#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CHD5	26038	hgsc.bcm.edu	37	1	6204188	6204188	+	Silent	SNP	G	G	A			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr1:6204188G>A	ENST00000262450.3	-	12	1929	c.1830C>T	c.(1828-1830)taC>taT	p.Y610Y	CHD5_ENST00000378021.1_5'UTR	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		ACTTGATCAGGTAGTGCACAT	0.567																																					p.Y610Y		Atlas-SNP	.											.	CHD5	267	.	0			c.C1830T						PASS	.						245.0	196.0	213.0					1																	6204188		2203	4300	6503	SO:0001819	synonymous_variant	26038	exon12			GATCAGGTAGTGC	AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.1830C>T	chr1.hg19:g.6204188G>A		187.0	0.0	.		169.0	82.0	.	NM_015557	A8KAP8|A8MQ44|D3DSH9|O60740	Silent	SNP	ENST00000262450.3	hg19	CCDS57.1																																																																																			.	.	.	none		0.567	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002823.2	NM_015557	
ARID1A	8289	hgsc.bcm.edu	37	1	27057775	27057775	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr1:27057775C>T	ENST00000324856.7	+	3	1854	c.1483C>T	c.(1483-1485)Cat>Tat	p.H495Y	ARID1A_ENST00000374152.2_Missense_Mutation_p.H112Y|ARID1A_ENST00000457599.2_Missense_Mutation_p.H495Y	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	495					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		CCAGACCCCTCATGCCCAACC	0.582			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.H495Y		Atlas-SNP	.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	ARID1A	842	.	0			c.C1483T						PASS	.						347.0	315.0	326.0					1																	27057775		2203	4300	6503	SO:0001583	missense	8289	exon3			ACCCCTCATGCCC	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.1483C>T	chr1.hg19:g.27057775C>T	ENSP00000320485:p.His495Tyr	443.0	0.0	.		446.0	61.0	.	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Missense_Mutation	SNP	ENST00000324856.7	hg19	CCDS285.1	.	.	.	.	.	.	.	.	.	.	C	12.43	1.935864	0.34189	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000524572;ENST00000374152	T;T;T;T	0.43688	4.5;4.28;0.94;4.29	5.33	5.33	0.75918	.	0.344170	0.34046	N	0.004318	T	0.22437	0.0541	N	0.08118	0	0.80722	D	1	B;B;B	0.29988	0.068;0.264;0.068	B;B;B	0.24701	0.014;0.055;0.014	T	0.12993	-1.0526	10	0.02654	T	1	-11.5851	19.2116	0.93757	0.0:1.0:0.0:0.0	.	495;495;149	O14497;O14497-2;Q4LE49	ARI1A_HUMAN;.;.	Y	495;495;112;112	ENSP00000320485:H495Y;ENSP00000387636:H495Y;ENSP00000432473:H112Y;ENSP00000363267:H112Y	ENSP00000320485:H495Y	H	+	1	0	ARID1A	26930362	1.000000	0.71417	1.000000	0.80357	0.678000	0.39670	3.260000	0.51523	2.766000	0.95052	0.655000	0.94253	CAT	.	.	.	none		0.582	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
C1orf177	163747	hgsc.bcm.edu	37	1	55272686	55272686	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr1:55272686T>C	ENST00000371273.3	+	2	137	c.122T>C	c.(121-123)gTt>gCt	p.V41A	C1orf177_ENST00000358193.3_Missense_Mutation_p.V41A	NM_001110533.1	NP_001104003	Q3ZCV2	CA177_HUMAN	chromosome 1 open reading frame 177	41										breast(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(6)|prostate(2)	17						ATCTCTGCTGTTTATCCCAAC	0.582																																					p.V41A		Atlas-SNP	.											.	C1orf177	36	.	0			c.T122C						PASS	.						230.0	214.0	219.0					1																	55272686		2203	4300	6503	SO:0001583	missense	163747	exon2			CTGCTGTTTATCC	AK097520	CCDS599.1, CCDS44153.1	1p32.3	2012-07-25			ENSG00000162398	ENSG00000162398			26854	protein-coding gene	gene with protein product							Standard	NM_152607		Approved	FLJ40201	uc001cyb.4	Q3ZCV2	OTTHUMG00000009986	ENST00000371273.3:c.122T>C	chr1.hg19:g.55272686T>C	ENSP00000360320:p.Val41Ala	304.0	0.0	.		240.0	97.0	.	NM_001110533	B7WPL2|Q8N7Y9	Missense_Mutation	SNP	ENST00000371273.3	hg19	CCDS44153.1	.	.	.	.	.	.	.	.	.	.	T	13.45	2.241605	0.39598	.	.	ENSG00000162398	ENST00000358193;ENST00000371273	T;T	0.26518	1.73;1.73	3.72	3.72	0.42706	.	0.129282	0.31821	N	0.007008	T	0.36138	0.0956	L	0.59436	1.845	0.36448	D	0.865922	D;D	0.56035	0.974;0.974	P;P	0.54499	0.754;0.754	T	0.43589	-0.9382	10	0.48119	T	0.1	-2.4596	10.7545	0.46228	0.0:0.0:0.0:1.0	.	41;41	Q3ZCV2;Q3ZCV2-2	CA177_HUMAN;.	A	41	ENSP00000350924:V41A;ENSP00000360320:V41A	ENSP00000350924:V41A	V	+	2	0	C1orf177	55045274	0.977000	0.34250	0.832000	0.32986	0.687000	0.40016	2.492000	0.45311	1.929000	0.55896	0.379000	0.24179	GTT	.	.	.	none		0.582	C1orf177-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000027674.1	NM_152607	
L1TD1	54596	hgsc.bcm.edu	37	1	62672679	62672679	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr1:62672679G>C	ENST00000498273.1	+	3	674	c.379G>C	c.(379-381)Ggt>Cgt	p.G127R		NM_001164835.1|NM_019079.4	NP_001158307.1|NP_061952.3	Q5T7N2	LITD1_HUMAN	LINE-1 type transposase domain containing 1	127										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	35						ctctaaaataggtgatgataa	0.308																																					p.G127R		Atlas-SNP	.											.	L1TD1	114	.	0			c.G379C						PASS	.						59.0	70.0	66.0					1																	62672679		2194	4294	6488	SO:0001583	missense	54596	exon4			AAAATAGGTGATG	BC060808	CCDS619.1	1p31.3	2009-01-12			ENSG00000240563	ENSG00000240563			25595	protein-coding gene	gene with protein product						12477932	Standard	NM_001164835		Approved	FLJ10884, ECAT11	uc001dae.4	Q5T7N2	OTTHUMG00000008914	ENST00000498273.1:c.379G>C	chr1.hg19:g.62672679G>C	ENSP00000419901:p.Gly127Arg	118.0	0.0	.		96.0	46.0	.	NM_001164835	Q8NDA1|Q9NUV8|Q9NV78	Missense_Mutation	SNP	ENST00000498273.1	hg19	CCDS619.1	.	.	.	.	.	.	.	.	.	.	G	6.882	0.532168	0.13127	.	.	ENSG00000240563	ENST00000498273	T	0.11277	2.79	2.07	1.1	0.20463	.	.	.	.	.	T	0.06142	0.0159	N	0.14661	0.345	0.09310	N	1	B	0.27594	0.182	B	0.25291	0.059	T	0.36504	-0.9745	9	0.54805	T	0.06	.	6.423	0.21754	0.0:0.3091:0.6909:0.0	.	127	Q5T7N2	LITD1_HUMAN	R	127	ENSP00000419901:G127R	ENSP00000419901:G127R	G	+	1	0	L1TD1	62445267	0.034000	0.19679	0.001000	0.08648	0.024000	0.10985	1.838000	0.39211	0.419000	0.25927	0.313000	0.20887	GGT	.	.	.	none		0.308	L1TD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024688.1	NM_019079	
VANGL1	81839	hgsc.bcm.edu	37	1	116202267	116202267	+	Missense_Mutation	SNP	G	G	C	rs143990097		TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr1:116202267G>C	ENST00000355485.2	+	3	348	c.77G>C	c.(76-78)aGa>aCa	p.R26T	VANGL1_ENST00000369510.4_Missense_Mutation_p.R26T|VANGL1_ENST00000310260.3_Missense_Mutation_p.R26T|VANGL1_ENST00000369509.1_Missense_Mutation_p.R26T	NM_001172411.1|NM_138959.2	NP_001165882.1|NP_620409.1	Q8TAA9	VANG1_HUMAN	VANGL planar cell polarity protein 1	26					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|liver(2)|lung(13)|urinary_tract(1)	27	Lung SC(450;0.211)	all_cancers(81;1.24e-06)|all_epithelial(167;1.02e-06)|all_lung(203;7.95e-06)|Lung NSC(69;4.97e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		TTCAGGGAAAGAACTAGAGAG	0.413																																					p.R26T		Atlas-SNP	.											.	VANGL1	65	.	0			c.G77C						PASS	.						127.0	138.0	134.0					1																	116202267		2203	4300	6503	SO:0001583	missense	81839	exon3			GGGAAAGAACTAG	AB075805	CCDS883.1, CCDS53350.1	1p13.1	2013-03-05	2013-03-05		ENSG00000173218	ENSG00000173218			15512	protein-coding gene	gene with protein product		610132	"""vang (van gogh, Drosophila)-like 1, vang, van gogh-like 1 (Drosophila)"", ""vang-like 1 (van gogh, Drosophila)"""			11956595, 12011995	Standard	NM_001172411		Approved	STB2	uc001efv.1	Q8TAA9	OTTHUMG00000011971	ENST00000355485.2:c.77G>C	chr1.hg19:g.116202267G>C	ENSP00000347672:p.Arg26Thr	199.0	0.0	.		207.0	9.0	.	NM_001172411	Q5T1D3|Q5T1D4|Q86WG8|Q8N559	Missense_Mutation	SNP	ENST00000355485.2	hg19	CCDS883.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.572304	0.86542	.	.	ENSG00000173218	ENST00000355485;ENST00000369510;ENST00000310260;ENST00000369509	D;D;D;D	0.86297	-2.1;-2.1;-2.1;-2.1	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	D	0.88381	0.6421	M	0.70595	2.14	0.58432	D	0.999999	P;P	0.48998	0.9;0.918	P;P	0.50378	0.506;0.639	D	0.89451	0.3730	10	0.62326	D	0.03	-9.9475	17.453	0.87597	0.0:0.0:1.0:0.0	.	26;26	Q8TAA9-2;Q8TAA9	.;VANG1_HUMAN	T	26	ENSP00000347672:R26T;ENSP00000358523:R26T;ENSP00000310800:R26T;ENSP00000358522:R26T	ENSP00000310800:R26T	R	+	2	0	VANGL1	116003790	1.000000	0.71417	0.995000	0.50966	0.934000	0.57294	7.940000	0.87693	2.561000	0.86390	0.563000	0.77884	AGA	.	G|1.000;A|0.000	.	alt		0.413	VANGL1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000033096.1		
NTRK1	4914	hgsc.bcm.edu	37	1	156849153	156849153	+	Splice_Site	SNP	G	G	A			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr1:156849153G>A	ENST00000524377.1	+	15	2086	c.2045G>A	c.(2044-2046)cGt>cAt	p.R682H	NTRK1_ENST00000358660.3_Splice_Site_p.R679H|NTRK1_ENST00000368196.3_Splice_Site_p.R676H|NTRK1_ENST00000392302.2_Splice_Site_p.R646H	NM_002529.3	NP_002520.2	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	682	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|axon guidance (GO:0007411)|axonogenesis involved in innervation (GO:0060385)|B cell differentiation (GO:0030183)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to nicotine (GO:0071316)|circadian rhythm (GO:0007623)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|developmental programmed cell death (GO:0010623)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory nerve development (GO:0021553)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to hydrostatic pressure (GO:0051599)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|Sertoli cell development (GO:0060009)|small GTPase mediated signal transduction (GO:0007264)|sympathetic nervous system development (GO:0048485)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome (GO:0005769)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(35)|ovary(8)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	74	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Amitriptyline(DB00321)|Imatinib(DB00619)|Regorafenib(DB08896)	GACTATTACCGTGTAAGGGTC	0.562			T	"""TPM3, TPR, TFG"""	papillary thyroid					TSP Lung(10;0.080)																											p.R682H		Atlas-SNP	.		Dom	yes		1	1q21-q22	4914	"""neurotrophic tyrosine kinase, receptor, type 1"""		E	.	NTRK1	287	.	0			c.G2045A						PASS	.						84.0	75.0	78.0					1																	156849153		2203	4300	6503	SO:0001630	splice_region_variant	4914	exon15			ATTACCGTGTAAG	Y09028	CCDS1161.1, CCDS30890.1, CCDS30891.1	1q21-q22	2014-09-17			ENSG00000198400	ENSG00000198400	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8031	protein-coding gene	gene with protein product	"""high affinity nerve growth factor receptor"""	191315				2869410	Standard	NM_001007792		Approved	TRK, TRKA, MTC	uc001fqh.1	P04629	OTTHUMG00000041304	ENST00000524377.1:c.2046+1G>A	chr1.hg19:g.156849153G>A		74.0	0.0	.		79.0	42.0	.	NM_002529	B2R6T5|B7ZM34|P08119|Q15655|Q15656|Q5D056|Q5VZS2|Q7Z5C3|Q9UIU7	Missense_Mutation	SNP	ENST00000524377.1	hg19	CCDS1161.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.953656	0.73902	.	.	ENSG00000198400	ENST00000392302;ENST00000368196;ENST00000524377;ENST00000358660	D;D;D;D	0.83163	-1.69;-1.69;-1.69;-1.69	4.13	4.13	0.48395	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Tyrosine-protein kinase, receptor class II, conserved site (1);Protein kinase, catalytic domain (1);	0.000000	0.45126	D	0.000390	D	0.86764	0.6011	L	0.56280	1.765	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.997;0.987;0.938;0.99	D	0.88394	0.3010	10	0.87932	D	0	.	15.4596	0.75342	0.0:0.0:1.0:0.0	.	679;676;682;646	A8K3Z4;P04629-2;P04629;A6NF12	.;.;NTRK1_HUMAN;.	H	646;676;682;679	ENSP00000376120:R646H;ENSP00000357179:R676H;ENSP00000431418:R682H;ENSP00000351486:R679H	ENSP00000351486:R679H	R	+	2	0	NTRK1	155115777	1.000000	0.71417	0.930000	0.37139	0.719000	0.41307	7.703000	0.84585	2.315000	0.78130	0.561000	0.74099	CGT	.	.	.	none		0.562	NTRK1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392279.1	NM_002529	Missense_Mutation
GLRX2	51022	hgsc.bcm.edu	37	1	193074704	193074704	+	5'Flank	SNP	G	G	A			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr1:193074704G>A	ENST00000367439.3	-	0	0				GLRX2_ENST00000367440.3_Missense_Mutation_p.A22V|GLRX2_ENST00000472197.1_Intron	NM_197962.2	NP_932066.1	Q9NS18	GLRX2_HUMAN	glutaredoxin 2						apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|DNA protection (GO:0042262)|glutathione metabolic process (GO:0006749)|protein folding (GO:0006457)|regulation of signal transduction (GO:0009966)|regulation of transcription, DNA-templated (GO:0006355)|response to hydrogen peroxide (GO:0042542)|response to organic substance (GO:0010033)|response to redox state (GO:0051775)|response to temperature stimulus (GO:0009266)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	2 iron, 2 sulfur cluster binding (GO:0051537)|arsenate reductase (glutaredoxin) activity (GO:0008794)|electron carrier activity (GO:0009055)|glutathione disulfide oxidoreductase activity (GO:0015038)|metal ion binding (GO:0046872)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)			breast(1)|large_intestine(1)|lung(3)	5					Glutathione(DB00143)	TCCAGCGAGTGCCACCCACGT	0.652																																					p.A22V		Atlas-SNP	.											.	GLRX2	9	.	0			c.C65T						PASS	.						41.0	44.0	43.0					1																	193074704		2203	4300	6503	SO:0001631	upstream_gene_variant	51022	exon1			GCGAGTGCCACCC	AF132495	CCDS1380.1, CCDS1381.1	1q31.2	2012-09-20			ENSG00000023572	ENSG00000023572			16065	protein-coding gene	gene with protein product	"""bA101E13.1 (GRX2 glutaredoxin (thioltransferase) 2)"""	606820				11297543	Standard	NM_016066		Approved	GRX2, bA101E13.1	uc001gsz.2	Q9NS18	OTTHUMG00000035677		chr1.hg19:g.193074704G>A	Exception_encountered	33.0	0.0	.		31.0	14.0	.	NM_016066	Q3LR69|Q7L1N7|Q96JC0|Q9Y3D4	Missense_Mutation	SNP	ENST00000367439.3	hg19	CCDS1381.1	.	.	.	.	.	.	.	.	.	.	G	9.608	1.130447	0.21041	.	.	ENSG00000023572	ENST00000367440	T	0.35236	1.32	2.13	-4.26	0.03755	.	595.624000	0.00166	N	0.000000	T	0.23171	0.0560	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.11421	-1.0588	9	0.33940	T	0.23	2.0784	2.9471	0.05849	0.1273:0.3676:0.3584:0.1468	.	22	Q9NS18-2	.	V	22	ENSP00000356410:A22V	ENSP00000356410:A22V	A	-	2	0	GLRX2	191341327	0.000000	0.05858	0.000000	0.03702	0.082000	0.17680	-1.156000	0.03160	-3.466000	0.00158	-0.687000	0.03738	GCA	.	.	.	none		0.652	GLRX2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000086699.1	NM_016066	
NEK7	140609	hgsc.bcm.edu	37	1	198266319	198266319	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr1:198266319G>C	ENST00000367385.4	+	9	1089	c.747G>C	c.(745-747)aaG>aaC	p.K249N	NEK7_ENST00000538004.1_Missense_Mutation_p.K249N	NM_133494.2	NP_598001.1	Q8TDX7	NEK7_HUMAN	NIMA-related kinase 7	249	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokinesis (GO:0000910)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle (GO:0007346)|spindle assembly (GO:0051225)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			endometrium(3)|kidney(2)|large_intestine(5)|lung(2)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	21						TGTGTAAGAAGATAGAACAGT	0.378																																					p.K249N		Atlas-SNP	.											.	NEK7	42	.	0			c.G747C						PASS	.						150.0	150.0	150.0					1																	198266319		2203	4300	6503	SO:0001583	missense	140609	exon9			TAAGAAGATAGAA	AB062450	CCDS1394.1	1q31.3	2012-11-15	2012-11-15		ENSG00000151414	ENSG00000151414			13386	protein-coding gene	gene with protein product		606848	"""NIMA (never in mitosis gene a)-related kinase 7"""			11701951	Standard	NM_133494		Approved		uc001gun.4	Q8TDX7	OTTHUMG00000035658	ENST00000367385.4:c.747G>C	chr1.hg19:g.198266319G>C	ENSP00000356355:p.Lys249Asn	206.0	0.0	.		188.0	84.0	.	NM_133494	A6NGT8	Missense_Mutation	SNP	ENST00000367385.4	hg19	CCDS1394.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.279186	0.80692	.	.	ENSG00000151414	ENST00000367385;ENST00000538004	T;T	0.66460	-0.21;-0.21	5.98	5.06	0.68205	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.69700	0.3140	L	0.42744	1.35	0.80722	D	1	P	0.39737	0.685	P	0.50049	0.629	T	0.70777	-0.4780	10	0.59425	D	0.04	.	14.6335	0.68673	0.0693:0.0:0.9307:0.0	.	249	Q8TDX7	NEK7_HUMAN	N	249	ENSP00000356355:K249N;ENSP00000444621:K249N	ENSP00000356355:K249N	K	+	3	2	NEK7	196532942	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.580000	0.60942	2.838000	0.97847	0.655000	0.94253	AAG	.	.	.	none		0.378	NEK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086550.2	NM_133494	
GDF7	151449	hgsc.bcm.edu	37	2	20871056	20871056	+	Silent	SNP	C	C	T	rs376857749		TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr2:20871056C>T	ENST00000272224.3	+	2	1800	c.1224C>T	c.(1222-1224)gaC>gaT	p.D408D		NM_182828.2	NP_878248.2	Q7Z4P5	GDF7_HUMAN	growth differentiation factor 7	408					activin receptor signaling pathway (GO:0032924)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|branching morphogenesis of an epithelial tube (GO:0048754)|cell fate commitment (GO:0045165)|epithelial cell differentiation (GO:0030855)|forebrain morphogenesis (GO:0048853)|gland morphogenesis (GO:0022612)|growth (GO:0040007)|midbrain development (GO:0030901)|morphogenesis of an epithelial fold (GO:0060571)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of tendon cell differentiation (GO:2001051)|positive regulation of transcription, DNA-templated (GO:0045893)|reproductive structure development (GO:0048608)|roof plate formation (GO:0021509)|spinal cord association neuron differentiation (GO:0021527)	extracellular space (GO:0005615)				breast(1)|cervix(1)|endometrium(2)|lung(1)|prostate(1)|skin(1)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGGCACCAGACGCGGCGCCGG	0.612																																					p.D408D		Atlas-SNP	.											.	GDF7	21	.	0			c.C1224T						PASS	.						69.0	60.0	63.0					2																	20871056		2203	4300	6503	SO:0001819	synonymous_variant	151449	exon2			ACCAGACGCGGCG	AF522369	CCDS1701.1	2p24.1	2008-05-22			ENSG00000143869	ENSG00000143869			4222	protein-coding gene	gene with protein product		604651				10022976, 9808626	Standard	NM_182828		Approved	BMP12	uc002rdz.1	Q7Z4P5	OTTHUMG00000090781	ENST00000272224.3:c.1224C>T	chr2.hg19:g.20871056C>T		39.0	0.0	.		15.0	11.0	.	NM_182828		Silent	SNP	ENST00000272224.3	hg19	CCDS1701.1																																																																																			.	.	.	alt		0.612	GDF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207563.2	NM_182828	
HTRA2	27429	hgsc.bcm.edu	37	2	74756587	74756587	+	5'UTR	SNP	G	G	C	rs376231592		TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr2:74756587G>C	ENST00000258080.3	+	0	84				AUP1_ENST00000377526.3_Silent_p.L30L|HTRA2_ENST00000352222.3_5'Flank	NM_013247.4	NP_037379.1	O43464	HTRA2_HUMAN	HtrA serine peptidase 2						adult walking behavior (GO:0007628)|cellular protein catabolic process (GO:0044257)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to interferon-beta (GO:0035458)|cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|ceramide metabolic process (GO:0006672)|execution phase of apoptosis (GO:0097194)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitochondrion organization (GO:0007005)|negative regulation of cell cycle (GO:0045786)|negative regulation of neuron death (GO:1901215)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|neuron development (GO:0048666)|pentacyclic triterpenoid metabolic process (GO:0019742)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell death (GO:0010942)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001269)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|regulation of mitochondrion degradation (GO:1903146)|regulation of multicellular organism growth (GO:0040014)|response to herbicide (GO:0009635)	CD40 receptor complex (GO:0035631)|chromatin (GO:0000785)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)|unfolded protein binding (GO:0051082)			endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	12						CTGGCGCGTAGAGCAGCAGCA	0.667													G|||	1	0.000199681	0.0	0.0	5008	,	,		17159	0.0		0.001	False		,,,				2504	0.0				p.L30L		Atlas-SNP	.											.	AUP1	29	.	0			c.C90G						PASS	.	G	,,	0,4280		0,0,2140	25.0	38.0	33.0		,,90	4.7	1.0	2		33	1,8483		0,1,4241	no	utr-5,utr-5,coding-synonymous	AUP1,HTRA2	NM_013247.4,NM_145074.2,NM_181575.3	,,	0,1,6381	CC,CG,GG		0.0118,0.0,0.0078	,,	,,30/411	74756587	1,12763	2140	4242	6382	SO:0001623	5_prime_UTR_variant	550	exon2			CGCGTAGAGCAGC		CCDS1951.1, CCDS1952.1	2p13.1	2011-07-21	2005-08-19	2005-08-19	ENSG00000115317	ENSG00000115317		"""Serine peptidases / Serine peptidases"", ""Parkinson disease"""	14348	protein-coding gene	gene with protein product		606441	"""protease, serine, 25"""	PRSS25		10644717, 10971580	Standard	XM_005264266		Approved	OMI, PARK13	uc002smi.1	O43464	OTTHUMG00000129957	ENST00000258080.3:c.-547G>C	chr2.hg19:g.74756587G>C		5.0	0.0	.		10.0	6.0	.	NM_181575	Q9HBZ4|Q9P0Y3|Q9P0Y4	Silent	SNP	ENST00000258080.3	hg19	CCDS1951.1																																																																																			.	.	.	weak		0.667	HTRA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252219.2	NM_013247	
TTN	7273	hgsc.bcm.edu	37	2	179401833	179401833	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr2:179401833C>T	ENST00000591111.1	-	306	95304	c.95080G>A	c.(95080-95082)Gag>Aag	p.E31694K	TTN_ENST00000359218.5_Missense_Mutation_p.E24395K|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.E24270K|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000415561.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E33335K|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E24462K|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E30767K|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586707.1_RNA			Q8WZ42	TITIN_HUMAN	titin	31694	Fibronectin type-III 130. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCAGCCCCCTCCTTGGCCTCA	0.502																																					p.E33335K		Atlas-SNP	.											.	TTN	18412	.	0			c.G100003A						PASS	.						67.0	66.0	66.0					2																	179401833		1941	4126	6067	SO:0001583	missense	7273	exon356			CCCCCTCCTTGGC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.95080G>A	chr2.hg19:g.179401833C>T	ENSP00000465570:p.Glu31694Lys	27.0	0.0	.		79.0	15.0	.	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	C	22.5	4.293637	0.80914	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57273	0.41;0.41;0.41;0.41	5.41	5.41	0.78517	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.56731	0.2005	N	0.05554	-0.025	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.83275	0.996;0.996;0.996;0.996	T	0.67806	-0.5575	9	0.87932	D	0	.	19.1973	0.93695	0.0:1.0:0.0:0.0	.	24270;24395;24462;31694	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	K	30767;24270;24462;24395;24267	ENSP00000343764:E30767K;ENSP00000434586:E24270K;ENSP00000340554:E24462K;ENSP00000352154:E24395K	ENSP00000340554:E24462K	E	-	1	0	TTN	179110079	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.818000	0.86416	2.544000	0.85801	0.462000	0.41574	GAG	.	.	.	none		0.502	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	hgsc.bcm.edu	37	2	179452053	179452053	+	Silent	SNP	C	C	T			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr2:179452053C>T	ENST00000591111.1	-	257	59186	c.58962G>A	c.(58960-58962)ggG>ggA	p.G19654G	TTN_ENST00000359218.5_Silent_p.G12355G|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000460472.2_Silent_p.G12230G|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000589042.1_Silent_p.G21295G|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000342175.6_Silent_p.G12422G|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000342992.6_Silent_p.G18727G|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA			Q8WZ42	TITIN_HUMAN	titin	19654	Fibronectin type-III 42. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCACTTGGCTCCCACCGTCGT	0.468																																					p.G21295G		Atlas-SNP	.											.	TTN	18412	.	0			c.G63885A						PASS	.						69.0	65.0	66.0					2																	179452053		1909	4130	6039	SO:0001819	synonymous_variant	7273	exon307			TTGGCTCCCACCG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.58962G>A	chr2.hg19:g.179452053C>T		29.0	0.0	.		92.0	6.0	.	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	hg19																																																																																				.	.	.	none		0.468	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
CPO	130749	hgsc.bcm.edu	37	2	207833968	207833968	+	Silent	SNP	G	G	C			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr2:207833968G>C	ENST00000272852.3	+	9	979	c.933G>C	c.(931-933)ctG>ctC	p.L311L		NM_173077.2	NP_775100.1	Q8IVL8	CBPO_HUMAN	carboxypeptidase O	311						extracellular region (GO:0005576)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	14				LUSC - Lung squamous cell carcinoma(261;0.0744)|Epithelial(149;0.0807)|Lung(261;0.142)		CGTTTGAGCTGAGGGACAGTG	0.512																																					p.L311L		Atlas-SNP	.											.	CPO	42	.	0			c.G933C						PASS	.						147.0	133.0	138.0					2																	207833968		2203	4300	6503	SO:0001819	synonymous_variant	130749	exon9			TGAGCTGAGGGAC		CCDS2372.1	2q34	2012-02-10			ENSG00000144410	ENSG00000144410			21011	protein-coding gene	gene with protein product	"""metallocarboxypeptidase O"", ""metallocarboxypeptidase C"""	609563				11836249	Standard	NM_173077		Approved		uc002vby.2	Q8IVL8	OTTHUMG00000088987	ENST00000272852.3:c.933G>C	chr2.hg19:g.207833968G>C		89.0	0.0	.		81.0	36.0	.	NM_173077	Q2M277|Q7RTW7	Silent	SNP	ENST00000272852.3	hg19	CCDS2372.1																																																																																			.	.	.	none		0.512	CPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000202040.2	NM_173077	
ABCA12	26154	hgsc.bcm.edu	37	2	215840568	215840568	+	Silent	SNP	A	A	G			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr2:215840568A>G	ENST00000272895.7	-	34	5541	c.5322T>C	c.(5320-5322)taT>taC	p.Y1774Y	ABCA12_ENST00000389661.4_Silent_p.Y1456Y	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	1774					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		GAATCTCTGGATAACTGTTGC	0.453																																					p.Y1774Y	Ovarian(66;664 1488 5121 34295)	Atlas-SNP	.											.	ABCA12	368	.	0			c.T5322C						PASS	.						147.0	142.0	144.0					2																	215840568		2203	4300	6503	SO:0001819	synonymous_variant	26154	exon34			CTCTGGATAACTG	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.5322T>C	chr2.hg19:g.215840568A>G		130.0	0.0	.		87.0	31.0	.	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Silent	SNP	ENST00000272895.7	hg19	CCDS33372.1																																																																																			.	.	.	none		0.453	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
TMPPE	643853	hgsc.bcm.edu	37	3	33135655	33135655	+	Silent	SNP	C	C	T			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr3:33135655C>T	ENST00000342462.4	-	2	223	c.33G>A	c.(31-33)gcG>gcA	p.A11A	GLB1_ENST00000399402.3_Intron|GLB1_ENST00000307377.8_Intron|GLB1_ENST00000445488.2_Intron|GLB1_ENST00000307363.5_Intron|TMPPE_ENST00000416695.2_Intron	NM_001039770.2	NP_001034859.2	Q6ZT21	TMPPE_HUMAN	transmembrane protein with metallophosphoesterase domain	11						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)	p.A11A(1)		breast(1)|large_intestine(5)|lung(6)|prostate(1)	13						GGGTGGCCTTCGCGCCTAGGG	0.587																																					p.A11A		Atlas-SNP	.											TMPPE,colon,carcinoma,-2,1	TMPPE	24	.	1	Substitution - coding silent(1)	lung(1)	c.G33A						PASS	.																																			SO:0001819	synonymous_variant	643853	exon2			GGCCTTCGCGCCT	AK126979	CCDS33732.1, CCDS46786.1	3p22.3	2014-02-12	2009-02-24		ENSG00000188167	ENSG00000188167			33865	protein-coding gene	gene with protein product							Standard	NM_001039770		Approved	FLJ45032	uc003cfk.2	Q6ZT21	OTTHUMG00000155779	ENST00000342462.4:c.33G>A	chr3.hg19:g.33135655C>T		91.0	0.0	.		82.0	8.0	.	NM_001039770	B2RNG5|Q6ZRG1	Silent	SNP	ENST00000342462.4	hg19	CCDS33732.1																																																																																			.	.	.	none		0.587	TMPPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341566.1	NM_001039770	
CTNNB1	1499	hgsc.bcm.edu	37	3	41274905	41274905	+	Silent	SNP	C	C	T	rs74692094	byFrequency	TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr3:41274905C>T	ENST00000349496.5	+	8	1435	c.1155C>T	c.(1153-1155)ctC>ctT	p.L385L	CTNNB1_ENST00000405570.1_Silent_p.L385L|CTNNB1_ENST00000453024.1_Silent_p.L378L|CTNNB1_ENST00000396185.3_Silent_p.L385L|CTNNB1_ENST00000396183.3_Silent_p.L385L	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	385					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)		CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TTTGGACTCTCAGGAATCTTT	0.413		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.L385L	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	.	CTNNB1	4904	.	0			c.C1155T						PASS	.						102.0	93.0	96.0					3																	41274905		2203	4300	6503	SO:0001819	synonymous_variant	1499	exon8	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	GACTCTCAGGAAT	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.1155C>T	chr3.hg19:g.41274905C>T		103.0	0.0	.		126.0	47.0	.	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Silent	SNP	ENST00000349496.5	hg19	CCDS2694.1																																																																																			.	C|0.999;A|0.001	.	alt		0.413	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
TMF1	7110	hgsc.bcm.edu	37	3	69101211	69101211	+	Silent	SNP	G	G	A			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr3:69101211G>A	ENST00000398559.2	-	1	243	c.27C>T	c.(25-27)ctC>ctT	p.L9L	CTD-2013N24.2_ENST00000595925.1_RNA|TMF1_ENST00000543976.1_Silent_p.L9L			P82094	TMF1_HUMAN	TATA element modulatory factor 1	9					acrosome assembly (GO:0001675)|cellular response to organic cyclic compound (GO:0071407)|defense response to bacterium (GO:0042742)|Leydig cell differentiation (GO:0033327)|luteinizing hormone secretion (GO:0032275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|positive regulation of cytokine production (GO:0001819)|positive regulation of testosterone secretion (GO:2000845)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of transcription, DNA-templated (GO:0006355)|sperm motility (GO:0030317)|spermatid nucleus differentiation (GO:0007289)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription cofactor activity (GO:0003712)			cervix(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;4.48e-05)|Epithelial(33;0.000274)|LUSC - Lung squamous cell carcinoma(21;0.0123)|KIRC - Kidney renal clear cell carcinoma(39;0.211)|Kidney(39;0.247)		CGAAGCTGGAGAGCTGGGAGG	0.642																																					p.L9L		Atlas-SNP	.											.	TMF1	77	.	0			c.C27T						PASS	.						62.0	65.0	64.0					3																	69101211		1931	4151	6082	SO:0001819	synonymous_variant	7110	exon1			GCTGGAGAGCTGG		CCDS43105.1	3p21-p12	2009-02-11			ENSG00000144747	ENSG00000144747			11870	protein-coding gene	gene with protein product		601126				1409643	Standard	NM_007114		Approved	ARA160, TMF	uc003dnn.3	P82094	OTTHUMG00000158771	ENST00000398559.2:c.27C>T	chr3.hg19:g.69101211G>A		129.0	0.0	.		133.0	57.0	.	NM_007114	B7ZLJ2|Q17R87|Q59GK0	Silent	SNP	ENST00000398559.2	hg19	CCDS43105.1																																																																																			.	.	.	none		0.642	TMF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352106.1	NM_007114	
MAPK10	5602	hgsc.bcm.edu	37	4	86950416	86950416	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr4:86950416T>C	ENST00000359221.3	-	13	1712	c.1186A>G	c.(1186-1188)Aag>Gag	p.K396E	MAPK10_ENST00000395157.3_Missense_Mutation_p.K251E|MAPK10_ENST00000395160.3_Missense_Mutation_p.K251E|MAPK10_ENST00000395161.2_Missense_Mutation_p.K396E|MAPK10_ENST00000361569.2_Missense_Mutation_p.K396E|MAPK10_ENST00000395169.3_Missense_Mutation_p.K358E|MAPK10_ENST00000395166.1_Missense_Mutation_p.K358E|MAPK10_ENST00000449047.2_Missense_Mutation_p.K251E			P53779	MK10_HUMAN	mitogen-activated protein kinase 10	396					activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|JUN phosphorylation (GO:0007258)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|JUN kinase activity (GO:0004705)|MAP kinase kinase activity (GO:0004708)			breast(1)|central_nervous_system(1)|stomach(1)	3		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.243)		OV - Ovarian serous cystadenocarcinoma(123;0.002)		ATTACTTCCTTGTAGATAAGT	0.328																																					p.K396E		Atlas-SNP	.											.	MAPK10	106	.	0			c.A1186G						PASS	.						172.0	162.0	166.0					4																	86950416		2203	4300	6503	SO:0001583	missense	5602	exon13			CTTCCTTGTAGAT	U07620	CCDS3612.1, CCDS3613.1, CCDS34026.1, CCDS43247.1	4q22-q23	2011-06-09			ENSG00000109339	ENSG00000109339	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6872	protein-coding gene	gene with protein product		602897		PRKM10		8654373, 12436199	Standard	NM_002753		Approved	JNK3, p493F12, p54bSAPK	uc003hpt.3	P53779	OTTHUMG00000130604	ENST00000359221.3:c.1186A>G	chr4.hg19:g.86950416T>C	ENSP00000352157:p.Lys396Glu	110.0	0.0	.		79.0	41.0	.	NM_002753	A6NFS3|A6NG28|B3KQ94|Q15707|Q49AP1	Missense_Mutation	SNP	ENST00000359221.3	hg19	CCDS34026.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.80|15.80	2.940106|2.940106	0.52972|0.52972	.|.	.|.	ENSG00000109339|ENSG00000109339	ENST00000395169;ENST00000359221;ENST00000395157;ENST00000361569;ENST00000395166;ENST00000395160;ENST00000449047;ENST00000395161|ENST00000515400	T;T;T;T;T;T;T;T|.	0.59083|.	0.29;0.29;0.29;0.29;0.29;0.29;0.29;0.29|.	5.96|5.96	5.96|5.96	0.96718|0.96718	Protein kinase-like domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.68696|0.68696	0.3029|0.3029	L|L	0.52206|0.52206	1.635|1.635	0.80722|0.80722	D|D	1|1	B;B;B;B;B|.	0.02656|.	0.0;0.0;0.0;0.0;0.0|.	B;B;B;B;B|.	0.08055|.	0.0;0.002;0.003;0.002;0.001|.	T|T	0.66023|0.66023	-0.6026|-0.6026	10|5	0.33141|.	T|.	0.24|.	-19.5226|-19.5226	16.0984|16.0984	0.81148|0.81148	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	282;251;358;396;396|.	B7Z1Z1;Q499Y8;P53779-3;P53779-2;P53779|.	.;.;.;.;MK10_HUMAN|.	E|R	358;396;251;396;358;251;251;396|308	ENSP00000378598:K358E;ENSP00000352157:K396E;ENSP00000378586:K251E;ENSP00000355297:K396E;ENSP00000378595:K358E;ENSP00000378589:K251E;ENSP00000414469:K251E;ENSP00000378590:K396E|.	ENSP00000352157:K396E|.	K|Q	-|-	1|2	0|0	MAPK10|MAPK10	87169440|87169440	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	6.935000|6.935000	0.75886|0.75886	2.278000|2.278000	0.76064|0.76064	0.533000|0.533000	0.62120|0.62120	AAG|CAA	.	.	.	none		0.328	MAPK10-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000361363.2		
LRBA	987	hgsc.bcm.edu	37	4	151827110	151827110	+	Silent	SNP	A	A	T			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr4:151827110A>T	ENST00000357115.3	-	13	1878	c.1635T>A	c.(1633-1635)ctT>ctA	p.L545L	LRBA_ENST00000510413.1_Silent_p.L545L|LRBA_ENST00000535741.1_Silent_p.L545L|LRBA_ENST00000507224.1_Silent_p.L545L	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	545						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					GGCAAAGTTCAAGTACTGCTC	0.388																																					p.L545L		Atlas-SNP	.											.	LRBA	253	.	0			c.T1635A						PASS	.						83.0	81.0	82.0					4																	151827110		2203	4300	6503	SO:0001819	synonymous_variant	987	exon13			AAGTTCAAGTACT	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.1635T>A	chr4.hg19:g.151827110A>T		76.0	0.0	.		82.0	37.0	.	NM_006726	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Silent	SNP	ENST00000357115.3	hg19	CCDS3773.1																																																																																			.	.	.	none		0.388	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1		
ASIC5	51802	hgsc.bcm.edu	37	4	156763435	156763436	+	Missense_Mutation	DNP	GC	GC	AT			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr4:156763435_156763436GC>AT	ENST00000537611.2	-	6	978_979	c.932_933GC>AT	c.(931-933)aGC>aAT	p.S311N		NM_017419.2	NP_059115.1	Q9NY37	ASIC5_HUMAN	acid-sensing (proton-gated) ion channel family member 5	311					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrogen ion channel activity (GO:0015252)|ligand-gated sodium channel activity (GO:0015280)										AACCAGAAGTGCTGTAGCTGCT	0.416																																					p.S311S|p.S311N		Atlas-SNP	.											.	.	.	.	0			c.C933T|c.G932A						PASS	.																																			SO:0001583	missense	51802	exon6			AGAAGTGCTGTAG|GAAGTGCTGTAGC	AJ252011	CCDS3793.1	4q32.1	2012-10-03	2012-03-02	2012-03-02	ENSG00000256394	ENSG00000256394			17537	protein-coding gene	gene with protein product			"""amiloride-sensitive cation channel 5, intestinal"""	ACCN5		10767424	Standard	NM_017419		Approved	INAC, HINAC	uc003ipe.1	Q9NY37	OTTHUMG00000161941	ENST00000537611.2:c.932_933delinsAT	chr4.hg19:g.156763435_156763436delinsAT	ENSP00000442477:p.Ser311Asn	106.0|104.0	0.0	.		117.0|112.0	64.0	.	NM_017419		Silent|Missense_Mutation	SNP	ENST00000537611.2	hg19	CCDS3793.1																																																																																			.	.	.	none		0.416	ASIC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366464.1		
HMGB2	3148	hgsc.bcm.edu	37	4	174254775	174254775	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr4:174254775G>A	ENST00000296503.5	-	2	899	c.26C>T	c.(25-27)cCg>cTg	p.P9L	HMGB2_ENST00000446922.2_Missense_Mutation_p.P9L|HMGB2_ENST00000438704.2_Missense_Mutation_p.P9L			P26583	HMGB2_HUMAN	high mobility group box 2	9					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|base-excision repair, DNA ligation (GO:0006288)|cell chemotaxis (GO:0060326)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to lipopolysaccharide (GO:0071222)|chromatin organization (GO:0006325)|DNA ligation involved in DNA repair (GO:0051103)|DNA topological change (GO:0006265)|male gonad development (GO:0008584)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive chemotaxis (GO:0050918)|positive regulation of DNA binding (GO:0043388)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of nuclease activity (GO:0032075)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to steroid hormone (GO:0048545)|spermatid nucleus differentiation (GO:0007289)|V(D)J recombination (GO:0033151)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	chemoattractant activity (GO:0042056)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RAGE receptor binding (GO:0050786)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|urinary_tract(3)	14		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;9.58e-18)|Epithelial(43;3.75e-16)|OV - Ovarian serous cystadenocarcinoma(60;6.24e-09)|STAD - Stomach adenocarcinoma(60;0.00273)|GBM - Glioblastoma multiforme(59;0.0064)|LUSC - Lung squamous cell carcinoma(193;0.0903)|Kidney(143;0.249)		TTTGCCCCGCGGCTTGTTGGG	0.627																																					p.P9L		Atlas-SNP	.											.	HMGB2	24	.	0			c.C26T						PASS	.						68.0	71.0	70.0					4																	174254775		2203	4300	6503	SO:0001583	missense	3148	exon1			CCCCGCGGCTTGT		CCDS3816.1	4q31	2011-07-01	2011-04-05	2002-08-16	ENSG00000164104	ENSG00000164104		"""High-mobility group / Canonical"""	5000	protein-coding gene	gene with protein product		163906	"""high-mobility group (nonhistone chromosomal) protein 2"", ""high-mobility group box 2"""	HMG2		1754403	Standard	NM_002129		Approved		uc011ckc.1	P26583	OTTHUMG00000160799	ENST00000296503.5:c.26C>T	chr4.hg19:g.174254775G>A	ENSP00000296503:p.Pro9Leu	99.0	0.0	.		87.0	43.0	.	NM_001130689	B2R4K8|D3DP37|Q5U072	Missense_Mutation	SNP	ENST00000296503.5	hg19	CCDS3816.1	.	.	.	.	.	.	.	.	.	.	G	18.67	3.673983	0.67928	.	.	ENSG00000164104	ENST00000296503;ENST00000446922;ENST00000438704;ENST00000506267	T;T;T;T	0.26067	1.76;1.76;1.76;1.76	5.45	4.61	0.57282	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (3);	0.088329	0.48767	D	0.000173	T	0.35128	0.0921	M	0.86097	2.795	0.80722	D	1	B	0.29481	0.245	B	0.28709	0.093	T	0.21621	-1.0240	10	0.42905	T	0.14	.	13.8749	0.63647	0.0744:0.0:0.9256:0.0	.	9	P26583	HMGB2_HUMAN	L	9	ENSP00000296503:P9L;ENSP00000393448:P9L;ENSP00000404912:P9L;ENSP00000423001:P9L	ENSP00000296503:P9L	P	-	2	0	HMGB2	174491350	1.000000	0.71417	0.938000	0.37757	0.038000	0.13279	9.505000	0.97989	1.313000	0.45069	0.563000	0.77884	CCG	.	.	.	none		0.627	HMGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362362.1	NM_001130688	
PRLR	5618	hgsc.bcm.edu	37	5	35070231	35070231	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr5:35070231G>C	ENST00000382002.5	-	7	1106	c.680C>G	c.(679-681)cCt>cGt	p.P227R	PRLR_ENST00000342362.5_Missense_Mutation_p.P126R|PRLR_ENST00000509934.1_5'UTR|PRLR_ENST00000511486.1_Missense_Mutation_p.P126R|PRLR_ENST00000231423.3_Missense_Mutation_p.P227R|PRLR_ENST00000348262.3_Missense_Mutation_p.P227R|PRLR_ENST00000542609.1_Missense_Mutation_p.P227R|PRLR_ENST00000397391.3_Missense_Mutation_p.P156R|PRLR_ENST00000310101.5_Missense_Mutation_p.P227R|PRLR_ENST00000513753.1_Missense_Mutation_p.P227R	NM_000949.5	NP_000940.1	P16471	PRLR_HUMAN	prolactin receptor	227	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of JAK2 kinase activity (GO:0042977)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cell surface receptor signaling pathway (GO:0007166)|embryo implantation (GO:0007566)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|negative regulation of apoptotic process (GO:0043066)|prolactin signaling pathway (GO:0038161)|steroid biosynthetic process (GO:0006694)|T cell activation (GO:0042110)	cell surface (GO:0009986)|endosome lumen (GO:0031904)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|ornithine decarboxylase activator activity (GO:0042978)|peptide hormone binding (GO:0017046)|prolactin receptor activity (GO:0004925)|protein homodimerization activity (GO:0042803)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Fluoxymesterone(DB01185)|Somatropin recombinant(DB00052)	CTCACCACTAGGTATCTGAAT	0.418																																					p.P227R		Atlas-SNP	.											.	PRLR	90	.	0			c.C680G						PASS	.						105.0	89.0	94.0					5																	35070231		2203	4300	6503	SO:0001583	missense	5618	exon7			CCACTAGGTATCT		CCDS3909.1, CCDS56358.1, CCDS56359.1, CCDS56360.1, CCDS56361.1, CCDS56362.1	5p14-p13	2013-02-27			ENSG00000113494	ENSG00000113494			9446	protein-coding gene	gene with protein product		176761					Standard	NM_001204315		Approved		uc003jjm.3	P16471	OTTHUMG00000090789	ENST00000382002.5:c.680C>G	chr5.hg19:g.35070231G>C	ENSP00000371432:p.Pro227Arg	66.0	0.0	.		49.0	19.0	.	NM_000949	B2R882|D1MDP1|Q16354|Q8TD75|Q8TD78|Q96P35|Q96P36|Q9BX87|Q9UHJ5	Missense_Mutation	SNP	ENST00000382002.5	hg19	CCDS3909.1	.	.	.	.	.	.	.	.	.	.	G	14.72	2.620133	0.46736	.	.	ENSG00000113494	ENST00000231423;ENST00000513753;ENST00000348262;ENST00000397391;ENST00000542609;ENST00000342362;ENST00000382002;ENST00000511486;ENST00000310101	T;T;T;T;T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78	5.65	5.65	0.86999	Fibronectin, type III (2);	0.000000	0.85682	D	0.000000	T	0.74382	0.3709	M	0.90542	3.125	0.58432	D	0.999993	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.998;0.999;1.0;0.998;0.997;0.996;0.994	T	0.79629	-0.1724	10	0.87932	D	0	-15.5927	15.3486	0.74363	0.0:0.0:0.8598:0.1401	.	227;227;126;156;227;227;227	P16471-3;P16471;P16471-2;Q8TD76;P16471-7;P16471-6;P16471-4	.;PRLR_HUMAN;.;.;.;.;.	R	227;227;227;156;227;126;227;126;227	ENSP00000231423:P227R;ENSP00000424841:P227R;ENSP00000311613:P227R;ENSP00000380546:P156R;ENSP00000441813:P227R;ENSP00000339213:P126R;ENSP00000371432:P227R;ENSP00000422556:P126R;ENSP00000309008:P227R	ENSP00000231423:P227R	P	-	2	0	PRLR	35105988	1.000000	0.71417	0.986000	0.45419	0.092000	0.18411	6.868000	0.75516	2.668000	0.90789	0.655000	0.94253	CCT	.	.	.	none		0.418	PRLR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207575.2		
SPOCK1	6695	hgsc.bcm.edu	37	5	136328174	136328174	+	Splice_Site	SNP	G	G	A			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr5:136328174G>A	ENST00000394945.1	-	7	874	c.705C>T	c.(703-705)ggC>ggT	p.G235G	SPOCK1_ENST00000282223.7_Splice_Site_p.G235G	NM_004598.3	NP_004589.1	Q08629	TICN1_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1	235					cell adhesion (GO:0007155)|central nervous system neuron differentiation (GO:0021953)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron projection development (GO:0010977)|nervous system development (GO:0007399)|neurogenesis (GO:0022008)|neuron migration (GO:0001764)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|postsynaptic density (GO:0014069)|proteinaceous extracellular matrix (GO:0005578)|sarcoplasm (GO:0016528)	calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TGGTCTTACTGCCTTGGGCTG	0.438																																					p.G235G		Atlas-SNP	.											.	SPOCK1	58	.	0			c.C705T						PASS	.						161.0	152.0	155.0					5																	136328174		2203	4300	6503	SO:0001630	splice_region_variant	6695	exon7			CTTACTGCCTTGG	AF231124	CCDS4191.1	5q31.2	2008-02-05	2005-11-04	2005-11-04	ENSG00000152377	ENSG00000152377			11251	protein-coding gene	gene with protein product		602264	"""sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican)"""	TIC1, SPOCK		9545645	Standard	NM_004598		Approved	testican-1	uc003lbp.3	Q08629	OTTHUMG00000129157	ENST00000394945.1:c.706+1C>T	chr5.hg19:g.136328174G>A		163.0	0.0	.		122.0	48.0	.	NM_004598	B3KSW3|Q59EW0|Q8N630|Q9UCL8	Silent	SNP	ENST00000394945.1	hg19	CCDS4191.1																																																																																			.	.	.	none		0.438	SPOCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251222.1	NM_004598	Silent
KDM3B	51780	hgsc.bcm.edu	37	5	137715373	137715373	+	Silent	SNP	T	T	C			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr5:137715373T>C	ENST00000314358.5	+	5	881	c.681T>C	c.(679-681)cgT>cgC	p.R227R		NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B	227					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						CCATCACTCGTCTTATGGAGG	0.483																																					p.R227R		Atlas-SNP	.											.	KDM3B	177	.	0			c.T681C						PASS	.						174.0	148.0	157.0					5																	137715373		2203	4300	6503	SO:0001819	synonymous_variant	51780	exon5			CACTCGTCTTATG	AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	ENST00000314358.5:c.681T>C	chr5.hg19:g.137715373T>C		105.0	0.0	.		103.0	37.0	.	NM_016604	A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Silent	SNP	ENST00000314358.5	hg19	CCDS34242.1																																																																																			.	.	.	none		0.483	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373597.1	NM_016604	
PSD2	84249	hgsc.bcm.edu	37	5	139197069	139197069	+	Silent	SNP	C	C	T	rs142589356		TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr5:139197069C>T	ENST00000274710.3	+	5	1225	c.1020C>T	c.(1018-1020)aaC>aaT	p.N340N		NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	340	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGGCAGCAACGAGTTTAGCA	0.592																																					p.N340N		Atlas-SNP	.											.	PSD2	88	.	0			c.C1020T						PASS	.	C		0,4406		0,0,2203	81.0	76.0	78.0		1020	-0.2	1.0	5	dbSNP_134	78	4,8596	3.7+/-12.6	0,4,4296	no	coding-synonymous	PSD2	NM_032289.2		0,4,6499	TT,TC,CC		0.0465,0.0,0.0308		340/772	139197069	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	84249	exon5			CAGCAACGAGTTT	AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.1020C>T	chr5.hg19:g.139197069C>T		68.0	0.0	.		62.0	21.0	.	NM_032289	D3DQD3|Q8N3J8	Silent	SNP	ENST00000274710.3	hg19	CCDS4216.1																																																																																			.	C|1.000;T|0.000	0.000	weak		0.592	PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251339.1	NM_032289	
PCDHB15	56121	hgsc.bcm.edu	37	5	140625417	140625417	+	Missense_Mutation	SNP	G	G	C	rs564192004		TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr5:140625417G>C	ENST00000231173.3	+	1	271	c.271G>C	c.(271-273)Gac>Cac	p.D91H		NM_018935.2	NP_061758.1	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15	91	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(8)|kidney(3)|large_intestine(14)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	61			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGAGAAGCTGGACCGGGAGAA	0.498													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17009	0.0		0.0	False		,,,				2504	0.0				p.D91H		Atlas-SNP	.											.	PCDHB15	138	.	0			c.G271C						PASS	.						54.0	61.0	59.0					5																	140625417		2203	4300	6503	SO:0001583	missense	56121	exon1			AAGCTGGACCGGG	AF152494	CCDS4257.1	5q31	2011-06-07			ENSG00000113248	ENSG00000113248		"""Cadherins / Protocadherins : Clustered"""	8686	other	protocadherin		606341				10380929	Standard	NM_018935		Approved	PCDH-BETA15	uc003lje.3	Q9Y5E8	OTTHUMG00000129609	ENST00000231173.3:c.271G>C	chr5.hg19:g.140625417G>C	ENSP00000231173:p.Asp91His	127.0	0.0	.		99.0	8.0	.	NM_018935	Q8IUX5	Missense_Mutation	SNP	ENST00000231173.3	hg19	CCDS4257.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.964851	0.74131	.	.	ENSG00000113248	ENST00000231173	T	0.53640	0.61	4.92	4.92	0.64577	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.82121	0.4968	H	0.98849	4.35	0.58432	D	0.999994	D	0.89917	1.0	D	0.97110	1.0	D	0.89982	0.4101	9	0.87932	D	0	.	18.0878	0.89463	0.0:0.0:1.0:0.0	.	91	Q9Y5E8	PCDBF_HUMAN	H	91	ENSP00000231173:D91H	ENSP00000231173:D91H	D	+	1	0	PCDHB15	140605601	1.000000	0.71417	1.000000	0.80357	0.838000	0.47535	9.804000	0.99143	2.442000	0.82660	0.491000	0.48974	GAC	.	.	.	none		0.498	PCDHB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251804.2	NM_018935	
F13A1	2162	hgsc.bcm.edu	37	6	6196094	6196094	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr6:6196094G>A	ENST00000264870.3	-	10	1506	c.1241C>T	c.(1240-1242)tCg>tTg	p.S414L		NM_000129.3	NP_000120.2	P00488	F13A_HUMAN	coagulation factor XIII, A1 polypeptide	414					blood coagulation (GO:0007596)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	62	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	GGCTTGAACCGAGGCGGGGCC	0.502																																					p.S414L		Atlas-SNP	.											.	F13A1	135	.	0			c.C1241T	GRCh37	CM023371|CM993150	F13A1	M		PASS	.						96.0	77.0	84.0					6																	6196094		2203	4300	6503	SO:0001583	missense	2162	exon10			TGAACCGAGGCGG	M14539	CCDS4496.1	6p24.2-p23	2014-01-24			ENSG00000124491	ENSG00000124491		"""Transglutaminases"""	3531	protein-coding gene	gene with protein product		134570		F13A			Standard	NM_000129		Approved		uc003mwv.3	P00488	OTTHUMG00000014186	ENST00000264870.3:c.1241C>T	chr6.hg19:g.6196094G>A	ENSP00000264870:p.Ser414Leu	37.0	0.0	.		37.0	10.0	.	NM_000129	Q59HA7|Q8N6X2|Q96P24|Q9BX29	Missense_Mutation	SNP	ENST00000264870.3	hg19	CCDS4496.1	.	.	.	.	.	.	.	.	.	.	G	19.46	3.831865	0.71258	.	.	ENSG00000124491	ENST00000264870;ENST00000441301	T	0.55234	0.53	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.71400	0.3335	M	0.81802	2.56	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.989;0.999	T	0.74621	-0.3604	10	0.87932	D	0	.	18.7232	0.91703	0.0:0.0:1.0:0.0	.	351;414	F5H080;P00488	.;F13A_HUMAN	L	414;351	ENSP00000264870:S414L	ENSP00000264870:S414L	S	-	2	0	F13A1	6141093	1.000000	0.71417	0.928000	0.36995	0.036000	0.12997	9.131000	0.94446	2.728000	0.93425	0.655000	0.94253	TCG	.	.	.	none		0.502	F13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039756.3	NM_000129	
GFRAL	389400	hgsc.bcm.edu	37	6	55223928	55223928	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr6:55223928C>T	ENST00000340465.2	+	6	1030	c.944C>T	c.(943-945)tCa>tTa	p.S315L		NM_207410.2	NP_997293.2	Q6UXV0	GFRAL_HUMAN	GDNF family receptor alpha like	315					negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|stress-activated protein kinase signaling cascade (GO:0031098)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S315L(1)		NS(1)|breast(1)|endometrium(2)|kidney(5)|large_intestine(2)|liver(1)|lung(31)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	48	Lung NSC(77;0.0875)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			CATAGAAAATCATGTTTCAGT	0.343																																					p.S315L		Atlas-SNP	.											GFRAL,NS,carcinoma,0,1	GFRAL	91	.	1	Substitution - Missense(1)	lung(1)	c.C944T						PASS	.						62.0	61.0	61.0					6																	55223928		2203	4299	6502	SO:0001583	missense	389400	exon6			GAAAATCATGTTT	AY358198	CCDS4957.1	6p12.1	2007-06-22			ENSG00000187871	ENSG00000187871			32789	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 144"""	C6orf144		16086688	Standard	NM_207410		Approved	GRAL, UNQ9356, bA360D14.1	uc003pcm.1	Q6UXV0	OTTHUMG00000014900	ENST00000340465.2:c.944C>T	chr6.hg19:g.55223928C>T	ENSP00000343636:p.Ser315Leu	88.0	0.0	.		85.0	9.0	.	NM_207410	Q5VTF6	Missense_Mutation	SNP	ENST00000340465.2	hg19	CCDS4957.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.941217	0.73557	.	.	ENSG00000187871	ENST00000340465	T	0.63417	-0.04	5.52	4.66	0.58398	GDNF/GAS1 (2);	0.157695	0.42682	D	0.000663	T	0.70193	0.3196	M	0.65498	2.005	0.39285	D	0.964639	D	0.89917	1.0	D	0.97110	1.0	T	0.74589	-0.3615	10	0.54805	T	0.06	-7.1541	14.1925	0.65646	0.0:0.9283:0.0:0.0717	.	315	Q6UXV0	GFRAL_HUMAN	L	315	ENSP00000343636:S315L	ENSP00000343636:S315L	S	+	2	0	GFRAL	55331887	1.000000	0.71417	0.682000	0.30024	0.971000	0.66376	5.350000	0.66016	1.327000	0.45338	0.557000	0.71058	TCA	.	.	.	none		0.343	GFRAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040995.2	NM_207410	
AIM1	202	hgsc.bcm.edu	37	6	106968949	106968949	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr6:106968949A>T	ENST00000369066.3	+	2	3129	c.2642A>T	c.(2641-2643)gAg>gTg	p.E881V		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		CCCACGACTGAGGGTGCCCCG	0.478																																					p.E881V		Atlas-SNP	.											.	AIM1	161	.	0			c.A2642T						PASS	.						70.0	75.0	73.0					6																	106968949		2203	4300	6503	SO:0001583	missense	202	exon2			CGACTGAGGGTGC	U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.2642A>T	chr6.hg19:g.106968949A>T	ENSP00000358062:p.Glu881Val	127.0	0.0	.		142.0	62.0	.	NM_001624	Q6P2P0|Q9BTM3	Missense_Mutation	SNP	ENST00000369066.3	hg19	CCDS34506.1	.	.	.	.	.	.	.	.	.	.	A	13.00	2.105028	0.37145	.	.	ENSG00000112297	ENST00000285105;ENST00000369066	T	0.73047	-0.71	5.99	4.82	0.62117	.	1.203230	0.05682	N	0.590607	T	0.57770	0.2076	M	0.68317	2.08	0.48830	D	0.999719	B	0.26672	0.156	B	0.21917	0.037	T	0.57277	-0.7839	10	0.72032	D	0.01	.	10.8946	0.47015	0.9291:0.0:0.0709:0.0	.	881	Q9Y4K1	AIM1_HUMAN	V	1289;881	ENSP00000358062:E881V	ENSP00000285105:E1289V	E	+	2	0	AIM1	107075642	1.000000	0.71417	0.609000	0.28983	0.728000	0.41692	4.089000	0.57685	1.079000	0.41038	0.533000	0.62120	GAG	.	.	.	none		0.478	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1		
CTGF	1490	hgsc.bcm.edu	37	6	132271489	132271489	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr6:132271489C>T	ENST00000367976.3	-	3	684	c.484G>A	c.(484-486)Gag>Aag	p.E162K	RP11-69I8.3_ENST00000435287.1_RNA	NM_001901.2	NP_001892	P29279	CTGF_HUMAN	connective tissue growth factor	162	VWFC. {ECO:0000255|PROSITE- ProRule:PRU00220}.				angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|chondrocyte proliferation (GO:0035988)|cytosolic calcium ion transport (GO:0060401)|DNA replication (GO:0006260)|epidermis development (GO:0008544)|extracellular matrix constituent secretion (GO:0070278)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|organ senescence (GO:0010260)|ossification (GO:0001503)|positive regulation of cardiac muscle contraction (GO:0060452)|positive regulation of cell activation (GO:0050867)|positive regulation of cell death (GO:0010942)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G0 to G1 transition (GO:0070318)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|regulation of cell growth (GO:0001558)|regulation of chondrocyte differentiation (GO:0032330)|response to amino acid (GO:0043200)|response to anoxia (GO:0034059)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to glucose (GO:0009749)|response to mineralocorticoid (GO:0051385)|response to peptide hormone (GO:0043434)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell cortex (GO:0005938)|cis-Golgi network (GO:0005801)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|insulin-like growth factor binding (GO:0005520)			breast(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	13	Breast(56;0.0602)			GBM - Glioblastoma multiforme(226;0.015)|OV - Ovarian serous cystadenocarcinoma(155;0.0169)		ACCCACTCCTCGCAGCATTTC	0.652											OREG0017666	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E162K	Esophageal Squamous(127;510 1660 12817 24400 38449)	Atlas-SNP	.											.	CTGF	36	.	0			c.G484A						PASS	.						90.0	91.0	91.0					6																	132271489		2203	4300	6503	SO:0001583	missense	1490	exon3			ACTCCTCGCAGCA	X78947	CCDS5151.1	6q23.2	2008-02-05			ENSG00000118523	ENSG00000118523			2500	protein-coding gene	gene with protein product		121009				1654338	Standard	NM_001901		Approved	IGFBP8, CCN2	uc003qcz.3	P29279	OTTHUMG00000015573	ENST00000367976.3:c.484G>A	chr6.hg19:g.132271489C>T	ENSP00000356954:p.Glu162Lys	170.0	0.0	.	1594	185.0	79.0	.	NM_001901	E1P578|Q6LCY0|Q96A79|Q96QX2|Q9UDL6	Missense_Mutation	SNP	ENST00000367976.3	hg19	CCDS5151.1	.	.	.	.	.	.	.	.	.	.	C	37	5.984351	0.97173	.	.	ENSG00000118523	ENST00000367976	T	0.71579	-0.58	5.57	5.57	0.84162	von Willebrand factor, type C (4);	0.049682	0.85682	D	0.000000	T	0.80732	0.4679	M	0.63208	1.945	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80946	-0.1155	10	0.59425	D	0.04	.	19.5503	0.95314	0.0:1.0:0.0:0.0	.	162	P29279	CTGF_HUMAN	K	162	ENSP00000356954:E162K	ENSP00000356954:E162K	E	-	1	0	CTGF	132313182	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	7.818000	0.86416	2.619000	0.88677	0.561000	0.74099	GAG	.	.	.	none		0.652	CTGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042239.2	NM_001901	
BCLAF1	9774	hgsc.bcm.edu	37	6	136596669	136596669	+	Splice_Site	SNP	C	C	T			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr6:136596669C>T	ENST00000531224.1	-	6	2105		c.e6+1		BCLAF1_ENST00000530767.1_Splice_Site|BCLAF1_ENST00000353331.4_Splice_Site|BCLAF1_ENST00000527536.1_Splice_Site|BCLAF1_ENST00000527759.1_Splice_Site|BCLAF1_ENST00000392348.2_Splice_Site	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1						apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		ACTAAGCATACCTTTAACATG	0.358																																					.	Colon(142;1534 1789 5427 7063 28491)	Atlas-SNP	.											.	BCLAF1	203	.	0			c.1852+1G>A						PASS	.						146.0	131.0	136.0					6																	136596669		2203	4300	6503	SO:0001630	splice_region_variant	9774	exon7			AGCATACCTTTAA	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.1852+1G>A	chr6.hg19:g.136596669C>T		143.0	0.0	.		175.0	8.0	.	NM_014739	A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Splice_Site	SNP	ENST00000531224.1	hg19	CCDS5177.1	.	.	.	.	.	.	.	.	.	.	C	16.19	3.053045	0.55218	.	.	ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000530767;ENST00000527759;ENST00000392348;ENST00000529826	.	.	.	5.14	5.14	0.70334	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.9665	0.86287	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	BCLAF1	136638362	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	6.683000	0.74533	2.661000	0.90470	0.460000	0.39030	.	.	.	.	none		0.358	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739	Intron
SASH1	23328	hgsc.bcm.edu	37	6	148808752	148808752	+	Silent	SNP	C	C	G			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr6:148808752C>G	ENST00000367467.3	+	8	1105	c.630C>G	c.(628-630)ctC>ctG	p.L210L		NM_015278.3	NP_056093.3	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	210					positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of p38MAPK cascade (GO:1900745)|protein polyubiquitination (GO:0000209)|regulation of protein autoubiquitination (GO:1902498)|regulation of protein K63-linked ubiquitination (GO:1900044)	membrane (GO:0016020)|protein complex (GO:0043234)	mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein C-terminus binding (GO:0008022)|protein complex scaffold (GO:0032947)|protein kinase binding (GO:0019901)			breast(4)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		TGTTACAGCTCAAGGAATACG	0.488																																					p.L210L		Atlas-SNP	.											.	SASH1	123	.	0			c.C630G						PASS	.						93.0	99.0	97.0					6																	148808752		2203	4300	6503	SO:0001819	synonymous_variant	23328	exon8			ACAGCTCAAGGAA	AB018333	CCDS5212.1	6q24.3	2013-01-10			ENSG00000111961	ENSG00000111961		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	19182	protein-coding gene	gene with protein product		607955				9872452, 12771949	Standard	NM_015278		Approved	KIAA0790, dJ323M4.1, SH3D6A	uc003qme.1	O94885	OTTHUMG00000015773	ENST00000367467.3:c.630C>G	chr6.hg19:g.148808752C>G		221.0	0.0	.		194.0	68.0	.	NM_015278	Q5TGN5|Q8TAI0|Q9H7R7	Silent	SNP	ENST00000367467.3	hg19	CCDS5212.1																																																																																			.	.	.	none		0.488	SASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042619.1	NM_015278	
TNRC18	84629	hgsc.bcm.edu	37	7	5352384	5352384	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr7:5352384G>A	ENST00000430969.1	-	27	8486	c.8138C>T	c.(8137-8139)tCg>tTg	p.S2713L	TNRC18_ENST00000399537.4_Missense_Mutation_p.S2713L	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	2713							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GGAGTGGGCCGAGGGCCGCGC	0.761																																					p.S2713L		Atlas-SNP	.											TNRC18_ENST00000430969,colon,carcinoma,0,3	TNRC18	311	.	0			c.C8138T						PASS	.						4.0	6.0	6.0					7																	5352384		1215	2847	4062	SO:0001583	missense	84629	exon27			TGGGCCGAGGGCC	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.8138C>T	chr7.hg19:g.5352384G>A	ENSP00000395538:p.Ser2713Leu	39.0	0.0	.		38.0	7.0	.	NM_001080495	A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	ENST00000430969.1	hg19	CCDS47534.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	6.791|6.791	0.514848|0.514848	0.12944|0.12944	.|.	.|.	ENSG00000182095|ENSG00000182095	ENST00000399544|ENST00000399537;ENST00000430969	.|T;T	.|0.05258	.|3.47;3.47	4.31|4.31	2.46|2.46	0.29980|0.29980	.|.	.|.	.|.	.|.	.|.	T|T	0.06280|0.06280	0.0162|0.0162	L|L	0.46157|0.46157	1.445|1.445	0.09310|0.09310	N|N	1|1	.|B	.|0.12013	.|0.005	.|B	.|0.06405	.|0.002	T|T	0.45026|0.45026	-0.9289|-0.9289	6|9	0.87932|0.09590	D|T	0|0.72	.|.	10.6731|10.6731	0.45770|0.45770	0.1532:0.0:0.8468:0.0|0.1532:0.0:0.8468:0.0	.|.	.|2713	.|O15417	.|TNC18_HUMAN	W|L	1226|2713	.|ENSP00000382452:S2713L;ENSP00000395538:S2713L	ENSP00000382459:R1226W|ENSP00000382452:S2713L	R|S	-|-	1|2	2|0	TNRC18|TNRC18	5318910|5318910	0.746000|0.746000	0.28272|0.28272	0.001000|0.001000	0.08648|0.08648	0.012000|0.012000	0.07955|0.07955	2.496000|2.496000	0.45346|0.45346	0.246000|0.246000	0.21394|0.21394	0.484000|0.484000	0.47621|0.47621	CGG|TCG	.	.	.	none		0.761	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
TNS3	64759	hgsc.bcm.edu	37	7	47440438	47440438	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr7:47440438G>A	ENST00000398879.1	-	14	1163	c.797C>T	c.(796-798)gCt>gTt	p.A266V	TNS3_ENST00000311160.9_Missense_Mutation_p.A266V|TNS3_ENST00000355730.3_Intron			Q68CZ2	TENS3_HUMAN	tensin 3	266	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				cell migration (GO:0016477)|lung alveolus development (GO:0048286)|positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(17)|endometrium(5)|kidney(4)|large_intestine(7)|liver(1)|lung(16)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	64						GCCCTGCACAGCCCCAGTGTG	0.577																																					p.A266V		Atlas-SNP	.											.	TNS3	140	.	0			c.C797T						PASS	.						78.0	98.0	91.0					7																	47440438		2047	4182	6229	SO:0001583	missense	64759	exon14			TGCACAGCCCCAG	AF378756	CCDS5506.2	7p12.3	2013-02-14	2005-05-13	2005-05-13	ENSG00000136205	ENSG00000136205		"""SH2 domain containing"""	21616	protein-coding gene	gene with protein product	"""tumor endothelial marker 6"""	606825	"""tensin-like SH2 domain-containing 1"""	TENS1		11559528	Standard	NM_022748		Approved	TEM6, H_NH0549I23.2, FLJ13732	uc003tnw.3	Q68CZ2	OTTHUMG00000074075	ENST00000398879.1:c.797C>T	chr7.hg19:g.47440438G>A	ENSP00000381854:p.Ala266Val	95.0	0.0	.		92.0	38.0	.	NM_022748	B2RNV1|Q6IPQ2|Q8IZW7|Q8NAD0|Q96PE0|Q96S48	Missense_Mutation	SNP	ENST00000398879.1	hg19	CCDS5506.2	.	.	.	.	.	.	.	.	.	.	G	25.5	4.643525	0.87859	.	.	ENSG00000136205	ENST00000311160;ENST00000538633;ENST00000398879;ENST00000457718;ENST00000450444	D;D;D;D	0.84800	-1.9;-1.9;-1.9;-1.9	4.99	4.99	0.66335	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.86793	0.6018	M	0.74546	2.27	0.80722	D	1	P	0.46859	0.885	P	0.45753	0.492	D	0.87020	0.2128	10	0.39692	T	0.17	-16.8831	15.8183	0.78621	0.0:0.0:1.0:0.0	.	266	Q68CZ2	TENS3_HUMAN	V	266;376;266;369;355	ENSP00000312143:A266V;ENSP00000381854:A266V;ENSP00000414358:A369V;ENSP00000396914:A355V	ENSP00000312143:A266V	A	-	2	0	TNS3	47406963	1.000000	0.71417	0.436000	0.26797	0.965000	0.64279	7.322000	0.79097	2.337000	0.79520	0.456000	0.33151	GCT	.	.	.	none		0.577	TNS3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157253.1	NM_022748	
PPP1R9A	55607	hgsc.bcm.edu	37	7	94915545	94915545	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr7:94915545C>A	ENST00000433881.1	+	13	3317	c.2785C>A	c.(2785-2787)Ccc>Acc	p.P929T	PPP1R9A_ENST00000340694.4_Missense_Mutation_p.P929T|PPP1R9A_ENST00000289495.5_Missense_Mutation_p.P1135T|PPP1R9A_ENST00000433360.1_Missense_Mutation_p.P1213T|PPP1R9A_ENST00000424654.1_Missense_Mutation_p.P1153T|PPP1R9A_ENST00000456331.2_Missense_Mutation_p.P1153T			Q9ULJ8	NEB1_HUMAN	protein phosphatase 1, regulatory subunit 9A	929	Interacts with TGN38. {ECO:0000250}.				actin filament organization (GO:0007015)|calcium-mediated signaling (GO:0019722)|neuron projection development (GO:0031175)	cell junction (GO:0030054)|cortical actin cytoskeleton (GO:0030864)|dendritic spine (GO:0043197)|filopodium (GO:0030175)|growth cone (GO:0030426)|synapse (GO:0045202)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(11)|liver(2)|lung(22)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(8)|urinary_tract(5)	71	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)			TGACTTCAGTCCCAGCAGTAC	0.453										HNSCC(28;0.073)																											p.P1213T		Atlas-SNP	.											.	PPP1R9A	264	.	0			c.C3637A						PASS	.						94.0	84.0	87.0					7																	94915545		2203	4300	6503	SO:0001583	missense	55607	exon18			TTCAGTCCCAGCA	AB033048	CCDS34683.1, CCDS55127.1, CCDS55128.1	7q21.3	2013-01-10	2011-10-04		ENSG00000158528	ENSG00000158528		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Sterile alpha motif (SAM) domain containing"""	14946	protein-coding gene	gene with protein product		602468	"""protein phosphatase 1, regulatory (inhibitor) subunit 9A"""			10574462	Standard	NM_001166160		Approved	Neurabin-I, KIAA1222, FLJ20068	uc010lfj.3	Q9ULJ8	OTTHUMG00000155566	ENST00000433881.1:c.2785C>A	chr7.hg19:g.94915545C>A	ENSP00000398870:p.Pro929Thr	55.0	0.0	.		64.0	23.0	.	NM_001166160	A1L494|B2RWQ1|E9PCA0|E9PCK6|E9PDX1|F8W7J9|O76059|Q9NXT2	Missense_Mutation	SNP	ENST00000433881.1	hg19	CCDS34683.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.022533	0.75275	.	.	ENSG00000158528	ENST00000433360;ENST00000340694;ENST00000424654;ENST00000433881;ENST00000289495;ENST00000456331	T;T;T;T;T;T	0.19669	2.14;2.32;2.18;2.32;2.13;2.18	4.99	4.99	0.66335	.	0.219511	0.40728	N	0.001031	T	0.37183	0.0994	L	0.34521	1.04	0.35638	D	0.810778	D;D;D;D;D;P	0.89917	0.979;1.0;0.999;1.0;0.999;0.682	P;D;D;D;D;B	0.79108	0.525;0.992;0.973;0.972;0.941;0.096	T	0.31888	-0.9927	10	0.45353	T	0.12	.	18.8526	0.92238	0.0:1.0:0.0:0.0	.	929;1135;1213;1153;1153;929	B7ZLX4;F8W7J9;E9PDX1;D6W5R0;E9PCK6;Q9ULJ8	.;.;.;.;.;NEB1_HUMAN	T	1213;929;1153;929;1135;1153	ENSP00000405514:P1213T;ENSP00000344524:P929T;ENSP00000411342:P1153T;ENSP00000398870:P929T;ENSP00000289495:P1135T;ENSP00000402893:P1153T	ENSP00000289495:P1135T	P	+	1	0	PPP1R9A	94753481	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	2.886000	0.48578	2.758000	0.94735	0.655000	0.94253	CCC	.	.	.	none		0.453	PPP1R9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340662.1	NM_001166160	
SLC35G5	83650	hgsc.bcm.edu	37	8	11188670	11188670	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr8:11188670C>T	ENST00000382435.4	+	1	274	c.55C>T	c.(55-57)Ccc>Tcc	p.P19S		NM_001282300.1|NM_054028.1	NP_001269229.1|NP_473369.1	Q96KT7	S35G5_HUMAN	solute carrier family 35, member G5	19						integral component of membrane (GO:0016021)											CCCATCGCCGCCCTCCGCTCC	0.677																																					p.P19S		Atlas-SNP	.											.	.	.	.	0			c.C55T						PASS	.						54.0	56.0	55.0					8																	11188670		2203	4300	6503	SO:0001583	missense	83650	exon1			TCGCCGCCCTCCG	AJ291677	CCDS5980.1	8p23.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000177710	ENSG00000177710		"""Solute carriers"""	15546	protein-coding gene	gene with protein product		615199	"""acyl-malonyl condensing enzyme 1-like 2"""	AMAC, AMAC1L2			Standard	NM_054028		Approved		uc003wtp.1	Q96KT7	OTTHUMG00000090653	ENST00000382435.4:c.55C>T	chr8.hg19:g.11188670C>T	ENSP00000371872:p.Pro19Ser	82.0	0.0	.		72.0	28.0	.	NM_054028	A2RRL6	Missense_Mutation	SNP	ENST00000382435.4	hg19	CCDS5980.1	.	.	.	.	.	.	.	.	.	.	C	10.07	1.250440	0.22880	.	.	ENSG00000177710	ENST00000382435	T	0.27256	1.68	0.34	0.34	0.15985	.	0.159640	0.29321	N	0.012484	T	0.28797	0.0714	N	0.24115	0.695	0.09310	N	0.999993	D	0.89917	1.0	D	0.80764	0.994	T	0.08310	-1.0728	9	0.35671	T	0.21	-11.4858	.	.	.	.	19	Q96KT7	S35G5_HUMAN	S	19	ENSP00000371872:P19S	ENSP00000371872:P19S	P	+	1	0	SLC35G5	11226080	0.007000	0.16637	0.221000	0.23827	0.172000	0.22775	0.166000	0.16583	0.426000	0.26116	0.089000	0.15464	CCC	.	.	.	none		0.677	SLC35G5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207313.2	NM_054028	
ANK1	286	hgsc.bcm.edu	37	8	41577342	41577342	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr8:41577342C>T	ENST00000347528.4	-	10	1027	c.944G>A	c.(943-945)gGa>gAa	p.G315E	ANK1_ENST00000265709.8_Missense_Mutation_p.G348E|ANK1_ENST00000396942.1_Missense_Mutation_p.G315E|ANK1_ENST00000379758.2_Missense_Mutation_p.G315E|ANK1_ENST00000352337.4_Missense_Mutation_p.G315E|ANK1_ENST00000289734.7_Missense_Mutation_p.G315E|ANK1_ENST00000396945.1_Missense_Mutation_p.G315E	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	315	89 kDa domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			GAGGTGGTCTCCCTGAGCCGC	0.567																																					p.G348E		Atlas-SNP	.											.	ANK1	497	.	0			c.G1043A						PASS	.						178.0	151.0	160.0					8																	41577342		2203	4300	6503	SO:0001583	missense	286	exon10			TGGTCTCCCTGAG	M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.944G>A	chr8.hg19:g.41577342C>T	ENSP00000339620:p.Gly315Glu	157.0	0.0	.		142.0	57.0	.	NM_001142446	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	ENST00000347528.4	hg19	CCDS6119.1	.	.	.	.	.	.	.	.	.	.	C	32	5.138021	0.94517	.	.	ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	T;T;T;T;T;T;T	0.62232	0.04;0.04;0.04;0.04;0.04;0.04;0.04	5.91	5.91	0.95273	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.69106	0.3074	N	0.17345	0.48	0.80722	D	1	D;D;P;D;D	0.89917	1.0;1.0;0.744;1.0;1.0	D;D;B;D;D	0.97110	1.0;1.0;0.414;0.988;1.0	T	0.71728	-0.4505	10	0.54805	T	0.06	.	20.2963	0.98556	0.0:1.0:0.0:0.0	.	348;315;315;315;315	P16157-21;P16157-4;P16157;P16157-5;P16157-3	.;.;ANK1_HUMAN;.;.	E	315;315;315;315;315;315;348;315	ENSP00000339620:G315E;ENSP00000289734:G315E;ENSP00000369082:G315E;ENSP00000380149:G315E;ENSP00000380147:G315E;ENSP00000309131:G315E;ENSP00000265709:G348E	ENSP00000265709:G348E	G	-	2	0	ANK1	41696499	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.757000	0.85209	2.813000	0.96785	0.655000	0.94253	GGA	.	.	.	none		0.567	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475	
SPIN1	10927	hgsc.bcm.edu	37	9	91083448	91083448	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr9:91083448G>C	ENST00000375859.3	+	5	795	c.517G>C	c.(517-519)Gac>Cac	p.D173H	SPIN1_ENST00000541629.1_Missense_Mutation_p.D173H|SPIN1_ENST00000469017.2_3'UTR	NM_006717.2	NP_006708.2	Q9Y657	SPIN1_HUMAN	spindlin 1	173	Tudor-like domain 2.				chromatin modification (GO:0016568)|gamete generation (GO:0007276)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|positive regulation of Wnt signaling pathway (GO:0030177)|rRNA transcription (GO:0009303)|Wnt signaling pathway (GO:0016055)	nucleolus (GO:0005730)|nucleus (GO:0005634)|spindle (GO:0005819)	methylated histone binding (GO:0035064)			endometrium(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	4						CTATGAGAAAGACCCTGTCTT	0.403																																					p.D173H		Atlas-SNP	.											.	SPIN1	22	.	0			c.G517C						PASS	.						188.0	182.0	184.0					9																	91083448		2158	4287	6445	SO:0001583	missense	10927	exon5			GAGAAAGACCCTG	AF317228	CCDS43843.1	9q22.1	2008-02-05	2007-01-03	2007-01-03	ENSG00000106723	ENSG00000106723			11243	protein-coding gene	gene with protein product		609936	"""spindlin"""	SPIN		16098913	Standard	NM_006717		Approved		uc004apy.3	Q9Y657	OTTHUMG00000020168	ENST00000375859.3:c.517G>C	chr9.hg19:g.91083448G>C	ENSP00000365019:p.Asp173His	173.0	0.0	.		132.0	11.0	.	NM_006717	A8K0X6|B3KRQ4|Q7KZJ8|Q9GZT2|Q9H0N7	Missense_Mutation	SNP	ENST00000375859.3	hg19	CCDS43843.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.466930	0.84425	.	.	ENSG00000106723	ENST00000375859;ENST00000541629	T;T	0.55588	0.51;0.51	5.12	4.2	0.49525	.	0.000000	0.85682	D	0.000000	T	0.69088	0.3072	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.73353	-0.4009	10	0.87932	D	0	-20.5419	14.8406	0.70220	0.0:0.0:0.8552:0.1448	.	173	Q9Y657	SPIN1_HUMAN	H	173	ENSP00000365019:D173H;ENSP00000441864:D173H	ENSP00000365019:D173H	D	+	1	0	SPIN1	90273268	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	9.155000	0.94700	1.327000	0.45338	0.655000	0.94253	GAC	.	.	.	none		0.403	SPIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052967.1	NM_006717	
SPAG6	9576	hgsc.bcm.edu	37	10	22676767	22676767	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr10:22676767G>T	ENST00000376624.3	+	6	836	c.694G>T	c.(694-696)Gct>Tct	p.A232S	SPAG6_ENST00000376603.2_Missense_Mutation_p.A308S|SPAG6_ENST00000313311.6_Missense_Mutation_p.A232S|RP11-301N24.3_ENST00000422675.1_RNA|SPAG6_ENST00000538630.1_Missense_Mutation_p.A207S|SPAG6_ENST00000376601.1_Intron	NM_001253855.1|NM_012443.3	NP_001240784.1|NP_036575.1	O75602	SPAG6_HUMAN	sperm associated antigen 6	232					cell projection organization (GO:0030030)|spermatid development (GO:0007286)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|motile cilium (GO:0031514)|nucleus (GO:0005634)				breast(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|prostate(1)|skin(2)	27						GATCCTTTCAGCTCTCAGTCA	0.373																																					p.A232S		Atlas-SNP	.											.	SPAG6	90	.	0			c.G694T						PASS	.						78.0	77.0	77.0					10																	22676767		2203	4300	6503	SO:0001583	missense	9576	exon6			CTTTCAGCTCTCA	AF079363	CCDS7139.1, CCDS7140.1, CCDS58071.1, CCDS73072.1	10p12.31	2014-01-21			ENSG00000077327	ENSG00000077327		"""Armadillo repeat containing"""	11215	protein-coding gene	gene with protein product	"""axoneme central apparatus protein"""	605730				10493827	Standard	NM_012443		Approved	Repro-SA-1, pf16, CT141	uc001iri.3	O75602	OTTHUMG00000017808	ENST00000376624.3:c.694G>T	chr10.hg19:g.22676767G>T	ENSP00000365811:p.Ala232Ser	129.0	0.0	.		80.0	27.0	.	NM_172242	A8K1I8|B4DXZ4|Q5VUX5|Q5VUX6|Q5VUX7|Q6FI74|Q8NHQ6	Missense_Mutation	SNP	ENST00000376624.3	hg19	CCDS7139.1	.	.	.	.	.	.	.	.	.	.	G	14.72	2.620704	0.46736	.	.	ENSG00000077327	ENST00000376624;ENST00000376603;ENST00000538630;ENST00000313311	T;T;T;T	0.80738	-1.41;-1.41;-1.41;-1.41	5.64	3.8	0.43715	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.86936	0.6053	M	0.83953	2.67	0.58432	D	0.999999	P;P;P;P	0.49783	0.795;0.928;0.866;0.74	P;P;P;P	0.55222	0.714;0.771;0.508;0.588	D	0.87333	0.2326	10	0.66056	D	0.02	-21.9001	12.0263	0.53373	0.1391:0.0:0.8609:0.0	.	207;308;232;232	B4DXZ4;O75602-3;O75602-2;O75602	.;.;.;SPAG6_HUMAN	S	232;308;207;232	ENSP00000365811:A232S;ENSP00000365788:A308S;ENSP00000441325:A207S;ENSP00000323599:A232S	ENSP00000323599:A232S	A	+	1	0	SPAG6	22716773	1.000000	0.71417	0.582000	0.28627	0.580000	0.36256	6.587000	0.74071	0.744000	0.32741	0.655000	0.94253	GCT	.	.	.	none		0.373	SPAG6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047187.1		
PIP4K2A	5305	hgsc.bcm.edu	37	10	23003187	23003187	+	Silent	SNP	G	G	A			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr10:23003187G>A	ENST00000376573.4	-	1	297	c.69C>T	c.(67-69)ttC>ttT	p.F23F	PIP4K2A_ENST00000545335.1_5'Flank	NM_005028.4	NP_005019.2	P48426	PI42A_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type II, alpha	23					megakaryocyte development (GO:0035855)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|1-phosphatidylinositol-5-phosphate 4-kinase activity (GO:0016309)|ATP binding (GO:0005524)			endometrium(4)|kidney(13)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	29						TCTGCGCTACGAAGTGCTTCT	0.647																																					p.F23F		Atlas-SNP	.											.	PIP4K2A	59	.	0			c.C69T						PASS	.						94.0	85.0	88.0					10																	23003187		2203	4300	6503	SO:0001819	synonymous_variant	5305	exon1			CGCTACGAAGTGC	S78798	CCDS7141.1	10p12.2	2007-08-21	2007-08-14	2007-08-14	ENSG00000150867	ENSG00000150867			8997	protein-coding gene	gene with protein product		603140	"""phosphatidylinositol-4-phosphate 5-kinase, type II, alpha"""	PIP5K2A		7852364, 9367159	Standard	NM_005028		Approved	PIP5KIIA, PIP5KIIalpha	uc001irl.4	P48426	OTTHUMG00000017810	ENST00000376573.4:c.69C>T	chr10.hg19:g.23003187G>A		63.0	0.0	.		48.0	23.0	.	NM_005028	B0YJ66|B4DGX2|D3DRV1|P53807|Q5VUX3	Silent	SNP	ENST00000376573.4	hg19	CCDS7141.1																																																																																			.	.	.	none		0.647	PIP4K2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047193.1	NM_005028	
ZNF485	220992	hgsc.bcm.edu	37	10	44112496	44112496	+	Silent	SNP	C	C	T			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr10:44112496C>T	ENST00000361807.3	+	5	1199	c.1005C>T	c.(1003-1005)ttC>ttT	p.F335F	ZNF485_ENST00000374437.2_Silent_p.F244F|ZNF485_ENST00000374435.3_Silent_p.F335F	NM_145312.3	NP_660355.2	Q8NCK3	ZN485_HUMAN	zinc finger protein 485	335					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	16						GAAAATCTTTCAGGTATAGCT	0.428																																					p.F335F		Atlas-SNP	.											.	ZNF485	102	.	0			c.C1005T						PASS	.						117.0	117.0	117.0					10																	44112496		2203	4300	6503	SO:0001819	synonymous_variant	220992	exon5			ATCTTTCAGGTAT	AK074679	CCDS7205.2	10q11.21	2013-01-08			ENSG00000198298	ENSG00000198298		"""Zinc fingers, C2H2-type"", ""-"""	23440	protein-coding gene	gene with protein product							Standard	NM_145312		Approved		uc010qfc.2	Q8NCK3	OTTHUMG00000018040	ENST00000361807.3:c.1005C>T	chr10.hg19:g.44112496C>T		145.0	0.0	.		119.0	46.0	.	NM_145312	B4DSE6|Q96CL0	Silent	SNP	ENST00000361807.3	hg19	CCDS7205.2																																																																																			.	.	.	none		0.428	ZNF485-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047719.2	NM_145312	
PCDH15	65217	hgsc.bcm.edu	37	10	55583106	55583106	+	Silent	SNP	G	G	C			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr10:55583106G>C	ENST00000320301.6	-	33	4774	c.4380C>G	c.(4378-4380)ctC>ctG	p.L1460L	PCDH15_ENST00000395432.2_Silent_p.L1420L|PCDH15_ENST00000395430.1_Silent_p.L1457L|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000414778.1_Intron|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000409834.1_Intron|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000395438.1_Intron|PCDH15_ENST00000395433.1_Silent_p.L1437L|PCDH15_ENST00000463095.1_5'UTR|PCDH15_ENST00000361849.3_Silent_p.L1462L|PCDH15_ENST00000437009.1_Silent_p.L1391L|PCDH15_ENST00000395445.1_Intron|PCDH15_ENST00000373965.2_Intron|PCDH15_ENST00000395446.1_Intron	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	1460					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				GAAAATGGTAGAGAAGGAAAA	0.363										HNSCC(58;0.16)																											p.L1467L		Atlas-SNP	.											.	PCDH15	1715	.	0			c.C4401G						PASS	.						94.0	97.0	96.0					10																	55583106		2203	4300	6503	SO:0001819	synonymous_variant	65217	exon35			ATGGTAGAGAAGG	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.4380C>G	chr10.hg19:g.55583106G>C		104.0	0.0	.		79.0	12.0	.	NM_001142763	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Silent	SNP	ENST00000320301.6	hg19	CCDS7248.1																																																																																			.	.	.	none		0.363	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	
FAM178A	55719	hgsc.bcm.edu	37	10	102683799	102683799	+	Silent	SNP	C	C	T			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr10:102683799C>T	ENST00000238961.4	+	5	1583	c.1041C>T	c.(1039-1041)agC>agT	p.S347S	FAM178A_ENST00000370271.3_Silent_p.S347S|FAM178A_ENST00000370269.3_Silent_p.S347S	NM_018121.3	NP_060591.3	Q8IX21	F178A_HUMAN	family with sequence similarity 178, member A	347						chromatin (GO:0000785)|extracellular space (GO:0005615)|nucleus (GO:0005634)											ATCTGAAAAGCACAAGAGAAT	0.343																																					p.S347S		Atlas-SNP	.											.	FAM178A	9	.	0			c.C1041T						PASS	.						44.0	43.0	43.0					10																	102683799		2203	4300	6503	SO:0001819	synonymous_variant	55719	exon5			GAAAAGCACAAGA	AF460991	CCDS7500.1, CCDS44470.1, CCDS65918.1	10q24.31	2008-07-18	2008-07-18	2008-07-18	ENSG00000119906	ENSG00000119906			17814	protein-coding gene	gene with protein product		610348	"""chromosome 10 open reading frame 6"""	C10orf6		12459258	Standard	NM_018121		Approved	FLJ10512, FLJ25012	uc001krs.3	Q8IX21	OTTHUMG00000018919	ENST00000238961.4:c.1041C>T	chr10.hg19:g.102683799C>T		76.0	0.0	.		50.0	22.0	.	NM_001136123	A8K950|B1AL17|Q5W0L8|Q6GMU6|Q9NPE8	Silent	SNP	ENST00000238961.4	hg19	CCDS7500.1																																																																																			.	.	.	none		0.343	FAM178A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049897.3		
NFKB2	4791	hgsc.bcm.edu	37	10	104161522	104161522	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr10:104161522G>C	ENST00000369966.3	+	21	2564	c.2314G>C	c.(2314-2316)Gat>Cat	p.D772H	NFKB2_ENST00000189444.6_Missense_Mutation_p.D772H|NFKB2_ENST00000428099.1_Missense_Mutation_p.D772H	NM_001077494.2	NP_001070962.1	Q00653	NFKB2_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)	772	Death.		Missing (in truncated form EB308).|Missing (in truncated form LB40).|Missing (in truncated form p80HT).		extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|spleen development (GO:0048536)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|skin(2)	23		Colorectal(252;0.00957)		Epithelial(162;3.4e-08)|all cancers(201;6.41e-07)	Acetylsalicylic acid(DB00945)|Glucosamine(DB01296)	GTCACTTGGTGATACAGCTCT	0.597			T	IGH@	B-NHL																																p.D772H		Atlas-SNP	.		Dom	yes		10	10q24	4791	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)		L	.	NFKB2	48	.	0			c.G2314C						PASS	.						47.0	47.0	47.0					10																	104161522		1987	4164	6151	SO:0001583	missense	4791	exon21			CTTGGTGATACAG	X61498	CCDS41564.1, CCDS41565.1	10q24	2013-01-10			ENSG00000077150	ENSG00000077150		"""Ankyrin repeat domain containing"""	7795	protein-coding gene	gene with protein product		164012				1876189	Standard	XM_005269860		Approved	LYT-10, p52, p105, NF-kB2	uc001kvb.4	Q00653	OTTHUMG00000018962	ENST00000369966.3:c.2314G>C	chr10.hg19:g.104161522G>C	ENSP00000358983:p.Asp772His	37.0	0.0	.		43.0	9.0	.	NM_001077494	A8K9D9|D3DR83|Q04860|Q9BU75|Q9H471|Q9H472	Missense_Mutation	SNP	ENST00000369966.3	hg19	CCDS41564.1	.	.	.	.	.	.	.	.	.	.	g	15.85	2.954405	0.53293	.	.	ENSG00000077150	ENST00000428099;ENST00000369966;ENST00000336486;ENST00000189444	T;T;T	0.21543	2.0;2.0;2.0	3.79	3.79	0.43588	Death (1);DEATH-like (2);	0.428788	0.25052	N	0.033513	T	0.17109	0.0411	L	0.36672	1.1	0.20403	N	0.999908	P;P	0.50943	0.94;0.94	P;P	0.44732	0.459;0.459	T	0.11397	-1.0589	10	0.59425	D	0.04	.	6.0921	0.20001	0.1804:0.0:0.8196:0.0	.	772;772	Q00653;A8K9D9	NFKB2_HUMAN;.	H	772	ENSP00000410256:D772H;ENSP00000358983:D772H;ENSP00000189444:D772H	ENSP00000189444:D772H	D	+	1	0	NFKB2	104151512	1.000000	0.71417	0.127000	0.21898	0.959000	0.62525	4.901000	0.63259	2.105000	0.64084	0.556000	0.70494	GAT	.	.	.	none		0.597	NFKB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050080.2		
OR51B6	390058	hgsc.bcm.edu	37	11	5373545	5373545	+	Missense_Mutation	SNP	G	G	T	rs138981931		TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr11:5373545G>T	ENST00000380219.1	+	1	808	c.808G>T	c.(808-810)Gtt>Ttt	p.V270F	HBG2_ENST00000380252.1_Intron|AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380259.2_Intron|HBE1_ENST00000380237.1_Intron	NM_001004750.1	NP_001004750.1	Q9H340	O51B6_HUMAN	olfactory receptor, family 51, subfamily B, member 6	270					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|skin(2)|urinary_tract(1)	21		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCCTCATGTCGTTCACATCAC	0.398																																					p.V270F		Atlas-SNP	.											.	OR51B6	53	.	0			c.G808T						PASS	.						215.0	193.0	200.0					11																	5373545		2201	4297	6498	SO:0001583	missense	390058	exon1			CATGTCGTTCACA		CCDS31379.1	11p15.4	2012-08-09			ENSG00000176239	ENSG00000176239		"""GPCR / Class A : Olfactory receptors"""	19600	protein-coding gene	gene with protein product							Standard	NM_001004750		Approved		uc010qzb.2	Q9H340	OTTHUMG00000066669	ENST00000380219.1:c.808G>T	chr11.hg19:g.5373545G>T	ENSP00000369568:p.Val270Phe	220.0	0.0	.		195.0	83.0	.	NM_001004750		Missense_Mutation	SNP	ENST00000380219.1	hg19	CCDS31379.1	.	.	.	.	.	.	.	.	.	.	G	14.71	2.618023	0.46736	.	.	ENSG00000176239	ENST00000537299;ENST00000380219	T	0.00130	8.69	5.13	4.22	0.49857	GPCR, rhodopsin-like superfamily (1);	0.136091	0.33127	N	0.005251	T	0.00412	0.0013	M	0.76838	2.35	0.09310	N	1	D	0.71674	0.998	D	0.74674	0.984	T	0.38222	-0.9671	10	0.87932	D	0	.	8.1363	0.31056	0.0849:0.1595:0.7556:0.0	.	270	Q9H340	O51B6_HUMAN	F	269;270	ENSP00000369568:V270F	ENSP00000369568:V270F	V	+	1	0	OR51B6	5330121	0.114000	0.22134	0.847000	0.33407	0.957000	0.61999	0.805000	0.27112	1.379000	0.46325	0.650000	0.86243	GTT	.	G|1.000;A|0.000	.	alt		0.398	OR51B6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142960.1	NM_001004750	
TUB	7275	hgsc.bcm.edu	37	11	8120419	8120419	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr11:8120419C>G	ENST00000299506.2	+	9	1262	c.1113C>G	c.(1111-1113)tgC>tgG	p.C371W	TUB_ENST00000305253.4_Missense_Mutation_p.C426W|TUB_ENST00000534099.1_Missense_Mutation_p.C377W	NM_177972.2	NP_813977.1	P50607	TUB_HUMAN	tubby bipartite transcription factor	371					multicellular organismal macromolecule metabolic process (GO:0044259)|phagocytosis (GO:0006909)|phototransduction (GO:0007602)|positive regulation of phagocytosis (GO:0050766)|response to hormone (GO:0009725)|retina development in camera-type eye (GO:0060041)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled photoreceptor activity (GO:0008020)|protein complex binding (GO:0032403)			breast(1)|cervix(1)|endometrium(9)|large_intestine(7)|lung(5)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	26		all_lung(207;6.91e-20)|Lung NSC(207;3.36e-17)		Epithelial(150;1.69e-62)|BRCA - Breast invasive adenocarcinoma(625;8.54e-06)|LUSC - Lung squamous cell carcinoma(625;0.000184)		CAGCTGTGTGCTACGTGAGTC	0.502											OREG0020732	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.C426W		Atlas-SNP	.											.	TUB	71	.	0			c.C1278G						PASS	.						114.0	108.0	110.0					11																	8120419		2201	4296	6497	SO:0001583	missense	7275	exon10			TGTGTGCTACGTG	U54644	CCDS7786.1, CCDS7787.1	11p15.5	2013-08-06	2013-08-06		ENSG00000166402	ENSG00000166402			12406	protein-coding gene	gene with protein product		601197	"""tubby (mouse) homolog"", ""tubby homolog (mouse)"""			8612280	Standard	NM_003320		Approved	rd5	uc001mfy.3	P50607	OTTHUMG00000165690	ENST00000299506.2:c.1113C>G	chr11.hg19:g.8120419C>G	ENSP00000299506:p.Cys371Trp	99.0	0.0	.	646	101.0	37.0	.	NM_003320	D3DQU4|O00293|Q6B007	Missense_Mutation	SNP	ENST00000299506.2	hg19	CCDS7787.1	.	.	.	.	.	.	.	.	.	.	C	16.44	3.122978	0.56613	.	.	ENSG00000166402	ENST00000534099;ENST00000305253;ENST00000299506	D;D;D	0.96300	-3.97;-3.97;-3.97	5.27	3.41	0.39046	Tubby, C-terminal (4);	0.000000	0.85682	D	0.000000	D	0.97473	0.9173	M	0.78456	2.415	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.992;0.995;0.987	D	0.96862	0.9633	10	0.62326	D	0.03	0.2328	10.0609	0.42275	0.0:0.7635:0.0:0.2365	.	377;371;426	E9PQR4;P50607;P50607-2	.;TUB_HUMAN;.	W	377;426;371	ENSP00000434400:C377W;ENSP00000305426:C426W;ENSP00000299506:C371W	ENSP00000299506:C371W	C	+	3	2	TUB	8076995	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	2.369000	0.44231	0.723000	0.32274	0.555000	0.69702	TGC	.	.	.	none		0.502	TUB-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385823.1	NM_003320	
ELP4	26610	hgsc.bcm.edu	37	11	31561263	31561263	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr11:31561263A>G	ENST00000350638.5	+	3	349	c.314A>G	c.(313-315)gAa>gGa	p.E105G	ELP4_ENST00000379163.5_Missense_Mutation_p.E105G|ELP4_ENST00000395934.2_Missense_Mutation_p.E105G	NM_019040.3	NP_061913.3	Q96EB1	ELP4_HUMAN	elongator acetyltransferase complex subunit 4	105					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)			breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(3)	20	Lung SC(675;0.225)					TTCCTGGCAGAAGGAATTGTC	0.338																																					p.E105G		Atlas-SNP	.											.	ELP4	78	.	0			c.A314G						PASS	.						192.0	161.0	170.0					11																	31561263		1821	4080	5901	SO:0001583	missense	26610	exon3			TGGCAGAAGGAAT	AJ276005	CCDS7875.2, CCDS73271.1, CCDS73272.1	11p13	2012-08-14	2012-08-08	2002-05-24	ENSG00000109911	ENSG00000109911		"""Elongator acetyltransferase complex subunits"""	1171	protein-coding gene	gene with protein product		606985	"""chromosome 11 open reading frame 19"", ""elongation protein 4 homolog (S. cerevisiae)"""	C11orf19		11889558, 11435442	Standard	XM_005252865		Approved	PAXNEB	uc001mtb.3	Q96EB1	OTTHUMG00000142919	ENST00000350638.5:c.314A>G	chr11.hg19:g.31561263A>G	ENSP00000298937:p.Glu105Gly	271.0	1.0	.		211.0	85.0	.	NM_019040	B4E3W0|E7EPZ6|Q9H4E8|Q9NX11	Missense_Mutation	SNP	ENST00000350638.5	hg19	CCDS7875.2	.	.	.	.	.	.	.	.	.	.	A	22.2	4.257149	0.80246	.	.	ENSG00000109911	ENST00000350638;ENST00000379163;ENST00000395934	T;T;T	0.57595	0.39;0.39;0.39	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.77491	0.4138	M	0.90309	3.105	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.82748	-0.0304	10	0.72032	D	0.01	-12.448	15.207	0.73186	1.0:0.0:0.0:0.0	.	105;105;105	B4E3W0;G5E9D4;Q96EB1	.;.;ELP4_HUMAN	G	105	ENSP00000298937:E105G;ENSP00000368461:E105G;ENSP00000379267:E105G	ENSP00000298937:E105G	E	+	2	0	ELP4	31517839	1.000000	0.71417	1.000000	0.80357	0.789000	0.44602	7.890000	0.87313	2.124000	0.65301	0.383000	0.25322	GAA	.	.	.	none		0.338	ELP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286640.1	NM_019040	
OR4A16	81327	hgsc.bcm.edu	37	11	55111508	55111508	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr11:55111508C>A	ENST00000314721.2	+	1	882	c.832C>A	c.(832-834)Ctc>Atc	p.L278I		NM_001005274.1	NP_001005274.1	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A, member 16	278						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	51						AATTATCACACTCATGTTGAA	0.323																																					p.L278I		Atlas-SNP	.											.	OR4A16	120	.	0			c.C832A						PASS	.						89.0	85.0	86.0					11																	55111508		2201	4296	6497	SO:0001583	missense	81327	exon1			ATCACACTCATGT	AB065519	CCDS31499.1	11q11	2012-08-09			ENSG00000181961	ENSG00000181961		"""GPCR / Class A : Olfactory receptors"""	15153	protein-coding gene	gene with protein product							Standard	NM_001005274		Approved	OR4A16Q	uc010rie.2	Q8NH70	OTTHUMG00000166710	ENST00000314721.2:c.832C>A	chr11.hg19:g.55111508C>A	ENSP00000325128:p.Leu278Ile	87.0	0.0	.		93.0	28.0	.	NM_001005274	Q6IFL3	Missense_Mutation	SNP	ENST00000314721.2	hg19	CCDS31499.1	.	.	.	.	.	.	.	.	.	.	c	10.38	1.333574	0.24167	.	.	ENSG00000181961	ENST00000314721	T	0.37058	1.22	2.86	2.86	0.33363	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.26304	0.0642	N	0.08118	0	0.21802	N	0.999535	B	0.31599	0.33	B	0.40602	0.334	T	0.37126	-0.9719	9	0.87932	D	0	.	11.4549	0.50176	0.0:1.0:0.0:0.0	.	278	Q8NH70	O4A16_HUMAN	I	278	ENSP00000325128:L278I	ENSP00000325128:L278I	L	+	1	0	OR4A16	54868084	0.438000	0.25602	0.986000	0.45419	0.221000	0.24807	6.035000	0.70940	1.606000	0.50161	0.423000	0.28283	CTC	.	.	.	none		0.323	OR4A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391160.1	NM_001005274	
MAGOHB	55110	hgsc.bcm.edu	37	12	10766047	10766047	+	Silent	SNP	G	G	T			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr12:10766047G>T	ENST00000320756.2	-	1	175	c.85C>A	c.(85-87)Cgg>Agg	p.R29R	MAGOHB_ENST00000539554.1_Intron|MAGOHB_ENST00000381881.2_Silent_p.R29R	NM_018048.3	NP_060518.1	Q96A72	MGN2_HUMAN	mago-nashi homolog B (Drosophila)	29					mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|large_intestine(2)	4						CCGTCCGGCCGAAATTCGAAC	0.617																																					p.R29R		Atlas-SNP	.											.	MAGOHB	17	.	0			c.C85A						PASS	.						97.0	98.0	97.0					12																	10766047		2203	4300	6503	SO:0001819	synonymous_variant	55110	exon1			CCGGCCGAAATTC		CCDS8628.1	12p13.2	2014-02-12	2008-01-24		ENSG00000111196	ENSG00000111196			25504	protein-coding gene	gene with protein product							Standard	NM_018048		Approved	FLJ10292, MGN2	uc001qyq.2	Q96A72	OTTHUMG00000168407	ENST00000320756.2:c.85C>A	chr12.hg19:g.10766047G>T		96.0	0.0	.		110.0	9.0	.	NM_018048		Silent	SNP	ENST00000320756.2	hg19	CCDS8628.1																																																																																			.	.	.	none		0.617	MAGOHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399616.1	NM_018048	
CIT	11113	hgsc.bcm.edu	37	12	120173153	120173153	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr12:120173153C>T	ENST00000261833.7	-	24	2894	c.2842G>A	c.(2842-2844)Gac>Aac	p.D948N	CIT_ENST00000392521.2_Missense_Mutation_p.D990N|CIT_ENST00000537607.1_5'UTR	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase	948					cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		TCCTCCAGGTCTGTGATTACC	0.458																																					p.D990N		Atlas-SNP	.											.	CIT	535	.	0			c.G2968A						PASS	.						190.0	170.0	177.0					12																	120173153		2203	4300	6503	SO:0001583	missense	11113	exon25			CCAGGTCTGTGAT	AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.2842G>A	chr12.hg19:g.120173153C>T	ENSP00000261833:p.Asp948Asn	108.0	0.0	.		110.0	43.0	.	NM_001206999	Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Missense_Mutation	SNP	ENST00000261833.7	hg19	CCDS9192.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.553919	0.86231	.	.	ENSG00000122966	ENST00000392521;ENST00000261833	T;T	0.65178	-0.08;-0.14	5.06	5.06	0.68205	.	0.054479	0.64402	D	0.000001	T	0.58104	0.2099	N	0.24115	0.695	0.80722	D	1	D;P;B	0.56035	0.974;0.805;0.447	P;B;B	0.47981	0.563;0.346;0.223	T	0.65059	-0.6260	10	0.72032	D	0.01	.	18.797	0.91999	0.0:1.0:0.0:0.0	.	990;948;481	Q2M5E1;O14578;O14578-3	.;CTRO_HUMAN;.	N	990;948	ENSP00000376306:D990N;ENSP00000261833:D948N	ENSP00000261833:D948N	D	-	1	0	CIT	118657536	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	2.505000	0.84491	0.655000	0.94253	GAC	.	.	.	none		0.458	CIT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259410.4	NM_007174	
OASL	8638	hgsc.bcm.edu	37	12	121465530	121465530	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr12:121465530C>A	ENST00000257570.5	-	4	1018	c.748G>T	c.(748-750)Gaa>Taa	p.E250*	OASL_ENST00000339275.5_Intron	NM_003733.3	NP_003724.1	Q15646	OASL_HUMAN	2'-5'-oligoadenylate synthetase-like	250					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of viral genome replication (GO:0045071)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|thyroid hormone receptor binding (GO:0046966)|transferase activity (GO:0016740)			NS(1)|endometrium(3)|large_intestine(4)|lung(4)|skin(2)	14	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TTCTCGTCTTCTTCAGTACCC	0.478																																					p.E250X	Colon(192;517 2041 31392 31913 39966)	Atlas-SNP	.											.	OASL	49	.	0			c.G748T						PASS	.						142.0	116.0	125.0					12																	121465530		2203	4300	6503	SO:0001587	stop_gained	8638	exon4			CGTCTTCTTCAGT	AF063611	CCDS9211.1, CCDS9212.1, CCDS73536.1	12q24.2	2008-08-05			ENSG00000135114	ENSG00000135114			8090	protein-coding gene	gene with protein product		603281				10087211	Standard	NM_003733		Approved	TRIP14, p59OASL	uc001tzj.2	Q15646	OTTHUMG00000154981	ENST00000257570.5:c.748G>T	chr12.hg19:g.121465530C>A	ENSP00000257570:p.Glu250*	84.0	0.0	.		73.0	26.0	.	NM_003733	B2RAZ2|I1YDD2|O75686|Q17R95|Q9Y6K6|Q9Y6K7	Nonsense_Mutation	SNP	ENST00000257570.5	hg19	CCDS9211.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.434616	0.83885	.	.	ENSG00000135114	ENST00000257570	.	.	.	5.58	-2.54	0.06307	.	3.081050	0.00951	N	0.002969	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.05436	T	0.98	-20.7634	0.3898	0.00408	0.2468:0.2802:0.242:0.231	.	.	.	.	X	250	.	ENSP00000257570:E250X	E	-	1	0	OASL	119949913	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.430000	0.02434	-0.099000	0.12263	-0.302000	0.09304	GAA	.	.	.	none		0.478	OASL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337875.2	NM_003733	
C14orf93	60686	hgsc.bcm.edu	37	14	23467861	23467861	+	Silent	SNP	A	A	C			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr14:23467861A>C	ENST00000299088.6	-	2	801	c.372T>G	c.(370-372)ccT>ccG	p.P124P	RP11-298I3.4_ENST00000555294.1_RNA|RP11-298I3.4_ENST00000556503.1_RNA|C14orf93_ENST00000397379.3_Silent_p.P124P|C14orf93_ENST00000341470.4_Silent_p.P124P|C14orf93_ENST00000397382.4_Silent_p.P124P|C14orf93_ENST00000406429.2_Silent_p.P124P|C14orf93_ENST00000397377.1_5'UTR|C14orf93_ENST00000557513.1_5'Flank	NM_001130708.1|NM_021944.2	NP_001124180.1|NP_068763.2	Q9H972	CN093_HUMAN	chromosome 14 open reading frame 93	124						extracellular region (GO:0005576)	poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(2)|urinary_tract(1)	17	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.0127)		TGAGAGGCCCAGGCTCCTCAG	0.597																																					p.P124P		Atlas-SNP	.											.	C14orf93	33	.	0			c.T372G						PASS	.						58.0	60.0	59.0					14																	23467861		2203	4300	6503	SO:0001819	synonymous_variant	60686	exon2			AGGCCCAGGCTCC	AK023026	CCDS9583.1, CCDS61399.1, CCDS61400.1	14q11.1	2012-09-25			ENSG00000100802	ENSG00000100802			20162	protein-coding gene	gene with protein product							Standard	XM_005267971		Approved	FLJ12154	uc001wih.3	Q9H972	OTTHUMG00000028712	ENST00000299088.6:c.372T>G	chr14.hg19:g.23467861A>C		98.0	0.0	.		53.0	23.0	.	NM_021944	B7WP03|D3DS38|D3DS39|Q86SE6|Q96CF7|Q9HA68	Silent	SNP	ENST00000299088.6	hg19	CCDS9583.1																																																																																			.	.	.	none		0.597	C14orf93-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071688.5	NM_021944	
SOS2	6655	hgsc.bcm.edu	37	14	50605361	50605361	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr14:50605361G>A	ENST00000216373.5	-	18	3201	c.2927C>T	c.(2926-2928)cCt>cTt	p.P976L	SOS2_ENST00000543680.1_Missense_Mutation_p.P943L	NM_006939.2	NP_008870.2	Q07890	SOS2_HUMAN	son of sevenless homolog 2 (Drosophila)	976	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	DNA binding (GO:0003677)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(16)|ovary(2)|skin(1)	39	all_epithelial(31;0.000822)|Breast(41;0.0065)					TAAACAGTAAGGCTGATTCTG	0.308																																					p.P976L		Atlas-SNP	.											.	SOS2	195	.	0			c.C2927T						PASS	.						92.0	92.0	92.0					14																	50605361		2201	4299	6500	SO:0001583	missense	6655	exon18			CAGTAAGGCTGAT	L13858	CCDS9697.1	14q21	2013-01-10	2001-12-04		ENSG00000100485	ENSG00000100485		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11188	protein-coding gene	gene with protein product		601247	"""son of sevenless (Drosophilia) homolog 2"""			8276400	Standard	NM_006939		Approved		uc001wxs.4	Q07890	OTTHUMG00000140292	ENST00000216373.5:c.2927C>T	chr14.hg19:g.50605361G>A	ENSP00000216373:p.Pro976Leu	161.0	0.0	.		110.0	46.0	.	NM_006939	B7ZKT6|D3DSB4|Q15503|Q17RN1	Missense_Mutation	SNP	ENST00000216373.5	hg19	CCDS9697.1	.	.	.	.	.	.	.	.	.	.	G	33	5.254361	0.95336	.	.	ENSG00000100485	ENST00000216373;ENST00000543680	T;T	0.35048	1.33;1.33	5.6	5.6	0.85130	Guanine-nucleotide dissociation stimulator CDC25 (3);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	T	0.61862	0.2381	M	0.87381	2.88	0.80722	D	1	D;D	0.58620	0.983;0.965	P;P	0.55087	0.768;0.708	T	0.69198	-0.5208	10	0.87932	D	0	.	19.6046	0.95575	0.0:0.0:1.0:0.0	.	943;976	B7ZKT6;Q07890	.;SOS2_HUMAN	L	976;943	ENSP00000216373:P976L;ENSP00000445328:P943L	ENSP00000216373:P976L	P	-	2	0	SOS2	49675111	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.405000	0.97313	2.640000	0.89533	0.655000	0.94253	CCT	.	.	.	none		0.308	SOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276878.2		
AK7	122481	hgsc.bcm.edu	37	14	96917831	96917831	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr14:96917831G>A	ENST00000267584.4	+	10	1066	c.1022G>A	c.(1021-1023)cGa>cAa	p.R341Q		NM_152327.3	NP_689540.2	Q96M32	KAD7_HUMAN	adenylate kinase 7	341					axoneme assembly (GO:0035082)|brain development (GO:0007420)|epithelial cilium movement (GO:0003351)|inflammatory response to antigenic stimulus (GO:0002437)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)			breast(2)|cervix(2)|endometrium(3)|large_intestine(8)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	31		all_cancers(154;0.0482)|all_epithelial(191;0.128)|Melanoma(154;0.155)		Epithelial(152;0.134)|COAD - Colon adenocarcinoma(157;0.228)		TTTAATATTCGATGGGCTGCC	0.393																																					p.R341Q		Atlas-SNP	.											.	AK7	69	.	0			c.G1022A						PASS	.						94.0	90.0	91.0					14																	96917831		2203	4300	6503	SO:0001583	missense	122481	exon10			ATATTCGATGGGC	AK057426	CCDS9945.1	14q32.31	2012-08-15			ENSG00000140057	ENSG00000140057		"""Adenylate kinases"""	20091	protein-coding gene	gene with protein product		615364					Standard	NM_152327		Approved	FLJ32864	uc001yfn.3	Q96M32	OTTHUMG00000171421	ENST00000267584.4:c.1022G>A	chr14.hg19:g.96917831G>A	ENSP00000267584:p.Arg341Gln	78.0	0.0	.		78.0	29.0	.	NM_152327	Q8IYP6	Missense_Mutation	SNP	ENST00000267584.4	hg19	CCDS9945.1	.	.	.	.	.	.	.	.	.	.	G	9.591	1.126082	0.20959	.	.	ENSG00000140057	ENST00000267584	T	0.61040	0.14	5.72	5.72	0.89469	.	0.354917	0.31772	N	0.007090	T	0.47948	0.1473	L	0.60455	1.87	0.54753	D	0.999986	P	0.35527	0.507	B	0.19666	0.026	T	0.46830	-0.9163	10	0.30078	T	0.28	-17.9477	12.7326	0.57206	0.0789:0.0:0.9211:0.0	.	341	Q96M32	KAD7_HUMAN	Q	341	ENSP00000267584:R341Q	ENSP00000267584:R341Q	R	+	2	0	AK7	95987584	0.290000	0.24343	0.621000	0.29145	0.004000	0.04260	2.176000	0.42500	2.711000	0.92665	0.655000	0.94253	CGA	.	.	.	none		0.393	AK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413340.1		
ARHGAP11A	9824	hgsc.bcm.edu	37	15	32929514	32929514	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr15:32929514C>T	ENST00000361627.3	+	12	3262	c.2540C>T	c.(2539-2541)tCt>tTt	p.S847F	ARHGAP11A_ENST00000543522.1_Missense_Mutation_p.S658F|ARHGAP11A_ENST00000565905.1_Missense_Mutation_p.S658F	NM_014783.3	NP_055598.1	Q6P4F7	RHGBA_HUMAN	Rho GTPase activating protein 11A	847					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		all_lung(180;1.3e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)		AGAATTAATTCTTTGTTGGAG	0.408																																					p.S847F	Colon(45;757 1134 30003 36652)	Atlas-SNP	.											.	ARHGAP11A	84	.	0			c.C2540T						PASS	.						121.0	128.0	125.0					15																	32929514		2201	4300	6501	SO:0001583	missense	9824	exon12			TTAATTCTTTGTT	D87717	CCDS10028.1, CCDS58349.1, CCDS66730.1	15q13.3	2006-09-19			ENSG00000198826	ENSG00000198826		"""Rho GTPase activating proteins"""	15783	protein-coding gene	gene with protein product	"""GAP (1-12)"""	610589				11829490	Standard	NM_199357		Approved	KIAA0013	uc001zgy.1	Q6P4F7	OTTHUMG00000129289	ENST00000361627.3:c.2540C>T	chr15.hg19:g.32929514C>T	ENSP00000355090:p.Ser847Phe	160.0	0.0	.		148.0	6.0	.	NM_014783	B4DZN9|Q6PI96|Q9Y3S6	Missense_Mutation	SNP	ENST00000361627.3	hg19	CCDS10028.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.331080	0.81690	.	.	ENSG00000198826	ENST00000361627;ENST00000543522	T	0.34667	1.35	5.67	5.67	0.87782	.	0.000000	0.56097	D	0.000025	T	0.65450	0.2692	M	0.80847	2.515	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.68655	-0.5351	10	0.87932	D	0	.	19.7686	0.96352	0.0:1.0:0.0:0.0	.	847	Q6P4F7	RHGBA_HUMAN	F	847;658	ENSP00000355090:S847F	ENSP00000355090:S847F	S	+	2	0	ARHGAP11A	30716806	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	6.951000	0.75983	2.665000	0.90641	0.591000	0.81541	TCT	.	.	.	none		0.408	ARHGAP11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251417.1	NM_014783	
MAP2K5	5607	hgsc.bcm.edu	37	15	67956981	67956981	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr15:67956981G>C	ENST00000178640.5	+	13	1472	c.845G>C	c.(844-846)aGa>aCa	p.R282T	MAP2K5_ENST00000354498.5_Missense_Mutation_p.R246T|MAP2K5_ENST00000340972.4_Missense_Mutation_p.R92T|MAP2K5_ENST00000395476.2_Missense_Mutation_p.R282T	NM_145160.2	NP_660143.1	Q13163	MP2K5_HUMAN	mitogen-activated protein kinase kinase 5	282	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|cellular response to growth factor stimulus (GO:0071363)|cellular response to laminar fluid shear stress (GO:0071499)|ERK5 cascade (GO:0070375)|heart development (GO:0007507)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000342)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of interleukin-8 biosynthetic process (GO:0045415)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of response to cytokine stimulus (GO:0060761)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.R282T(2)		breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|skin(1)	16						ATTTTACATAGAGGTATGTGC	0.333																																					p.R282T		Atlas-SNP	.											MAP2K5_ENST00000178640,NS,carcinoma,0,2	MAP2K5	70	.	2	Substitution - Missense(2)	endometrium(2)	c.G845C						PASS	.						112.0	114.0	113.0					15																	67956981		2199	4297	6496	SO:0001583	missense	5607	exon13			TACATAGAGGTAT	U25265	CCDS10224.1, CCDS42051.1, CCDS55970.1	15q22.31	2011-06-09			ENSG00000137764	ENSG00000137764		"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6845	protein-coding gene	gene with protein product		602520		PRKMK5		7759517	Standard	NM_002757		Approved	MEK5, MAPKK5, HsT17454	uc002aqu.3	Q13163	OTTHUMG00000133264	ENST00000178640.5:c.845G>C	chr15.hg19:g.67956981G>C	ENSP00000178640:p.Arg282Thr	105.0	0.0	.		93.0	8.0	.	NM_145160	B4DE43|Q92961|Q92962	Missense_Mutation	SNP	ENST00000178640.5	hg19	CCDS10224.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.501730	0.85176	.	.	ENSG00000137764	ENST00000541298;ENST00000395476;ENST00000178640;ENST00000354498;ENST00000340972	T;T;T;T	0.19105	2.17;2.17;2.17;2.17	6.04	6.04	0.98038	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.65616	0.2708	H	0.98048	4.135	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.78226	-0.2286	10	0.87932	D	0	-21.9076	18.7754	0.91910	0.0:0.0:1.0:0.0	.	92;282;282	A6NK28;Q13163-2;Q13163	.;.;MP2K5_HUMAN	T	282;282;282;246;92	ENSP00000378859:R282T;ENSP00000178640:R282T;ENSP00000346493:R246T;ENSP00000342101:R92T	ENSP00000178640:R282T	R	+	2	0	MAP2K5	65744035	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.843000	0.86859	2.873000	0.98535	0.563000	0.77884	AGA	.	.	.	none		0.333	MAP2K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257041.1	NM_145162	
AGBL1	123624	hgsc.bcm.edu	37	15	87217502	87217502	+	Splice_Site	SNP	A	A	G			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr15:87217502A>G	ENST00000441037.2	+	22	3014		c.e22-1		AGBL1_ENST00000389298.3_Splice_Site|AGBL1_ENST00000421325.2_Splice_Site	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1						C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)	p.?(1)		NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						TTTAACTGGCAGGGTCTACAG	0.478																																					.		Atlas-SNP	.											AGBL1,NS,carcinoma,0,1	AGBL1	151	.	1	Unknown(1)	lung(1)	c.2920-2A>G						PASS	.						52.0	49.0	50.0					15																	87217502		1970	4174	6144	SO:0001630	splice_region_variant	123624	exon22			ACTGGCAGGGTCT	AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.2920-1A>G	chr15.hg19:g.87217502A>G		16.0	0.0	.		18.0	8.0	.	NM_152336	A1A4X5|A6NJH6|C9JHL5	Splice_Site	SNP	ENST00000441037.2	hg19	CCDS58398.1	.	.	.	.	.	.	.	.	.	.	A	19.01	3.744859	0.69418	.	.	ENSG00000166748	ENST00000421325;ENST00000389298	.	.	.	5.49	5.49	0.81192	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.967	0.58490	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AGBL1	85018506	1.000000	0.71417	0.987000	0.45799	0.840000	0.47671	5.346000	0.65992	2.068000	0.61886	0.460000	0.39030	.	.	.	.	none		0.478	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000314929.5	NM_152336	Intron
SRRM2	23524	hgsc.bcm.edu	37	16	2816146	2816146	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr16:2816146C>G	ENST00000301740.8	+	11	6166	c.5617C>G	c.(5617-5619)Cac>Gac	p.H1873D		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1873	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						TCCAGCCACTCACCGGCGATC	0.612																																					p.H1873D		Atlas-SNP	.											.	SRRM2	263	.	0			c.C5617G						PASS	.						80.0	77.0	78.0					16																	2816146		2198	4300	6498	SO:0001583	missense	23524	exon11			GCCACTCACCGGC	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.5617C>G	chr16.hg19:g.2816146C>G	ENSP00000301740:p.His1873Asp	88.0	0.0	.		73.0	22.0	.	NM_016333	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	ENST00000301740.8	hg19	CCDS32373.1	.	.	.	.	.	.	.	.	.	.	C	2.782	-0.253191	0.05829	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933	T	0.24538	1.85	5.34	5.34	0.76211	.	0.000000	0.64402	D	0.000006	T	0.27489	0.0675	N	0.08118	0	0.35745	D	0.819014	D	0.65815	0.995	P	0.57911	0.829	T	0.42189	-0.9466	10	0.52906	T	0.07	-12.2072	16.5384	0.84377	0.0:1.0:0.0:0.0	.	1873	Q9UQ35	SRRM2_HUMAN	D	1873;1873;1125	ENSP00000301740:H1873D	ENSP00000301740:H1873D	H	+	1	0	SRRM2	2756147	0.881000	0.30235	1.000000	0.80357	0.997000	0.91878	1.956000	0.40382	2.492000	0.84095	0.650000	0.86243	CAC	.	.	.	none		0.612	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
SRRM2	23524	hgsc.bcm.edu	37	16	2818196	2818196	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr16:2818196C>G	ENST00000301740.8	+	11	8216	c.7667C>G	c.(7666-7668)tCt>tGt	p.S2556C	AC092117.2_ENST00000581119.1_RNA|SRRM2_ENST00000574593.1_3'UTR	NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	2556	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						tcctcctcctcTGGCTCCAGT	0.572																																					p.S2556C		Atlas-SNP	.											.	SRRM2	263	.	0			c.C7667G						PASS	.						56.0	51.0	53.0					16																	2818196		2198	4300	6498	SO:0001583	missense	23524	exon11			CCTCCTCTGGCTC	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.7667C>G	chr16.hg19:g.2818196C>G	ENSP00000301740:p.Ser2556Cys	44.0	0.0	.		42.0	15.0	.	NM_016333	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	ENST00000301740.8	hg19	CCDS32373.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.951695	0.73787	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933	T	0.77877	-1.13	5.91	5.91	0.95273	.	0.000000	0.51477	D	0.000098	D	0.82586	0.5069	L	0.32530	0.975	0.36253	D	0.854052	D	0.76494	0.999	D	0.77557	0.99	D	0.85933	0.1453	10	0.62326	D	0.03	-5.5072	15.8054	0.78501	0.0:1.0:0.0:0.0	.	2556	Q9UQ35	SRRM2_HUMAN	C	2556;2138;1808	ENSP00000301740:S2556C	ENSP00000301740:S2556C	S	+	2	0	SRRM2	2758197	0.998000	0.40836	1.000000	0.80357	0.886000	0.51366	4.236000	0.58675	2.808000	0.96608	0.655000	0.94253	TCT	.	.	.	none		0.572	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
LONP2	83752	hgsc.bcm.edu	37	16	48385617	48385617	+	Silent	SNP	T	T	C			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr16:48385617T>C	ENST00000285737.4	+	15	2556	c.2463T>C	c.(2461-2463)ttT>ttC	p.F821F	LONP2_ENST00000564259.1_3'UTR|LONP2_ENST00000535754.1_Silent_p.F777F	NM_031490.2	NP_113678.2			lon peptidase 2, peroxisomal											breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						ATTTAAGTTTTGTCACAGCAA	0.473																																					p.F821F		Atlas-SNP	.											.	LONP2	63	.	0			c.T2463C						PASS	.						89.0	85.0	86.0					16																	48385617		2200	4300	6500	SO:0001819	synonymous_variant	83752	exon15			AAGTTTTGTCACA	AJ548761	CCDS10734.1, CCDS73880.1	16q12.1	2010-04-21			ENSG00000102910	ENSG00000102910		"""ATPases / AAA-type"""	20598	protein-coding gene	gene with protein product						14561759	Standard	XM_005256191		Approved	MGC4840, LONP, LONPL	uc002efi.1	Q86WA8	OTTHUMG00000133144	ENST00000285737.4:c.2463T>C	chr16.hg19:g.48385617T>C		100.0	0.0	.		89.0	34.0	.	NM_031490		Silent	SNP	ENST00000285737.4	hg19	CCDS10734.1																																																																																			.	.	.	none		0.473	LONP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256839.2	NM_031490	
ZFHX3	463	hgsc.bcm.edu	37	16	72828734	72828734	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr16:72828734C>T	ENST00000268489.5	-	9	8519	c.7847G>A	c.(7846-7848)aGg>aAg	p.R2616K	ZFHX3_ENST00000397992.5_Missense_Mutation_p.R1702K	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	2616					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				CTCCAGCTTCCTCTTGAGAGT	0.547																																					p.R2616K		Atlas-SNP	.											.	ZFHX3	404	.	0			c.G7847A						PASS	.						207.0	212.0	210.0					16																	72828734		2198	4300	6498	SO:0001583	missense	463	exon9			AGCTTCCTCTTGA	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.7847G>A	chr16.hg19:g.72828734C>T	ENSP00000268489:p.Arg2616Lys	533.0	1.0	.		461.0	188.0	.	NM_006885	D3DWS8|O15101|Q13719	Missense_Mutation	SNP	ENST00000268489.5	hg19	CCDS10908.1	.	.	.	.	.	.	.	.	.	.	C	13.86	2.362208	0.41902	.	.	ENSG00000140836	ENST00000268489;ENST00000397992	T;T	0.74737	-0.87;-0.86	5.64	5.64	0.86602	.	0.000000	0.56097	D	0.000033	D	0.84014	0.5379	L	0.56199	1.76	0.80722	D	1	D	0.58970	0.984	D	0.68192	0.956	D	0.83807	0.0239	10	0.54805	T	0.06	.	19.683	0.95971	0.0:1.0:0.0:0.0	.	2616	Q15911	ZFHX3_HUMAN	K	2616;1702	ENSP00000268489:R2616K;ENSP00000438926:R1702K	ENSP00000268489:R2616K	R	-	2	0	ZFHX3	71386235	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.818000	0.86416	2.653000	0.90120	0.561000	0.74099	AGG	.	.	.	none		0.547	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
GEMIN4	50628	hgsc.bcm.edu	37	17	649344	649344	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr17:649344C>G	ENST00000319004.5	-	2	2057	c.1939G>C	c.(1939-1941)Gag>Cag	p.E647Q	GEMIN4_ENST00000576778.1_Missense_Mutation_p.E636Q	NM_015721.2	NP_056536.2	P57678	GEMI4_HUMAN	gem (nuclear organelle) associated protein 4	647					gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)				breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(4)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(207;0.204)		UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		TCGTCTGGCTCAAGAAGAGCA	0.488																																					p.E647Q		Atlas-SNP	.											.	GEMIN4	116	.	0			c.G1939C						PASS	.						64.0	67.0	66.0					17																	649344		1893	4118	6011	SO:0001583	missense	50628	exon2			CTGGCTCAAGAAG	AF177341	CCDS45559.1	17p13.3	2008-07-18				ENSG00000179409			15717	protein-coding gene	gene with protein product	"""HCC-associated protein 1"", ""component of gems 4"""	606969				10725331	Standard	NM_015721		Approved	HHRF-1, DKFZP434B131, p97, DKFZP434D174, HC56, HCAP1	uc002frs.1	P57678		ENST00000319004.5:c.1939G>C	chr17.hg19:g.649344C>G	ENSP00000321706:p.Glu647Gln	82.0	0.0	.		84.0	10.0	.	NM_015721	Q9NZS7|Q9UG32|Q9Y4Q2	Missense_Mutation	SNP	ENST00000319004.5	hg19	CCDS45559.1	.	.	.	.	.	.	.	.	.	.	C	4.186	0.033188	0.08101	.	.	ENSG00000179409	ENST00000319004	T	0.05786	3.39	5.57	4.6	0.57074	.	0.448686	0.24490	N	0.038075	T	0.05456	0.0144	L	0.41236	1.265	0.22378	N	0.999157	B	0.21225	0.053	B	0.17722	0.019	T	0.35076	-0.9803	10	0.30078	T	0.28	-12.805	5.0874	0.14691	0.1555:0.6319:0.1337:0.0789	.	647	P57678	GEMI4_HUMAN	Q	647	ENSP00000321706:E647Q	ENSP00000321706:E647Q	E	-	1	0	GEMIN4	596094	0.185000	0.23213	0.959000	0.39883	0.826000	0.46750	0.956000	0.29202	1.358000	0.45922	0.655000	0.94253	GAG	.	.	.	none		0.488	GEMIN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437181.1	NM_015721	
ADPRM	56985	hgsc.bcm.edu	37	17	10608559	10608559	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr17:10608559C>T	ENST00000379774.4	+	2	407	c.316C>T	c.(316-318)Cat>Tat	p.H106Y	ADPRM_ENST00000609540.1_Missense_Mutation_p.H106Y	NM_020233.4	NP_064618.3	Q3LIE5	ADPRM_HUMAN	ADP-ribose/CDP-alcohol diphosphatase, manganese-dependent	106							ADP-ribose diphosphatase activity (GO:0047631)|CDP-glycerol diphosphatase activity (GO:0047734)|metal ion binding (GO:0046872)										TCCAGTTCATCATACATGGGG	0.353																																					p.H106Y		Atlas-SNP	.											.	.	.	.	0			c.C316T						PASS	.						88.0	82.0	84.0					17																	10608559		2203	4300	6503	SO:0001583	missense	56985	exon2			GTTCATCATACAT	BC070155	CCDS11159.2	17p13.1	2012-07-20	2012-07-20	2012-07-20	ENSG00000170222	ENSG00000170222	3.6.1.13, 3.6.1.16, 3.6.1.53		30925	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 48"""	C17orf48		18352857	Standard	XM_005256738		Approved	MDS006	uc002gmt.3	Q3LIE5	OTTHUMG00000130366	ENST00000379774.4:c.316C>T	chr17.hg19:g.10608559C>T	ENSP00000369099:p.His106Tyr	106.0	0.0	.		115.0	18.0	.	NM_020233	A8K9B4|D3DTS4|Q9BVD4|Q9NRU8	Missense_Mutation	SNP	ENST00000379774.4	hg19	CCDS11159.2	.	.	.	.	.	.	.	.	.	.	C	24.7	4.565615	0.86439	.	.	ENSG00000170222	ENST00000379774	D	0.84660	-1.88	5.64	5.64	0.86602	Metallophosphoesterase domain (1);	0.000000	0.85682	D	0.000000	D	0.89949	0.6863	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.83803	0.0237	10	0.02654	T	1	-8.9416	19.5025	0.95103	0.0:1.0:0.0:0.0	.	106	Q3LIE5	ADPRM_HUMAN	Y	106	ENSP00000369099:H106Y	ENSP00000369099:H106Y	H	+	1	0	C17orf48	10549284	1.000000	0.71417	0.964000	0.40570	0.988000	0.76386	6.987000	0.76206	2.937000	0.99478	0.650000	0.86243	CAT	.	.	.	none		0.353	ADPRM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252732.2	NM_020233	
MYO18A	399687	hgsc.bcm.edu	37	17	27430634	27430634	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr17:27430634A>T	ENST00000527372.1	-	21	3670	c.3490T>A	c.(3490-3492)Tgc>Agc	p.C1164S	MYO18A_ENST00000533112.1_Missense_Mutation_p.C1164S|MYO18A_ENST00000531253.1_Missense_Mutation_p.C1164S|MYO18A_ENST00000354329.4_Missense_Mutation_p.C1164S	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	1164	Myosin motor.				actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			AGGCCCATGCAGCAGCTGCTC	0.657																																					p.C1164S	Esophageal Squamous(182;472 2015 7001 15270 22562)	Atlas-SNP	.											.	MYO18A	217	.	0			c.T3490A						PASS	.						47.0	54.0	52.0					17																	27430634		2074	4207	6281	SO:0001583	missense	399687	exon21			CCATGCAGCAGCT	D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.3490T>A	chr17.hg19:g.27430634A>T	ENSP00000437073:p.Cys1164Ser	61.0	0.0	.		32.0	16.0	.	NM_078471	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Missense_Mutation	SNP	ENST00000527372.1	hg19	CCDS45642.1	.	.	.	.	.	.	.	.	.	.	A	12.27	1.887500	0.33348	.	.	ENSG00000196535	ENST00000354329;ENST00000359450;ENST00000533112;ENST00000531253;ENST00000527372;ENST00000529799;ENST00000540575;ENST00000458428	D;D;D;D	0.86366	-2.11;-2.11;-2.11;-2.11	5.44	3.22	0.36961	Myosin head, motor domain (2);	0.313479	0.39544	N	0.001332	T	0.74680	0.3748	N	0.25890	0.77	0.37666	D	0.922943	B;B;B;B;B	0.22346	0.006;0.009;0.009;0.009;0.068	B;B;B;B;B	0.21708	0.003;0.015;0.009;0.009;0.036	T	0.66392	-0.5935	10	0.32370	T	0.25	.	3.1069	0.06345	0.6565:0.0:0.1571:0.1864	.	833;776;1164;1164;1164	Q92614-2;F8W6Y3;Q92614-3;Q92614-4;Q92614	.;.;.;.;MY18A_HUMAN	S	1164;1164;1164;1164;1164;60;60;776	ENSP00000346291:C1164S;ENSP00000435932:C1164S;ENSP00000434228:C1164S;ENSP00000437073:C1164S	ENSP00000346291:C1164S	C	-	1	0	MYO18A	24454760	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.734000	0.47368	0.878000	0.35920	0.459000	0.35465	TGC	.	.	.	none		0.657	MYO18A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389396.1	NM_078471	
KCNJ16	3773	hgsc.bcm.edu	37	17	68129360	68129360	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr17:68129360G>A	ENST00000589377.1	+	2	1295	c.1132G>A	c.(1132-1134)Gcc>Acc	p.A378T	KCNJ16_ENST00000586462.1_Missense_Mutation_p.A417T|KCNJ16_ENST00000283936.1_Missense_Mutation_p.A378T|KCNJ16_ENST00000585558.1_Missense_Mutation_p.A413T|KCNJ16_ENST00000392670.1_Missense_Mutation_p.A378T|KCNJ16_ENST00000392671.1_Missense_Mutation_p.A378T	NM_001270422.1	NP_001257351.1	Q9NPI9	KCJ16_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 16	378					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)			breast(3)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	32	Breast(10;2.96e-09)					TAGTGCAGTTGCCATTGTCAG	0.498																																					p.A378T		Atlas-SNP	.											.	KCNJ16	72	.	0			c.G1132A						PASS	.						109.0	92.0	98.0					17																	68129360		2203	4300	6503	SO:0001583	missense	3773	exon6			GCAGTTGCCATTG	AF153815	CCDS11687.1, CCDS74141.1	17q24.3	2011-07-05				ENSG00000153822		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6262	protein-coding gene	gene with protein product		605722				11240146, 16382105	Standard	NM_018658		Approved	Kir5.1, BIR9	uc002jio.4	Q9NPI9		ENST00000589377.1:c.1132G>A	chr17.hg19:g.68129360G>A	ENSP00000465967:p.Ala378Thr	80.0	0.0	.		84.0	43.0	.	NM_001270422		Missense_Mutation	SNP	ENST00000589377.1	hg19	CCDS11687.1	.	.	.	.	.	.	.	.	.	.	G	12.84	2.058214	0.36277	.	.	ENSG00000153822	ENST00000283936;ENST00000392671;ENST00000392670	D;D;D	0.89270	-2.49;-2.49;-2.49	5.8	5.8	0.92144	.	1.758860	0.02733	N	0.115373	D	0.84584	0.5504	L	0.27053	0.805	0.36349	D	0.859948	B;B	0.29909	0.261;0.01	B;B	0.21546	0.035;0.007	T	0.60910	-0.7169	9	.	.	.	.	13.9035	0.63819	0.0735:0.0:0.9265:0.0	.	378;378	A8K434;Q9NPI9	.;IRK16_HUMAN	T	378	ENSP00000283936:A378T;ENSP00000376439:A378T;ENSP00000376438:A378T	.	A	+	1	0	KCNJ16	65640955	0.999000	0.42202	0.952000	0.39060	0.454000	0.32378	6.073000	0.71245	2.736000	0.93811	0.591000	0.81541	GCC	.	.	.	none		0.498	KCNJ16-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450880.1	NM_018658	
YES1	7525	hgsc.bcm.edu	37	18	756694	756694	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr18:756694G>A	ENST00000584307.1	-	2	304	c.134C>T	c.(133-135)tCt>tTt	p.S45F	YES1_ENST00000577961.1_Missense_Mutation_p.S50F|YES1_ENST00000577611.1_5'UTR|YES1_ENST00000314574.4_Missense_Mutation_p.S45F			P07947	YES_HUMAN	YES proto-oncogene 1, Src family tyrosine kinase	45					blood coagulation (GO:0007596)|cellular protein modification process (GO:0006464)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|glucose transport (GO:0015758)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|regulation of vascular permeability (GO:0043114)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(1)	17					Dasatinib(DB01254)	CTTTGCTGAAGATGACGGACA	0.468																																					p.S45F		Atlas-SNP	.											.	YES1	50	.	0			c.C134T						PASS	.						248.0	208.0	222.0					18																	756694		2203	4300	6503	SO:0001583	missense	7525	exon2			GCTGAAGATGACG	M15990	CCDS11824.1	18p11.31-p11.21	2014-06-26	2014-06-26		ENSG00000176105	ENSG00000176105		"""SH2 domain containing"""	12841	protein-coding gene	gene with protein product		164880	"""v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1"""			2983418	Standard	NM_005433		Approved	Yes, c-yes, HsT441	uc002kky.3	P07947	OTTHUMG00000131472	ENST00000584307.1:c.134C>T	chr18.hg19:g.756694G>A	ENSP00000462468:p.Ser45Phe	289.0	0.0	.		235.0	33.0	.	NM_005433	A6NLB3|D3DUH1	Missense_Mutation	SNP	ENST00000584307.1	hg19	CCDS11824.1	.	.	.	.	.	.	.	.	.	.	G	6.428	0.447146	0.12223	.	.	ENSG00000176105	ENST00000359834;ENST00000314574	T	0.75050	-0.9	4.66	4.66	0.58398	.	0.822602	0.09557	U	0.786109	T	0.66297	0.2775	L	0.29908	0.895	0.45366	D	0.998353	B	0.02656	0.0	B	0.08055	0.003	T	0.53851	-0.8380	10	0.16420	T	0.52	.	17.9046	0.88914	0.0:0.0:1.0:0.0	.	45	P07947	YES_HUMAN	F	45	ENSP00000324740:S45F	ENSP00000324740:S45F	S	-	2	0	YES1	746694	1.000000	0.71417	0.017000	0.16124	0.934000	0.57294	6.760000	0.74939	2.299000	0.77371	0.313000	0.20887	TCT	.	.	.	none		0.468	YES1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440827.2	NM_005433	
NEDD4L	23327	hgsc.bcm.edu	37	18	55996285	55996285	+	Silent	SNP	C	C	A			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr18:55996285C>A	ENST00000400345.3	+	10	1022	c.739C>A	c.(739-741)Cgg>Agg	p.R247R	NEDD4L_ENST00000357895.5_Silent_p.R239R|NEDD4L_ENST00000256830.9_Silent_p.R247R|NEDD4L_ENST00000435432.2_Silent_p.R126R|NEDD4L_ENST00000586263.1_Silent_p.R239R|NEDD4L_ENST00000456986.1_Silent_p.R126R|NEDD4L_ENST00000431212.2_Silent_p.R126R|NEDD4L_ENST00000356462.6_Silent_p.R247R|NEDD4L_ENST00000456173.2_Silent_p.R126R|NEDD4L_ENST00000382850.4_Silent_p.R247R|NEDD4L_ENST00000589054.1_Intron|NEDD4L_ENST00000256832.7_Silent_p.R126R	NM_001144967.2	NP_001138439.1	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase	247					cellular sodium ion homeostasis (GO:0006883)|excretion (GO:0007588)|gene expression (GO:0010467)|ion transmembrane transport (GO:0034220)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cation channel activity (GO:2001259)|positive regulation of caveolin-mediated endocytosis (GO:2001288)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of sodium ion transport (GO:0010765)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane depolarization (GO:0003254)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of protein catabolic process (GO:0042176)|regulation of tight junction assembly (GO:2000810)|response to metal ion (GO:0010038)|response to salt stress (GO:0009651)|sodium ion transport (GO:0006814)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|ventricular cardiac muscle cell action potential (GO:0086005)|viral life cycle (GO:0019058)|viral process (GO:0016032)|water homeostasis (GO:0030104)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ion channel binding (GO:0044325)|ligase activity (GO:0016874)|potassium channel inhibitor activity (GO:0019870)|potassium channel regulator activity (GO:0015459)|sodium channel inhibitor activity (GO:0019871)|sodium channel regulator activity (GO:0017080)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(11)|ovary(1)|prostate(4)	37						GGCAGCACACCGGCGCTTCCG	0.597																																					p.R247R		Atlas-SNP	.											.	NEDD4L	126	.	0			c.C739A						PASS	.						38.0	45.0	43.0					18																	55996285		2100	4227	6327	SO:0001819	synonymous_variant	23327	exon10			GCACACCGGCGCT	AF210730	CCDS45872.1, CCDS45873.1, CCDS45874.1, CCDS45875.1, CCDS45876.1, CCDS58632.1, CCDS59323.1	18q21.31	2014-08-12	2012-02-23		ENSG00000049759				7728	protein-coding gene	gene with protein product		606384	"""neural precursor cell expressed, developmentally down-regulated 4-like"""			10594025, 11244092, 18322022	Standard	NM_001144965		Approved	KIAA0439, RSP5, NEDD4-2	uc002lgy.3	Q96PU5	OTTHUMG00000179875	ENST00000400345.3:c.739C>A	chr18.hg19:g.55996285C>A		41.0	0.0	.		44.0	4.0	.	NM_015277	O43165|Q3LSM7|Q7Z5F1|Q7Z5F2|Q7Z5N3|Q8N5A7|Q8WUU9|Q9BW58|Q9H2W4|Q9NT88	Silent	SNP	ENST00000400345.3	hg19	CCDS45872.1																																																																																			.	.	.	none		0.597	NEDD4L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000448749.1		
MUC16	94025	hgsc.bcm.edu	37	19	9087506	9087506	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr19:9087506C>T	ENST00000397910.4	-	1	4512	c.4309G>A	c.(4309-4311)Gat>Aat	p.D1437N		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1437	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CCTGGGACATCAGAAGTTAGT	0.512																																					p.D1437N		Atlas-SNP	.											.	MUC16	4315	.	0			c.G4309A						PASS	.						118.0	114.0	116.0					19																	9087506		1966	4148	6114	SO:0001583	missense	94025	exon1			GGACATCAGAAGT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.4309G>A	chr19.hg19:g.9087506C>T	ENSP00000381008:p.Asp1437Asn	130.0	0.0	.		149.0	12.0	.	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	3.824	-0.037221	0.07497	.	.	ENSG00000181143	ENST00000397910	T	0.02944	4.1	1.0	-0.286	0.12862	.	.	.	.	.	T	0.01489	0.0048	N	0.08118	0	.	.	.	B	0.26845	0.161	B	0.18263	0.021	T	0.44190	-0.9344	8	0.87932	D	0	.	3.1617	0.06522	0.0:0.617:0.0:0.383	.	1437	B5ME49	.	N	1437	ENSP00000381008:D1437N	ENSP00000381008:D1437N	D	-	1	0	MUC16	8948506	0.001000	0.12720	0.002000	0.10522	0.042000	0.13812	-0.052000	0.11865	-0.065000	0.13021	0.305000	0.20034	GAT	.	.	.	none		0.512	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ECSIT	51295	hgsc.bcm.edu	37	19	11618829	11618829	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr19:11618829T>C	ENST00000270517.7	-	5	908	c.773A>G	c.(772-774)gAt>gGt	p.D258G	ECSIT_ENST00000591352.1_5'UTR|ECSIT_ENST00000592312.1_Missense_Mutation_p.D142G|ECSIT_ENST00000252440.7_Missense_Mutation_p.D258G|ZNF653_ENST00000593191.1_5'Flank|ECSIT_ENST00000588998.1_Missense_Mutation_p.D44G|ECSIT_ENST00000591104.1_Missense_Mutation_p.D258G|ZNF653_ENST00000293771.5_5'Flank|CTC-398G3.6_ENST00000585656.1_5'Flank|ECSIT_ENST00000417981.2_Missense_Mutation_p.D44G	NM_016581.4	NP_057665.2	Q9BQ95	ECSIT_HUMAN	ECSIT signalling integrator	258					BMP signaling pathway (GO:0030509)|innate immune response (GO:0045087)|mesoderm formation (GO:0001707)|oxidation-reduction process (GO:0055114)|regulation of oxidoreductase activity (GO:0051341)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	oxidoreductase activity, acting on NAD(P)H (GO:0016651)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			kidney(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	11						CTGGGGGGGATCTGCTGCACC	0.577																																					p.D258G		Atlas-SNP	.											.	ECSIT	32	.	0			c.A773G						PASS	.						99.0	108.0	105.0					19																	11618829		2203	4300	6503	SO:0001583	missense	51295	exon5			GGGGGATCTGCTG	BC005119	CCDS12262.1, CCDS45979.1, CCDS45980.1, CCDS59353.1	19p13.2	2013-05-24	2013-05-24			ENSG00000130159		"""Mitochondrial respiratory chain complex assembly factors"""	29548	protein-coding gene	gene with protein product	"""signaling intermediate in Toll pathway evolutionarily conserved ortholog (mouse)"""	608388	"""ECSIT homolog (Drosophila)"""			10465784, 22982022	Standard	NM_001142464		Approved	SITPEC	uc002msb.3	Q9BQ95		ENST00000270517.7:c.773A>G	chr19.hg19:g.11618829T>C	ENSP00000270517:p.Asp258Gly	105.0	0.0	.		117.0	39.0	.	NM_001142464	E9PAN9|K7EMM0|Q96HQ7|Q9NYI1	Missense_Mutation	SNP	ENST00000270517.7	hg19	CCDS12262.1	.	.	.	.	.	.	.	.	.	.	T	15.67	2.901102	0.52227	.	.	ENSG00000130159	ENST00000270517;ENST00000417981;ENST00000252440	T;T;T	0.80480	-1.38;1.22;-1.38	3.81	2.67	0.31697	.	0.528567	0.19970	N	0.102018	T	0.77343	0.4116	M	0.73598	2.24	0.09310	N	1	P;P;P	0.44139	0.827;0.557;0.485	B;B;B	0.41510	0.359;0.178;0.248	T	0.71646	-0.4530	10	0.66056	D	0.02	-5.0804	6.5677	0.22521	0.0:0.0:0.2477:0.7523	.	44;258;258	E9PAN9;Q9BQ95-2;Q9BQ95	.;.;ECSIT_HUMAN	G	258;44;258	ENSP00000270517:D258G;ENSP00000412712:D44G;ENSP00000252440:D258G	ENSP00000252440:D258G	D	-	2	0	ECSIT	11479829	0.181000	0.23161	0.007000	0.13788	0.266000	0.26442	2.000000	0.40816	1.671000	0.50874	0.459000	0.35465	GAT	.	.	.	none		0.577	ECSIT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442603.2	NM_016581	
HOOK2	29911	hgsc.bcm.edu	37	19	12875721	12875721	+	Silent	SNP	C	C	T			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr19:12875721C>T	ENST00000397668.3	-	20	1807	c.1734G>A	c.(1732-1734)cgG>cgA	p.R578R	HOOK2_ENST00000264827.5_Silent_p.R576R|HOOK2_ENST00000589965.1_5'Flank	NM_013312.2	NP_037444.2	Q96ED9	HOOK2_HUMAN	hook microtubule-tethering protein 2	578	Required for localization to the centrosome and induction of aggresome formation.				early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	centrosome (GO:0005813)|FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(5)|skin(1)	20						GCTCCTCGATCCGCCGGGCTG	0.632											OREG0025273	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R578R		Atlas-SNP	.											.	HOOK2	73	.	0			c.G1734A						PASS	.						67.0	73.0	71.0					19																	12875721		2018	4169	6187	SO:0001819	synonymous_variant	29911	exon20			CTCGATCCGCCGG	AF044924	CCDS42507.1, CCDS42508.1	19p13.2	2013-08-21	2013-08-21						19885	protein-coding gene	gene with protein product		607824	"""hook homolog 2 (Drosophila)"""			9927460	Standard	NM_013312		Approved	HK2	uc002muy.2	Q96ED9		ENST00000397668.3:c.1734G>A	chr19.hg19:g.12875721C>T		108.0	0.0	.	683	145.0	9.0	.	NM_013312	O60562	Silent	SNP	ENST00000397668.3	hg19	CCDS42508.1																																																																																			.	.	.	none		0.632	HOOK2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451008.1	NM_013312	
NOTCH3	4854	hgsc.bcm.edu	37	19	15288375	15288375	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr19:15288375T>C	ENST00000263388.2	-	24	4439	c.4364A>G	c.(4363-4365)aAc>aGc	p.N1455S		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1455					forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			GCAGTCGAAGTTGTCGTAGAG	0.657																																					p.N1455S		Atlas-SNP	.											.	NOTCH3	340	.	0			c.A4364G						PASS	.						14.0	13.0	13.0					19																	15288375		2111	4180	6291	SO:0001583	missense	4854	exon24			TCGAAGTTGTCGT	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.4364A>G	chr19.hg19:g.15288375T>C	ENSP00000263388:p.Asn1455Ser	28.0	0.0	.		15.0	4.0	.	NM_000435	Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	ENST00000263388.2	hg19	CCDS12326.1	.	.	.	.	.	.	.	.	.	.	T	19.38	3.816967	0.70912	.	.	ENSG00000074181	ENST00000263388	T	0.63913	-0.07	4.66	4.66	0.58398	Notch domain (5);	.	.	.	.	T	0.56746	0.2006	L	0.47016	1.485	0.45883	D	0.998736	B	0.31968	0.349	B	0.33799	0.17	T	0.60255	-0.7299	9	0.56958	D	0.05	.	13.0613	0.59008	0.0:0.0:0.0:1.0	.	1455	Q9UM47	NOTC3_HUMAN	S	1455	ENSP00000263388:N1455S	ENSP00000263388:N1455S	N	-	2	0	NOTCH3	15149375	1.000000	0.71417	1.000000	0.80357	0.817000	0.46193	1.398000	0.34554	1.728000	0.51552	0.260000	0.18958	AAC	.	.	.	none		0.657	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1	NM_000435	
UNC13A	23025	hgsc.bcm.edu	37	19	17750273	17750273	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr19:17750273A>T	ENST00000519716.2	-	24	2917	c.2918T>A	c.(2917-2919)cTc>cAc	p.L973H	UNC13A_ENST00000552293.1_Missense_Mutation_p.L973H|UNC13A_ENST00000550896.1_Missense_Mutation_p.L971H|UNC13A_ENST00000428389.2_Missense_Mutation_p.L1061H|UNC13A_ENST00000551649.1_Missense_Mutation_p.L973H|UNC13A_ENST00000252773.7_Missense_Mutation_p.L973H	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	973					beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						GATGCTGGTGAGAAGGTCCAC	0.532																																					p.L973H		Atlas-SNP	.											.	UNC13A	299	.	0			c.T2918A						PASS	.						79.0	78.0	79.0					19																	17750273		1967	4144	6111	SO:0001583	missense	23025	exon23			CTGGTGAGAAGGT	AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.2918T>A	chr19.hg19:g.17750273A>T	ENSP00000429562:p.Leu973His	40.0	0.0	.		32.0	8.0	.	NM_001080421	E5RHY9	Missense_Mutation	SNP	ENST00000519716.2	hg19	CCDS46013.2	.	.	.	.	.	.	.	.	.	.	A	20.4	3.975812	0.74360	.	.	ENSG00000130477	ENST00000519716;ENST00000428389;ENST00000252773;ENST00000551649;ENST00000552293;ENST00000550896	D;D;D;D;D;D	0.87729	-2.28;-2.29;-2.27;-2.12;-2.16;-2.29	3.95	3.95	0.45737	.	0.179999	0.36303	U	0.002675	D	0.92619	0.7655	M	0.80183	2.485	0.52501	D	0.999952	D	0.89917	1.0	D	0.83275	0.996	D	0.93099	0.6507	10	0.87932	D	0	-16.3271	11.1266	0.48322	1.0:0.0:0.0:0.0	.	973	Q9UPW8	UN13A_HUMAN	H	973;1061;973;973;973;971	ENSP00000429562:L973H;ENSP00000400409:L1061H;ENSP00000252773:L973H;ENSP00000447236:L973H;ENSP00000447572:L973H;ENSP00000446831:L971H	ENSP00000252773:L973H	L	-	2	0	UNC13A	17611273	1.000000	0.71417	0.892000	0.35008	0.984000	0.73092	9.105000	0.94246	1.568000	0.49683	0.248000	0.18094	CTC	.	.	.	none		0.532	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376169.2	XM_038604	
CYP2A13	1553	hgsc.bcm.edu	37	19	41596079	41596079	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr19:41596079C>G	ENST00000330436.3	+	3	471	c.471C>G	c.(469-471)atC>atG	p.I157M		NM_000766.4	NP_000757.2	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 13	157					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(6)|kidney(4)|large_intestine(8)|lung(13)|ovary(3)|prostate(3)|skin(2)	42					Methoxsalen(DB00553)|Nicotine(DB00184)|Testosterone(DB00624)	GCTTCCTCATCGACGCCCTCC	0.687																																					p.I157M		Atlas-SNP	.											.	CYP2A13	90	.	0			c.C471G						PASS	.						31.0	32.0	31.0					19																	41596079		2202	4300	6502	SO:0001583	missense	1553	exon3			CCTCATCGACGCC	U22028	CCDS12571.1	19q13.2	2013-11-11	2003-01-14		ENSG00000197838	ENSG00000197838		"""Cytochrome P450s"""	2608	protein-coding gene	gene with protein product		608055	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 13"""			7668294, 15128046	Standard	NM_000766		Approved	CPAD, CYP2A	uc002opt.4	Q16696	OTTHUMG00000182762	ENST00000330436.3:c.471C>G	chr19.hg19:g.41596079C>G	ENSP00000332679:p.Ile157Met	76.0	0.0	.		75.0	46.0	.	NM_000766	Q53YR8|Q6R569|Q6R570|Q9H2X2	Missense_Mutation	SNP	ENST00000330436.3	hg19	CCDS12571.1	.	.	.	.	.	.	.	.	.	.	.	11.11	1.542221	0.27563	.	.	ENSG00000197838	ENST00000330436	T	0.01379	4.96	3.43	-3.64	0.04515	.	0.840898	0.10215	U	0.701698	T	0.01353	0.0044	L	0.45285	1.41	0.09310	N	1	B	0.25667	0.131	B	0.30029	0.11	T	0.47623	-0.9103	10	0.49607	T	0.09	.	1.1459	0.01775	0.1312:0.246:0.2879:0.3349	.	157	Q16696	CP2AD_HUMAN	M	157	ENSP00000332679:I157M	ENSP00000332679:I157M	I	+	3	3	CYP2A13	46287919	0.000000	0.05858	0.053000	0.19242	0.011000	0.07611	-2.752000	0.00791	-0.321000	0.08627	0.305000	0.20034	ATC	.	.	.	none		0.687	CYP2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463505.1	NM_000766	
DMWD	1762	hgsc.bcm.edu	37	19	46289265	46289265	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr19:46289265G>A	ENST00000270223.6	-	3	1534	c.1489C>T	c.(1489-1491)Ccg>Tcg	p.P497S	DMWD_ENST00000377735.3_Missense_Mutation_p.P497S|DMWD_ENST00000601370.1_5'Flank|AC011530.4_ENST00000593999.1_5'Flank	NM_004943.1	NP_004934.1	Q09019	DMWD_HUMAN	dystrophia myotonica, WD repeat containing	497										central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	16		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00604)|GBM - Glioblastoma multiforme(486;0.0807)|Epithelial(262;0.236)		GCTGGGTGCGGGAGACTGTTG	0.731																																					p.P497S		Atlas-SNP	.											.	DMWD	46	.	0			c.C1489T						PASS	.						6.0	7.0	7.0					19																	46289265		1846	3685	5531	SO:0001583	missense	1762	exon3			GGTGCGGGAGACT	L19267	CCDS33054.1	19q13.32	2013-01-09	2007-02-20		ENSG00000185800	ENSG00000185800		"""WD repeat domain containing"""	2936	protein-coding gene	gene with protein product		609857	"""dystrophia myotonica-containing WD repeat motif"""			1302022	Standard	NM_004943		Approved	DMR-N9, gene59, D19S593E	uc021uwc.1	Q09019	OTTHUMG00000169044	ENST00000270223.6:c.1489C>T	chr19.hg19:g.46289265G>A	ENSP00000270223:p.Pro497Ser	25.0	0.0	.		19.0	7.0	.	NM_004943		Missense_Mutation	SNP	ENST00000270223.6	hg19	CCDS33054.1	.	.	.	.	.	.	.	.	.	.	G	18.03	3.533457	0.64972	.	.	ENSG00000185800	ENST00000377735;ENST00000270223	T;T	0.59906	0.25;0.23	4.21	4.21	0.49690	.	0.000000	0.85682	D	0.000000	T	0.64516	0.2605	L	0.49126	1.545	0.58432	D	0.99999	D;D;D	0.71674	0.997;0.998;0.997	P;D;P	0.64776	0.888;0.929;0.888	T	0.58549	-0.7617	10	0.09084	T	0.74	-15.5092	14.4428	0.67330	0.0:0.0:1.0:0.0	.	182;497;497	Q8WUW6;G5E9A7;Q09019	.;.;DMWD_HUMAN	S	497	ENSP00000366964:P497S;ENSP00000270223:P497S	ENSP00000270223:P497S	P	-	1	0	DMWD	50981105	1.000000	0.71417	0.939000	0.37840	0.356000	0.29392	9.141000	0.94612	2.365000	0.80145	0.462000	0.41574	CCG	.	.	.	none		0.731	DMWD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402063.1	NM_004943	
HRC	3270	hgsc.bcm.edu	37	19	49658341	49658341	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr19:49658341C>T	ENST00000252825.4	-	1	340	c.154G>A	c.(154-156)Gag>Aag	p.E52K	TRPM4_ENST00000355712.5_5'Flank|TRPM4_ENST00000427978.2_5'Flank|HRC_ENST00000595625.1_Missense_Mutation_p.E52K|TRPM4_ENST00000252826.5_5'Flank	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	52					cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		GCTGATGCCTCCTCGGAGAGC	0.597																																					p.E52K	Melanoma(37;75 1097 24567 25669 30645)	Atlas-SNP	.											.	HRC	85	.	0			c.G154A						PASS	.						168.0	147.0	154.0					19																	49658341		2203	4300	6503	SO:0001583	missense	3270	exon1			ATGCCTCCTCGGA		CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.154G>A	chr19.hg19:g.49658341C>T	ENSP00000252825:p.Glu52Lys	187.0	0.0	.		173.0	24.0	.	NM_002152	Q504Y6	Missense_Mutation	SNP	ENST00000252825.4	hg19	CCDS12759.1	.	.	.	.	.	.	.	.	.	.	C	19.95	3.921389	0.73213	.	.	ENSG00000130528	ENST00000252825	T	0.06687	3.27	3.26	3.26	0.37387	.	.	.	.	.	T	0.08802	0.0218	L	0.47716	1.5	0.09310	N	0.999997	B	0.33694	0.421	B	0.24701	0.055	T	0.16188	-1.0411	9	0.66056	D	0.02	-4.7962	12.7671	0.57399	0.0:1.0:0.0:0.0	.	52	P23327	SRCH_HUMAN	K	52	ENSP00000252825:E52K	ENSP00000252825:E52K	E	-	1	0	HRC	54350153	0.554000	0.26522	0.204000	0.23530	0.009000	0.06853	1.738000	0.38207	2.104000	0.64026	0.561000	0.74099	GAG	.	.	.	none		0.597	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465649.1	NM_002152	
FPR2	2358	hgsc.bcm.edu	37	19	52272650	52272650	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr19:52272650G>C	ENST00000598776.1	+	2	1511	c.739G>C	c.(739-741)Gtg>Ctg	p.V247L	FPR2_ENST00000340023.6_Missense_Mutation_p.V247L|FPR2_ENST00000598953.1_Missense_Mutation_p.V247L	NM_001462.3	NP_001453.1	P25090	FPR2_HUMAN	formyl peptide receptor 2	247					cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|N-formyl peptide receptor activity (GO:0004982)			endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	33						CACTGCTGTGGTGGCTTCTTT	0.483																																					p.V247L		Atlas-SNP	.											.	FPR2	66	.	0			c.G739C						PASS	.						162.0	129.0	140.0					19																	52272650		2203	4300	6503	SO:0001583	missense	2358	exon2			GCTGTGGTGGCTT	M88107	CCDS12840.1	19q13.3-q13.4	2012-08-10	2008-04-17	2008-04-17		ENSG00000171049		"""GPCR / Class A : Formyl peptide receptors"", ""GPCR / Class A : Leukotriene receptors"""	3827	protein-coding gene	gene with protein product		136538	"""formyl peptide receptor-like 1"""	FPRL1		9054386	Standard	NM_001462		Approved	LXA4R, HM63, FPRH2, FMLPX, FPR2A, FMLP-R-II, ALXR	uc002pxr.3	P25090		ENST00000598776.1:c.739G>C	chr19.hg19:g.52272650G>C	ENSP00000468897:p.Val247Leu	81.0	0.0	.		63.0	28.0	.	NM_001005738	A8K3E2	Missense_Mutation	SNP	ENST00000598776.1	hg19	CCDS12840.1	.	.	.	.	.	.	.	.	.	.	.	17.61	3.432553	0.62844	.	.	ENSG00000171049	ENST00000340023	T	0.72051	-0.62	3.79	2.69	0.31865	GPCR, rhodopsin-like superfamily (1);	0.083720	0.47455	U	0.000226	T	0.81659	0.4869	M	0.85777	2.775	0.31492	N	0.66581	D	0.55800	0.973	D	0.64506	0.926	T	0.81373	-0.0962	10	0.54805	T	0.06	.	8.5694	0.33561	0.1273:0.0:0.8727:0.0	.	247	P25090	FPR2_HUMAN	L	247	ENSP00000340191:V247L	ENSP00000340191:V247L	V	+	1	0	FPR2	56964462	0.210000	0.23517	0.680000	0.29994	0.976000	0.68499	1.340000	0.33896	0.909000	0.36697	0.484000	0.47621	GTG	.	.	.	none		0.483	FPR2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466912.2	NM_001005738	
LAIR2	3904	hgsc.bcm.edu	37	19	55019129	55019129	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr19:55019129T>A	ENST00000301202.2	+	3	216	c.94T>A	c.(94-96)Tcg>Acg	p.S32T	LAIR2_ENST00000351841.2_Missense_Mutation_p.S32T	NM_002288.4	NP_002279.2	Q6ISS4	LAIR2_HUMAN	leukocyte-associated immunoglobulin-like receptor 2	32	Ig-like C2-type.					extracellular region (GO:0005576)				central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(1)	18	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0967)		ACCCTCCATCTCGGCTGAGCC	0.577																																					p.S32T		Atlas-SNP	.											.	LAIR2	30	.	0			c.T94A						PASS	.						116.0	129.0	124.0					19																	55019129		2203	4300	6503	SO:0001583	missense	3904	exon3			TCCATCTCGGCTG	AF013250	CCDS12897.1, CCDS12898.1	19q13.4	2013-01-29	2006-03-23		ENSG00000167618	ENSG00000167618		"""Leukocyte-associated Ig like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6478	protein-coding gene	gene with protein product		602993	"""leukocyte-associated Ig-like receptor 2"""			9285412	Standard	XM_005277264		Approved	CD306	uc002qgc.3	Q6ISS4	OTTHUMG00000065697	ENST00000301202.2:c.94T>A	chr19.hg19:g.55019129T>A	ENSP00000301202:p.Ser32Thr	259.0	0.0	.		222.0	79.0	.	NM_002288	Q6PEZ4	Missense_Mutation	SNP	ENST00000301202.2	hg19	CCDS12897.1	.	.	.	.	.	.	.	.	.	.	T	11.56	1.675150	0.29783	.	.	ENSG00000167618	ENST00000412608;ENST00000452094;ENST00000301202;ENST00000351841	T;T;T	0.23147	1.92;2.69;2.69	3.39	0.919	0.19392	Immunoglobulin-like fold (1);	2.380980	0.01840	N	0.035242	T	0.39064	0.1064	M	0.69358	2.11	0.09310	N	1	P;P;P	0.48589	0.911;0.873;0.912	P;B;P	0.50708	0.648;0.275;0.597	T	0.16512	-1.0400	10	0.72032	D	0.01	.	5.5099	0.16874	0.4585:0.0:0.0:0.5414	.	26;32;32	C9JFQ0;Q6ISS4-2;Q6ISS4	.;.;LAIR2_HUMAN	T	26;14;32;32	ENSP00000390729:S26T;ENSP00000301202:S32T;ENSP00000301203:S32T	ENSP00000301202:S32T	S	+	1	0	LAIR2	59710941	0.002000	0.14202	0.041000	0.18516	0.736000	0.42039	-0.423000	0.07034	0.452000	0.26830	0.260000	0.18958	TCG	.	.	.	none		0.577	LAIR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140801.1		
PROCR	10544	hgsc.bcm.edu	37	20	33762617	33762617	+	Silent	SNP	A	A	T			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr20:33762617A>T	ENST00000216968.4	+	2	265	c.183A>T	c.(181-183)ccA>ccT	p.P61P	EDEM2_ENST00000540582.1_Intron	NM_006404.3	NP_006395.2	Q9UNN8	EPCR_HUMAN	protein C receptor, endothelial	61					antigen processing and presentation (GO:0019882)|blood coagulation (GO:0007596)|immune response (GO:0006955)|negative regulation of coagulation (GO:0050819)	cell surface (GO:0009986)|centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			breast(1)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	10			BRCA - Breast invasive adenocarcinoma(18;0.0152)		Drotrecogin alfa(DB00055)	TGGAAGGCCCAGACACCAACA	0.622																																					p.P61P		Atlas-SNP	.											.	PROCR	26	.	0			c.A183T						PASS	.						93.0	70.0	78.0					20																	33762617		2203	4300	6503	SO:0001819	synonymous_variant	10544	exon2			AGGCCCAGACACC	L35545	CCDS13248.1	20q11.2	2010-05-04	2010-05-04		ENSG00000101000	ENSG00000101000		"""CD molecules"""	9452	protein-coding gene	gene with protein product		600646				7929370, 10518938	Standard	NM_006404		Approved	EPCR, CCD41, CD201	uc002xbt.3	Q9UNN8	OTTHUMG00000032323	ENST00000216968.4:c.183A>T	chr20.hg19:g.33762617A>T		63.0	0.0	.		75.0	30.0	.	NM_006404	B2RC04|Q14218|Q6IB56|Q96CB3|Q9ULX1	Silent	SNP	ENST00000216968.4	hg19	CCDS13248.1																																																																																			.	.	.	none		0.622	PROCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078843.3		
SLC13A3	64849	hgsc.bcm.edu	37	20	45204227	45204227	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr20:45204227C>A	ENST00000279027.4	-	10	1335	c.1317G>T	c.(1315-1317)atG>atT	p.M439I	SLC13A3_ENST00000413164.2_Missense_Mutation_p.M389I|SLC13A3_ENST00000495082.1_Missense_Mutation_p.M392I|SLC13A3_ENST00000472148.1_Missense_Mutation_p.M357I|SLC13A3_ENST00000290317.5_Missense_Mutation_p.M392I|SLC13A3_ENST00000435032.1_Intron|SLC13A3_ENST00000396360.1_Missense_Mutation_p.M357I	NM_001193342.1|NM_022829.5	NP_001180271.1|NP_073740.2	Q8WWT9	S13A3_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3	439					transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	high-affinity sodium:dicarboxylate symporter activity (GO:0015362)			breast(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	AGCCTTTGGCCATGGCGAAGC	0.632																																					p.M439I		Atlas-SNP	.											.	SLC13A3	88	.	0			c.G1317T						PASS	.						63.0	49.0	54.0					20																	45204227		2203	4300	6503	SO:0001583	missense	64849	exon10			TTTGGCCATGGCG	AF154121	CCDS13400.1, CCDS42886.1, CCDS54469.1, CCDS54470.1	20q13.12	2013-05-22			ENSG00000158296	ENSG00000158296		"""Solute carriers"""	14430	protein-coding gene	gene with protein product		606411				10794676, 10992006	Standard	NM_001011554		Approved	NADC3, SDCT2	uc002xsf.2	Q8WWT9	OTTHUMG00000033042	ENST00000279027.4:c.1317G>T	chr20.hg19:g.45204227C>A	ENSP00000279027:p.Met439Ile	25.0	0.0	.		17.0	7.0	.	NM_022829	B4DIR8|E1P5U4|F6WI18|Q5JYC9|Q5JYD0|Q5JYD1|Q5TCQ2|Q8IVB1|Q8N8K4|Q96MM5|Q9BR25|Q9H1G1|Q9H3W4|Q9NQN5|Q9NS04	Missense_Mutation	SNP	ENST00000279027.4	hg19	CCDS13400.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.386648	0.82902	.	.	ENSG00000158296	ENST00000290317;ENST00000396360;ENST00000279027;ENST00000472148;ENST00000413164;ENST00000495082;ENST00000468915	T;T;T;T;T;T;T	0.03386	3.95;3.95;3.95;3.95;3.95;3.95;3.95	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.06690	0.0171	N	0.25031	0.7	0.80722	D	1	P;P;P;P	0.46020	0.775;0.843;0.746;0.871	P;P;P;P	0.49799	0.507;0.544;0.487;0.622	T	0.36866	-0.9730	10	0.72032	D	0.01	-34.8403	17.6296	0.88103	0.0:1.0:0.0:0.0	.	389;357;392;439	B4DIR8;Q8WWT9-3;F6WI18;Q8WWT9	.;.;.;S13A3_HUMAN	I	392;357;439;357;389;392;392	ENSP00000290317:M392I;ENSP00000379648:M357I;ENSP00000279027:M439I;ENSP00000420177:M357I;ENSP00000415852:M389I;ENSP00000419621:M392I;ENSP00000417784:M392I	ENSP00000279027:M439I	M	-	3	0	SLC13A3	44637634	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.897000	0.69831	2.399000	0.81585	0.655000	0.94253	ATG	.	.	.	none		0.632	SLC13A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080329.2		
ZNF831	128611	hgsc.bcm.edu	37	20	57766279	57766279	+	Missense_Mutation	SNP	G	G	A	rs375833789		TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr20:57766279G>A	ENST00000371030.2	+	1	205	c.205G>A	c.(205-207)Ggg>Agg	p.G69R		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	69	Pro-rich.						metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					GGTGCCTCCCGGGGGCCTCCA	0.706																																					p.G69R		Atlas-SNP	.											.	ZNF831	287	.	0			c.G205A						PASS	.	G	ARG/GLY	1,3705		0,1,1852	9.0	11.0	10.0		205	5.6	0.9	20		10	0,8092		0,0,4046	no	missense	ZNF831	NM_178457.1	125	0,1,5898	AA,AG,GG		0.0,0.027,0.0085	probably-damaging	69/1678	57766279	1,11797	1853	4046	5899	SO:0001583	missense	128611	exon1			CCTCCCGGGGGCC	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.205G>A	chr20.hg19:g.57766279G>A	ENSP00000360069:p.Gly69Arg	29.0	0.0	.		25.0	11.0	.	NM_178457	Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	hg19	CCDS42894.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.011024	0.75046	2.7E-4	0.0	ENSG00000124203	ENST00000371030	T	0.05081	3.5	5.55	5.55	0.83447	.	.	.	.	.	T	0.16854	0.0405	L	0.27053	0.805	0.33846	D	0.632	D	0.89917	1.0	D	0.91635	0.999	T	0.05146	-1.0903	9	0.87932	D	0	-18.5525	18.4859	0.90828	0.0:0.0:1.0:0.0	.	69	Q5JPB2	ZN831_HUMAN	R	69	ENSP00000360069:G69R	ENSP00000360069:G69R	G	+	1	0	ZNF831	57199674	0.950000	0.32346	0.917000	0.36280	0.949000	0.60115	2.282000	0.43461	2.608000	0.88229	0.462000	0.41574	GGG	.	.	.	weak		0.706	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457	
LIPI	149998	hgsc.bcm.edu	37	21	15554081	15554081	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr21:15554081T>C	ENST00000536861.1	-	4	640	c.641A>G	c.(640-642)aAt>aGt	p.N214S	LIPI_ENST00000344577.2_Missense_Mutation_p.N235S			Q6XZB0	LIPI_HUMAN	lipase, member I	214					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|phospholipase activity (GO:0004620)			endometrium(1)|kidney(13)|large_intestine(9)|liver(3)|lung(24)|ovary(3)|urinary_tract(1)	54				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)		TTTGTTACCATTGGAGTCAGA	0.398																																					p.N235S		Atlas-SNP	.											.	LIPI	95	.	0			c.A704G						PASS	.						76.0	71.0	73.0					21																	15554081		2203	4300	6503	SO:0001583	missense	149998	exon4			TTACCATTGGAGT	BC028732	CCDS13564.1	21q11.2	2012-07-31			ENSG00000188992	ENSG00000188992			18821	protein-coding gene	gene with protein product	"""membrane-associated phospholipase A1 beta"", ""cancer/testis antigen 17"""	609252				12719377	Standard	XM_005260924		Approved	PRED5, LPDL, CT17, mPA-PLA1beta, PLA1C	uc002yjm.3	Q6XZB0	OTTHUMG00000074258	ENST00000536861.1:c.641A>G	chr21.hg19:g.15554081T>C	ENSP00000440381:p.Asn214Ser	42.0	0.0	.		45.0	22.0	.	NM_198996	G1JSG3|G1JSG4|G1JSG5|G1JSG6|G1JSG7|G1JSG8|G1JSG9	Missense_Mutation	SNP	ENST00000536861.1	hg19		.	.	.	.	.	.	.	.	.	.	T	9.157	1.017856	0.19355	.	.	ENSG00000188992	ENST00000344577;ENST00000536861;ENST00000382981	D;D	0.90069	-2.61;-2.61	5.46	4.31	0.51392	.	0.306919	0.38548	N	0.001658	T	0.77177	0.4092	N	0.13235	0.315	0.28263	N	0.924755	B;B	0.18741	0.03;0.03	B;B	0.21151	0.033;0.02	T	0.60172	-0.7315	10	0.08381	T	0.77	.	11.4777	0.50308	0.0:0.0716:0.0:0.9284	.	214;235	G1JSG6;Q6XZB0-2	.;.	S	235;214;109	ENSP00000343331:N235S;ENSP00000440381:N214S	ENSP00000343331:N235S	N	-	2	0	LIPI	14475952	1.000000	0.71417	0.643000	0.29450	0.055000	0.15305	5.357000	0.66058	1.007000	0.39238	0.533000	0.62120	AAT	.	.	.	none		0.398	LIPI-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_198996	
DEPDC5	9681	hgsc.bcm.edu	37	22	32301997	32301997	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr22:32301997T>G	ENST00000382111.2	+	40	4463	c.4403T>G	c.(4402-4404)cTg>cGg	p.L1468R	DEPDC5_ENST00000266091.3_Silent_p.S1466S|DEPDC5_ENST00000400246.1_Missense_Mutation_p.L1468R|DEPDC5_ENST00000539165.1_Silent_p.S305S|DEPDC5_ENST00000535622.1_Silent_p.S1388S|DEPDC5_ENST00000382105.2_3'UTR|DEPDC5_ENST00000400248.2_Silent_p.S1457S|DEPDC5_ENST00000400249.2_Silent_p.S1457S|DEPDC5_ENST00000382112.3_Silent_p.S1479S			O75140	DEPD5_HUMAN	DEP domain containing 5	0					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						ATAAATATTCTGCCTCTGCTT	0.488																																					p.S1488S		Atlas-SNP	.											.	DEPDC5	266	.	0			c.T4464G						PASS	.						89.0	85.0	86.0					22																	32301997		1943	4137	6080	SO:0001583	missense	9681	exon42			ATATTCTGCCTCT	AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382111.2:c.4403T>G	chr22.hg19:g.32301997T>G	ENSP00000371545:p.Leu1468Arg	61.0	0.0	.		39.0	20.0	.	NM_001242896	A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Silent	SNP	ENST00000382111.2	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.81|11.81	1.751165|1.751165	0.31046|0.31046	.|.	.|.	ENSG00000100150|ENSG00000100150	ENST00000433147|ENST00000400246;ENST00000382111	.|T;T	.|0.29655	.|1.56;1.56	5.01|5.01	-1.17|-1.17	0.09648|0.09648	.|.	.|.	.|.	.|.	.|.	T|T	0.29389|0.29389	0.0732|0.0732	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.29761|0.29761	-1.0001|-1.0001	4|6	.|0.72032	.|D	.|0.01	.|.	0.9017|0.9017	0.01275|0.01275	0.3175:0.289:0.1114:0.2822|0.3175:0.289:0.1114:0.2822	.|.	.|.	.|.	.|.	G|R	864|1468	.|ENSP00000383105:L1468R;ENSP00000371545:L1468R	.|ENSP00000371545:L1468R	C|L	+|+	1|2	0|0	DEPDC5|DEPDC5	30631997|30631997	0.011000|0.011000	0.17503|0.17503	0.969000|0.969000	0.41365|0.41365	0.990000|0.990000	0.78478|0.78478	-1.295000|-1.295000	0.02764|0.02764	-0.538000|-0.538000	0.06281|0.06281	0.459000|0.459000	0.35465|0.35465	TGC|CTG	.	.	.	none		0.488	DEPDC5-004	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000129085.1	NM_014662	
GPKOW	27238	hgsc.bcm.edu	37	X	48979068	48979068	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chrX:48979068G>A	ENST00000156109.5	-	2	313	c.235C>T	c.(235-237)Cgc>Tgc	p.R79C		NM_015698.4	NP_056513.2	Q92917	GPKOW_HUMAN	G patch domain and KOW motifs	79						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|ovary(2)	21						GGCTGCCTGCGATGGCCATTC	0.637																																					p.R79C		Atlas-SNP	.											.	GPKOW	38	.	0			c.C235T						PASS	.						37.0	39.0	38.0					X																	48979068		2203	4300	6503	SO:0001583	missense	27238	exon2			GCCTGCGATGGCC	U66359	CCDS35251.1	Xp11.23	2013-01-28			ENSG00000068394	ENSG00000068394		"""G patch domain containing"""	30677	protein-coding gene	gene with protein product	"""G patch domain containing 5"""					21880142, 22365833	Standard	NM_015698		Approved	T54, GPATC5, GPATCH5, Spp2	uc004dmr.3	Q92917	OTTHUMG00000021511	ENST00000156109.5:c.235C>T	chrX.hg19:g.48979068G>A	ENSP00000156109:p.Arg79Cys	24.0	0.0	.		35.0	17.0	.	NM_015698	Q59EK5|Q9BQA8	Missense_Mutation	SNP	ENST00000156109.5	hg19	CCDS35251.1	.	.	.	.	.	.	.	.	.	.	G	11.21	1.571866	0.28003	.	.	ENSG00000068394	ENST00000156109	.	.	.	4.73	0.739	0.18324	.	0.440958	0.26038	N	0.026709	T	0.28366	0.0701	L	0.51422	1.61	0.09310	N	0.999999	D	0.65815	0.995	B	0.44315	0.446	T	0.18209	-1.0344	9	0.59425	D	0.04	-3.2051	3.9276	0.09270	0.4817:0.1829:0.3353:0.0	.	79	Q92917	GPKOW_HUMAN	C	79	.	ENSP00000156109:R79C	R	-	1	0	GPKOW	48866012	0.070000	0.21116	0.006000	0.13384	0.580000	0.36256	2.429000	0.44758	0.398000	0.25338	-0.300000	0.09419	CGC	.	.	.	none		0.637	GPKOW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056535.2	NM_015698	
ESX1	80712	hgsc.bcm.edu	37	X	103499100	103499100	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chrX:103499100C>T	ENST00000372588.4	-	2	324	c.241G>A	c.(241-243)Gag>Aag	p.E81K		NM_153448.3	NP_703149.1	Q8N693	ESX1_HUMAN	ESX homeobox 1	81					labyrinthine layer blood vessel development (GO:0060716)|labyrinthine layer morphogenesis (GO:0060713)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(10)|lung(12)|ovary(1)|skin(2)	27						TGCTCCGGCTCGTGGCCGCCG	0.662																																					p.E81K	Pancreas(200;1705 2227 25194 28471 45274)	Atlas-SNP	.											.	ESX1	57	.	0			c.G241A						PASS	.						62.0	70.0	67.0					X																	103499100		2200	4276	6476	SO:0001583	missense	80712	exon2			CCGGCTCGTGGCC	AL049631	CCDS14516.1	Xq22.2	2011-06-20	2007-07-11	2006-02-08	ENSG00000123576	ENSG00000123576		"""Homeoboxes / PRD class"""	14865	protein-coding gene	gene with protein product		300154	"""extraembryonic, spermatogenesis, homeobox 1 homolog (mouse)"""	ESX1L		11374906, 17242862	Standard	NM_153448		Approved	ESXR1	uc004ely.3	Q8N693	OTTHUMG00000022125	ENST00000372588.4:c.241G>A	chrX.hg19:g.103499100C>T	ENSP00000361669:p.Glu81Lys	283.0	0.0	.		274.0	33.0	.	NM_153448	B0QYU3|Q7Z6K7	Missense_Mutation	SNP	ENST00000372588.4	hg19	CCDS14516.1	.	.	.	.	.	.	.	.	.	.	c	9.690	1.151579	0.21371	.	.	ENSG00000123576	ENST00000372588	D	0.91521	-2.86	3.13	-6.25	0.02039	.	.	.	.	.	T	0.77011	0.4068	N	0.24115	0.695	0.09310	N	1	P	0.35011	0.48	B	0.18561	0.022	T	0.63902	-0.6532	9	0.13853	T	0.58	-2.0978	12.3476	0.55130	0.0:0.1335:0.6842:0.1822	.	81	Q8N693	ESX1_HUMAN	K	81	ENSP00000361669:E81K	ENSP00000361669:E81K	E	-	1	0	ESX1	103385756	0.000000	0.05858	0.000000	0.03702	0.080000	0.17528	-0.657000	0.05335	-2.111000	0.00836	-0.560000	0.04181	GAG	.	.	.	none		0.662	ESX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057763.2	NM_153448	
ZNF318	24149	hgsc.bcm.edu	37	6	43320114	43320114	+	Splice_Site	DEL	C	C	-			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr6:43320114delC	ENST00000361428.2	-	5	2848		c.e5+1		ZNF318_ENST00000318149.3_Splice_Site	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318						meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			GCAGCTGATACCTTGTTGTTT	0.418																																					.		Atlas-INDEL	.											.	ZNF318	175	.	0			c.2770+2G>-						PASS	.						110.0	97.0	102.0					6																	43320114		2203	4300	6503	SO:0001630	splice_region_variant	24149	exon6			.	AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.2770+1G>-	chr6.hg19:g.43320114delC		66.0	0.0	0		68.0	30.0	0.441176	NM_014345	O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Splice_Site	DEL	ENST00000361428.2	hg19	CCDS4895.2																																																																																			.	.	.	none		0.418	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040601.2	NM_014345	Intron
POMGNT1	55624	hgsc.bcm.edu	37	1	46662703	46662704	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	GA	GA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr1:46662703_46662704delGA	ENST00000371984.3	-	3	330_331	c.173_174delTC	c.(172-174)atcfs	p.I58fs	POMGNT1_ENST00000371986.3_Frame_Shift_Del_p.I58fs|POMGNT1_ENST00000535522.1_Frame_Shift_Del_p.I36fs|POMGNT1_ENST00000396420.3_Frame_Shift_Del_p.I58fs|POMGNT1_ENST00000371992.1_Frame_Shift_Del_p.I58fs	NM_017739.3	NP_060209	Q8WZA1	PMGT1_HUMAN	protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-)	58					protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity (GO:0047223)			breast(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(166;0.155)					GAGTGTCCAGGATCAACTTGAT	0.55																																					p.58_59del		Atlas-INDEL	.											.	POMGNT1	96	.	0			c.174_175del						PASS	.																																			SO:0001589	frameshift_variant	55624	exon3			.		CCDS531.1, CCDS57995.1	1p34.1	2014-09-17	2013-07-31		ENSG00000085998	ENSG00000085998	2.4.1.-	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	19139	protein-coding gene	gene with protein product	"""protein O-mannose beta-1,2-N-acetylglucosaminyltransferase"""	606822	"""muscle-eye-brain disease"", ""protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase"""	MEB		11742540, 12788071	Standard	NM_017739		Approved	FLJ20277, MGAT1.2, LGMD2O	uc001cpg.3	Q8WZA1	OTTHUMG00000007604	ENST00000371984.3:c.173_174delTC	chr1.hg19:g.46662703_46662704delGA	ENSP00000361052:p.Ile58fs	312.0	0.0	0		257.0	97.0	0.377432	NM_017739	D3DQ16|Q5VST2|Q5VST3|Q9BV55|Q9H9L8|Q9NXF9|Q9NYF7	Frame_Shift_Del	DEL	ENST00000371984.3	hg19	CCDS531.1																																																																																			.	.	.	none		0.550	POMGNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020146.1	NM_017739	
DSC3	1825	hgsc.bcm.edu	37	18	28576918	28576918	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr18:28576918delT	ENST00000360428.4	-	15	2412	c.2332delA	c.(2332-2334)accfs	p.T778fs	DSC3_ENST00000434452.1_Frame_Shift_Del_p.T778fs	NM_001941.3	NP_001932.2	Q14574	DSC3_HUMAN	desmocollin 3	778					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|protein stabilization (GO:0050821)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(29)|ovary(2)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56			OV - Ovarian serous cystadenocarcinoma(10;0.125)			ATTTCAATGGTTTCCTGCCCT	0.502																																					p.T778fs		Atlas-INDEL	.											.	DSC3	225	.	0			c.2333delC						PASS	.						119.0	96.0	104.0					18																	28576918		2203	4300	6503	SO:0001589	frameshift_variant	1825	exon15			.	X83929	CCDS32810.1	18q12.1	2014-07-30			ENSG00000134762	ENSG00000134762		"""Cadherins / Major cadherins"""	3037	protein-coding gene	gene with protein product		600271		DSC4		7774948, 8486729	Standard	NM_001941		Approved	CDHF3, DSC, DSC1, DSC2	uc002kwj.4	Q14574	OTTHUMG00000179622	ENST00000360428.4:c.2332delA	chr18.hg19:g.28576918delT	ENSP00000353608:p.Thr778fs	62.0	0.0	0		60.0	22.0	0.366667	NM_024423	A6NN35|Q14200|Q9HAZ9	Frame_Shift_Del	DEL	ENST00000360428.4	hg19	CCDS32810.1																																																																																			.	.	.	none		0.502	DSC3-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447384.1	NM_001941, NM_024423	
PLXNB2	23654	hgsc.bcm.edu	37	22	50719301	50719302	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr22:50719301_50719302insT	ENST00000449103.1	-	24	4004_4005	c.3864_3865insA	c.(3862-3867)ccctccfs	p.S1289fs	PLXNB2_ENST00000359337.4_Frame_Shift_Ins_p.S1289fs|PLXNB2_ENST00000496720.1_5'Flank			O15031	PLXB2_HUMAN	plexin B2	1289					brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CCGTCCTTGGAGGGCAGGAAGA	0.629																																					p.S1289fs		Atlas-INDEL	.											.	PLXNB2	172	.	0			c.3865_3866insA						PASS	.																																			SO:0001589	frameshift_variant	23654	exon24			.		CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.3864_3865insA	chr22.hg19:g.50719301_50719302insT	ENSP00000409171:p.Ser1289fs	52.0	0.0	0		42.0	13.0	0.309524	NM_012401	A6QRH0|Q7KZU3|Q9BSU7	Frame_Shift_Ins	INS	ENST00000449103.1	hg19	CCDS43035.1																																																																																			.	.	.	none		0.629	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316874.3	NM_012401	
RAB6A	5870	hgsc.bcm.edu	37	11	73418504	73418504	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr11:73418504delA	ENST00000336083.3	-	6	911	c.456delT	c.(454-456)tttfs	p.F152fs	RAB6A_ENST00000541588.1_Intron|RAB6A_ENST00000536566.1_Frame_Shift_Del_p.F119fs|RAB6A_ENST00000310653.6_Frame_Shift_Del_p.F152fs	NM_198896.1	NP_942599.1	P20340	RAB6A_HUMAN	RAB6A, member RAS oncogene family	152					antigen processing and presentation (GO:0019882)|early endosome to Golgi transport (GO:0034498)|GTP catabolic process (GO:0006184)|minus-end-directed organelle transport along microtubule (GO:0072385)|peptidyl-cysteine methylation (GO:0018125)|protein localization to Golgi apparatus (GO:0034067)|protein targeting to Golgi (GO:0000042)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)|protein domain specific binding (GO:0019904)			large_intestine(2)|lung(2)	4						TAGTTTCAATAAACATAACAT	0.348																																					p.I153fs		Atlas-INDEL	.											.	RAB6A	17	.	0			c.457delA						PASS	.						189.0	175.0	180.0					11																	73418504		2200	4293	6493	SO:0001589	frameshift_variant	5870	exon6			.	AF130986	CCDS8223.1, CCDS8224.1, CCDS58155.1, CCDS58156.1	11q13.3	2008-08-08			ENSG00000175582	ENSG00000175582		"""RAB, member RAS oncogene"""	9786	protein-coding gene	gene with protein product		179513		RAB6			Standard	NM_001243718		Approved		uc001ouf.3	P20340	OTTHUMG00000134308	ENST00000336083.3:c.456delT	chr11.hg19:g.73418504delA	ENSP00000336850:p.Phe152fs	184.0	0.0	0		121.0	51.0	0.421488	NM_002869	A8K133|B7Z772|F5H668|Q1W5D8|Q5U0A8|Q9UBE4	Frame_Shift_Del	DEL	ENST00000336083.3	hg19	CCDS8224.1																																																																																			.	.	.	none		0.348	RAB6A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259241.2		
NAPSA	9476	hgsc.bcm.edu	37	19	50862007	50862007	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr19:50862007delA	ENST00000253719.2	-	9	1274	c.1066delT	c.(1066-1068)tccfs	p.S356fs	NR1H2_ENST00000600978.1_Intron|NR1H2_ENST00000542413.1_Intron	NM_004851.1	NP_004842.1	O96009	NAPSA_HUMAN	napsin A aspartic peptidase	356					membrane protein proteolysis (GO:0033619)|proteolysis (GO:0006508)|surfactant homeostasis (GO:0043129)	alveolar lamellar body (GO:0097208)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	aspartic-type endopeptidase activity (GO:0004190)|endopeptidase activity (GO:0004175)|peptidase activity (GO:0008233)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|skin(3)	12		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00743)|GBM - Glioblastoma multiforme(134;0.0183)		TGGAAACCGGACAAGCAGAGG	0.632																																					p.S356fs		Atlas-INDEL	.											.	NAPSA	38	.	0			c.1067delC						PASS	.						24.0	26.0	25.0					19																	50862007		2200	4299	6499	SO:0001589	frameshift_variant	9476	exon9			.	AF090386	CCDS12794.1	19q13.33	2011-08-25				ENSG00000131400			13395	protein-coding gene	gene with protein product	"""kidney-derived aspartic protease-like protein"""	605631					Standard	NM_004851		Approved	NAP1, NAPA, Kdap, KAP	uc002prx.3	O96009		ENST00000253719.2:c.1066delT	chr19.hg19:g.50862007delA	ENSP00000253719:p.Ser356fs	31.0	0.0	0		22.0	11.0	0.5	NM_004851	Q8WWD9	Frame_Shift_Del	DEL	ENST00000253719.2	hg19	CCDS12794.1																																																																																			.	.	.	none		0.632	NAPSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464714.1	NM_004851	
TENM3	55714	hgsc.bcm.edu	37	4	183664509	183664515	+	Frame_Shift_Del	DEL	GCGATTT	GCGATTT	-	rs189480567		TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	GCGATTT	GCGATTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr4:183664509_183664515delGCGATTT	ENST00000511685.1	+	19	3689_3695	c.3566_3572delGCGATTT	c.(3565-3573)ggcgatttcfs	p.GDF1189fs	TENM3_ENST00000502950.1_3'UTR|TENM3_ENST00000406950.2_Frame_Shift_Del_p.GDF1189fs			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	1189					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.G1189G(1)									CTGTACGTAGGCGATTTCAACTATGTG	0.473																																					p.1189_1191del		Atlas-INDEL	.											.	.	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.3565_3571del						PASS	.																																			SO:0001589	frameshift_variant	55714	exon18			.	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.3566_3572delGCGATTT	chr4.hg19:g.183664509_183664515delGCGATTT	ENSP00000424226:p.Gly1189fs	112.0	0.0	0		70.0	19.0	0.271429	NM_001080477	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Frame_Shift_Del	DEL	ENST00000511685.1	hg19	CCDS47165.1																																																																																			.	.	.	none		0.473	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361734.1		
KMT2D	8085	hgsc.bcm.edu	37	12	49434210	49434210	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr12:49434210delT	ENST00000301067.7	-	31	7342	c.7343delA	c.(7342-7344)gacfs	p.D2448fs		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	2448	Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										AGAATAAGGGTCAGGGGACTG	0.612																																					p.D2448fs		Atlas-INDEL	.											.	MLL2	1173	.	0			c.7344delC						PASS	.						43.0	49.0	47.0					12																	49434210		2063	4194	6257	SO:0001589	frameshift_variant	8085	exon31			.	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.7343delA	chr12.hg19:g.49434210delT	ENSP00000301067:p.Asp2448fs	76.0	0.0	0		76.0	31.0	0.407895	NM_003482	O14687	Frame_Shift_Del	DEL	ENST00000301067.7	hg19	CCDS44873.1																																																																																			.	.	.	none		0.612	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
USP28	57646	hgsc.bcm.edu	37	11	113679118	113679119	+	Frame_Shift_Ins	INS	-	-	TG	rs2465647	byFrequency	TCGA-BQ-5878-01A-11D-1589-08	TCGA-BQ-5878-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01600b4b-cddc-41a5-b541-326677217bc2	0d002eab-1f4e-4846-b2cc-25aae886715d	g.chr11:113679118_113679119insTG	ENST00000003302.4	-	18	2273_2274	c.2205_2206insCA	c.(2203-2208)tcgtctfs	p.S736fs	USP28_ENST00000545540.1_Frame_Shift_Ins_p.S611fs|USP28_ENST00000260188.5_Frame_Shift_Ins_p.S736fs|USP28_ENST00000544967.1_Frame_Shift_Ins_p.S444fs	NM_020886.2	NP_065937.1	Q96RU2	UBP28_HUMAN	ubiquitin specific peptidase 28	736					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|protein deubiquitination (GO:0016579)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(24)|ovary(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	59		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		GCATGCTCAGACGACAAGCAGC	0.47																																					p.S736fs	Melanoma(4;162 555 7664)|GBM(79;500 2010 17506)|Esophageal Squamous(9;463 924 15765)	Atlas-INDEL	.											.	USP28	135	.	0			c.2206_2207insCA						PASS	.																																			SO:0001589	frameshift_variant	57646	exon18			.	AB040948	CCDS31680.1, CCDS73394.1	11q23	2008-04-11	2005-08-08		ENSG00000048028	ENSG00000048028		"""Ubiquitin-specific peptidases"""	12625	protein-coding gene	gene with protein product		610748	"""ubiquitin specific protease 28"""			12838346, 11597335	Standard	XM_005271630		Approved	KIAA1515	uc001poh.3	Q96RU2	OTTHUMG00000168205	ENST00000003302.4:c.2205_2206insCA	chr11.hg19:g.113679118_113679119insTG	ENSP00000003302:p.Ser736fs	122.0	0.0	0		142.0	54.0	0.380282	NM_020886	B0YJC0|B0YJC1|Q9P213	Frame_Shift_Ins	INS	ENST00000003302.4	hg19	CCDS31680.1																																																																																			.	.	.	none		0.470	USP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398789.1		
