSP00000353129:p.Asp67Asn	23.0	0.0	.		36.0	14.0	.	NM_198353	A2RU39	Missense_Mutation	SNP	ENST00000360029.3	hg19	CCDS3467.1	.	.	.	.	.	.	.	.	.	.	C	16.67	3.187972	0.57909	.	.	ENSG00000183783	ENST00000360029	T	0.46451	0.87	3.59	3.59	0.41128	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.64402	D	0.000001	T	0.34337	0.0894	L	0.28014	0.82	0.58432	D	0.999992	B	0.31640	0.333	B	0.37091	0.241	T	0.28902	-1.0029	10	0.42905	T	0.14	.	14.3619	0.66779	0.0:1.0:0.0:0.0	.	67	Q6ZWB6	KCTD8_HUMAN	N	67	ENSP00000353129:D67N	ENSP00000353129:D67N	D	-	1	0	KCTD8	44145099	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.682000	0.68182	1.810000	0.52873	0.467000	0.42956	GAC	.	.	.	none		0.682	KCTD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216868.1		
CDC20B	166979	hgsc.bcm.edu	37	5	54429246	54429246	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr5:54429246C>A	ENST00000381375.2	-	6	836	c.691G>T	c.(691-693)Gac>Tac	p.D231Y	CDC20B_ENST00000296733.1_Missense_Mutation_p.D231Y|CDC20B_ENST00000334206.5_Missense_Mutation_p.D231Y|CDC20B_ENST00000322374.6_Missense_Mutation_p.D231Y			Q86Y33	CD20B_HUMAN	cell division cycle 20B	231										kidney(1)|large_intestine(5)|lung(7)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	19		Lung NSC(810;0.000744)|Breast(144;0.159)|Prostate(74;0.194)	LUSC - Lung squamous cell carcinoma(15;0.225)			TTACAGTAGTCATTTCGAAGA	0.353																																					p.D231Y		Atlas-SNP	.											.	CDC20B	61	.	0			c.G691T						PASS	.						99.0	100.0	100.0					5																	54429246		2203	4300	6503	SO:0001583	missense	166979	exon6			AGTAGTCATTTCG	AB086378	CCDS3966.1, CCDS47207.1, CCDS54852.1	5q11.2	2013-01-17	2013-01-17		ENSG00000164287	ENSG00000164287		"""WD repeat domain containing"""	24222	protein-coding gene	gene with protein product			"""CDC20 cell division cycle 20 homolog B (S. cerevisiae)"", ""cell division cycle 20 homolog B (S. cerevisiae)"""				Standard	NM_152623		Approved	FLJ37927	uc003jpo.2	Q86Y33	OTTHUMG00000131185	ENST00000381375.2:c.691G>T	chr5.hg19:g.54429246C>A	ENSP00000370781:p.Asp231Tyr	139.0	0.0	.		99.0	37.0	.	NM_001170402	B7WNV8|B9EGL8|C9J6X8|C9JHE9|C9JKL5|Q86Y31|Q86Y32|Q8IUZ8|Q8N1S1|Q8NG56	Missense_Mutation	SNP	ENST00000381375.2	hg19	CCDS54852.1	.	.	.	.	.	.	.	.	.	.	C	18.52	3.642068	0.67244	.	.	ENSG00000164287	ENST00000334206;ENST00000296733;ENST00000381375;ENST00000322374	T;T;T;T	0.10099	2.91;2.91;2.91;2.91	4.97	4.1	0.47936	WD40 repeat-like-containing domain (1);	0.000000	0.49305	D	0.000156	T	0.41789	0.1174	M	0.93328	3.405	0.80722	D	1	D;D;P;D	0.89917	0.999;0.97;0.949;1.0	D;P;P;D	0.74348	0.976;0.808;0.648;0.983	T	0.56607	-0.7951	10	0.87932	D	0	-6.0811	13.2244	0.59907	0.0:0.9223:0.0:0.0777	.	231;231;231;231	Q86Y33-4;Q86Y33-3;Q86Y33;Q86Y33-2	.;.;CD20B_HUMAN;.	Y	231	ENSP00000335664:D231Y;ENSP00000296733:D231Y;ENSP00000370781:D231Y;ENSP00000315720:D231Y	ENSP00000296733:D231Y	D	-	1	0	CDC20B	54465003	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.180000	0.65048	1.303000	0.44873	0.650000	0.86243	GAC	.	.	.	none		0.353	CDC20B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369715.1	NM_152623	
OTP	23440	hgsc.bcm.edu	37	5	76932809	76932809	+	Missense_Mutation	SNP	G	G	C	rs148662448	byFrequency	TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr5:76932809G>C	ENST00000306422.3	-	2	1422	c.284C>G	c.(283-285)gCc>gGc	p.A95G	OTP_ENST00000515716.1_5'UTR	NM_032109.2	NP_115485.1	Q5XKR4	OTP_HUMAN	orthopedia homeobox	95					forebrain neuron differentiation (GO:0021879)|hypothalamus cell differentiation (GO:0021979)|neurohypophysis development (GO:0021985)|positive regulation of neuroblast proliferation (GO:0002052)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|pancreas(1)	13		all_lung(232;0.00051)|Lung NSC(167;0.000601)|Ovarian(174;0.0105)|Prostate(461;0.214)		OV - Ovarian serous cystadenocarcinoma(54;9.04e-51)|Epithelial(54;1.62e-45)|all cancers(79;4.4e-41)		CTGCTGGCCGGCTTGGCTGGG	0.677																																					p.A95G		Atlas-SNP	.											.	OTP	29	.	0			c.C284G						PASS	.						56.0	64.0	61.0					5																	76932809		2203	4300	6503	SO:0001583	missense	23440	exon2			TGGCCGGCTTGGC		CCDS4039.1	5q14.1	2011-06-20	2007-02-15		ENSG00000171540	ENSG00000171540		"""Homeoboxes / PRD class"""	8518	protein-coding gene	gene with protein product		604529	"""orthopedia homolog (Drosophila)"""			10458915	Standard	NM_032109		Approved		uc003kfg.3	Q5XKR4	OTTHUMG00000102171	ENST00000306422.3:c.284C>G	chr5.hg19:g.76932809G>C	ENSP00000302814:p.Ala95Gly	141.0	0.0	.		152.0	49.0	.	NM_032109		Missense_Mutation	SNP	ENST00000306422.3	hg19	CCDS4039.1	.	.	.	.	.	.	.	.	.	.	G	17.92	3.506573	0.64410	.	.	ENSG00000171540	ENST00000306422	D	0.95588	-3.75	5.42	4.53	0.55603	Homeodomain-related (1);Homeodomain-like (1);	1.125700	0.06735	N	0.777347	D	0.90143	0.6920	N	0.08118	0	0.36166	D	0.848472	B	0.06786	0.001	B	0.04013	0.001	T	0.76332	-0.2998	10	0.21014	T	0.42	.	15.0725	0.72049	0.0:0.1428:0.8572:0.0	.	95	Q5XKR4	OTP_HUMAN	G	95	ENSP00000302814:A95G	ENSP00000302814:A95G	A	-	2	0	OTP	76968565	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	4.154000	0.58125	1.376000	0.46267	0.655000	0.94253	GCC	.	G|0.995;A|0.005	.	alt		0.677	OTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220016.2		
AFF4	27125	hgsc.bcm.edu	37	5	132270292	132270292	+	Silent	SNP	T	T	G			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr5:132270292T>G	ENST00000265343.5	-	3	844	c.465A>C	c.(463-465)tcA>tcC	p.S155S	AFF4_ENST00000491831.1_5'UTR|AFF4_ENST00000378595.3_Silent_p.S155S	NM_014423.3	NP_055238.1	Q9UHB7	AFF4_HUMAN	AF4/FMR2 family, member 4	155	Ser-rich.				spermatid development (GO:0007286)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	sequence-specific DNA binding transcription factor activity (GO:0003700)		SEPT8/AFF4(2)	breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(7)|lung(11)|ovary(3)|pancreas(1)|prostate(3)|skin(2)	43		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TATTGTTATATGACTCACGGT	0.522																																					p.S155S	Ovarian(126;889 1733 2942 10745 11605)	Atlas-SNP	.											.	AFF4	120	.	0			c.A465C						PASS	.						146.0	141.0	143.0					5																	132270292		2203	4300	6503	SO:0001819	synonymous_variant	27125	exon3			GTTATATGACTCA	AF197927	CCDS4164.1	5q31	2006-04-28			ENSG00000072364	ENSG00000072364			17869	protein-coding gene	gene with protein product	"""ALL1 fused gene from 5q31"""	604417				10588740	Standard	XM_005271963		Approved	AF5Q31, MCEF	uc003kyd.3	Q9UHB7	OTTHUMG00000059838	ENST00000265343.5:c.465A>C	chr5.hg19:g.132270292T>G		183.0	0.0	.		147.0	65.0	.	NM_014423	B2RP19|B7WPD2|Q498B2|Q59FB3|Q6P592|Q8TDR1|Q9P0E4	Silent	SNP	ENST00000265343.5	hg19	CCDS4164.1																																																																																			.	.	.	none		0.522	AFF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133049.1	NM_014423	
CDHR2	54825	hgsc.bcm.edu	37	5	175995765	175995765	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr5:175995765G>T	ENST00000510636.1	+	4	485	c.211G>T	c.(211-213)Gct>Tct	p.A71S	CDHR2_ENST00000506348.1_Missense_Mutation_p.A71S|CDHR2_ENST00000261944.5_Missense_Mutation_p.A71S	NM_001171976.1	NP_001165447.1	Q9BYE9	CDHR2_HUMAN	cadherin-related family member 2	71	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|liver(1)|lung(23)|ovary(3)|prostate(5)|skin(4)|urinary_tract(1)	56						CTACTTCTTCGCTGTCACTCC	0.612																																					p.A71S		Atlas-SNP	.											CDHR2,colon,carcinoma,0,1	CDHR2	152	.	0			c.G211T						PASS	.						93.0	92.0	92.0					5																	175995765		2203	4300	6503	SO:0001583	missense	54825	exon4			TTCTTCGCTGTCA	AB047004	CCDS34297.1	5q35.2	2011-07-01	2010-01-25	2010-01-25		ENSG00000074276		"""Cadherins / Cadherin-related"""	18231	protein-coding gene	gene with protein product	"""protocadherin LKC"""		"""protocadherin 24"""	PCDH24		11082270, 12117771	Standard	NM_001171976		Approved	PC-LKC, FLJ20124, FLJ20383, PCLKC	uc003mem.2	Q9BYE9		ENST00000510636.1:c.211G>T	chr5.hg19:g.175995765G>T	ENSP00000424565:p.Ala71Ser	125.0	1.0	.		123.0	7.0	.	NM_017675	A1L3U4|A6NC80|Q9NXP8	Missense_Mutation	SNP	ENST00000510636.1	hg19	CCDS34297.1	.	.	.	.	.	.	.	.	.	.	G	2.961	-0.214546	0.06101	.	.	ENSG00000074276	ENST00000510636;ENST00000261944;ENST00000506348	T;T;T	0.60171	0.21;0.21;0.21	4.8	-8.08	0.01094	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.17492	0.0420	N	0.01284	-0.91	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.25847	-1.0120	9	0.07990	T	0.79	0.5066	4.5371	0.12038	0.2851:0.0:0.3045:0.4103	.	71	Q9BYE9	CDHR2_HUMAN	S	71	ENSP00000424565:A71S;ENSP00000261944:A71S;ENSP00000421078:A71S	ENSP00000261944:A71S	A	+	1	0	CDHR2	175928371	0.000000	0.05858	0.001000	0.08648	0.010000	0.07245	-2.753000	0.00791	-0.928000	0.03761	-1.233000	0.01565	GCT	.	.	.	none		0.612	CDHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372201.1	NM_017675	
DST	667	hgsc.bcm.edu	37	6	56480769	56480769	+	Missense_Mutation	SNP	C	C	T	rs148062292		TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr6:56480769C>T	ENST00000370765.6	-	24	7603	c.7496G>A	c.(7495-7497)cGg>cAg	p.R2499Q	DST_ENST00000312431.6_Intron|DST_ENST00000244364.6_Intron|DST_ENST00000421834.2_Intron|DST_ENST00000370754.5_Intron|DST_ENST00000370769.4_Intron|DST_ENST00000446842.2_Intron|DST_ENST00000370788.2_Intron|DST_ENST00000361203.3_Intron	NM_001723.5	NP_001714.1	Q03001	DYST_HUMAN	dystonin	1795					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TTCGGCCACCCGGTACTTTTT	0.512																																					p.R2499Q		Atlas-SNP	.											.	DST	1427	.	0			c.G7496A						PASS	.	C	GLN/ARG,	0,4406		0,0,2203	71.0	77.0	75.0		7496,	5.9	1.0	6	dbSNP_134	75	1,8599	1.2+/-3.3	0,1,4299	no	missense,intron	DST	NM_001723.5,NM_015548.4	43,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	2499/2650,	56480769	1,13005	2203	4300	6503	SO:0001583	missense	667	exon24			GCCACCCGGTACT	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000370765.6:c.7496G>A	chr6.hg19:g.56480769C>T	ENSP00000359801:p.Arg2499Gln	141.0	0.0	.		114.0	44.0	.	NM_001723	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000370765.6	hg19	CCDS4959.1	.	.	.	.	.	.	.	.	.	.	C	9.658	1.143434	0.21205	0.0	1.16E-4	ENSG00000151914	ENST00000370765	T	0.72725	-0.68	5.94	5.94	0.96194	.	.	.	.	.	T	0.55033	0.1895	.	.	.	0.09310	N	0.999998	B	0.29253	0.239	B	0.15870	0.014	T	0.58730	-0.7585	7	0.66056	D	0.02	.	20.3593	0.98849	0.0:1.0:0.0:0.0	.	2499	Q03001-3	.	Q	2499	ENSP00000359801:R2499Q	ENSP00000359801:R2499Q	R	-	2	0	DST	56588728	0.989000	0.36119	0.993000	0.49108	0.251000	0.25915	3.295000	0.51794	2.822000	0.97130	0.557000	0.71058	CGG	.	C|1.000;T|0.000	0.000	weak		0.512	DST-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041027.2	NM_001723	
SEPT7	989	hgsc.bcm.edu	37	7	35930344	35930344	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr7:35930344A>T	ENST00000435235.1	+	10	1212	c.780A>T	c.(778-780)aaA>aaT	p.K260N	SEPT7_ENST00000494488.2_Missense_Mutation_p.K299N|SEPT7_ENST00000399035.3_Missense_Mutation_p.K312N|SEPT7_ENST00000432293.2_Intron|SEPT7_ENST00000399034.2_Missense_Mutation_p.K314N|SEPT7_ENST00000350320.6_Missense_Mutation_p.K312N			Q16181	SEPT7_HUMAN	septin 7	313	Septin-type G.				cilium morphogenesis (GO:0060271)|cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein heterooligomerization (GO:0051291)|regulation of embryonic cell shape (GO:0016476)	actin cytoskeleton (GO:0015629)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|septin complex (GO:0031105)|stress fiber (GO:0001725)	GTP binding (GO:0005525)|identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)	14						GAAGCAGAAAACTTGCAGCTG	0.338																																					p.K312N		Atlas-SNP	.											.	SEPT7	24	.	0			c.A936T						PASS	.						51.0	46.0	48.0					7																	35930344		1836	4089	5925	SO:0001583	missense	989	exon10			CAGAAAACTTGCA	S72008	CCDS75582.1	7p14.2	2013-01-21	2005-01-11	2005-01-12	ENSG00000122545	ENSG00000122545		"""Septins"""	1717	protein-coding gene	gene with protein product		603151	"""CDC10 cell division cycle 10 homolog (S. cerevisiae)"""	CDC10		8037772	Standard	NM_001788		Approved	CDC3, SEPT7A	uc011kau.2	Q16181	OTTHUMG00000155063	ENST00000435235.1:c.780A>T	chr7.hg19:g.35930344A>T	ENSP00000413507:p.Lys260Asn	30.0	0.0	.		27.0	15.0	.	NM_001011553	Q52M76|Q6NX50	Missense_Mutation	SNP	ENST00000435235.1	hg19		.	.	.	.	.	.	.	.	.	.	A	15.31	2.797066	0.50208	.	.	ENSG00000122545	ENST00000435235;ENST00000399034;ENST00000350320;ENST00000399035;ENST00000537785;ENST00000493670;ENST00000494488	T;T;T;T;T	0.54479	0.57;0.57;0.57;0.57;0.57	4.94	0.725	0.18242	.	0.000000	0.85682	U	0.000000	T	0.52338	0.1728	M	0.71920	2.185	0.80722	D	1	P;P;P	0.38420	0.63;0.63;0.63	B;B;B	0.42625	0.393;0.393;0.393	T	0.54364	-0.8305	10	0.62326	D	0.03	.	9.3111	0.37905	0.7223:0.0:0.2777:0.0	.	258;312;313	B4DNE4;E7EPK1;Q16181	.;.;SEPT7_HUMAN	N	260;314;312;312;258;260;299	ENSP00000413507:K260N;ENSP00000381992:K314N;ENSP00000344868:K312N;ENSP00000381993:K312N;ENSP00000438395:K299N	ENSP00000344868:K312N	K	+	3	2	SEPT7	35896869	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.373000	0.34272	0.300000	0.22699	0.460000	0.39030	AAA	.	.	.	none		0.338	SEPT7-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000338285.1	NM_001788	
FOXP2	93986	hgsc.bcm.edu	37	7	114299729	114299729	+	Splice_Site	SNP	G	G	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr7:114299729G>A	ENST00000393494.2	+	13	1926		c.e13+1		FOXP2_ENST00000403559.4_Splice_Site|FOXP2_ENST00000350908.4_Splice_Site|FOXP2_ENST00000393491.3_Splice_Site|FOXP2_ENST00000393500.3_Splice_Site|FOXP2_ENST00000408937.3_Splice_Site|FOXP2_ENST00000393498.2_Splice_Site|FOXP2_ENST00000393489.3_Splice_Site			O15409	FOXP2_HUMAN	forkhead box P2						camera-type eye development (GO:0043010)|caudate nucleus development (GO:0021757)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|growth (GO:0040007)|lung alveolus development (GO:0048286)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of mesenchymal cell proliferation (GO:0002053)|post-embryonic development (GO:0009791)|putamen development (GO:0021758)|righting reflex (GO:0060013)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|vocal learning (GO:0042297)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(7)|kidney(4)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	52						AACTTGGAAGGTAACTACTTT	0.388																																					.		Atlas-SNP	.											.	FOXP2	133	.	0			c.1647+1G>A						PASS	.						109.0	103.0	105.0					7																	114299729		2203	4300	6503	SO:0001630	splice_region_variant	93986	exon13			TGGAAGGTAACTA	U80741	CCDS5760.1, CCDS5761.1, CCDS43635.1, CCDS5761.2, CCDS55154.1	7q31	2008-07-18			ENSG00000128573	ENSG00000128573		"""Forkhead boxes"""	13875	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 10"", ""forkhead/winged-helix transcription factor"", ""speech and language disorder 1"", ""CAG repeat protein 44"""	605317		TNRC10, SPCH1		11586359, 9225980	Standard	NM_014491		Approved	CAGH44	uc003vgz.3	O15409	OTTHUMG00000023131	ENST00000393494.2:c.1647+1G>A	chr7.hg19:g.114299729G>A		96.0	0.0	.		58.0	25.0	.	NM_014491	A0AUV6|A4D0U8|A6NNW4|B4DLD9|Q6ZND1|Q75MJ3|Q8IZE0|Q8N0W2|Q8N6B7|Q8N6B8|Q8NFQ1|Q8NFQ2|Q8NFQ3|Q8NFQ4|Q8TD74	Splice_Site	SNP	ENST00000393494.2	hg19	CCDS5760.1	.	.	.	.	.	.	.	.	.	.	G	16.68	3.189262	0.57909	.	.	ENSG00000128573	ENST00000393494;ENST00000408937;ENST00000403559;ENST00000350908;ENST00000393498;ENST00000393489;ENST00000393491	.	.	.	6.06	6.06	0.98353	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.6243	0.99512	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FOXP2	114086965	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.879000	0.98667	0.650000	0.86243	.	.	.	.	none		0.388	FOXP2-014	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317366.1	NM_014491	Intron
SGK223	157285	hgsc.bcm.edu	37	8	8234118	8234118	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr8:8234118C>A	ENST00000520004.1	-	3	2065	c.1801G>T	c.(1801-1803)Ggt>Tgt	p.G601C	SGK223_ENST00000330777.4_Missense_Mutation_p.G601C			Q86YV5	SG223_HUMAN		603							ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										ATAGCGACACCGTTGGTCCGG	0.662																																					p.G601C	GBM(34;731 755 10259 33573 33867)	Atlas-SNP	.											.	.	.	.	0			c.G1801T						PASS	.						33.0	37.0	36.0					8																	8234118		1991	4172	6163	SO:0001583	missense	0	exon2			CGACACCGTTGGT																												ENST00000520004.1:c.1801G>T	chr8.hg19:g.8234118C>A	ENSP00000428054:p.Gly601Cys	76.0	0.0	.		88.0	23.0	.	NM_001080826	Q8N3N5	Missense_Mutation	SNP	ENST00000520004.1	hg19	CCDS43706.1	.	.	.	.	.	.	.	.	.	.	C	15.89	2.965915	0.53507	.	.	ENSG00000182319	ENST00000330777;ENST00000520004	T;T	0.60299	0.2;0.2	4.16	3.28	0.37604	.	0.672928	0.13029	N	0.419511	T	0.62588	0.2440	L	0.29908	0.895	0.25653	N	0.986074	D	0.76494	0.999	D	0.65010	0.931	T	0.54077	-0.8347	10	0.72032	D	0.01	.	11.5527	0.50729	0.0:0.9104:0.0:0.0896	.	601	Q86YV5	SG223_HUMAN	C	601	ENSP00000330930:G601C;ENSP00000428054:G601C	ENSP00000330930:G601C	G	-	1	0	AC068353.1	8271528	0.017000	0.18338	0.019000	0.16419	0.011000	0.07611	0.576000	0.23744	1.057000	0.40506	0.467000	0.42956	GGT	.	.	.	none		0.662	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374864.1		
ZNF395	55893	hgsc.bcm.edu	37	8	28209093	28209093	+	Silent	SNP	C	C	A	rs145491469	byFrequency	TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr8:28209093C>A	ENST00000344423.5	-	7	1283	c.1152G>T	c.(1150-1152)ccG>ccT	p.P384P	ZNF395_ENST00000523202.1_Silent_p.P384P|ZNF395_ENST00000523095.1_Silent_p.P384P	NM_018660.2	NP_061130.1	Q9H8N7	ZN395_HUMAN	zinc finger protein 395	384					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(5)|large_intestine(6)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.102)|Kidney(114;0.123)|Colorectal(74;0.142)		GGGAGGACTCCGGGCCAGGAT	0.642																																					p.P384P		Atlas-SNP	.											ZNF395,NS,carcinoma,0,1	ZNF395	54	.	0			c.G1152T						PASS	.						62.0	73.0	69.0					8																	28209093		2203	4299	6502	SO:0001819	synonymous_variant	55893	exon7			GGACTCCGGGCCA	AB044750	CCDS6067.1	8p21	2008-05-02			ENSG00000186918	ENSG00000186918		"""Zinc fingers, C2H2-type"""	18737	protein-coding gene	gene with protein product		609494				14625278	Standard	NM_018660		Approved	PRF-1, HDBP2, PBF, DKFZp434K1210	uc003xgr.3	Q9H8N7	OTTHUMG00000102137	ENST00000344423.5:c.1152G>T	chr8.hg19:g.28209093C>A		160.0	1.0	.		178.0	62.0	.	NM_018660	B3KUY7|D3DST4|Q6F6H2|Q9BY72|Q9NPB2|Q9NS57|Q9NS58|Q9NS59	Silent	SNP	ENST00000344423.5	hg19	CCDS6067.1																																																																																			.	C|1.000;T|0.000	.	alt		0.642	ZNF395-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219976.1		
PLEC	5339	hgsc.bcm.edu	37	8	144998457	144998457	+	Silent	SNP	C	C	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr8:144998457C>T	ENST00000322810.4	-	31	6220	c.6051G>A	c.(6049-6051)ctG>ctA	p.L2017L	PLEC_ENST00000354958.2_Silent_p.L1858L|PLEC_ENST00000357649.2_Silent_p.L1884L|PLEC_ENST00000356346.3_Silent_p.L1866L|PLEC_ENST00000345136.3_Silent_p.L1880L|PLEC_ENST00000436759.2_Silent_p.L1907L|PLEC_ENST00000527096.1_Silent_p.L1903L|PLEC_ENST00000398774.2_Silent_p.L1848L|PLEC_ENST00000354589.3_Silent_p.L1880L	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2017	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CCTGCTCCTCCAGCCGCCGCC	0.706																																					p.L2017L		Atlas-SNP	.											.	PLEC	1144	.	0			c.G6051A						PASS	.						7.0	9.0	8.0					8																	144998457		1983	4065	6048	SO:0001819	synonymous_variant	5339	exon31			CTCCTCCAGCCGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.6051G>A	chr8.hg19:g.144998457C>T		23.0	0.0	.		18.0	8.0	.	NM_201380	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	hg19	CCDS43772.1																																																																																			.	.	.	none		0.706	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
VPS13A	23230	hgsc.bcm.edu	37	9	79955424	79955424	+	Silent	SNP	T	T	A	rs144477984	byFrequency	TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr9:79955424T>A	ENST00000360280.3	+	50	7244	c.6984T>A	c.(6982-6984)gcT>gcA	p.A2328A	VPS13A_ENST00000376636.3_Silent_p.A2289A|VPS13A_ENST00000376634.4_Silent_p.A2328A|VPS13A_ENST00000357409.5_Silent_p.A2328A	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	2328					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						TATCAGTGGCTGAAGAAGGAA	0.333																																					p.A2328A		Atlas-SNP	.											.	VPS13A	735	.	0			c.T6984A						PASS	.						88.0	91.0	90.0					9																	79955424		2203	4295	6498	SO:0001819	synonymous_variant	23230	exon50			AGTGGCTGAAGAA	AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.6984T>A	chr9.hg19:g.79955424T>A		122.0	0.0	.		91.0	42.0	.	NM_001018038	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Silent	SNP	ENST00000360280.3	hg19	CCDS6655.1																																																																																			.	T|1.000;C|0.000	.	alt		0.333	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052753.2	NM_015186	
TLL2	7093	hgsc.bcm.edu	37	10	98136535	98136535	+	Missense_Mutation	SNP	C	C	A	rs150738442		TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr10:98136535C>A	ENST00000357947.3	-	18	2587	c.2362G>T	c.(2362-2364)Gcg>Tcg	p.A788S		NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	788	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		TTGGGGCTCGCCAGGGTCCCC	0.567																																					p.A788S		Atlas-SNP	.											.	TLL2	122	.	0			c.G2362T						PASS	.						66.0	66.0	66.0					10																	98136535		2203	4300	6503	SO:0001583	missense	7093	exon18			GGCTCGCCAGGGT	AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.2362G>T	chr10.hg19:g.98136535C>A	ENSP00000350630:p.Ala788Ser	86.0	0.0	.		104.0	33.0	.	NM_012465	A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Missense_Mutation	SNP	ENST00000357947.3	hg19	CCDS7449.1	.	.	.	.	.	.	.	.	.	.	C	11.34	1.609563	0.28623	.	.	ENSG00000095587	ENST00000357947	T	0.16897	2.31	4.98	4.07	0.47477	CUB (5);	1.170570	0.06454	N	0.728224	T	0.05044	0.0135	N	0.00666	-1.275	0.22842	N	0.998661	B	0.10296	0.003	B	0.11329	0.006	T	0.36648	-0.9739	10	0.17832	T	0.49	.	3.874	0.09048	0.193:0.6039:0.0:0.2031	.	788	Q9Y6L7	TLL2_HUMAN	S	788	ENSP00000350630:A788S	ENSP00000350630:A788S	A	-	1	0	TLL2	98126525	0.000000	0.05858	0.988000	0.46212	0.744000	0.42396	0.481000	0.22260	1.431000	0.47355	0.655000	0.94253	GCG	.	C|1.000;T|0.000	.	alt		0.567	TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049608.1		
GBF1	8729	hgsc.bcm.edu	37	10	104130546	104130546	+	Missense_Mutation	SNP	G	G	T	rs7894865	byFrequency	TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr10:104130546G>T	ENST00000369983.3	+	29	3846	c.3586G>T	c.(3586-3588)Gtg>Ttg	p.V1196L		NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	Q92538	GBF1_HUMAN	golgi brefeldin A resistant guanine nucleotide exchange factor 1	1196					COPI coating of Golgi vesicle (GO:0048205)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of ARF protein signal transduction (GO:0032012)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	cis-Golgi network (GO:0005801)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(14)|kidney(8)|large_intestine(15)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	71		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		CTGCTTCCTTGTGGAGCGGGC	0.542																																					p.V1197L		Atlas-SNP	.											.	GBF1	142	.	0			c.G3589T						PASS	.						182.0	147.0	159.0					10																	104130546		2203	4300	6503	SO:0001583	missense	8729	exon29			TTCCTTGTGGAGC	D87435	CCDS7533.1	10q24	2010-02-12	2010-02-12		ENSG00000107862	ENSG00000107862			4181	protein-coding gene	gene with protein product		603698	"""golgi-specific brefeldin A resistance factor 1"""			9828135	Standard	NM_004193		Approved	KIAA0248, ARF1GEF	uc001kux.2	Q92538	OTTHUMG00000018955	ENST00000369983.3:c.3586G>T	chr10.hg19:g.104130546G>T	ENSP00000359000:p.Val1196Leu	133.0	0.0	.		101.0	40.0	.	NM_001199378	Q5VXX3|Q96CK6|Q96HZ3|Q9H473	Missense_Mutation	SNP	ENST00000369983.3	hg19	CCDS7533.1	.	.	.	.	.	.	.	.	.	.	G	10.48	1.360689	0.24598	.	.	ENSG00000107862	ENST00000369983	T	0.12569	2.67	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.22936	0.0554	N	0.17872	0.535	0.80722	D	1	B;B;D	0.58970	0.107;0.025;0.984	B;B;D	0.68192	0.037;0.016;0.956	T	0.05289	-1.0894	10	0.19590	T	0.45	-16.6116	19.277	0.94036	0.0:0.0:1.0:0.0	.	1196;1196;1196	Q149P1;Q149P0;Q92538	.;.;GBF1_HUMAN	L	1196	ENSP00000359000:V1196L	ENSP00000359000:V1196L	V	+	1	0	GBF1	104120536	1.000000	0.71417	1.000000	0.80357	0.625000	0.37756	7.674000	0.83992	2.782000	0.95742	0.655000	0.94253	GTG	.	G|0.996;A|0.004	.	alt		0.542	GBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050051.1		
SUFU	51684	hgsc.bcm.edu	37	10	104353417	104353417	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr10:104353417C>A	ENST00000369902.3	+	5	788	c.622C>A	c.(622-624)Cta>Ata	p.L208I	RNU6-43P_ENST00000384302.1_RNA|SUFU_ENST00000423559.2_Missense_Mutation_p.L208I|SUFU_ENST00000369899.2_Missense_Mutation_p.L208I|SUFU_ENST00000471000.1_3'UTR	NM_016169.3	NP_057253.2	Q9UMX1	SUFU_HUMAN	suppressor of fused homolog (Drosophila)	208					cytoplasmic sequestering of transcription factor (GO:0042994)|heart looping (GO:0001947)|multicellular organismal development (GO:0007275)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|negative regulation of transcription factor import into nucleus (GO:0042992)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|proteolysis (GO:0006508)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|skin development (GO:0043588)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|primary cilium (GO:0072372)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(7)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(2)	24		Colorectal(252;0.207)		Epithelial(162;1.36e-08)|all cancers(201;3.81e-07)|BRCA - Breast invasive adenocarcinoma(275;0.242)		CACTGAAGAGCTACACTCAGC	0.607			"""D, F, S"""		medulloblastoma	medulloblastoma			Medulloblastoma, associated with Germline SUFU Mutation																												p.L208I		Atlas-SNP	.	yes	Rec	yes	Medulloblastoma predisposition	10	10q24.32	51684	suppressor of fused homolog (Drosophila)		O	.	SUFU	44	.	0			c.C622A						PASS	.						99.0	83.0	89.0					10																	104353417		2203	4300	6503	SO:0001583	missense	51684	exon5	Familial Cancer Database		GAAGAGCTACACT	AF175770	CCDS7537.1, CCDS53571.1	10q24.32	2014-09-17			ENSG00000107882	ENSG00000107882			16466	protein-coding gene	gene with protein product		607035				15367681	Standard	NM_016169		Approved	SUFUH, SUFUXL, PRO1280	uc001kvy.2	Q9UMX1	OTTHUMG00000018966	ENST00000369902.3:c.622C>A	chr10.hg19:g.104353417C>A	ENSP00000358918:p.Leu208Ile	89.0	0.0	.		73.0	39.0	.	NM_001178133	Q7LCP7|Q9NT90|Q9NZ07|Q9UHK2|Q9UHM8|Q9UMY0	Missense_Mutation	SNP	ENST00000369902.3	hg19	CCDS7537.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.614385	0.87359	.	.	ENSG00000107882	ENST00000369902;ENST00000369899;ENST00000423559	D;D;D	0.83755	-1.76;-1.76;-1.76	6.08	4.21	0.49690	Suppressor of fused domain (1);	0.062987	0.64402	D	0.000004	D	0.91088	0.7195	M	0.93763	3.455	0.53005	D	0.999963	P;P;D	0.61697	0.816;0.78;0.99	P;P;P	0.61132	0.789;0.683;0.884	D	0.91841	0.5483	10	0.72032	D	0.01	-14.0459	8.8655	0.35282	0.0:0.7723:0.0:0.2277	.	208;208;208	Q9UMX1;Q9UMX1-2;Q9UMX1-3	SUFU_HUMAN;.;.	I	208	ENSP00000358918:L208I;ENSP00000358915:L208I;ENSP00000411597:L208I	ENSP00000358915:L208I	L	+	1	2	SUFU	104343407	1.000000	0.71417	0.997000	0.53966	0.958000	0.62258	2.022000	0.41030	1.557000	0.49525	0.655000	0.94253	CTA	.	.	.	none		0.607	SUFU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050089.1	NM_016169	
POLR2L	5441	hgsc.bcm.edu	37	11	840428	840428	+	Silent	SNP	G	G	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr11:840428G>A	ENST00000322028.4	-	2	184	c.148C>T	c.(148-150)Ctg>Ttg	p.L50L	TSPAN4_ENST00000397397.2_5'Flank|TSPAN4_ENST00000397408.1_5'Flank|TSPAN4_ENST00000397396.1_5'Flank|TSPAN4_ENST00000397411.2_5'Flank	NM_021128.4	NP_066951.1	P62875	RPAB5_HUMAN	polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa	50					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of type I interferon production (GO:0032481)|positive regulation of viral transcription (GO:0050434)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|RNA splicing (GO:0008380)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cytosol (GO:0005829)|DNA-directed RNA polymerase I complex (GO:0005736)|DNA-directed RNA polymerase II, core complex (GO:0005665)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			lung(1)	1		all_cancers(49;2.31e-08)|all_epithelial(84;3.72e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.179)|all_lung(207;0.227)		all cancers(45;4.1e-25)|Epithelial(43;3.15e-24)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		ACGTGGGCCAGCAGCATCCGG	0.637																																					p.L50L		Atlas-SNP	.											.	POLR2L	2	.	0			c.C148T						PASS	.						159.0	125.0	137.0					11																	840428		2203	4298	6501	SO:0001819	synonymous_variant	5441	exon2			GGGCCAGCAGCAT	U37690	CCDS7720.1	11p15	2013-01-21	2002-08-29		ENSG00000177700	ENSG00000177700		"""RNA polymerase subunits"""	9199	protein-coding gene	gene with protein product		601189	"""polymerase (RNA) II (DNA directed) polypeptide L (7.6kD)"""			8786124	Standard	NM_021128		Approved	RPB10beta, RBP10, RPABC5, RPB7.6, hRPB7.6, hsRPB10b	uc001lsc.3	P62875	OTTHUMG00000133316	ENST00000322028.4:c.148C>T	chr11.hg19:g.840428G>A		193.0	0.0	.		173.0	48.0	.	NM_021128	P52436|Q6FHX3	Silent	SNP	ENST00000322028.4	hg19	CCDS7720.1																																																																																			.	.	.	none		0.637	POLR2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257114.1	NM_021128	
SAAL1	113174	hgsc.bcm.edu	37	11	18101957	18101957	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr11:18101957C>G	ENST00000524803.1	-	12	1463	c.1414G>C	c.(1414-1416)Gtt>Ctt	p.V472L	SAAL1_ENST00000300013.4_Missense_Mutation_p.V471L|SAAL1_ENST00000529318.1_Missense_Mutation_p.V474L			Q96ER3	SAAL1_HUMAN	serum amyloid A-like 1	472										breast(2)|large_intestine(5)|lung(8)	15						TAAGTCTGAACCTTCAAACTT	0.318																																					p.V472L		Atlas-SNP	.											.	SAAL1	34	.	0			c.G1414C						PASS	.						59.0	62.0	61.0					11																	18101957		2200	4293	6493	SO:0001583	missense	113174	exon12			TCTGAACCTTCAA	AK123457	CCDS31439.1	11p15.1	2005-10-28			ENSG00000166788	ENSG00000166788			25158	protein-coding gene	gene with protein product							Standard	NM_138421		Approved	FLJ41463	uc001mnq.3	Q96ER3	OTTHUMG00000166428	ENST00000524803.1:c.1414G>C	chr11.hg19:g.18101957C>G	ENSP00000432487:p.Val472Leu	102.0	0.0	.		68.0	16.0	.	NM_138421	A6NH05	Missense_Mutation	SNP	ENST00000524803.1	hg19	CCDS31439.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.29|11.29	1.595377|1.595377	0.28445|0.28445	.|.	.|.	ENSG00000166788|ENSG00000166788	ENST00000532452|ENST00000524803;ENST00000300013;ENST00000529318	.|T;T;T	.|0.32023	.|1.47;1.47;1.47	5.56|5.56	4.65|4.65	0.58169|0.58169	.|.	.|0.883413	.|0.10083	.|N	.|0.718158	T|T	0.25568|0.25568	0.0622|0.0622	L|L	0.40543|0.40543	1.245|1.245	0.25551|0.25551	N|N	0.987081|0.987081	.|B;B;B	.|0.02656	.|0.0;0.0;0.0	.|B;B;B	.|0.08055	.|0.003;0.003;0.003	T|T	0.20207|0.20207	-1.0282|-1.0282	5|10	.|0.22109	.|T	.|0.4	-0.1106|-0.1106	9.5663|9.5663	0.39400|0.39400	0.0:0.783:0.1416:0.0753|0.0:0.783:0.1416:0.0753	.|.	.|474;472;472	.|E9PRZ1;G1UCX3;Q96ER3	.|.;.;SAAL1_HUMAN	S|L	130|472;471;474	.|ENSP00000432487:V472L;ENSP00000300013:V471L;ENSP00000432216:V474L	.|ENSP00000300013:V471L	R|V	-|-	3|1	2|0	SAAL1|SAAL1	18058533|18058533	0.998000|0.998000	0.40836|0.40836	0.998000|0.998000	0.56505|0.56505	0.389000|0.389000	0.30415|0.30415	1.161000|1.161000	0.31773|0.31773	1.485000|1.485000	0.48380|0.48380	0.549000|0.549000	0.68633|0.68633	AGG|GTT	.	.	.	none		0.318	SAAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389728.1	NM_138421	
GAB2	9846	hgsc.bcm.edu	37	11	77934564	77934564	+	Silent	SNP	G	G	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr11:77934564G>A	ENST00000361507.4	-	6	1546	c.1461C>T	c.(1459-1461)gaC>gaT	p.D487D	GAB2_ENST00000340149.2_Silent_p.D449D	NM_080491.2	NP_536739.1	Q9UQC2	GAB2_HUMAN	GRB2-associated binding protein 2	487					cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mast cell degranulation (GO:0043306)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)		INTS4/GAB2(2)	NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(8)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(14;3.31e-18)|all_epithelial(13;5.3e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.58e-23)			AGCCAAGTGAGTCAAAGTGAT	0.557																																					p.D487D		Atlas-SNP	.											.	GAB2	63	.	0			c.C1461T						PASS	.						218.0	207.0	211.0					11																	77934564		2200	4292	6492	SO:0001819	synonymous_variant	9846	exon6			AAGTGAGTCAAAG	AB011143	CCDS8259.1, CCDS8260.1	11q13.4-q13.5	2013-01-10			ENSG00000033327	ENSG00000033327		"""Pleckstrin homology (PH) domain containing"""	14458	protein-coding gene	gene with protein product	"""Grb2-associated binder 2"""	606203				10391903, 10068651	Standard	NM_080491		Approved	KIAA0571	uc001ozh.3	Q9UQC2	OTTHUMG00000166673	ENST00000361507.4:c.1461C>T	chr11.hg19:g.77934564G>A		270.0	0.0	.		229.0	70.0	.	NM_080491	A2RRM2|A6NEW9|A7MD36|O60317	Silent	SNP	ENST00000361507.4	hg19	CCDS8259.1																																																																																			.	.	.	none		0.557	GAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391085.1	NM_080491	
CASP5	838	hgsc.bcm.edu	37	11	104879534	104879534	+	Splice_Site	SNP	T	T	G			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr11:104879534T>G	ENST00000260315.3	-	2	180	c.181A>C	c.(181-183)Aaa>Caa	p.K61Q	CASP5_ENST00000393139.2_Splice_Site_p.K28Q|CASP5_ENST00000418434.1_Intron|CASP5_ENST00000444749.2_Intron|CASP5_ENST00000393141.2_Splice_Site_p.K74Q|CASP5_ENST00000526056.1_Splice_Site_p.K74Q|CASP5_ENST00000531367.1_Intron			P51878	CASP5_HUMAN	caspase 5, apoptosis-related cysteine peptidase	61	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|execution phase of apoptosis (GO:0097194)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of inflammatory response (GO:0050727)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|NLRP1 inflammasome complex (GO:0072558)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|ovary(3)|skin(1)|urinary_tract(1)	35		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)		CCAGTCTTACTTTTTACACTG	0.388																																					p.K74Q		Atlas-SNP	.											.	CASP5	213	.	0			c.A220C						PASS	.						101.0	95.0	97.0					11																	104879534		2202	4299	6501	SO:0001630	splice_region_variant	838	exon2			TCTTACTTTTTAC		CCDS8328.2, CCDS44718.1, CCDS44719.1, CCDS44720.1	11q22.2-q22.3	2006-02-17	2005-08-17		ENSG00000137757	ENSG00000137757		"""Caspases"""	1506	protein-coding gene	gene with protein product		602665	"""caspase 5, apoptosis-related cysteine protease"""			7797592, 9250871	Standard	NM_004347		Approved	ICE(rel)III	uc010ruz.1	P51878	OTTHUMG00000048073	ENST00000260315.3:c.181+1A>C	chr11.hg19:g.104879534T>G		83.0	0.0	.		58.0	23.0	.	NM_001136112	B4DKP5|Q0QVY7|Q0QVY8|Q0QVZ0|Q0QVZ1|Q0QVZ2|Q14DD6|Q1HBJ3|Q6DJV7	Missense_Mutation	SNP	ENST00000260315.3	hg19	CCDS8328.2	.	.	.	.	.	.	.	.	.	.	.	8.417	0.845448	0.16963	.	.	ENSG00000137757	ENST00000393141;ENST00000393139;ENST00000260315;ENST00000526056;ENST00000456094	T;T;T;T;T	0.26810	4.66;1.71;4.68;4.66;2.75	1.45	0.338	0.15974	DEATH-like (1);Caspase Recruitment (2);	0.671852	0.11352	U	0.572858	T	0.09642	0.0237	N	0.08118	0	0.09310	N	1	B;B	0.28636	0.218;0.183	B;B	0.21546	0.035;0.021	T	0.31916	-0.9926	9	.	.	.	.	3.7847	0.08695	0.0:0.7446:0.0:0.2554	.	61;74	P51878;P51878-5	CASP5_HUMAN;.	Q	74;28;61;74;45	ENSP00000376849:K74Q;ENSP00000376847:K28Q;ENSP00000260315:K61Q;ENSP00000436877:K74Q;ENSP00000415241:K45Q	.	K	-	1	0	CASP5	104384744	0.989000	0.36119	0.124000	0.21820	0.011000	0.07611	0.266000	0.18534	0.155000	0.19261	-0.182000	0.12963	AAA	.	.	.	none		0.388	CASP5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109397.2	NM_004347	Missense_Mutation
KDM5A	5927	hgsc.bcm.edu	37	12	404935	404935	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr12:404935G>C	ENST00000399788.2	-	26	4621	c.4259C>G	c.(4258-4260)cCt>cGt	p.P1420R	KDM5A_ENST00000382815.4_Missense_Mutation_p.P1420R|KDM5A_ENST00000540838.1_5'Flank	NM_001042603.1	NP_001036068.1	P29375	KDM5A_HUMAN	lysine (K)-specific demethylase 5A	1420					chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|multicellular organismal development (GO:0007275)|negative regulation of histone deacetylase activity (GO:1901726)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(29)|ovary(1)|prostate(5)|skin(6)|stomach(1)|urinary_tract(2)	77						GCTCTTCCGAGGTTGTTTCCT	0.408			T	NUP98	AML																																p.P1420R		Atlas-SNP	.		Dom	yes		12	12p11	5927	"""lysine (K)-specific demethylase 5A, JARID1A"""		L	.	KDM5A	307	.	0			c.C4259G						PASS	.						97.0	94.0	95.0					12																	404935		1825	4074	5899	SO:0001583	missense	5927	exon26			TTCCGAGGTTGTT		CCDS41736.1	12p13.33	2013-01-28	2009-04-06	2009-04-06	ENSG00000073614	ENSG00000073614		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	9886	protein-coding gene	gene with protein product		180202	"""retinoblastoma-binding protein 2"", ""Jumonji, AT rich interactive domain 1A (RBBP2-like)"", ""jumonji, AT rich interactive domain 1A"""	RBBP2, JARID1A		1857421	Standard	NM_001042603		Approved		uc001qif.1	P29375	OTTHUMG00000168055	ENST00000399788.2:c.4259C>G	chr12.hg19:g.404935G>C	ENSP00000382688:p.Pro1420Arg	199.0	0.0	.		143.0	54.0	.	NM_001042603	A8MV76|Q4LE72|Q86XZ1	Missense_Mutation	SNP	ENST00000399788.2	hg19	CCDS41736.1	.	.	.	.	.	.	.	.	.	.	G	18.11	3.551819	0.65311	.	.	ENSG00000073614	ENST00000399788;ENST00000382815	D;D	0.85171	-1.95;-1.77	5.42	5.42	0.78866	.	0.118506	0.64402	D	0.000015	D	0.88254	0.6387	L	0.29908	0.895	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	D	0.85541	0.1215	10	0.25751	T	0.34	-15.9882	19.5762	0.95446	0.0:0.0:1.0:0.0	.	1420;1420	P29375;P29375-2	KDM5A_HUMAN;.	R	1420	ENSP00000382688:P1420R;ENSP00000372265:P1420R	ENSP00000372265:P1420R	P	-	2	0	KDM5A	275196	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.505000	0.97989	2.699000	0.92147	0.561000	0.74099	CCT	.	.	.	none		0.408	KDM5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397812.1	NM_005056	
AEBP2	121536	hgsc.bcm.edu	37	12	19615463	19615463	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr12:19615463G>C	ENST00000398864.3	+	2	717	c.691G>C	c.(691-693)Gat>Cat	p.D231H	AEBP2_ENST00000541908.1_Missense_Mutation_p.D2H|AEBP2_ENST00000266508.9_Missense_Mutation_p.D231H|AEBP2_ENST00000360995.4_Missense_Mutation_p.D15H	NM_001114176.1	NP_001107648.1	Q6ZN18	AEBP2_HUMAN	AE binding protein 2	231	Interaction with RBBP4.|Ser-rich.				chromatin modification (GO:0016568)	ESC/E(Z) complex (GO:0035098)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)			ovary(1)	1	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)|Esophageal squamous(101;0.143)					TACTATAATGGATGTAGACAG	0.328																																					p.D231H		Atlas-SNP	.											.	AEBP2	21	.	0			c.G691C						PASS	.						57.0	51.0	53.0					12																	19615463		1877	4113	5990	SO:0001583	missense	121536	exon2			ATAATGGATGTAG		CCDS44841.1, CCDS44842.1, CCDS58215.1	12p12.3	2012-10-02			ENSG00000139154	ENSG00000139154			24051	protein-coding gene	gene with protein product						10329662	Standard	NM_153207		Approved	MGC17922	uc001ref.2	Q6ZN18	OTTHUMG00000168906	ENST00000398864.3:c.691G>C	chr12.hg19:g.19615463G>C	ENSP00000381840:p.Asp231His	25.0	0.0	.		32.0	13.0	.	NM_001114176	Q59FS5|Q6ZN62|Q96BG3	Missense_Mutation	SNP	ENST00000398864.3	hg19	CCDS44841.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.961310	0.74016	.	.	ENSG00000139154	ENST00000538425;ENST00000541908;ENST00000398864;ENST00000435841;ENST00000266508;ENST00000360995	D;T;D;D;T	0.91631	-2.52;-0.65;-2.88;-2.88;-0.45	5.55	4.66	0.58398	.	.	.	.	.	D	0.91938	0.7447	N	0.24115	0.695	0.80722	D	1	D	0.71674	0.998	P	0.62885	0.908	D	0.93102	0.6509	9	0.66056	D	0.02	4.244	14.732	0.69388	0.0692:0.0:0.9308:0.0	.	231	Q6ZN18	AEBP2_HUMAN	H	2;2;231;165;231;15	ENSP00000444255:D2H;ENSP00000437983:D2H;ENSP00000381840:D231H;ENSP00000266508:D231H;ENSP00000354267:D15H	ENSP00000266508:D231H	D	+	1	0	AEBP2	19506730	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.263000	0.95617	1.578000	0.49821	0.655000	0.94253	GAT	.	.	.	none		0.328	AEBP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000401575.1	NM_153207	
PFKM	5213	hgsc.bcm.edu	37	12	48538849	48538849	+	Silent	SNP	C	C	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr12:48538849C>A	ENST00000312352.7	+	21	2067	c.2028C>A	c.(2026-2028)gcC>gcA	p.A676A	PFKM_ENST00000551804.1_Silent_p.A645A|PFKM_ENST00000340802.6_Silent_p.A747A|PFKM_ENST00000395233.2_Silent_p.A645A|PFKM_ENST00000359794.5_Silent_p.A676A|PFKM_ENST00000547587.1_Silent_p.A676A	NM_001166687.1	NP_001160159.1	P08237	PFKAM_HUMAN	phosphofructokinase, muscle	676	C-terminal regulatory PFK domain 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 6-phosphate metabolic process (GO:0006002)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|muscle cell cellular homeostasis (GO:0046716)|positive regulation of insulin secretion (GO:0032024)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	6-phosphofructokinase complex (GO:0005945)|apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|sperm principal piece (GO:0097228)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|fructose binding (GO:0070061)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			NS(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	35						GGAATTTTGCCACTAAGATGG	0.473																																					p.A747A		Atlas-SNP	.											.	PFKM	117	.	0			c.C2241A						PASS	.						99.0	96.0	97.0					12																	48538849		2203	4300	6503	SO:0001819	synonymous_variant	5213	exon23			TTTTGCCACTAAG	M26066	CCDS8760.1, CCDS53786.1	12q13.11	2014-06-13					2.7.1.11		8877	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 122"""	610681	"""phosphofructokinase, polypeptide X"""	PFKX			Standard	NM_001166686		Approved	PFK-1, PPP1R122	uc001rrb.2	P08237		ENST00000312352.7:c.2028C>A	chr12.hg19:g.48538849C>A		71.0	0.0	.		119.0	42.0	.	NM_001166686	J3KNX3|Q16814|Q16815|Q6ZTT1	Silent	SNP	ENST00000312352.7	hg19	CCDS8760.1																																																																																			.	.	.	none		0.473	PFKM-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406490.1	NM_000289	
NCKAP1L	3071	hgsc.bcm.edu	37	12	54903761	54903761	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr12:54903761T>G	ENST00000293373.6	+	7	806	c.727T>G	c.(727-729)Tca>Gca	p.S243A	NCKAP1L_ENST00000552211.1_3'UTR|NCKAP1L_ENST00000545638.2_Missense_Mutation_p.S193A	NM_005337.4	NP_005328.2	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	243					actin polymerization-dependent cell motility (GO:0070358)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|chemotaxis (GO:0006935)|cortical actin cytoskeleton organization (GO:0030866)|erythrocyte development (GO:0048821)|maintenance of cell polarity (GO:0030011)|myeloid cell homeostasis (GO:0002262)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of myosin-light-chain-phosphatase activity (GO:0035509)|neutrophil chemotaxis (GO:0030593)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of CD8-positive, alpha-beta T cell differentiation (GO:0043378)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of lymphocyte differentiation (GO:0045621)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of T cell proliferation (GO:0042102)|protein complex assembly (GO:0006461)|response to drug (GO:0042493)|T cell homeostasis (GO:0043029)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)|protein kinase activator activity (GO:0030295)|Rac GTPase activator activity (GO:0030675)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(37)|ovary(3)|prostate(3)|skin(3)|stomach(2)	80						CCCTGCTAATTCAGATACAGT	0.488																																					p.S243A		Atlas-SNP	.											.	NCKAP1L	180	.	0			c.T727G						PASS	.						146.0	139.0	141.0					12																	54903761		2203	4300	6503	SO:0001583	missense	3071	exon7			GCTAATTCAGATA	AI924363	CCDS31813.1, CCDS53799.1	12q13.1	2005-10-11	2005-10-11	2005-10-11		ENSG00000123338			4862	protein-coding gene	gene with protein product		141180	"""hematopoietic protein 1"""	HEM1		1932118	Standard	NM_005337		Approved		uc001sgc.4	P55160	OTTHUMG00000169843	ENST00000293373.6:c.727T>G	chr12.hg19:g.54903761T>G	ENSP00000293373:p.Ser243Ala	142.0	0.0	.		150.0	56.0	.	NM_005337	B4DUT5|Q52LW0	Missense_Mutation	SNP	ENST00000293373.6	hg19	CCDS31813.1	.	.	.	.	.	.	.	.	.	.	T	15.83	2.948714	0.53186	.	.	ENSG00000123338	ENST00000293373;ENST00000545638	T;T	0.32515	1.45;1.45	5.83	5.83	0.93111	.	0.066512	0.64402	D	0.000007	T	0.25791	0.0628	L	0.38838	1.175	0.40526	D	0.980889	P	0.38473	0.633	B	0.38194	0.267	T	0.06058	-1.0848	10	0.18276	T	0.48	-7.392	14.1522	0.65392	0.0:0.0:0.0:1.0	.	243	P55160	NCKPL_HUMAN	A	243;193	ENSP00000293373:S243A;ENSP00000445596:S193A	ENSP00000293373:S243A	S	+	1	0	NCKAP1L	53190028	1.000000	0.71417	0.930000	0.37139	0.606000	0.37113	7.701000	0.84566	2.216000	0.71823	0.460000	0.39030	TCA	.	.	.	none		0.488	NCKAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406195.1	NM_005337	
GDE1	51573	hgsc.bcm.edu	37	16	19516303	19516303	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr16:19516303A>C	ENST00000353258.3	-	5	928	c.748T>G	c.(748-750)Ttt>Gtt	p.F250V	CTA-363E6.7_ENST00000569345.1_RNA	NM_016641.3	NP_057725.1	Q9NZC3	GDE1_HUMAN	glycerophosphodiester phosphodiesterase 1	250	GP-PDE.				glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|glycerophosphoinositol glycerophosphodiesterase activity (GO:0047395)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)	13						ATCATAACAAATATAAAATGT	0.403																																					p.F250V		Atlas-SNP	.											.	GDE1	31	.	0			c.T748G						PASS	.						161.0	151.0	154.0					16																	19516303		2197	4300	6497	SO:0001583	missense	51573	exon5			TAACAAATATAAA		CCDS10578.1	16p12-p11.2	2011-01-25			ENSG00000006007	ENSG00000006007	3.1.4.46		29644	protein-coding gene	gene with protein product	"""membrane interacting protein of RGS16"""	605943				12576545, 16472945	Standard	NM_016641		Approved	MIR16	uc002dgh.3	Q9NZC3	OTTHUMG00000131454	ENST00000353258.3:c.748T>G	chr16.hg19:g.19516303A>C	ENSP00000261386:p.Phe250Val	145.0	0.0	.		164.0	51.0	.	NM_016641	O43334|Q6PKF7|Q7KYR4	Missense_Mutation	SNP	ENST00000353258.3	hg19	CCDS10578.1	.	.	.	.	.	.	.	.	.	.	A	5.389	0.256908	0.10185	.	.	ENSG00000006007	ENST00000353258	T	0.27557	1.66	5.66	3.41	0.39046	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);	0.193879	0.56097	D	0.000040	T	0.13884	0.0336	N	0.08118	0	0.23533	N	0.997474	B	0.24368	0.102	B	0.24701	0.055	T	0.20840	-1.0263	10	0.28530	T	0.3	-7.2402	5.9584	0.19286	0.7453:0.0:0.1327:0.122	.	250	Q9NZC3	GDE1_HUMAN	V	250	ENSP00000261386:F250V	ENSP00000261386:F250V	F	-	1	0	GDE1	19423804	0.998000	0.40836	0.125000	0.21846	0.104000	0.19210	3.728000	0.54991	0.417000	0.25871	0.533000	0.62120	TTT	.	.	.	none		0.403	GDE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254274.2	NM_016641	
EEF2K	29904	hgsc.bcm.edu	37	16	22237117	22237117	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr16:22237117C>T	ENST00000263026.5	+	2	541	c.67C>T	c.(67-69)Cat>Tat	p.H23Y		NM_013302.3	NP_037434	O00418	EF2K_HUMAN	eukaryotic elongation factor-2 kinase	23			H -> R (in dbSNP:rs9935059). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:17344846}.		insulin receptor signaling pathway (GO:0008286)|protein autophosphorylation (GO:0046777)|regulation of protein autophosphorylation (GO:0031952)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|elongation factor-2 kinase activity (GO:0004686)|protein kinase activity (GO:0004672)|translation factor activity, nucleic acid binding (GO:0008135)			breast(1)|central_nervous_system(1)|endometrium(8)|large_intestine(2)|lung(13)|ovary(1)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(48;0.0223)		CCGAGCTGGCCATGATGGTGA	0.557																																					p.H23Y	NSCLC(195;1411 2157 20319 27471 51856)	Atlas-SNP	.											.	EEF2K	142	.	0			c.C67T						PASS	.						56.0	55.0	55.0					16																	22237117		2197	4300	6497	SO:0001583	missense	29904	exon2			GCTGGCCATGATG	U93850	CCDS10604.1	16p12	2008-02-05			ENSG00000103319	ENSG00000103319			24615	protein-coding gene	gene with protein product		606968				9144159, 12051769	Standard	NM_013302		Approved	eEF-2K	uc002dki.3	O00418	OTTHUMG00000094771	ENST00000263026.5:c.67C>T	chr16.hg19:g.22237117C>T	ENSP00000263026:p.His23Tyr	82.0	0.0	.		92.0	20.0	.	NM_013302	Q8N588	Missense_Mutation	SNP	ENST00000263026.5	hg19	CCDS10604.1	.	.	.	.	.	.	.	.	.	.	C	1.297	-0.605948	0.03717	.	.	ENSG00000103319	ENST00000263026	T	0.08102	3.13	5.82	5.82	0.92795	.	0.750933	0.13237	N	0.403188	T	0.06142	0.0159	L	0.34521	1.04	0.09310	N	1	B	0.18863	0.031	B	0.19148	0.024	T	0.45891	-0.9230	10	0.02654	T	1	-9.8593	8.7204	0.34436	0.1519:0.7677:0.0:0.0804	.	23	O00418	EF2K_HUMAN	Y	23	ENSP00000263026:H23Y	ENSP00000263026:H23Y	H	+	1	0	EEF2K	22144618	0.005000	0.15991	0.338000	0.25549	0.158000	0.22134	0.566000	0.23593	2.757000	0.94681	0.655000	0.94253	CAT	.	.	.	none		0.557	EEF2K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211580.2	NM_013302	
CX3CL1	6376	hgsc.bcm.edu	37	16	57413588	57413588	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr16:57413588A>G	ENST00000006053.6	+	2	224	c.113A>G	c.(112-114)aAg>aGg	p.K38R	CX3CL1_ENST00000565912.1_5'UTR|CX3CL1_ENST00000563383.1_Missense_Mutation_p.K44R|CX3CL1_ENST00000564948.1_Intron	NM_002996.3	NP_002987.1	P78423	X3CL1_HUMAN	chemokine (C-X3-C motif) ligand 1	38	Chemokine.				angiogenesis involved in wound healing (GO:0060055)|cell adhesion (GO:0007155)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|immune response (GO:0006955)|leukocyte adhesive activation (GO:0050902)|leukocyte chemotaxis (GO:0030595)|lymphocyte chemotaxis (GO:0048247)|macrophage chemotaxis (GO:0048246)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neutrophil chemotaxis (GO:0030593)|positive regulation of angiogenesis (GO:0045766)|positive regulation of calcium-independent cell-cell adhesion (GO:0051041)|positive regulation of inflammatory response (GO:0050729)|positive regulation of transforming growth factor beta1 production (GO:0032914)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	chemokine activity (GO:0008009)|receptor binding (GO:0005102)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)	5						ACGTGCAGCAAGATGACATCA	0.522																																					p.K38R		Atlas-SNP	.											.	CX3CL1	27	.	0			c.A113G						PASS	.						181.0	129.0	146.0					16																	57413588		2198	4300	6498	SO:0001583	missense	6376	exon2			GCAGCAAGATGAC	U84487	CCDS10779.1	16q13	2013-02-25	2002-08-22	2002-08-23	ENSG00000006210	ENSG00000006210		"""Endogenous ligands"""	10647	protein-coding gene	gene with protein product		601880	"""small inducible cytokine subfamily D (Cys-X3-Cys), member 1 (fractalkine, neurotactin)"""	SCYD1		9177350, 9024663	Standard	NM_002996		Approved	NTN, C3Xkine, ABCD-3, CXC3C, CXC3, fractalkine, neurotactin	uc002eli.3	P78423	OTTHUMG00000133469	ENST00000006053.6:c.113A>G	chr16.hg19:g.57413588A>G	ENSP00000006053:p.Lys38Arg	71.0	0.0	.		85.0	19.0	.	NM_002996	O00672	Missense_Mutation	SNP	ENST00000006053.6	hg19	CCDS10779.1	.	.	.	.	.	.	.	.	.	.	A	10.55	1.382853	0.25031	.	.	ENSG00000006210	ENST00000006053	T	0.05199	3.48	2.87	0.504	0.16946	Chemokine interleukin-8-like domain (3);	0.903877	0.09116	N	0.846367	T	0.05777	0.0151	L	0.41710	1.295	0.23421	N	0.997716	B	0.17268	0.021	B	0.18871	0.023	T	0.42481	-0.9449	10	0.87932	D	0	-13.2272	3.0514	0.06171	0.602:0.2553:0.1427:0.0	.	38	P78423	X3CL1_HUMAN	R	38	ENSP00000006053:K38R	ENSP00000006053:K38R	K	+	2	0	CX3CL1	55971089	0.037000	0.19845	0.149000	0.22428	0.245000	0.25701	-0.164000	0.09983	0.081000	0.16988	0.254000	0.18369	AAG	.	.	.	none		0.522	CX3CL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257345.3	NM_002996	
SLC12A4	6560	hgsc.bcm.edu	37	16	67981315	67981315	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr16:67981315C>G	ENST00000316341.3	-	16	2131	c.1991G>C	c.(1990-1992)gGg>gCg	p.G664A	SLC12A4_ENST00000572037.1_Missense_Mutation_p.G616A|SLC12A4_ENST00000576616.1_Missense_Mutation_p.G664A|SLC12A4_ENST00000541864.2_Missense_Mutation_p.G633A|SLC12A4_ENST00000338335.3_Missense_Mutation_p.G664A|SLC12A4_ENST00000537830.2_Missense_Mutation_p.G658A|SLC12A4_ENST00000422611.2_Missense_Mutation_p.G666A|CTC-479C5.17_ENST00000590594.1_lincRNA	NM_001145961.1|NM_005072.4	NP_001139433.1|NP_005063.1	Q9UP95	S12A4_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 4	664					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(2)|ovary(2)|prostate(4)|skin(2)|urinary_tract(3)	29		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	GCCTCGGATCCCGTCACCCCA	0.672																																					p.G666A		Atlas-SNP	.											.	SLC12A4	81	.	0			c.G1997C						PASS	.						46.0	56.0	53.0					16																	67981315		2195	4299	6494	SO:0001583	missense	6560	exon15			CGGATCCCGTCAC		CCDS10855.1, CCDS54030.1, CCDS54031.1, CCDS54032.1	16q22.1	2013-07-18	2013-07-18		ENSG00000124067	ENSG00000124067		"""Solute carriers"""	10913	protein-coding gene	gene with protein product		604119				8663127	Standard	NM_005072		Approved	KCC1	uc010ceu.2	Q9UP95	OTTHUMG00000137535	ENST00000316341.3:c.1991G>C	chr16.hg19:g.67981315C>G	ENSP00000318557:p.Gly664Ala	37.0	0.0	.		34.0	8.0	.	NM_001145962	B4DF69|B4DR04|B4DZ82|B7ZAV0|F5H066|F5H0S9|F5H3C0|O60632|O75893|Q13953|Q96LD5	Missense_Mutation	SNP	ENST00000316341.3	hg19	CCDS10855.1	.	.	.	.	.	.	.	.	.	.	C	35	5.435871	0.96168	.	.	ENSG00000124067	ENST00000422611;ENST00000541864;ENST00000537830;ENST00000338335;ENST00000316341	D;D;D;D;D	0.98550	-4.99;-4.99;-4.99;-4.99;-4.99	5.76	5.76	0.90799	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.98748	0.9579	M	0.61703	1.905	0.80722	D	1	D;D;D;D;D;D	0.89917	0.994;0.999;1.0;0.982;0.982;0.986	D;D;D;P;P;D	0.97110	0.95;0.992;1.0;0.854;0.854;0.91	D	0.99872	1.1098	10	0.72032	D	0.01	.	19.9738	0.97296	0.0:1.0:0.0:0.0	.	666;664;633;658;664;664	F5H3C0;B4DF30;F5H066;F5H0S9;Q9UP95-2;Q9UP95	.;.;.;.;.;S12A4_HUMAN	A	666;633;658;664;664	ENSP00000395983:G666A;ENSP00000438334:G633A;ENSP00000445962:G658A;ENSP00000343374:G664A;ENSP00000318557:G664A	ENSP00000318557:G664A	G	-	2	0	SLC12A4	66538816	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	7.760000	0.85248	2.732000	0.93576	0.655000	0.94253	GGG	.	.	.	none		0.672	SLC12A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268864.4	NM_005072	
NFATC3	4775	hgsc.bcm.edu	37	16	68224719	68224719	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr16:68224719C>A	ENST00000346183.3	+	9	2171	c.2147C>A	c.(2146-2148)cCa>cAa	p.P716Q	NFATC3_ENST00000329524.4_Missense_Mutation_p.P716Q|NFATC3_ENST00000349223.5_Missense_Mutation_p.P716Q|NFATC3_ENST00000575270.1_Missense_Mutation_p.P716Q|SNORA48_ENST00000391143.1_RNA|NFATC3_ENST00000535127.2_3'UTR	NM_173165.2	NP_775188.1	Q12968	NFAC3_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3	716					cellular respiration (GO:0045333)|cellular response to calcium ion (GO:0071277)|cellular response to lithium ion (GO:0071285)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	44		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)		TCTTCAGTTCCATCTTTGCCT	0.383																																					p.P716Q		Atlas-SNP	.											.	NFATC3	190	.	0			c.C2147A						PASS	.						107.0	99.0	101.0					16																	68224719		2198	4300	6498	SO:0001583	missense	4775	exon9			CAGTTCCATCTTT	L41067	CCDS10860.1, CCDS10861.1, CCDS10862.1	16q22	2009-11-24			ENSG00000072736	ENSG00000072736		"""Nuclear factor of activated T-cells"""	7777	protein-coding gene	gene with protein product		602698				7749981	Standard	NM_004555		Approved	NFAT4, NFATX	uc002evo.2	Q12968	OTTHUMG00000137555	ENST00000346183.3:c.2147C>A	chr16.hg19:g.68224719C>A	ENSP00000300659:p.Pro716Gln	206.0	0.0	.		171.0	95.0	.	NM_173163	O75211|Q14516|Q99840|Q99841|Q99842	Missense_Mutation	SNP	ENST00000346183.3	hg19	CCDS10860.1	.	.	.	.	.	.	.	.	.	.	C	19.34	3.808656	0.70797	.	.	ENSG00000072736	ENST00000349223;ENST00000346183;ENST00000329524;ENST00000535127	T;T;T	0.14516	2.5;2.5;2.5	5.55	4.59	0.56863	.	0.059669	0.64402	D	0.000002	T	0.33206	0.0855	M	0.72894	2.215	0.44079	D	0.996834	P;D;P;P	0.57257	0.747;0.979;0.747;0.747	P;P;P;P	0.58970	0.499;0.849;0.499;0.499	T	0.14144	-1.0483	10	0.72032	D	0.01	-2.556	15.7347	0.77834	0.1378:0.8622:0.0:0.0	.	716;716;716;716	Q12968;Q12968-3;B5B2S0;B5B2S2	NFAC3_HUMAN;.;.;.	Q	716;716;716;237	ENSP00000264008:P716Q;ENSP00000300659:P716Q;ENSP00000331324:P716Q	ENSP00000331324:P716Q	P	+	2	0	NFATC3	66782220	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	7.294000	0.78760	1.330000	0.45394	-0.321000	0.08615	CCA	.	.	.	none		0.383	NFATC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268890.2	NM_004555	
CHMP1A	5119	hgsc.bcm.edu	37	16	89715819	89715819	+	Silent	SNP	C	C	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr16:89715819C>T	ENST00000397901.3	-	4	448	c.192G>A	c.(190-192)cgG>cgA	p.R64R	CHMP1A_ENST00000535997.2_5'UTR|CHMP1A_ENST00000253475.5_Missense_Mutation_p.D58N|CHMP1A_ENST00000547614.1_5'UTR|CHMP1A_ENST00000550102.1_Silent_p.R64R	NM_002768.3	NP_002759.2	Q9HD42	CHM1A_HUMAN	charged multivesicular body protein 1A	64					cytokinesis (GO:0000910)|gene silencing (GO:0016458)|mitotic chromosome condensation (GO:0007076)|negative regulation of transcription by glucose (GO:0045014)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|proteolysis (GO:0006508)|transcription, DNA-templated (GO:0006351)|vesicle-mediated transport (GO:0016192)	condensed nuclear chromosome (GO:0000794)|early endosome (GO:0005769)|endomembrane system (GO:0012505)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|nuclear matrix (GO:0016363)	metallopeptidase activity (GO:0008237)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(1)|ovary(1)	3		all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.048)		GGGACGCCATCCGAAGCCAGT	0.602																																					p.D58N		Atlas-SNP	.											.	CHMP1A	15	.	0			c.G172A						PASS	.						90.0	104.0	99.0					16																	89715819		2154	4245	6399	SO:0001819	synonymous_variant	5119	exon3			CGCCATCCGAAGC	U58048	CCDS45552.1	16q24.3	2011-09-21	2011-09-21	2007-03-20	ENSG00000131165	ENSG00000131165		"""Charged multivesicular body proteins"""	8740	protein-coding gene	gene with protein product		164010	"""procollagen (type III) N-endopeptidase"", ""chromatin modifying protein 1A"""	PRSM1, PCOLN3		11559748, 11559747	Standard	NM_002768		Approved	KIAA0047, CHMP1, Vps46A	uc002fnu.4	Q9HD42	OTTHUMG00000169521	ENST00000397901.3:c.192G>A	chr16.hg19:g.89715819C>T		150.0	0.0	.		210.0	63.0	.	NM_001083314	A2RU09|Q14468|Q15779|Q96G31	Missense_Mutation	SNP	ENST00000397901.3	hg19	CCDS45552.1	.	.	.	.	.	.	.	.	.	.	C	11.56	1.674550	0.29693	.	.	ENSG00000131165	ENST00000253475	.	.	.	5.38	-6.01	0.02199	.	0.480369	0.15538	N	0.257085	T	0.22244	0.0536	.	.	.	0.09310	N	0.999992	B	0.12013	0.005	B	0.09377	0.004	T	0.15009	-1.0452	8	0.87932	D	0	0.0142	3.6277	0.08119	0.1185:0.3755:0.2125:0.2936	.	58	A6NG32	.	N	58	.	ENSP00000253475:D58N	D	-	1	0	CHMP1A	88243320	0.002000	0.14202	0.974000	0.42286	0.700000	0.40528	-1.471000	0.02344	-0.529000	0.06358	-1.157000	0.01802	GAT	.	.	.	none		0.602	CHMP1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404581.1	NM_002768	
CDK10	8558	hgsc.bcm.edu	37	16	89756963	89756963	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr16:89756963C>T	ENST00000353379.7	+	3	206	c.163C>T	c.(163-165)Cgg>Tgg	p.R55W	CDK10_ENST00000505473.1_5'UTR|CDK10_ENST00000514965.1_3'UTR|CDK10_ENST00000331006.8_Missense_Mutation_p.R8W	NM_001098533.2|NM_001160367.1|NM_052988.4	NP_001092003.2|NP_001153839.1|NP_443714.3	Q15131	CDK10_HUMAN	cyclin-dependent kinase 10	55	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of cell proliferation (GO:0008285)|traversing start control point of mitotic cell cycle (GO:0007089)		ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			ovary(1)	1		Lung NSC(15;2.19e-05)|all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.0276)		CATTCCAGATCGGGCCCGGGA	0.592																																					p.R55W		Atlas-SNP	.											.	CDK10	26	.	0			c.C163T						PASS	.						195.0	162.0	173.0					16																	89756963		2198	4300	6498	SO:0001583	missense	8558	exon3			CCAGATCGGGCCC	L33264	CCDS10984.2, CCDS32514.1, CCDS32514.2	16q24.3	2011-11-08	2007-11-21		ENSG00000185324	ENSG00000185324		"""Cyclin-dependent kinases"""	1770	protein-coding gene	gene with protein product		603464	"""cyclin-dependent kinase (CDC2-like) 10"""			8208557, 8084611	Standard	NM_052988		Approved	PISSLRE	uc010cio.3	Q15131	OTTHUMG00000138049	ENST00000353379.7:c.163C>T	chr16.hg19:g.89756963C>T	ENSP00000338673:p.Arg55Trp	111.0	0.0	.		144.0	28.0	.	NM_052988	A8K370|A8K8I6|A8MXU6|B3KQJ3|B7Z420|D3DX82|D3DX83|Q0VGZ7|Q15130|Q6PJC0	Missense_Mutation	SNP	ENST00000353379.7	hg19	CCDS10984.2	.	.	.	.	.	.	.	.	.	.	C	25.2	4.617358	0.87359	.	.	ENSG00000185324	ENST00000331006;ENST00000393082;ENST00000353379	T;T	0.66995	0.87;-0.24	5.1	3.11	0.35812	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.84906	0.5576	M	0.92268	3.29	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.996;0.999	D	0.87752	0.2592	10	0.87932	D	0	-35.2961	14.2251	0.65853	0.2716:0.7284:0.0:0.0	.	49;55;49	B7Z319;Q15131;B3KQJ3	.;CDK10_HUMAN;.	W	8;26;55	ENSP00000329957:R8W;ENSP00000338673:R55W	ENSP00000329957:R8W	R	+	1	2	CDK10	88284464	1.000000	0.71417	0.996000	0.52242	0.815000	0.46073	3.632000	0.54287	0.517000	0.28361	0.561000	0.74099	CGG	.	.	.	none		0.592	CDK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269925.2		
ACAP1	9744	hgsc.bcm.edu	37	17	7250507	7250507	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr17:7250507G>A	ENST00000158762.3	+	14	1495	c.1289G>A	c.(1288-1290)tGg>tAg	p.W430*		NM_014716.3	NP_055531.1	Q15027	ACAP1_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 1	430	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.|Required for interaction with GULP1.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)	endosome (GO:0005768)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|cervix(3)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|prostate(3)|skin(1)|urinary_tract(1)	33						GCCCCGGAGTGGGCCAGCATC	0.657																																					p.W430X		Atlas-SNP	.											.	ACAP1	66	.	0			c.G1289A						PASS	.						75.0	86.0	82.0					17																	7250507		2203	4300	6503	SO:0001587	stop_gained	9744	exon14			CGGAGTGGGCCAG	D30758	CCDS11101.1	17p13.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000072818	ENSG00000072818		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16467	protein-coding gene	gene with protein product		607763	"""centaurin, beta 1"""	CENTB1		11050434, 11062263	Standard	NM_014716		Approved	KIAA0050	uc002ggd.2	Q15027	OTTHUMG00000102199	ENST00000158762.3:c.1289G>A	chr17.hg19:g.7250507G>A	ENSP00000158762:p.Trp430*	105.0	0.0	.		121.0	38.0	.	NM_014716	Q53XN9	Nonsense_Mutation	SNP	ENST00000158762.3	hg19	CCDS11101.1	.	.	.	.	.	.	.	.	.	.	G	40	8.222149	0.98712	.	.	ENSG00000072818	ENST00000158762	.	.	.	4.77	4.77	0.60923	.	0.120594	0.64402	D	0.000011	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.3166	0.74085	0.0:0.0:1.0:0.0	.	.	.	.	X	430	.	ENSP00000158762:W430X	W	+	2	0	ACAP1	7191231	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.244000	0.95423	2.480000	0.83734	0.462000	0.41574	TGG	.	.	.	none		0.657	ACAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220049.4	NM_014716	
ATAD5	79915	hgsc.bcm.edu	37	17	29162059	29162059	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr17:29162059G>C	ENST00000321990.4	+	2	1338	c.960G>C	c.(958-960)aaG>aaC	p.K320N	CTD-2349P21.11_ENST00000580873.1_RNA	NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	320					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				TACGCTTTAAGACAGTTACTG	0.378																																					p.K320N		Atlas-SNP	.											.	ATAD5	150	.	0			c.G960C						PASS	.						51.0	54.0	53.0					17																	29162059		2173	4287	6460	SO:0001583	missense	79915	exon2			CTTTAAGACAGTT		CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.960G>C	chr17.hg19:g.29162059G>C	ENSP00000313171:p.Lys320Asn	108.0	0.0	.		61.0	22.0	.	NM_024857	Q05DH0|Q69YR6|Q9H9I1	Missense_Mutation	SNP	ENST00000321990.4	hg19	CCDS11260.1	.	.	.	.	.	.	.	.	.	.	G	9.891	1.204236	0.22205	.	.	ENSG00000176208	ENST00000321990	T	0.11930	2.73	5.91	2.57	0.30868	.	0.221364	0.38778	N	0.001570	T	0.29061	0.0722	M	0.66939	2.045	0.29942	N	0.821002	D;D	0.76494	0.999;0.997	D;P	0.71656	0.974;0.879	T	0.06789	-1.0807	10	0.87932	D	0	.	7.1115	0.25392	0.4358:0.0:0.5642:0.0	.	320;320	Q96QE3-2;Q96QE3	.;ATAD5_HUMAN	N	320	ENSP00000313171:K320N	ENSP00000313171:K320N	K	+	3	2	ATAD5	26186185	1.000000	0.71417	0.993000	0.49108	0.993000	0.82548	1.162000	0.31786	0.850000	0.35239	-0.136000	0.14681	AAG	.	.	.	none		0.378	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256206.2	NM_024857	
LRRC37B	114659	hgsc.bcm.edu	37	17	30348539	30348539	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr17:30348539G>T	ENST00000341671.7	+	1	379	c.374G>T	c.(373-375)cGg>cTg	p.R125L	LRRC37B_ENST00000394713.3_Missense_Mutation_p.R125L|LRRC37B_ENST00000543378.2_Missense_Mutation_p.R43L|LRRC37B_ENST00000327564.7_Missense_Mutation_p.R152L|LRRC37B_ENST00000584368.1_Missense_Mutation_p.R137L	NM_052888.2	NP_443120.2	Q96QE4	LR37B_HUMAN	leucine rich repeat containing 37B	125						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	29		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.111)|Ovarian(249;0.182)|Breast(31;0.244)				AATGACAAGCGGACTCCAGAA	0.537																																					p.R125L		Atlas-SNP	.											.	LRRC37B	67	.	0			c.G374T						PASS	.						67.0	72.0	70.0					17																	30348539		2203	4299	6502	SO:0001583	missense	114659	exon1			ACAAGCGGACTCC	AJ314647	CCDS32609.1	17q11.2	2006-11-29		2005-08-09	ENSG00000185158	ENSG00000185158			29070	protein-coding gene	gene with protein product	"""KIAA0563-related"""					11468690, 10843809	Standard	NM_052888		Approved		uc002hgu.3	Q96QE4	OTTHUMG00000132785	ENST00000341671.7:c.374G>T	chr17.hg19:g.30348539G>T	ENSP00000340519:p.Arg125Leu	167.0	0.0	.		153.0	49.0	.	NM_052888	Q17RC9|Q5YKG6	Missense_Mutation	SNP	ENST00000341671.7	hg19	CCDS32609.1	.	.	.	.	.	.	.	.	.	.	N	0	-2.679426	0.00102	.	.	ENSG00000185158	ENST00000543378;ENST00000327564;ENST00000394713;ENST00000341671	T;T;T;T	0.48836	1.03;0.8;1.92;0.83	1.88	-3.76	0.04359	.	.	.	.	.	T	0.08846	0.0219	N	0.00210	-1.845	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.08027	-1.0742	9	0.09338	T	0.73	.	1.1007	0.01683	0.17:0.2722:0.3459:0.2118	.	125;125	Q17RC9;Q96QE4	.;LR37B_HUMAN	L	43;152;125;125	ENSP00000443345:R43L;ENSP00000332536:R152L;ENSP00000378202:R125L;ENSP00000340519:R125L	ENSP00000332536:R152L	R	+	2	0	LRRC37B	27372652	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.498000	0.06420	-2.354000	0.00614	-1.626000	0.00786	CGG	.	.	.	none		0.537	LRRC37B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446508.1	NM_052888	
MFSD11	79157	hgsc.bcm.edu	37	17	74772621	74772621	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr17:74772621C>T	ENST00000588460.1	+	12	3225	c.1183C>T	c.(1183-1185)Cag>Tag	p.Q395*	MFSD11_ENST00000590514.1_Nonsense_Mutation_p.Q395*|MFSD11_ENST00000590070.1_3'UTR|MFSD11_ENST00000586622.1_Nonsense_Mutation_p.Q395*|MFSD11_ENST00000336509.4_Nonsense_Mutation_p.Q395*|MFSD11_ENST00000593181.1_Nonsense_Mutation_p.Q343*|MFSD11_ENST00000355954.3_Nonsense_Mutation_p.Q343*	NM_001242534.1	NP_001229463.1	O43934	MFS11_HUMAN	major facilitator superfamily domain containing 11	395						integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)	17						CAAGTTTGTTCAGGTAACCTC	0.423																																					p.Q395X		Atlas-SNP	.											.	MFSD11	47	.	0			c.C1183T						PASS	.						165.0	158.0	160.0					17																	74772621		2203	4300	6503	SO:0001587	stop_gained	79157	exon12			TTTGTTCAGGTAA	BC002753	CCDS11750.1, CCDS56045.1	17q25.1	2012-03-09			ENSG00000092931	ENSG00000092931			25458	protein-coding gene	gene with protein product						9358160	Standard	NM_001242532		Approved	FLJ22196, FLJ20226	uc002jte.3	O43934		ENST00000588460.1:c.1183C>T	chr17.hg19:g.74772621C>T	ENSP00000464932:p.Gln395*	236.0	0.0	.		220.0	108.0	.	NM_001242532	O43442|Q9NXI5	Nonsense_Mutation	SNP	ENST00000588460.1	hg19	CCDS11750.1	.	.	.	.	.	.	.	.	.	.	C	39	7.628628	0.98399	.	.	ENSG00000092931	ENST00000336509;ENST00000355954	.	.	.	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-9.9106	19.2358	0.93858	0.0:1.0:0.0:0.0	.	.	.	.	X	395;343	.	ENSP00000337240:Q395X	Q	+	1	0	MFSD11	72284216	1.000000	0.71417	0.995000	0.50966	0.966000	0.64601	7.624000	0.83124	2.529000	0.85273	0.563000	0.77884	CAG	.	.	.	none		0.423	MFSD11-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451516.1	NM_024311	
SYT4	6860	hgsc.bcm.edu	37	18	40853823	40853823	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr18:40853823C>T	ENST00000255224.3	-	2	939	c.571G>A	c.(571-573)Gac>Aac	p.D191N	SYT4_ENST00000590752.1_Missense_Mutation_p.D173N|SYT4_ENST00000586678.1_Intron	NM_020783.3	NP_065834.1	Q9H2B2	SYT4_HUMAN	synaptotagmin IV	191	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.|Phospholipid binding. {ECO:0000305}.				exocytosis (GO:0006887)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of vesicle fusion (GO:0031339)|neurotransmitter secretion (GO:0007269)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44						ATATATGGGTCAGAGGTCATC	0.438																																					p.D191N	NSCLC(85;81 1419 2855 22820 35912)	Atlas-SNP	.											.	SYT4	162	.	0			c.G571A						PASS	.						78.0	77.0	78.0					18																	40853823		2203	4300	6503	SO:0001583	missense	6860	exon2			ATGGGTCAGAGGT	BC036538	CCDS11922.1	18q12.3	2013-01-21			ENSG00000132872	ENSG00000132872		"""Synaptotagmins"""	11512	protein-coding gene	gene with protein product		600103				8058779	Standard	NM_020783		Approved	KIAA1342, HsT1192	uc002law.3	Q9H2B2	OTTHUMG00000132610	ENST00000255224.3:c.571G>A	chr18.hg19:g.40853823C>T	ENSP00000255224:p.Asp191Asn	109.0	0.0	.		112.0	46.0	.	NM_020783	B4DEU3|Q9P2K4	Missense_Mutation	SNP	ENST00000255224.3	hg19	CCDS11922.1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.979225	0.92982	.	.	ENSG00000132872	ENST00000255224	T	0.14516	2.5	5.87	5.87	0.94306	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.43188	0.1236	M	0.78637	2.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.19192	-1.0313	10	0.87932	D	0	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	173;191	B4DEU3;Q9H2B2	.;SYT4_HUMAN	N	191	ENSP00000255224:D191N	ENSP00000255224:D191N	D	-	1	0	SYT4	39107821	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.729000	0.84864	2.941000	0.99782	0.655000	0.94253	GAC	.	.	.	none		0.438	SYT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255851.2	NM_020783	
MRPL54	116541	hgsc.bcm.edu	37	19	3765208	3765208	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr19:3765208G>A	ENST00000330133.4	+	2	200	c.163G>A	c.(163-165)Gcc>Acc	p.A55T		NM_172251.2	NP_758455.1	Q6P161	RM54_HUMAN	mitochondrial ribosomal protein L54	55						mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|lung(1)|ovary(1)	5		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00467)|STAD - Stomach adenocarcinoma(1328;0.18)		GACCAGCGAGGCCCTCAAGGA	0.572																																					p.A55T		Atlas-SNP	.											MRPL54,colon,carcinoma,0,1	MRPL54	9	.	0			c.G163A						PASS	.						109.0	90.0	96.0					19																	3765208		2202	4300	6502	SO:0001583	missense	116541	exon2			AGCGAGGCCCTCA		CCDS12111.1	19p13.3	2012-11-14			ENSG00000183617	ENSG00000183617		"""Mitochondrial ribosomal proteins / large subunits"""	16685	protein-coding gene	gene with protein product		611858				11551941	Standard	NM_172251		Approved		uc002lyq.4	Q6P161	OTTHUMG00000180873	ENST00000330133.4:c.163G>A	chr19.hg19:g.3765208G>A	ENSP00000331849:p.Ala55Thr	90.0	0.0	.		50.0	24.0	.	NM_172251		Missense_Mutation	SNP	ENST00000330133.4	hg19	CCDS12111.1	.	.	.	.	.	.	.	.	.	.	G	5.440	0.266338	0.10294	.	.	ENSG00000183617	ENST00000330133	.	.	.	4.9	1.59	0.23543	.	0.387651	0.25753	N	0.028522	T	0.22704	0.0548	N	0.19112	0.55	0.09310	N	0.999999	B	0.14438	0.01	B	0.12837	0.008	T	0.18840	-1.0324	9	0.16420	T	0.52	-5.8698	8.109	0.30903	0.2723:0.0:0.7277:0.0	.	55	Q6P161	RM54_HUMAN	T	55	.	ENSP00000331849:A55T	A	+	1	0	MRPL54	3716208	0.988000	0.35896	0.368000	0.25939	0.019000	0.09904	2.395000	0.44459	0.485000	0.27652	0.462000	0.41574	GCC	.	.	.	none		0.572	MRPL54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453443.1	NM_172251	
ZNF225	7768	hgsc.bcm.edu	37	19	44635911	44635911	+	Silent	SNP	A	A	C			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr19:44635911A>C	ENST00000262894.6	+	5	1424	c.1144A>C	c.(1144-1146)Aga>Cga	p.R382R	ZNF225_ENST00000592780.1_3'UTR|ZNF225_ENST00000590612.1_Silent_p.R382R	NM_013362.2	NP_037494.2	Q9UK10	ZN225_HUMAN	zinc finger protein 225	382					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|skin(1)|stomach(1)	16		Prostate(69;0.0352)|all_neural(266;0.202)				AAAGAGCTTCAGATGGGCCTC	0.408																																					p.R382R		Atlas-SNP	.											.	ZNF225	41	.	0			c.A1144C						PASS	.						74.0	80.0	78.0					19																	44635911		2182	4282	6464	SO:0001819	synonymous_variant	7768	exon5			AGCTTCAGATGGG	AF187991	CCDS46100.1	19q13.31	2013-01-08				ENSG00000256294		"""Zinc fingers, C2H2-type"", ""-"""	13018	protein-coding gene	gene with protein product							Standard	NM_013362		Approved		uc002oyj.1	Q9UK10		ENST00000262894.6:c.1144A>C	chr19.hg19:g.44635911A>C		113.0	0.0	.		101.0	47.0	.	NM_013362	A8K8S2|Q53F12|Q9NS46|Q9UID8	Silent	SNP	ENST00000262894.6	hg19	CCDS46100.1																																																																																			.	.	.	none		0.408	ZNF225-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460581.1		
ZNF547	284306	hgsc.bcm.edu	37	19	57888699	57888699	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr19:57888699G>A	ENST00000282282.3	+	4	505	c.355G>A	c.(355-357)Gca>Aca	p.A119T	AC003002.4_ENST00000597658.1_Intron	NM_173631.2	NP_775902.2	Q8IVP9	ZN547_HUMAN	zinc finger protein 547	119					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	12		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		CACGTGTCCAGCACATCTTCA	0.517																																					p.A119T		Atlas-SNP	.											.	ZNF547	45	.	0			c.G355A						PASS	.						100.0	88.0	92.0					19																	57888699		2203	4300	6503	SO:0001583	missense	284306	exon4			TGTCCAGCACATC	AK055662	CCDS33131.1	19q13.43	2013-01-08				ENSG00000152433		"""Zinc fingers, C2H2-type"", ""-"""	26432	protein-coding gene	gene with protein product							Standard	NM_173631		Approved	FLJ31100	uc002qol.3	Q8IVP9		ENST00000282282.3:c.355G>A	chr19.hg19:g.57888699G>A	ENSP00000282282:p.Ala119Thr	97.0	0.0	.		91.0	27.0	.	NM_173631	A8K5Z9|Q96NC4	Missense_Mutation	SNP	ENST00000282282.3	hg19	CCDS33131.1	.	.	.	.	.	.	.	.	.	.	G	11.74	1.727951	0.30593	.	.	ENSG00000152433	ENST00000391704;ENST00000282282	T	0.05855	3.38	2.09	-1.39	0.08997	.	.	.	.	.	T	0.05823	0.0152	L	0.37800	1.135	0.09310	N	1	P;B;P	0.51057	0.728;0.141;0.941	B;B;B	0.43889	0.358;0.031;0.435	T	0.36311	-0.9753	9	0.42905	T	0.14	.	6.7967	0.23729	0.4946:0.0:0.5054:0.0	.	119;119;119	Q8IVP9-2;C9JTQ3;Q8IVP9	.;.;ZN547_HUMAN	T	119	ENSP00000282282:A119T	ENSP00000282282:A119T	A	+	1	0	ZNF547	62580511	0.000000	0.05858	0.004000	0.12327	0.227000	0.25037	-0.074000	0.11450	-0.246000	0.09611	0.491000	0.48974	GCA	.	.	.	none		0.517	ZNF547-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465787.1	NM_173631	
ITGB2	3689	hgsc.bcm.edu	37	21	46306670	46306670	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr21:46306670A>C	ENST00000397850.2	-	16	2680	c.2228T>G	c.(2227-2229)cTc>cGc	p.L743R	ITGB2_ENST00000397857.1_Missense_Mutation_p.L743R|ITGB2_ENST00000302347.5_Missense_Mutation_p.L743R|ITGB2_ENST00000397854.3_Missense_Mutation_p.L686R|ITGB2_ENST00000397852.1_Missense_Mutation_p.L743R|ITGB2_ENST00000355153.4_Missense_Mutation_p.L743R			P05107	ITB2_HUMAN	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	743					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|neutrophil chemotaxis (GO:0030593)|receptor clustering (GO:0043113)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|glycoprotein binding (GO:0001948)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(4)|skin(3)	35				Colorectal(79;0.0669)	Simvastatin(DB00641)	CTGGGACTTGAGCTTCTCCTT	0.617																																					p.L743R		Atlas-SNP	.											.	ITGB2	107	.	0			c.T2228G						PASS	.						110.0	88.0	96.0					21																	46306670		2203	4300	6503	SO:0001583	missense	3689	exon15			GACTTGAGCTTCT	AK222505	CCDS13716.1	21q22.3	2014-09-17	2006-03-02		ENSG00000160255	ENSG00000160255		"""CD molecules"", ""Complement system"", ""Integrins"""	6155	protein-coding gene	gene with protein product		600065	"""integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit)"""	CD18, MFI7			Standard	NM_000211		Approved	LFA-1, MAC-1	uc002zgf.3	P05107	OTTHUMG00000090257	ENST00000397850.2:c.2228T>G	chr21.hg19:g.46306670A>C	ENSP00000380948:p.Leu743Arg	73.0	0.0	.		43.0	6.0	.	NM_000211	B3KTS8|D3DSM1|Q16418|Q53HS5|Q9UD72	Missense_Mutation	SNP	ENST00000397850.2	hg19	CCDS13716.1	.	.	.	.	.	.	.	.	.	.	A	2.100	-0.406333	0.04832	.	.	ENSG00000160255	ENST00000397852;ENST00000397857;ENST00000397854;ENST00000355153;ENST00000397850;ENST00000302347	D;D;D;D;D;D	0.87966	-2.32;-2.32;-2.32;-2.32;-2.32;-2.32	4.62	2.16	0.27623	Integrin beta subunit, cytoplasmic (2);	.	.	.	.	T	0.78483	0.4290	L	0.34521	1.04	0.30302	N	0.789334	P;P	0.37276	0.589;0.589	B;B	0.43018	0.405;0.315	T	0.67795	-0.5578	9	0.15066	T	0.55	.	1.6167	0.02705	0.5553:0.1773:0.0964:0.171	.	686;743	A8MYE6;P05107	.;ITB2_HUMAN	R	743;743;686;743;743;743	ENSP00000380950:L743R;ENSP00000380955:L743R;ENSP00000380952:L686R;ENSP00000347279:L743R;ENSP00000380948:L743R;ENSP00000303242:L743R	ENSP00000303242:L743R	L	-	2	0	ITGB2	45131098	1.000000	0.71417	0.996000	0.52242	0.100000	0.18952	1.319000	0.33655	0.157000	0.19338	-0.250000	0.11733	CTC	.	.	.	none		0.617	ITGB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206566.2	NM_000211	
NF2	4771	hgsc.bcm.edu	37	22	30038223	30038223	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr22:30038223C>A	ENST00000338641.4	+	4	837	c.396C>A	c.(394-396)taC>taA	p.Y132*	NF2_ENST00000397789.3_Nonsense_Mutation_p.Y132*|NF2_ENST00000361166.4_Nonsense_Mutation_p.Y132*|NF2_ENST00000361452.4_Nonsense_Mutation_p.Y91*|NF2_ENST00000413209.2_Nonsense_Mutation_p.Y132*|NF2_ENST00000361676.4_Nonsense_Mutation_p.Y90*|NF2_ENST00000403435.1_Nonsense_Mutation_p.Y132*|NF2_ENST00000403999.3_Nonsense_Mutation_p.Y132*|NF2_ENST00000347330.5_Nonsense_Mutation_p.Y49*|NF2_ENST00000353887.4_Nonsense_Mutation_p.Y49*|NF2_ENST00000334961.7_Nonsense_Mutation_p.Y49*	NM_000268.3|NM_016418.5|NM_181832.2	NP_000259.1|NP_057502.2|NP_861970.1	P35240	MERL_HUMAN	neurofibromin 2 (merlin)	132	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin cytoskeleton organization (GO:0030036)|cell-cell junction organization (GO:0045216)|ectoderm development (GO:0007398)|hippocampus development (GO:0021766)|lens fiber cell differentiation (GO:0070306)|mesoderm formation (GO:0001707)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of DNA replication (GO:0008156)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell differentiation (GO:0045597)|positive regulation of stress fiber assembly (GO:0051496)|regulation of hippo signaling (GO:0035330)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of protein localization to nucleus (GO:1900180)|regulation of protein stability (GO:0031647)|Schwann cell proliferation (GO:0014010)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|cleavage furrow (GO:0032154)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome (GO:0005769)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)		p.V122_K149del(5)|p.?(3)|p.L127_P134del(1)|p.K123fs*2(1)		NS(1)|bone(2)|breast(5)|central_nervous_system(21)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(17)|large_intestine(9)|liver(1)|lung(9)|meninges(372)|ovary(2)|pituitary(1)|pleura(9)|prostate(1)|skin(7)|soft_tissue(303)|stomach(2)|thyroid(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	776						AAAAGATCTACTGCCCTCCTG	0.468			"""D, Mis, N, F, S, O"""		"""meningioma, acoustic neuroma, renal """	"""meningioma, acoustic neuroma"""			Neurofibromatosis, type 2																												p.Y132X		Atlas-SNP	.	yes	Rec	yes	Neurofibromatosis type 2	22	22q12.2	4771	neurofibromatosis type 2 gene		O	.	NF2	1312	.	10	Deletion - In frame(6)|Unknown(3)|Deletion - Frameshift(1)	soft_tissue(8)|large_intestine(1)|stomach(1)	c.C396A						PASS	.						95.0	90.0	92.0					22																	30038223		2203	4300	6503	SO:0001587	stop_gained	4771	exon4	Familial Cancer Database	NF2, Central Neurofibromatosis, Bilateral Acoustic Neurofibromatosis	GATCTACTGCCCT	L11353	CCDS13861.1, CCDS13862.1, CCDS13863.1, CCDS13864.1, CCDS13865.1, CCDS54516.1	22q12.2	2014-09-17	2007-12-17		ENSG00000186575	ENSG00000186575		"""A-kinase anchor proteins"""	7773	protein-coding gene	gene with protein product	"""moesin-ezrin-radixin like"", ""schwannomin"""	607379	"""neurofibromin 2 (bilateral acoustic neuroma)"""			10591208	Standard	NM_000268		Approved	merlin	uc003age.4	P35240	OTTHUMG00000030727	ENST00000338641.4:c.396C>A	chr22.hg19:g.30038223C>A	ENSP00000344666:p.Tyr132*	66.0	0.0	.		55.0	37.0	.	NM_000268	O95683|Q8WUJ2|Q969N0|Q969Q3|Q96T30|Q96T31|Q96T32|Q96T33|Q9BTW3|Q9UNG9|Q9UNH3|Q9UNH4	Nonsense_Mutation	SNP	ENST00000338641.4	hg19	CCDS13861.1	.	.	.	.	.	.	.	.	.	.	C	39	7.545417	0.98348	.	.	ENSG00000186575	ENST00000413209;ENST00000347330;ENST00000338641;ENST00000403435;ENST00000361452;ENST00000397822;ENST00000403999;ENST00000334961;ENST00000353887;ENST00000397789;ENST00000361676;ENST00000361166	.	.	.	5.45	2.11	0.27256	.	0.116668	0.64402	D	0.000011	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.5018	0.50441	0.0:0.7981:0.0:0.2019	.	.	.	.	X	132;49;132;132;91;132;132;49;49;132;90;132	.	.	Y	+	3	2	NF2	28368223	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.702000	0.37836	0.657000	0.30906	0.655000	0.94253	TAC	.	.	.	none		0.468	NF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075615.3	NM_000268	
SLC9A7	84679	hgsc.bcm.edu	37	X	46491075	46491075	+	Silent	SNP	A	A	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chrX:46491075A>T	ENST00000328306.4	-	14	1708	c.1683T>A	c.(1681-1683)gtT>gtA	p.V561V	SLC9A7_ENST00000464933.1_5'UTR	NM_001257291.1|NM_032591.2	NP_001244220.1|NP_115980.1	Q96T83	SL9A7_HUMAN	solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7	561					ion transport (GO:0006811)|potassium ion transmembrane transport (GO:0071805)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|recycling endosome membrane (GO:0055038)|trans-Golgi network (GO:0005802)	potassium:proton antiporter activity (GO:0015386)|protein homodimerization activity (GO:0042803)|sodium:proton antiporter activity (GO:0015385)			breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)|skin(1)	21						GATCGGGGTCAACACCAACTC	0.498																																					p.V562V	Pancreas(118;454 1696 1930 13865 39976)	Atlas-SNP	.											.	SLC9A7	73	.	0			c.T1686A						PASS	.						110.0	90.0	97.0					X																	46491075		2203	4300	6503	SO:0001819	synonymous_variant	84679	exon14			GGGGTCAACACCA	AF298591	CCDS14269.1, CCDS75967.1	Xp11.3	2013-05-22	2012-03-22		ENSG00000065923	ENSG00000065923		"""Solute carriers"""	17123	protein-coding gene	gene with protein product		300368	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 7"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 7"""			11279194	Standard	NM_001257291		Approved	NHE7	uc004dgv.2	Q96T83	OTTHUMG00000021428	ENST00000328306.4:c.1683T>A	chrX.hg19:g.46491075A>T		26.0	0.0	.		48.0	17.0	.	NM_001257291	O75827|Q5JXP9	Silent	SNP	ENST00000328306.4	hg19	CCDS14269.1																																																																																			.	.	.	none		0.498	SLC9A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056370.1	NM_032591	
MCTS1	28985	hgsc.bcm.edu	37	X	119739295	119739296	+	Nonsense_Mutation	DNP	CC	CC	AT			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chrX:119739295_119739296CC>AT	ENST00000371317.5	+	2	302_303	c.45_46CC>AT	c.(43-48)atCCag>atATag	p.Q16*	MCTS1_ENST00000487133.1_3'UTR|MCTS1_ENST00000371315.3_Nonsense_Mutation_p.Q17*	NM_014060.2	NP_054779.1	Q9ULC4	MCTS1_HUMAN	malignant T cell amplified sequence 1	16					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|formation of translation preinitiation complex (GO:0001731)|IRES-dependent translational initiation (GO:0002192)|positive regulation of cell proliferation (GO:0008284)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|ribosome disassembly (GO:0032790)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	translation initiation factor activity (GO:0003743)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|stomach(1)|urinary_tract(1)	10						CCAACTGCATCCAGTTGAAAAC	0.337																																					p.I16I|p.Q17X		Atlas-SNP	.											.	MCTS1	40	.	0			c.C48A|c.C49T						PASS	.																																			SO:0001587	stop_gained	28985	exon2			CTGCATCCAGTTG|TGCATCCAGTTGA	AB034206	CCDS14601.1, CCDS48160.1	Xq24	2008-05-14			ENSG00000232119	ENSG00000232119			23357	protein-coding gene	gene with protein product		300587				9766643	Standard	NM_014060		Approved	MCT-1	uc011mub.2	Q9ULC4	OTTHUMG00000022303	Exception_encountered	chrX.hg19:g.119739295_119739296delinsAT	ENSP00000360367:p.Gln16*	163.0|165.0	0.0	.		126.0|123.0	30.0	.	NM_001137554	B4DGY2|Q502X6	Silent|Nonsense_Mutation	SNP	ENST00000371317.5	hg19	CCDS14601.1																																																																																			.	.	.	none		0.337	MCTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058110.1	NM_014060	
SEPT7	989	hgsc.bcm.edu	37	7	35930341	35930341	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr7:35930341delA	ENST00000435235.1	+	10	1209	c.777delA	c.(775-777)agafs	p.R259fs	SEPT7_ENST00000494488.2_Frame_Shift_Del_p.R298fs|SEPT7_ENST00000399035.3_Frame_Shift_Del_p.R311fs|SEPT7_ENST00000432293.2_Intron|SEPT7_ENST00000399034.2_Frame_Shift_Del_p.R313fs|SEPT7_ENST00000350320.6_Frame_Shift_Del_p.R311fs			Q16181	SEPT7_HUMAN	septin 7	312	Septin-type G.				cilium morphogenesis (GO:0060271)|cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein heterooligomerization (GO:0051291)|regulation of embryonic cell shape (GO:0016476)	actin cytoskeleton (GO:0015629)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|septin complex (GO:0031105)|stress fiber (GO:0001725)	GTP binding (GO:0005525)|identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)	14						ACAGAAGCAGAAAACTTGCAG	0.333																																					p.R311fs		Atlas-INDEL	.											.	SEPT7	24	.	0			c.932delG						PASS	.						51.0	46.0	48.0					7																	35930341		1835	4089	5924	SO:0001589	frameshift_variant	989	exon10			.	S72008	CCDS75582.1	7p14.2	2013-01-21	2005-01-11	2005-01-12	ENSG00000122545	ENSG00000122545		"""Septins"""	1717	protein-coding gene	gene with protein product		603151	"""CDC10 cell division cycle 10 homolog (S. cerevisiae)"""	CDC10		8037772	Standard	NM_001788		Approved	CDC3, SEPT7A	uc011kau.2	Q16181	OTTHUMG00000155063	ENST00000435235.1:c.777delA	chr7.hg19:g.35930341delA	ENSP00000413507:p.Arg259fs	30.0	0.0	0		31.0	15.0	0.483871	NM_001011553	Q52M76|Q6NX50	Frame_Shift_Del	DEL	ENST00000435235.1	hg19																																																																																				.	.	.	none		0.333	SEPT7-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000338285.1	NM_001788	
RASA4	10156	hgsc.bcm.edu	37	7	102240772	102240772	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr7:102240772delC	ENST00000262940.7	-	7	641	c.574delG	c.(574-576)gccfs	p.A192fs	RASA4_ENST00000461209.1_Frame_Shift_Del_p.A120fs|RASA4_ENST00000449970.2_Frame_Shift_Del_p.A192fs|RASA4_ENST00000462172.1_Frame_Shift_Del_p.A120fs|RP11-514P8.6_ENST00000519541.1_3'UTR	NM_006989.5	NP_008920.5	O43374	RASL2_HUMAN	RAS p21 protein activator 4	192	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				cellular response to calcium ion (GO:0071277)|intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)			lung(1)|prostate(1)|urinary_tract(1)	3						GCCTCCATGGCCCCCTCCTGC	0.632																																					p.A192fs		Atlas-INDEL	.											.	RASA4	7	.	0			c.575delC						PASS	.																																			SO:0001589	frameshift_variant	10156	exon7			.	AB011110	CCDS5725.1, CCDS47674.1	7q22-q31.1	2008-12-05			ENSG00000105808	ENSG00000105808			23181	protein-coding gene	gene with protein product		607943				11448776	Standard	NM_001079877		Approved	KIAA0538, CAPRI, GAPL	uc003vae.3	O43374	OTTHUMG00000150383	ENST00000262940.7:c.574delG	chr7.hg19:g.102240772delC	ENSP00000262940:p.Ala192fs	100.0	0.0	0		103.0	10.0	0.0970874	NM_006989	O60286|Q14CQ4|Q86UW3|Q96QU0	Frame_Shift_Del	DEL	ENST00000262940.7	hg19	CCDS5725.1																																																																																			.	.	.	none		0.632	RASA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317900.3	NM_006989	
STAG2	10735	hgsc.bcm.edu	37	X	123184115	123184118	+	Frame_Shift_Del	DEL	AATG	AATG	-			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	AATG	AATG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chrX:123184115_123184118delAATG	ENST00000371160.1	+	11	1263_1266	c.973_976delAATG	c.(973-978)aatgacfs	p.ND325fs	STAG2_ENST00000371145.3_Frame_Shift_Del_p.ND325fs|STAG2_ENST00000354548.5_Frame_Shift_Del_p.ND256fs|STAG2_ENST00000469481.1_Intron|STAG2_ENST00000218089.9_Frame_Shift_Del_p.ND325fs|STAG2_ENST00000371144.3_Frame_Shift_Del_p.ND325fs|STAG2_ENST00000371157.3_Frame_Shift_Del_p.ND325fs	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	325	SCD. {ECO:0000255|PROSITE- ProRule:PRU00750}.				meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						TGCCTTTCTTAATGACAGTTATTT	0.412																																					p.324_325del		Atlas-INDEL	.											.	STAG2	309	.	0			c.972_975del						PASS	.																																			SO:0001589	frameshift_variant	10735	exon11			.	Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.973_976delAATG	chrX.hg19:g.123184115_123184118delAATG	ENSP00000360202:p.Asn325fs	252.0	0.0	0		179.0	61.0	0.340782	NM_001042749	B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Frame_Shift_Del	DEL	ENST00000371160.1	hg19	CCDS14607.1																																																																																			.	.	.	none		0.412	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000156159.2	NM_006603	
KRT18P55	284085	hgsc.bcm.edu	37	17	26604362	26604363	+	RNA	INS	-	-	A	rs540929081		TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr17:26604362_26604363insA	ENST00000577198.1	-	0	598_599				AC061975.8_ENST00000385109.1_RNA	NR_028334.1				keratin 18 pseudogene 55																		GTGAAGTTCATGCTGTCCGGGG	0.51																																					.		Atlas-INDEL	.											.	.	.	.	0			.						PASS	.																																					284085	.			.			17q11.2	2013-06-25			ENSG00000265480	ENSG00000265480			26874	pseudogene	pseudogene							Standard	NR_028334		Approved		uc002has.3		OTTHUMG00000179422		chr17.hg19:g.26604362_26604363insA		92.0	0.0	0		76.0	35.0	0.460526	.		RNA	INS	ENST00000577198.1	hg19																																																																																				.	.	.	none		0.510	KRT18P55-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000446194.1	NR_028334	
MCTS1	28985	hgsc.bcm.edu	37	X	119739292	119739293	+	Frame_Shift_Ins	INS	-	-	AT			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chrX:119739292_119739293insAT	ENST00000371317.5	+	2	299_300	c.42_43insAT	c.(43-45)atcfs	p.I15fs	MCTS1_ENST00000487133.1_3'UTR|MCTS1_ENST00000371315.3_Frame_Shift_Ins_p.I16fs	NM_014060.2	NP_054779.1	Q9ULC4	MCTS1_HUMAN	malignant T cell amplified sequence 1	15					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|formation of translation preinitiation complex (GO:0001731)|IRES-dependent translational initiation (GO:0002192)|positive regulation of cell proliferation (GO:0008284)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|ribosome disassembly (GO:0032790)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	translation initiation factor activity (GO:0003743)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|stomach(1)|urinary_tract(1)	10						TGTCCAACTGCATCCAGTTGAA	0.332																																					p.C15fs		Atlas-INDEL	.											.	MCTS1	40	.	0			c.45_46insAT						PASS	.																																			SO:0001589	frameshift_variant	28985	exon2			.	AB034206	CCDS14601.1, CCDS48160.1	Xq24	2008-05-14			ENSG00000232119	ENSG00000232119			23357	protein-coding gene	gene with protein product		300587				9766643	Standard	NM_014060		Approved	MCT-1	uc011mub.2	Q9ULC4	OTTHUMG00000022303	ENST00000371317.5:c.43_44dupAT	chrX.hg19:g.119739293_119739294dupAT	ENSP00000360367:p.Ile15fs	159.0	0.0	0		131.0	28.0	0.21374	NM_001137554	B4DGY2|Q502X6	Frame_Shift_Ins	INS	ENST00000371317.5	hg19	CCDS14601.1																																																																																			.	.	.	none		0.332	MCTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058110.1	NM_014060	
TMEM144	55314	hgsc.bcm.edu	37	4	159138552	159138552	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr4:159138552delA	ENST00000296529.6	+	5	832	c.312delA	c.(310-312)ttafs	p.L104fs	TMEM144_ENST00000514558.1_Frame_Shift_Del_p.L104fs	NM_018342.4	NP_060812.2	Q7Z5S9	TM144_HUMAN	transmembrane protein 144	104						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|endometrium(1)|large_intestine(7)|lung(9)|prostate(1)	19	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0539)		TTAATGCCTTAACTGGCTGGG	0.378																																					p.L104X		Atlas-INDEL	.											.	TMEM144	34	.	0			c.311delT						PASS	.						110.0	105.0	107.0					4																	159138552		2203	4300	6503	SO:0001589	frameshift_variant	55314	exon5			.	AK002017	CCDS3799.1	4q32.1	2008-02-05			ENSG00000164124	ENSG00000164124			25633	protein-coding gene	gene with protein product						12477932	Standard	NM_018342		Approved	FLJ11155	uc003ipx.3	Q7Z5S9	OTTHUMG00000162013	ENST00000296529.6:c.312delA	chr4.hg19:g.159138552delA	ENSP00000296529:p.Leu104fs	92.0	0.0	0		62.0	26.0	0.419355	NM_018342	D3DP24|Q49A05|Q9NUT3	Frame_Shift_Del	DEL	ENST00000296529.6	hg19	CCDS3799.1																																																																																			.	.	.	none		0.378	TMEM144-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365597.1	NM_018342	
OR51A2	401667	hgsc.bcm.edu	37	11	4976463	4976469	+	Frame_Shift_Del	DEL	AGGGAAG	AGGGAAG	-			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	AGGGAAG	AGGGAAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr11:4976463_4976469delAGGGAAG	ENST00000380371.1	-	1	474_480	c.475_481delCTTCCCT	c.(475-483)cttcccttcfs	p.LPF159fs	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001004748.1	NP_001004748.1	Q8NGJ7	O51A2_HUMAN	olfactory receptor, family 51, subfamily A, member 2	159						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		GTGAAAGGGAAGGGAAGAACCAGGAGC	0.44																																					p.159_161del		Atlas-INDEL	.											.	OR51A2	40	.	0			c.476_482del						PASS	.																																			SO:0001589	frameshift_variant	401667	exon1			.	AB065797	CCDS31368.1	11p15.4	2012-08-09			ENSG00000205496	ENSG00000205496		"""GPCR / Class A : Olfactory receptors"""	14764	protein-coding gene	gene with protein product							Standard	NM_001004748		Approved		uc010qyt.2	Q8NGJ7	OTTHUMG00000066602	ENST00000380371.1:c.475_481delCTTCCCT	chr11.hg19:g.4976463_4976469delAGGGAAG	ENSP00000369729:p.Leu159fs	244.0	0.0	0		164.0	27.0	0.164634	NM_001004748		Frame_Shift_Del	DEL	ENST00000380371.1	hg19	CCDS31368.1																																																																																			.	.	.	none		0.440	OR51A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142809.1	NM_001004748	
DNAJC16	23341	hgsc.bcm.edu	37	1	15894493	15894493	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr1:15894493delG	ENST00000375847.3	+	15	2334	c.2170delG	c.(2170-2172)gggfs	p.G724fs	RP4-680D5.8_ENST00000606186.1_RNA|DNAJC16_ENST00000375849.1_Intron|DNAJC16_ENST00000483270.1_3'UTR	NM_015291.2	NP_056106.1	Q9Y2G8	DJC16_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 16	724					cell redox homeostasis (GO:0045454)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(7)|urinary_tract(1)	18		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00173)|all_lung(284;0.00459)|Lung NSC(340;0.00499)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		GGAAGCCATAGGGTCGTGCAG	0.512																																					p.I723fs		Atlas-INDEL	.											.	DNAJC16	59	.	0			c.2169delA						PASS	.						124.0	103.0	110.0					1																	15894493		2203	4300	6503	SO:0001589	frameshift_variant	23341	exon15			.	AB023179	CCDS30606.1, CCDS72710.1	1p36.1	2011-09-02			ENSG00000116138	ENSG00000116138		"""Heat shock proteins / DNAJ (HSP40)"""	29157	protein-coding gene	gene with protein product							Standard	NM_015291		Approved	KIAA0962	uc001aws.3	Q9Y2G8	OTTHUMG00000002358	ENST00000375847.3:c.2170delG	chr1.hg19:g.15894493delG	ENSP00000365007:p.Gly724fs	110.0	0.0	0		75.0	17.0	0.226667	NM_015291	Q68D57|Q86X32|Q8N5P4	Frame_Shift_Del	DEL	ENST00000375847.3	hg19	CCDS30606.1																																																																																			.	.	.	none		0.512	DNAJC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006764.1	NM_015291	
