#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
VPS13D	55187	hgsc.bcm.edu	37	1	12327038	12327038	+	Silent	SNP	T	T	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr1:12327038T>C	ENST00000358136.3	+	14	1825	c.1695T>C	c.(1693-1695)acT>acC	p.T565T	VPS13D_ENST00000356315.4_Silent_p.T565T	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		CAGAAGGAACTATGTTTCCTC	0.408																																					p.T565T		Atlas-SNP	.											.	VPS13D	316	.	0			c.T1695C						PASS	.						124.0	114.0	117.0					1																	12327038		2203	4300	6503	SO:0001819	synonymous_variant	55187	exon14			AGGAACTATGTTT	AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.1695T>C	chr1.hg19:g.12327038T>C		141.0	0.0	.		168.0	30.0	.	NM_015378		Silent	SNP	ENST00000358136.3	hg19	CCDS30588.1																																																																																			.	.	.	none		0.408	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2	NM_015378	
POMGNT1	55624	hgsc.bcm.edu	37	1	46654508	46654508	+	3'UTR	SNP	G	G	T			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr1:46654508G>T	ENST00000371984.3	-	0	2574				POMGNT1_ENST00000396420.3_3'UTR|POMGNT1_ENST00000371992.1_Missense_Mutation_p.N710K|POMGNT1_ENST00000535522.1_3'UTR|POMGNT1_ENST00000371986.3_Missense_Mutation_p.N710K|POMGNT1_ENST00000485714.1_5'Flank	NM_017739.3	NP_060209	Q8WZA1	PMGT1_HUMAN	protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-)						protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity (GO:0047223)			breast(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(166;0.155)					CTGTCCATGGGTTGGGCACAG	0.577																																					p.N710K		Atlas-SNP	.											.	POMGNT1	96	.	0			c.C2130A						PASS	.						56.0	55.0	55.0					1																	46654508		876	1991	2867	SO:0001624	3_prime_UTR_variant	55624	exon23			CCATGGGTTGGGC		CCDS531.1, CCDS57995.1	1p34.1	2014-09-17	2013-07-31		ENSG00000085998	ENSG00000085998	2.4.1.-	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	19139	protein-coding gene	gene with protein product	"""protein O-mannose beta-1,2-N-acetylglucosaminyltransferase"""	606822	"""muscle-eye-brain disease"", ""protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase"""	MEB		11742540, 12788071	Standard	NM_017739		Approved	FLJ20277, MGAT1.2, LGMD2O	uc001cpg.3	Q8WZA1	OTTHUMG00000007604	ENST00000371984.3:c.*434C>A	chr1.hg19:g.46654508G>T		72.0	0.0	.		71.0	9.0	.	NM_001243766	D3DQ16|Q5VST2|Q5VST3|Q9BV55|Q9H9L8|Q9NXF9|Q9NYF7	Missense_Mutation	SNP	ENST00000371984.3	hg19	CCDS531.1	.	.	.	.	.	.	.	.	.	.	G	12.02	1.812764	0.32053	.	.	ENSG00000085998	ENST00000371992;ENST00000371986	T;T	0.33438	1.41;1.41	5.24	2.3	0.28687	.	1.133680	0.06705	N	0.772169	T	0.23330	0.0564	.	.	.	0.09310	N	0.999997	B	0.11235	0.004	B	0.09377	0.004	T	0.31420	-0.9944	9	0.87932	D	0	-1.0E-4	4.1207	0.10104	0.0857:0.1588:0.5908:0.1646	.	710	Q5VST3	.	K	710	ENSP00000361060:N710K;ENSP00000361054:N710K	ENSP00000361054:N710K	N	-	3	2	POMGNT1	46427095	0.092000	0.21681	0.001000	0.08648	0.912000	0.54170	1.599000	0.36751	0.432000	0.26286	-0.140000	0.14226	AAC	.	.	.	none		0.577	POMGNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020146.1	NM_017739	
FAM73A	374986	hgsc.bcm.edu	37	1	78325733	78325733	+	Silent	SNP	T	T	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr1:78325733T>C	ENST00000370791.3	+	11	1229	c.1197T>C	c.(1195-1197)ctT>ctC	p.L399L	FAM73A_ENST00000443751.2_Silent_p.L361L	NM_001270384.1|NM_198549.3	NP_001257313.1|NP_940951.1	Q8NAN2	FA73A_HUMAN	family with sequence similarity 73, member A	399						integral component of membrane (GO:0016021)				breast(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	19				Colorectal(170;0.226)		AGGTAATTCTTTCAGAATCAG	0.343																																					p.L399L		Atlas-SNP	.											.	FAM73A	56	.	0			c.T1197C						PASS	.						43.0	44.0	44.0					1																	78325733		2203	4300	6503	SO:0001819	synonymous_variant	374986	exon11			AATTCTTTCAGAA		CCDS681.1, CCDS72809.1	1p31.1	2008-02-05			ENSG00000180488	ENSG00000180488			24741	protein-coding gene	gene with protein product							Standard	NM_001270384		Approved	FLJ35093	uc010ork.3	Q8NAN2	OTTHUMG00000009766	ENST00000370791.3:c.1197T>C	chr1.hg19:g.78325733T>C		51.0	0.0	.		86.0	4.0	.	NM_001270384	Q6MZG0	Silent	SNP	ENST00000370791.3	hg19	CCDS681.1																																																																																			.	.	.	none		0.343	FAM73A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000026931.1	NM_198549	
LRRC8D	55144	hgsc.bcm.edu	37	1	90399406	90399406	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr1:90399406A>T	ENST00000337338.5	+	3	1186	c.779A>T	c.(778-780)aAa>aTa	p.K260I	LRRC8D_ENST00000394593.3_Missense_Mutation_p.K260I	NM_001134479.1	NP_001127951.1	Q7L1W4	LRC8D_HUMAN	leucine rich repeat containing 8 family, member D	260					ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(2)|skin(1)	29		all_lung(203;0.0894)|Lung NSC(277;0.227)		all cancers(265;0.0109)|Epithelial(280;0.0427)		ACTGGCTTTAAATTTTCAGCT	0.458																																					p.K260I		Atlas-SNP	.											.	LRRC8D	78	.	0			c.A779T						PASS	.						44.0	42.0	43.0					1																	90399406		2203	4300	6503	SO:0001583	missense	55144	exon3			GCTTTAAATTTTC	AK001332	CCDS726.1	1p22.2	2008-02-05	2005-06-29	2005-06-29	ENSG00000171492	ENSG00000171492			16992	protein-coding gene	gene with protein product		612890	"""leucine rich repeat containing 5"""	LRRC5			Standard	NM_018103		Approved	FLJ10470	uc001dnn.3	Q7L1W4	OTTHUMG00000010583	ENST00000337338.5:c.779A>T	chr1.hg19:g.90399406A>T	ENSP00000338887:p.Lys260Ile	33.0	0.0	.		44.0	16.0	.	NM_018103	D3DT29|Q6UWB2|Q9NVW3	Missense_Mutation	SNP	ENST00000337338.5	hg19	CCDS726.1	.	.	.	.	.	.	.	.	.	.	A	14.20	2.464588	0.43736	.	.	ENSG00000171492	ENST00000337338;ENST00000394593;ENST00000441269	T;T;T	0.49432	1.35;1.35;0.78	5.88	5.88	0.94601	.	0.111169	0.64402	D	0.000017	T	0.30070	0.0753	L	0.36672	1.1	0.48696	D	0.99969	P	0.40376	0.715	B	0.42062	0.374	T	0.07121	-1.0789	9	.	.	.	.	16.3009	0.82811	1.0:0.0:0.0:0.0	.	260	Q7L1W4	LRC8D_HUMAN	I	260	ENSP00000338887:K260I;ENSP00000378093:K260I;ENSP00000405784:K260I	.	K	+	2	0	LRRC8D	90171994	1.000000	0.71417	0.980000	0.43619	0.959000	0.62525	4.701000	0.61810	2.246000	0.74042	0.533000	0.62120	AAA	.	.	.	none		0.458	LRRC8D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029203.2	NM_018103	
DNTTIP2	30836	hgsc.bcm.edu	37	1	94342829	94342829	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr1:94342829A>C	ENST00000436063.2	-	2	719	c.662T>G	c.(661-663)aTt>aGt	p.I221S	DNTTIP2_ENST00000460191.1_5'UTR	NM_014597.4	NP_055412.2	Q5QJE6	TDIF2_HUMAN	deoxynucleotidyltransferase, terminal, interacting protein 2	221					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	38		all_lung(203;0.0111)|Lung NSC(277;0.0347)		all cancers(265;0.00679)|GBM - Glioblastoma multiforme(16;0.0278)|Epithelial(280;0.128)		TCCTGGTACAATCTTACTATC	0.393																																					p.I221S		Atlas-SNP	.											.	DNTTIP2	59	.	0			c.T662G						PASS	.						157.0	156.0	157.0					1																	94342829		1874	4097	5971	SO:0001583	missense	30836	exon2			GGTACAATCTTAC	AY394925	CCDS44174.1	1p22.1	2008-02-05			ENSG00000067334	ENSG00000067334			24013	protein-coding gene	gene with protein product	"""acidic 82 kDa protein mRNA"""	611199				15047147	Standard	NM_014597		Approved	HSU15552, ERBP, TdIF2	uc001dqf.3	Q5QJE6	OTTHUMG00000010268	ENST00000436063.2:c.662T>G	chr1.hg19:g.94342829A>C	ENSP00000411010:p.Ile221Ser	264.0	0.0	.		295.0	109.0	.	NM_014597	Q12987|Q53H59|Q5TFJ4|Q6TLI0|Q76MJ8|Q86WX9	Missense_Mutation	SNP	ENST00000436063.2	hg19	CCDS44174.1	.	.	.	.	.	.	.	.	.	.	A	7.865	0.726984	0.15439	.	.	ENSG00000067334	ENST00000436063	T	0.16743	2.32	4.97	-4.84	0.03151	.	1.525530	0.03836	N	0.269774	T	0.04998	0.0134	L	0.56769	1.78	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.45308	-0.9270	10	0.72032	D	0.01	.	0.8184	0.01107	0.315:0.2126:0.2868:0.1855	.	221	Q5QJE6	TDIF2_HUMAN	S	221	ENSP00000411010:I221S	ENSP00000352137:I221S	I	-	2	0	DNTTIP2	94115417	0.000000	0.05858	0.000000	0.03702	0.318000	0.28184	0.416000	0.21198	-0.444000	0.07170	0.533000	0.62120	ATT	.	.	.	none		0.393	DNTTIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028317.2	NM_014597	
SASS6	163786	hgsc.bcm.edu	37	1	100572514	100572514	+	Silent	SNP	A	A	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr1:100572514A>C	ENST00000287482.5	-	12	1502	c.1362T>G	c.(1360-1362)gtT>gtG	p.V454V	SASS6_ENST00000535161.1_Silent_p.V287V|SASS6_ENST00000462159.1_5'UTR	NM_194292.1	NP_919268.1	Q6UVJ0	SAS6_HUMAN	spindle assembly 6 homolog (C. elegans)	454					centriole replication (GO:0007099)|centrosome duplication (GO:0051298)	centriole (GO:0005814)|centrosome (GO:0005813)|deuterosome (GO:0098536)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	19		all_epithelial(167;4.58e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.085)|all cancers(265;0.139)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.197)		CAAGTTTTTTAACTGTAGCTT	0.249																																					p.V454V		Atlas-SNP	.											.	SASS6	61	.	0			c.T1362G						PASS	.						68.0	68.0	68.0					1																	100572514		2189	4293	6482	SO:0001819	synonymous_variant	163786	exon12			TTTTTTAACTGTA	AL834265	CCDS764.1	1p21.3	2008-02-05			ENSG00000156876	ENSG00000156876			25403	protein-coding gene	gene with protein product		609321				15665853, 14654843	Standard	NM_194292		Approved	DKFZp761A078, SAS-6, FLJ22097, SAS6	uc001dsu.3	Q6UVJ0	OTTHUMG00000010754	ENST00000287482.5:c.1362T>G	chr1.hg19:g.100572514A>C		37.0	0.0	.		38.0	11.0	.	NM_194292	D3DT55|Q8N3K0	Silent	SNP	ENST00000287482.5	hg19	CCDS764.1																																																																																			.	.	.	none		0.249	SASS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029656.2	NM_194292	
HORMAD1	84072	hgsc.bcm.edu	37	1	150679129	150679129	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr1:150679129T>A	ENST00000361824.2	-	10	809	c.704A>T	c.(703-705)aAt>aTt	p.N235I	HORMAD1_ENST00000368993.2_Missense_Mutation_p.N235I|HORMAD1_ENST00000368995.4_Missense_Mutation_p.N155I|HORMAD1_ENST00000322343.7_Missense_Mutation_p.N228I	NM_032132.4	NP_115508.2	Q86X24	HORM1_HUMAN	HORMA domain containing 1	235					blastocyst development (GO:0001824)|meiotic DNA double-strand break formation (GO:0042138)|meiotic nuclear division (GO:0007126)|meiotic recombination checkpoint (GO:0051598)|meiotic sister chromatid cohesion (GO:0051177)|oogenesis (GO:0048477)|regulation of homologous chromosome segregation (GO:0060629)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(3)	16	all_cancers(9;3.23e-52)|all_epithelial(9;4.68e-43)|all_lung(15;5.74e-35)|Lung NSC(24;2.09e-31)|Breast(34;0.0009)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;2.32e-23)|all cancers(9;5.21e-23)|OV - Ovarian serous cystadenocarcinoma(6;6.72e-15)|BRCA - Breast invasive adenocarcinoma(12;0.000479)|LUSC - Lung squamous cell carcinoma(543;0.171)			TGAGTCAATATTTTCCATTCG	0.343																																					p.N235I		Atlas-SNP	.											.,1	HORMAD1	59	.	0			c.A704T						PASS	.						202.0	191.0	195.0					1																	150679129		2203	4300	6503	SO:0001583	missense	84072	exon10			TCAATATTTTCCA	AL136755	CCDS967.1, CCDS55633.1	1q21.2	2009-03-09			ENSG00000143452	ENSG00000143452			25245	protein-coding gene	gene with protein product	"""cancer/testis antigen 46"""	609824				11230166, 15999985	Standard	NM_032132		Approved	DKFZP434A1315, CT46	uc001evk.2	Q86X24	OTTHUMG00000035005	ENST00000361824.2:c.704A>T	chr1.hg19:g.150679129T>A	ENSP00000355167:p.Asn235Ile	209.0	0.0	.		226.0	86.0	.	NM_032132	A6NMK2|B3KUK1|Q4G114|Q5T5I3|Q5T5I4|Q5T5I5|Q6FIC1|Q9H0K8	Missense_Mutation	SNP	ENST00000361824.2	hg19	CCDS967.1	.	.	.	.	.	.	.	.	.	.	T	18.41	3.617697	0.66787	.	.	ENSG00000143452	ENST00000368995;ENST00000368993;ENST00000368992;ENST00000540570;ENST00000322343;ENST00000361824;ENST00000368987;ENST00000442853	T;T;T;T	0.47177	0.85;1.42;1.43;1.42	5.48	4.34	0.51931	.	0.219611	0.53938	D	0.000043	T	0.38188	0.1031	L	0.32530	0.975	0.28943	N	0.890864	D;D;D	0.71674	0.998;0.988;0.964	D;P;P	0.65010	0.931;0.878;0.65	T	0.28004	-1.0057	10	0.72032	D	0.01	-12.6203	7.2033	0.25893	0.0:0.2218:0.0:0.7781	.	155;228;235	Q86X24-4;Q86X24-2;Q86X24	.;.;HORM1_HUMAN	I	155;235;164;155;228;235;164;157	ENSP00000357991:N155I;ENSP00000357989:N235I;ENSP00000326489:N228I;ENSP00000355167:N235I	ENSP00000326489:N228I	N	-	2	0	HORMAD1	148945753	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	1.692000	0.37731	2.092000	0.63282	0.383000	0.25322	AAT	.	.	.	none		0.343	HORMAD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084722.1	NM_032132	
CREG1	8804	hgsc.bcm.edu	37	1	167515357	167515357	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr1:167515357A>G	ENST00000370509.4	-	3	665	c.640T>C	c.(640-642)Tat>Cat	p.Y214H	CREG1_ENST00000466652.1_5'UTR	NM_003851.2	NP_003842.1	O75629	CREG1_HUMAN	cellular repressor of E1A-stimulated genes 1	214					cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	extracellular vesicular exosome (GO:0070062)|transcription factor complex (GO:0005667)	FMN binding (GO:0010181)|oxidoreductase activity (GO:0016491)|transcription corepressor activity (GO:0003714)										ACATTATAATATTCTTCTGGT	0.438																																					p.Y214H		Atlas-SNP	.											.	CREG1	6	.	0			c.T640C						PASS	.						70.0	73.0	72.0					1																	167515357		2203	4300	6503	SO:0001583	missense	8804	exon3			TATAATATTCTTC	AF084523	CCDS1262.1	1q24	2008-02-05	2004-09-22	2004-09-22	ENSG00000143162	ENSG00000143162			2351	protein-coding gene	gene with protein product			"""cellular repressor of E1A-stimulated genes"""	CREG		9710587	Standard	NM_003851		Approved		uc001gel.3	O75629	OTTHUMG00000034682	ENST00000370509.4:c.640T>C	chr1.hg19:g.167515357A>G	ENSP00000359540:p.Tyr214His	66.0	0.0	.		67.0	29.0	.	NM_003851	B2RDD4|Q8N9A3	Missense_Mutation	SNP	ENST00000370509.4	hg19	CCDS1262.1	.	.	.	.	.	.	.	.	.	.	A	19.78	3.891151	0.72524	.	.	ENSG00000143162	ENST00000370509	.	.	.	5.86	5.86	0.93980	FMN-binding split barrel-related (1);FMN-binding split barrel (1);	0.000000	0.85682	D	0.000000	D	0.83326	0.5230	M	0.91818	3.245	0.53005	D	0.999968	D	0.89917	1.0	D	0.97110	1.0	D	0.87426	0.2385	8	0.87932	D	0	-7.3711	16.2453	0.82441	1.0:0.0:0.0:0.0	.	214	O75629	CREG1_HUMAN	H	214	.	ENSP00000359540:Y214H	Y	-	1	0	CREG1	165781981	1.000000	0.71417	0.810000	0.32431	0.581000	0.36288	8.428000	0.90278	2.241000	0.73720	0.533000	0.62120	TAT	.	.	.	none		0.438	CREG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083911.1	NM_003851	
HMCN1	83872	hgsc.bcm.edu	37	1	185984290	185984290	+	Splice_Site	SNP	G	G	A	rs568290303	byFrequency	TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr1:185984290G>A	ENST00000271588.4	+	31	4859		c.e31-1		HMCN1_ENST00000367492.2_Splice_Site	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1						response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						ATCCTTTGTAGTTCCACCTAG	0.338																																					.		Atlas-SNP	.											HMCN1,NS,carcinoma,0,1	HMCN1	797	.	0			c.4631-1G>A						PASS	.						72.0	71.0	71.0					1																	185984290		2203	4299	6502	SO:0001630	splice_region_variant	83872	exon31			TTTGTAGTTCCAC	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.4631-1G>A	chr1.hg19:g.185984290G>A		129.0	1.0	.		93.0	37.0	.	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Splice_Site	SNP	ENST00000271588.4	hg19	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.501313	0.85176	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	.	.	.	5.22	5.22	0.72569	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1551	0.93507	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	HMCN1	184250913	1.000000	0.71417	0.999000	0.59377	0.957000	0.61999	8.911000	0.92721	2.583000	0.87209	0.557000	0.71058	.	.	.	.	none		0.338	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	Intron
ASAP2	8853	hgsc.bcm.edu	37	2	9533671	9533671	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr2:9533671T>C	ENST00000281419.3	+	24	2919	c.2579T>C	c.(2578-2580)tTg>tCg	p.L860S	ASAP2_ENST00000315273.4_Missense_Mutation_p.L815S|ASAP2_ENST00000491413.1_3'UTR	NM_003887.2	NP_003878.1	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 2	860	Pro-rich.				positive regulation of catalytic activity (GO:0043085)|regulation of ARF GTPase activity (GO:0032312)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|enzyme activator activity (GO:0008047)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	36						ATGGAAGCCTTGAGCCAGCCG	0.701																																					p.L860S		Atlas-SNP	.											.	ASAP2	91	.	0			c.T2579C						PASS	.						13.0	15.0	14.0					2																	9533671		2199	4294	6493	SO:0001583	missense	8853	exon24			AAGCCTTGAGCCA	AB007860	CCDS1661.1, CCDS46224.1	2p24	2013-01-10	2008-09-22	2008-09-22	ENSG00000151693	ENSG00000151693		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2721	protein-coding gene	gene with protein product	"""centaurin, beta 3"""	603817	"""development and differentiation enhancing factor 2"""	DDEF2		10022920, 9455477	Standard	NM_003887		Approved	KIAA0400, PAP, SHAG1, CENTB3	uc002qzh.2	O43150	OTTHUMG00000117485	ENST00000281419.3:c.2579T>C	chr2.hg19:g.9533671T>C	ENSP00000281419:p.Leu860Ser	27.0	0.0	.		19.0	6.0	.	NM_003887	D6W4Y8	Missense_Mutation	SNP	ENST00000281419.3	hg19	CCDS1661.1	.	.	.	.	.	.	.	.	.	.	T	10.11	1.260257	0.23051	.	.	ENSG00000151693	ENST00000281419;ENST00000315273	T;T	0.58506	0.42;0.33	5.36	5.36	0.76844	Src homology-3 domain (1);	4.673060	0.00166	N	0.000005	T	0.67702	0.2921	N	0.19112	0.55	0.35637	D	0.81066	D;B	0.69078	0.997;0.011	D;B	0.75484	0.986;0.01	T	0.56956	-0.7893	10	0.18710	T	0.47	.	15.3426	0.74309	0.0:0.0:0.0:1.0	.	815;860	O43150-2;O43150	.;ASAP2_HUMAN	S	860;815	ENSP00000281419:L860S;ENSP00000316404:L815S	ENSP00000281419:L860S	L	+	2	0	ASAP2	9451122	1.000000	0.71417	0.799000	0.32177	0.419000	0.31324	4.442000	0.59988	2.034000	0.60081	0.379000	0.24179	TTG	.	.	.	none		0.701	ASAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000237522.1	NM_003887	
NRBP1	29959	hgsc.bcm.edu	37	2	27664588	27664588	+	Missense_Mutation	SNP	G	G	A	rs141700147	byFrequency	TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr2:27664588G>A	ENST00000233557.3	+	19	2349	c.1517G>A	c.(1516-1518)cGg>cAg	p.R506Q	KRTCAP3_ENST00000407293.1_5'Flank|NRBP1_ENST00000379852.3_Missense_Mutation_p.R506Q|KRTCAP3_ENST00000543753.1_5'Flank|KRTCAP3_ENST00000288873.3_5'Flank|NRBP1_ENST00000379863.3_Missense_Mutation_p.R514Q			Q9UHY1	NRBP_HUMAN	nuclear receptor binding protein 1	506					ER to Golgi vesicle-mediated transport (GO:0006888)|gene expression (GO:0010467)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell projection (GO:0042995)|endomembrane system (GO:0012505)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)	p.R506Q(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19	Acute lymphoblastic leukemia(172;0.155)					GACCAGAGCCGGTTGACTTCT	0.547													G|||	6	0.00119808	0.0045	0.0	5008	,	,		18142	0.0		0.0	False		,,,				2504	0.0				p.R506Q		Atlas-SNP	.											NRBP1,colon,carcinoma,0,1	NRBP1	40	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1517A						PASS	.	G	GLN/ARG	4,4402	9.9+/-24.2	0,4,2199	179.0	183.0	182.0		1517	5.7	1.0	2	dbSNP_134	182	1,8599	1.2+/-3.3	0,1,4299	yes	missense	NRBP1	NM_013392.2	43	0,5,6498	AA,AG,GG		0.0116,0.0908,0.0384	possibly-damaging	506/536	27664588	5,13001	2203	4300	6503	SO:0001583	missense	29959	exon18			AGAGCCGGTTGAC	AF113249	CCDS1753.1	2p23	2008-02-05	2005-12-22	2005-12-22	ENSG00000115216	ENSG00000115216			7993	protein-coding gene	gene with protein product		606010	"""nuclear receptor binding protein"""	NRBP		10843813, 11956649	Standard	NM_013392		Approved	BCON3, MUDPNP, MADM	uc002rkp.3	Q9UHY1	OTTHUMG00000097789	ENST00000233557.3:c.1517G>A	chr2.hg19:g.27664588G>A	ENSP00000233557:p.Arg506Gln	314.0	1.0	.		334.0	127.0	.	NM_013392	B3KV40|D6W558|Q53FZ5|Q96SU3	Missense_Mutation	SNP	ENST00000233557.3	hg19	CCDS1753.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.944186	0.73672	9.08E-4	1.16E-4	ENSG00000115216	ENST00000233557;ENST00000421823;ENST00000379852;ENST00000379863	T;T;T	0.14022	2.84;2.84;2.54	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.14399	0.0348	L	0.43152	1.355	0.58432	D	0.999999	B;B;B	0.32302	0.363;0.239;0.154	B;B;B	0.24701	0.022;0.055;0.025	T	0.02093	-1.1215	10	0.45353	T	0.12	-8.6676	18.2912	0.90131	0.0:0.0:1.0:0.0	.	486;514;506	B4DW31;F8W6G1;Q9UHY1	.;.;NRBP_HUMAN	Q	506;486;506;514	ENSP00000233557:R506Q;ENSP00000369181:R506Q;ENSP00000369192:R514Q	ENSP00000233557:R506Q	R	+	2	0	NRBP1	27518092	1.000000	0.71417	0.999000	0.59377	0.972000	0.66771	6.787000	0.75099	2.662000	0.90505	0.561000	0.74099	CGG	.	G|1.000;A|0.000	0.000	weak		0.547	NRBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215033.1	NM_013392	
SLC8A1	6546	hgsc.bcm.edu	37	2	40656328	40656328	+	Missense_Mutation	SNP	G	G	T	rs370199920		TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr2:40656328G>T	ENST00000403092.1	-	2	1126	c.1093C>A	c.(1093-1095)Cgc>Agc	p.R365S	SLC8A1_ENST00000402441.1_Missense_Mutation_p.R365S|SLC8A1_ENST00000405901.3_Missense_Mutation_p.R365S|SLC8A1_ENST00000332839.4_Missense_Mutation_p.R365S|SLC8A1_ENST00000406391.2_Missense_Mutation_p.R365S|SLC8A1_ENST00000406785.2_Missense_Mutation_p.R365S|SLC8A1_ENST00000408028.2_Missense_Mutation_p.R365S|SLC8A1_ENST00000405269.1_Missense_Mutation_p.R365S|SLC8A1_ENST00000542024.1_Missense_Mutation_p.R365S|SLC8A1_ENST00000542756.1_Missense_Mutation_p.R365S			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	365					blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	GCTTGAATGCGATAAAATGCT	0.433																																					p.R365S		Atlas-SNP	.											SLC8A1,colon,carcinoma,+1,1	SLC8A1	221	.	0			c.C1093A						PASS	.						165.0	157.0	160.0					2																	40656328		2203	4300	6503	SO:0001583	missense	6546	exon1			GAATGCGATAAAA		CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.1093C>A	chr2.hg19:g.40656328G>T	ENSP00000384763:p.Arg365Ser	236.0	0.0	.		267.0	14.0	.	NM_001252624	A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	ENST00000403092.1	hg19	CCDS1806.1	.	.	.	.	.	.	.	.	.	.	G	17.93	3.509948	0.64522	.	.	ENSG00000183023	ENST00000406785;ENST00000378715;ENST00000542756;ENST00000403092;ENST00000405901;ENST00000402441;ENST00000405269;ENST00000332839;ENST00000408028;ENST00000535962;ENST00000406391;ENST00000542024	T;T;T;T;T;T;T;T;T;T	0.53857	0.65;0.68;0.67;0.68;0.65;0.65;0.67;0.6;0.65;0.64	6.17	5.29	0.74685	Heat shock protein DnaJ, N-terminal (1);	0.049164	0.85682	D	0.000000	T	0.78233	0.4251	M	0.91663	3.23	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.996;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.995;1.0;0.996;1.0	D	0.83814	0.0243	10	0.87932	D	0	.	14.9877	0.71362	0.0:0.0:0.857:0.143	.	365;365;365;365;365	P32418-4;P32418-2;P32418-3;F6VPY9;P32418	.;.;.;.;NAC1_HUMAN	S	365	ENSP00000383886:R365S;ENSP00000440727:R365S;ENSP00000384763:R365S;ENSP00000385678:R365S;ENSP00000385188:R365S;ENSP00000385535:R365S;ENSP00000332931:R365S;ENSP00000384908:R365S;ENSP00000385811:R365S;ENSP00000443515:R365S	ENSP00000332931:R365S	R	-	1	0	SLC8A1	40509832	1.000000	0.71417	0.992000	0.48379	0.990000	0.78478	7.812000	0.86109	1.600000	0.50102	0.655000	0.94253	CGC	.	.	.	alt		0.433	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	NM_021097	
MSH6	2956	hgsc.bcm.edu	37	2	48027125	48027125	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr2:48027125C>G	ENST00000234420.5	+	4	2155	c.2003C>G	c.(2002-2004)tCc>tGc	p.S668C	FBXO11_ENST00000405808.1_Intron|MSH6_ENST00000540021.1_Missense_Mutation_p.S538C|MSH6_ENST00000538136.1_Missense_Mutation_p.S366C	NM_000179.2	NP_000170.1	P52701	MSH6_HUMAN	mutS homolog 6	668					ATP catabolic process (GO:0006200)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|response to UV (GO:0009411)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|MutSalpha complex (GO:0032301)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|guanine/thymine mispair binding (GO:0032137)|methylated histone binding (GO:0035064)|mismatched DNA binding (GO:0030983)	p.0?(2)		breast(8)|central_nervous_system(29)|cervix(1)|endometrium(32)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(75)|lung(25)|ovary(3)|prostate(3)|skin(10)|stomach(22)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	229		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			GAGTCTGATTCCATTGGGTTG	0.433			"""Mis, N, F, S"""		colorectal	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.S668C		Atlas-SNP	.	yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p16	2956	mutS homolog 6 (E. coli)		E	.	MSH6	341	.	2	Whole gene deletion(2)	haematopoietic_and_lymphoid_tissue(2)	c.C2003G						PASS	.						152.0	146.0	148.0					2																	48027125		2203	4300	6503	SO:0001583	missense	2956	exon4	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	CTGATTCCATTGG	U54777	CCDS1836.1, CCDS62906.1, CCDS62907.1	2p16	2014-09-17	2013-09-12		ENSG00000116062	ENSG00000116062			7329	protein-coding gene	gene with protein product		600678	"""mutS (E. coli) homolog 6"", ""mutS homolog 6 (E. coli)"""	GTBP		7604266	Standard	NM_000179		Approved		uc002rwd.4	P52701	OTTHUMG00000129129	ENST00000234420.5:c.2003C>G	chr2.hg19:g.48027125C>G	ENSP00000234420:p.Ser668Cys	274.0	0.0	.		282.0	107.0	.	NM_000179	B4DF41|B4E3I4|F5H2F9|O43706|O43917|Q8TCX4|Q9BTB5	Missense_Mutation	SNP	ENST00000234420.5	hg19	CCDS1836.1	.	.	.	.	.	.	.	.	.	.	C	15.11	2.735857	0.49045	.	.	ENSG00000116062	ENST00000234420;ENST00000544857;ENST00000540021;ENST00000538136	D;D;D	0.88664	-2.04;-2.12;-2.41	4.8	3.92	0.45320	DNA mismatch repair protein MutS, connector (1);	0.361706	0.32518	N	0.005990	D	0.93112	0.7807	M	0.76574	2.34	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.976	D;D;P	0.67231	0.95;0.95;0.738	D	0.93502	0.6845	10	0.72032	D	0.01	-2.7325	12.8528	0.57867	0.0:0.9212:0.0:0.0788	.	538;668;668	B4DF41;P52701;P52701-2	.;MSH6_HUMAN;.	C	668;666;538;366	ENSP00000234420:S668C;ENSP00000446475:S538C;ENSP00000438580:S366C	ENSP00000234420:S668C	S	+	2	0	MSH6	47880629	1.000000	0.71417	0.996000	0.52242	0.942000	0.58702	5.875000	0.69660	1.243000	0.43853	0.460000	0.39030	TCC	.	.	.	none		0.433	MSH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251180.4	NM_000179	
TCF7L1	83439	hgsc.bcm.edu	37	2	85536242	85536242	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr2:85536242T>C	ENST00000282111.3	+	12	1699	c.1424T>C	c.(1423-1425)aTg>aCg	p.M475T		NM_031283.2	NP_112573.1	Q9HCS4	TF7L1_HUMAN	transcription factor 7-like 1 (T-cell specific, HMG-box)	475					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|skin(4)|upper_aerodigestive_tract(1)	18						CACGGGAGCATGCTGGACTCC	0.652																																					p.M475T		Atlas-SNP	.											.	TCF7L1	44	.	0			c.T1424C						PASS	.						93.0	102.0	99.0					2																	85536242		2203	4300	6503	SO:0001583	missense	83439	exon12			GGAGCATGCTGGA	X62870	CCDS1971.1	2p11.2	2008-02-05			ENSG00000152284	ENSG00000152284			11640	protein-coding gene	gene with protein product		604652		TCF3		1741298, 11085512	Standard	NM_031283		Approved		uc002soy.3	Q9HCS4	OTTHUMG00000130026	ENST00000282111.3:c.1424T>C	chr2.hg19:g.85536242T>C	ENSP00000282111:p.Met475Thr	307.0	1.0	.		264.0	89.0	.	NM_031283	Q53R97|Q6PD70|Q9NP00	Missense_Mutation	SNP	ENST00000282111.3	hg19	CCDS1971.1	.	.	.	.	.	.	.	.	.	.	T	16.35	3.097296	0.56075	.	.	ENSG00000152284	ENST00000282111	T	0.34072	1.38	5.11	0.36	0.16097	.	0.117117	0.85682	N	0.000000	T	0.37972	0.1023	L	0.54323	1.7	0.29754	N	0.836071	P	0.50156	0.932	P	0.58391	0.838	T	0.35301	-0.9794	10	0.13108	T	0.6	.	3.6615	0.08240	0.1572:0.2705:0.0:0.5722	.	475	Q9HCS4	TF7L1_HUMAN	T	475	ENSP00000282111:M475T	ENSP00000282111:M475T	M	+	2	0	TCF7L1	85389753	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	2.286000	0.43496	-0.075000	0.12798	0.448000	0.29417	ATG	.	.	.	none		0.652	TCF7L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252301.2	NM_031283	
EIF5B	9669	hgsc.bcm.edu	37	2	100015354	100015354	+	Silent	SNP	A	A	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr2:100015354A>C	ENST00000289371.6	+	23	3739	c.3537A>C	c.(3535-3537)acA>acC	p.T1179T		NM_015904.3	NP_056988.3	O60841	IF2P_HUMAN	eukaryotic translation initiation factor 5B	1179					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of translational initiation (GO:0006446)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						TTGAAGCTACAGATATTCTTG	0.398																																					p.T1179T	Colon(162;2388 2567 2705 3444)	Atlas-SNP	.											.	EIF5B	95	.	0			c.A3537C						PASS	.						70.0	64.0	66.0					2																	100015354		1859	4090	5949	SO:0001819	synonymous_variant	9669	exon23			AGCTACAGATATT	AF078035	CCDS42721.1	2q11.2	2012-09-20			ENSG00000158417	ENSG00000158417			30793	protein-coding gene	gene with protein product	"""translation initiation factor IF2"""	606086				10200264, 10432305	Standard	XM_005264075		Approved	IF2, KIAA0741, DKFZp434I036, FLJ10524	uc002tab.3	O60841	OTTHUMG00000153242	ENST00000289371.6:c.3537A>C	chr2.hg19:g.100015354A>C		81.0	0.0	.		86.0	33.0	.	NM_015904	O95805|Q53RV7|Q53SI8|Q9UF81|Q9UMN7	Silent	SNP	ENST00000289371.6	hg19	CCDS42721.1																																																																																			.	.	.	none		0.398	EIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330364.2	NM_015904	
CXCR4	7852	hgsc.bcm.edu	37	2	136873381	136873381	+	Silent	SNP	G	G	T			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr2:136873381G>T	ENST00000241393.3	-	2	221	c.117C>A	c.(115-117)atC>atA	p.I39I	CXCR4_ENST00000466288.1_5'UTR|CXCR4_ENST00000409817.1_Silent_p.I43I	NM_003467.2	NP_003458.1	P61073	CXCR4_HUMAN	chemokine (C-X-C motif) receptor 4	39					activation of MAPK activity (GO:0000187)|ameboidal cell migration (GO:0001667)|apoptotic process (GO:0006915)|brain development (GO:0007420)|calcium-mediated signaling (GO:0019722)|cellular response to cytokine stimulus (GO:0071345)|chemokine-mediated signaling pathway (GO:0070098)|dendritic cell chemotaxis (GO:0002407)|entry into host cell (GO:0030260)|G-protein coupled receptor signaling pathway (GO:0007186)|germ cell development (GO:0007281)|germ cell migration (GO:0008354)|inflammatory response (GO:0006954)|motor neuron axon guidance (GO:0008045)|myelin maintenance (GO:0043217)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|neutrophil activation (GO:0042119)|patterning of blood vessels (GO:0001569)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of cell migration (GO:0030334)|regulation of chemotaxis (GO:0050920)|response to hypoxia (GO:0001666)|response to virus (GO:0009615)|T cell proliferation (GO:0042098)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|G-protein coupled receptor activity (GO:0004930)|myosin light chain binding (GO:0032027)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|virus receptor activity (GO:0001618)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.155)	Framycetin(DB00452)|Plerixafor(DB06809)	TGGGCAGGAAGATTTTATTGA	0.438																																					p.I43I		Atlas-SNP	.											CXCR4,NS,carcinoma,0,1	CXCR4	51	.	0			c.C129A						PASS	.						128.0	129.0	128.0					2																	136873381		2203	4300	6503	SO:0001819	synonymous_variant	7852	exon1			CAGGAAGATTTTA	AF005058	CCDS33295.1, CCDS46420.1	2q21	2014-09-17	2002-08-22		ENSG00000121966	ENSG00000121966		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	2561	protein-coding gene	gene with protein product		162643	"""chemokine (C-X-C motif), receptor 4 (fusin)"""			9599023, 9379028	Standard	NM_001008540		Approved	LESTR, NPY3R, HM89, NPYY3R, D2S201E, fusin, HSY3RR, NPYR, CD184	uc002tuz.3	P61073	OTTHUMG00000153583	ENST00000241393.3:c.117C>A	chr2.hg19:g.136873381G>T		145.0	1.0	.		163.0	61.0	.	NM_001008540	B2R5N0|O60835|P30991|P56438|Q53S69|Q9BXA0|Q9UKN2	Silent	SNP	ENST00000241393.3	hg19	CCDS46420.1																																																																																			.	.	.	none		0.438	CXCR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331732.1		
DNAH7	56171	hgsc.bcm.edu	37	2	196749321	196749321	+	Silent	SNP	T	T	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr2:196749321T>C	ENST00000312428.6	-	35	5851	c.5751A>G	c.(5749-5751)caA>caG	p.Q1917Q		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1917					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						CAGTGACAAATTGATAATCAT	0.433																																					p.Q1917Q		Atlas-SNP	.											.	DNAH7	512	.	0			c.A5751G						PASS	.						77.0	75.0	76.0					2																	196749321		1911	4123	6034	SO:0001819	synonymous_variant	56171	exon35			GACAAATTGATAA	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.5751A>G	chr2.hg19:g.196749321T>C		83.0	0.0	.		106.0	33.0	.	NM_018897	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Silent	SNP	ENST00000312428.6	hg19	CCDS42794.1																																																																																			.	.	.	none		0.433	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	
ERBB4	2066	hgsc.bcm.edu	37	2	212426810	212426810	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr2:212426810C>A	ENST00000342788.4	-	20	2615	c.2305G>T	c.(2305-2307)Gct>Tct	p.A769S	ERBB4_ENST00000436443.1_Missense_Mutation_p.A769S|ERBB4_ENST00000402597.1_Missense_Mutation_p.A759S	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	769	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	ATGATCAGAGCTTCCTGTAAG	0.403										TSP Lung(8;0.080)																											p.A769S		Atlas-SNP	.											.	ERBB4	480	.	0			c.G2305T						PASS	.						81.0	75.0	77.0					2																	212426810		2203	4300	6503	SO:0001583	missense	2066	exon20			TCAGAGCTTCCTG	L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.2305G>T	chr2.hg19:g.212426810C>A	ENSP00000342235:p.Ala769Ser	80.0	0.0	.		107.0	42.0	.	NM_001042599	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	ENST00000342788.4	hg19	CCDS2394.1	.	.	.	.	.	.	.	.	.	.	C	32	5.153661	0.94645	.	.	ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597	T;T;T	0.64085	-0.08;-0.08;-0.08	5.36	5.36	0.76844	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.81847	0.4909	M	0.82517	2.595	0.80722	D	1	D;P;D;D	0.76494	0.999;0.738;0.999;0.999	D;D;D;D	0.91635	0.999;0.911;0.998;0.999	D	0.83933	0.0307	10	0.72032	D	0.01	.	19.4633	0.94927	0.0:1.0:0.0:0.0	.	759;759;769;769	Q15303-4;Q15303-2;Q15303-3;Q15303	.;.;.;ERBB4_HUMAN	S	769;769;759	ENSP00000342235:A769S;ENSP00000403204:A769S;ENSP00000385565:A759S	ENSP00000342235:A769S	A	-	1	0	ERBB4	212135055	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.776000	0.85560	2.666000	0.90696	0.655000	0.94253	GCT	.	.	.	none		0.403	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599	
FBXO45	200933	hgsc.bcm.edu	37	3	196304554	196304554	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr3:196304554A>T	ENST00000311630.6	+	2	846	c.549A>T	c.(547-549)caA>caT	p.Q183H	FBXO45_ENST00000440469.1_Missense_Mutation_p.Q4H	NM_001105573.1	NP_001099043.1	P0C2W1	FBSP1_HUMAN	F-box protein 45	183	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				anterior commissure morphogenesis (GO:0021960)|cellular response to DNA damage stimulus (GO:0006974)|cerebral cortex radially oriented cell migration (GO:0021799)|cerebral cortex tangential migration (GO:0021800)|corticospinal tract morphogenesis (GO:0021957)|neuron migration (GO:0001764)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|synapse assembly involved in innervation (GO:0060386)	cell junction (GO:0030054)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)				cervix(1)|kidney(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	7	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;2.75e-23)|all cancers(36;2.47e-21)|OV - Ovarian serous cystadenocarcinoma(49;2.32e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00314)		TGCAGTGCCAAGGTTATGTGG	0.547																																					p.Q183H		Atlas-SNP	.											.	FBXO45	18	.	0			c.A549T						PASS	.						48.0	49.0	49.0					3																	196304554		1953	4148	6101	SO:0001583	missense	200933	exon2			GTGCCAAGGTTAT	AK025697	CCDS46985.1	3q29	2008-02-05			ENSG00000174013	ENSG00000174013		"""F-boxes /  ""other"""""	29148	protein-coding gene	gene with protein product		609112					Standard	NM_001105573		Approved	Fbx45	uc010iai.3	P0C2W1	OTTHUMG00000155571	ENST00000311630.6:c.549A>T	chr3.hg19:g.196304554A>T	ENSP00000310332:p.Gln183His	31.0	0.0	.		27.0	23.0	.	NM_001105573	A6NF90|D3DXB5	Missense_Mutation	SNP	ENST00000311630.6	hg19	CCDS46985.1	.	.	.	.	.	.	.	.	.	.	A	9.264	1.043862	0.19748	.	.	ENSG00000174013	ENST00000440469;ENST00000311630	T;T	0.60171	0.21;0.21	4.95	2.42	0.29668	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.052694	0.85682	N	0.000000	T	0.25754	0.0627	N	0.01789	-0.72	0.54753	D	0.999983	B	0.11235	0.004	B	0.12156	0.007	T	0.02450	-1.1157	10	0.25106	T	0.35	-22.4406	6.7957	0.23725	0.6401:0.0:0.3599:0.0	.	183	P0C2W1	FBSP1_HUMAN	H	4;183	ENSP00000389868:Q4H;ENSP00000310332:Q183H	ENSP00000310332:Q183H	Q	+	3	2	FBXO45	197788951	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.363000	0.52321	0.403000	0.25479	0.374000	0.22700	CAA	.	.	.	none		0.547	FBXO45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340687.2		
MYO10	4651	hgsc.bcm.edu	37	5	16764479	16764479	+	Silent	SNP	G	G	T			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr5:16764479G>T	ENST00000513610.1	-	12	1660	c.1206C>A	c.(1204-1206)gcC>gcA	p.A402A		NM_012334.2	NP_036466.2	Q9HD67	MYO10_HUMAN	myosin X	402	Myosin motor.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|plus-end directed microfilament motor activity (GO:0060002)|spectrin binding (GO:0030507)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	86						ACAGAGCCATGGCCAGGGAGT	0.547																																					p.A402A		Atlas-SNP	.											.	MYO10	198	.	0			c.C1206A						PASS	.						107.0	103.0	105.0					5																	16764479		2098	4241	6339	SO:0001819	synonymous_variant	4651	exon12			AGCCATGGCCAGG	AF247457	CCDS54834.1	5p15.1-p14.3	2013-01-10				ENSG00000145555		"""Myosins / Myosin superfamily : Class X"", ""Pleckstrin homology (PH) domain containing"""	7593	protein-coding gene	gene with protein product		601481				8884266	Standard	NM_012334		Approved	KIAA0799	uc003jft.4	Q9HD67		ENST00000513610.1:c.1206C>A	chr5.hg19:g.16764479G>T		111.0	0.0	.		103.0	44.0	.	NM_012334	A7E2D1|O94893|Q8IVX5|Q9NYM7|Q9P110|Q9P111|Q9UHF6	Silent	SNP	ENST00000513610.1	hg19	CCDS54834.1																																																																																			.	.	.	none		0.547	MYO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366167.1	NM_012334	
PARP8	79668	hgsc.bcm.edu	37	5	50137860	50137860	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr5:50137860A>T	ENST00000281631.5	+	26	2681	c.2523A>T	c.(2521-2523)aaA>aaT	p.K841N	PARP8_ENST00000505554.1_Missense_Mutation_p.K820N|PARP8_ENST00000511363.2_3'UTR|PARP8_ENST00000505697.2_Missense_Mutation_p.K841N|PARP8_ENST00000514067.2_Missense_Mutation_p.K799N|PARP8_ENST00000503750.2_Missense_Mutation_p.K799N	NM_001178056.1|NM_024615.3	NP_001171527.1|NP_078891.2	Q8N3A8	PARP8_HUMAN	poly (ADP-ribose) polymerase family, member 8	841	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.					intracellular (GO:0005622)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Lung NSC(810;0.0305)|Breast(144;0.222)				GCATTCACAAAGAGATCCTCC	0.358																																					p.K841N		Atlas-SNP	.											.	PARP8	93	.	0			c.A2523T						PASS	.						86.0	82.0	83.0					5																	50137860		2203	4300	6503	SO:0001583	missense	79668	exon27			TCACAAAGAGATC	AL834477	CCDS3954.1, CCDS54849.1	5q11.2	2010-02-16			ENSG00000151883	ENSG00000151883		"""Poly (ADP-ribose) polymerases"""	26124	protein-coding gene	gene with protein product						15273990	Standard	NM_001178055		Approved	FLJ21308, pART16	uc003joo.3	Q8N3A8	OTTHUMG00000096969	ENST00000281631.5:c.2523A>T	chr5.hg19:g.50137860A>T	ENSP00000281631:p.Lys841Asn	112.0	0.0	.		101.0	43.0	.	NM_001178055	Q3KRB7|Q6DHZ1|Q9H754	Missense_Mutation	SNP	ENST00000281631.5	hg19	CCDS3954.1	.	.	.	.	.	.	.	.	.	.	A	15.51	2.855481	0.51376	.	.	ENSG00000151883	ENST00000505697;ENST00000503750;ENST00000281631;ENST00000514067;ENST00000505554	.	.	.	6.08	3.7	0.42460	Poly(ADP-ribose) polymerase, catalytic domain (1);	0.058378	0.64402	D	0.000002	T	0.41465	0.1160	L	0.44542	1.39	0.80722	D	1	P;B;B	0.37781	0.608;0.447;0.319	B;B;B	0.35114	0.193;0.196;0.096	T	0.12941	-1.0528	8	.	.	.	-15.5759	10.485	0.44717	0.8695:0.0:0.1305:0.0	.	733;799;841	B4DQ81;Q8N3A8-2;Q8N3A8	.;.;PARP8_HUMAN	N	841;799;841;799;820	.	.	K	+	3	2	PARP8	50173617	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.471000	0.45127	0.545000	0.28902	-0.256000	0.11100	AAA	.	.	.	none		0.358	PARP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214035.3	NM_024615	
GPR98	84059	hgsc.bcm.edu	37	5	89989974	89989974	+	Silent	SNP	A	A	T			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr5:89989974A>T	ENST00000405460.2	+	33	7497	c.7401A>T	c.(7399-7401)acA>acT	p.T2467T		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	2467	Calx-beta 17. {ECO:0000305|PubMed:11606593}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TCTGGATGACATCATGGATCA	0.488																																					p.T2467T		Atlas-SNP	.											.	GPR98	605	.	0			c.A7401T						PASS	.						67.0	66.0	66.0					5																	89989974		1926	4127	6053	SO:0001819	synonymous_variant	84059	exon33			GATGACATCATGG	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.7401A>T	chr5.hg19:g.89989974A>T		52.0	0.0	.		51.0	23.0	.	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Silent	SNP	ENST00000405460.2	hg19	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	A	9.244	1.039019	0.19669	.	.	ENSG00000164199	ENST00000509621	.	.	.	5.92	-3.15	0.05233	.	.	.	.	.	T	0.36908	0.0984	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35968	-0.9767	4	.	.	.	.	1.1269	0.01736	0.4642:0.1847:0.1714:0.1797	.	.	.	.	L	33	.	.	H	+	2	0	GPR98	90025730	0.645000	0.27286	0.979000	0.43373	0.943000	0.58893	-0.090000	0.11163	-0.108000	0.12066	0.533000	0.62120	CAT	.	.	.	none		0.488	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
CRIP3	401262	hgsc.bcm.edu	37	6	43275360	43275360	+	Silent	SNP	T	T	C	rs568254475		TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr6:43275360T>C	ENST00000274990.4	-	4	322	c.318A>G	c.(316-318)caA>caG	p.Q106Q	CRIP3_ENST00000372569.3_Silent_p.Q106Q|ZNF318_ENST00000607252.1_5'UTR			Q6Q6R5	CRIP3_HUMAN	cysteine-rich protein 3	106					T cell proliferation (GO:0042098)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)			TTTTCTTGCCTTGGGGGAGGC	0.642													T|||	1	0.000199681	0.0	0.0	5008	,	,		16423	0.0		0.0	False		,,,				2504	0.001				p.Q106Q		Atlas-SNP	.											.	CRIP3	30	.	0			c.A318G						PASS	.						44.0	50.0	48.0					6																	43275360		2203	4300	6503	SO:0001819	synonymous_variant	401262	exon4			CTTGCCTTGGGGG	AY555741	CCDS4894.2	6p21	2008-02-05			ENSG00000146215	ENSG00000146215			17751	protein-coding gene	gene with protein product						15380775	Standard	NM_206922		Approved	TLP-A, bA480N24.2, TLP	uc003ouu.1	Q6Q6R5	OTTHUMG00000014727	ENST00000274990.4:c.318A>G	chr6.hg19:g.43275360T>C		99.0	0.0	.		121.0	46.0	.	NM_206922	A2A436|Q5T043|Q6Q6R4|Q6Q6R6|Q6Q6R7	Silent	SNP	ENST00000274990.4	hg19		.	.	.	.	.	.	.	.	.	.	T	3.522	-0.097611	0.07010	.	.	ENSG00000146215	ENST00000416431	.	.	.	5.28	-4.75	0.03239	.	.	.	.	.	T	0.06735	0.0172	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.34054	-0.9844	4	.	.	.	0.0414	3.3614	0.07188	0.1112:0.4248:0.1114:0.3527	.	.	.	.	G	54	.	.	R	-	1	2	CRIP3	43383338	0.138000	0.22547	0.008000	0.14137	0.650000	0.38633	-0.340000	0.07821	-0.788000	0.04504	0.533000	0.62120	AGG	.	.	.	none		0.642	CRIP3-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000313968.1		
OGFRL1	79627	hgsc.bcm.edu	37	6	72011098	72011098	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr6:72011098C>A	ENST00000370435.4	+	7	836	c.702C>A	c.(700-702)caC>caA	p.H234Q	RP11-154D6.1_ENST00000586232.1_RNA|RP11-154D6.1_ENST00000587397.1_RNA|RP11-154D6.1_ENST00000586030.1_RNA|RP11-154D6.1_ENST00000423255.1_RNA|RP11-154D6.1_ENST00000591156.1_RNA|RP11-154D6.1_ENST00000412751.1_RNA|RP11-154D6.1_ENST00000587253.1_RNA|RP11-154D6.1_ENST00000588612.1_RNA|RP11-154D6.1_ENST00000432050.1_RNA|RP11-154D6.1_ENST00000585882.1_RNA|RP11-154D6.1_ENST00000587036.1_RNA|RP11-154D6.1_ENST00000450998.1_RNA|RP3-331H24.5_ENST00000602823.1_lincRNA	NM_024576.3	NP_078852.3	Q5TC84	OGRL1_HUMAN	opioid growth factor receptor-like 1	234						membrane (GO:0016020)	receptor activity (GO:0004872)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|upper_aerodigestive_tract(1)	13						GGTCCCAGCACAACTATTTAA	0.358																																					p.H234Q		Atlas-SNP	.											.	OGFRL1	44	.	0			c.C702A						PASS	.						224.0	259.0	247.0					6																	72011098		2203	4299	6502	SO:0001583	missense	79627	exon7			CCAGCACAACTAT		CCDS34482.1	6q13	2008-02-05			ENSG00000119900	ENSG00000119900			21378	protein-coding gene	gene with protein product							Standard	NM_024576		Approved	dJ331H24.1	uc003pfx.1	Q5TC84	OTTHUMG00000015000	ENST00000370435.4:c.702C>A	chr6.hg19:g.72011098C>A	ENSP00000359464:p.His234Gln	782.0	1.0	.		745.0	267.0	.	NM_024576	Q2TAC1|Q8NEQ4|Q9H7B5	Missense_Mutation	SNP	ENST00000370435.4	hg19	CCDS34482.1	.	.	.	.	.	.	.	.	.	.	C	18.16	3.561728	0.65538	.	.	ENSG00000119900	ENST00000370435	T	0.67345	-0.26	5.94	4.16	0.48862	Opioid growth factor receptor (OGFr) conserved domain (1);	0.094242	0.85682	D	0.000000	T	0.74535	0.3729	M	0.83012	2.62	0.46749	D	0.999187	D	0.76494	0.999	D	0.68039	0.955	T	0.78663	-0.2116	10	0.87932	D	0	-12.2653	10.4706	0.44635	0.0:0.741:0.0:0.259	.	234	Q5TC84	OGRL1_HUMAN	Q	234	ENSP00000359464:H234Q	ENSP00000359464:H234Q	H	+	3	2	OGFRL1	72067819	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.730000	0.47335	0.846000	0.35142	0.563000	0.77884	CAC	.	.	.	none		0.358	OGFRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041153.2	NM_024576	
SYNE1	23345	hgsc.bcm.edu	37	6	152658075	152658075	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr6:152658075C>G	ENST00000367255.5	-	76	13030	c.12429G>C	c.(12427-12429)tgG>tgC	p.W4143C	SYNE1_ENST00000341594.5_Missense_Mutation_p.W4008C|SYNE1_ENST00000265368.4_Missense_Mutation_p.W4143C|SYNE1_ENST00000423061.1_Missense_Mutation_p.W4072C|SYNE1_ENST00000448038.1_Missense_Mutation_p.W4072C	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4143					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GCAGGTAAATCCAGAGCTCAG	0.458										HNSCC(10;0.0054)																											p.W4143C		Atlas-SNP	.											.	SYNE1	3227	.	0			c.G12429C						PASS	.						109.0	99.0	102.0					6																	152658075		2203	4300	6503	SO:0001583	missense	23345	exon76			GTAAATCCAGAGC	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.12429G>C	chr6.hg19:g.152658075C>G	ENSP00000356224:p.Trp4143Cys	106.0	0.0	.		73.0	22.0	.	NM_182961	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	hg19	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	C	13.68	2.309305	0.40895	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.52754	0.74;0.7;0.65;0.7;0.73	5.47	5.47	0.80525	.	0.000000	0.56097	D	0.000036	T	0.50154	0.1599	L	0.57536	1.79	0.80722	D	1	D;D;D;D	0.71674	0.996;0.996;0.996;0.998	P;P;P;P	0.59703	0.608;0.608;0.608;0.862	T	0.49513	-0.8932	10	0.44086	T	0.13	.	12.6398	0.56702	0.0:0.9245:0.0:0.0755	.	4143;4143;4143;4072	B7ZBC3;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	C	4143;4072;4143;4072;4008	ENSP00000356224:W4143C;ENSP00000396024:W4072C;ENSP00000265368:W4143C;ENSP00000390975:W4072C;ENSP00000341887:W4008C	ENSP00000265368:W4143C	W	-	3	0	SYNE1	152699768	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	1.774000	0.38573	2.572000	0.86782	0.655000	0.94253	TGG	.	.	.	none		0.458	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
RNF216	54476	hgsc.bcm.edu	37	7	5781025	5781025	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr7:5781025A>G	ENST00000425013.2	-	4	676	c.452T>C	c.(451-453)cTg>cCg	p.L151P	RNF216_ENST00000389902.3_Missense_Mutation_p.L208P	NM_207111.3|NM_207116.2	NP_996994.1|NP_996999.1	Q9NWF9	RN216_HUMAN	ring finger protein 216	151					apoptotic process (GO:0006915)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|regulation of defense response to virus by host (GO:0050691)|regulation of interferon-beta production (GO:0032648)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)		FBXL18/RNF216(2)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)|skin(1)|urinary_tract(4)	33		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)		ATTTGATAACAGCTCTGTCTC	0.458																																					p.L208P		Atlas-SNP	.											.	RNF216	71	.	0			c.T623C						PASS	.						172.0	174.0	174.0					7																	5781025		2203	4300	6503	SO:0001583	missense	54476	exon4			GATAACAGCTCTG	AY062174	CCDS34594.1, CCDS34595.1	7p22.1	2014-02-12	2007-08-20		ENSG00000011275	ENSG00000011275		"""RING-type (C3HC4) zinc fingers"""	21698	protein-coding gene	gene with protein product		609948					Standard	NM_207111		Approved	TRIAD3, UBCE7IP1, ZIN	uc003sox.2	Q9NWF9	OTTHUMG00000155500	ENST00000425013.2:c.452T>C	chr7.hg19:g.5781025A>G	ENSP00000404602:p.Leu151Pro	328.0	1.0	.		350.0	117.0	.	NM_207111	Q6Y691|Q75ML7|Q7Z2H7|Q7Z7C1|Q8NHW7|Q9NYT1	Missense_Mutation	SNP	ENST00000425013.2	hg19	CCDS34595.1	.	.	.	.	.	.	.	.	.	.	A	17.96	3.515649	0.64634	.	.	ENSG00000011275	ENST00000425013;ENST00000389902	T;T	0.64803	-0.12;0.2	5.97	5.97	0.96955	.	0.000000	0.64402	D	0.000002	T	0.73737	0.3625	L	0.54323	1.7	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.67548	0.952;0.916	T	0.75593	-0.3264	10	0.62326	D	0.03	-11.2668	13.8294	0.63370	1.0:0.0:0.0:0.0	.	151;208	Q9NWF9;Q9NWF9-1	RN216_HUMAN;.	P	151;208	ENSP00000404602:L151P;ENSP00000374552:L208P	ENSP00000374550:L151P	L	-	2	0	RNF216	5747551	1.000000	0.71417	0.836000	0.33094	0.819000	0.46315	3.643000	0.54374	2.289000	0.77006	0.459000	0.35465	CTG	.	.	.	none		0.458	RNF216-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000340374.1	NM_207111	
OR2A14	135941	hgsc.bcm.edu	37	7	143826220	143826220	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr7:143826220G>T	ENST00000408899.2	+	1	70	c.15G>T	c.(13-15)aaG>aaT	p.K5N		NM_001001659.1	NP_001001659.1	Q96R47	O2A14_HUMAN	olfactory receptor, family 2, subfamily A, member 14	5						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(4)|lung(17)|skin(1)	22	Melanoma(164;0.0783)					AAGGCAACAAGACATGGATCA	0.498																																					p.K5N		Atlas-SNP	.											.	OR2A14	66	.	0			c.G15T						PASS	.						80.0	77.0	78.0					7																	143826220		2034	4193	6227	SO:0001583	missense	135941	exon1			CAACAAGACATGG		CCDS43672.1	7q35	2013-09-20		2004-03-08	ENSG00000221938	ENSG00000221938		"""GPCR / Class A : Olfactory receptors"""	15084	protein-coding gene	gene with protein product				OR2A14P, OR2A6			Standard	NM_001001659		Approved	OST182	uc011kua.2	Q96R47	OTTHUMG00000158003	ENST00000408899.2:c.15G>T	chr7.hg19:g.143826220G>T	ENSP00000386137:p.Lys5Asn	57.0	0.0	.		53.0	23.0	.	NM_001001659	Q6IF41|Q8NGT8	Missense_Mutation	SNP	ENST00000408899.2	hg19	CCDS43672.1	.	.	.	.	.	.	.	.	.	.	G	8.070	0.770134	0.15983	.	.	ENSG00000221938	ENST00000408899	T	0.00348	8.0	4.18	4.18	0.49190	.	.	.	.	.	T	0.00144	0.0004	N	0.04320	-0.23	0.09310	N	1	B	0.23591	0.088	B	0.20184	0.028	T	0.50372	-0.8836	9	0.48119	T	0.1	-2.9556	12.1908	0.54270	0.0:0.0:1.0:0.0	.	5	Q96R47	O2A14_HUMAN	N	5	ENSP00000386137:K5N	ENSP00000386137:K5N	K	+	3	2	OR2A14	143457153	0.000000	0.05858	0.341000	0.25589	0.476000	0.33039	-0.561000	0.05957	2.303000	0.77524	0.561000	0.74099	AAG	.	.	.	none		0.498	OR2A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349980.1		
ENTPD7	57089	hgsc.bcm.edu	37	10	101460770	101460770	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr10:101460770T>G	ENST00000370489.4	+	11	1554	c.1376T>G	c.(1375-1377)tTc>tGc	p.F459C		NM_020354.3	NP_065087.1	Q9NQZ7	ENTP7_HUMAN	ectonucleoside triphosphate diphosphohydrolase 7	459						cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|urinary_tract(1)	18		Colorectal(252;0.234)		Epithelial(162;4.72e-10)|all cancers(201;3.75e-08)		ACTCAGAGATTCAAGAATGGC	0.433																																					p.F459C		Atlas-SNP	.											.	ENTPD7	44	.	0			c.T1376G						PASS	.						361.0	321.0	334.0					10																	101460770		2203	4300	6503	SO:0001583	missense	57089	exon11			AGAGATTCAAGAA	AF269255	CCDS7480.1	10q23-q24	2004-07-01			ENSG00000198018	ENSG00000198018			19745	protein-coding gene	gene with protein product						11278936	Standard	NM_020354		Approved	LALP1, FLJ30978	uc001kqa.4	Q9NQZ7	OTTHUMG00000018888	ENST00000370489.4:c.1376T>G	chr10.hg19:g.101460770T>G	ENSP00000359520:p.Phe459Cys	407.0	0.0	.		272.0	93.0	.	NM_020354	B2RB83|B3KP21|D3DR64	Missense_Mutation	SNP	ENST00000370489.4	hg19	CCDS7480.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.321910	0.81580	.	.	ENSG00000198018	ENST00000370489	T	0.12255	2.7	5.21	5.21	0.72293	.	0.056019	0.64402	D	0.000001	T	0.41282	0.1152	M	0.85197	2.74	0.53688	D	0.999977	D	0.76494	0.999	D	0.70935	0.971	T	0.42949	-0.9421	10	0.59425	D	0.04	-26.5929	14.9011	0.70681	0.0:0.0:0.0:1.0	.	459	Q9NQZ7	ENTP7_HUMAN	C	459	ENSP00000359520:F459C	ENSP00000359520:F459C	F	+	2	0	ENTPD7	101450760	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	7.860000	0.86993	2.192000	0.70111	0.523000	0.50628	TTC	.	.	.	none		0.433	ENTPD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049809.2	NM_020354	
DPF2	5977	hgsc.bcm.edu	37	11	65113198	65113198	+	Silent	SNP	G	G	A			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr11:65113198G>A	ENST00000528416.1	+	7	832	c.699G>A	c.(697-699)ttG>ttA	p.L233L	DPF2_ENST00000415073.2_Intron|DPF2_ENST00000532264.1_3'UTR|DPF2_ENST00000252268.4_Silent_p.L247L	NM_006268.4	NP_006259.1	Q92785	REQU_HUMAN	D4, zinc and double PHD fingers family 2	233					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|prostate(1)	23						ACTCCCACTTGGCTGAGGAGG	0.512																																					p.L233L		Atlas-SNP	.											.	DPF2	54	.	0			c.G699A						PASS	.						78.0	71.0	73.0					11																	65113198		2201	4297	6498	SO:0001819	synonymous_variant	5977	exon7			CCACTTGGCTGAG	U94585	CCDS8100.1	11q13.1	2014-05-13	2003-10-06	2003-10-08	ENSG00000133884	ENSG00000133884		"""Zinc fingers, PHD-type"""	9964	protein-coding gene	gene with protein product		601671	"""requiem, apoptosis response zinc finger gene"""	REQ		11845289	Standard	NM_006268		Approved	ubi-d4, BAF45d	uc001odm.3	Q92785	OTTHUMG00000165985	ENST00000528416.1:c.699G>A	chr11.hg19:g.65113198G>A		81.0	0.0	.		66.0	27.0	.	NM_006268	A8K7C9|B4DT58	Silent	SNP	ENST00000528416.1	hg19	CCDS8100.1																																																																																			.	.	.	none		0.512	DPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387293.3	NM_006268	
SPTBN2	6712	hgsc.bcm.edu	37	11	66468283	66468283	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr11:66468283G>T	ENST00000533211.1	-	17	3618	c.3287C>A	c.(3286-3288)aCc>aAc	p.T1096N	SPTBN2_ENST00000309996.2_Missense_Mutation_p.T1096N|SPTBN2_ENST00000529997.1_Missense_Mutation_p.T1096N			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	1096					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						CTCAGGCAGGGTGGCCGGCCC	0.692																																					p.T1096N		Atlas-SNP	.											.	SPTBN2	188	.	0			c.C3287A						PASS	.						16.0	18.0	17.0					11																	66468283		2193	4285	6478	SO:0001583	missense	6712	exon16			GGCAGGGTGGCCG	AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.3287C>A	chr11.hg19:g.66468283G>T	ENSP00000432568:p.Thr1096Asn	51.0	0.0	.		27.0	15.0	.	NM_006946	O14872|O14873	Missense_Mutation	SNP	ENST00000533211.1	hg19	CCDS8150.1	.	.	.	.	.	.	.	.	.	.	G	17.54	3.414677	0.62511	.	.	ENSG00000173898	ENST00000533211;ENST00000309996;ENST00000529997	T;T;T	0.34275	1.37;1.37;1.37	4.7	4.7	0.59300	.	0.059484	0.64402	D	0.000001	T	0.20981	0.0505	N	0.12182	0.205	0.36280	D	0.855746	B	0.28026	0.198	B	0.28305	0.088	T	0.20075	-1.0286	10	0.27785	T	0.31	.	11.7357	0.51763	0.0:0.0:0.8233:0.1767	.	1096	O15020	SPTN2_HUMAN	N	1096	ENSP00000432568:T1096N;ENSP00000311489:T1096N;ENSP00000433593:T1096N	ENSP00000311489:T1096N	T	-	2	0	SPTBN2	66224859	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	6.377000	0.73145	2.446000	0.82766	0.491000	0.48974	ACC	.	.	.	none		0.692	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393892.2	NM_006946	
PCF11	51585	hgsc.bcm.edu	37	11	82877600	82877600	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr11:82877600A>G	ENST00000298281.4	+	5	2113	c.1661A>G	c.(1660-1662)gAt>gGt	p.D554G		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	554					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						GATATTCGGGATCCAAGGCGA	0.423																																					p.D554G		Atlas-SNP	.											.	PCF11	220	.	0			c.A1661G						PASS	.						80.0	76.0	77.0					11																	82877600		1873	4113	5986	SO:0001583	missense	51585	exon5			TTCGGGATCCAAG	AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.1661A>G	chr11.hg19:g.82877600A>G	ENSP00000298281:p.Asp554Gly	81.0	0.0	.		73.0	19.0	.	NM_015885	A6H8W7|O43671|Q6P0X8	Missense_Mutation	SNP	ENST00000298281.4	hg19	CCDS44689.1	.	.	.	.	.	.	.	.	.	.	A	20.5	4.007795	0.75046	.	.	ENSG00000165494	ENST00000298281;ENST00000530660;ENST00000530304	T;T;T	0.56611	1.4;0.45;0.46	6.07	6.07	0.98685	.	0.000000	0.64402	D	0.000008	T	0.63189	0.2490	L	0.32530	0.975	0.58432	D	0.999996	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.94	T	0.60409	-0.7269	9	.	.	.	.	16.6406	0.85098	1.0:0.0:0.0:0.0	.	554;554	E9PQ01;O94913	.;PCF11_HUMAN	G	554	ENSP00000298281:D554G;ENSP00000434540:D554G;ENSP00000431567:D554G	.	D	+	2	0	PCF11	82555248	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.615000	0.90920	2.326000	0.78906	0.533000	0.62120	GAT	.	.	.	none		0.423	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392548.2	NM_015885	
SNX19	399979	hgsc.bcm.edu	37	11	130785820	130785820	+	Silent	SNP	T	T	A			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr11:130785820T>A	ENST00000265909.4	-	1	584	c.15A>T	c.(13-15)acA>acT	p.T5T	SNX19_ENST00000530356.1_Intron|SNX19_ENST00000528555.1_Intron|SNX19_ENST00000533214.1_Silent_p.T5T|SNX19_ENST00000539184.1_Intron|SNX19_ENST00000533318.1_Intron	NM_014758.2	NP_055573	Q92543	SNX19_HUMAN	sorting nexin 19	5					protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(8)|ovary(3)|prostate(1)|skin(6)|urinary_tract(1)	35	all_hematologic(175;0.0597)	Lung NSC(97;0.000272)|all_lung(97;0.000608)|Breast(109;0.000962)|all_neural(223;0.0298)|Medulloblastoma(222;0.0425)		OV - Ovarian serous cystadenocarcinoma(99;0.0195)|Lung(977;0.233)		ACGGTGGCACTGTTTCTGTCT	0.542																																					p.T5T		Atlas-SNP	.											.	SNX19	84	.	0			c.A15T						PASS	.						50.0	44.0	46.0					11																	130785820		2201	4297	6498	SO:0001819	synonymous_variant	399979	exon1			TGGCACTGTTTCT	D87443	CCDS31721.1, CCDS73416.1	11q25	2010-04-20			ENSG00000120451	ENSG00000120451		"""Sorting nexins"""	21532	protein-coding gene	gene with protein product							Standard	NM_014758		Approved	KIAA0254, CHET8	uc001qgk.4	Q92543	OTTHUMG00000165663	ENST00000265909.4:c.15A>T	chr11.hg19:g.130785820T>A		56.0	0.0	.		29.0	13.0	.	NM_014758	E9PKB9|Q8IV55	Silent	SNP	ENST00000265909.4	hg19	CCDS31721.1																																																																																			.	.	.	none		0.542	SNX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385649.1	NM_014758	
ATN1	1822	hgsc.bcm.edu	37	12	7045767	7045767	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr12:7045767C>A	ENST00000356654.4	+	5	1574	c.1337C>A	c.(1336-1338)cCt>cAt	p.P446H	ATN1_ENST00000396684.2_Missense_Mutation_p.P446H	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	446	Poly-Pro.				cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						CCACCACCTCCTCCCTATGGC	0.627																																					p.P446H		Atlas-SNP	.											.	ATN1	95	.	0			c.C1337A						PASS	.						149.0	144.0	146.0					12																	7045767		2203	4300	6503	SO:0001583	missense	1822	exon5			CACCTCCTCCCTA	U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.1337C>A	chr12.hg19:g.7045767C>A	ENSP00000349076:p.Pro446His	377.0	0.0	.		366.0	144.0	.	NM_001007026	Q99495|Q99621|Q9UEK7	Missense_Mutation	SNP	ENST00000356654.4	hg19	CCDS31734.1	.	.	.	.	.	.	.	.	.	.	c	12.53	1.964846	0.34659	.	.	ENSG00000111676	ENST00000356654;ENST00000396684;ENST00000544325;ENST00000229279	T;T;T	0.55413	0.52;0.52;0.52	3.88	3.88	0.44766	.	.	.	.	.	T	0.63390	0.2507	L	0.40543	1.245	0.46416	D	0.999032	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.988	T	0.63721	-0.6573	9	0.38643	T	0.18	.	16.2396	0.82401	0.0:1.0:0.0:0.0	.	446;446	Q86V38;P54259	.;ATN1_HUMAN	H	446;446;446;31	ENSP00000349076:P446H;ENSP00000379915:P446H;ENSP00000441744:P446H	ENSP00000229279:P31H	P	+	2	0	ATN1	6916028	0.028000	0.19301	0.947000	0.38551	0.354000	0.29330	0.722000	0.25925	1.883000	0.54544	0.586000	0.80456	CCT	.	.	.	none		0.627	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401948.2	NM_001940	
PITPNM2	57605	hgsc.bcm.edu	37	12	123479959	123479959	+	Silent	SNP	C	C	T			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr12:123479959C>T	ENST00000542749.1	-	12	2094	c.2031G>A	c.(2029-2031)caG>caA	p.Q677Q	PITPNM2_ENST00000392428.1_Silent_p.Q398Q|PITPNM2_ENST00000280562.5_Silent_p.Q677Q|PITPNM2_ENST00000320201.4_Silent_p.Q677Q			Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein, membrane-associated 2	677					metabolic process (GO:0008152)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)			NS(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	39	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		CCTGGTGCTGCTGGATGGTAT	0.637																																					p.Q677Q		Atlas-SNP	.											.	PITPNM2	105	.	0			c.G2031A						PASS	.						58.0	67.0	64.0					12																	123479959		2203	4299	6502	SO:0001819	synonymous_variant	57605	exon13			GTGCTGCTGGATG	AF334585	CCDS9242.1, CCDS73543.1	12q24.31	2008-02-05				ENSG00000090975			21044	protein-coding gene	gene with protein product		608920				10022914	Standard	XM_005253582		Approved	RDGBA2, RDGB2, NIR3	uc001uej.1	Q9BZ72		ENST00000542749.1:c.2031G>A	chr12.hg19:g.123479959C>T		104.0	0.0	.		150.0	43.0	.	NM_020845	Q9P271	Silent	SNP	ENST00000542749.1	hg19	CCDS9242.1																																																																																			.	.	.	none		0.637	PITPNM2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401342.1	NM_020845	
TTC7B	145567	hgsc.bcm.edu	37	14	91161893	91161893	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr14:91161893C>G	ENST00000328459.6	-	6	849	c.728G>C	c.(727-729)aGa>aCa	p.R243T	RP11-661G16.2_ENST00000553712.1_RNA|TTC7B_ENST00000357056.2_Missense_Mutation_p.R243T	NM_001010854.1	NP_001010854.1	Q86TV6	TTC7B_HUMAN	tetratricopeptide repeat domain 7B	243										NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	36		Melanoma(154;0.222)				GAGAAGCTCTCTAAATCTTCC	0.413																																					p.R243T		Atlas-SNP	.											.	TTC7B	93	.	0			c.G728C						PASS	.						138.0	111.0	120.0					14																	91161893		2203	4300	6503	SO:0001583	missense	145567	exon6			AGCTCTCTAAATC	BC035865	CCDS32140.1	14q32.12	2013-01-11	2004-06-02	2004-06-04		ENSG00000165914		"""Tetratricopeptide (TTC) repeat domain containing"""	19858	protein-coding gene	gene with protein product			"""tetratricopeptide repeat domain 7 like 1"""	TTC7L1			Standard	XM_005267367		Approved		uc001xyp.3	Q86TV6		ENST00000328459.6:c.728G>C	chr14.hg19:g.91161893C>G	ENSP00000336127:p.Arg243Thr	64.0	0.0	.		42.0	23.0	.	NM_001010854	Q86U24|Q86VT3	Missense_Mutation	SNP	ENST00000328459.6	hg19	CCDS32140.1	.	.	.	.	.	.	.	.	.	.	C	14.89	2.671065	0.47781	.	.	ENSG00000165914	ENST00000555768;ENST00000357056;ENST00000328459;ENST00000557766	T;T	0.66638	0.45;-0.22	5.72	4.83	0.62350	.	0.000000	0.85682	D	0.000000	T	0.69278	0.3093	M	0.82517	2.595	0.80722	D	1	B	0.30482	0.281	B	0.27796	0.083	T	0.72279	-0.4340	10	0.87932	D	0	-14.3324	14.3423	0.66636	0.0:0.9283:0.0:0.0717	.	243	Q86TV6	TTC7B_HUMAN	T	141;243;243;163	ENSP00000349564:R243T;ENSP00000336127:R243T	ENSP00000336127:R243T	R	-	2	0	TTC7B	90231646	1.000000	0.71417	0.781000	0.31783	0.002000	0.02628	7.184000	0.77705	1.420000	0.47138	-0.229000	0.12294	AGA	.	.	.	none		0.413	TTC7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411364.2		
TYRO3	7301	hgsc.bcm.edu	37	15	41854918	41854918	+	Splice_Site	SNP	T	T	G			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr15:41854918T>G	ENST00000263798.3	+	4	804		c.e4+2		TYRO3_ENST00000559066.1_Splice_Site	NM_006293.3	NP_006284.2	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase						apoptotic cell clearance (GO:0043277)|cell adhesion (GO:0007155)|forebrain cell migration (GO:0021885)|natural killer cell differentiation (GO:0001779)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|neuron cellular homeostasis (GO:0070050)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein autophosphorylation (GO:0046777)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(26)|ovary(3)|prostate(1)	43		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		ATGTAACAGGTGAGCAGCCTC	0.582																																					.		Atlas-SNP	.											.	TYRO3	169	.	0			c.580+2T>G						PASS	.						22.0	20.0	21.0					15																	41854918		2203	4300	6503	SO:0001630	splice_region_variant	7301	exon4			AACAGGTGAGCAG	D50479	CCDS10080.1	15q15.1-q21.1	2013-02-11			ENSG00000092445	ENSG00000092445	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12446	protein-coding gene	gene with protein product		600341		RSE		7851890	Standard	NM_006293		Approved	Dtk, Brt, Tif, Sky	uc001zof.2	Q06418	OTTHUMG00000130341	ENST00000263798.3:c.580+2T>G	chr15.hg19:g.41854918T>G		23.0	0.0	.		31.0	8.0	.	NM_006293	O14953|Q86VR3	Splice_Site	SNP	ENST00000263798.3	hg19	CCDS10080.1	.	.	.	.	.	.	.	.	.	.	t	21.2	4.113398	0.77210	.	.	ENSG00000092445	ENST00000540218;ENST00000263798	.	.	.	4.8	4.8	0.61643	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5013	0.67724	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	TYRO3	39642210	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	6.037000	0.70956	2.007000	0.58848	0.387000	0.25754	.	.	.	.	none		0.582	TYRO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252693.2		Intron
MAPKBP1	23005	hgsc.bcm.edu	37	15	42105966	42105966	+	Missense_Mutation	SNP	G	G	A	rs374717785		TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr15:42105966G>A	ENST00000456763.2	+	10	1181	c.985G>A	c.(985-987)Gtc>Atc	p.V329I	MAPKBP1_ENST00000457542.2_Missense_Mutation_p.V323I|MAPKBP1_ENST00000221214.6_Intron|MAPKBP1_ENST00000260357.7_Missense_Mutation_p.V211I|MAPKBP1_ENST00000514566.1_Missense_Mutation_p.V323I	NM_001128608.1	NP_001122080.1	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein 1	329								p.V323I(1)		breast(6)|central_nervous_system(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		CATTGCTAGCGTCACCGAGGC	0.592																																					p.V329I		Atlas-SNP	.											MAPKBP1,colon,carcinoma,0,1	MAPKBP1	120	.	1	Substitution - Missense(1)	large_intestine(1)	c.G985A						PASS	.	A	ILE/VAL,ILE/VAL	3,4403	6.2+/-15.9	0,3,2200	115.0	106.0	109.0		985,967	-6.3	0.1	15		109	0,8600		0,0,4300	no	missense,missense	MAPKBP1	NM_001128608.1,NM_014994.2	29,29	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	benign,benign	329/1515,323/1509	42105966	3,13003	2203	4300	6503	SO:0001583	missense	23005	exon10			GCTAGCGTCACCG	AB011168	CCDS32201.1, CCDS45239.1, CCDS58359.1	15q15.1	2013-01-10	2008-01-30		ENSG00000137802	ENSG00000137802		"""WD repeat domain containing"""	29536	protein-coding gene	gene with protein product			"""mitogen activated protein kinase binding protein 1"""			9628581, 10471813	Standard	NM_014994		Approved	KIAA0596	uc001zok.4	O60336	OTTHUMG00000160227	ENST00000456763.2:c.985G>A	chr15.hg19:g.42105966G>A	ENSP00000393099:p.Val329Ile	180.0	0.0	.		153.0	42.0	.	NM_001128608	A6NM93|A8K8P9|Q14CB5|Q14CD8|Q49AJ8|Q5W9G9	Missense_Mutation	SNP	ENST00000456763.2	hg19	CCDS45239.1	.	.	.	.	.	.	.	.	.	.	g	0.324	-0.960053	0.02267	6.81E-4	0.0	ENSG00000137802	ENST00000457542;ENST00000260357;ENST00000456763;ENST00000514566	T;T;T;T	0.42131	1.08;0.98;1.15;1.24	5.64	-6.33	0.01988	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.593302	0.19314	N	0.117308	T	0.28962	0.0719	L	0.38531	1.155	0.09310	N	0.999993	B;B;B;B	0.12013	0.001;0.005;0.001;0.001	B;B;B;B	0.13407	0.001;0.009;0.001;0.002	T	0.05053	-1.0909	10	0.21014	T	0.42	-1.6987	18.1757	0.89760	0.2499:0.0:0.7501:0.0	.	211;323;329;323	F8WC21;O60336-2;O60336;O60336-6	.;.;MABP1_HUMAN;.	I	323;211;329;323	ENSP00000397570:V323I;ENSP00000260357:V211I;ENSP00000393099:V329I;ENSP00000426154:V323I	ENSP00000260357:V211I	V	+	1	0	MAPKBP1	39893258	0.000000	0.05858	0.055000	0.19348	0.822000	0.46500	-0.443000	0.06862	-1.516000	0.01782	-1.913000	0.00520	GTC	.	.	.	weak		0.592	MAPKBP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000359745.1	NM_014994	
AP4E1	23431	hgsc.bcm.edu	37	15	51289917	51289917	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr15:51289917T>A	ENST00000261842.5	+	18	2847	c.2741T>A	c.(2740-2742)aTa>aAa	p.I914K	AP4E1_ENST00000560508.1_Missense_Mutation_p.I839K	NM_001252127.1|NM_007347.4	NP_001239056.1|NP_031373.2	Q9UPM8	AP4E1_HUMAN	adaptor-related protein complex 4, epsilon 1 subunit	914					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	coated pit (GO:0005905)|Golgi apparatus (GO:0005794)|membrane coat (GO:0030117)				breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(5)|skin(2)	27				all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)		ACTGAATACATACACTCAAAT	0.353																																					p.I914K		Atlas-SNP	.											.	AP4E1	78	.	0			c.T2741A						PASS	.						66.0	68.0	67.0					15																	51289917		2196	4294	6490	SO:0001583	missense	23431	exon18			AATACATACACTC	AB030653	CCDS32240.1, CCDS58362.1	15q21.2	2014-09-17			ENSG00000081014	ENSG00000081014			573	protein-coding gene	gene with protein product		607244				10436028, 21620353	Standard	NM_007347		Approved	AP-4-EPSILON, SPG51	uc001zyx.2	Q9UPM8	OTTHUMG00000172458	ENST00000261842.5:c.2741T>A	chr15.hg19:g.51289917T>A	ENSP00000261842:p.Ile914Lys	117.0	0.0	.		146.0	65.0	.	NM_007347	A0AVD6|A1L4A9|A6NNX7|H0YKX4|Q68D31|Q9Y588	Missense_Mutation	SNP	ENST00000261842.5	hg19	CCDS32240.1	.	.	.	.	.	.	.	.	.	.	T	4.902	0.167570	0.09339	.	.	ENSG00000081014	ENST00000261842	T	0.16457	2.34	5.2	4.06	0.47325	Coatomer, beta subunit, C-terminal (1);	0.708362	0.14326	N	0.326718	T	0.08179	0.0204	N	0.08118	0	0.09310	N	1	B	0.12013	0.005	B	0.13407	0.009	T	0.26430	-1.0103	10	0.52906	T	0.07	-0.4045	3.9914	0.09538	0.0:0.1738:0.2024:0.6238	.	914	Q9UPM8	AP4E1_HUMAN	K	914	ENSP00000261842:I914K	ENSP00000261842:I914K	I	+	2	0	AP4E1	49077209	0.972000	0.33761	0.226000	0.23910	0.357000	0.29423	2.092000	0.41700	0.804000	0.34136	0.383000	0.25322	ATA	.	.	.	none		0.353	AP4E1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418656.1		
PIAS1	8554	hgsc.bcm.edu	37	15	68479999	68479999	+	Silent	SNP	T	T	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr15:68479999T>C	ENST00000249636.6	+	14	1930	c.1782T>C	c.(1780-1782)agT>agC	p.S594S	PIAS1_ENST00000545237.1_Silent_p.S596S	NM_016166.1	NP_057250.1	O75925	PIAS1_HUMAN	protein inhibitor of activated STAT, 1	594	4 X 4 AA repeats of N-T-S-L.|Ser-rich.				androgen receptor signaling pathway (GO:0030521)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of transcription, DNA-templated (GO:0045893)|protein sumoylation (GO:0016925)|protein-DNA complex assembly (GO:0065004)|regulation of cell proliferation (GO:0042127)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|SUMO ligase activity (GO:0019789)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)	24						ATCAGTTAAGTGCAGGAGGCA	0.502																																					p.S594S		Atlas-SNP	.											.	PIAS1	42	.	0			c.T1782C						PASS	.						85.0	83.0	83.0					15																	68479999		2018	4191	6209	SO:0001819	synonymous_variant	8554	exon14			GTTAAGTGCAGGA	AF077951	CCDS45290.1	15q	2011-10-11	2002-04-19	2002-04-19		ENSG00000033800		"""Zinc fingers, MIZ-type"""	2752	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 3"""	603566	"""DEAD/H (Asp-Glu-Ala-Asp/His) box binding protein 1"""	DDXBP1		9724754, 9177271	Standard	XM_005254735		Approved	GBP, GU/RH-II, ZMIZ3	uc002aqz.3	O75925		ENST00000249636.6:c.1782T>C	chr15.hg19:g.68479999T>C		66.0	0.0	.		77.0	34.0	.	NM_016166	B2RB67|B3KSY9|C5J4B4|Q147X4|Q99751|Q9UN02	Silent	SNP	ENST00000249636.6	hg19	CCDS45290.1																																																																																			.	.	.	none		0.502	PIAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419642.2		
ZNF688	146542	hgsc.bcm.edu	37	16	30581595	30581595	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr16:30581595G>A	ENST00000223459.6	-	3	1577	c.473C>T	c.(472-474)gCc>gTc	p.A158V	AC002310.7_ENST00000492040.1_RNA|AC002310.7_ENST00000486926.1_RNA|ZNF688_ENST00000395219.1_Missense_Mutation_p.A144V	NM_145271.3	NP_660314.1	P0C7X2	ZN688_HUMAN	zinc finger protein 688	158					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(2)|lung(2)|ovary(1)	8						CGGGTCCCAGGCAGCATTTTT	0.672																																					p.A158V		Atlas-SNP	.											.	ZNF688	37	.	0			c.C473T						PASS	.						29.0	32.0	31.0					16																	30581595		2197	4299	6496	SO:0001583	missense	146542	exon3			TCCCAGGCAGCAT	AK122680	CCDS10684.1	16p11.2	2013-01-08			ENSG00000229809	ENSG00000229809		"""Zinc fingers, C2H2-type"", ""-"""	30489	protein-coding gene	gene with protein product						10493829	Standard	XM_005255139		Approved		uc002dys.2	P0C7X2	OTTHUMG00000132408	ENST00000223459.6:c.473C>T	chr16.hg19:g.30581595G>A	ENSP00000223459:p.Ala158Val	38.0	0.0	.		46.0	19.0	.	NM_145271	A8MV39|B3KV51|O75701|Q8IW91|Q8WV14|Q96MN0	Missense_Mutation	SNP	ENST00000223459.6	hg19	CCDS10684.1	.	.	.	.	.	.	.	.	.	.	G	12.04	1.817925	0.32145	.	.	ENSG00000229809	ENST00000395219;ENST00000223459	T;T	0.04194	3.68;3.91	4.26	0.961	0.19638	.	.	.	.	.	T	0.04003	0.0112	L	0.41236	1.265	0.09310	N	1	B;B	0.14438	0.002;0.01	B;B	0.11329	0.003;0.006	T	0.43523	-0.9386	9	0.28530	T	0.3	.	3.1826	0.06589	0.2262:0.0:0.5648:0.209	.	158;144	P0C7X2;A8MV39	ZN688_HUMAN;.	V	144;158	ENSP00000378645:A144V;ENSP00000223459:A158V	ENSP00000223459:A158V	A	-	2	0	ZNF688	30489096	0.018000	0.18449	0.721000	0.30653	0.192000	0.23643	1.655000	0.37345	0.546000	0.28920	0.460000	0.39030	GCC	.	.	.	none		0.672	ZNF688-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255544.2	NM_145271	
RPGRIP1L	23322	hgsc.bcm.edu	37	16	53708941	53708941	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr16:53708941A>C	ENST00000379925.3	-	7	920	c.870T>G	c.(868-870)atT>atG	p.I290M	RPGRIP1L_ENST00000563746.1_Missense_Mutation_p.I290M|RPGRIP1L_ENST00000262135.4_Missense_Mutation_p.I290M|RPGRIP1L_ENST00000564374.1_Missense_Mutation_p.I290M	NM_015272.2	NP_056087.2	Q68CZ1	FTM_HUMAN	RPGRIP1-like	290					camera-type eye development (GO:0043010)|cerebellum development (GO:0021549)|cilium assembly (GO:0042384)|corpus callosum development (GO:0022038)|determination of left/right symmetry (GO:0007368)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment or maintenance of cell polarity (GO:0007163)|head development (GO:0060322)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lateral ventricle development (GO:0021670)|liver development (GO:0001889)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|neural tube patterning (GO:0021532)|nose development (GO:0043584)|olfactory bulb development (GO:0021772)|pericardium development (GO:0060039)|regulation of smoothened signaling pathway (GO:0008589)	axoneme (GO:0005930)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	thromboxane A2 receptor binding (GO:0031870)			endometrium(6)|kidney(3)|large_intestine(9)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(2)	46		all_cancers(37;0.0973)				CTTGAAGCTGAATAAATTTTC	0.308																																					p.I290M		Atlas-SNP	.											.	RPGRIP1L	118	.	0			c.T870G						PASS	.						131.0	117.0	122.0					16																	53708941		2197	4297	6494	SO:0001583	missense	23322	exon7			AAGCTGAATAAAT		CCDS32447.1, CCDS45486.1	16q12.2	2014-09-17				ENSG00000103494			29168	protein-coding gene	gene with protein product	"""fantom homolog"", ""Meckel syndrome, type 5"", ""protein phosphatase 1, regulatory subunit 134"""	610937				10231032	Standard	NM_015272		Approved	KIAA1005, CORS3, JBTS7, MKS5, NPHP8, FTM, PPP1R134	uc002ehp.3	Q68CZ1		ENST00000379925.3:c.870T>G	chr16.hg19:g.53708941A>C	ENSP00000369257:p.Ile290Met	68.0	0.0	.		71.0	31.0	.	NM_001127897	A0PJ88|Q9Y2K8	Missense_Mutation	SNP	ENST00000379925.3	hg19	CCDS32447.1	.	.	.	.	.	.	.	.	.	.	A	11.30	1.597979	0.28445	.	.	ENSG00000103494	ENST00000379925;ENST00000262135	D;D	0.89875	-2.58;-2.58	5.98	4.87	0.63330	.	0.287071	0.33834	N	0.004504	T	0.77638	0.4160	L	0.36672	1.1	0.80722	D	1	B;B;B;P	0.38250	0.351;0.241;0.241;0.624	B;B;B;B	0.32342	0.071;0.071;0.071;0.144	T	0.76244	-0.3030	10	0.48119	T	0.1	-8.1579	0.3735	0.00383	0.3487:0.18:0.1302:0.3411	.	290;290;290;290	B4E3M8;B7ZKJ9;Q68CZ1;Q68CZ1-2	.;.;FTM_HUMAN;.	M	290	ENSP00000369257:I290M;ENSP00000262135:I290M	ENSP00000262135:I290M	I	-	3	3	RPGRIP1L	52266442	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.557000	0.36299	2.293000	0.77203	0.477000	0.44152	ATT	.	.	.	none		0.308	RPGRIP1L-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000422187.1	NM_015272	
CHRNB1	1140	hgsc.bcm.edu	37	17	7357711	7357711	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr17:7357711C>G	ENST00000306071.2	+	8	983	c.916C>G	c.(916-918)Ccc>Gcc	p.P306A	CHRNB1_ENST00000536404.2_Missense_Mutation_p.P234A|CHRNB1_ENST00000576360.1_Intron|CHRNB1_ENST00000575379.1_5'Flank	NM_000747.2	NP_000738.2	P11230	ACHB_HUMAN	cholinergic receptor, nicotinic, beta 1 (muscle)	306					behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|neurological system process (GO:0050877)|neuromuscular synaptic transmission (GO:0007274)|postsynaptic membrane organization (GO:0001941)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)|channel activity (GO:0015267)|ligand-gated ion channel activity (GO:0015276)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|ovary(3)	23		Prostate(122;0.157)			Galantamine(DB00674)	ACTATCAGTACCCATTATTAT	0.512																																					p.P306A		Atlas-SNP	.											.	CHRNB1	46	.	0			c.C916G						PASS	.						307.0	238.0	262.0					17																	7357711		2203	4300	6503	SO:0001583	missense	1140	exon8			TCAGTACCCATTA	X14830	CCDS11106.1	17p13.1	2012-02-11	2006-02-01		ENSG00000170175	ENSG00000170175		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1961	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 1 (muscle)"""	100710	"""cholinergic receptor, nicotinic, beta polypeptide 1 (muscle)"""	CHRNB			Standard	NM_000747		Approved		uc002ghb.3	P11230	OTTHUMG00000108139	ENST00000306071.2:c.916C>G	chr17.hg19:g.7357711C>G	ENSP00000304290:p.Pro306Ala	183.0	0.0	.		214.0	60.0	.	NM_000747	B7Z5H1|Q8IZ46|Q96FB8	Missense_Mutation	SNP	ENST00000306071.2	hg19	CCDS11106.1	.	.	.	.	.	.	.	.	.	.	C	16.76	3.212473	0.58452	.	.	ENSG00000170175	ENST00000306071;ENST00000536404	D;D	0.85339	-1.97;-1.97	4.92	4.92	0.64577	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.95245	0.8458	H	0.99074	4.42	0.80722	D	1	D	0.63880	0.993	P	0.61132	0.884	D	0.97341	0.9957	10	0.87932	D	0	.	15.675	0.77311	0.0:1.0:0.0:0.0	.	306	P11230	ACHB_HUMAN	A	306;234	ENSP00000304290:P306A;ENSP00000439209:P234A	ENSP00000304290:P306A	P	+	1	0	CHRNB1	7298435	1.000000	0.71417	0.998000	0.56505	0.270000	0.26580	7.818000	0.86416	2.300000	0.77407	0.298000	0.19748	CCC	.	.	.	none		0.512	CHRNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226942.3		
MYL4	4635	hgsc.bcm.edu	37	17	45286883	45286883	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr17:45286883A>G	ENST00000354968.1	+	2	223	c.95A>G	c.(94-96)gAg>gGg	p.E32G	MYL4_ENST00000572316.1_Missense_Mutation_p.E32G|MYL4_ENST00000393450.1_Missense_Mutation_p.E32G	NM_001002841.1	NP_001002841.1	P12829	MYL4_HUMAN	myosin, light chain 4, alkali; atrial, embryonic	32					cardiac muscle contraction (GO:0060048)|muscle filament sliding (GO:0030049)|positive regulation of ATPase activity (GO:0032781)|regulation of the force of heart contraction (GO:0002026)	A band (GO:0031672)|cytosol (GO:0005829)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|calcium ion binding (GO:0005509)|myosin II heavy chain binding (GO:0032038)			endometrium(2)|large_intestine(1)|lung(4)|ovary(3)|prostate(1)	11						ccagctcctgAGGCTCCCAAG	0.582																																					p.E32G		Atlas-SNP	.											.	MYL4	27	.	0			c.A95G						PASS	.						65.0	64.0	64.0					17																	45286883		2203	4300	6503	SO:0001583	missense	4635	exon2			CTCCTGAGGCTCC		CCDS11510.1	17q21.32	2013-09-19	2006-09-29		ENSG00000198336	ENSG00000198336		"""Myosins / Light chain"", ""EF-hand domain containing"""	7585	protein-coding gene	gene with protein product	"""myosin, atrial/fetal muscle, light chain"""	160770	"""myosin, light polypeptide 4, alkali; atrial, embryonic"""			3417683	Standard	NM_002476		Approved	ALC1, AMLC, GT1, PRO1957	uc002ilg.3	P12829	OTTHUMG00000178232	ENST00000354968.1:c.95A>G	chr17.hg19:g.45286883A>G	ENSP00000347055:p.Glu32Gly	115.0	0.0	.		104.0	5.0	.	NM_001002841	D3DXJ7|P11783	Missense_Mutation	SNP	ENST00000354968.1	hg19	CCDS11510.1	.	.	.	.	.	.	.	.	.	.	A	13.90	2.376256	0.42105	.	.	ENSG00000198336	ENST00000354968;ENST00000393450;ENST00000536623	D;D	0.88124	-2.34;-2.34	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	D	0.91965	0.7455	M	0.81942	2.565	0.42862	D	0.994118	D	0.57899	0.981	D	0.65140	0.932	D	0.90935	0.4793	10	0.29301	T	0.29	-32.6232	11.5071	0.50472	1.0:0.0:0.0:0.0	.	32	P12829	MYL4_HUMAN	G	32;32;2	ENSP00000347055:E32G;ENSP00000377096:E32G	ENSP00000347055:E32G	E	+	2	0	MYL4	42641882	0.998000	0.40836	0.994000	0.49952	0.561000	0.35649	2.795000	0.47861	1.991000	0.58162	0.459000	0.35465	GAG	.	.	.	none		0.582	MYL4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441059.1	NM_001002841	
HDHD2	84064	hgsc.bcm.edu	37	18	44639349	44639349	+	Splice_Site	SNP	A	A	T			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr18:44639349A>T	ENST00000300605.6	-	6	827	c.675T>A	c.(673-675)acT>acA	p.T225T	HDHD2_ENST00000587841.1_5'UTR	NM_032124.4	NP_115500.1	Q9H0R4	HDHD2_HUMAN	haloacid dehalogenase-like hydrolase domain containing 2	225						extracellular vesicular exosome (GO:0070062)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)			kidney(2)|large_intestine(2)|lung(1)|skin(1)	6						GATACATACCAGTCTTTACTA	0.408																																					p.T225T		Atlas-SNP	.											.	HDHD2	12	.	0			c.T675A						PASS	.						115.0	100.0	105.0					18																	44639349		2203	4300	6503	SO:0001630	splice_region_variant	84064	exon6			CATACCAGTCTTT	AL136681	CCDS32829.1	18q21.1	2008-02-05				ENSG00000167220			25364	protein-coding gene	gene with protein product						11230166	Standard	NM_032124		Approved	DKFZP564D1378	uc002lcs.3	Q9H0R4		ENST00000300605.6:c.676+1T>A	chr18.hg19:g.44639349A>T		72.0	0.0	.		86.0	28.0	.	NM_032124	A8K7T3|Q96NV4	Silent	SNP	ENST00000300605.6	hg19	CCDS32829.1																																																																																			.	.	.	none		0.408	HDHD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450668.2	NM_032124	Silent
MUC16	94025	hgsc.bcm.edu	37	19	9083127	9083127	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr19:9083127C>A	ENST00000397910.4	-	1	8891	c.8688G>T	c.(8686-8688)gaG>gaT	p.E2896D		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2897	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AACTTGGGACCTCAGAAAACT	0.507																																					p.E2896D		Atlas-SNP	.											.	MUC16	4315	.	0			c.G8688T						PASS	.						75.0	69.0	71.0					19																	9083127		1897	4124	6021	SO:0001583	missense	94025	exon1			TGGGACCTCAGAA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.8688G>T	chr19.hg19:g.9083127C>A	ENSP00000381008:p.Glu2896Asp	46.0	0.0	.		29.0	6.0	.	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	2.382	-0.341788	0.05243	.	.	ENSG00000181143	ENST00000397910	T	0.02606	4.23	0.773	-1.55	0.08558	.	.	.	.	.	T	0.01489	0.0048	N	0.08118	0	.	.	.	B	0.19817	0.039	B	0.15484	0.013	T	0.45906	-0.9229	8	0.87932	D	0	.	2.2074	0.03939	0.0:0.3584:0.3406:0.301	.	2896	B5ME49	.	D	2896	ENSP00000381008:E2896D	ENSP00000381008:E2896D	E	-	3	2	MUC16	8944127	0.000000	0.05858	0.000000	0.03702	0.154000	0.21943	-0.875000	0.04205	-0.903000	0.03881	0.313000	0.20887	GAG	.	.	.	none		0.507	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
IRF2BP1	26145	hgsc.bcm.edu	37	19	46387423	46387423	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr19:46387423G>A	ENST00000302165.3	-	1	1953	c.1610C>T	c.(1609-1611)gCg>gTg	p.A537V		NM_015649.1	NP_056464.1	Q8IU81	I2BP1_HUMAN	interferon regulatory factor 2 binding protein 1	537	Cys-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)			cervix(1)|kidney(1)|lung(2)	4		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00442)|GBM - Glioblastoma multiforme(486;0.0402)|Epithelial(262;0.231)		CGGGCCCTGCGCCTTGATGAA	0.677																																					p.A537V		Atlas-SNP	.											.	IRF2BP1	23	.	0			c.C1610T						PASS	.						30.0	30.0	30.0					19																	46387423		2203	4299	6502	SO:0001583	missense	26145	exon1			CCCTGCGCCTTGA	AY278022	CCDS12678.1	19q13.32	2008-02-05							21728	protein-coding gene	gene with protein product		615331				12799427	Standard	NM_015649		Approved	DKFZP434M154, IRF-2BP1	uc002pds.1	Q8IU81		ENST00000302165.3:c.1610C>T	chr19.hg19:g.46387423G>A	ENSP00000307265:p.Ala537Val	73.0	0.0	.		67.0	7.0	.	NM_015649	Q53EL7|Q6DC95|Q9BRZ9|Q9Y4P4	Missense_Mutation	SNP	ENST00000302165.3	hg19	CCDS12678.1	.	.	.	.	.	.	.	.	.	.	G	18.22	3.574987	0.65878	.	.	ENSG00000170604	ENST00000302165	D	0.86230	-2.09	4.58	4.58	0.56647	Zinc finger, C3HC4 RING-type (1);	0.382217	0.24182	N	0.040786	T	0.75961	0.3921	N	0.22421	0.69	0.30785	N	0.741587	P	0.43750	0.816	B	0.32533	0.147	T	0.77253	-0.2656	10	0.33940	T	0.23	.	14.914	0.70781	0.0:0.0:1.0:0.0	.	537	Q8IU81	I2BP1_HUMAN	V	537	ENSP00000307265:A537V	ENSP00000307265:A537V	A	-	2	0	IRF2BP1	51079263	0.964000	0.33143	0.999000	0.59377	0.968000	0.65278	2.896000	0.48656	2.362000	0.80069	0.563000	0.77884	GCG	.	.	.	none		0.677	IRF2BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461683.1	NM_015649	
FAM71E1	112703	hgsc.bcm.edu	37	19	50970929	50970929	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr19:50970929G>A	ENST00000600100.1	-	4	1061	c.697C>T	c.(697-699)Cgc>Tgc	p.R233C	FAM71E1_ENST00000595790.1_Missense_Mutation_p.R217C			Q6IPT2	F71E1_HUMAN	family with sequence similarity 71, member E1	233										breast(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.0077)|GBM - Glioblastoma multiforme(134;0.026)		AAGCGCAGGCGGTAGAGCAGC	0.612																																					p.R217C		Atlas-SNP	.											.	FAM71E1	21	.	0			c.C649T						PASS	.						26.0	27.0	26.0					19																	50970929		2195	4290	6485	SO:0001583	missense	112703	exon4			GCAGGCGGTAGAG		CCDS33081.1	19q13.33	2007-11-20				ENSG00000142530			25107	protein-coding gene	gene with protein product							Standard	XM_005258472		Approved		uc002psg.3	Q6IPT2		ENST00000600100.1:c.697C>T	chr19.hg19:g.50970929G>A	ENSP00000472421:p.Arg233Cys	14.0	0.0	.		11.0	4.0	.	NM_138411	Q96EJ5|Q9BSM9	Missense_Mutation	SNP	ENST00000600100.1	hg19		.	.	.	.	.	.	.	.	.	.	g	15.85	2.955383	0.53293	.	.	ENSG00000142530	ENST00000391816;ENST00000270620	T;T	0.17854	2.25;2.25	4.0	0.356	0.16074	.	0.791977	0.10938	N	0.617646	T	0.29914	0.0748	L	0.51422	1.61	0.42510	D	0.992969	D;D	0.89917	1.0;1.0	D;D	0.73380	0.98;0.95	T	0.19877	-1.0292	10	0.66056	D	0.02	-6.3609	5.8158	0.18492	0.096:0.0:0.5658:0.3382	.	233;217	Q6IPT2;Q6IPT2-2	F71E1_HUMAN;.	C	233;217	ENSP00000375692:R233C;ENSP00000270620:R217C	ENSP00000270620:R217C	R	-	1	0	FAM71E1	55662741	1.000000	0.71417	0.998000	0.56505	0.724000	0.41520	2.576000	0.46033	0.057000	0.16193	0.462000	0.41574	CGC	.	.	.	none		0.612	FAM71E1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000464754.2		
ZFP28	140612	hgsc.bcm.edu	37	19	57066282	57066282	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr19:57066282T>C	ENST00000301318.3	+	8	2199	c.2128T>C	c.(2128-2130)Ttt>Ctt	p.F710L	AC007228.11_ENST00000596587.1_RNA	NM_020828.1	NP_065879.1	Q8NHY6	ZFP28_HUMAN	ZFP28 zinc finger protein	710					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(6)|ovary(1)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	35		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0302)		TGGGAAGGCCTTTGGTGATAA	0.443																																					p.F710L	Ovarian(124;554 1662 19430 21141 52494)	Atlas-SNP	.											.	ZFP28	99	.	0			c.T2128C						PASS	.						105.0	105.0	105.0					19																	57066282		2203	4300	6503	SO:0001583	missense	140612	exon8			AAGGCCTTTGGTG		CCDS12946.1	19q13.43	2013-01-08	2012-11-27			ENSG00000196867		"""Zinc fingers, C2H2-type"", ""-"""	17801	protein-coding gene	gene with protein product			"""zinc finger protein 28 homolog (mouse)"""				Standard	NM_020828		Approved	KIAA1431, mkr5	uc002qnj.3	Q8NHY6		ENST00000301318.3:c.2128T>C	chr19.hg19:g.57066282T>C	ENSP00000301318:p.Phe710Leu	124.0	0.0	.		128.0	45.0	.	NM_020828	A0JNV6|K7ES88|Q8NHU8|Q9BY30|Q9P2B6	Missense_Mutation	SNP	ENST00000301318.3	hg19	CCDS12946.1	.	.	.	.	.	.	.	.	.	.	T	18.87	3.714627	0.68730	.	.	ENSG00000196867	ENST00000301318	T	0.46063	0.88	4.0	2.98	0.34508	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.47093	D	0.000249	T	0.64659	0.2618	M	0.87097	2.86	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.66488	-0.5911	10	0.87932	D	0	.	8.4668	0.32960	0.0:0.0964:0.0:0.9036	.	710	Q8NHY6	ZFP28_HUMAN	L	710	ENSP00000301318:F710L	ENSP00000301318:F710L	F	+	1	0	ZFP28	61758094	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.655000	0.67981	0.710000	0.31997	0.454000	0.30748	TTT	.	.	.	none		0.443	ZFP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458409.1	NM_020828	
ZFP28	140612	hgsc.bcm.edu	37	19	57066298	57066298	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr19:57066298C>A	ENST00000301318.3	+	8	2215	c.2144C>A	c.(2143-2145)tCc>tAc	p.S715Y	AC007228.11_ENST00000596587.1_RNA	NM_020828.1	NP_065879.1	Q8NHY6	ZFP28_HUMAN	ZFP28 zinc finger protein	715					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(6)|ovary(1)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	35		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0302)		GATAACTCATCCTGTACTCAA	0.433																																					p.S715Y	Ovarian(124;554 1662 19430 21141 52494)	Atlas-SNP	.											.	ZFP28	99	.	0			c.C2144A						PASS	.						108.0	108.0	108.0					19																	57066298		2203	4300	6503	SO:0001583	missense	140612	exon8			ACTCATCCTGTAC		CCDS12946.1	19q13.43	2013-01-08	2012-11-27			ENSG00000196867		"""Zinc fingers, C2H2-type"", ""-"""	17801	protein-coding gene	gene with protein product			"""zinc finger protein 28 homolog (mouse)"""				Standard	NM_020828		Approved	KIAA1431, mkr5	uc002qnj.3	Q8NHY6		ENST00000301318.3:c.2144C>A	chr19.hg19:g.57066298C>A	ENSP00000301318:p.Ser715Tyr	129.0	0.0	.		130.0	45.0	.	NM_020828	A0JNV6|K7ES88|Q8NHU8|Q9BY30|Q9P2B6	Missense_Mutation	SNP	ENST00000301318.3	hg19	CCDS12946.1	.	.	.	.	.	.	.	.	.	.	C	0.336	-0.953021	0.02285	.	.	ENSG00000196867	ENST00000301318	T	0.36878	1.23	4.0	2.86	0.33363	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.44902	D	0.000413	T	0.22742	0.0549	L	0.35723	1.085	0.20074	N	0.999935	P	0.39181	0.663	B	0.37346	0.247	T	0.07481	-1.0770	10	0.17832	T	0.49	.	7.0155	0.24885	0.0:0.7197:0.1785:0.1018	.	715	Q8NHY6	ZFP28_HUMAN	Y	715	ENSP00000301318:S715Y	ENSP00000301318:S715Y	S	+	2	0	ZFP28	61758110	0.001000	0.12720	0.992000	0.48379	0.984000	0.73092	1.178000	0.31981	2.228000	0.72767	0.555000	0.69702	TCC	.	.	.	none		0.433	ZFP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458409.1	NM_020828	
NCOA6	23054	hgsc.bcm.edu	37	20	33329544	33329544	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr20:33329544T>C	ENST00000374796.2	-	12	7086	c.4516A>G	c.(4516-4518)Aaa>Gaa	p.K1506E	NCOA6_ENST00000359003.2_Missense_Mutation_p.K1506E			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	1506					brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						CCAGGGGGTTTAATTGTCACA	0.463																																					p.K1506E		Atlas-SNP	.											.	NCOA6	219	.	0			c.A4516G						PASS	.						78.0	70.0	73.0					20																	33329544		2203	4300	6503	SO:0001583	missense	23054	exon11			GGGGTTTAATTGT	AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.4516A>G	chr20.hg19:g.33329544T>C	ENSP00000363929:p.Lys1506Glu	132.0	0.0	.		107.0	43.0	.	NM_014071	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Missense_Mutation	SNP	ENST00000374796.2	hg19	CCDS13241.1	.	.	.	.	.	.	.	.	.	.	T	16.73	3.203458	0.58234	.	.	ENSG00000198646	ENST00000374796;ENST00000359003	T;T	0.34859	1.34;1.34	5.37	5.37	0.77165	.	0.000000	0.64402	D	0.000002	T	0.38852	0.1056	L	0.27053	0.805	0.39212	D	0.963341	D	0.60575	0.988	P	0.54759	0.76	T	0.16482	-1.0401	10	0.25106	T	0.35	-8.9946	15.5409	0.76048	0.0:0.0:0.0:1.0	.	1506	Q14686	NCOA6_HUMAN	E	1506	ENSP00000363929:K1506E;ENSP00000351894:K1506E	ENSP00000351894:K1506E	K	-	1	0	NCOA6	32793205	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	5.330000	0.65899	2.254000	0.74563	0.482000	0.46254	AAA	.	.	.	none		0.463	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078811.2	NM_014071	
SLC5A3	6526	hgsc.bcm.edu	37	21	35468362	35468362	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr21:35468362G>A	ENST00000381151.3	+	2	1377	c.865G>A	c.(865-867)Gcc>Acc	p.A289T	AP000320.7_ENST00000362077.4_RNA|MRPS6_ENST00000399312.2_Intron|SLC5A3_ENST00000608209.1_Missense_Mutation_p.A289T			P53794	SC5A3_HUMAN	solute carrier family 5 (sodium/myo-inositol cotransporter), member 3	289					inositol metabolic process (GO:0006020)|peripheral nervous system development (GO:0007422)|regulation of respiratory gaseous exchange (GO:0043576)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	myo-inositol:sodium symporter activity (GO:0005367)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	20						GGTCCTTGCAGCCAAAAACAT	0.478																																					p.A289T		Atlas-SNP	.											.	SLC5A3	52	.	0			c.G865A						PASS	.						102.0	98.0	100.0					21																	35468362		2203	4300	6503	SO:0001583	missense	6526	exon2			CTTGCAGCCAAAA		CCDS33549.1	21q22.11	2013-05-22	2008-09-02		ENSG00000198743	ENSG00000198743		"""Solute carriers"""	11038	protein-coding gene	gene with protein product		600444	"""solute carrier family 5 (inositol transporter), member 3"""			7789985	Standard	NM_006933		Approved	SMIT, SMIT1	uc002yto.3	P53794	OTTHUMG00000065821	ENST00000381151.3:c.865G>A	chr21.hg19:g.35468362G>A	ENSP00000370543:p.Ala289Thr	217.0	0.0	.		190.0	80.0	.	NM_006933	O43489	Missense_Mutation	SNP	ENST00000381151.3	hg19	CCDS33549.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.936080	0.73442	.	.	ENSG00000198743	ENST00000381151	D	0.88975	-2.45	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.96482	0.8852	H	0.96365	3.81	0.58432	D	0.999999	D	0.89917	1.0	D	0.79108	0.992	D	0.97583	1.0112	10	0.87932	D	0	.	18.2056	0.89853	0.0:0.0:1.0:0.0	.	289	P53794	SC5A3_HUMAN	T	289	ENSP00000370543:A289T	ENSP00000370543:A289T	A	+	1	0	SLC5A3	34390232	1.000000	0.71417	0.922000	0.36590	0.963000	0.63663	9.869000	0.99810	2.589000	0.87451	0.609000	0.83330	GCC	.	.	.	none		0.478	SLC5A3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000141037.1		
POTEH	23784	hgsc.bcm.edu	37	22	16287580	16287580	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr22:16287580G>T	ENST00000343518.6	-	1	357	c.306C>A	c.(304-306)tgC>tgA	p.C102*		NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	102										NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						AGCAGTGGCAGCACCACTTGC	0.597																																					p.C102X		Atlas-SNP	.											POTEH,caecum,carcinoma,0,1	POTEH	114	.	0			c.C306A						PASS	.						67.0	81.0	76.0					22																	16287580		1945	3669	5614	SO:0001587	stop_gained	23784	exon1			GTGGCAGCACCAC	AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.306C>A	chr22.hg19:g.16287580G>T	ENSP00000340610:p.Cys102*	1092.0	2.0	.		417.0	167.0	.	NM_001136213	A2CEK4|A6NCI1|A9Z1W0	Nonsense_Mutation	SNP	ENST00000343518.6	hg19	CCDS46658.1	.	.	.	.	.	.	.	.	.	.	.	13.12	2.143668	0.37825	.	.	ENSG00000198062	ENST00000343518;ENST00000355872	.	.	.	0.168	0.168	0.15012	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	.	.	.	.	.	.	.	X	102	.	ENSP00000340610:C102X	C	-	3	2	POTEH	14667580	0.005000	0.15991	0.025000	0.17156	0.026000	0.11368	0.263000	0.18478	0.278000	0.22164	0.283000	0.19423	TGC	.	.	.	none		0.597	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276918.4	NM_001136213	
CENPM	79019	hgsc.bcm.edu	37	22	42342456	42342456	+	Silent	SNP	C	C	G	rs372178394		TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr22:42342456C>G	ENST00000215980.5	-	2	189	c.102G>C	c.(100-102)tcG>tcC	p.S34S	CENPM_ENST00000402420.1_5'UTR|CENPM_ENST00000402338.1_5'UTR|CENPM_ENST00000407253.3_Silent_p.S34S|CENPM_ENST00000404067.1_5'UTR	NM_024053.3	NP_076958.1	Q9NSP4	CENPM_HUMAN	centromere protein M	34					mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)				kidney(1)|large_intestine(1)|prostate(1)	3						CTTTGAGCATCGAGTCCGCCA	0.647											OREG0026600	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S34S		Atlas-SNP	.											.	CENPM	8	.	0			c.G102C						PASS	.						36.0	31.0	33.0					22																	42342456		2203	4299	6502	SO:0001819	synonymous_variant	79019	exon2			GAGCATCGAGTCC	BC000705	CCDS14025.1, CCDS46719.1, CCDS46720.1	22q13.2	2013-11-05	2006-06-15	2006-06-15	ENSG00000100162	ENSG00000100162			18352	protein-coding gene	gene with protein product		610152	"""chromosome 22 open reading frame 18"""	C22orf18		16622420, 16622419	Standard	NM_001110215		Approved	Pane1, CENP-M, MGC861	uc003bbn.3	Q9NSP4	OTTHUMG00000151277	ENST00000215980.5:c.102G>C	chr22.hg19:g.42342456C>G		39.0	0.0	.	908	32.0	4.0	.	NM_024053	A7LM22|B1AHQ9|Q6I9W3	Silent	SNP	ENST00000215980.5	hg19	CCDS14025.1																																																																																			.	.	.	alt		0.647	CENPM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322058.1	NM_024053	
TAF1	6872	hgsc.bcm.edu	37	X	70643918	70643918	+	Splice_Site	SNP	T	T	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chrX:70643918T>C	ENST00000373790.4	+	31	4716		c.e31+2		TAF1_ENST00000423759.1_Splice_Site|TAF1_ENST00000461764.1_Splice_Site|TAF1_ENST00000449580.1_Splice_Site|TAF1_ENST00000276072.3_Splice_Site	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa						cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				ATACGTAAGGTGAGTGAGTGA	0.373																																					.		Atlas-SNP	.											.	TAF1	439	.	0			c.4728+2T>C						PASS	.						133.0	107.0	116.0					X																	70643918		2203	4300	6503	SO:0001630	splice_region_variant	6872	exon31			GTAAGGTGAGTGA		CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.4665+2T>C	chrX.hg19:g.70643918T>C		73.0	0.0	.		65.0	49.0	.	NM_004606	A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Splice_Site	SNP	ENST00000373790.4	hg19	CCDS35325.1	.	.	.	.	.	.	.	.	.	.	T	16.92	3.255554	0.59321	.	.	ENSG00000147133	ENST00000373790;ENST00000449580;ENST00000423759;ENST00000395779;ENST00000538124;ENST00000276072;ENST00000437147	.	.	.	4.85	4.85	0.62838	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8076	0.63243	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	TAF1	70560643	1.000000	0.71417	0.992000	0.48379	0.831000	0.47069	7.412000	0.80091	1.704000	0.51252	0.486000	0.48141	.	.	.	.	none		0.373	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058995.2	NM_004606	Intron
TENM1	10178	hgsc.bcm.edu	37	X	123518587	123518587	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chrX:123518587G>C	ENST00000371130.3	-	29	6236	c.6173C>G	c.(6172-6174)aCc>aGc	p.T2058S	STAG2_ENST00000469481.1_Intron|TENM1_ENST00000422452.2_Missense_Mutation_p.T2065S	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	2058					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										AGGCAAAGGGGTTTCATTGAT	0.393																																					p.T2065S		Atlas-SNP	.											.	.	.	.	0			c.C6194G						PASS	.						125.0	106.0	112.0					X																	123518587		2203	4300	6503	SO:0001583	missense	10178	exon30			AAAGGGGTTTCAT	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.6173C>G	chrX.hg19:g.123518587G>C	ENSP00000360171:p.Thr2058Ser	117.0	0.0	.		97.0	81.0	.	NM_001163278	B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	hg19	CCDS14609.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.184284	0.78677	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.86097	-2.07;-2.03	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	D	0.90992	0.7167	M	0.62723	1.935	0.80722	D	1	D;D;D	0.76494	0.997;0.999;0.999	D;D;D	0.70716	0.97;0.918;0.937	D	0.90198	0.4255	10	0.39692	T	0.17	.	18.3227	0.90244	0.0:0.0:1.0:0.0	.	2064;2065;2058	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	S	2058;2065	ENSP00000360171:T2058S;ENSP00000403954:T2065S	ENSP00000360171:T2058S	T	-	2	0	ODZ1	123346268	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.964000	0.87933	2.265000	0.75225	0.600000	0.82982	ACC	.	.	.	none		0.393	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253	
WDR33	55339	hgsc.bcm.edu	37	2	128484249	128484249	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr2:128484249delT	ENST00000322313.4	-	8	985	c.827delA	c.(826-828)aagfs	p.K276fs		NM_018383.4	NP_060853.3	Q9C0J8	WDR33_HUMAN	WD repeat domain 33	276					mRNA processing (GO:0006397)|postreplication repair (GO:0006301)|spermatogenesis (GO:0007283)	collagen trimer (GO:0005581)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		CTGCCCAGTCTTGGGATCCCA	0.468																																					p.K276fs		Atlas-INDEL	.											.	WDR33	136	.	0			c.828delG						PASS	.						154.0	153.0	153.0					2																	128484249		2203	4300	6503	SO:0001589	frameshift_variant	55339	exon8			.		CCDS2150.1, CCDS42746.1, CCDS46407.1	2q21.1	2013-01-09			ENSG00000136709	ENSG00000136709		"""WD repeat domain containing"""	25651	protein-coding gene	gene with protein product						11162572	Standard	NM_001006622		Approved	FLJ11294, WDC146, NET14	uc002tpg.2	Q9C0J8	OTTHUMG00000131534	ENST00000322313.4:c.827delA	chr2.hg19:g.128484249delT	ENSP00000325377:p.Lys276fs	130.0	0.0	0		136.0	38.0	0.279412	NM_018383	Q05DP8|Q53FG9|Q587J1|Q69YF7|Q6NUQ0|Q9NUL1	Frame_Shift_Del	DEL	ENST00000322313.4	hg19	CCDS2150.1																																																																																			.	.	.	none		0.468	WDR33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331141.2	NM_018383	
SMARCB1	6598	hgsc.bcm.edu	37	22	24167461	24167461	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr22:24167461delA	ENST00000263121.7	+	7	1041	c.845delA	c.(844-846)gacfs	p.D282fs	SMARCB1_ENST00000407422.3_Frame_Shift_Del_p.D273fs|SMARCB1_ENST00000407082.3_Frame_Shift_Del_p.D236fs|SMARCB1_ENST00000477836.1_3'UTR|SMARCB1_ENST00000344921.6_Frame_Shift_Del_p.D291fs	NM_003073.3	NP_003064.2	Q12824	SNF5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1	282	2 X approximate tandem repeats.				ATP-dependent chromatin remodeling (GO:0043044)|blastocyst hatching (GO:0001835)|cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|DNA integration (GO:0015074)|DNA repair (GO:0006281)|mitotic cell cycle phase transition (GO:0044772)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	p53 binding (GO:0002039)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)	p.?(6)|p.L266_*386del(1)		bone(4)|central_nervous_system(198)|endometrium(4)|haematopoietic_and_lymphoid_tissue(25)|kidney(3)|large_intestine(5)|liver(2)|lung(5)|meninges(5)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|soft_tissue(194)	458		Medulloblastoma(6;2.2e-09)|all_neural(6;2.73e-05)				TTTGAGTGGGACATGTCAGAG	0.537			"""D, N, F, S"""		malignant rhabdoid	malignant rhabdoid																															p.D282fs		Atlas-INDEL	.	yes	Rec	yes	Rhabdoid predisposition syndrome	22	22q11	6598	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1"""		M	.	SMARCB1	586	.	7	Unknown(6)|Deletion - In frame(1)	central_nervous_system(6)|soft_tissue(1)	c.844delG						PASS	.						126.0	101.0	110.0					22																	24167461		2203	4300	6503	SO:0001589	frameshift_variant	6598	exon7			.	U04847	CCDS13817.1, CCDS46671.1	22q11.23	2014-09-17			ENSG00000099956	ENSG00000099956			11103	protein-coding gene	gene with protein product	"""sucrose nonfermenting, yeast, homolog-like 1"", ""integrase interactor 1"", ""malignant rhabdoid tumor suppressor"", ""protein phosphatase 1, regulatory subunit 144"""	601607		SNF5L1		7801128, 10319872, 10365963	Standard	NM_003073		Approved	BAF47, Ini1, Snr1, hSNFS, Sfh1p, RDT, PPP1R144	uc002zyb.3	Q12824	OTTHUMG00000150737	ENST00000263121.7:c.845delA	chr22.hg19:g.24167461delA	ENSP00000263121:p.Asp282fs	92.0	0.0	0		75.0	57.0	0.76	NM_003073	O75784|O95474|Q17S11|Q38GA1|Q76N08|Q9UBH2	Frame_Shift_Del	DEL	ENST00000263121.7	hg19	CCDS13817.1																																																																																			.	.	.	none		0.537	SMARCB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319872.1	NM_003073	
TRIM41	90933	hgsc.bcm.edu	37	5	180661231	180661232	+	Frame_Shift_Ins	INS	-	-	C	rs138245799		TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr5:180661231_180661232insC	ENST00000315073.5	+	6	2059_2060	c.1349_1350insC	c.(1348-1353)cgccggfs	p.R451fs	TRIM41_ENST00000351937.5_Frame_Shift_Ins_p.R451fs|TRIM41_ENST00000510072.1_3'UTR	NM_033549.4	NP_291027.3	Q8WV44	TRI41_HUMAN	tripartite motif containing 41	451	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(3)|prostate(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	26	all_cancers(89;9.17e-06)|all_epithelial(37;1.19e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000209)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCCCCTGACCGCCGGGGGGTCC	0.698																																					p.R450fs		Atlas-INDEL	.											.	TRIM41	96	.	0			c.1349_1350insC						PASS	.																																			SO:0001589	frameshift_variant	90933	exon6			.	AF258579	CCDS4465.1, CCDS4466.1	5q35.3	2013-01-09	2011-01-25		ENSG00000146063	ENSG00000146063		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19013	protein-coding gene	gene with protein product	"""RING-finger protein that interacts with C kinase"""	610530	"""tripartite motif-containing 41"""			16022281	Standard	NM_033549		Approved	MGC1127, RINCK	uc003mne.2	Q8WV44	OTTHUMG00000130965	ENST00000315073.5:c.1351dupC	chr5.hg19:g.180661233_180661233dupC	ENSP00000320869:p.Arg451fs	121.0	0.0	0		104.0	38.0	0.365385	NM_033549	B3KNJ6|D3DWR9|Q5BKT0|Q7L484|Q96Q10|Q9BSL8	Frame_Shift_Ins	INS	ENST00000315073.5	hg19	CCDS4466.1																																																																																			.	.	.	none		0.698	TRIM41-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253574.3	NM_201627	
ERCC5	2073	hgsc.bcm.edu	37	13	103510748	103510748	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr13:103510748delT	ENST00000355739.4	+	6	2075	c.652delT	c.(652-654)ttafs	p.L218fs	BIVM-ERCC5_ENST00000602836.1_Frame_Shift_Del_p.I644fs|ERCC5_ENST00000535557.1_Frame_Shift_Del_p.L218fs	NM_000123.3	NP_000114	P28715	ERCC5_HUMAN	excision repair cross-complementation group 5	218					DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|response to UV (GO:0009411)|response to UV-C (GO:0010225)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	bubble DNA binding (GO:0000405)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	51	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					CAGAAGAACATTATTTGAAGC	0.373			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.T671fs		Atlas-INDEL	.	yes	Rec		Xeroderma pigmentosum (G)	13	13q33	2073	"""excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome))"""		E	.	.	.	.	0			c.2013delA						PASS	.						96.0	99.0	98.0					13																	103510748		2203	4300	6503	SO:0001589	frameshift_variant	0	exon14	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	.	X71342	CCDS32004.1	13q22-q34	2014-09-17	2014-03-07		ENSG00000134899	ENSG00000134899			3437	protein-coding gene	gene with protein product	"""Cockayne syndrome"""	133530	"""xeroderma pigmentosum, complementation group G"", ""excision repair cross-complementing rodent repair deficiency, complementation group 5"""	ERCM2, XPGC		8088806	Standard	NM_000123		Approved			P28715	OTTHUMG00000017310	ENST00000355739.4:c.652delT	chr13.hg19:g.103510748delT	ENSP00000347978:p.Leu218fs	132.0	0.0	0		144.0	51.0	0.354167	NM_001204425	A6NGT4|Q5JUS4|Q5JUS5|Q7Z2V3|Q8IZL6|Q8N1B7|Q9HD59|Q9HD60	Frame_Shift_Del	DEL	ENST00000355739.4	hg19	CCDS32004.1																																																																																			.	.	.	none		0.373	ERCC5-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045708.1		
SPEF2	79925	hgsc.bcm.edu	37	5	35771741	35771743	+	In_Frame_Del	DEL	GAA	GAA	-			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	GAA	GAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr5:35771741_35771743delGAA	ENST00000356031.3	+	27	3986_3988	c.3832_3834delGAA	c.(3832-3834)gaadel	p.E1280del	CTD-2113L7.1_ENST00000510433.1_RNA|SPEF2_ENST00000440995.2_In_Frame_Del_p.E1275del	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	1280					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GAGGCTTATGGAAGAAGAAAAAG	0.399																																					p.1277_1278del		Atlas-INDEL	.											.	SPEF2	324	.	0			c.3831_3833del						PASS	.																																			SO:0001651	inframe_deletion	79925	exon27			.	AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.3832_3834delGAA	chr5.hg19:g.35771747_35771749delGAA	ENSP00000348314:p.Glu1280del	54.0	0.0	0		58.0	12.0	0.206897	NM_024867	Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	In_Frame_Del	DEL	ENST00000356031.3	hg19	CCDS43309.1																																																																																			.	.	.	none		0.399	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	NM_144722	
IFNA2	3440	hgsc.bcm.edu	37	9	21385064	21385067	+	Frame_Shift_Del	DEL	GATT	GATT	-			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	GATT	GATT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr9:21385064_21385067delGATT	ENST00000380206.2	-	1	329_332	c.262_265delAATC	c.(262-267)aatctcfs	p.NL88fs		NM_000605.3	NP_000596.2	P01563	IFNA2_HUMAN	interferon, alpha 2	88					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of gene expression (GO:0010629)|negative regulation of interleukin-13 secretion (GO:2000666)|negative regulation of interleukin-5 secretion (GO:2000663)|negative regulation of T cell differentiation (GO:0045581)|negative regulation of T-helper 2 cell cytokine production (GO:2000552)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral entry into host cell (GO:0046597)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	type I interferon receptor binding (GO:0005132)			breast(2)|large_intestine(4)|lung(6)|upper_aerodigestive_tract(1)	13				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.0173)		GTGCTGAAGAGATTGAAGATCTGC	0.49																																					p.88_89del		Atlas-INDEL	.											.	IFNA2	32	.	0			c.263_266del						PASS	.																																			SO:0001589	frameshift_variant	3440	exon1			.		CCDS6506.1	9p22	2010-08-24			ENSG00000188379	ENSG00000188379		"""Interferons"""	5423	protein-coding gene	gene with protein product	"""alpha-2a interferon"", ""interferon alpha 2b"", ""interferon alpha A"""	147562				1385305	Standard	NM_000605		Approved	IFNA, IFN-alphaA	uc003zpb.3	P01563	OTTHUMG00000019674	ENST00000380206.2:c.262_265delAATC	chr9.hg19:g.21385064_21385067delGATT	ENSP00000369554:p.Asn88fs	216.0	0.0	0		215.0	87.0	0.404651	NM_000605	H2DF54|H2DF55|P01564|Q14606|Q6DJX8|Q96KI6	Frame_Shift_Del	DEL	ENST00000380206.2	hg19	CCDS6506.1																																																																																			.	.	.	none		0.490	IFNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051903.1	NM_000605	
