#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MACF1	23499	hgsc.bcm.edu	37	1	39775962	39775962	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr1:39775962C>A	ENST00000372915.3	+	24	3064	c.2977C>A	c.(2977-2979)Ctt>Att	p.L993I	MACF1_ENST00000564288.1_Missense_Mutation_p.L988I|MACF1_ENST00000539005.1_Missense_Mutation_p.L993I|MACF1_ENST00000317713.7_Missense_Mutation_p.L993I|MACF1_ENST00000545844.1_Missense_Mutation_p.L993I|MACF1_ENST00000476350.1_3'UTR|MACF1_ENST00000361689.2_Missense_Mutation_p.L993I|MACF1_ENST00000567887.1_Missense_Mutation_p.L1025I			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	993					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TATGAAGAACCTTCAGGCCCA	0.463																																					p.L993I		Atlas-SNP	.											.	MACF1	909	.	0			c.C2977A						PASS	.						114.0	94.0	101.0					1																	39775962		2203	4300	6503	SO:0001583	missense	23499	exon26			AAGAACCTTCAGG	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.2977C>A	chr1.hg19:g.39775962C>A	ENSP00000362006:p.Leu993Ile	52.0	0.0	.		53.0	12.0	.	NM_012090	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.6|20.6	4.013512|4.013512	0.75161|0.75161	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000524432;ENST00000530262|ENST00000372925	D;D;D;D;D;D;D|.	0.95035|.	-1.71;-1.73;-1.71;-1.74;-1.62;-3.08;-3.59|.	5.21|5.21	5.21|5.21	0.72293|0.72293	.|.	.|.	.|.	.|.	.|.	T|T	0.77987|0.77987	0.4213|0.4213	M|M	0.87456|0.87456	2.885|2.885	0.80722|0.80722	D|D	1|1	P;D;D|.	0.89917|.	0.524;0.997;1.0|.	B;P;D|.	0.78314|.	0.3;0.839;0.991|.	T|T	0.80953|0.80953	-0.1152|-0.1152	9|5	0.72032|.	D|.	0.01|.	.|.	12.1581|12.1581	0.54089|0.54089	0.0:0.9218:0.0:0.0782|0.0:0.9218:0.0:0.0782	.|.	993;993;958|.	F8W8Q1;Q9UPN3-2;Q9UPN3-3|.	.;.;.|.	I|H	993;993;993;993;993;951;1142|126	ENSP00000439537:L993I;ENSP00000362006:L993I;ENSP00000354573:L993I;ENSP00000313438:L993I;ENSP00000444364:L993I;ENSP00000435070:L951I;ENSP00000437059:L1142I|.	ENSP00000313438:L993I|.	L|P	+|+	1|2	0|0	MACF1|MACF1	39548549|39548549	1.000000|1.000000	0.71417|0.71417	0.989000|0.989000	0.46669|0.46669	0.721000|0.721000	0.41392|0.41392	3.237000|3.237000	0.51344|0.51344	2.430000|2.430000	0.82344|0.82344	0.655000|0.655000	0.94253|0.94253	CTT|CCT	.	.	.	none		0.463	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
HIVEP3	59269	hgsc.bcm.edu	37	1	41976755	41976755	+	Silent	SNP	G	G	C			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr1:41976755G>C	ENST00000372583.1	-	9	7473	c.6588C>G	c.(6586-6588)ccC>ccG	p.P2196P	HIVEP3_ENST00000372584.1_Silent_p.P2195P|HIVEP3_ENST00000460604.1_5'UTR|HIVEP3_ENST00000247584.5_Silent_p.P2196P|HIVEP3_ENST00000429157.2_Silent_p.P2195P	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	2196					positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				TCCCACCGATGGGAATCAAGG	0.667																																					p.P2196P		Atlas-SNP	.											.	HIVEP3	235	.	0			c.C6588G						PASS	.						101.0	103.0	102.0					1																	41976755		2203	4300	6503	SO:0001819	synonymous_variant	59269	exon9			ACCGATGGGAATC	AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.6588C>G	chr1.hg19:g.41976755G>C		149.0	0.0	.		122.0	22.0	.	NM_024503	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Silent	SNP	ENST00000372583.1	hg19	CCDS463.1																																																																																			.	.	.	none		0.667	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000016978.1	NM_024503	
NTNG1	22854	hgsc.bcm.edu	37	1	107937850	107937850	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr1:107937850C>A	ENST00000370068.1	+	4	1808	c.962C>A	c.(961-963)aCt>aAt	p.T321N	NTNG1_ENST00000370070.2_Missense_Mutation_p.T321N|NTNG1_ENST00000542803.1_Missense_Mutation_p.T321N|NTNG1_ENST00000370066.1_Missense_Mutation_p.T321N|NTNG1_ENST00000370061.3_Missense_Mutation_p.T321N|NTNG1_ENST00000370072.3_Missense_Mutation_p.T321N|NTNG1_ENST00000370071.2_Missense_Mutation_p.T321N|NTNG1_ENST00000370065.1_Missense_Mutation_p.T321N|NTNG1_ENST00000370074.4_Missense_Mutation_p.T321N|NTNG1_ENST00000370067.1_Missense_Mutation_p.T321N|NTNG1_ENST00000370073.2_Missense_Mutation_p.T321N			Q9Y2I2	NTNG1_HUMAN	netrin G1	321	Laminin EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|soft_tissue(1)|urinary_tract(1)	37		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		GAGCACAACACTACAGGTCCA	0.493																																					p.T321N		Atlas-SNP	.											.	NTNG1	274	.	0			c.C962A						PASS	.						203.0	192.0	196.0					1																	107937850		2203	4300	6503	SO:0001583	missense	22854	exon4			ACAACACTACAGG	AB023193	CCDS30785.1, CCDS44179.1, CCDS44180.1	1p13.2-p13.1	2013-03-01			ENSG00000162631	ENSG00000162631		"""Netrins"""	23319	protein-coding gene	gene with protein product	"""netrin G1f"", ""Netrin-G1"""	608818				10964959	Standard	NM_001113226		Approved	KIAA0976, Lmnt1	uc001dvh.4	Q9Y2I2	OTTHUMG00000010965	ENST00000370068.1:c.962C>A	chr1.hg19:g.107937850C>A	ENSP00000359085:p.Thr321Asn	203.0	0.0	.		199.0	35.0	.	NM_014917	Q5VU86|Q5VU87|Q5VU89|Q5VU90|Q5VU91|Q7Z2Y3|Q8N633	Missense_Mutation	SNP	ENST00000370068.1	hg19	CCDS44180.1	.	.	.	.	.	.	.	.	.	.	C	32	5.127060	0.94429	.	.	ENSG00000162631	ENST00000370076;ENST00000370073;ENST00000370071;ENST00000542803;ENST00000370061;ENST00000370072;ENST00000370070;ENST00000535584;ENST00000370064;ENST00000370062;ENST00000370074;ENST00000370068;ENST00000294649;ENST00000370067;ENST00000370066;ENST00000370065	T;T;T;T;T;T;T;T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12;-0.12;-0.12;-0.12;-0.12;-0.12;-0.12;-0.12	5.8	5.8	0.92144	EGF-like, laminin (3);EGF-like region, conserved site (1);	0.000000	0.64402	D	0.000006	D	0.87366	0.6159	H	0.98487	4.245	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.998;1.0;0.98;1.0	D;D;D;D;D	0.91635	0.997;0.994;0.999;0.912;0.998	D	0.91580	0.5278	10	0.87932	D	0	.	20.0637	0.97700	0.0:1.0:0.0:0.0	.	321;321;321;321;321	B4DKF0;Q9Y2I2;Q9Y2I2-4;Q9Y2I2-2;Q9Y2I2-1	.;NTNG1_HUMAN;.;.;.	N	321;321;321;321;321;321;321;321;82;82;321;321;321;321;321;321	ENSP00000359090:T321N;ENSP00000359088:T321N;ENSP00000440561:T321N;ENSP00000359078:T321N;ENSP00000359089:T321N;ENSP00000359087:T321N;ENSP00000359091:T321N;ENSP00000359085:T321N;ENSP00000359084:T321N;ENSP00000359083:T321N;ENSP00000359082:T321N	ENSP00000294649:T321N	T	+	2	0	NTNG1	107739373	1.000000	0.71417	0.999000	0.59377	0.965000	0.64279	7.818000	0.86416	2.751000	0.94390	0.650000	0.86243	ACT	.	.	.	none		0.493	NTNG1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000030340.1	NM_014917	
IGSF3	3321	hgsc.bcm.edu	37	1	117131439	117131439	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr1:117131439C>T	ENST00000369486.3	-	8	3082	c.2317G>A	c.(2317-2319)Gag>Aag	p.E773K	IGSF3_ENST00000369483.1_Missense_Mutation_p.E793K|IGSF3_ENST00000318837.6_Missense_Mutation_p.E793K	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	773	Ig-like C2-type 6.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		TCGCTGACCTCGGCTCTCTGG	0.627																																					p.E793K		Atlas-SNP	.											.	IGSF3	294	.	0			c.G2377A						PASS	.						29.0	29.0	29.0					1																	117131439		2201	4295	6496	SO:0001583	missense	3321	exon9			TGACCTCGGCTCT	AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.2317G>A	chr1.hg19:g.117131439C>T	ENSP00000358498:p.Glu773Lys	35.0	0.0	.		56.0	12.0	.	NM_001542	A6NJZ6|A6NMC7	Missense_Mutation	SNP	ENST00000369486.3	hg19	CCDS30813.1	.	.	.	.	.	.	.	.	.	.	C	16.54	3.152472	0.57259	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.64438	-0.1;-0.1;-0.1	3.98	3.01	0.34805	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.410465	0.24846	N	0.035140	T	0.43634	0.1256	M	0.66939	2.045	0.49483	D	0.999798	P;P;P	0.45212	0.604;0.853;0.656	B;B;B	0.38106	0.073;0.265;0.12	T	0.50285	-0.8846	10	0.41790	T	0.15	-28.9037	10.5216	0.44922	0.0:0.6523:0.3476:0.0	.	793;773;793	O75054-2;O75054;A6NJZ6	.;IGSF3_HUMAN;.	K	773;793;793	ENSP00000358498:E773K;ENSP00000358495:E793K;ENSP00000321184:E793K	ENSP00000321184:E793K	E	-	1	0	IGSF3	116932962	0.956000	0.32656	0.994000	0.49952	0.981000	0.71138	2.102000	0.41796	2.050000	0.60909	0.462000	0.41574	GAG	.	.	.	none		0.627	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000059040.1	NM_001542	
SELL	6402	hgsc.bcm.edu	37	1	169677647	169677647	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr1:169677647C>T	ENST00000236147.4	-	3	582	c.422G>A	c.(421-423)tGc>tAc	p.C141Y	SELL_ENST00000463108.1_5'UTR|C1orf112_ENST00000498289.1_Intron	NM_000655.4	NP_000646.2	P14151	LYAM1_HUMAN	selectin L	128	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|regulation of immune response (GO:0050776)|response to ATP (GO:0033198)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|protease binding (GO:0002020)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(3)|lung(5)|urinary_tract(1)	15	all_hematologic(923;0.208)					GATCTCCACGCAGTCCTCCTT	0.488																																					p.C141Y		Atlas-SNP	.											.	SELL	43	.	0			c.G422A						PASS	.						99.0	98.0	98.0					1																	169677647		2057	4216	6273	SO:0001583	missense	6402	exon3			TCCACGCAGTCCT	M25280	CCDS53427.1	1q23-q25	2008-07-31	2008-07-31		ENSG00000188404	ENSG00000188404		"""CD molecules"""	10720	protein-coding gene	gene with protein product		153240	"""lymphocyte adhesion molecule 1"""	LYAM1, LNHR		2664786, 1375831	Standard	NR_029467		Approved	LSEL, LAM1, LAM-1, hLHRc, Leu-8, Lyam-1, PLNHR, CD62L	uc001ggk.3	P14151	OTTHUMG00000034809	ENST00000236147.4:c.422G>A	chr1.hg19:g.169677647C>T	ENSP00000236147:p.Cys141Tyr	76.0	0.0	.		86.0	23.0	.	NM_000655	B2R6Q8|P15023|Q9UJ43	Missense_Mutation	SNP	ENST00000236147.4	hg19	CCDS53427.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.592012	0.86953	.	.	ENSG00000188404	ENST00000236147	T	0.61980	0.06	5.71	5.71	0.89125	C-type lectin fold (1);C-type lectin, conserved site (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.56097	D	0.000024	D	0.84279	0.5437	H	0.95539	3.685	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88376	0.2998	10	0.87932	D	0	-22.4594	18.4088	0.90543	0.0:1.0:0.0:0.0	.	141;128	Q8WW79;P14151	.;LYAM1_HUMAN	Y	141	ENSP00000236147:C141Y	ENSP00000236147:C141Y	C	-	2	0	SELL	167944271	1.000000	0.71417	0.997000	0.53966	0.938000	0.57974	7.487000	0.81328	2.698000	0.92095	0.650000	0.86243	TGC	.	.	.	none		0.488	SELL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084233.1	NM_000655	
CAD	790	hgsc.bcm.edu	37	2	27459639	27459639	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr2:27459639C>A	ENST00000403525.1	+	26	4292	c.4148C>A	c.(4147-4149)gCc>gAc	p.A1383D	CAD_ENST00000264705.4_Missense_Mutation_p.A1446D			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATCGGGCCAGCCCCTCCTTTG	0.537																																					p.A1446D		Atlas-SNP	.											.	CAD	199	.	0			c.C4337A						PASS	.						121.0	117.0	118.0					2																	27459639		2203	4300	6503	SO:0001583	missense	790	exon27			GGCCAGCCCCTCC	D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.4148C>A	chr2.hg19:g.27459639C>A	ENSP00000384510:p.Ala1383Asp	183.0	0.0	.		189.0	42.0	.	NM_004341	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	ENST00000403525.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.3|20.3	3.962670|3.962670	0.74016|0.74016	.|.	.|.	ENSG00000084774|ENSG00000084774	ENST00000264705;ENST00000403525|ENST00000458503	D;D|.	0.86694|.	-2.16;-2.16|.	5.58|5.58	5.58|5.58	0.84498|0.84498	Methylglyoxal synthase-like domain (1);|.	0.092996|.	0.85682|.	D|.	0.000000|.	T|T	0.69931|0.69931	0.3166|0.3166	L|L	0.50333|0.50333	1.59|1.59	0.80722|0.80722	D|D	1|1	P;D|.	0.71674|.	0.919;0.998|.	P;D|.	0.80764|.	0.587;0.994|.	T|T	0.66064|0.66064	-0.6016|-0.6016	10|5	0.12103|.	T|.	0.63|.	-6.9253|-6.9253	18.128|18.128	0.89592|0.89592	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1383;1446|.	F8VPD4;P27708|.	.;PYR1_HUMAN|.	D|T	1446;1383|98	ENSP00000264705:A1446D;ENSP00000384510:A1383D|.	ENSP00000264705:A1446D|.	A|P	+|+	2|1	0|0	CAD|CAD	27313143|27313143	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.966000|0.966000	0.64601|0.64601	4.299000|4.299000	0.59073|0.59073	2.622000|2.622000	0.88805|0.88805	0.561000|0.561000	0.74099|0.74099	GCC|CCC	.	.	.	none		0.537	CAD-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000324970.1		
VWA3B	200403	hgsc.bcm.edu	37	2	98744846	98744846	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr2:98744846G>T	ENST00000477737.1	+	6	1051	c.847G>T	c.(847-849)Gat>Tat	p.D283Y	VWA3B_ENST00000435344.1_Missense_Mutation_p.D283Y|VWA3B_ENST00000451075.2_Missense_Mutation_p.D133Y	NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	283										NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						TTTTCTAAAGGATCTGAGTGC	0.527																																					p.D283Y		Atlas-SNP	.											VWA3B,NS,carcinoma,0,1	VWA3B	138	.	0			c.G847T						PASS	.						96.0	96.0	96.0					2																	98744846		2002	4172	6174	SO:0001583	missense	200403	exon6			CTAAAGGATCTGA	AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.847G>T	chr2.hg19:g.98744846G>T	ENSP00000417955:p.Asp283Tyr	78.0	1.0	.		74.0	15.0	.	NM_144992	B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Missense_Mutation	SNP	ENST00000477737.1	hg19	CCDS42718.1	.	.	.	.	.	.	.	.	.	.	G	18.32	3.598190	0.66332	.	.	ENSG00000168658	ENST00000435344;ENST00000477737;ENST00000451075	T;T;T	0.15718	7.36;7.36;2.4	5.24	3.39	0.38822	.	0.502898	0.19634	N	0.109604	T	0.36413	0.0966	M	0.65975	2.015	0.26308	N	0.977864	D;D;D	0.76494	0.991;0.999;0.998	P;D;D	0.71656	0.844;0.974;0.946	T	0.07083	-1.0791	10	0.87932	D	0	.	10.7231	0.46052	0.0773:0.1356:0.7872:0.0	.	133;283;283	B7Z7Q7;Q502W6;Q502W6-8	.;VWA3B_HUMAN;.	Y	283;283;133	ENSP00000401959:D283Y;ENSP00000417955:D283Y;ENSP00000389463:D133Y	ENSP00000411168:D283Y	D	+	1	0	VWA3B	98111278	1.000000	0.71417	0.950000	0.38849	0.861000	0.49209	2.541000	0.45735	1.324000	0.45282	-0.175000	0.13238	GAT	.	.	.	none		0.527	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353469.2	NM_144992	
DNAH1	25981	hgsc.bcm.edu	37	3	52398951	52398951	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr3:52398951A>G	ENST00000420323.2	+	34	5695	c.5434A>G	c.(5434-5436)Atc>Gtc	p.I1812V		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	1812					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GTTTCCCACCATCAAGGAGGA	0.612																																					p.I1812V		Atlas-SNP	.											.	DNAH1	534	.	0			c.A5434G						PASS	.						86.0	89.0	88.0					3																	52398951		2137	4249	6386	SO:0001583	missense	25981	exon34			CCCACCATCAAGG	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.5434A>G	chr3.hg19:g.52398951A>G	ENSP00000401514:p.Ile1812Val	93.0	0.0	.		100.0	30.0	.	NM_015512	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	ENST00000420323.2	hg19	CCDS46842.1	.	.	.	.	.	.	.	.	.	.	A	4.931	0.172935	0.09391	.	.	ENSG00000114841	ENST00000420323	T	0.37411	1.2	4.49	4.49	0.54785	.	0.143268	0.31358	N	0.007794	T	0.17704	0.0425	N	0.10945	0.07	0.46774	D	0.999194	B	0.12013	0.005	B	0.09377	0.004	T	0.08597	-1.0714	10	0.02654	T	1	.	13.8185	0.63306	1.0:0.0:0.0:0.0	.	1812	C9JXH6	.	V	1812	ENSP00000401514:I1812V	ENSP00000401514:I1812V	I	+	1	0	DNAH1	52373991	1.000000	0.71417	1.000000	0.80357	0.786000	0.44442	5.138000	0.64795	1.682000	0.51000	0.383000	0.25322	ATC	.	.	.	none		0.612	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	
NFXL1	152518	hgsc.bcm.edu	37	4	47901107	47901107	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr4:47901107G>A	ENST00000507489.1	-	7	1033	c.857C>T	c.(856-858)aCa>aTa	p.T286I	NFXL1_ENST00000329043.3_Missense_Mutation_p.T286I|NFXL1_ENST00000381538.3_Missense_Mutation_p.T286I	NM_001278624.1	NP_001265553.1	Q6ZNB6	NFXL1_HUMAN	nuclear transcription factor, X-box binding-like 1	286						integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(4)	27						ACAAGTAGTTGTGACCATCTT	0.388																																					p.T286I		Atlas-SNP	.											.	NFXL1	79	.	0			c.C857T						PASS	.						85.0	79.0	81.0					4																	47901107		2203	4300	6503	SO:0001583	missense	152518	exon7			GTAGTTGTGACCA	AY134856	CCDS3478.2	4p12	2008-02-05			ENSG00000170448	ENSG00000170448			18726	protein-coding gene	gene with protein product	"""ovarian zinc finger protein"""						Standard	NM_152995		Approved	HOZFP	uc003gxp.3	Q6ZNB6	OTTHUMG00000128621	ENST00000507489.1:c.857C>T	chr4.hg19:g.47901107G>A	ENSP00000422037:p.Thr286Ile	55.0	0.0	.		54.0	10.0	.	NM_152995	B1Q2K1|Q86VG1|Q8WVH1	Missense_Mutation	SNP	ENST00000507489.1	hg19	CCDS3478.2	.	.	.	.	.	.	.	.	.	.	G	11.50	1.656404	0.29425	.	.	ENSG00000170448	ENST00000381538;ENST00000507489;ENST00000329043	T;T;T	0.42131	0.98;0.98;0.98	4.85	4.85	0.62838	.	0.275863	0.32918	N	0.005484	T	0.46151	0.1378	M	0.62723	1.935	0.43126	D	0.994855	P	0.36683	0.565	B	0.37888	0.26	T	0.53201	-0.8472	10	0.56958	D	0.05	-8.3899	17.9625	0.89090	0.0:0.0:1.0:0.0	.	286	Q6ZNB6	NFXL1_HUMAN	I	286	ENSP00000370949:T286I;ENSP00000422037:T286I;ENSP00000333113:T286I	ENSP00000333113:T286I	T	-	2	0	NFXL1	47595864	1.000000	0.71417	1.000000	0.80357	0.283000	0.27025	5.916000	0.69981	2.215000	0.71742	0.655000	0.94253	ACA	.	.	.	none		0.388	NFXL1-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361636.1	NM_152995	
SLC4A4	8671	hgsc.bcm.edu	37	4	72429512	72429512	+	Silent	SNP	T	T	A			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr4:72429512T>A	ENST00000264485.5	+	24	3219	c.3102T>A	c.(3100-3102)tcT>tcA	p.S1034S	SLC4A4_ENST00000425175.1_Intron|SLC4A4_ENST00000351898.6_Silent_p.S950S|SLC4A4_ENST00000340595.3_Silent_p.S990S	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	1034					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	TTTCACAGTCTGACTGCCCAT	0.363																																					p.S1034S		Atlas-SNP	.											SLC4A4,NS,carcinoma,+2,1	SLC4A4	269	.	0			c.T3102A						PASS	.						124.0	135.0	131.0					4																	72429512		2203	4300	6503	SO:0001819	synonymous_variant	8671	exon24			ACAGTCTGACTGC	AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.3102T>A	chr4.hg19:g.72429512T>A		199.0	0.0	.		195.0	35.0	.	NM_001098484	C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Silent	SNP	ENST00000264485.5	hg19	CCDS43236.1																																																																																			.	.	.	none		0.363	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362090.1	NM_003759	
SLC26A8	116369	hgsc.bcm.edu	37	6	35949921	35949921	+	Silent	SNP	C	C	T	rs547194034		TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr6:35949921C>T	ENST00000490799.1	-	8	1355	c.1002G>A	c.(1000-1002)acG>acA	p.T334T	SLC26A8_ENST00000355574.2_Silent_p.T334T|SLC26A8_ENST00000394602.2_Silent_p.T229T	NM_052961.3	NP_443193.1			solute carrier family 26 (anion exchanger), member 8											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(16)|ovary(3)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	46						TGTCAATAAGCGTCTGGCTGG	0.423													C|||	1	0.000199681	0.0	0.0014	5008	,	,		20134	0.0		0.0	False		,,,				2504	0.0				p.T334T		Atlas-SNP	.											.	SLC26A8	95	.	0			c.G1002A						PASS	.						123.0	113.0	116.0					6																	35949921		2203	4300	6503	SO:0001819	synonymous_variant	116369	exon8			AATAAGCGTCTGG	AF331522	CCDS4813.1, CCDS4814.1	6p21	2013-07-18	2013-07-18		ENSG00000112053	ENSG00000112053		"""Solute carriers"""	14468	protein-coding gene	gene with protein product		608480	"""solute carrier family 26, member 8"""			11834742, 11829495	Standard	NM_001193476		Approved		uc003olm.3	Q96RN1	OTTHUMG00000014586	ENST00000490799.1:c.1002G>A	chr6.hg19:g.35949921C>T		146.0	0.0	.		125.0	19.0	.	NM_052961		Silent	SNP	ENST00000490799.1	hg19	CCDS4813.1																																																																																			.	.	.	none		0.423	SLC26A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040325.2		
RBAK	57786	hgsc.bcm.edu	37	7	5104736	5104736	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr7:5104736A>T	ENST00000353796.3	+	6	1973	c.1649A>T	c.(1648-1650)gAg>gTg	p.E550V	RBAK-RBAKDN_ENST00000396904.2_Intron|RBAK-RBAKDN_ENST00000407184.1_Intron|RBAK_ENST00000396912.1_Missense_Mutation_p.E550V	NM_001204456.1	NP_001191385.1	Q9NYW8	RBAK_HUMAN	RB-associated KRAB zinc finger	550	Interaction with AR.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(2)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	10		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)		TTATTCAATGAGTTGTCATAC	0.393																																					p.E550V		Atlas-SNP	.											.	RBAK	82	.	0			c.A1649T						PASS	.						63.0	63.0	63.0					7																	5104736		2203	4299	6502	SO:0001583	missense	57786	exon6			TCAATGAGTTGTC	AF226869	CCDS5337.1	7p22.1	2013-01-08			ENSG00000146587	ENSG00000146587		"""Zinc fingers, C2H2-type"", ""-"""	17680	protein-coding gene	gene with protein product		608191					Standard	NM_021163		Approved	ZNF769	uc003sns.1	Q9NYW8	OTTHUMG00000121155	ENST00000353796.3:c.1649A>T	chr7.hg19:g.5104736A>T	ENSP00000275423:p.Glu550Val	94.0	0.0	.		107.0	35.0	.	NM_001204456	A6NDF2|A8KAK4|B2RN44|B9EGS1|F8W6M7	Missense_Mutation	SNP	ENST00000353796.3	hg19	CCDS5337.1	.	.	.	.	.	.	.	.	.	.	A	13.27	2.187436	0.38609	.	.	ENSG00000146587	ENST00000353796;ENST00000396912	T;T	0.14516	2.5;2.5	3.76	3.76	0.43208	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.572849	0.15837	N	0.242235	T	0.15003	0.0362	L	0.33753	1.03	0.26673	N	0.971686	P	0.42123	0.771	P	0.46885	0.53	T	0.13872	-1.0493	8	.	.	.	.	11.0559	0.47918	1.0:0.0:0.0:0.0	.	550	Q9NYW8	RBAK_HUMAN	V	550	ENSP00000275423:E550V;ENSP00000380120:E550V	.	E	+	2	0	RBAK	5071262	0.000000	0.05858	0.706000	0.30403	0.897000	0.52465	0.042000	0.13949	1.931000	0.55961	0.454000	0.30748	GAG	.	.	.	none		0.393	RBAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241640.2	NM_021163	
SP4	6671	hgsc.bcm.edu	37	7	21468915	21468915	+	Silent	SNP	G	G	A			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr7:21468915G>A	ENST00000222584.3	+	3	350	c.132G>A	c.(130-132)caG>caA	p.Q44Q		NM_003112.3	NP_003103.2	Q02446	SP4_HUMAN	Sp4 transcription factor	44					regulation of heart contraction (GO:0008016)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	35						AGGACTCTCAGCCCTCTCCTC	0.483																																					p.Q44Q		Atlas-SNP	.											.	SP4	91	.	0			c.G132A						PASS	.						34.0	37.0	36.0					7																	21468915		2201	4300	6501	SO:0001819	synonymous_variant	6671	exon3			CTCTCAGCCCTCT		CCDS5373.1	7p15	2013-01-08			ENSG00000105866	ENSG00000105866		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11209	protein-coding gene	gene with protein product		600540				1454515	Standard	XM_005249828		Approved	SPR-1, HF1B, MGC130008, MGC130009	uc003sva.3	Q02446	OTTHUMG00000094801	ENST00000222584.3:c.132G>A	chr7.hg19:g.21468915G>A		60.0	0.0	.		71.0	9.0	.	NM_003112	O60402|Q32M52	Silent	SNP	ENST00000222584.3	hg19	CCDS5373.1																																																																																			.	.	.	none		0.483	SP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211617.2	NM_003112	
CCDC132	55610	hgsc.bcm.edu	37	7	92932848	92932848	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr7:92932848A>G	ENST00000305866.5	+	17	1566	c.1438A>G	c.(1438-1440)Atc>Gtc	p.I480V	CCDC132_ENST00000541136.1_Missense_Mutation_p.I291V|CCDC132_ENST00000317751.6_Missense_Mutation_p.I211V|CCDC132_ENST00000535481.1_Missense_Mutation_p.I200V|CCDC132_ENST00000544910.1_Missense_Mutation_p.I450V	NM_017667.3	NP_060137.2	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132	480						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				endometrium(1)|large_intestine(2)|lung(5)	8	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			AAATTTCAGCATCTTGCAACT	0.308																																					p.I480V		Atlas-SNP	.											.	CCDC132	136	.	0			c.A1438G						PASS	.						138.0	134.0	135.0					7																	92932848		1818	4077	5895	SO:0001583	missense	55610	exon17			TTCAGCATCTTGC	AL833112, AK055965, AL832393	CCDS5630.1, CCDS43617.1, CCDS59065.1	7q21.3	2007-07-23			ENSG00000004766	ENSG00000004766			25956	protein-coding gene	gene with protein product						11347906	Standard	NM_024553		Approved	KIAA1861, FLJ20097, DKFZp313I2429	uc003umo.4	Q96JG6	OTTHUMG00000131733	ENST00000305866.5:c.1438A>G	chr7.hg19:g.92932848A>G	ENSP00000307666:p.Ile480Val	210.0	0.0	.		254.0	48.0	.	NM_017667	B3KX22|D1MQ00|F5H5U7|Q75N07|Q8WVK3|Q9H5C6	Missense_Mutation	SNP	ENST00000305866.5	hg19	CCDS43617.1	.	.	.	.	.	.	.	.	.	.	A	11.98	1.801621	0.31869	.	.	ENSG00000004766	ENST00000305866;ENST00000544910;ENST00000541136;ENST00000535481;ENST00000317751	T	0.39229	1.09	4.92	4.92	0.64577	.	0.000000	0.85682	D	0.000000	T	0.44829	0.1312	L	0.27053	0.805	0.80722	D	1	P;P;P	0.38863	0.518;0.65;0.518	P;P;P	0.54140	0.558;0.743;0.558	T	0.19257	-1.0311	10	0.14252	T	0.57	-8.589	15.0541	0.71897	1.0:0.0:0.0:0.0	.	200;450;480	B4DS55;F5H5U7;Q96JG6	.;.;CC132_HUMAN	V	480;450;291;200;211	ENSP00000325582:I211V	ENSP00000307666:I480V	I	+	1	0	CCDC132	92770784	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.051000	0.93849	2.200000	0.70718	0.460000	0.39030	ATC	.	.	.	none		0.308	CCDC132-019	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341687.1	NM_017667	
GBA2	57704	hgsc.bcm.edu	37	9	35751270	35751270	+	5'Flank	SNP	G	G	A			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr9:35751270G>A	ENST00000378103.3	-	0	0				RGP1_ENST00000378078.4_Silent_p.Q165Q|RGP1_ENST00000456972.2_Silent_p.Q205Q|GBA2_ENST00000378094.4_5'Flank|GBA2_ENST00000545786.1_5'Flank|MSMP_ENST00000414286.1_5'Flank	NM_020944.2	NP_065995.1	Q9HCG7	GBA2_HUMAN	glucosidase, beta (bile acid) 2						bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|central nervous system neuron development (GO:0021954)|glucosylceramide catabolic process (GO:0006680)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-glucosidase activity (GO:0008422)|glucosylceramidase activity (GO:0004348)			NS(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(4)|skin(3)	21	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TAGGCCTTCAGGATGTCCGGT	0.498																																					p.Q165Q		Atlas-SNP	.											.	RGP1	60	.	0			c.G495A						PASS	.						226.0	221.0	222.0					9																	35751270		1947	4138	6085	SO:0001631	upstream_gene_variant	9827	exon6			CCTTCAGGATGTC	AJ309567	CCDS6589.1	9p13.2	2013-09-11			ENSG00000070610	ENSG00000070610			18986	protein-coding gene	gene with protein product	"""bile acid beta-glucosidase"", ""non-lysosomal glucosylceramidase"""	609471	"""spastic paraplegia 46 (autosomal recessive)"""	SPG46		11489889, 23332916, 23332917	Standard	NM_020944		Approved	KIAA1605, AD035, DKFZp762K054	uc003zxw.3	Q9HCG7	OTTHUMG00000021024		chr9.hg19:g.35751270G>A	Exception_encountered	404.0	0.0	.		410.0	87.0	.	NM_001080496	D3DRP2|Q5TCV6|Q96A51|Q96LY1|Q96SJ2|Q9H2L8	Silent	SNP	ENST00000378103.3	hg19	CCDS6589.1																																																																																			.	.	.	none		0.498	GBA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055456.1	NM_020944	
NUP214	8021	hgsc.bcm.edu	37	9	134020018	134020018	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr9:134020018G>T	ENST00000359428.5	+	12	1790	c.1646G>T	c.(1645-1647)gGa>gTa	p.G549V	RP11-544A12.4_ENST00000590461.1_RNA|RP11-544A12.4_ENST00000589667.1_RNA|RP11-544A12.4_ENST00000586290.1_RNA|NUP214_ENST00000451030.1_Missense_Mutation_p.G549V|RP11-544A12.4_ENST00000415391.2_RNA|RP11-544A12.4_ENST00000587408.1_RNA|RP11-544A12.4_ENST00000589540.1_RNA|NUP214_ENST00000411637.2_Missense_Mutation_p.G549V|RP11-544A12.4_ENST00000587264.1_RNA|RP11-544A12.4_ENST00000588378.1_RNA			P35658	NU214_HUMAN	nucleoporin 214kDa	549	11 X 5 AA approximate repeats.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)			NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		TTCTCCTTTGGATCATCTGGT	0.537			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																p.G549V	Pancreas(4;24 48 25510 30394 32571)	Atlas-SNP	.		Dom	yes		9	9q34.1	8021	nucleoporin 214kDa (CAN)		L	.	NUP214	166	.	0			c.G1646T						PASS	.						82.0	78.0	79.0					9																	134020018		2203	4300	6503	SO:0001583	missense	8021	exon12			CCTTTGGATCATC	X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.1646G>T	chr9.hg19:g.134020018G>T	ENSP00000352400:p.Gly549Val	125.0	0.0	.		107.0	24.0	.	NM_005085	A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Missense_Mutation	SNP	ENST00000359428.5	hg19	CCDS6940.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.7|21.7	4.184253|4.184253	0.78677|0.78677	.|.	.|.	ENSG00000126883|ENSG00000126883	ENST00000359428;ENST00000411637;ENST00000451030;ENST00000541375;ENST00000540899|ENST00000530863	T;T;T|.	0.40756|.	1.24;1.02;1.25|.	5.89|5.89	5.89|5.89	0.94794|0.94794	.|.	0.000000|.	0.42172|.	D|.	0.000758|.	T|T	0.45935|0.45935	0.1367|0.1367	N|N	0.08118|0.08118	0|0	0.58432|0.58432	D|D	0.999998|0.999998	D;D|.	0.63046|.	0.992;0.992|.	P;P|.	0.59357|.	0.856;0.856|.	T|T	0.41034|0.41034	-0.9531|-0.9531	10|5	0.51188|.	T|.	0.08|.	-8.3011|-8.3011	17.3793|17.3793	0.87400|0.87400	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	549;549|.	P35658-4;P35658|.	.;NU214_HUMAN|.	V|C	549;549;549;549;142|124	ENSP00000352400:G549V;ENSP00000396576:G549V;ENSP00000405014:G549V|.	ENSP00000352400:G549V|.	G|W	+|+	2|3	0|0	NUP214|NUP214	133009839|133009839	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.875000|0.875000	0.50365|0.50365	5.666000|5.666000	0.68059|0.68059	2.778000|2.778000	0.95560|0.95560	0.655000|0.655000	0.94253|0.94253	GGA|TGG	.	.	.	none		0.537	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000054694.2	NM_005085	
CUBN	8029	hgsc.bcm.edu	37	10	16918967	16918967	+	Missense_Mutation	SNP	G	G	A	rs143741363		TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr10:16918967G>A	ENST00000377833.4	-	57	9100	c.9035C>T	c.(9034-9036)cCg>cTg	p.P3012L		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	3012	CUB 22. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AAGCAGAACCGGCCCAGCGAT	0.483													G|||	1	0.000199681	0.0	0.0	5008	,	,		17695	0.001		0.0	False		,,,				2504	0.0				p.P3012L		Atlas-SNP	.											.	CUBN	515	.	0			c.C9035T						PASS	.	G	LEU/PRO	2,4404	4.2+/-10.8	0,2,2201	124.0	108.0	114.0		9035	5.8	0.3	10	dbSNP_134	114	1,8599	1.2+/-3.3	0,1,4299	no	missense	CUBN	NM_001081.3	98	0,3,6500	AA,AG,GG		0.0116,0.0454,0.0231	probably-damaging	3012/3624	16918967	3,13003	2203	4300	6503	SO:0001583	missense	8029	exon57			AGAACCGGCCCAG	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.9035C>T	chr10.hg19:g.16918967G>A	ENSP00000367064:p.Pro3012Leu	113.0	0.0	.		119.0	18.0	.	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	hg19	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.015130	0.75161	4.54E-4	1.16E-4	ENSG00000107611	ENST00000377833	T	0.16897	2.31	5.8	5.8	0.92144	CUB (5);	0.000000	0.46758	D	0.000275	T	0.22781	0.0550	L	0.48362	1.52	0.80722	D	1	D	0.55800	0.973	P	0.44897	0.463	T	0.00402	-1.1762	10	0.54805	T	0.06	.	18.8345	0.92155	0.0:0.0:1.0:0.0	.	3012	O60494	CUBN_HUMAN	L	3012	ENSP00000367064:P3012L	ENSP00000367064:P3012L	P	-	2	0	CUBN	16958973	1.000000	0.71417	0.339000	0.25562	0.006000	0.05464	7.336000	0.79245	2.735000	0.93741	0.655000	0.94253	CCG	.	G|1.000;A|0.000	0.000	weak		0.483	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
ACADSB	36	hgsc.bcm.edu	37	10	124793900	124793900	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr10:124793900C>T	ENST00000358776.4	+	2	85	c.71C>T	c.(70-72)tCt>tTt	p.S24F	ACADSB_ENST00000496730.2_3'UTR|ACADSB_ENST00000368869.4_5'UTR	NM_001609.3	NP_001600.1	P45954	ACDSB_HUMAN	acyl-CoA dehydrogenase, short/branched chain	24					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|fatty acid metabolic process (GO:0006631)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)		Colorectal(40;0.0811)|COAD - Colon adenocarcinoma(40;0.0835)	L-Isoleucine(DB00167)|Valproic Acid(DB00313)	ACTTGTTTGTCTTCTTGGAAG	0.363																																					p.S24F		Atlas-SNP	.											.	ACADSB	45	.	0			c.C71T						PASS	.						143.0	141.0	142.0					10																	124793900		2203	4300	6503	SO:0001583	missense	36	exon2			GTTTGTCTTCTTG	U12778	CCDS7634.1	10q25-q26	2014-09-17	2010-04-30		ENSG00000196177	ENSG00000196177	1.3.99.-		91	protein-coding gene	gene with protein product		600301	"""acyl-Coenzyme A dehydrogenase, short/branched chain"""			7698750, 7759115	Standard	NM_001609		Approved	SBCAD, ACAD7	uc001lhb.3	P45954	OTTHUMG00000019200	ENST00000358776.4:c.71C>T	chr10.hg19:g.124793900C>T	ENSP00000357873:p.Ser24Phe	118.0	0.0	.		168.0	37.0	.	NM_001609	B4DQ51|Q5SQN6|Q96CX7	Missense_Mutation	SNP	ENST00000358776.4	hg19	CCDS7634.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.85|16.85	3.235388|3.235388	0.58886|0.58886	.|.	.|.	ENSG00000196177|ENSG00000196177	ENST00000411816|ENST00000358776	.|D	.|0.97430	.|-4.38	4.95|4.95	4.02|4.02	0.46733|0.46733	.|.	.|0.689788	.|0.14097	.|N	.|0.341677	D|D	0.93792|0.93792	0.8015|0.8015	L|L	0.27053|0.27053	0.805|0.805	0.26364|0.26364	N|N	0.976999|0.976999	.|P	.|0.45283	.|0.855	.|B	.|0.41510	.|0.359	D|D	0.87882|0.87882	0.2678|0.2678	5|10	.|0.49607	.|T	.|0.09	.|.	12.9162|12.9162	0.58207|0.58207	0.0:0.6883:0.3117:0.0|0.0:0.6883:0.3117:0.0	.|.	.|24	.|P45954	.|ACDSB_HUMAN	F|F	30|24	.|ENSP00000357873:S24F	.|ENSP00000357873:S24F	L|S	+|+	1|2	0|0	ACADSB|ACADSB	124783890|124783890	0.776000|0.776000	0.28616|0.28616	0.955000|0.955000	0.39395|0.39395	0.812000|0.812000	0.45895|0.45895	1.477000|1.477000	0.35431|0.35431	1.167000|1.167000	0.42706|0.42706	0.591000|0.591000	0.81541|0.81541	CTT|TCT	.	.	.	none		0.363	ACADSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050843.1	NM_001609	
OR8J3	81168	hgsc.bcm.edu	37	11	55904466	55904466	+	Silent	SNP	C	C	T			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr11:55904466C>T	ENST00000301529.1	-	1	728	c.729G>A	c.(727-729)tcG>tcA	p.S243S		NM_001004064.1	NP_001004064.1	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J, member 3	243						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S243S(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(38)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	59	Esophageal squamous(21;0.00693)					CTATCATATGCGAAGCGCAGG	0.403																																					p.S243S		Atlas-SNP	.											OR8J3,NS,carcinoma,0,3	OR8J3	112	.	1	Substitution - coding silent(1)	endometrium(1)	c.G729A						PASS	.						122.0	113.0	116.0					11																	55904466		2201	4296	6497	SO:0001819	synonymous_variant	81168	exon1			CATATGCGAAGCG		CCDS31520.1	11q12.2	2012-08-09			ENSG00000167822	ENSG00000167822		"""GPCR / Class A : Olfactory receptors"""	15312	protein-coding gene	gene with protein product							Standard	NM_001004064		Approved		uc010riz.2	Q8NGG0	OTTHUMG00000166834	ENST00000301529.1:c.729G>A	chr11.hg19:g.55904466C>T		119.0	1.0	.		117.0	25.0	.	NM_001004064	Q6IFB6|Q96RC2	Silent	SNP	ENST00000301529.1	hg19	CCDS31520.1																																																																																			.	.	.	none		0.403	OR8J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391542.1	NM_001004064	
DPAGT1	1798	hgsc.bcm.edu	37	11	118971040	118971040	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr11:118971040C>T	ENST00000409993.2	-	6	2126	c.575G>A	c.(574-576)gGc>gAc	p.G192D	DPAGT1_ENST00000445653.1_5'Flank|DPAGT1_ENST00000354202.4_Missense_Mutation_p.G192D|DPAGT1_ENST00000432443.2_Missense_Mutation_p.G85D			Q9H3H5	GPT_HUMAN	dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase)	192			G -> S (in CMSTA2). {ECO:0000269|PubMed:22742743}.		cellular protein metabolic process (GO:0044267)|dolichol biosynthetic process (GO:0019408)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|protein oligomerization (GO:0051259)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	phospho-N-acetylmuramoyl-pentapeptide-transferase activity (GO:0008963)|transferase activity, transferring glycosyl groups (GO:0016757)|UDP-N-acetylglucosamine-dolichyl-phosphate N-acetylglucosaminephosphotransferase activity (GO:0003975)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(2)	17	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.55e-05)		AGCCTCTAGGCCGTTAATTCC	0.507											OREG0021396	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G192D		Atlas-SNP	.											.	DPAGT1	43	.	0			c.G575A						PASS	.						107.0	104.0	105.0					11																	118971040		2200	4295	6495	SO:0001583	missense	1798	exon4			TCTAGGCCGTTAA	Z82022	CCDS8411.1	11q23.3	2007-12-14			ENSG00000172269	ENSG00000172269	2.7.8.15		2995	protein-coding gene	gene with protein product		191350		DPAGT2, DPAGT		8244387	Standard	NM_001382		Approved	GPT, D11S366, DGPT, ALG7, CDG-Ij	uc001pvi.3	Q9H3H5	OTTHUMG00000153533	ENST00000409993.2:c.575G>A	chr11.hg19:g.118971040C>T	ENSP00000386597:p.Gly192Asp	153.0	0.0	.	1492	166.0	28.0	.	NM_001382	O15216|Q86WV9|Q9BWE6	Missense_Mutation	SNP	ENST00000409993.2	hg19	CCDS8411.1	.	.	.	.	.	.	.	.	.	.	C	34	5.350440	0.95830	.	.	ENSG00000172269	ENST00000409993;ENST00000354202;ENST00000432443	D;D;D	0.98914	-5.23;-5.23;-5.23	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.99554	0.9840	H	0.98487	4.245	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97880	1.0291	10	0.87932	D	0	-21.1374	18.6978	0.91607	0.0:1.0:0.0:0.0	.	85;192	E7EW40;Q9H3H5	.;GPT_HUMAN	D	192;192;85	ENSP00000386597:G192D;ENSP00000346142:G192D;ENSP00000404036:G85D	ENSP00000346142:G192D	G	-	2	0	DPAGT1	118476250	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.652000	0.90054	0.655000	0.94253	GGC	.	.	.	none		0.507	DPAGT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331527.2	NM_001382	
DGKA	1606	hgsc.bcm.edu	37	12	56346149	56346149	+	Missense_Mutation	SNP	C	C	G	rs546159503		TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr12:56346149C>G	ENST00000331886.5	+	20	2131	c.1677C>G	c.(1675-1677)ttC>ttG	p.F559L	DGKA_ENST00000551156.1_Missense_Mutation_p.F559L|DGKA_ENST00000549079.2_3'UTR|DGKA_ENST00000394147.1_Missense_Mutation_p.F559L	NM_001345.4	NP_001336.2	P23743	DGKA_HUMAN	diacylglycerol kinase, alpha 80kDa	559					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)|phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|large_intestine(1)|lung(11)|ovary(4)|pancreas(1)|skin(3)|urinary_tract(1)	25					Vitamin E(DB00163)	TATGGTACTTCGAATTTGCCA	0.478																																					p.F559L		Atlas-SNP	.											.	DGKA	70	.	0			c.C1677G						PASS	.						163.0	139.0	147.0					12																	56346149		2203	4300	6503	SO:0001583	missense	1606	exon20			GTACTTCGAATTT	AF064767	CCDS8896.1	12q13.3	2013-01-10	2002-08-29			ENSG00000065357	2.7.1.107	"""EF-hand domain containing"""	2849	protein-coding gene	gene with protein product		125855	"""diacylglycerol kinase, alpha (80kD)"""	DAGK, DAGK1		8180475, 7959783	Standard	NM_001345		Approved	DGK-alpha	uc001sim.3	P23743		ENST00000331886.5:c.1677C>G	chr12.hg19:g.56346149C>G	ENSP00000328405:p.Phe559Leu	133.0	0.0	.		172.0	57.0	.	NM_201554	O75481|O75482|O75483|O95217|Q3ZE25|Q8IZ56|Q8N5Q2	Missense_Mutation	SNP	ENST00000331886.5	hg19	CCDS8896.1	.	.	.	.	.	.	.	.	.	.	C	14.00	2.404771	0.42613	.	.	ENSG00000065357	ENST00000331886;ENST00000555218;ENST00000394147;ENST00000551156;ENST00000552903	T;T;T;T;T	0.39229	1.09;1.67;1.09;1.09;1.67	5.02	-9.21	0.00678	Diacylglycerol kinase, accessory domain (2);	0.053094	0.85682	N	0.000000	T	0.34600	0.0903	L	0.43923	1.385	0.45914	D	0.998757	B;B	0.29378	0.01;0.243	B;B	0.42214	0.054;0.38	T	0.43294	-0.9400	10	0.49607	T	0.09	.	11.684	0.51474	0.0:0.1096:0.2082:0.6822	.	478;559	G3V4E1;P23743	.;DGKA_HUMAN	L	559;478;559;559;169	ENSP00000328405:F559L;ENSP00000451743:F478L;ENSP00000377703:F559L;ENSP00000450359:F559L;ENSP00000451518:F169L	ENSP00000328405:F559L	F	+	3	2	DGKA	54632416	0.169000	0.23002	0.857000	0.33713	0.979000	0.70002	-0.687000	0.05156	-1.471000	0.01886	-0.339000	0.08088	TTC	.	.	.	none		0.478	DGKA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407291.1		
RDH11	51109	hgsc.bcm.edu	37	14	68157017	68157017	+	Silent	SNP	G	G	A			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr14:68157017G>A	ENST00000381346.4	-	5	686	c.576C>T	c.(574-576)ggC>ggT	p.G192G	RP11-1012A1.4_ENST00000553306.1_Missense_Mutation_p.A23V|RDH11_ENST00000428130.2_Intron|RDH11_ENST00000553384.1_Silent_p.G179G|RP11-1012A1.4_ENST00000554493.1_5'Flank	NM_001252650.1|NM_016026.3	NP_001239579.1|NP_057110.3	Q8TC12	RDH11_HUMAN	retinol dehydrogenase 11 (all-trans/9-cis/11-cis)	192					adaptation of rhodopsin mediated signaling (GO:0016062)|phototransduction, visible light (GO:0007603)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|photoreceptor inner segment (GO:0001917)	NADP-retinol dehydrogenase activity (GO:0052650)|retinol dehydrogenase activity (GO:0004745)			breast(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(3)|ovary(1)	12				all cancers(60;0.00047)|OV - Ovarian serous cystadenocarcinoma(108;0.00206)|BRCA - Breast invasive adenocarcinoma(234;0.00924)	Vitamin A(DB00162)	AGAATTTCTCGCCCTGCAGGT	0.517																																					p.G192G		Atlas-SNP	.											.	RDH11	21	.	0			c.C576T						PASS	.						186.0	159.0	168.0					14																	68157017		2203	4300	6503	SO:0001819	synonymous_variant	51109	exon5			TTTCTCGCCCTGC	AF151840	CCDS32104.1, CCDS58326.1	14q24.1	2013-10-15	2006-05-09		ENSG00000072042	ENSG00000072042	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	17964	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 1"", ""androgen-regulated short-chain dehydrogenase/reductase 1"""	607849	"""retinol dehydrogenase 11 (all-trans and 9-cis)"""			12226107, 8018917, 19027726	Standard	NM_016026		Approved	MDT1, SDR7C1, ARSDR1	uc001xjv.4	Q8TC12	OTTHUMG00000171196	ENST00000381346.4:c.576C>T	chr14.hg19:g.68157017G>A		110.0	0.0	.		90.0	26.0	.	NM_016026	A6NDK3|A8K062|B2RB26|B4DDW0|Q0QD40|Q6IAH5|Q9NRW0|Q9Y391	Silent	SNP	ENST00000381346.4	hg19	CCDS32104.1	.	.	.	.	.	.	.	.	.	.	G	9.466	1.094486	0.20471	.	.	ENSG00000258466	ENST00000557564	.	.	.	5.67	-11.3	0.00108	.	.	.	.	.	T	0.33440	0.0863	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41124	-0.9526	4	.	.	.	.	3.1001	0.06323	0.2592:0.1913:0.4203:0.1292	.	.	.	.	V	23	.	.	A	-	2	0	RP11-1012A1.4	67226770	0.000000	0.05858	0.230000	0.23976	0.971000	0.66376	-1.633000	0.02022	-2.268000	0.00685	-0.150000	0.13652	GCG	.	.	.	none		0.517	RDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412257.3		
RFX7	64864	hgsc.bcm.edu	37	15	56387238	56387238	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr15:56387238C>G	ENST00000559447.2	-	9	2668	c.2397G>C	c.(2395-2397)caG>caC	p.Q799H	RFX7_ENST00000423270.1_Missense_Mutation_p.Q896H|RFX7_ENST00000422057.1_Missense_Mutation_p.Q799H|RFX7_ENST00000317318.6_Missense_Mutation_p.Q896H			Q2KHR2	RFX7_HUMAN	regulatory factor X, 7	799					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						TTGACATTTGCTGCTCCATAA	0.418																																					p.Q896H		Atlas-SNP	.											.	RFX7	170	.	0			c.G2688C						PASS	.						105.0	103.0	103.0					15																	56387238		1983	4164	6147	SO:0001583	missense	64864	exon9			CATTTGCTGCTCC			15q21.3	2008-08-04	2008-08-04	2008-08-04		ENSG00000181827			25777	protein-coding gene	gene with protein product		612660	"""regulatory factor X domain containing 2"""	RFXDC2			Standard	NM_022841		Approved	FLJ12994	uc010bfn.3	Q2KHR2		ENST00000559447.2:c.2397G>C	chr15.hg19:g.56387238C>G	ENSP00000453281:p.Gln799His	57.0	0.0	.		81.0	15.0	.	NM_022841	Q6ZRR1|Q6ZTY6|Q8N3J0|Q9H7A9|Q9H956	Missense_Mutation	SNP	ENST00000559447.2	hg19		.	.	.	.	.	.	.	.	.	.	C	12.40	1.925982	0.34002	.	.	ENSG00000181827	ENST00000422057;ENST00000317318;ENST00000423270	T;T;T	0.53423	0.62;0.62;0.62	5.57	4.46	0.54185	.	0.069338	0.51477	D	0.000090	T	0.33614	0.0869	N	0.14661	0.345	0.38957	D	0.95847	P;P	0.49961	0.855;0.93	B;P	0.44732	0.359;0.459	T	0.34304	-0.9834	10	0.87932	D	0	-7.1862	10.8605	0.46823	0.0:0.8402:0.0:0.1598	.	799;799	Q2KHR2;C9JU50	RFX7_HUMAN;.	H	799;896;896	ENSP00000387504:Q799H;ENSP00000313299:Q896H;ENSP00000397644:Q896H	ENSP00000313299:Q896H	Q	-	3	2	RFX7	54174530	0.998000	0.40836	1.000000	0.80357	0.994000	0.84299	0.596000	0.24044	2.602000	0.87976	0.514000	0.50259	CAG	.	.	.	none		0.418	RFX7-001	KNOWN	non_canonical_U12|basic	protein_coding	protein_coding	OTTHUMT00000418841.3	NM_022841	
FASN	2194	hgsc.bcm.edu	37	17	80041413	80041413	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr17:80041413A>C	ENST00000306749.2	-	31	5539	c.5321T>G	c.(5320-5322)cTt>cGt	p.L1774R	FASN_ENST00000579758.1_5'Flank	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	1774	Enoyl reductase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	GTTCTGAGAAAGGTCGAATTT	0.637																																					p.L1774R	Colon(59;314 1043 11189 28578 32273)	Atlas-SNP	.											.	FASN	154	.	0			c.T5321G						PASS	.						54.0	53.0	54.0					17																	80041413		2199	4298	6497	SO:0001583	missense	2194	exon31			TGAGAAAGGTCGA	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.5321T>G	chr17.hg19:g.80041413A>C	ENSP00000304592:p.Leu1774Arg	60.0	0.0	.		100.0	11.0	.	NM_004104	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	ENST00000306749.2	hg19	CCDS11801.1	.	.	.	.	.	.	.	.	.	.	A	15.48	2.846071	0.51164	.	.	ENSG00000169710	ENST00000306749;ENST00000545909	T	0.04083	3.71	4.77	3.69	0.42338	Alcohol dehydrogenase, C-terminal (1);Polyketide synthase, enoylreductase (1);NAD(P)-binding domain (1);	0.076785	0.56097	D	0.000039	T	0.24236	0.0587	M	0.90252	3.1	0.58432	D	0.999998	D	0.89917	1.0	D	0.83275	0.996	T	0.01127	-1.1443	10	0.87932	D	0	-12.1836	9.8571	0.41092	0.9181:0.0:0.0819:0.0	.	1774	P49327	FAS_HUMAN	R	1774;739	ENSP00000304592:L1774R	ENSP00000304592:L1774R	L	-	2	0	FASN	77634702	1.000000	0.71417	0.518000	0.27811	0.128000	0.20619	8.901000	0.92560	0.675000	0.31264	0.459000	0.35465	CTT	.	.	.	none		0.637	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
LAMA1	284217	hgsc.bcm.edu	37	18	7025998	7025998	+	Silent	SNP	A	A	G			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr18:7025998A>G	ENST00000389658.3	-	17	2475	c.2382T>C	c.(2380-2382)ccT>ccC	p.P794P		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	794	Laminin EGF-like 7. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				CTATGGTGAGAGGGCAGGCGC	0.622																																					p.P794P		Atlas-SNP	.											.	LAMA1	458	.	0			c.T2382C						PASS	.						51.0	42.0	45.0					18																	7025998		2203	4300	6503	SO:0001819	synonymous_variant	284217	exon17			GGTGAGAGGGCAG	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.2382T>C	chr18.hg19:g.7025998A>G		23.0	0.0	.		21.0	4.0	.	NM_005559		Silent	SNP	ENST00000389658.3	hg19	CCDS32787.1																																																																																			.	.	.	none		0.622	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
ZNF236	7776	hgsc.bcm.edu	37	18	74622686	74622686	+	Silent	SNP	C	C	T			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr18:74622686C>T	ENST00000253159.8	+	16	2916	c.2718C>T	c.(2716-2718)agC>agT	p.S906S	ZNF236_ENST00000320610.9_Silent_p.S908S	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	906					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		AGGATTCCAGCACACTTGAGT	0.493																																					p.S906S		Atlas-SNP	.											.	ZNF236	325	.	0			c.C2718T						PASS	.						73.0	72.0	72.0					18																	74622686		2000	4185	6185	SO:0001819	synonymous_variant	7776	exon16			TTCCAGCACACTT	AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.2718C>T	chr18.hg19:g.74622686C>T		97.0	0.0	.		132.0	29.0	.	NM_007345	B2RTX9|Q9UL37	Silent	SNP	ENST00000253159.8	hg19	CCDS42447.1																																																																																			.	.	.	none		0.493	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000445776.1		
ZNF266	10781	hgsc.bcm.edu	37	19	9524367	9524367	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr19:9524367T>G	ENST00000592904.1	-	5	3310	c.1234A>C	c.(1234-1236)Aaa>Caa	p.K412Q	ZNF266_ENST00000592292.1_Missense_Mutation_p.K412Q|ZNF266_ENST00000361151.1_Missense_Mutation_p.K412Q|ZNF266_ENST00000588221.1_Missense_Mutation_p.K412Q|ZNF266_ENST00000590306.1_Missense_Mutation_p.K412Q|ZNF266_ENST00000588933.1_Missense_Mutation_p.K412Q|ZNF266_ENST00000361451.2_Missense_Mutation_p.K412Q			Q14584	ZN266_HUMAN	zinc finger protein 266	412					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(2)|large_intestine(11)|lung(8)|ovary(1)|skin(2)|stomach(1)	28						TTCCCACATTTGACACATTCA	0.433																																					p.K412Q		Atlas-SNP	.											.	ZNF266	65	.	0			c.A1234C						PASS	.						72.0	72.0	72.0					19																	9524367		2203	4300	6503	SO:0001583	missense	10781	exon11			CACATTTGACACA	X78924	CCDS12213.1	19p13.2	2013-01-08				ENSG00000174652		"""Zinc fingers, C2H2-type"""	13059	protein-coding gene	gene with protein product		604751				7865130	Standard	NM_006631		Approved	HZF1	uc002mlo.4	Q14584		ENST00000592904.1:c.1234A>C	chr19.hg19:g.9524367T>G	ENSP00000466714:p.Lys412Gln	73.0	0.0	.		75.0	22.0	.	NM_001271314	A0AV90|A4FU85|Q6IQ07|Q6U8A5|Q8IVG3|Q8WVX1|Q96SX9	Missense_Mutation	SNP	ENST00000592904.1	hg19	CCDS12213.1	.	.	.	.	.	.	.	.	.	.	T	13.51	2.259791	0.39995	.	.	ENSG00000174652	ENST00000361451;ENST00000361151	T;T	0.07444	3.19;3.19	2.76	-5.41	0.02648	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02533	0.0077	N	0.03029	-0.43	0.09310	N	1	B	0.22604	0.072	B	0.17098	0.017	T	0.45848	-0.9233	9	0.21014	T	0.42	.	5.5147	0.16900	0.0:0.411:0.2893:0.2997	.	412	Q14584	ZN266_HUMAN	Q	412	ENSP00000354680:K412Q;ENSP00000355047:K412Q	ENSP00000355047:K412Q	K	-	1	0	ZNF266	9385367	0.000000	0.05858	0.000000	0.03702	0.998000	0.95712	-1.671000	0.01954	-1.372000	0.02137	0.454000	0.30748	AAA	.	.	.	none		0.433	ZNF266-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449033.1		
ZNF561	93134	hgsc.bcm.edu	37	19	9721627	9721627	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr19:9721627G>A	ENST00000302851.3	-	6	1073	c.710C>T	c.(709-711)tCt>tTt	p.S237F	ZNF561_ENST00000354661.4_Missense_Mutation_p.S101F|ZNF561_ENST00000495503.1_5'UTR|ZNF561_ENST00000326044.5_3'UTR|ZNF561_ENST00000424629.1_Missense_Mutation_p.S168F	NM_152289.2	NP_689502.2	Q8N587	ZN561_HUMAN	zinc finger protein 561	237					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)	14						TAGGTGTGAAGAAGCTGTGAC	0.373																																					p.S237F		Atlas-SNP	.											.	ZNF561	64	.	0			c.C710T						PASS	.						65.0	63.0	63.0					19																	9721627		2203	4300	6503	SO:0001583	missense	93134	exon6			TGTGAAGAAGCTG	AK074787	CCDS12216.2	19p13.2	2013-09-20			ENSG00000171469	ENSG00000171469		"""Zinc fingers, C2H2-type"", ""-"""	28684	protein-coding gene	gene with protein product						12477932	Standard	NM_152289		Approved	MGC45408	uc002mlu.3	Q8N587	OTTHUMG00000157054	ENST00000302851.3:c.710C>T	chr19.hg19:g.9721627G>A	ENSP00000303915:p.Ser237Phe	117.0	0.0	.		113.0	24.0	.	NM_152289	B4E2Q8|Q6PJS0	Missense_Mutation	SNP	ENST00000302851.3	hg19	CCDS12216.2	.	.	.	.	.	.	.	.	.	.	G	11.49	1.655669	0.29425	.	.	ENSG00000171469	ENST00000424629;ENST00000302851;ENST00000354661;ENST00000444611	T;T;T;T	0.29917	1.55;1.55;1.55;2.36	1.1	1.1	0.20463	.	.	.	.	.	T	0.48223	0.1488	M	0.77486	2.375	0.09310	N	1	D	0.61697	0.99	D	0.71656	0.974	T	0.22312	-1.0220	9	0.37606	T	0.19	.	5.1359	0.14934	0.0:0.3792:0.6208:0.0	.	237	Q8N587	ZN561_HUMAN	F	168;237;101;243	ENSP00000393074:S168F;ENSP00000303915:S237F;ENSP00000346687:S101F;ENSP00000392013:S243F	ENSP00000303915:S237F	S	-	2	0	ZNF561	9582627	0.019000	0.18553	0.002000	0.10522	0.033000	0.12548	2.273000	0.43381	0.905000	0.36596	0.298000	0.19748	TCT	.	.	.	none		0.373	ZNF561-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347272.2	NM_152289	
MYO9B	4650	hgsc.bcm.edu	37	19	17311587	17311587	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr19:17311587G>T	ENST00000594824.1	+	26	4659	c.4512G>T	c.(4510-4512)caG>caT	p.Q1504H	MYO9B_ENST00000397274.2_Missense_Mutation_p.Q1504H|MYO9B_ENST00000595618.1_Missense_Mutation_p.Q1504H			Q13459	MYO9B_HUMAN	myosin IXB	1504	Tail.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						TGTTCCGCCAGATCACCAACG	0.577																																					p.Q1504H		Atlas-SNP	.											.	MYO9B	264	.	0			c.G4512T						PASS	.						127.0	138.0	135.0					19																	17311587		2113	4228	6341	SO:0001583	missense	4650	exon26			CCGCCAGATCACC		CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.4512G>T	chr19.hg19:g.17311587G>T	ENSP00000471367:p.Gln1504His	86.0	0.0	.		96.0	25.0	.	NM_001130065	O75314|Q9NUJ2|Q9UHN0	Missense_Mutation	SNP	ENST00000594824.1	hg19		.	.	.	.	.	.	.	.	.	.	G	12.57	1.977073	0.34848	.	.	ENSG00000099331	ENST00000397274	D	0.84223	-1.82	4.75	2.43	0.29744	.	0.446964	0.20636	N	0.088489	T	0.68137	0.2968	N	0.08118	0	0.29597	N	0.848014	P;P;P;P	0.37708	0.472;0.606;0.472;0.472	B;B;B;B	0.37422	0.116;0.249;0.116;0.126	T	0.65508	-0.6151	10	0.44086	T	0.13	.	7.4385	0.27169	0.2708:0.0:0.7292:0.0	.	1504;1504;1504;1510	Q13459;Q13459-2;B0I1T6;Q4LE74	MYO9B_HUMAN;.;.;.	H	1504	ENSP00000380444:Q1504H	ENSP00000380444:Q1504H	Q	+	3	2	MYO9B	17172587	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	1.332000	0.33805	1.006000	0.39211	0.491000	0.48974	CAG	.	.	.	none		0.577	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000463236.1		
UMODL1	89766	hgsc.bcm.edu	37	21	43505425	43505425	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr21:43505425C>T	ENST00000408910.2	+	4	506	c.506C>T	c.(505-507)tCc>tTc	p.S169F	UMODL1_ENST00000408989.2_Missense_Mutation_p.S169F|UMODL1_ENST00000400427.1_Missense_Mutation_p.S97F|UMODL1_ENST00000400424.2_Missense_Mutation_p.S97F	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1	169					adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						CCTGTGGGCTCCTGGTACAAC	0.537																																					p.S169F	Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	Atlas-SNP	.											.	UMODL1	186	.	0			c.C506T						PASS	.						113.0	117.0	116.0					21																	43505425		1912	4141	6053	SO:0001583	missense	89766	exon4			TGGGCTCCTGGTA		CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.506C>T	chr21.hg19:g.43505425C>T	ENSP00000386147:p.Ser169Phe	147.0	0.0	.		181.0	34.0	.	NM_173568	C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Missense_Mutation	SNP	ENST00000408910.2	hg19	CCDS42936.1	.	.	.	.	.	.	.	.	.	.	C	8.956	0.969471	0.18659	.	.	ENSG00000177398	ENST00000400427;ENST00000400424;ENST00000408989;ENST00000408910;ENST00000380462;ENST00000400417;ENST00000423139	T;T;T;T	0.72394	-0.65;-0.63;-0.65;-0.63	3.02	-6.05	0.02172	.	0.899723	0.09081	N	0.851345	T	0.29423	0.0733	N	0.00823	-1.155	0.20703	N	0.999862	B;B	0.20261	0.043;0.0	B;B	0.15052	0.012;0.0	T	0.18178	-1.0345	10	0.32370	T	0.25	-0.4883	1.9738	0.03412	0.1682:0.5079:0.1126:0.2114	.	169;169	Q5DID0-2;Q5DID0	.;UROL1_HUMAN	F	97;97;169;169;15;15;4	ENSP00000383279:S97F;ENSP00000383276:S97F;ENSP00000386126:S169F;ENSP00000386147:S169F	ENSP00000369829:S15F	S	+	2	0	UMODL1	42378494	0.020000	0.18652	0.030000	0.17652	0.492000	0.33523	-1.121000	0.03270	-1.577000	0.01650	-0.253000	0.11424	TCC	.	.	.	none		0.537	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195292.2		
MYO18B	84700	hgsc.bcm.edu	37	22	26400727	26400727	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr22:26400727C>T	ENST00000407587.2	+	42	6548	c.6379C>T	c.(6379-6381)Cag>Tag	p.Q2127*	MYO18B_ENST00000335473.7_Nonsense_Mutation_p.Q2126*|MYO18B_ENST00000536101.1_Nonsense_Mutation_p.Q2126*			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2126						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						GGGCAGCCTGCAGTCCTGGTT	0.532																																					p.Q2126X		Atlas-SNP	.											.	MYO18B	322	.	0			c.C6376T						PASS	.						79.0	83.0	81.0					22																	26400727		2115	4248	6363	SO:0001587	stop_gained	84700	exon42			AGCCTGCAGTCCT	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.6379C>T	chr22.hg19:g.26400727C>T	ENSP00000386096:p.Gln2127*	87.0	0.0	.		102.0	13.0	.	NM_032608	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Nonsense_Mutation	SNP	ENST00000407587.2	hg19		.	.	.	.	.	.	.	.	.	.	C	48	14.649130	0.99804	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	.	.	.	4.33	3.25	0.37280	.	1.244550	0.05893	N	0.628605	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	.	8.5131	0.33229	0.2492:0.7508:0.0:0.0	.	.	.	.	X	2126;2126;2127	.	ENSP00000334563:Q2126X	Q	+	1	0	MYO18B	24730727	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.482000	0.45224	2.246000	0.74042	0.650000	0.86243	CAG	.	.	.	none		0.532	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
MKL1	57591	hgsc.bcm.edu	37	22	40814880	40814880	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr22:40814880C>T	ENST00000355630.3	-	12	2152	c.1562G>A	c.(1561-1563)cGc>cAc	p.R521H	MKL1_ENST00000402042.1_Missense_Mutation_p.R471H|MKL1_ENST00000407029.1_Missense_Mutation_p.R521H|MKL1_ENST00000396617.3_Missense_Mutation_p.R521H	NM_020831.3	NP_065882.1	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia (translocation) 1	521					negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription via serum response element binding (GO:0010735)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|actin monomer binding (GO:0003785)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	30						GTCCTTGTCGCGCCCCTCTAG	0.682			T	RBM15	acute megakaryocytic leukemia																																p.R521H		Atlas-SNP	.		Dom	yes		22	22q13	57591	megakaryoblastic leukemia (translocation) 1		L	.	MKL1	69	.	0			c.G1562A						PASS	.						28.0	33.0	31.0					22																	40814880		2203	4297	6500	SO:0001583	missense	57591	exon12			TTGTCGCGCCCCT	AB037859	CCDS14003.1, CCDS74865.1, CCDS74866.1	22q13	2008-06-12			ENSG00000196588	ENSG00000196588			14334	protein-coding gene	gene with protein product	"""megakaryocytic acute leukemia"", ""myocardin-related transcription factor A"", ""basic, SAP and coiled-coil domain"""	606078				11431691, 12019265, 14970199	Standard	XM_005261692		Approved	KIAA1438, MAL, MRTF-A, BSAC	uc003ayw.1	Q969V6	OTTHUMG00000151146	ENST00000355630.3:c.1562G>A	chr22.hg19:g.40814880C>T	ENSP00000347847:p.Arg521His	100.0	0.0	.		98.0	21.0	.	NM_020831	Q8TCL1|Q96SC5|Q96SC6|Q9P2B0	Missense_Mutation	SNP	ENST00000355630.3	hg19	CCDS14003.1	.	.	.	.	.	.	.	.	.	.	C	12.77	2.039005	0.35989	.	.	ENSG00000196588	ENST00000355630;ENST00000396617;ENST00000402042;ENST00000407029	T;T;T;T	0.44482	0.93;0.92;0.93;0.93	4.89	3.86	0.44501	.	0.428770	0.23016	N	0.052902	T	0.30230	0.0758	N	0.04959	-0.14	0.09310	N	0.999999	D;D;D	0.67145	0.968;0.996;0.993	B;P;P	0.53185	0.374;0.72;0.609	T	0.05852	-1.0860	10	0.45353	T	0.12	-4.7852	8.2012	0.31426	0.1863:0.7301:0.0:0.0835	.	471;521;521	B0QY83;E7ER32;Q969V6	.;.;MKL1_HUMAN	H	521;521;471;521	ENSP00000347847:R521H;ENSP00000379861:R521H;ENSP00000385584:R471H;ENSP00000385835:R521H	ENSP00000347847:R521H	R	-	2	0	MKL1	39144826	0.227000	0.23707	0.758000	0.31321	0.866000	0.49608	0.691000	0.25467	1.165000	0.42670	0.591000	0.81541	CGC	.	.	.	none		0.682	MKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321522.1	NM_020831	
MAOB	4129	hgsc.bcm.edu	37	X	43702915	43702915	+	Splice_Site	SNP	C	C	G			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chrX:43702915C>G	ENST00000378069.4	-	2	289		c.e2+1		MAOB_ENST00000536181.1_Splice_Site|MAOB_ENST00000487544.1_Splice_Site|MAOB_ENST00000538942.1_Splice_Site	NM_000898.4	NP_000889.3	P27338	AOFB_HUMAN	monoamine oxidase B						negative regulation of serotonin secretion (GO:0014063)|positive regulation of dopamine metabolic process (GO:0045964)|response to aluminum ion (GO:0010044)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|primary amine oxidase activity (GO:0008131)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(2)|skin(5)	21					Amantadine(DB00915)|Amphetamine(DB00182)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Procaine(DB00721)|Rasagiline(DB01367)|Selegiline(DB01037)|Sertraline(DB01104)|Tranylcypromine(DB00752)|Zonisamide(DB00909)	TAATGCCTTACCCTAAGAGTG	0.478																																					.		Atlas-SNP	.											.	MAOB	52	.	0			c.141+1G>C						PASS	.						83.0	67.0	73.0					X																	43702915		2203	4300	6503	SO:0001630	splice_region_variant	4129	exon3			GCCTTACCCTAAG		CCDS14261.1	Xp11.4-p11.3	2008-02-05			ENSG00000069535	ENSG00000069535	1.4.3.4		6834	protein-coding gene	gene with protein product		309860					Standard	NM_000898		Approved		uc004dfz.4	P27338	OTTHUMG00000021388	ENST00000378069.4:c.141+1G>C	chrX.hg19:g.43702915C>G		30.0	0.0	.		30.0	14.0	.	NM_000898	B2R6R3|B7Z5H3|D3DWC3|Q7Z6S2	Splice_Site	SNP	ENST00000378069.4	hg19	CCDS14261.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.440115	0.83993	.	.	ENSG00000069535	ENST00000378069;ENST00000536181;ENST00000538942	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5321	0.90996	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MAOB	43587859	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	5.391000	0.66266	2.318000	0.78349	0.600000	0.82982	.	.	.	.	none		0.478	MAOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056303.1	NM_000898	Intron
SMC1A	8243	hgsc.bcm.edu	37	X	53407985	53407985	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chrX:53407985A>T	ENST00000322213.4	-	23	3588	c.3461T>A	c.(3460-3462)gTc>gAc	p.V1154D	SMC1A_ENST00000469129.1_5'Flank	NM_006306.2	NP_006297.2	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	1154	Ala/Asp-rich (DA-box).				DNA repair (GO:0006281)|gene expression (GO:0010467)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid cohesion (GO:0007064)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA endoreduplication (GO:0032876)|response to radiation (GO:0009314)|RNA splicing (GO:0008380)|signal transduction in response to DNA damage (GO:0042770)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin core heterodimer (GO:0008280)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|meiotic cohesin complex (GO:0030893)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(8)|ovary(5)|upper_aerodigestive_tract(2)	49						CTCATCCAGGACGAAGAAGGG	0.632																																					p.V1154D		Atlas-SNP	.											.	SMC1A	112	.	0			c.T3461A						PASS	.						69.0	60.0	63.0					X																	53407985		2203	4300	6503	SO:0001583	missense	8243	exon23			TCCAGGACGAAGA	S78271	CCDS14352.1, CCDS75985.1	Xp11.22-p11.21	2014-09-17	2006-07-06	2006-07-06	ENSG00000072501	ENSG00000072501		"""Structural maintenance of chromosomes proteins"""	11111	protein-coding gene	gene with protein product		300040	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 1 (yeast)"""	SMC1L1		7757074	Standard	NM_006306		Approved	DXS423E, KIAA0178, SB1.8, Smcb	uc004dsg.3	Q14683	OTTHUMG00000021614	ENST00000322213.4:c.3461T>A	chrX.hg19:g.53407985A>T	ENSP00000323421:p.Val1154Asp	78.0	0.0	.		67.0	27.0	.	NM_006306	O14995|Q16351|Q2M228	Missense_Mutation	SNP	ENST00000322213.4	hg19	CCDS14352.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.943345	0.73672	.	.	ENSG00000072501	ENST00000322213	D	0.92099	-2.97	5.29	5.29	0.74685	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	D	0.96901	0.8988	M	0.93150	3.385	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97755	1.0217	10	0.87932	D	0	.	13.4304	0.61051	1.0:0.0:0.0:0.0	.	1154	Q14683	SMC1A_HUMAN	D	1154	ENSP00000323421:V1154D	ENSP00000323421:V1154D	V	-	2	0	SMC1A	53424710	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.113000	0.94321	1.882000	0.54519	0.481000	0.45027	GTC	.	.	.	none		0.632	SMC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056756.2	NM_006306	
ACAA1	30	hgsc.bcm.edu	37	3	38167081	38167092	+	In_Frame_Del	DEL	TGAGCAGCGTGA	TGAGCAGCGTGA	-	rs138308587		TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	TGAGCAGCGTGA	TGAGCAGCGTGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr3:38167081_38167092delTGAGCAGCGTGA	ENST00000333167.8	-	11	1335_1346	c.1163_1174delTCACGCTGCTCA	c.(1162-1176)atcacgctgctcaat>aat	p.ITLL388del	ACAA1_ENST00000301810.7_In_Frame_Del_p.ITLL295del|Y_RNA_ENST00000365095.1_RNA|ACAA1_ENST00000480865.1_5'UTR|ACAA1_ENST00000450296.1_In_Frame_Del_p.ITLL347del	NM_001607.3	NP_001598.1	P09110	THIK_HUMAN	acetyl-CoA acyltransferase 1	388					alpha-linolenic acid metabolic process (GO:0036109)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	acetyl-CoA C-acyltransferase activity (GO:0003988)|palmitoyl-CoA oxidase activity (GO:0016401)			endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)	9				KIRC - Kidney renal clear cell carcinoma(284;0.0523)|Kidney(284;0.0657)		TTCAGCTCATTGAGCAGCGTGATGACCTGTCG	0.618																																					p.388_392del		Atlas-INDEL	.											ACAA1,NS,carcinoma,0,1	ACAA1	32	.	0			c.1164_1175del						PASS	.																																			SO:0001651	inframe_deletion	30	exon11			.	X14813	CCDS2673.1, CCDS46794.1	3p22.2	2012-05-16	2010-04-30		ENSG00000060971	ENSG00000060971	2.3.1.16		82	protein-coding gene	gene with protein product	"""peroxisomal 3-oxoacyl-Coenzyme A thiolase"""	604054	"""acetyl-Coenzyme A acyltransferase 1"""				Standard	NM_001607		Approved		uc003cht.3	P09110	OTTHUMG00000131087	ENST00000333167.8:c.1163_1174delTCACGCTGCTCA	chr3.hg19:g.38167081_38167092delTGAGCAGCGTGA	ENSP00000333664:p.Ile388_Leu391del	96.0	0.0	0		94.0	13.0	0.138298	NM_001607	G5E935|Q96CA6	In_Frame_Del	DEL	ENST00000333167.8	hg19	CCDS2673.1																																																																																			.	.	.	none		0.618	ACAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342980.1	NM_001607	
STAG3	10734	hgsc.bcm.edu	37	7	99779767	99779767	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr7:99779767delT	ENST00000426455.1	+	3	578	c.171delT	c.(169-171)aatfs	p.N57fs	STAG3_ENST00000394018.2_Frame_Shift_Del_p.N57fs|STAG3_ENST00000317296.5_Frame_Shift_Del_p.N57fs	NM_001282716.1	NP_001269645.1	Q9UJ98	STAG3_HUMAN	stromal antigen 3	57					chromosome segregation (GO:0007059)|synaptonemal complex assembly (GO:0007130)	chromosome, centromeric region (GO:0000775)|extracellular space (GO:0005615)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleolus (GO:0005730)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)|transverse filament (GO:0000802)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(11)|lung(30)|ovary(5)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	66	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					ACAGCTTGAATCGCAATGTGA	0.438																																					p.N57fs		Atlas-INDEL	.											.	STAG3	121	.	0			c.170delA						PASS	.						122.0	112.0	115.0					7																	99779767		2203	4300	6503	SO:0001589	frameshift_variant	10734	exon3			.	AJ007798	CCDS34703.1, CCDS64730.1, CCDS75642.1	7q22	2008-02-01			ENSG00000066923	ENSG00000066923			11356	protein-coding gene	gene with protein product		608489				10698974	Standard	XM_005250116		Approved		uc003utx.1	Q9UJ98	OTTHUMG00000155183	ENST00000426455.1:c.171delT	chr7.hg19:g.99779767delT	ENSP00000400359:p.Asn57fs	76.0	0.0	0		71.0	10.0	0.140845	NM_012447	A6H8Z1|B4DZ10|D6W5U8|H7BYK9|Q8NDP3	Frame_Shift_Del	DEL	ENST00000426455.1	hg19	CCDS34703.1																																																																																			.	.	.	none		0.438	STAG3-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338734.2	NM_012447	
LGR4	55366	hgsc.bcm.edu	37	11	27390335	27390336	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr11:27390335_27390336insA	ENST00000379214.4	-	18	2377_2378	c.1934_1935insT	c.(1933-1935)ttafs	p.L645fs	LGR4_ENST00000389858.4_Frame_Shift_Ins_p.L621fs	NM_018490.2	NP_060960.2	Q9BXB1	LGR4_HUMAN	leucine-rich repeat containing G protein-coupled receptor 4	645					bone mineralization (GO:0030282)|bone remodeling (GO:0046849)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cell differentiation involved in metanephros development (GO:0072202)|epithelial cell proliferation (GO:0050673)|innate immune response (GO:0045087)|male genitalia development (GO:0030539)|metanephric glomerulus development (GO:0072224)|metanephric nephron tubule morphogenesis (GO:0072282)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast differentiation (GO:0001649)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(10)|ovary(1)	32						CTTTTGCAGATAAGCTTCTTTC	0.431																																					p.L645fs		Atlas-INDEL	.											.	LGR4	87	.	0			c.1935_1936insT						PASS	.																																			SO:0001589	frameshift_variant	55366	exon18			.	AF257182	CCDS31449.1	11p14-p13	2012-08-21	2011-01-25	2004-11-12	ENSG00000205213	ENSG00000205213		"""GPCR / Class A : Orphans"""	13299	protein-coding gene	gene with protein product		606666	"""G protein-coupled receptor 48"", ""leucine-rich repeat-containing G protein-coupled receptor 4"""	GPR48		10894923	Standard	NM_018490		Approved		uc001mrj.4	Q9BXB1	OTTHUMG00000133508	ENST00000379214.4:c.1935dupT	chr11.hg19:g.27390337_27390337dupA	ENSP00000368516:p.Leu645fs	102.0	0.0	0		112.0	21.0	0.1875	NM_018490	A6NCH3|G5E9B3|Q8N537|Q9NYD1	Frame_Shift_Ins	INS	ENST00000379214.4	hg19	CCDS31449.1																																																																																			.	.	.	none		0.431	LGR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257467.1	NM_018490	
PRB4	5545	hgsc.bcm.edu	37	12	11461597	11461597	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr12:11461597delC	ENST00000535904.1	-	3	353	c.320delG	c.(319-321)ggafs	p.G107fs	PRB4_ENST00000279575.1_Frame_Shift_Del_p.G107fs|PRB4_ENST00000445719.2_Frame_Shift_Del_p.G107fs			P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4	128	9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.					extracellular region (GO:0005576)				breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|skin(4)|upper_aerodigestive_tract(3)	30						GGACTGGTTTCCTCCTTGTGG	0.612										HNSCC(22;0.051)																											p.G107fs		Atlas-INDEL	.											.	PRB4	59	.	0			c.321delA						PASS	.						190.0	200.0	197.0					12																	11461597		2203	4299	6502	SO:0001589	frameshift_variant	5545	exon3			.		CCDS8641.1, CCDS58208.1	12p13.2	2012-10-02			ENSG00000230657	ENSG00000230657			9340	protein-coding gene	gene with protein product		180990					Standard	NM_002723		Approved		uc001qzt.4	P10163	OTTHUMG00000169116	ENST00000535904.1:c.320delG	chr12.hg19:g.11461597delC	ENSP00000442834:p.Gly107fs	633.0	0.0	0		789.0	116.0	0.147022	NM_002723	A1L439|O00600|P02813|P10161|P10162|P81489	Frame_Shift_Del	DEL	ENST00000535904.1	hg19	CCDS8641.1																																																																																			.	.	.	none		0.612	PRB4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402308.1	NM_002723	
GBE1	2632	hgsc.bcm.edu	37	3	81698998	81698998	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr3:81698998delA	ENST00000429644.2	-	4	1147	c.504delT	c.(502-504)ggtfs	p.G168fs	GBE1_ENST00000489715.1_Frame_Shift_Del_p.G127fs	NM_000158.3	NP_000149	Q04446	GLGB_HUMAN	glucan (1,4-alpha-), branching enzyme 1	168					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	1,4-alpha-glucan branching enzyme activity (GO:0003844)|cation binding (GO:0043169)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			breast(1)|endometrium(5)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Lung NSC(201;0.0117)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0654)|Epithelial(33;0.00305)|LUSC - Lung squamous cell carcinoma(29;0.00646)|BRCA - Breast invasive adenocarcinoma(55;0.00813)|Lung(72;0.0129)|KIRC - Kidney renal clear cell carcinoma(39;0.212)|Kidney(39;0.247)		TCACATTATCACCTTCACGAA	0.348									Glycogen Storage Disease, type IV																												p.D169fs		Atlas-INDEL	.											.	GBE1	111	.	0			c.505delG						PASS	.						102.0	101.0	101.0					3																	81698998		1874	4119	5993	SO:0001589	frameshift_variant	2632	exon4	Familial Cancer Database	Andersen Disease, Brancher deficiency	.		CCDS54612.1	3p12.2	2013-09-20	2008-08-01		ENSG00000114480	ENSG00000114480	2.4.1.18		4180	protein-coding gene	gene with protein product	"""glycogen branching enzyme"", ""Andersen disease"", ""glycogen storage disease type IV"""	607839				8463281	Standard	NM_000158		Approved		uc021xav.1	Q04446	OTTHUMG00000158978	ENST00000429644.2:c.504delT	chr3.hg19:g.81698998delA	ENSP00000410833:p.Gly168fs	63.0	0.0	0		60.0	11.0	0.183333	NM_000158	B3KWV3|Q96EN0	Frame_Shift_Del	DEL	ENST00000429644.2	hg19	CCDS54612.1																																																																																			.	.	.	none		0.348	GBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352760.2		
PSD2	84249	hgsc.bcm.edu	37	5	139193812	139193812	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr5:139193812delG	ENST00000274710.3	+	4	1084	c.879delG	c.(877-879)gagfs	p.E293fs		NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	293	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAGCTCGGAGGGGTTGGAGC	0.632																																					p.E293fs		Atlas-INDEL	.											.	PSD2	88	.	0			c.878delA						PASS	.						89.0	81.0	84.0					5																	139193812		2203	4300	6503	SO:0001589	frameshift_variant	84249	exon4			.	AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.879delG	chr5.hg19:g.139193812delG	ENSP00000274710:p.Glu293fs	122.0	0.0	0		170.0	27.0	0.158824	NM_032289	D3DQD3|Q8N3J8	Frame_Shift_Del	DEL	ENST00000274710.3	hg19	CCDS4216.1																																																																																			.	.	.	none		0.632	PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251339.1	NM_032289	
KMT2D	8085	hgsc.bcm.edu	37	12	49443557	49443558	+	Frame_Shift_Del	DEL	AT	AT	-	rs201794205		TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	AT	AT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr12:49443557_49443558delAT	ENST00000301067.7	-	11	3812_3813	c.3813_3814delAT	c.(3811-3816)ctattgfs	p.LL1271fs		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	1271					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										GCATCGCACAATAGTGAGTCAT	0.609																																					p.1272_1272del		Atlas-INDEL	.											.	MLL2	1173	.	0			c.3814_3815del						PASS	.																																			SO:0001589	frameshift_variant	8085	exon11			.	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.3813_3814delAT	chr12.hg19:g.49443557_49443558delAT	ENSP00000301067:p.Leu1271fs	116.0	0.0	0		158.0	24.0	0.151899	NM_003482	O14687	Frame_Shift_Del	DEL	ENST00000301067.7	hg19	CCDS44873.1																																																																																			.	.	.	none		0.609	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
