#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PLPPR5	163404	hgsc.bcm.edu	37	1	99418655	99418655	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr1:99418655G>T	ENST00000263177.4	-	3	813	c.592C>A	c.(592-594)Ctc>Atc	p.L198I	LPPR5_ENST00000370188.3_Missense_Mutation_p.L198I	NM_001037317.1	NP_001032394.1	Q32ZL2	LPPR5_HUMAN		198						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)										TAGACACTGAGAGCTGCTTCT	0.388																																					p.L198I		Atlas-SNP	.											.	.	.	.	0			c.C592A						PASS	.						122.0	111.0	115.0					1																	99418655		2203	4300	6503	SO:0001583	missense	0	exon3			CACTGAGAGCTGC																												ENST00000263177.4:c.592C>A	chr1.hg19:g.99418655G>T	ENSP00000263177:p.Leu198Ile	96.0	0.0	.		97.0	4.0	.	NM_001010861	A8MPX4|B7UCH3|Q32ZD0|Q3ZCU7	Missense_Mutation	SNP	ENST00000263177.4	hg19	CCDS30778.1	.	.	.	.	.	.	.	.	.	.	G	19.34	3.807957	0.70797	.	.	ENSG00000117598	ENST00000370188;ENST00000263177	T;T	0.56776	0.44;0.44	5.16	4.25	0.50352	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.49389	0.1554	L	0.45285	1.41	0.45390	D	0.998374	D;D	0.64830	0.992;0.994	P;P	0.59012	0.652;0.85	T	0.55270	-0.8167	10	0.62326	D	0.03	.	12.987	0.58598	0.0783:0.0:0.9217:0.0	.	198;198	Q32ZL2-2;Q32ZL2	.;LPPR5_HUMAN	I	198	ENSP00000359207:L198I;ENSP00000263177:L198I	ENSP00000263177:L198I	L	-	1	0	AL161744.1	99191243	1.000000	0.71417	0.959000	0.39883	0.950000	0.60333	7.449000	0.80643	1.311000	0.45024	0.655000	0.94253	CTC	.	.	.	none		0.388	LPPR5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000393221.1		
SMG5	23381	hgsc.bcm.edu	37	1	156236156	156236156	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr1:156236156T>C	ENST00000361813.5	-	12	1415	c.1271A>G	c.(1270-1272)aAg>aGg	p.K424R	SMG5_ENST00000368267.5_Intron|SMG5_ENST00000489907.2_5'UTR	NM_015327.2	NP_056142.2	Q9UPR3	SMG5_HUMAN	SMG5 nonsense mediated mRNA decay factor	424					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			NS(1)|breast(3)|endometrium(8)|kidney(2)|large_intestine(7)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	48	Hepatocellular(266;0.158)					CACAGGTTCCTTGGACTCTGG	0.582																																					p.K424R		Atlas-SNP	.											.	SMG5	98	.	0			c.A1271G						PASS	.						40.0	42.0	41.0					1																	156236156		2203	4300	6503	SO:0001583	missense	23381	exon12			GGTTCCTTGGACT	AB029012	CCDS1137.1	1q21	2013-07-02	2013-07-02		ENSG00000198952	ENSG00000198952			24644	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog B (S. cerevisiae)"""	610962	"""smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)"""			12676087, 12699629	Standard	NM_015327		Approved	KIAA1089, LPTS-RP1, LPTSRP1, RP11-54H19.7, SMG-5, EST1B	uc001foc.4	Q9UPR3	OTTHUMG00000017491	ENST00000361813.5:c.1271A>G	chr1.hg19:g.156236156T>C	ENSP00000355261:p.Lys424Arg	85.0	0.0	.		89.0	31.0	.	NM_015327	D3DVB7|Q5QJE7|Q659C7|Q8IXC0|Q8IY09|Q96IJ7	Missense_Mutation	SNP	ENST00000361813.5	hg19	CCDS1137.1	.	.	.	.	.	.	.	.	.	.	T	9.820	1.185549	0.21870	.	.	ENSG00000198952	ENST00000361813	T	0.29142	1.58	5.28	1.67	0.24075	.	0.436632	0.25777	N	0.028378	T	0.04048	0.0113	N	0.12182	0.205	0.80722	D	1	B	0.06786	0.001	B	0.09377	0.004	T	0.33266	-0.9875	10	0.09843	T	0.71	-8.5258	5.1542	0.15027	0.0:0.2355:0.1441:0.6204	.	424	Q9UPR3	SMG5_HUMAN	R	424	ENSP00000355261:K424R	ENSP00000355261:K424R	K	-	2	0	SMG5	154502780	1.000000	0.71417	0.364000	0.25888	0.638000	0.38207	0.547000	0.23299	0.030000	0.15379	0.460000	0.39030	AAG	.	.	.	none		0.582	SMG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046308.1	NM_015327	
POMC	5443	hgsc.bcm.edu	37	2	25387619	25387619	+	Missense_Mutation	SNP	C	C	T	rs146551109		TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr2:25387619C>T	ENST00000405623.1	-	2	478	c.23G>A	c.(22-24)cGc>cAc	p.R8H	POMC_ENST00000264708.3_Missense_Mutation_p.R8H|POMC_ENST00000395826.2_Missense_Mutation_p.R8H|POMC_ENST00000380794.1_Missense_Mutation_p.R8H			P01189	COLI_HUMAN	proopiomelanocortin	8					cell-cell signaling (GO:0007267)|cellular pigmentation (GO:0033059)|cellular protein metabolic process (GO:0044267)|generation of precursor metabolites and energy (GO:0006091)|glucose homeostasis (GO:0042593)|negative regulation of tumor necrosis factor production (GO:0032720)|neuropeptide signaling pathway (GO:0007218)|peptide hormone processing (GO:0016486)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of appetite (GO:0032098)|regulation of blood pressure (GO:0008217)|regulation of corticosterone secretion (GO:2000852)|regulation of glycogen metabolic process (GO:0070873)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|peroxisomal matrix (GO:0005782)|secretory granule (GO:0030141)|secretory granule lumen (GO:0034774)	G-protein coupled receptor binding (GO:0001664)|hormone activity (GO:0005179)|receptor binding (GO:0005102)|type 1 melanocortin receptor binding (GO:0070996)|type 3 melanocortin receptor binding (GO:0031781)|type 4 melanocortin receptor binding (GO:0031782)	p.R8H(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(5)|ovary(1)	12	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Loperamide(DB00836)	GGCCCCCGAGCGGCTGCAGCA	0.612																																					p.R8H	Colon(110;1515 1566 8452 10082 43216)	Atlas-SNP	.											POMC,NS,lymphoid_neoplasm,0,1	POMC	33	.	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.G23A						PASS	.	C	HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	41.0	44.0	43.0		23,23	3.8	0.0	2	dbSNP_134	43	0,8598		0,0,4299	no	missense,missense	POMC	NM_000939.2,NM_001035256.1	29,29	0,1,6501	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	8/268,8/268	25387619	1,13003	2203	4299	6502	SO:0001583	missense	5443	exon3			CCCGAGCGGCTGC		CCDS1717.1	2p23	2013-02-25	2008-07-31		ENSG00000115138	ENSG00000115138		"""Endogenous ligands"""	9201	protein-coding gene	gene with protein product	"""adrenocorticotropin"", ""beta-lipotropin"", ""alpha-melanocyte stimulating hormone"", ""beta-melanocyte stimulating hormone"", ""beta-endorphin"", ""adrenocorticotropic hormone"", ""opiomelanocortin prepropeptide"""	176830				6254047, 9620771	Standard	NM_001035256		Approved	MSH, POC, CLIP, ACTH, NPP, LPH	uc002rfz.1	P01189	OTTHUMG00000094764	ENST00000405623.1:c.23G>A	chr2.hg19:g.25387619C>T	ENSP00000384092:p.Arg8His	63.0	0.0	.		98.0	27.0	.	NM_001035256	P78442|Q53T23|Q9UD39|Q9UD40	Missense_Mutation	SNP	ENST00000405623.1	hg19	CCDS1717.1	.	.	.	.	.	.	.	.	.	.	C	10.91	1.485311	0.26598	2.27E-4	0.0	ENSG00000115138	ENST00000380794;ENST00000405623;ENST00000264708;ENST00000395826;ENST00000449220	T;T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24;-1.24	5.64	3.82	0.43975	.	0.809526	0.10655	N	0.649411	T	0.64800	0.2631	L	0.33485	1.01	0.09310	N	1	D	0.60575	0.988	B	0.43916	0.436	T	0.52011	-0.8632	10	0.15952	T	0.53	-24.4143	4.8248	0.13410	0.1512:0.6107:0.0:0.2382	.	8	P01189	COLI_HUMAN	H	8	ENSP00000370171:R8H;ENSP00000384092:R8H;ENSP00000264708:R8H;ENSP00000379170:R8H;ENSP00000387993:R8H	ENSP00000264708:R8H	R	-	2	0	POMC	25241123	0.278000	0.24230	0.019000	0.16419	0.096000	0.18686	0.717000	0.25851	1.381000	0.46364	0.462000	0.41574	CGC	.	C|1.000;T|0.000	0.000	weak		0.612	POMC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211573.3	NM_001035256	
BIRC6	57448	hgsc.bcm.edu	37	2	32656054	32656054	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr2:32656054A>C	ENST00000421745.2	+	12	3278	c.3144A>C	c.(3142-3144)gaA>gaC	p.E1048D		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	1048					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					GCTGGGTAGAAGTTCAACAAG	0.483																																					p.E1048D	Pancreas(94;175 1509 16028 18060 45422)	Atlas-SNP	.											.	BIRC6	838	.	0			c.A3144C						PASS	.						92.0	80.0	84.0					2																	32656054		2203	4300	6503	SO:0001583	missense	57448	exon12			GGTAGAAGTTCAA	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.3144A>C	chr2.hg19:g.32656054A>C	ENSP00000393596:p.Glu1048Asp	76.0	0.0	.		63.0	20.0	.	NM_016252	Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	hg19	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	A	17.67	3.447198	0.63178	.	.	ENSG00000115760	ENST00000421745	D	0.84070	-1.8	5.62	0.657	0.17850	.	0.000000	0.85682	D	0.000000	D	0.83894	0.5353	L	0.36672	1.1	0.45541	D	0.998494	D	0.58970	0.984	D	0.68192	0.956	T	0.81510	-0.0900	10	0.87932	D	0	.	9.7011	0.40187	0.6633:0.0:0.3367:0.0	.	1048	Q9NR09	BIRC6_HUMAN	D	1048	ENSP00000393596:E1048D	ENSP00000393596:E1048D	E	+	3	2	BIRC6	32509558	1.000000	0.71417	0.985000	0.45067	0.974000	0.67602	1.623000	0.37008	-0.105000	0.12132	0.533000	0.62120	GAA	.	.	.	none		0.483	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
NFE2L2	4780	hgsc.bcm.edu	37	2	178098956	178098956	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr2:178098956A>C	ENST00000397062.3	-	2	643	c.89T>G	c.(88-90)cTt>cGt	p.L30R	NFE2L2_ENST00000446151.2_Missense_Mutation_p.L14R|NFE2L2_ENST00000464747.1_Missense_Mutation_p.L14R|NFE2L2_ENST00000397063.4_Missense_Mutation_p.L14R|NFE2L2_ENST00000423513.1_Missense_Mutation_p.L14R	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	30					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L30R(2)|p.L30H(1)		central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			ACTTACTCCAAGATCTATATC	0.363			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																											p.L30R		Atlas-SNP	.		Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	NFE2L2,NS,carcinoma,0,5	NFE2L2	225	.	3	Substitution - Missense(3)	endometrium(2)|kidney(1)	c.T89G						PASS	.						68.0	61.0	63.0					2																	178098956		1839	4101	5940	SO:0001583	missense	4780	exon2			ACTCCAAGATCTA		CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.89T>G	chr2.hg19:g.178098956A>C	ENSP00000380252:p.Leu30Arg	62.0	0.0	.		66.0	7.0	.	NM_006164	B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	ENST00000397062.3	hg19	CCDS42782.1	.	.	.	.	.	.	.	.	.	.	A	19.55	3.849301	0.71603	.	.	ENSG00000116044	ENST00000397063;ENST00000397062;ENST00000446151;ENST00000449627;ENST00000448782;ENST00000421929;ENST00000423513	T;T;T;T;T;T;T	0.39056	1.1;1.1;1.1;1.1;1.1;1.1;1.1	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.69931	0.3166	M	0.86953	2.85	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.91635	0.998;0.998;0.999;0.998	T	0.76061	-0.3097	10	0.87932	D	0	.	16.098	0.81144	1.0:0.0:0.0:0.0	.	14;14;14;30	E9PGJ7;B4DNB0;C9JFL6;Q16236	.;.;.;NF2L2_HUMAN	R	14;30;14;14;14;14;14	ENSP00000380253:L14R;ENSP00000380252:L30R;ENSP00000411575:L14R;ENSP00000391590:L14R;ENSP00000400073:L14R;ENSP00000412191:L14R;ENSP00000410015:L14R	ENSP00000380252:L30R	L	-	2	0	NFE2L2	177807202	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.962000	0.93254	2.210000	0.71456	0.460000	0.39030	CTT	.	.	.	none		0.363	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257752.4	NM_006164	
SSFA2	6744	hgsc.bcm.edu	37	2	182786760	182786760	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr2:182786760G>C	ENST00000431877.2	+	16	3475	c.3296G>C	c.(3295-3297)gGa>gCa	p.G1099A	SSFA2_ENST00000428267.2_Missense_Mutation_p.G924A|SSFA2_ENST00000409001.1_Missense_Mutation_p.G1077A|SSFA2_ENST00000409136.1_Missense_Mutation_p.G608A|SSFA2_ENST00000320370.7_Missense_Mutation_p.G1099A|SSFA2_ENST00000467172.2_3'UTR	NM_001130445.1	NP_001123917.1	P28290	SSFA2_HUMAN	sperm specific antigen 2	1099						cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(18)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	38			OV - Ovarian serous cystadenocarcinoma(117;0.0856)			ATTCCTCCTGGAGAAAGCTCA	0.438																																					p.G1099A		Atlas-SNP	.											.	SSFA2	130	.	0			c.G3296C						PASS	.						86.0	89.0	88.0					2																	182786760		2203	4300	6503	SO:0001583	missense	6744	exon16			CTCCTGGAGAAAG	M61199	CCDS2284.1, CCDS46467.1, CCDS74611.1	2q32.1	2012-02-01			ENSG00000138434	ENSG00000138434			11319	protein-coding gene	gene with protein product	"""cleavage signal-1 protein"", ""KRAS-induced actin-interacting protein"", ""sperm associated antigen 13"""	118990				1555770	Standard	XM_005246812		Approved	CS-1, SPAG13, KRAP, KIAA1927	uc002uoh.3	P28290	OTTHUMG00000132584	ENST00000431877.2:c.3296G>C	chr2.hg19:g.182786760G>C	ENSP00000388731:p.Gly1099Ala	114.0	0.0	.		134.0	30.0	.	NM_001130445	A8K6T0|Q68DA6|Q7Z7L2|Q8N1L3|Q8N263|Q8N7H2|Q8NEN5|Q96E36|Q96PW1	Missense_Mutation	SNP	ENST00000431877.2	hg19	CCDS46467.1	.	.	.	.	.	.	.	.	.	.	G	11.09	1.536228	0.27475	.	.	ENSG00000138434	ENST00000431877;ENST00000320370;ENST00000409001;ENST00000428267;ENST00000409136;ENST00000451836	T;T;T;T;T	0.13420	2.84;2.59;2.81;2.81;2.6	5.81	3.98	0.46160	.	0.255590	0.34156	N	0.004205	T	0.09512	0.0234	L	0.31120	0.905	0.33216	D	0.554017	B;B;B;B;B	0.20261	0.043;0.043;0.043;0.043;0.043	B;B;B;B;B	0.19148	0.024;0.024;0.024;0.024;0.024	T	0.10847	-1.0612	10	0.29301	T	0.29	-16.5272	8.2067	0.31458	0.1663:0.1882:0.6455:0.0	.	924;608;1077;1099;1099	E7END2;E7EUL7;E9PHV5;P28290;P28290-3	.;.;.;SSFA2_HUMAN;.	A	1099;1099;1077;924;608;44	ENSP00000388731:G1099A;ENSP00000314669:G1099A;ENSP00000387319:G1077A;ENSP00000409867:G924A;ENSP00000386916:G608A	ENSP00000314669:G1099A	G	+	2	0	SSFA2	182495005	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.480000	0.45206	1.461000	0.47929	0.563000	0.77884	GGA	.	.	.	none		0.438	SSFA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255793.2	NM_006751	
ZFAND2B	130617	hgsc.bcm.edu	37	2	220072989	220072989	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr2:220072989T>G	ENST00000289528.5	+	5	641	c.446T>G	c.(445-447)aTc>aGc	p.I149S	ZFAND2B_ENST00000444522.2_Missense_Mutation_p.I149S|ZFAND2B_ENST00000409097.1_Missense_Mutation_p.I149S|ZFAND2B_ENST00000409336.1_Missense_Mutation_p.I149S|ZFAND2B_ENST00000409206.1_Missense_Mutation_p.I149S|ZFAND2B_ENST00000409217.1_Missense_Mutation_p.I149S|ZFAND2B_ENST00000409594.1_Missense_Mutation_p.I149S	NM_001270998.1|NM_001270999.1|NM_138802.2	NP_001257927.1|NP_001257928.1|NP_620157.1	Q8WV99	ZFN2B_HUMAN	zinc finger, AN1-type domain 2B	149						endoplasmic reticulum (GO:0005783)	zinc ion binding (GO:0008270)	p.I149T(1)		endometrium(2)|kidney(4)|lung(4)|upper_aerodigestive_tract(1)	11		Renal(207;0.0915)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTTGCTGCCATCTCCAGAGCA	0.532																																					p.I149S		Atlas-SNP	.											ZFAND2B,NS,carcinoma,-1,1	ZFAND2B	28	.	1	Substitution - Missense(1)	kidney(1)	c.T446G						PASS	.						75.0	62.0	66.0					2																	220072989		2203	4300	6503	SO:0001583	missense	130617	exon5			CTGCCATCTCCAG	AK074571	CCDS2435.1, CCDS74656.1	2q35	2010-04-23	2005-08-22		ENSG00000158552	ENSG00000158552		"""Zinc fingers, AN1-type domain containing"""	25206	protein-coding gene	gene with protein product	"""arsenite inducible RNA associated protein-like"""	613474	"""zinc finger, AN1-type 2B"""			18467495	Standard	NM_138802		Approved	AIRAPL	uc002vka.4	Q8WV99	OTTHUMG00000133135	ENST00000289528.5:c.446T>G	chr2.hg19:g.220072989T>G	ENSP00000289528:p.Ile149Ser	40.0	0.0	.		54.0	18.0	.	NM_138802	Q8NB98	Missense_Mutation	SNP	ENST00000289528.5	hg19	CCDS2435.1	.	.	.	.	.	.	.	.	.	.	T	16.31	3.088523	0.55968	.	.	ENSG00000158552	ENST00000409206;ENST00000409594;ENST00000289528;ENST00000422255;ENST00000409097;ENST00000409336;ENST00000409217;ENST00000444522	T;T;T;T;T;T;T;T	0.44881	0.96;0.96;0.92;0.92;0.91;0.92;0.92;0.91	5.32	5.32	0.75619	Zinc finger, AN1-type (1);	0.400654	0.26646	N	0.023223	T	0.48241	0.1489	L	0.54323	1.7	0.40724	D	0.982682	D;B;B	0.57571	0.98;0.329;0.069	P;B;B	0.51550	0.673;0.116;0.053	T	0.52230	-0.8603	10	0.59425	D	0.04	-15.7601	11.5973	0.50981	0.0:0.0:0.0:1.0	.	40;149;149	B3KQB0;Q8WV99;B4DEN4	.;ZFN2B_HUMAN;.	S	149	ENSP00000386824:I149S;ENSP00000386399:I149S;ENSP00000289528:I149S;ENSP00000409931:I149S;ENSP00000387179:I149S;ENSP00000386898:I149S;ENSP00000386370:I149S;ENSP00000411334:I149S	ENSP00000289528:I149S	I	+	2	0	ZFAND2B	219781233	0.998000	0.40836	1.000000	0.80357	0.961000	0.63080	3.720000	0.54933	2.233000	0.73108	0.533000	0.62120	ATC	.	.	.	none		0.532	ZFAND2B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256824.2	NM_138802	
UGT1A3	54659	hgsc.bcm.edu	37	2	234637943	234637943	+	Silent	SNP	G	G	A	rs374045195		TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr2:234637943G>A	ENST00000482026.1	+	1	190	c.171G>A	c.(169-171)caG>caA	p.Q57Q	UGT1A1_ENST00000609637.1_Intron|UGT1A4_ENST00000373409.3_Intron|UGT1A6_ENST00000480628.1_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A1_ENST00000609767.1_Silent_p.Q57Q|UGT1A5_ENST00000373414.3_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A1_ENST00000608381.1_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A6_ENST00000406651.1_Intron|UGT1A6_ENST00000305139.6_Intron			P35503	UD13_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A3	57					cellular glucuronidation (GO:0052695)|flavonoid glucuronidation (GO:0052696)|metabolic process (GO:0008152)|retinoic acid metabolic process (GO:0042573)|xenobiotic glucuronidation (GO:0052697)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|UDP-glycosyltransferase activity (GO:0008194)			breast(2)|endometrium(7)|kidney(18)|large_intestine(6)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	46		Breast(86;0.000765)|all_lung(227;0.00266)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0456)|Lung SC(224;0.128)		Epithelial(121;2.4e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000476)|Lung(119;0.00243)|LUSC - Lung squamous cell carcinoma(224;0.00599)	Atorvastatin(DB01076)|Candesartan(DB00796)|Cyproheptadine(DB00434)|Eltrombopag(DB06210)|Etodolac(DB00749)|Ezetimibe(DB00973)|Ezogabine(DB04953)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Irbesartan(DB01029)|Lamotrigine(DB00555)|Losartan(DB00678)|Lovastatin(DB00227)|Mitiglinide(DB01252)|Morphine(DB00295)|Pitavastatin(DB08860)|Simvastatin(DB00641)|Valproic Acid(DB00313)	GAGGCCACCAGGCAGTGGTCC	0.552																																					p.Q57Q		Atlas-SNP	.											.	UGT1A3	91	.	0			c.G171A						PASS	.	G	,,,,,,,,	1,4405	2.1+/-5.4	0,1,2202	78.0	79.0	78.0		,,,,,,171,,	-2.3	0.0	2		78	0,8600		0,0,4300	no	intron,intron,intron,intron,intron,intron,coding-synonymous,intron,intron	UGT1A10,UGT1A8,UGT1A7,UGT1A6,UGT1A5,UGT1A9,UGT1A4,UGT1A3	NM_001072.3,NM_007120.2,NM_019075.2,NM_019076.4,NM_019077.2,NM_019078.1,NM_019093.2,NM_021027.2,NM_205862.1	,,,,,,,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,,,,,,,	,,,,,,57/535,,	234637943	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	54659	exon1			CCACCAGGCAGTG	M84127	CCDS2509.1	2q37	2010-03-05	2005-07-20		ENSG00000243135	ENSG00000243135		"""UDP glucuronosyltransferases"""	12535	other	complex locus constituent		606428	"""UDP glycosyltransferase 1 family, polypeptide A3"""			9295054, 1339448, 11434514	Standard	NM_019093		Approved	UGT1C		P35503	OTTHUMG00000059118	ENST00000482026.1:c.171G>A	chr2.hg19:g.234637943G>A		70.0	0.0	.		76.0	21.0	.	NM_019093	B8K287	Silent	SNP	ENST00000482026.1	hg19	CCDS2509.1																																																																																			.	.	.	weak		0.552	UGT1A3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130983.1	NM_019093	
TCAIM	285343	hgsc.bcm.edu	37	3	44438258	44438258	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr3:44438258C>T	ENST00000342649.4	+	8	1244	c.817C>T	c.(817-819)Cgt>Tgt	p.R273C	TCAIM_ENST00000417237.1_Missense_Mutation_p.R273C	NM_001282913.1|NM_173826.3	NP_001269842.1|NP_776187.2	Q8N3R3	TCAIM_HUMAN	T cell activation inhibitor, mitochondrial	273						mitochondrion (GO:0005739)		p.R273G(1)									ATTTACAGACCGTTCTGGCAT	0.408																																					p.R273C		Atlas-SNP	.											C3orf23,NS,carcinoma,0,1	.	.	.	1	Substitution - Missense(1)	lung(1)	c.C817T						PASS	.						135.0	124.0	128.0					3																	44438258		2203	4300	6503	SO:0001583	missense	285343	exon8			ACAGACCGTTCTG		CCDS2712.1, CCDS43076.1	3p21.33-p21.32	2012-08-22	2012-08-22	2012-08-22	ENSG00000179152	ENSG00000179152			25241	protein-coding gene	gene with protein product	"""tolerance associated gene-1"""		"""chromosome 3 open reading frame 23"""	C3orf23		12477932	Standard	NM_001029840		Approved	DKFZp313N0621, TOAG-1	uc003cnd.4	Q8N3R3	OTTHUMG00000133049	ENST00000342649.4:c.817C>T	chr3.hg19:g.44438258C>T	ENSP00000341539:p.Arg273Cys	91.0	0.0	.		128.0	55.0	.	NM_173826	A8K9P1|Q0P5T9|Q495R1|Q495R3|Q4G0M4|Q6GMU8	Missense_Mutation	SNP	ENST00000342649.4	hg19	CCDS2712.1	.	.	.	.	.	.	.	.	.	.	C	17.47	3.396479	0.62177	.	.	ENSG00000179152	ENST00000417237;ENST00000342649	T;T	0.48201	0.82;0.82	5.6	3.8	0.43715	.	0.255107	0.43747	N	0.000534	T	0.56046	0.1959	L	0.51422	1.61	0.46396	D	0.999026	D	0.89917	1.0	P	0.60682	0.878	T	0.56007	-0.8050	10	0.66056	D	0.02	.	9.6854	0.40096	0.0:0.6626:0.267:0.0703	.	273	Q8N3R3	CC023_HUMAN	C	273	ENSP00000402581:R273C;ENSP00000341539:R273C	ENSP00000341539:R273C	R	+	1	0	C3orf23	44413262	1.000000	0.71417	0.930000	0.37139	0.684000	0.39900	2.565000	0.45939	0.718000	0.32166	0.655000	0.94253	CGT	.	.	.	none		0.408	TCAIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256655.2	NM_173826	
CCDC58	131076	hgsc.bcm.edu	37	3	122102042	122102042	+	Silent	SNP	A	A	G			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr3:122102042A>G	ENST00000291458.5	-	1	36	c.30T>C	c.(28-30)tgT>tgC	p.C10C	CCDC58_ENST00000497726.1_Silent_p.C10C|FAM162A_ENST00000469967.1_5'Flank|FAM162A_ENST00000477892.1_5'Flank|FAM162A_ENST00000232125.5_5'Flank|CCDC58_ENST00000479899.1_5'UTR	NM_001017928.2	NP_001017928.1	Q4VC31	CCD58_HUMAN	coiled-coil domain containing 58	10						mitochondrion (GO:0005739)				large_intestine(1)|lung(1)	2				GBM - Glioblastoma multiforme(114;0.148)		CGAACTCCTCACAGTTCACAC	0.602																																					p.C10C		Atlas-SNP	.											.	CCDC58	14	.	0			c.T30C						PASS	.						83.0	73.0	76.0					3																	122102042		2203	4300	6503	SO:0001819	synonymous_variant	131076	exon1			CTCCTCACAGTTC	AK090592	CCDS33838.1	3q21.1	2006-01-17			ENSG00000160124	ENSG00000160124			31136	protein-coding gene	gene with protein product							Standard	XM_005247108		Approved	FLJ33273	uc003eey.3	Q4VC31	OTTHUMG00000159490	ENST00000291458.5:c.30T>C	chr3.hg19:g.122102042A>G		96.0	0.0	.		125.0	14.0	.	NM_001017928	Q32LY6	Silent	SNP	ENST00000291458.5	hg19	CCDS33838.1																																																																																			.	.	.	none		0.602	CCDC58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355754.1	NM_001017928	
PIK3CB	5291	hgsc.bcm.edu	37	3	138409857	138409857	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr3:138409857A>G	ENST00000477593.1	-	14	2094	c.2021T>C	c.(2020-2022)cTa>cCa	p.L674P	PIK3CB_ENST00000289153.2_Missense_Mutation_p.L674P|PIK3CB_ENST00000544716.1_Missense_Mutation_p.L120P			P42338	PK3CB_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta	674	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.				activation of MAPK activity (GO:0000187)|autophagy (GO:0006914)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|embryonic cleavage (GO:0040016)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of autophagy (GO:0010508)|regulation of cell-matrix adhesion (GO:0001952)|regulation of clathrin-mediated endocytosis (GO:2000369)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)			NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	41					Caffeine(DB00201)	ATGCCAAAATAGAAACTGCCC	0.353																																					p.L674P		Atlas-SNP	.											.	PIK3CB	103	.	0			c.T2021C						PASS	.						135.0	140.0	138.0					3																	138409857		2203	4300	6503	SO:0001583	missense	5291	exon13			CAAAATAGAAACT		CCDS3104.1	3q22.3	2013-09-19	2012-07-13		ENSG00000051382	ENSG00000051382	2.7.1.153		8976	protein-coding gene	gene with protein product		602925	"""phosphoinositide-3-kinase, catalytic, beta polypeptide"""	PIK3C1		8246984	Standard	NM_006219		Approved		uc011bmq.3	P42338	OTTHUMG00000159893	ENST00000477593.1:c.2021T>C	chr3.hg19:g.138409857A>G	ENSP00000418143:p.Leu674Pro	188.0	0.0	.		269.0	63.0	.	NM_006219	D3DNF0|Q24JU2	Missense_Mutation	SNP	ENST00000477593.1	hg19	CCDS3104.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	21.8|21.8	4.204435|4.204435	0.79127|0.79127	.|.	.|.	ENSG00000051382|ENSG00000051382	ENST00000477593;ENST00000544716;ENST00000289153|ENST00000493568	T;T;T|.	0.77358|.	-1.09;-1.09;-1.09|.	5.66|5.66	5.66|5.66	0.87406|0.87406	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.86142|0.86142	0.5862|0.5862	M|M	0.93420|0.93420	3.415|3.415	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	0.998;0.997;1.0|.	D|D	0.89873|0.89873	0.4024|0.4024	10|5	0.87932|.	D|.	0|.	-9.4984|-9.4984	15.8807|15.8807	0.79201|0.79201	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	674;261;120|.	P42338;B4DZI3;Q68DL0|.	PK3CB_HUMAN;.;.|.	P|H	674;120;674|306	ENSP00000418143:L674P;ENSP00000438259:L120P;ENSP00000289153:L674P|.	ENSP00000289153:L674P|.	L|Y	-|-	2|1	0|0	PIK3CB|PIK3CB	139892547|139892547	1.000000|1.000000	0.71417|0.71417	0.989000|0.989000	0.46669|0.46669	0.983000|0.983000	0.72400|0.72400	9.339000|9.339000	0.96797|0.96797	2.151000|2.151000	0.67156|0.67156	0.533000|0.533000	0.62120|0.62120	CTA|TAT	.	.	.	none		0.353	PIK3CB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358019.1		
PDE6B	5158	hgsc.bcm.edu	37	4	619837	619837	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr4:619837A>C	ENST00000496514.1	+	1	443	c.422A>C	c.(421-423)cAc>cCc	p.H141P	PDE6B_ENST00000255622.6_Missense_Mutation_p.H141P			P35913	PDE6B_HUMAN	phosphodiesterase 6B, cGMP-specific, rod, beta	141	GAF 1.				cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			NS(1)|breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|urinary_tract(1)	30					Caffeine(DB00201)	GTCGTGGGCCACGTGGCTCAG	0.642																																					p.H141P	GBM(71;463 1194 9848 25922 46834)	Atlas-SNP	.											.	PDE6B	80	.	0			c.A422C						PASS	.						22.0	16.0	18.0					4																	619837		2193	4298	6491	SO:0001583	missense	5158	exon1			TGGGCCACGTGGC	BC000249	CCDS33932.1, CCDS46993.1, CCDS54703.1	4p16.3	2014-01-28	2008-07-31		ENSG00000133256	ENSG00000133256	3.1.4.17	"""Phosphodiesterases"""	8786	protein-coding gene	gene with protein product	"""congenital stationary night blindness 3, autosomal dominant"""	180072		PDEB		1313787	Standard	NM_001145292		Approved	CSNB3, rd1, RP40, CSNBAD2	uc003gap.3	P35913	OTTHUMG00000159909	ENST00000496514.1:c.422A>C	chr4.hg19:g.619837A>C	ENSP00000420295:p.His141Pro	12.0	0.0	.		9.0	5.0	.	NM_001145291	B7Z9T9|E7ETT3|Q53XN5|Q9BWH5|Q9UD49	Missense_Mutation	SNP	ENST00000496514.1	hg19	CCDS33932.1	.	.	.	.	.	.	.	.	.	.	A	19.70	3.877195	0.72294	.	.	ENSG00000133256	ENST00000255622;ENST00000496514	T;T	0.67523	-0.27;-0.27	4.88	4.88	0.63580	GAF (2);	0.103854	0.64402	D	0.000005	T	0.81418	0.4818	M	0.91406	3.205	0.80722	D	1	D;D	0.55385	0.971;0.964	P;P	0.56865	0.808;0.709	D	0.84544	0.0640	10	0.49607	T	0.09	.	12.4206	0.55518	1.0:0.0:0.0:0.0	.	141;141	P35913;P35913-2	PDE6B_HUMAN;.	P	141	ENSP00000255622:H141P;ENSP00000420295:H141P	ENSP00000255622:H141P	H	+	2	0	PDE6B	609837	0.663000	0.27448	1.000000	0.80357	0.862000	0.49288	5.590000	0.67530	1.845000	0.53610	0.459000	0.35465	CAC	.	.	.	none		0.642	PDE6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358109.1	NM_000283	
CMYA5	202333	hgsc.bcm.edu	37	5	79032748	79032748	+	Silent	SNP	T	T	C			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr5:79032748T>C	ENST00000446378.2	+	2	8191	c.8160T>C	c.(8158-8160)acT>acC	p.T2720T		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	2720					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		TGGAGAAAACTAAGACTTTCC	0.378																																					p.T2720T		Atlas-SNP	.											CMYA5_ENST00000446378,colon,carcinoma,0,2	CMYA5	643	.	0			c.T8160C						PASS	.						41.0	41.0	41.0					5																	79032748		1825	4074	5899	SO:0001819	synonymous_variant	202333	exon2			GAAAACTAAGACT	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.8160T>C	chr5.hg19:g.79032748T>C		38.0	0.0	.		26.0	3.0	.	NM_153610	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Silent	SNP	ENST00000446378.2	hg19	CCDS47238.1																																																																																			.	.	.	none		0.378	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610	
ALDH7A1	501	hgsc.bcm.edu	37	5	125930919	125930919	+	5'UTR	SNP	A	A	G	rs556650006	byFrequency	TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr5:125930919A>G	ENST00000409134.3	-	0	191				ALDH7A1_ENST00000553117.1_5'UTR|ALDH7A1_ENST00000413020.1_5'Flank|ALDH7A1_ENST00000447989.2_Missense_Mutation_p.L18P	NM_001182.4|NM_001201377.1	NP_001173.2|NP_001188306.1	P49419	AL7A1_HUMAN	aldehyde dehydrogenase 7 family, member A1						cellular aldehyde metabolic process (GO:0006081)|cellular nitrogen compound metabolic process (GO:0034641)|glycine betaine biosynthetic process from choline (GO:0019285)|lysine catabolic process (GO:0006554)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|betaine-aldehyde dehydrogenase activity (GO:0008802)|L-aminoadipate-semialdehyde dehydrogenase activity (GO:0004043)			endometrium(1)|kidney(4)|large_intestine(4)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	16		all_cancers(142;0.24)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0417)|OV - Ovarian serous cystadenocarcinoma(64;0.068)|all cancers(49;0.109)		GATGAGCCCAAGGCCCTGAGA	0.687													A|||	3	0.000599042	0.0	0.0	5008	,	,		12559	0.0		0.0	False		,,,				2504	0.0031				p.L18P		Atlas-SNP	.											.	ALDH7A1	57	.	0			c.T53C						PASS	.						13.0	14.0	14.0					5																	125930919		692	1591	2283	SO:0001623	5_prime_UTR_variant	501	exon1			AGCCCAAGGCCCT	S74728	CCDS4137.2, CCDS56380.1	5q31	2013-06-03			ENSG00000164904	ENSG00000164904	1.2.1.31	"""Aldehyde dehydrogenases"""	877	protein-coding gene	gene with protein product	"""antiquitin 1"", ""26g turgor protein homolog"", ""alpha-aminoadipic semialdehyde dehydrogenase"", ""alpha-AASA dehydrogenase"", ""delta1-piperideine-6-carboxylate dehydrogenease"", ""P6c dehydrogenase"""	107323		ATQ1		9417906	Standard	NM_001182		Approved	EPD, PDE	uc003ktx.3	P49419	OTTHUMG00000128942	ENST00000409134.3:c.-29T>C	chr5.hg19:g.125930919A>G		1.0	0.0	.		5.0	4.0	.	NM_001202404	B2R669|B4DIC7|B4DMA0|E7EPT3|O14619|Q6IPU8|Q9BUL4	Missense_Mutation	SNP	ENST00000409134.3	hg19	CCDS4137.2	.	.	.	.	.	.	.	.	.	.	A	10.94	1.493842	0.26774	.	.	ENSG00000164904	ENST00000447989	D	0.81499	-1.5	3.48	2.58	0.30949	.	.	.	.	.	T	0.60196	0.2250	N	0.08118	0	0.09310	N	0.999999	B;B	0.22604	0.021;0.072	B;B	0.19148	0.024;0.024	T	0.53107	-0.8485	9	0.72032	D	0.01	.	4.6287	0.12491	0.2338:0.6439:0.0:0.1223	.	18;18	E7EPT3;B4DMA0	.;.	P	18	ENSP00000414132:L18P	ENSP00000414132:L18P	L	-	2	0	ALDH7A1	125958818	0.000000	0.05858	0.010000	0.14722	0.002000	0.02628	-0.075000	0.11431	0.732000	0.32470	-0.452000	0.05504	CTT	.	.	.	none		0.687	ALDH7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250921.2	NM_001182	
ZBED9	114821	hgsc.bcm.edu	37	6	28543371	28543371	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr6:28543371C>A	ENST00000452236.2	-	3	1728	c.1111G>T	c.(1111-1113)Gtt>Ttt	p.V371F	SCAND3_ENST00000530247.1_5'Flank	NM_052923.1	NP_443155.1														NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						CTTGAACTAACTTCCTTAATT	0.343																																					p.V371F		Atlas-SNP	.											.	SCAND3	156	.	0			c.G1111T						PASS	.						122.0	124.0	124.0					6																	28543371		2203	4300	6503	SO:0001583	missense	114821	exon3			AACTAACTTCCTT																												ENST00000452236.2:c.1111G>T	chr6.hg19:g.28543371C>A	ENSP00000395259:p.Val371Phe	195.0	0.0	.		199.0	63.0	.	NM_052923		Missense_Mutation	SNP	ENST00000452236.2	hg19	CCDS34355.1	.	.	.	.	.	.	.	.	.	.	C	16.74	3.208100	0.58343	.	.	ENSG00000232040	ENST00000452236	T	0.01474	4.85	3.45	2.58	0.30949	Integrase, catalytic core (1);Ribonuclease H-like (1);	.	.	.	.	T	0.01320	0.0043	L	0.29908	0.895	0.27530	N	0.951136	D	0.69078	0.997	D	0.63488	0.915	T	0.54337	-0.8309	9	0.23891	T	0.37	.	6.9505	0.24542	0.0:0.8705:0.0:0.1295	.	371	Q6R2W3	SCND3_HUMAN	F	371	ENSP00000395259:V371F	ENSP00000395259:V371F	V	-	1	0	SCAND3	28651350	0.993000	0.37304	0.998000	0.56505	0.998000	0.95712	0.080000	0.14802	0.789000	0.33779	0.655000	0.94253	GTT	.	.	.	none		0.343	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000043551.3		
INTS1	26173	hgsc.bcm.edu	37	7	1535858	1535858	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr7:1535858T>C	ENST00000404767.3	-	12	1730	c.1645A>G	c.(1645-1647)Atg>Gtg	p.M549V	INTS1_ENST00000389470.4_Missense_Mutation_p.M677V	NM_001080453.2	NP_001073922.2	Q8N201	INT1_HUMAN	integrator complex subunit 1	549					inner cell mass cell proliferation (GO:0001833)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|snRNA processing (GO:0016180)|U2 snRNA 3'-end processing (GO:0034474)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)				autonomic_ganglia(1)|cervix(1)|endometrium(14)|kidney(3)|large_intestine(7)|lung(24)|ovary(1)|prostate(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	62		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		CCCAGCATCATGGACACGGCC	0.632																																					p.M549V		Atlas-SNP	.											.	INTS1	145	.	0			c.A1645G						PASS	.						84.0	95.0	91.0					7																	1535858		2106	4225	6331	SO:0001583	missense	26173	exon12			GCATCATGGACAC	AB037861	CCDS47526.1	7p22.3	2009-11-06			ENSG00000164880	ENSG00000164880			24555	protein-coding gene	gene with protein product		611345				16239144	Standard	NM_001080453		Approved	DKFZp586J0619, KIAA1440, INT1, NET28	uc003skn.2	Q8N201	OTTHUMG00000151449	ENST00000404767.3:c.1645A>G	chr7.hg19:g.1535858T>C	ENSP00000385722:p.Met549Val	93.0	0.0	.		136.0	35.0	.	NM_001080453	A6NJ44|Q6NT70|Q6UX74|Q8WV40|Q96D36|Q9NTD1|Q9P2A8|Q9Y3W8	Missense_Mutation	SNP	ENST00000404767.3	hg19	CCDS47526.1	.	.	.	.	.	.	.	.	.	.	T	18.94	3.730230	0.69074	.	.	ENSG00000164880	ENST00000404767;ENST00000389470	T;T	0.47528	0.84;0.85	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.48021	0.1477	L	0.52011	1.625	0.80722	D	1	P	0.39044	0.656	B	0.42361	0.385	T	0.47509	-0.9112	10	0.41790	T	0.15	.	14.7485	0.69508	0.0:0.0:0.0:1.0	.	549	Q8N201	INT1_HUMAN	V	549;677	ENSP00000385722:M549V;ENSP00000374121:M677V	ENSP00000374121:M677V	M	-	1	0	INTS1	1502384	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	7.866000	0.87056	1.897000	0.54924	0.533000	0.62120	ATG	.	.	.	none		0.632	INTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323683.1		
PTPRZ1	5803	hgsc.bcm.edu	37	7	121668665	121668665	+	Missense_Mutation	SNP	C	C	A	rs368834797		TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr7:121668665C>A	ENST00000393386.2	+	14	5459	c.5048C>A	c.(5047-5049)tCc>tAc	p.S1683Y	PTPRZ1_ENST00000449182.1_Missense_Mutation_p.S823Y	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	1683					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						AGAGTTATATCCACACCTCCA	0.383																																					p.S1683Y		Atlas-SNP	.											.	PTPRZ1	605	.	0			c.C5048A						PASS	.						184.0	155.0	165.0					7																	121668665		2203	4300	6503	SO:0001583	missense	5803	exon14			TTATATCCACACC	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.5048C>A	chr7.hg19:g.121668665C>A	ENSP00000377047:p.Ser1683Tyr	132.0	0.0	.		173.0	11.0	.	NM_002851	A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	ENST00000393386.2	hg19	CCDS34740.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.480370	0.84747	.	.	ENSG00000106278	ENST00000393386;ENST00000449182	T;T	0.79141	0.76;-1.24	5.8	5.8	0.92144	.	0.000000	0.64402	D	0.000002	D	0.84880	0.5570	L	0.46157	1.445	0.53688	D	0.999977	D;D;P	0.67145	0.996;0.97;0.95	D;P;P	0.65874	0.939;0.682;0.736	D	0.84173	0.0435	10	0.51188	T	0.08	.	20.0637	0.97700	0.0:1.0:0.0:0.0	.	822;823;1683	P23471-2;C9JFM0;P23471	.;.;PTPRZ_HUMAN	Y	1683;823	ENSP00000377047:S1683Y;ENSP00000410000:S823Y	ENSP00000377047:S1683Y	S	+	2	0	PTPRZ1	121455901	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.356000	0.79445	2.751000	0.94390	0.650000	0.86243	TCC	.	.	.	alt		0.383	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851	
SVEP1	79987	hgsc.bcm.edu	37	9	113259109	113259109	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr9:113259109T>C	ENST00000401783.2	-	8	2122	c.1786A>G	c.(1786-1788)Aac>Gac	p.N596D	SVEP1_ENST00000302728.8_Missense_Mutation_p.N596D|SVEP1_ENST00000467821.1_5'UTR|SVEP1_ENST00000374469.1_Missense_Mutation_p.N573D|SVEP1_ENST00000374461.1_Missense_Mutation_p.N573D	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	596	HYR 1. {ECO:0000255|PROSITE- ProRule:PRU00113}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						TCACCAGAGTTGTCTTTAGCT	0.398																																					p.N596D		Atlas-SNP	.											.	SVEP1	326	.	0			c.A1786G						PASS	.						115.0	107.0	109.0					9																	113259109		1881	4083	5964	SO:0001583	missense	79987	exon8			CAGAGTTGTCTTT	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.1786A>G	chr9.hg19:g.113259109T>C	ENSP00000384917:p.Asn596Asp	4.0	0.0	.		12.0	4.0	.	NM_153366	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	hg19	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.505631	0.85282	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000302728;ENST00000374461	T;T;T;T	0.25579	1.79;1.79;1.79;1.79	5.71	5.71	0.89125	Hyalin (2);	0.000000	0.85682	D	0.000000	T	0.59088	0.2168	M	0.90759	3.145	0.38327	D	0.943687	D;D;D	0.89917	0.999;1.0;0.996	D;D;D	0.87578	0.995;0.998;0.99	T	0.71155	-0.4675	10	0.72032	D	0.01	.	14.9529	0.71088	0.0:0.0:0.0:1.0	.	596;596;596	E9PBN8;Q4LDE5;Q4LDE5-2	.;SVEP1_HUMAN;.	D	596;573;596;573	ENSP00000384917:N596D;ENSP00000363593:N573D;ENSP00000304118:N596D;ENSP00000363585:N573D	ENSP00000304118:N596D	N	-	1	0	SVEP1	112298930	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.259000	0.72494	2.181000	0.69327	0.477000	0.44152	AAC	.	.	.	none		0.398	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
INTS5	80789	hgsc.bcm.edu	37	11	62417117	62417117	+	Silent	SNP	A	A	G			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr11:62417117A>G	ENST00000330574.2	-	2	487	c.435T>C	c.(433-435)agT>agC	p.S145S		NM_030628.1	NP_085131.1	Q6P9B9	INT5_HUMAN	integrator complex subunit 5	145					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)				breast(1)|endometrium(4)|large_intestine(6)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	36						TGGACCATGCACTAATCACAG	0.572																																					p.S145S		Atlas-SNP	.											.	INTS5	81	.	0			c.T435C						PASS	.						108.0	107.0	107.0					11																	62417117		2202	4299	6501	SO:0001819	synonymous_variant	80789	exon2			CCATGCACTAATC	AK123587	CCDS8027.1	11q12.3	2006-04-26	2006-03-15	2006-03-15	ENSG00000185085	ENSG00000185085			29352	protein-coding gene	gene with protein product		611349	"""KIAA1698"""	KIAA1698		16239144	Standard	NM_030628		Approved	INT5	uc001nud.3	Q6P9B9	OTTHUMG00000167605	ENST00000330574.2:c.435T>C	chr11.hg19:g.62417117A>G		126.0	0.0	.		111.0	44.0	.	NM_030628	Q8N6W5|Q9C0G5	Silent	SNP	ENST00000330574.2	hg19	CCDS8027.1																																																																																			.	.	.	none		0.572	INTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395327.1	NM_030628	
ARAP1	116985	hgsc.bcm.edu	37	11	72423355	72423355	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr11:72423355A>G	ENST00000393609.3	-	7	1110	c.908T>C	c.(907-909)tTg>tCg	p.L303S	ARAP1_ENST00000426523.1_Missense_Mutation_p.L58S|ARAP1_ENST00000455638.2_Missense_Mutation_p.L303S|ARAP1_ENST00000429686.1_Missense_Mutation_p.L58S|ARAP1_ENST00000359373.5_Missense_Mutation_p.L303S|ARAP1_ENST00000334211.8_Missense_Mutation_p.L58S|ARAP1_ENST00000393605.3_Missense_Mutation_p.L63S	NM_001040118.2	NP_001035207.1	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1	303					actin filament reorganization involved in cell cycle (GO:0030037)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of receptor recycling (GO:0001921)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of cellular component movement (GO:0051270)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27						GGGCAAGGACAAGCTCAGGCT	0.672																																					p.L303S	Ovarian(102;1198 1520 13195 17913 37529)	Atlas-SNP	.											.	ARAP1	168	.	0			c.T908C						PASS	.						28.0	28.0	28.0					11																	72423355		2200	4293	6493	SO:0001583	missense	116985	exon7			AAGGACAAGCTCA	AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2			Standard	NM_001040118		Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.908T>C	chr11.hg19:g.72423355A>G	ENSP00000377233:p.Leu303Ser	20.0	0.0	.		23.0	6.0	.	NM_001040118	A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	Missense_Mutation	SNP	ENST00000393609.3	hg19	CCDS41687.1	.	.	.	.	.	.	.	.	.	.	A	0.304	-0.971901	0.02215	.	.	ENSG00000186635	ENST00000359373;ENST00000455638;ENST00000393605;ENST00000334211;ENST00000393609;ENST00000426523;ENST00000429686;ENST00000340247	T;T;T;T;T;T;T	0.13538	2.58;2.58;2.58;2.58;2.58;2.58;2.58	4.44	2.14	0.27477	.	0.724250	0.11919	N	0.516857	T	0.05135	0.0137	N	0.03608	-0.345	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0	T	0.43621	-0.9380	10	0.07990	T	0.79	.	8.6422	0.33983	0.16:0.0:0.84:0.0	.	58;58;303;303;63	E7EU13;B2RTS2;Q96P48-3;Q96P48;Q96P48-1	.;.;.;ARAP1_HUMAN;.	S	303;303;63;58;303;58;58;92	ENSP00000352332:L303S;ENSP00000390461:L303S;ENSP00000377230:L63S;ENSP00000335506:L58S;ENSP00000377233:L303S;ENSP00000392264:L58S;ENSP00000403127:L58S	ENSP00000335506:L58S	L	-	2	0	ARAP1	72101003	0.145000	0.22656	0.008000	0.14137	0.081000	0.17604	0.839000	0.27586	0.330000	0.23485	0.459000	0.35465	TTG	.	.	.	none		0.672	ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347428.1	NM_001040118	
ZW10	9183	hgsc.bcm.edu	37	11	113628545	113628545	+	Missense_Mutation	SNP	G	G	A	rs377079908		TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr11:113628545G>A	ENST00000200135.3	-	7	908	c.764C>T	c.(763-765)cCg>cTg	p.P255L		NM_004724.3	NP_004715.1	O43264	ZW10_HUMAN	zw10 kinetochore protein	255	Interaction with RINT1.				ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic metaphase plate congression (GO:0007080)|mitotic sister chromatid segregation (GO:0000070)|protein complex assembly (GO:0006461)|protein localization to kinetochore (GO:0034501)|protein transport (GO:0015031)|regulation of exit from mitosis (GO:0007096)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|nucleus (GO:0005634)|spindle pole (GO:0000922)	centromeric DNA binding (GO:0019237)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)	18		all_cancers(61;3.84e-16)|all_epithelial(67;1e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000237)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0421)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.94e-06)|Epithelial(105;0.000103)|all cancers(92;0.000786)		AGATGCCAGCGGCCTAAGGAT	0.403													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18410	0.0		0.0	False		,,,				2504	0.0				p.P255L		Atlas-SNP	.											.	ZW10	49	.	0			c.C764T						PASS	.	G	LEU/PRO	0,4402		0,0,2201	66.0	69.0	68.0		764	5.5	1.0	11		68	1,8591	1.2+/-3.3	0,1,4295	no	missense	ZW10	NM_004724.3	98	0,1,6496	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	255/780	113628545	1,12993	2201	4296	6497	SO:0001583	missense	9183	exon7			GCCAGCGGCCTAA	U54996	CCDS8363.1	11q23	2013-01-17	2012-12-13		ENSG00000086827	ENSG00000086827			13194	protein-coding gene	gene with protein product		603954	"""ZW10 (Drosophila) homolog, centromere/kinetochore protein"", ""ZW10, kinetochore associated, homolog (Drosophila)"""			9298984	Standard	NM_004724		Approved	KNTC1AP	uc001poe.3	O43264	OTTHUMG00000168190	ENST00000200135.3:c.764C>T	chr11.hg19:g.113628545G>A	ENSP00000200135:p.Pro255Leu	73.0	0.0	.		65.0	19.0	.	NM_004724	A1A528	Missense_Mutation	SNP	ENST00000200135.3	hg19	CCDS8363.1	.	.	.	.	.	.	.	.	.	.	G	19.95	3.921357	0.73213	0.0	1.16E-4	ENSG00000086827	ENST00000200135	T	0.64438	-0.1	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.62392	0.2424	L	0.53249	1.67	0.80722	D	1	P	0.43857	0.819	B	0.41374	0.355	T	0.68330	-0.5437	10	0.87932	D	0	-10.4182	18.3058	0.90180	0.0:0.0:1.0:0.0	.	255	O43264	ZW10_HUMAN	L	255	ENSP00000200135:P255L	ENSP00000200135:P255L	P	-	2	0	ZW10	113133755	1.000000	0.71417	0.999000	0.59377	0.869000	0.49853	8.079000	0.89508	2.571000	0.86741	0.650000	0.86243	CCG	.	.	.	weak		0.403	ZW10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398700.1	NM_004724	
AKAP6	9472	hgsc.bcm.edu	37	14	33204952	33204952	+	Missense_Mutation	SNP	T	T	A	rs201928179		TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr14:33204952T>A	ENST00000280979.4	+	11	3406	c.3236T>A	c.(3235-3237)cTg>cAg	p.L1079Q	AKAP6_ENST00000557272.1_Missense_Mutation_p.L1079Q	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	1079					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		AGTGGAAGCCTGGTAAGGCAG	0.488																																					p.L1079Q	Melanoma(49;821 1200 7288 13647 42351)	Atlas-SNP	.											.	AKAP6	308	.	0			c.T3236A						PASS	.						70.0	72.0	71.0					14																	33204952		2203	4300	6503	SO:0001583	missense	9472	exon11			GAAGCCTGGTAAG	AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.3236T>A	chr14.hg19:g.33204952T>A	ENSP00000280979:p.Leu1079Gln	92.0	0.0	.		77.0	26.0	.	NM_004274	A7E242|A7E2D4|O15028	Missense_Mutation	SNP	ENST00000280979.4	hg19	CCDS9644.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.981383	0.74474	.	.	ENSG00000151320	ENST00000280979;ENST00000557272	T;T	0.22539	3.18;1.95	5.7	4.54	0.55810	.	0.118007	0.37809	N	0.001926	T	0.26629	0.0651	N	0.14661	0.345	0.44000	D	0.996707	D	0.71674	0.998	D	0.63488	0.915	T	0.07385	-1.0775	10	0.62326	D	0.03	-5.2892	12.8687	0.57953	0.0:0.0:0.1363:0.8637	.	1079	Q13023	AKAP6_HUMAN	Q	1079	ENSP00000280979:L1079Q;ENSP00000451247:L1079Q	ENSP00000280979:L1079Q	L	+	2	0	AKAP6	32274703	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.041000	0.76558	0.961000	0.38030	0.477000	0.44152	CTG	.	T|1.000;C|0.000	.	alt		0.488	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276617.2	NM_004274	
DAAM1	23002	hgsc.bcm.edu	37	14	59791109	59791109	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr14:59791109T>A	ENST00000395125.1	+	7	949	c.926T>A	c.(925-927)cTg>cAg	p.L309Q	DAAM1_ENST00000360909.3_Missense_Mutation_p.L309Q|DAAM1_ENST00000351081.1_Missense_Mutation_p.L309Q	NM_014992.2	NP_055807.1	Q9Y4D1	DAAM1_HUMAN	dishevelled associated activator of morphogenesis 1	309	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin cytoskeleton organization (GO:0030036)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	identical protein binding (GO:0042802)			breast(3)|cervix(3)|endometrium(5)|kidney(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.165)		TATGAATTTCTGATGTTAGGA	0.308																																					p.L309Q		Atlas-SNP	.											.	DAAM1	95	.	0			c.T926A						PASS	.						87.0	91.0	90.0					14																	59791109		2203	4300	6503	SO:0001583	missense	23002	exon8			AATTTCTGATGTT	AB014566	CCDS9737.1, CCDS58323.1	14q22.3	2008-08-11			ENSG00000100592	ENSG00000100592			18142	protein-coding gene	gene with protein product		606626				11779461, 18162551	Standard	NM_014992		Approved	KIAA0666	uc031qou.1	Q9Y4D1	OTTHUMG00000140326	ENST00000395125.1:c.926T>A	chr14.hg19:g.59791109T>A	ENSP00000378557:p.Leu309Gln	134.0	0.0	.		117.0	35.0	.	NM_001270520	Q86U34|Q8N1Z8|Q8TB39	Missense_Mutation	SNP	ENST00000395125.1	hg19	CCDS9737.1	.	.	.	.	.	.	.	.	.	.	T	17.20	3.330005	0.60743	.	.	ENSG00000100592	ENST00000360909;ENST00000351081;ENST00000358498;ENST00000395125	D;D;D	0.84516	-1.86;-1.86;-1.86	5.17	4.01	0.46588	GTPase-binding/formin homology 3 (1);Diaphanous FH3 (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.88377	0.6420	M	0.80508	2.5	0.80722	D	1	P;P	0.45634	0.835;0.863	P;P	0.49140	0.466;0.601	D	0.88524	0.3098	10	0.62326	D	0.03	.	12.2246	0.54453	0.0:0.0:0.1426:0.8574	.	309;309	Q9Y4D1-2;Q9Y4D1	.;DAAM1_HUMAN	Q	309	ENSP00000354162:L309Q;ENSP00000247170:L309Q;ENSP00000378557:L309Q	ENSP00000247170:L309Q	L	+	2	0	DAAM1	58860862	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.841000	0.86834	0.965000	0.38133	0.533000	0.62120	CTG	.	.	.	none		0.308	DAAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276942.2	NM_014992	
MGA	23269	hgsc.bcm.edu	37	15	42005411	42005411	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr15:42005411T>A	ENST00000570161.1	+	8	3147	c.3147T>A	c.(3145-3147)aaT>aaA	p.N1049K	MGA_ENST00000389936.4_Missense_Mutation_p.N1049K|MGA_ENST00000545763.1_Missense_Mutation_p.N1049K|MGA_ENST00000219905.7_Missense_Mutation_p.N1049K|MGA_ENST00000566586.1_Missense_Mutation_p.N1049K			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CCTGCAACAATGACTTCTGTC	0.463																																					p.N1049K		Atlas-SNP	.											.	MGA	264	.	0			c.T3147A						PASS	.						156.0	153.0	154.0					15																	42005411		1992	4139	6131	SO:0001583	missense	23269	exon9			CAACAATGACTTC	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.3147T>A	chr15.hg19:g.42005411T>A	ENSP00000457035:p.Asn1049Lys	132.0	0.0	.		117.0	32.0	.	NM_001080541	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000570161.1	hg19	CCDS55959.1	.	.	.	.	.	.	.	.	.	.	T	15.20	2.762234	0.49468	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	T;T;T	0.16457	2.34;2.34;2.34	5.75	3.24	0.37175	.	0.270326	0.40144	N	0.001172	T	0.15739	0.0379	N	0.14661	0.345	0.36995	D	0.894984	P;P	0.50272	0.933;0.533	P;B	0.56865	0.808;0.305	T	0.15983	-1.0418	10	0.44086	T	0.13	.	4.9526	0.14023	0.1341:0.1556:0.0:0.7103	.	1049;1049	F5H7K2;E7ENI0	.;.	K	1049	ENSP00000219905:N1049K;ENSP00000374586:N1049K;ENSP00000442467:N1049K	ENSP00000219905:N1049K	N	+	3	2	MGA	39792703	0.996000	0.38824	1.000000	0.80357	0.997000	0.91878	0.237000	0.17985	0.882000	0.36016	0.533000	0.62120	AAT	.	.	.	none		0.463	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1	
VPS13C	54832	hgsc.bcm.edu	37	15	62167108	62167108	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr15:62167108T>A	ENST00000261517.5	-	77	10454	c.10381A>T	c.(10381-10383)Att>Ttt	p.I3461F	VPS13C_ENST00000558919.1_5'Flank|VPS13C_ENST00000395898.3_Missense_Mutation_p.I3418F|VPS13C_ENST00000249837.3_Missense_Mutation_p.I3418F|VPS13C_ENST00000395896.4_Missense_Mutation_p.I3461F	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						CTCACTCCAATCACTAACCCC	0.303																																					p.I3461F		Atlas-SNP	.											.	VPS13C	506	.	0			c.A10381T						PASS	.						104.0	104.0	104.0					15																	62167108		2203	4300	6503	SO:0001583	missense	54832	exon77			CTCCAATCACTAA	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.10381A>T	chr15.hg19:g.62167108T>A	ENSP00000261517:p.Ile3461Phe	141.0	0.0	.		173.0	60.0	.	NM_020821		Missense_Mutation	SNP	ENST00000261517.5	hg19	CCDS32257.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.404605	0.83230	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.43294	0.95;0.95;1.12	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.56108	0.1963	L	0.40543	1.245	0.80722	D	1	D;D;D;D	0.69078	0.978;0.995;0.997;0.997	D;D;D;D	0.71656	0.923;0.962;0.974;0.92	T	0.56511	-0.7967	10	0.54805	T	0.06	.	16.1946	0.82018	0.0:0.0:0.0:1.0	.	3418;3461;3418;3461	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	F	3418;3461;3461;3461	ENSP00000249837:I3418F;ENSP00000261517:I3461F;ENSP00000379233:I3461F	ENSP00000249837:I3418F	I	-	1	0	VPS13C	59954400	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	4.402000	0.59722	2.228000	0.72767	0.528000	0.53228	ATT	.	.	.	none		0.303	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	NM_017684	
TP53	7157	hgsc.bcm.edu	37	17	7578190	7578190	+	Missense_Mutation	SNP	T	T	G	rs121912666		TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr17:7578190T>G	ENST00000269305.4	-	6	848	c.659A>C	c.(658-660)tAt>tCt	p.Y220S	TP53_ENST00000413465.2_Missense_Mutation_p.Y220S|TP53_ENST00000420246.2_Missense_Mutation_p.Y220S|TP53_ENST00000455263.2_Missense_Mutation_p.Y220S|TP53_ENST00000574684.1_Intron|TP53_ENST00000359597.4_Missense_Mutation_p.Y220S|TP53_ENST00000445888.2_Missense_Mutation_p.Y220S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	220	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:9450901}.|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y220C(278)|p.Y127C(24)|p.Y220S(12)|p.?(11)|p.0?(8)|p.D208fs*1(1)|p.Y220_P223delYEPP(1)|p.V218_E224delVPYEPPE(1)|p.V218_E221delVPYE(1)|p.Y127S(1)|p.V218_Y220delVPY(1)|p.Y220fs*25(1)|p.V216_Y220delVVVPY(1)|p.Y220fs*2(1)|p.V218fs*26(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGCGGCTCATAGGGCACCAC	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.Y220S	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,NS,carcinoma,0,1	TP53	33396	.	343	Substitution - Missense(315)|Unknown(11)|Whole gene deletion(8)|Deletion - In frame(5)|Deletion - Frameshift(3)|Insertion - Frameshift(1)	ovary(55)|breast(54)|lung(37)|upper_aerodigestive_tract(35)|urinary_tract(19)|oesophagus(19)|large_intestine(17)|liver(17)|central_nervous_system(16)|stomach(15)|haematopoietic_and_lymphoid_tissue(15)|endometrium(14)|soft_tissue(8)|biliary_tract(6)|bone(5)|pancreas(4)|prostate(4)|peritoneum(2)|small_intestine(1)	c.A659C	GRCh37	CM015378|CM951227	TP53	M	rs121912666	PASS	.						102.0	94.0	97.0					17																	7578190		2203	4300	6503	SO:0001583	missense	7157	exon6	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GGCTCATAGGGCA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.659A>C	chr17.hg19:g.7578190T>G	ENSP00000269305:p.Tyr220Ser	44.0	0.0	.		61.0	9.0	.	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.447753	0.84101	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99833	-7.03;-7.03;-7.03;-7.03;-7.03;-7.03;-7.03;-7.03	5.28	5.28	0.74379	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.89287	3.02	0.80722	A	1	D;D;D;D;D;D;D	0.89917	1.0;0.994;0.997;1.0;0.995;0.968;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.921;0.963;1.0;0.977;0.926;1.0	D	0.96735	0.9542	9	0.87932	D	0	-1.87	13.4753	0.61306	0.0:0.0:0.0:1.0	.	181;220;220;127;220;220;220	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	S	220;220;220;220;220;220;209;127;88;127	ENSP00000410739:Y220S;ENSP00000352610:Y220S;ENSP00000269305:Y220S;ENSP00000398846:Y220S;ENSP00000391127:Y220S;ENSP00000391478:Y220S;ENSP00000425104:Y88S;ENSP00000423862:Y127S	ENSP00000269305:Y220S	Y	-	2	0	TP53	7518915	1.000000	0.71417	0.585000	0.28666	0.993000	0.82548	6.232000	0.72313	2.128000	0.65567	0.460000	0.39030	TAT	.	.	.	weak		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
CHAD	1101	hgsc.bcm.edu	37	17	48546019	48546019	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr17:48546019C>A	ENST00000508540.1	-	1	308	c.156G>T	c.(154-156)aaG>aaT	p.K52N	ACSF2_ENST00000502667.1_Intron|ACSF2_ENST00000504392.1_Intron|ACSF2_ENST00000300441.4_Intron|CHAD_ENST00000258969.4_Missense_Mutation_p.K52N|ACSF2_ENST00000506085.1_Intron|ACSF2_ENST00000541920.1_Intron|ACSF2_ENST00000427954.2_Intron	NM_001267.2	NP_001258.2	O15335	CHAD_HUMAN	chondroadherin	52	LRRNT.				bone development (GO:0060348)|cartilage condensation (GO:0001502)|negative regulation of bone trabecula formation (GO:1900155)	proteinaceous extracellular matrix (GO:0005578)				central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(2)|ovary(2)	15	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			GCAGCTTGGTCTTCTCTGACA	0.622																																					p.K52N		Atlas-SNP	.											.	CHAD	36	.	0			c.G156T						PASS	.						92.0	77.0	82.0					17																	48546019		2203	4300	6503	SO:0001583	missense	1101	exon1			CTTGGTCTTCTCT	U96767	CCDS11568.1	17q21.33	2008-02-05			ENSG00000136457	ENSG00000136457		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	1909	protein-coding gene	gene with protein product	"""chondroadherin proteoglycan"""	602178				9344663	Standard	NM_001267		Approved	SLRR4A	uc010dbr.3	O15335	OTTHUMG00000162129	ENST00000508540.1:c.156G>T	chr17.hg19:g.48546019C>A	ENSP00000423812:p.Lys52Asn	70.0	0.0	.		86.0	17.0	.	NM_001267	A8K812|Q6GTU0|Q96RJ5	Missense_Mutation	SNP	ENST00000508540.1	hg19	CCDS11568.1	.	.	.	.	.	.	.	.	.	.	C	9.129	1.010904	0.19277	.	.	ENSG00000136457	ENST00000508540;ENST00000258969	T;T	0.04015	3.73;3.73	4.31	2.29	0.28610	Leucine-rich repeat-containing N-terminal (1);	0.490348	0.23123	N	0.051679	T	0.01835	0.0058	N	0.04018	-0.295	0.28724	N	0.902844	B	0.17465	0.022	B	0.14578	0.011	T	0.45086	-0.9285	10	0.09084	T	0.74	.	4.7213	0.12920	0.1537:0.601:0.0:0.2453	.	52	O15335	CHAD_HUMAN	N	52	ENSP00000423812:K52N;ENSP00000258969:K52N	ENSP00000258969:K52N	K	-	3	2	CHAD	45901018	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	1.268000	0.33062	0.442000	0.26555	0.462000	0.41574	AAG	.	.	.	none		0.622	CHAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367447.3	NM_001267	
RBPJL	11317	hgsc.bcm.edu	37	20	43940944	43940944	+	Silent	SNP	C	C	T			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr20:43940944C>T	ENST00000343694.3	+	6	600	c.528C>T	c.(526-528)cgC>cgT	p.R176R	RBPJL_ENST00000372741.3_Silent_p.R176R|RBPJL_ENST00000372743.1_Silent_p.R176R	NM_001281448.1|NM_001281449.1|NM_014276.2	NP_001268377.1|NP_001268378.1|NP_055091.2	Q9UBG7	RBPJL_HUMAN	recombination signal binding protein for immunoglobulin kappa J region-like	176					positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Myeloproliferative disorder(115;0.0122)				tggtgctgcgCGGGGGCCGGG	0.602																																					p.R176R		Atlas-SNP	.											RBPJL,NS,chondrosarcoma,0,1	RBPJL	67	.	0			c.C528T						PASS	.						28.0	31.0	30.0					20																	43940944		2203	4300	6503	SO:0001819	synonymous_variant	11317	exon6			GCTGCGCGGGGGC	AB024964	CCDS13349.1, CCDS63283.1, CCDS63284.1	20q13.12	2013-10-18	2007-02-26	2007-02-26	ENSG00000124232	ENSG00000124232			13761	protein-coding gene	gene with protein product			"""recombining binding protein suppressor of hairless (Drosophila)-like"""	RBPSUHL		9929984	Standard	NM_014276		Approved	RBP-L, SUH, SUHL	uc002xns.3	Q9UBG7	OTTHUMG00000033055	ENST00000343694.3:c.528C>T	chr20.hg19:g.43940944C>T		39.0	1.0	.		44.0	14.0	.	NM_014276	O95723|Q5QPU9|Q5QPV0|Q9ULV9	Silent	SNP	ENST00000343694.3	hg19	CCDS13349.1																																																																																			.	.	.	none		0.602	RBPJL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080391.1	NM_014276	
TOP3B	8940	hgsc.bcm.edu	37	22	22327036	22327036	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr22:22327036G>T	ENST00000398793.2	-	4	691	c.257C>A	c.(256-258)cCc>cAc	p.P86H	TOP3B_ENST00000357179.5_Missense_Mutation_p.P86H|TOP3B_ENST00000413067.2_5'UTR	NM_003935.3	NP_003926.1	O95985	TOP3B_HUMAN	topoisomerase (DNA) III beta	86	Toprim. {ECO:0000255|PROSITE- ProRule:PRU00995}.				chromosome segregation (GO:0007059)|DNA topological change (GO:0006265)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA topoisomerase activity (GO:0003916)|DNA topoisomerase type I activity (GO:0003917)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(4)|lung(9)|ovary(1)	26	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.145)		CTTCTCCGTGGGAGCTTGGCT	0.562											OREG0026347	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P86H		Atlas-SNP	.											.	TOP3B	107	.	0			c.C257A						PASS	.						155.0	123.0	134.0					22																	22327036		2203	4300	6503	SO:0001583	missense	8940	exon4			TCCGTGGGAGCTT	AF017146	CCDS13797.1	22q11.22	2011-05-24			ENSG00000100038	ENSG00000100038			11993	protein-coding gene	gene with protein product		603582				9786842, 9074928	Standard	XM_005261811		Approved		uc002zvs.3	O95985	OTTHUMG00000167438	ENST00000398793.2:c.257C>A	chr22.hg19:g.22327036G>T	ENSP00000381773:p.Pro86His	65.0	0.0	.	755	69.0	29.0	.	NM_003935	A0M8Q3|Q9BUP5	Missense_Mutation	SNP	ENST00000398793.2	hg19	CCDS13797.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.372315	0.82573	.	.	ENSG00000100038	ENST00000357179;ENST00000398793;ENST00000449517;ENST00000424393;ENST00000437929;ENST00000430142	T;T;T;T;T	0.21543	2.0;2.0;2.0;2.0;2.0	5.0	3.97	0.46021	DNA topoisomerase, type IA, core domain (1);Toprim domain (2);	0.052237	0.85682	D	0.000000	T	0.47563	0.1452	H	0.94620	3.56	0.80722	D	1	P	0.41848	0.763	P	0.48030	0.564	T	0.65166	-0.6234	10	0.87932	D	0	-8.5874	15.6079	0.76689	0.0:0.1378:0.8622:0.0	.	86	O95985	TOP3B_HUMAN	H	86	ENSP00000349705:P86H;ENSP00000381773:P86H;ENSP00000390977:P86H;ENSP00000402622:P86H;ENSP00000414538:P86H	ENSP00000349705:P86H	P	-	2	0	TOP3B	20657036	1.000000	0.71417	0.432000	0.26747	0.906000	0.53458	9.361000	0.97122	1.317000	0.45149	0.563000	0.77884	CCC	.	.	.	none		0.562	TOP3B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320251.1	NM_003935	
CABIN1	23523	hgsc.bcm.edu	37	22	24483456	24483456	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr22:24483456C>A	ENST00000398319.2	+	23	3700	c.3315C>A	c.(3313-3315)gaC>gaA	p.D1105E	CABIN1_ENST00000263119.5_Missense_Mutation_p.D1105E|CABIN1_ENST00000405822.2_Missense_Mutation_p.D1055E	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	1105					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						GCATTCAGGACAAGCTGAACT	0.547																																					p.D1105E		Atlas-SNP	.											.	CABIN1	153	.	0			c.C3315A						PASS	.						70.0	64.0	66.0					22																	24483456		2203	4300	6503	SO:0001583	missense	23523	exon23			TCAGGACAAGCTG	AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.3315C>A	chr22.hg19:g.24483456C>A	ENSP00000381364:p.Asp1105Glu	85.0	0.0	.		61.0	15.0	.	NM_001199281	G5E9F3|Q6PHY0|Q9Y460	Missense_Mutation	SNP	ENST00000398319.2	hg19	CCDS13823.1	.	.	.	.	.	.	.	.	.	.	C	16.53	3.149010	0.57151	.	.	ENSG00000099991	ENST00000263119;ENST00000405822;ENST00000398319	T;T;T	0.75477	-0.94;-0.94;-0.94	5.1	1.91	0.25777	Tetratricopeptide-like helical (1);	0.055118	0.64402	D	0.000001	T	0.54111	0.1838	L	0.27053	0.805	0.80722	D	1	P;P	0.40619	0.724;0.603	B;B	0.34452	0.183;0.089	T	0.42899	-0.9424	10	0.23302	T	0.38	.	9.3964	0.38406	0.0:0.7705:0.0:0.2295	.	1055;1105	G5E9F3;Q9Y6J0	.;CABIN_HUMAN	E	1105;1055;1105	ENSP00000263119:D1105E;ENSP00000384694:D1055E;ENSP00000381364:D1105E	ENSP00000263119:D1105E	D	+	3	2	CABIN1	22813456	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.242000	0.32755	0.299000	0.22661	0.650000	0.86243	GAC	.	.	.	none		0.547	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320161.2	NM_012295	
DDX53	168400	hgsc.bcm.edu	37	X	23019108	23019108	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chrX:23019108G>A	ENST00000327968.5	+	1	1022	c.934G>A	c.(934-936)Gtg>Atg	p.V312M	RP11-40F8.2_ENST00000455399.1_lincRNA	NM_182699.3	NP_874358.2	Q86TM3	DDX53_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 53	312	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|RNA binding (GO:0003723)			breast(2)|endometrium(5)|kidney(4)|large_intestine(3)|lung(15)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	35						GGCTCTTCACGTGGAAGCTGA	0.408													G|||	1	0.000264901	0.0008	0.0	3775	,	,		16112	0.0		0.0	False		,,,				2504	0.0				p.V312M		Atlas-SNP	.											.	DDX53	76	.	0			c.G934A						PASS	.						74.0	73.0	73.0					X																	23019108		2203	4300	6503	SO:0001583	missense	168400	exon1			CTTCACGTGGAAG	AY039237	CCDS35214.1	Xp22.13	2009-03-25			ENSG00000184735	ENSG00000184735		"""DEAD-boxes"""	20083	protein-coding gene	gene with protein product	"""cancer associated gene"", ""cancer/testis antigen 26"""						Standard	NM_182699		Approved	CAGE, CT26	uc004daj.3	Q86TM3	OTTHUMG00000021248	ENST00000327968.5:c.934G>A	chrX.hg19:g.23019108G>A	ENSP00000368667:p.Val312Met	68.0	0.0	.		64.0	36.0	.	NM_182699	Q0D2N2|Q6NVV4	Missense_Mutation	SNP	ENST00000327968.5	hg19	CCDS35214.1	.	.	.	.	.	.	.	.	.	.	G	9.356	1.066739	0.20067	.	.	ENSG00000184735	ENST00000327968	T	0.05139	3.49	4.3	1.28	0.21552	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.300009	0.31370	N	0.007767	T	0.24586	0.0596	M	0.91920	3.255	0.09310	N	1	D	0.89917	1.0	D	0.85130	0.997	T	0.02877	-1.1099	10	0.87932	D	0	-6.7638	4.8973	0.13757	0.2269:0.1801:0.593:0.0	.	312	Q86TM3	DDX53_HUMAN	M	312	ENSP00000368667:V312M	ENSP00000368667:V312M	V	+	1	0	DDX53	22929029	1.000000	0.71417	0.029000	0.17559	0.023000	0.10783	2.224000	0.42945	0.759000	0.33084	0.600000	0.82982	GTG	.	.	.	none		0.408	DDX53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056043.1	NM_182699	
ZNF559	84527	hgsc.bcm.edu	37	19	9452840	9452840	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr19:9452840delA	ENST00000393883.2	+	6	1361	c.713delA	c.(712-714)gaafs	p.E238fs	ZNF559_ENST00000592896.1_3'UTR|ZNF177_ENST00000602738.1_Intron|ZNF559_ENST00000538743.1_Frame_Shift_Del_p.E158fs|ZNF559_ENST00000603380.1_Frame_Shift_Del_p.E238fs|ZNF177_ENST00000541595.2_Intron|CTC-325H20.2_ENST00000592371.1_lincRNA|ZNF559_ENST00000586255.1_Intron|ZNF559_ENST00000317221.7_3'UTR|ZNF177_ENST00000605471.1_Intron|ZNF177_ENST00000446085.4_Intron|ZNF559_ENST00000587557.1_Frame_Shift_Del_p.E302fs|ZNF177_ENST00000602856.1_Intron	NM_001202412.1	NP_001189341.1	Q9BR84	ZN559_HUMAN	zinc finger protein 559	238					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|large_intestine(7)|lung(15)|ovary(1)|urinary_tract(1)	26						CAAGATGGAGAAAAATTCTAT	0.363																																					p.E302fs		Atlas-INDEL	.											.	ZNF559	77	.	0			c.904delG						PASS	.						77.0	79.0	79.0					19																	9452840		2201	4300	6501	SO:0001589	frameshift_variant	84527	exon6			.	AL389937	CCDS12211.1, CCDS59349.1, CCDS62531.1, CCDS62532.1	19p13.2	2013-09-20			ENSG00000188321	ENSG00000188321		"""Zinc fingers, C2H2-type"", ""-"""	28197	protein-coding gene	gene with protein product						12477932	Standard	NM_001202406		Approved	MGC13105	uc002mle.4	Q9BR84	OTTHUMG00000179942	ENST00000393883.2:c.713delA	chr19.hg19:g.9452840delA	ENSP00000377461:p.Glu238fs	106.0	0.0	0		110.0	38.0	0.345455	NM_001202406	K7EMG6	Frame_Shift_Del	DEL	ENST00000393883.2	hg19	CCDS12211.1																																																																																			.	.	.	none		0.363	ZNF559-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000449021.1	NM_032497	
ABHD16A	7920	hgsc.bcm.edu	37	6	31655645	31655646	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr6:31655645_31655646insG	ENST00000395952.3	-	17	1564_1565	c.1402_1403insC	c.(1402-1404)cgafs	p.R468fs	XXbac-BPG32J3.20_ENST00000461287.1_3'UTR|ABHD16A_ENST00000471644.1_5'UTR|ABHD16A_ENST00000440843.2_Frame_Shift_Ins_p.R435fs|ABHD16A_ENST00000375842.4_Frame_Shift_Ins_p.R249fs	NM_021160.2	NP_066983.1	O95870	ABHGA_HUMAN	abhydrolase domain containing 16A	468						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)	10						CCTCACCACTCGAAGACCCTCC	0.594																																					p.R468fs		Atlas-INDEL	.											.	ABHD16A	34	.	0			c.1403_1404insC						PASS	.																																			SO:0001589	frameshift_variant	7920	exon17			.	AF129756	CCDS4713.1, CCDS54988.1	6p21.3	2013-01-17	2010-12-09	2010-12-09	ENSG00000204427	ENSG00000204427		"""Abhydrolase domain containing"""	13921	protein-coding gene	gene with protein product		142620	"""HLA-B associated transcript 5"""	BAT5		2911734, 2813433	Standard	NM_021160		Approved	NG26, D6S82E	uc003nvy.2	O95870	OTTHUMG00000031177	ENST00000395952.3:c.1403dupC	chr6.hg19:g.31655646_31655646dupG	ENSP00000379282:p.Arg468fs	135.0	0.0	0		118.0	21.0	0.177966	NM_021160	A2BEY3|B7Z4R6|Q5SRR1|Q5SRR2|Q8WYH0|Q9NW33	Frame_Shift_Ins	INS	ENST00000395952.3	hg19	CCDS4713.1																																																																																			.	.	.	none		0.594	ABHD16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076342.4		
