#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ELTD1	64123	hgsc.bcm.edu	37	1	79386001	79386001	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr1:79386001G>A	ENST00000370742.3	-	10	1391	c.1328C>T	c.(1327-1329)gCc>gTc	p.A443V		NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1	443					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		AATGCATATGGCAAGACAAAT	0.313																																					p.A443V		Atlas-SNP	.											.	ELTD1	143	.	0			c.C1328T						PASS	.						103.0	97.0	99.0					1																	79386001		1812	4078	5890	SO:0001583	missense	64123	exon10			CATATGGCAAGAC	AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.1328C>T	chr1.hg19:g.79386001G>A	ENSP00000359778:p.Ala443Val	161.0	0.0	.		135.0	37.0	.	NM_022159	B1AR71|Q5KU34	Missense_Mutation	SNP	ENST00000370742.3	hg19	CCDS41352.1	.	.	.	.	.	.	.	.	.	.	G	15.22	2.768298	0.49680	.	.	ENSG00000162618	ENST00000370742	T	0.41065	1.01	5.0	5.0	0.66597	GPCR, family 2-like (1);	0.175937	0.50627	D	0.000111	T	0.21921	0.0528	L	0.45422	1.42	0.40567	D	0.981269	B	0.10296	0.003	B	0.23018	0.043	T	0.04537	-1.0944	9	.	.	.	.	14.2963	0.66316	0.0:0.1486:0.8513:0.0	.	443	Q9HBW9	ELTD1_HUMAN	V	443	ENSP00000359778:A443V	.	A	-	2	0	ELTD1	79158589	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	5.598000	0.67585	2.469000	0.83416	0.650000	0.86243	GCC	.	.	.	none		0.313	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026859.1	NM_022159	
LMNA	4000	hgsc.bcm.edu	37	1	156105085	156105085	+	Silent	SNP	C	C	T			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr1:156105085C>T	ENST00000368300.4	+	5	1130	c.918C>T	c.(916-918)ctC>ctT	p.L306L	LMNA_ENST00000368301.2_Silent_p.L306L|LMNA_ENST00000392353.3_Silent_p.L225L|LMNA_ENST00000361308.4_Silent_p.L306L|LMNA_ENST00000368299.3_Silent_p.L306L|LMNA_ENST00000496738.1_3'UTR|LMNA_ENST00000473598.2_Silent_p.L207L|LMNA_ENST00000448611.2_Silent_p.L194L|LMNA_ENST00000368297.1_Silent_p.L225L|LMNA_ENST00000347559.2_Silent_p.L306L	NM_170707.3	NP_733821.1	P02545	LMNA_HUMAN	lamin A/C	306	Coil 2.|Rod.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to hypoxia (GO:0071456)|endoplasmic reticulum unfolded protein response (GO:0030968)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic nuclear envelope reassembly (GO:0007084)|muscle organ development (GO:0007517)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|positive regulation of cell aging (GO:0090343)|protein localization to nucleus (GO:0034504)|regulation of cell migration (GO:0030334)|regulation of protein localization to nucleus (GO:1900180)|sterol regulatory element binding protein import into nucleus (GO:0035105)|ventricular cardiac muscle cell development (GO:0055015)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament (GO:0005882)|lamin filament (GO:0005638)|nuclear envelope (GO:0005635)|nuclear lamina (GO:0005652)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	structural molecule activity (GO:0005198)			NS(1)|endometrium(1)|kidney(1)|lung(3)|ovary(4)	10	Hepatocellular(266;0.158)					CTGCCCAGCTCAGCCAGCTCC	0.662									Werner syndrome;Hutchinson-Gilford Progeria Syndrome																												p.L306L		Atlas-SNP	.											.	LMNA	31	.	0			c.C918T						PASS	.						25.0	28.0	27.0					1																	156105085		2202	4299	6501	SO:0001819	synonymous_variant	4000	exon5	Familial Cancer Database	WS, Adult Progeria;HGPS, Progeria	CCAGCTCAGCCAG	BC014507	CCDS1129.1, CCDS1131.1, CCDS58038.1, CCDS72941.1, CCDS72942.1	1q22	2014-09-17			ENSG00000160789	ENSG00000160789		"""Intermediate filaments type V, lamins"""	6636	protein-coding gene	gene with protein product		150330	"""cardiomyopathy, dilated 1A (autosomal dominant)"", ""limb girdle muscular dystrophy 1B (autosomal dominant)"", ""progeria 1 (Hutchinson-Gilford type)"", ""lamin A/C-like 1"""	LMN1, CMD1A, LGMD1B, PRO1, LMNL1		8511676, 8838815, 12702809	Standard	NM_005572		Approved	HGPS	uc001fni.3	P02545	OTTHUMG00000013961	ENST00000368300.4:c.918C>T	chr1.hg19:g.156105085C>T		37.0	0.0	.		35.0	10.0	.	NM_170707	B4DI32|D3DVB0|D6RAQ3|E7EUI9|P02546|Q5I6Y4|Q5I6Y6|Q5TCJ2|Q5TCJ3|Q6UYC3|Q969I8|Q96JA2	Silent	SNP	ENST00000368300.4	hg19	CCDS1129.1																																																																																			.	.	.	none		0.662	LMNA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039200.2	NM_170707	
SLC5A6	8884	hgsc.bcm.edu	37	2	27427384	27427384	+	Missense_Mutation	SNP	G	G	A	rs199587675		TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr2:27427384G>A	ENST00000310574.3	-	9	1423	c.950C>T	c.(949-951)gCg>gTg	p.A317V	SLC5A6_ENST00000461319.1_5'Flank|SLC5A6_ENST00000408041.1_Missense_Mutation_p.A317V	NM_021095.2	NP_066918.2	Q9Y289	SC5A6_HUMAN	solute carrier family 5 (sodium/multivitamin and iodide cotransporter), member 6	317					biotin metabolic process (GO:0006768)|biotin transport (GO:0015878)|pantothenate metabolic process (GO:0015939)|pantothenate transmembrane transport (GO:0015887)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)	p.A317V(1)		endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|ovary(3)|prostate(1)|skin(1)	20	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Biotin(DB00121)|gabapentin enacarbil(DB08872)|Lipoic Acid(DB00166)	CTGGTAATACGCGAACATGAC	0.597																																					p.A317V		Atlas-SNP	.											SLC5A6,colon,carcinoma,0,1	SLC5A6	63	.	1	Substitution - Missense(1)	large_intestine(1)	c.C950T						PASS	.						99.0	95.0	96.0					2																	27427384		2203	4300	6503	SO:0001583	missense	8884	exon9			TAATACGCGAACA	AF069307	CCDS1740.1	2p23	2013-07-19	2013-07-19		ENSG00000138074	ENSG00000138074		"""Solute carriers"""	11041	protein-coding gene	gene with protein product		604024	"""solute carrier family 5 (sodium-dependent vitamin transporter), member 6"""			9516450, 10329687	Standard	NM_021095		Approved	SMVT	uc002rjd.3	Q9Y289	OTTHUMG00000097075	ENST00000310574.3:c.950C>T	chr2.hg19:g.27427384G>A	ENSP00000310208:p.Ala317Val	109.0	0.0	.		107.0	33.0	.	NM_021095	B2RB85|D6W549|Q969Y5	Missense_Mutation	SNP	ENST00000310574.3	hg19	CCDS1740.1	.	.	.	.	.	.	.	.	.	.	G	11.01	1.513536	0.27123	.	.	ENSG00000138074	ENST00000310574;ENST00000408041	D;D	0.88586	-2.4;-2.4	4.93	2.04	0.26737	.	0.604283	0.16756	N	0.200821	D	0.85733	0.5765	M	0.67569	2.06	0.39947	D	0.974481	B	0.33345	0.409	B	0.34242	0.178	T	0.82370	-0.0491	10	0.52906	T	0.07	.	7.2906	0.26364	0.1706:0.1441:0.6852:0.0	.	317	Q9Y289	SC5A6_HUMAN	V	317	ENSP00000310208:A317V;ENSP00000384853:A317V	ENSP00000310208:A317V	A	-	2	0	SLC5A6	27280888	0.999000	0.42202	0.226000	0.23910	0.215000	0.24574	3.539000	0.53604	0.585000	0.29608	0.655000	0.94253	GCG	.	.	.	weak		0.597	SLC5A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214194.1	NM_021095	
RAB3GAP1	22930	hgsc.bcm.edu	37	2	135815628	135815628	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr2:135815628G>A	ENST00000264158.8	+	3	165	c.122G>A	c.(121-123)gGa>gAa	p.G41E	RAB3GAP1_ENST00000442034.1_Missense_Mutation_p.G41E|RAB3GAP1_ENST00000539493.1_5'UTR|RAB3GAP1_ENST00000425393.1_Missense_Mutation_p.G41E	NM_012233.2	NP_036365.1	Q15042	RB3GP_HUMAN	RAB3 GTPase activating protein subunit 1 (catalytic)	41					brain development (GO:0007420)|camera-type eye development (GO:0043010)|establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|face morphogenesis (GO:0060325)|hypothalamus development (GO:0021854)|lipid particle organization (GO:0034389)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of calcium ion-dependent exocytosis of neurotransmitter (GO:1903233)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of GTPase activity (GO:0043087)|regulation of short-term neuronal synaptic plasticity (GO:0048172)	cytoplasm (GO:0005737)|endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(10)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32				BRCA - Breast invasive adenocarcinoma(221;0.117)		AAACTGATTGGAAACTCTTTG	0.383																																					p.G41E		Atlas-SNP	.											.	RAB3GAP1	87	.	0			c.G122A						PASS	.						91.0	86.0	88.0					2																	135815628		2203	4300	6503	SO:0001583	missense	22930	exon3			TGATTGGAAACTC	D31886	CCDS33294.1, CCDS54402.1	2q21.3	2013-07-09			ENSG00000115839	ENSG00000115839			17063	protein-coding gene	gene with protein product		602536				9030515, 15696165	Standard	NM_012233		Approved	RAB3GAP, KIAA0066, RAB3GAP130, WARBM1	uc010fnf.3	Q15042	OTTHUMG00000154889	ENST00000264158.8:c.122G>A	chr2.hg19:g.135815628G>A	ENSP00000264158:p.Gly41Glu	66.0	0.0	.		76.0	27.0	.	NM_001172435	A6H8Z3|C9J837|Q659F5|Q8TBB4	Missense_Mutation	SNP	ENST00000264158.8	hg19	CCDS33294.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.554169	0.86231	.	.	ENSG00000115839	ENST00000264158;ENST00000442034;ENST00000425393	T;T	0.48201	0.84;0.82	5.62	5.62	0.85841	.	0.174050	0.52532	D	0.000076	T	0.66268	0.2772	M	0.69823	2.125	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.70227	0.927;0.968	T	0.61466	-0.7057	10	0.25751	T	0.34	-20.0075	16.5774	0.84705	0.0:0.0:1.0:0.0	.	41;41	C9J837;Q15042	.;RB3GP_HUMAN	E	41	ENSP00000264158:G41E;ENSP00000411418:G41E	ENSP00000264158:G41E	G	+	2	0	RAB3GAP1	135532098	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.478000	0.81082	2.642000	0.89623	0.655000	0.94253	GGA	.	.	.	none		0.383	RAB3GAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337514.2	NM_012233	
TTN	7273	hgsc.bcm.edu	37	2	179429062	179429062	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr2:179429062G>T	ENST00000591111.1	-	276	77098	c.76874C>A	c.(76873-76875)gCa>gAa	p.A25625E	TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.A27266E|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.A18326E|TTN_ENST00000460472.2_Missense_Mutation_p.A18201E|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.A24698E|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.A18393E|TTN-AS1_ENST00000592600.1_RNA			Q8WZ42	TITIN_HUMAN	titin	25625	Fibronectin type-III 86. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCATCTCTTGCAGTAATGGC	0.393																																					p.A27266E		Atlas-SNP	.											.	TTN	18412	.	0			c.C81797A						PASS	.						106.0	104.0	105.0					2																	179429062		1912	4119	6031	SO:0001583	missense	7273	exon326			TCTCTTGCAGTAA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.76874C>A	chr2.hg19:g.179429062G>T	ENSP00000465570:p.Ala25625Glu	138.0	0.0	.		135.0	31.0	.	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	G	15.43	2.830143	0.50845	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.54279	0.58;0.58;0.58;0.58	6.07	6.07	0.98685	Fibronectin, type III (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.79287	0.4420	M	0.89478	3.035	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.996;0.996;0.996;0.996	T	0.81406	-0.0947	9	0.87932	D	0	.	20.6452	0.99591	0.0:0.0:1.0:0.0	.	18201;18326;18393;25625	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	E	24698;18201;18393;18326;18199	ENSP00000343764:A24698E;ENSP00000434586:A18201E;ENSP00000340554:A18393E;ENSP00000352154:A18326E	ENSP00000340554:A18393E	A	-	2	0	TTN	179137308	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.030000	0.88816	2.885000	0.99019	0.650000	0.86243	GCA	.	.	.	none		0.393	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
FYTTD1	84248	hgsc.bcm.edu	37	3	197501076	197501076	+	Silent	SNP	T	T	C			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr3:197501076T>C	ENST00000241502.4	+	6	873	c.651T>C	c.(649-651)acT>acC	p.T217T	FYTTD1_ENST00000415708.2_Silent_p.T191T|FYTTD1_ENST00000428395.2_Silent_p.T126T|FYTTD1_ENST00000424384.2_Silent_p.T150T	NM_032288.6	NP_115664.2	Q96QD9	UIF_HUMAN	forty-two-three domain containing 1	217					mRNA export from nucleus (GO:0006406)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	13	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.175)		CAAAGAGAACTCGTCAGTAAG	0.378																																					p.T217T		Atlas-SNP	.											.	FYTTD1	34	.	0			c.T651C						PASS	.						171.0	168.0	169.0					3																	197501076		2203	4300	6503	SO:0001819	synonymous_variant	84248	exon6			GAGAACTCGTCAG	AJ344094	CCDS3329.1, CCDS43196.1, CCDS43196.2	3q29	2011-03-03			ENSG00000122068	ENSG00000122068			25407	protein-coding gene	gene with protein product	"""UAP56-interacting factor"""					19836239	Standard	NM_001011537		Approved	DKFZp761B1514, UIF	uc003fyi.2	Q96QD9	OTTHUMG00000155453	ENST00000241502.4:c.651T>C	chr3.hg19:g.197501076T>C		150.0	0.0	.		139.0	6.0	.	NM_032288	A8MY74|B2RCB2|B7Z3R4|B7Z7V1|B7Z8I0|B7ZAJ3|C9J7P6|C9JNG6|C9JTH3|C9JY50|Q96SL9|Q9BQI8	Silent	SNP	ENST00000241502.4	hg19	CCDS3329.1																																																																																			.	.	.	none		0.378	FYTTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340185.3	NM_032288	
PRSS12	8492	hgsc.bcm.edu	37	4	119273492	119273492	+	Silent	SNP	A	A	T			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr4:119273492A>T	ENST00000296498.3	-	1	666	c.384T>A	c.(382-384)gcT>gcA	p.A128A		NM_003619.3	NP_003610.2	P56730	NETR_HUMAN	protease, serine, 12 (neurotrypsin, motopsin)	128	Kringle. {ECO:0000255|PROSITE- ProRule:PRU00121}.				exocytosis (GO:0006887)|zymogen activation (GO:0031638)	axon (GO:0030424)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)|terminal bouton (GO:0043195)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(3)|kidney(1)|large_intestine(9)|lung(11)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	29						CTCGCAGCTGAGCCCAGCTCG	0.706																																					p.A128A		Atlas-SNP	.											.	PRSS12	71	.	0			c.T384A						PASS	.						9.0	10.0	10.0					4																	119273492		2194	4283	6477	SO:0001819	synonymous_variant	8492	exon1			CAGCTGAGCCCAG	AJ001531	CCDS3709.1	4q25-q26	2010-05-07			ENSG00000164099	ENSG00000164099		"""Serine peptidases / Serine peptidases"""	9477	protein-coding gene	gene with protein product		606709				9540828, 9245503	Standard	NM_003619		Approved	BSSP-3, MRT1	uc003ica.2	P56730	OTTHUMG00000161166	ENST00000296498.3:c.384T>A	chr4.hg19:g.119273492A>T		3.0	0.0	.		8.0	4.0	.	NM_003619	Q9UP16	Silent	SNP	ENST00000296498.3	hg19	CCDS3709.1																																																																																			.	.	.	none		0.706	PRSS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256516.2		
SLC12A7	10723	hgsc.bcm.edu	37	5	1094290	1094290	+	Silent	SNP	C	C	T			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr5:1094290C>T	ENST00000264930.5	-	2	241	c.198G>A	c.(196-198)ggG>ggA	p.G66G		NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	66					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	CCATGTTCTTCCCTTCAAAGA	0.468																																					p.G66G		Atlas-SNP	.											.	SLC12A7	97	.	0			c.G198A						PASS	.						128.0	120.0	123.0					5																	1094290		2203	4300	6503	SO:0001819	synonymous_variant	10723	exon2			GTTCTTCCCTTCA	AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.198G>A	chr5.hg19:g.1094290C>T		171.0	0.0	.		87.0	49.0	.	NM_006598	A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Silent	SNP	ENST00000264930.5	hg19	CCDS34129.1																																																																																			.	.	.	none		0.468	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366446.2	NM_006598	
POP1	10940	hgsc.bcm.edu	37	8	99142345	99142345	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr8:99142345C>T	ENST00000401707.2	+	5	707	c.626C>T	c.(625-627)gCc>gTc	p.A209V	POP1_ENST00000349693.3_Missense_Mutation_p.A209V	NM_001145860.1|NM_001145861.1	NP_001139332.1|NP_001139333.1	Q99575	POP1_HUMAN	processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)	209					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA 5'-leader removal (GO:0001682)|tRNA catabolic process (GO:0016078)	extracellular space (GO:0005615)|nucleolar ribonuclease P complex (GO:0005655)|ribonuclease MRP complex (GO:0000172)	poly(A) RNA binding (GO:0044822)|ribonuclease MRP activity (GO:0000171)|ribonuclease P activity (GO:0004526)	p.A209V(1)		autonomic_ganglia(1)|breast(3)|endometrium(4)|large_intestine(9)|lung(15)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.145)			ATCTGGCACGCCAAGCGGTTT	0.488																																					p.A209V		Atlas-SNP	.											POP1,NS,carcinoma,0,1	POP1	85	.	1	Substitution - Missense(1)	lung(1)	c.C626T						PASS	.						75.0	72.0	73.0					8																	99142345		2203	4300	6503	SO:0001583	missense	10940	exon5			GGCACGCCAAGCG	D31765	CCDS6277.1	8q22.2	2012-05-21			ENSG00000104356	ENSG00000104356			30129	protein-coding gene	gene with protein product	"""processing of precursors 1"""	602486				10199568, 8918471	Standard	NM_015029		Approved		uc011lgv.2	Q99575	OTTHUMG00000164635	ENST00000401707.2:c.626C>T	chr8.hg19:g.99142345C>T	ENSP00000385787:p.Ala209Val	128.0	0.0	.		115.0	45.0	.	NM_001145860	A8K5W9|Q15037	Missense_Mutation	SNP	ENST00000401707.2	hg19	CCDS6277.1	.	.	.	.	.	.	.	.	.	.	C	36	5.647996	0.96714	.	.	ENSG00000104356	ENST00000401707;ENST00000349693	T;T	0.61980	0.06;0.06	5.81	5.81	0.92471	Ribonuclease P/MRP, subunit POP1 (1);	0.139825	0.47093	D	0.000247	T	0.76905	0.4053	M	0.66378	2.025	0.80722	D	1	D	0.56287	0.975	D	0.65323	0.934	T	0.75004	-0.3470	9	.	.	.	-3.0517	17.8794	0.88835	0.0:1.0:0.0:0.0	.	209	Q99575	POP1_HUMAN	V	209	ENSP00000385787:A209V;ENSP00000339529:A209V	.	A	+	2	0	POP1	99211521	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.731000	0.84895	2.746000	0.94184	0.591000	0.81541	GCC	.	.	.	none		0.488	POP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379470.1	NM_015029	
RDX	5962	hgsc.bcm.edu	37	11	110124813	110124813	+	Missense_Mutation	SNP	G	G	T	rs370869036		TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr11:110124813G>T	ENST00000343115.4	-	9	1136	c.817C>A	c.(817-819)Cgt>Agt	p.R273S	RDX_ENST00000528900.1_Intron|RDX_ENST00000405097.1_Missense_Mutation_p.R273S|RDX_ENST00000528498.1_Missense_Mutation_p.R273S|RDX_ENST00000544551.1_Missense_Mutation_p.R137S|RDX_ENST00000530301.1_Intron	NM_001260494.1|NM_002906.3	NP_001247423.1|NP_002897.1	P35241	RADI_HUMAN	radixin	273	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin filament capping (GO:0051693)|apical protein localization (GO:0045176)|establishment of endothelial barrier (GO:0061028)|microvillus assembly (GO:0030033)|positive regulation of gene expression (GO:0010628)	apical part of cell (GO:0045177)|cell tip (GO:0051286)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|stereocilium (GO:0032420)|T-tubule (GO:0030315)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(2)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	18		all_cancers(61;7.18e-13)|all_epithelial(67;2.61e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.13e-06)|BRCA - Breast invasive adenocarcinoma(274;9.75e-06)|all cancers(92;5.9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0248)		ATTCTCAGACGAGGTGCATAA	0.338																																					p.R273S	Esophageal Squamous(55;25 1062 11040 28755 44273)	Atlas-SNP	.											.	RDX	59	.	0			c.C817A						PASS	.						81.0	72.0	75.0					11																	110124813		2201	4298	6499	SO:0001583	missense	5962	exon9			TCAGACGAGGTGC	BC020751	CCDS8343.1, CCDS58171.1, CCDS58172.1, CCDS58173.1, CCDS58174.1	11q23	2008-03-17				ENSG00000137710			9944	protein-coding gene	gene with protein product		179410	"""deafness, autosomal recessive 24"""	DFNB24		8486357, 17226784	Standard	NM_001260492		Approved		uc031qdy.1	P35241		ENST00000343115.4:c.817C>A	chr11.hg19:g.110124813G>T	ENSP00000342830:p.Arg273Ser	80.0	0.0	.		77.0	4.0	.	NM_001260493	A7YIJ8|A7YIK0|A7YIK3|B7Z9U6|F5H1A7|Q86Y61	Missense_Mutation	SNP	ENST00000343115.4	hg19	CCDS8343.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.599569	0.87055	.	.	ENSG00000137710	ENST00000528498;ENST00000429481;ENST00000405097;ENST00000343115;ENST00000544551	T;T;T;T	0.79554	-1.28;-1.28;-1.28;-1.28	5.72	5.72	0.89469	FERM, C-terminal PH-like domain (1);FERM domain (1);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	D	0.86969	0.6061	L	0.54908	1.71	0.80722	D	1	P;D;B	0.64830	0.501;0.994;0.026	B;P;B	0.62298	0.206;0.9;0.089	D	0.85377	0.1117	10	0.41790	T	0.15	.	19.8831	0.96905	0.0:0.0:1.0:0.0	.	137;273;273	F5H1A7;A7YIJ8;P35241	.;.;RADI_HUMAN	S	273;273;273;273;137	ENSP00000432112:R273S;ENSP00000384136:R273S;ENSP00000342830:R273S;ENSP00000445826:R137S	ENSP00000342830:R273S	R	-	1	0	RDX	109630023	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.799000	0.99117	2.705000	0.92388	0.655000	0.94253	CGT	.	.	.	alt		0.338	RDX-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390535.2	NM_002906	
NELL2	4753	hgsc.bcm.edu	37	12	45097517	45097517	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr12:45097517T>C	ENST00000429094.2	-	12	1814	c.1310A>G	c.(1309-1311)tAc>tGc	p.Y437C	NELL2_ENST00000437801.2_Missense_Mutation_p.Y487C|NELL2_ENST00000395487.2_Missense_Mutation_p.Y436C|NELL2_ENST00000452445.2_Missense_Mutation_p.Y437C|NELL2_ENST00000551601.1_Missense_Mutation_p.Y436C|NELL2_ENST00000549027.1_Missense_Mutation_p.Y436C|NELL2_ENST00000333837.4_Missense_Mutation_p.Y460C	NM_001145108.1	NP_001138580.1	Q99435	NELL2_HUMAN	NEL-like 2 (chicken)	437	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(16)|lung(30)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	65	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		ACCTTCACAGTAGGCATTATC	0.403																																					p.Y487C		Atlas-SNP	.											.	NELL2	286	.	0			c.A1460G						PASS	.						97.0	89.0	92.0					12																	45097517		2203	4300	6503	SO:0001583	missense	4753	exon13			TCACAGTAGGCAT	D83018	CCDS8746.1, CCDS44863.1, CCDS44864.1, CCDS53781.1	12q12	2012-01-30	2001-11-28		ENSG00000184613	ENSG00000184613			7751	protein-coding gene	gene with protein product		602320	"""nel (chicken)-like 2"""			19249368	Standard	NM_006159		Approved	NRP2	uc010skz.1	Q99435	OTTHUMG00000169464	ENST00000429094.2:c.1310A>G	chr12.hg19:g.45097517T>C	ENSP00000390680:p.Tyr437Cys	136.0	0.0	.		104.0	32.0	.	NM_001145107	B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Missense_Mutation	SNP	ENST00000429094.2	hg19	CCDS8746.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.07|19.07	3.756435|3.756435	0.69648|0.69648	.|.	.|.	ENSG00000184613|ENSG00000184613	ENST00000550313|ENST00000395487;ENST00000429094;ENST00000551601;ENST00000452445;ENST00000549027;ENST00000333837;ENST00000437801;ENST00000543684	.|D;D;T;D;D;D;D	.|0.95622	.|-1.56;-1.56;-0.63;-1.56;-1.56;-2.26;-3.76	5.6|5.6	5.6|5.6	0.85130|0.85130	.|Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.97396|0.97396	0.9148|0.9148	M|M	0.77616|0.77616	2.38|2.38	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;0.999;1.0;1.0	.|D;D;D;D;D;D	.|0.80764	.|0.956;0.984;0.986;0.994;0.968;0.993	D|D	0.97098|0.97098	0.9795|0.9795	5|10	.|0.36615	.|T	.|0.2	-30.8204|-30.8204	15.7975|15.7975	0.78423|0.78423	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|460;487;436;437;437;436	.|B7Z2U7;B7Z9U3;F8VVB6;B3KTI3;Q99435;Q96JS2	.|.;.;.;.;NELL2_HUMAN;.	A|C	181|436;437;436;437;436;460;487;436	.|ENSP00000378866:Y436C;ENSP00000390680:Y437C;ENSP00000449332:Y436C;ENSP00000394612:Y437C;ENSP00000447927:Y436C;ENSP00000327988:Y460C;ENSP00000416341:Y487C	.|ENSP00000327988:Y460C	T|Y	-|-	1|2	0|0	NELL2|NELL2	43383784|43383784	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.089000|7.089000	0.76909|0.76909	2.135000|2.135000	0.66039|0.66039	0.528000|0.528000	0.53228|0.53228	ACT|TAC	.	.	.	none		0.403	NELL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404180.1	NM_006159	
ELMSAN1	91748	hgsc.bcm.edu	37	14	74196477	74196477	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr14:74196477T>C	ENST00000286523.5	-	4	2743	c.1961A>G	c.(1960-1962)tAc>tGc	p.Y654C	ELMSAN1_ENST00000394071.2_Missense_Mutation_p.Y654C	NM_194278.3	NP_919254.2	Q6PJG2	EMSA1_HUMAN	ELM2 and Myb/SANT-like domain containing 1	654					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)										GGGCGGCGTGTAGGGAGGTAG	0.627																																					p.Y654C		Atlas-SNP	.											.	.	.	.	0			c.A1961G						PASS	.						69.0	63.0	65.0					14																	74196477		2203	4300	6503	SO:0001583	missense	91748	exon4			GGCGTGTAGGGAG	BF971739	CCDS9819.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000156030	ENSG00000156030			19853	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 117"", ""chromosome 14 open reading frame 43"""	C14orf117, C14orf43			Standard	NM_194278		Approved	LSR68	uc001xou.3	Q6PJG2	OTTHUMG00000150359	ENST00000286523.5:c.1961A>G	chr14.hg19:g.74196477T>C	ENSP00000286523:p.Tyr654Cys	95.0	0.0	.		78.0	23.0	.	NM_194278	Q6PK13|Q6PK59|Q6ZS23	Missense_Mutation	SNP	ENST00000286523.5	hg19	CCDS9819.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.429427	0.83776	.	.	ENSG00000156030	ENST00000394071;ENST00000286523;ENST00000423556;ENST00000435371	T;T;T;T	0.51071	0.72;0.72;0.72;0.74	5.27	5.27	0.74061	.	0.000000	0.64402	D	0.000018	T	0.70404	0.3220	M	0.81497	2.545	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.75608	-0.3259	10	0.87932	D	0	-12.2873	15.1835	0.72978	0.0:0.0:0.0:1.0	.	654;654	A0PJD3;Q6PJG2	.;CN043_HUMAN	C	654	ENSP00000377634:Y654C;ENSP00000286523:Y654C;ENSP00000407767:Y654C;ENSP00000402380:Y654C	ENSP00000286523:Y654C	Y	-	2	0	C14orf43	73266230	1.000000	0.71417	0.999000	0.59377	0.972000	0.66771	8.032000	0.88838	1.977000	0.57605	0.391000	0.25812	TAC	.	.	.	none		0.627	ELMSAN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317793.1	NM_194278	
RYR3	6263	hgsc.bcm.edu	37	15	33905537	33905537	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr15:33905537G>T	ENST00000389232.4	+	19	2388	c.2318G>T	c.(2317-2319)gGg>gTg	p.G773V	RYR3_ENST00000415757.3_Missense_Mutation_p.G773V	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	773	B30.2/SPRY 1. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AACACAGACGGGCTCTTCTTC	0.552																																					p.G773V		Atlas-SNP	.											.	RYR3	760	.	0			c.G2318T						PASS	.						50.0	54.0	53.0					15																	33905537		2107	4260	6367	SO:0001583	missense	6263	exon19			CAGACGGGCTCTT		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.2318G>T	chr15.hg19:g.33905537G>T	ENSP00000373884:p.Gly773Val	52.0	0.0	.		32.0	18.0	.	NM_001243996	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	hg19	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.821891	0.90873	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	T;T	0.70869	-0.52;-0.52	5.4	5.4	0.78164	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.85682	D	0.000000	T	0.80944	0.4721	L	0.47190	1.495	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.96	T	0.79305	-0.1858	10	0.45353	T	0.12	.	19.4159	0.94700	0.0:0.0:1.0:0.0	.	773;773	Q15413-2;Q15413	.;RYR3_HUMAN	V	773	ENSP00000373884:G773V;ENSP00000399610:G773V	ENSP00000354735:G773V	G	+	2	0	RYR3	31692829	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.715000	0.84713	2.821000	0.97095	0.650000	0.86243	GGG	.	.	.	none		0.552	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
NUP88	4927	hgsc.bcm.edu	37	17	5314095	5314095	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr17:5314095C>T	ENST00000573584.1	-	4	1117	c.608G>A	c.(607-609)cGt>cAt	p.R203H		NM_002532.4	NP_002523.2	Q99567	NUP88_HUMAN	nucleoporin 88kDa	203					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	transporter activity (GO:0005215)			endometrium(4)|kidney(4)|large_intestine(4)|lung(3)	15						CTGCGGCTCACGTAGTGAGTA	0.388																																					p.R203H		Atlas-SNP	.											.	NUP88	47	.	0			c.G608A						PASS	.						107.0	114.0	112.0					17																	5314095		2203	4300	6503	SO:0001583	missense	4927	exon4			GGCTCACGTAGTG	Y08612	CCDS11070.1	17p13	2004-02-18	2002-08-29		ENSG00000108559	ENSG00000108559			8067	protein-coding gene	gene with protein product		602552	"""nucleoporin 88kD"""			9049309	Standard	NM_002532		Approved	MGC8530	uc002gbo.2	Q99567	OTTHUMG00000099453	ENST00000573584.1:c.608G>A	chr17.hg19:g.5314095C>T	ENSP00000458954:p.Arg203His	254.0	0.0	.		240.0	84.0	.	NM_002532	D3DTM2|Q9BWE5	Missense_Mutation	SNP	ENST00000573584.1	hg19	CCDS11070.1	.	.	.	.	.	.	.	.	.	.	C	11.84	1.757883	0.31137	.	.	ENSG00000108559	ENST00000225696;ENST00000543132	.	.	.	5.47	3.46	0.39613	.	0.364516	0.30126	N	0.010346	T	0.36936	0.0985	L	0.44542	1.39	0.28618	N	0.908315	B;B;B	0.09022	0.002;0.002;0.001	B;B;B	0.08055	0.002;0.002;0.003	T	0.28776	-1.0033	9	0.45353	T	0.12	-6.739	8.1438	0.31100	0.0:0.6984:0.0:0.3016	.	203;72;203	B7Z5I6;B4DP20;Q99567	.;.;NUP88_HUMAN	H	203;72	.	ENSP00000225696:R203H	R	-	2	0	NUP88	5254819	0.997000	0.39634	0.947000	0.38551	0.620000	0.37586	1.229000	0.32600	0.794000	0.33899	0.561000	0.74099	CGT	.	.	.	none		0.388	NUP88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216918.3	NM_002532	
MYH3	4621	hgsc.bcm.edu	37	17	10554908	10554908	+	Silent	SNP	G	G	A	rs577513442		TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr17:10554908G>A	ENST00000583535.1	-	5	513	c.426C>T	c.(424-426)ggC>ggT	p.G142G	MYH3_ENST00000226209.7_Silent_p.G142G	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	142	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						TGCCTCGGTAGCCTTCCACCA	0.557													G|||	1	0.000199681	0.0	0.0	5008	,	,		14358	0.001		0.0	False		,,,				2504	0.0				p.G142G		Atlas-SNP	.											.	MYH3	227	.	0			c.C426T						PASS	.						137.0	137.0	137.0					17																	10554908		2203	4300	6503	SO:0001819	synonymous_variant	4621	exon5			TCGGTAGCCTTCC		CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.426C>T	chr17.hg19:g.10554908G>A		243.0	0.0	.		232.0	68.0	.	NM_002470	Q15492	Silent	SNP	ENST00000583535.1	hg19	CCDS11157.1																																																																																			.	.	.	none		0.557	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252734.2	NM_002470	
GH1	2688	hgsc.bcm.edu	37	17	61995168	61995168	+	Silent	SNP	G	G	T			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr17:61995168G>T	ENST00000323322.5	-	4	450	c.408C>A	c.(406-408)gtC>gtA	p.V136V	GH1_ENST00000458650.2_Silent_p.V121V|GH1_ENST00000342364.4_Intron|CSHL1_ENST00000392824.4_Intron|GH1_ENST00000351388.4_Silent_p.V96V	NM_000515.3	NP_000506.2	P01241	SOMA_HUMAN	growth hormone 1	136			V -> I (in dbSNP:rs5388). {ECO:0000269|PubMed:12655557, ECO:0000269|PubMed:15001589}.		bone maturation (GO:0070977)|glucose transport (GO:0015758)|growth hormone receptor signaling pathway (GO:0060396)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|response to estradiol (GO:0032355)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)|growth hormone receptor binding (GO:0005131)|metal ion binding (GO:0046872)|prolactin receptor binding (GO:0005148)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)	19						GGAGGTCATAGACGTTGCTGT	0.607																																					p.V136V		Atlas-SNP	.											.	GH1	39	.	0			c.C408A						PASS	.						68.0	68.0	68.0					17																	61995168		2203	4300	6503	SO:0001819	synonymous_variant	2688	exon4			GTCATAGACGTTG	M13438	CCDS11653.1, CCDS11654.1, CCDS45760.1	17q22-q24	2014-01-30				ENSG00000259384		"""Endogenous ligands"""	4261	protein-coding gene	gene with protein product	"""pituitary growth hormone"", ""somatotropin"""	139250				6306568	Standard	XM_005257218		Approved	GH-N, GHN, GH, hGH-N	uc002jdj.3	P01241		ENST00000323322.5:c.408C>A	chr17.hg19:g.61995168G>T		128.0	0.0	.		131.0	57.0	.	NM_000515	A6NEF6|Q14405|Q16631|Q5EB53|Q9HBZ1|Q9UMJ7|Q9UNL5	Silent	SNP	ENST00000323322.5	hg19	CCDS11653.1																																																																																			.	.	.	none		0.607	GH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417708.1	NM_000515	
RYR1	6261	hgsc.bcm.edu	37	19	38948197	38948197	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr19:38948197G>T	ENST00000359596.3	+	17	1852	c.1852G>T	c.(1852-1854)Gat>Tat	p.D618Y	RYR1_ENST00000360985.3_Missense_Mutation_p.D618Y|RYR1_ENST00000355481.4_Missense_Mutation_p.D618Y			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	618	B30.2/SPRY 1. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CTCCAACCAAGATCTTATTAC	0.522																																					p.D618Y		Atlas-SNP	.											RYR1,caecum,carcinoma,0,1	RYR1	708	.	0			c.G1852T						PASS	.						341.0	275.0	297.0					19																	38948197		2203	4300	6503	SO:0001583	missense	6261	exon17			AACCAAGATCTTA	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.1852G>T	chr19.hg19:g.38948197G>T	ENSP00000352608:p.Asp618Tyr	293.0	0.0	.		311.0	14.0	.	NM_001042723	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	hg19	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	G	14.39	2.521791	0.44866	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.97089	-4.24;-4.24;-4.24	3.76	3.76	0.43208	Intracellular calcium-release channel (1);B30.2/SPRY domain (1);	0.075267	0.49916	U	0.000125	D	0.95912	0.8669	L	0.36672	1.1	0.42899	D	0.99422	D;D	0.64830	0.994;0.98	P;P	0.61722	0.862;0.893	D	0.94764	0.7939	10	0.87932	D	0	.	5.1222	0.14865	0.2768:0.0:0.7232:0.0	.	618;618	P21817-2;P21817	.;RYR1_HUMAN	Y	618	ENSP00000352608:D618Y;ENSP00000347667:D618Y;ENSP00000354254:D618Y	ENSP00000347667:D618Y	D	+	1	0	RYR1	43640037	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.680000	0.54641	2.113000	0.64589	0.555000	0.69702	GAT	.	.	.	none		0.522	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
ZNF175	7728	hgsc.bcm.edu	37	19	52091521	52091521	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr19:52091521T>C	ENST00000262259.2	+	5	2295	c.1937T>C	c.(1936-1938)cTt>cCt	p.L646P	ZNF175_ENST00000436511.2_Intron	NM_007147.2	NP_009078.1	Q9Y473	ZN175_HUMAN	zinc finger protein 175	646					defense response to virus (GO:0051607)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000426)|OV - Ovarian serous cystadenocarcinoma(262;0.0257)		TATGAATGCCTTGACTGTGGG	0.443																																					p.L646P		Atlas-SNP	.											.	ZNF175	65	.	0			c.T1937C						PASS	.						86.0	84.0	85.0					19																	52091521		2203	4300	6503	SO:0001583	missense	7728	exon5			AATGCCTTGACTG	D50419	CCDS12837.1	19q13.4	2013-01-08			ENSG00000105497	ENSG00000105497		"""Zinc fingers, C2H2-type"", ""-"""	12964	protein-coding gene	gene with protein product		601139				8838321	Standard	NM_007147		Approved	OTK18	uc002pxb.3	Q9Y473	OTTHUMG00000167771	ENST00000262259.2:c.1937T>C	chr19.hg19:g.52091521T>C	ENSP00000262259:p.Leu646Pro	154.0	0.0	.		156.0	50.0	.	NM_007147	A8K9H2	Missense_Mutation	SNP	ENST00000262259.2	hg19	CCDS12837.1	.	.	.	.	.	.	.	.	.	.	T	1.034	-0.680825	0.03353	.	.	ENSG00000105497	ENST00000262259	T	0.10763	2.84	2.14	-2.05	0.07321	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02418	0.0074	N	0.00707	-1.245	0.09310	N	1	B	0.28324	0.207	B	0.29663	0.105	T	0.37009	-0.9724	9	0.48119	T	0.1	.	0.6964	0.00900	0.1625:0.18:0.2558:0.4017	.	646	Q9Y473	ZN175_HUMAN	P	646	ENSP00000262259:L646P	ENSP00000262259:L646P	L	+	2	0	ZNF175	56783333	0.000000	0.05858	0.066000	0.19879	0.247000	0.25773	-3.014000	0.00646	-0.395000	0.07715	-1.142000	0.01873	CTT	.	.	.	none		0.443	ZNF175-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396205.1	NM_007147	
PTPRA	5786	hgsc.bcm.edu	37	20	2998529	2998529	+	Silent	SNP	C	C	T			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr20:2998529C>T	ENST00000216877.6	+	12	1384	c.984C>T	c.(982-984)gtC>gtT	p.V328V	PTPRA_ENST00000425918.2_Silent_p.V348V|PTPRA_ENST00000358719.4_Silent_p.V193V|PTPRA_ENST00000399903.2_Silent_p.V337V|PTPRA_ENST00000318266.5_Silent_p.V328V|PTPRA_ENST00000356147.3_Silent_p.V328V|PTPRA_ENST00000380393.3_Silent_p.V337V	NM_080840.2	NP_543030.1	P18433	PTPRA_HUMAN	protein tyrosine phosphatase, receptor type, A	337	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axon guidance (GO:0007411)|insulin receptor signaling pathway (GO:0008286)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein phosphorylation (GO:0006468)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						CCACCATCGTCATGGTTACCA	0.433																																					p.V337V		Atlas-SNP	.											.	PTPRA	75	.	0			c.C1011T						PASS	.						114.0	105.0	108.0					20																	2998529		2203	4300	6503	SO:0001819	synonymous_variant	5786	exon17			CATCGTCATGGTT		CCDS13038.1, CCDS13039.1	20p13	2011-06-09			ENSG00000132670	ENSG00000132670		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9664	protein-coding gene	gene with protein product		176884		PTPRL2, PTPA		2172030, 2169617	Standard	NM_080840		Approved	LRP, HLPR, HPTPA, RPTPA	uc002whn.3	P18433	OTTHUMG00000031718	ENST00000216877.6:c.984C>T	chr20.hg19:g.2998529C>T		69.0	0.0	.		57.0	27.0	.	NM_002836	A8K2G8|D3DVX5|Q14513|Q7Z2I2|Q96TD9	Silent	SNP	ENST00000216877.6	hg19	CCDS13039.1																																																																																			.	.	.	none		0.433	PTPRA-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077682.3		
SSX1	6756	hgsc.bcm.edu	37	X	48123289	48123289	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chrX:48123289G>A	ENST00000376919.3	+	6	539	c.403G>A	c.(403-405)Gat>Aat	p.D135N		NM_001278691.1|NM_005635.2	NP_001265620.1|NP_005626.1	Q16384	SSX1_HUMAN	synovial sarcoma, X breakpoint 1	135					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|transcription corepressor activity (GO:0003714)		SS18/SSX1(1169)|SS18L1/SSX1(2)	endometrium(2)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	9						CCCACAAAACGATGGGAAACA	0.423			T	SS18	synovial sarcoma																																p.D135N	Esophageal Squamous(175;994 1982 2214 6527 18857)	Atlas-SNP	.		Dom	yes		X	Xp11.23-p11.22	6756	"""synovial sarcoma, X breakpoint 1"""		M	.	SSX1	27	.	0			c.G403A						PASS	.						153.0	141.0	145.0					X																	48123289		2203	4299	6502	SO:0001583	missense	6756	exon6			CAAAACGATGGGA	BC001003	CCDS14290.1	Xp11.23	2009-03-12			ENSG00000126752	ENSG00000126752			11335	protein-coding gene	gene with protein product	"""cancer/testis antigen family 5, member 1"""	312820				7655467	Standard	NM_005635		Approved	CT5.1	uc004djb.1	Q16384	OTTHUMG00000021488	ENST00000376919.3:c.403G>A	chrX.hg19:g.48123289G>A	ENSP00000366118:p.Asp135Asn	334.0	0.0	.		345.0	19.0	.	NM_005635	A3KN76|Q08AJ2|Q5JQ64	Missense_Mutation	SNP	ENST00000376919.3	hg19	CCDS14290.1	.	.	.	.	.	.	.	.	.	.	N	0.021	-1.430282	0.01117	.	.	ENSG00000126752	ENST00000376919	T	0.07327	3.2	2.1	1.21	0.21127	.	1.694760	0.03640	N	0.239416	T	0.04318	0.0119	L	0.38175	1.15	0.09310	N	1	P	0.47545	0.897	B	0.29524	0.103	T	0.32903	-0.9889	10	0.02654	T	1	.	4.011	0.09623	0.2273:0.0:0.7727:0.0	.	135	Q16384	SSX1_HUMAN	N	135	ENSP00000366118:D135N	ENSP00000366118:D135N	D	+	1	0	SSX1	48008233	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	-0.159000	0.10056	0.336000	0.23639	0.380000	0.24917	GAT	.	.	.	none		0.423	SSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056485.1	NM_005635	
USP26	83844	hgsc.bcm.edu	37	X	132160221	132160221	+	Silent	SNP	A	A	C			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chrX:132160221A>C	ENST00000511190.1	-	6	2497	c.2028T>G	c.(2026-2028)ccT>ccG	p.P676P	USP26_ENST00000370832.1_Silent_p.P676P|USP26_ENST00000406273.1_Silent_p.P676P	NM_031907.1	NP_114113.1	Q9BXU7	UBP26_HUMAN	ubiquitin specific peptidase 26	676	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	60	Acute lymphoblastic leukemia(192;0.000127)					GGCTGCTGGCAGGTTTACCTC	0.428																																					p.P676P	NSCLC(104;342 1621 36940 47097 52632)	Atlas-SNP	.											.	USP26	135	.	0			c.T2028G						PASS	.						83.0	79.0	81.0					X																	132160221		2203	4299	6502	SO:0001819	synonymous_variant	83844	exon1			GCTGGCAGGTTTA	AF285593	CCDS14635.1	Xq26.2	2012-07-13	2005-08-08		ENSG00000134588	ENSG00000134588	3.4.19.12	"""Ubiquitin-specific peptidases"""	13485	protein-coding gene	gene with protein product		300309	"""ubiquitin specific protease 26"""			12838346	Standard	NM_031907		Approved		uc011mvf.2	Q9BXU7	OTTHUMG00000022429	ENST00000511190.1:c.2028T>G	chrX.hg19:g.132160221A>C		215.0	0.0	.		196.0	41.0	.	NM_031907	B9WRT6|Q5H9H4	Silent	SNP	ENST00000511190.1	hg19	CCDS14635.1																																																																																			.	.	.	none		0.428	USP26-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359441.1	NM_031907	
LSM14A	26065	hgsc.bcm.edu	37	19	34710448	34710449	+	Frame_Shift_Del	DEL	AG	AG	-	rs372366966		TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	AG	AG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr19:34710448_34710449delAG	ENST00000433627.5	+	7	1009_1010	c.934_935delAG	c.(934-936)agafs	p.R312fs	LSM14A_ENST00000540746.2_Frame_Shift_Del_p.R271fs|LSM14A_ENST00000544216.3_Frame_Shift_Del_p.R312fs	NM_001114093.1	NP_001107565.1	Q8ND56	LS14A_HUMAN	LSM14A, SCD6 homolog A (S. cerevisiae)	312	DFDF. {ECO:0000255|PROSITE- ProRule:PRU00845}.				cytoplasmic mRNA processing body assembly (GO:0033962)|multicellular organismal development (GO:0007275)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of translation (GO:0006417)|RIG-I signaling pathway (GO:0039529)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|intracellular membrane-bounded organelle (GO:0043231)	double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)	p.R312K(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(7)|skin(1)	22	Esophageal squamous(110;0.162)					AGAGATTGACAGAGAGTTTCAT	0.327																																					p.311_312del		Atlas-INDEL	.											.	LSM14A	44	.	1	Substitution - Missense(1)	large_intestine(1)	c.933_934del						PASS	.																																			SO:0001589	frameshift_variant	26065	exon7			.	AL834398	CCDS12435.1, CCDS46040.1	19q13.12	2010-01-27	2006-12-21	2006-01-24		ENSG00000257103			24489	protein-coding gene	gene with protein product		610677	"""chromosome 19 open reading frame 13"", ""family with sequence similarity 61, member A"", ""LSM14 homolog A (SCD6, S. cerevisiae)"""	C19orf13, FAM61A		12477932	Standard	NM_015578		Approved	DKFZP434D1335, RAP55A, RAP55	uc002nva.4	Q8ND56		ENST00000433627.5:c.934_935delAG	chr19.hg19:g.34710452_34710453delAG	ENSP00000413964:p.Arg312fs	144.0	0.0	0		142.0	59.0	0.415493	NM_001114093	B4DTG6|Q76LX7|Q96AR3|Q96K73|Q96SN5|Q9UFR3	Frame_Shift_Del	DEL	ENST00000433627.5	hg19	CCDS46040.1																																																																																			.	.	.	none		0.327	LSM14A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451576.3	NM_015578	
ACTR1B	10120	hgsc.bcm.edu	37	2	98275011	98275014	+	Frame_Shift_Del	DEL	GAGT	GAGT	-	rs200965492		TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	GAGT	GAGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr2:98275011_98275014delGAGT	ENST00000289228.5	-	6	749_752	c.533_536delACTC	c.(532-537)cactccfs	p.HS178fs		NM_005735.3	NP_005726.1	P42025	ACTY_HUMAN	ARP1 actin-related protein 1 homolog B, centractin beta (yeast)	178					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)			endometrium(1)|large_intestine(5)|lung(7)|ovary(1)|skin(1)	15						CCGCATGATGGAGTGAGGCATGGC	0.603																																					p.178_179del		Atlas-INDEL	.											.	ACTR1B	34	.	0			c.534_537del						PASS	.																																			SO:0001589	frameshift_variant	10120	exon6			.	X82207	CCDS2033.1	2q11.1-q11.2	2008-05-20	2001-11-28		ENSG00000115073	ENSG00000115073			168	protein-coding gene	gene with protein product		605144	"""ARP1 (actin-related protein 1, yeast) homolog B (centractin beta)"""	CTRN2		7696711, 10343100	Standard	NM_005735		Approved		uc002syb.2	P42025	OTTHUMG00000130549	ENST00000289228.5:c.533_536delACTC	chr2.hg19:g.98275011_98275014delGAGT	ENSP00000289228:p.His178fs	105.0	0.0	0		73.0	10.0	0.136986	NM_005735	D3DVH2|Q53SK5|Q9BRB7	Frame_Shift_Del	DEL	ENST00000289228.5	hg19	CCDS2033.1																																																																																			.	.	.	none		0.603	ACTR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252973.1	NM_005735	
