#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
EMC1	23065	hgsc.bcm.edu	37	1	19545821	19545821	+	Silent	SNP	C	C	T			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr1:19545821C>T	ENST00000477853.1	-	23	3000	c.2958G>A	c.(2956-2958)aaG>aaA	p.K986K	RP1-43E13.2_ENST00000437898.1_RNA|EMC1_ENST00000480380.1_5'UTR|EMC1_ENST00000375208.3_Silent_p.K964K|EMC1_ENST00000375199.3_Silent_p.K985K	NM_001271427.1|NM_001271428.1|NM_015047.2	NP_001258356.1|NP_001258357.1|NP_055862.1	Q8N766	EMC1_HUMAN	ER membrane protein complex subunit 1	986						ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)											GATTCAGGAGCTTCACCTGTG	0.502																																					p.K986K		Atlas-SNP	.											.	.	.	.	0			c.G2958A						PASS	.						76.0	71.0	72.0					1																	19545821		2203	4300	6503	SO:0001819	synonymous_variant	23065	exon23			CAGGAGCTTCACC		CCDS190.1, CCDS59190.1, CCDS59191.1	1p36.13	2012-05-23	2012-05-23	2012-05-23	ENSG00000127463	ENSG00000127463			28957	protein-coding gene	gene with protein product			"""KIAA0090"""	KIAA0090		22119785	Standard	NM_015047		Approved		uc001bbo.4	Q8N766	OTTHUMG00000002497	ENST00000477853.1:c.2958G>A	chr1.hg19:g.19545821C>T		75.0	0.0	.		75.0	4.0	.	NM_015047	A8K6F3|Q14700|Q5TG62|Q63HL0|Q63HL3|Q8NBH8	Silent	SNP	ENST00000477853.1	hg19	CCDS190.1	.	.	.	.	.	.	.	.	.	.	C	9.326	1.059255	0.19987	.	.	ENSG00000127463	ENST00000375197	.	.	.	6.06	-0.986	0.10252	.	.	.	.	.	T	0.58977	0.2160	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56153	-0.8026	4	.	.	.	.	12.1403	0.53994	0.0:0.5935:0.0:0.4065	.	.	.	.	T	611	.	.	A	-	1	0	KIAA0090	19418408	0.934000	0.31675	0.995000	0.50966	0.993000	0.82548	0.012000	0.13287	-0.119000	0.11830	-0.312000	0.09012	GCT	.	.	.	none		0.502	EMC1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000007076.2	NM_015047	
KIF3C	3797	hgsc.bcm.edu	37	2	26203576	26203576	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr2:26203576G>A	ENST00000264712.3	-	1	1790	c.1211C>T	c.(1210-1212)cCc>cTc	p.P404L	KIF3C_ENST00000405914.1_Missense_Mutation_p.P404L	NM_002254.6	NP_002245	O14782	KIF3C_HUMAN	kinesin family member 3C	404					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle transport along microtubule (GO:0072384)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTTCCTCCGGGGCCGCTTCCC	0.652																																					p.P404L		Atlas-SNP	.											.	KIF3C	79	.	0			c.C1211T						PASS	.						46.0	48.0	47.0					2																	26203576		2203	4300	6503	SO:0001583	missense	3797	exon1			CTCCGGGGCCGCT		CCDS1719.1	2p23	2008-02-05			ENSG00000084731	ENSG00000084731		"""Kinesins"""	6321	protein-coding gene	gene with protein product		602845				9480755	Standard	NM_002254		Approved		uc002rgu.2	O14782	OTTHUMG00000094797	ENST00000264712.3:c.1211C>T	chr2.hg19:g.26203576G>A	ENSP00000264712:p.Pro404Leu	124.0	0.0	.		119.0	5.0	.	NM_002254	O43544|Q4ZG18|Q53SX5|Q562F7	Missense_Mutation	SNP	ENST00000264712.3	hg19	CCDS1719.1	.	.	.	.	.	.	.	.	.	.	G	8.691	0.907521	0.17833	.	.	ENSG00000084731	ENST00000264712;ENST00000542511;ENST00000405914	T;T	0.73258	-0.73;-0.73	5.0	4.04	0.47022	Kinesin, motor domain (1);	0.465840	0.23937	N	0.043100	T	0.46580	0.1400	N	0.12182	0.205	0.40162	D	0.977078	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.34453	-0.9828	10	0.27082	T	0.32	.	4.7743	0.13171	0.2331:0.0:0.7669:0.0	.	404;404	B7ZM25;O14782	.;KIF3C_HUMAN	L	404;210;404	ENSP00000264712:P404L;ENSP00000385030:P404L	ENSP00000264712:P404L	P	-	2	0	KIF3C	26057080	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	2.612000	0.46343	1.249000	0.43950	0.655000	0.94253	CCC	.	.	.	none		0.652	KIF3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211611.1		
SMPD4	55627	hgsc.bcm.edu	37	2	130931124	130931124	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr2:130931124C>T	ENST00000409031.1	-	4	1497	c.349G>A	c.(349-351)Gtg>Atg	p.V117M	SMPD4_ENST00000339679.7_Missense_Mutation_p.C29Y|SMPD4_ENST00000452225.2_Intron|SMPD4_ENST00000431183.2_Intron|SMPD4_ENST00000426662.2_Intron|SMPD4_ENST00000473720.1_Intron|SMPD4_ENST00000351288.6_Missense_Mutation_p.V117M|SMPD4_ENST00000453750.1_Intron|SMPD4_ENST00000443958.2_Intron	NM_017951.4	NP_060421.2	Q9NXE4	NSMA3_HUMAN	sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3)	78					cellular response to tumor necrosis factor (GO:0071356)|ceramide biosynthetic process (GO:0046513)|glycerophospholipid catabolic process (GO:0046475)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)|sphingomyelin phosphodiesterase D activity (GO:0050290)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(17)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29	Colorectal(110;0.1)				Phosphatidylserine(DB00144)	CTGTACTCCACAGGATTCACG	0.542																																					p.V117M		Atlas-SNP	.											.	SMPD4	67	.	0			c.G349A						PASS	.						59.0	54.0	56.0					2																	130931124		2203	4300	6503	SO:0001583	missense	55627	exon4			ACTCCACAGGATT	AF052134	CCDS2156.2, CCDS42751.1, CCDS54398.1	2q21.1	2009-11-06			ENSG00000136699	ENSG00000136699			32949	protein-coding gene	gene with protein product		610457				16517606	Standard	NM_001171083		Approved	FLJ20297, FLJ20756, nSMase-3, KIAA1418, NSMASE3, NET13	uc002tqr.2	Q9NXE4	OTTHUMG00000131624	ENST00000409031.1:c.349G>A	chr2.hg19:g.130931124C>T	ENSP00000386531:p.Val117Met	39.0	0.0	.		50.0	7.0	.	NM_017751	B4DM23|B4DQ31|B4DRB8|B4DWK7|B4E0L6|E7ESA2|E9PCE6|Q6FI76|Q6P1P7|Q6ZT43|Q9H0M2|Q9NW20|Q9NWL2|Q9P2C9	Missense_Mutation	SNP	ENST00000409031.1	hg19	CCDS42751.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	0.864|0.864	-0.734336|-0.734336	0.03111|0.03111	.|.	.|.	ENSG00000136699|ENSG00000136699	ENST00000339679|ENST00000351288;ENST00000409031;ENST00000441135	.|.	.|.	.|.	3.74|3.74	0.579|0.579	0.17397|0.17397	.|.	.|0.842482	.|0.10004	.|N	.|0.728107	T|T	0.30230|0.30230	0.0758|0.0758	L|L	0.43152|0.43152	1.355|1.355	0.09310|0.09310	N|N	1|1	B|B;B	0.02656|0.15719	0.0|0.014;0.007	B|B;B	0.01281|0.17098	0.0|0.017;0.008	T|T	0.27640|0.27640	-1.0068|-1.0068	8|9	0.22109|0.36615	T|T	0.4|0.2	.|.	3.3119|3.3119	0.07020|0.07020	0.0:0.4028:0.2084:0.3888|0.0:0.4028:0.2084:0.3888	.|.	29|78;117	B4E0T5|Q9NXE4;B1PBA3	.|NSMA3_HUMAN;.	Y|M	29|117;117;78	.|.	ENSP00000339721:C29Y|ENSP00000259217:V117M	C|V	-|-	2|1	0|0	SMPD4|SMPD4	130647594|130647594	0.367000|0.367000	0.25023|0.25023	0.045000|0.045000	0.18777|0.18777	0.188000|0.188000	0.23474|0.23474	1.298000|1.298000	0.33412|0.33412	0.248000|0.248000	0.21435|0.21435	0.455000|0.455000	0.32223|0.32223	TGT|GTG	.	.	.	none		0.542	SMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254516.3	NM_017751	
TRIM71	131405	hgsc.bcm.edu	37	3	32927537	32927537	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr3:32927537C>A	ENST00000383763.5	+	3	1195	c.1132C>A	c.(1132-1134)Cgc>Agc	p.R378S		NM_001039111.1	NP_001034200.1	Q2Q1W2	LIN41_HUMAN	tripartite motif containing 71, E3 ubiquitin protein ligase	378					fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|miRNA metabolic process (GO:0010586)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|positive regulation of gene silencing by miRNA (GO:2000637)|protein autoubiquitination (GO:0051865)|regulation of gene silencing by miRNA (GO:0060964)|regulation of neural precursor cell proliferation (GO:2000177)|stem cell proliferation (GO:0072089)	cytoplasmic mRNA processing body (GO:0000932)	ligase activity (GO:0016874)|miRNA binding (GO:0035198)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CCTGGAGGAACGCGAGTGTGA	0.612																																					p.R378S		Atlas-SNP	.											TRIM71,NS,carcinoma,0,1	TRIM71	73	.	0			c.C1132A						PASS	.						74.0	85.0	81.0					3																	32927537		2153	4244	6397	SO:0001583	missense	131405	exon3			GAGGAACGCGAGT		CCDS43060.1	3p22.3	2014-02-17	2012-02-29		ENSG00000206557	ENSG00000206557		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	32669	protein-coding gene	gene with protein product			"""tripartite motif-containing 71"", ""tripartite motif containing 71"""				Standard	NM_001039111		Approved	LIN41, LIN-41	uc003cff.3	Q2Q1W2	OTTHUMG00000155778	ENST00000383763.5:c.1132C>A	chr3.hg19:g.32927537C>A	ENSP00000373272:p.Arg378Ser	50.0	0.0	.		65.0	3.0	.	NM_001039111		Missense_Mutation	SNP	ENST00000383763.5	hg19	CCDS43060.1	.	.	.	.	.	.	.	.	.	.	C	18.39	3.613528	0.66672	.	.	ENSG00000206557	ENST00000383763	D	0.85171	-1.95	5.0	2.98	0.34508	.	0.000000	0.85682	D	0.000000	T	0.82162	0.4977	N	0.24115	0.695	0.80722	D	1	D	0.69078	0.997	P	0.54815	0.761	D	0.84124	0.0408	10	0.72032	D	0.01	-29.8714	12.0485	0.53493	0.3404:0.6596:0.0:0.0	.	378	Q2Q1W2	LIN41_HUMAN	S	378	ENSP00000373272:R378S	ENSP00000373272:R378S	R	+	1	0	TRIM71	32902541	0.999000	0.42202	0.998000	0.56505	0.688000	0.40055	0.771000	0.26633	2.318000	0.78349	0.462000	0.41574	CGC	.	.	.	none		0.612	TRIM71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341565.3	NM_001039111	
ENTPD3	956	hgsc.bcm.edu	37	3	40465427	40465427	+	Silent	SNP	T	T	A			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr3:40465427T>A	ENST00000301825.3	+	10	1444	c.1326T>A	c.(1324-1326)acT>acA	p.T442T	ENTPD3-AS1_ENST00000452768.1_RNA|ENTPD3-AS1_ENST00000439293.1_RNA|ENTPD3-AS1_ENST00000425156.1_RNA|ENTPD3_ENST00000456402.1_Silent_p.T442T|ENTPD3_ENST00000445129.1_Silent_p.T442T	NM_001248.2	NP_001239.2	O75355	ENTP3_HUMAN	ectonucleoside triphosphate diphosphohydrolase 3	442					nucleoside diphosphate catabolic process (GO:0009134)|nucleoside triphosphate catabolic process (GO:0009143)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)			endometrium(1)|kidney(3)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				KIRC - Kidney renal clear cell carcinoma(284;0.0605)|Kidney(284;0.0758)		CAGAGGAGACTTGGCCCCAAA	0.408																																					p.T442T		Atlas-SNP	.											.	ENTPD3	48	.	0			c.T1326A						PASS	.						118.0	109.0	112.0					3																	40465427		2203	4300	6503	SO:0001819	synonymous_variant	956	exon10			GGAGACTTGGCCC	AF039917	CCDS2691.1, CCDS74919.1	3p21.3	2004-02-26			ENSG00000168032	ENSG00000168032			3365	protein-coding gene	gene with protein product		603161		CD39L3		9676430	Standard	XM_005265605		Approved	NTPDase-3, HB6	uc003ckd.4	O75355	OTTHUMG00000131390	ENST00000301825.3:c.1326T>A	chr3.hg19:g.40465427T>A		141.0	0.0	.		179.0	9.0	.	NM_001248	B2R8D0|G5E9N0|O60495|Q8N6K2	Silent	SNP	ENST00000301825.3	hg19	CCDS2691.1																																																																																			.	.	.	none		0.408	ENTPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254179.2	NM_001248	
CENPC	1060	hgsc.bcm.edu	37	4	68338326	68338326	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr4:68338326T>A	ENST00000273853.6	-	19	3079	c.2829A>T	c.(2827-2829)agA>agT	p.R943S		NM_001812.2	NP_001803.2	Q03188	CENPC_HUMAN	centromere protein C	943	MIF2 homology domain III.				chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	centromeric DNA binding (GO:0019237)|DNA binding (GO:0003677)										TGATCTTTCATCTTTTTATCT	0.249																																					p.R943S		Atlas-SNP	.											.	CENPC1	66	.	0			c.A2829T						PASS	.						25.0	23.0	24.0					4																	68338326		1675	3879	5554	SO:0001583	missense	1060	exon19			CTTTCATCTTTTT	M95724	CCDS47063.1	4q13.2	2013-11-05	2013-07-03	2013-07-03	ENSG00000145241	ENSG00000145241			1854	protein-coding gene	gene with protein product		117141	"""centromere protein C 1"""	CENPC1		7959789	Standard	XR_245245		Approved	CENP-C, hcp-4, MIF2	uc003hdd.1	Q03188	OTTHUMG00000160735	ENST00000273853.6:c.2829A>T	chr4.hg19:g.68338326T>A	ENSP00000273853:p.Arg943Ser	2.0	0.0	.		9.0	8.0	.	NM_001812	Q8IW27|Q9P0M5	Missense_Mutation	SNP	ENST00000273853.6	hg19	CCDS47063.1	.	.	.	.	.	.	.	.	.	.	T	16.45	3.126153	0.56721	.	.	ENSG00000145241	ENST00000273853	.	.	.	3.59	-2.03	0.07365	.	0.474882	0.18938	N	0.127023	T	0.15478	0.0373	N	0.12182	0.205	0.27738	N	0.944564	B	0.19445	0.036	B	0.12837	0.008	T	0.07693	-1.0759	9	0.72032	D	0.01	.	3.7757	0.08659	0.5677:0.1197:0.0:0.3126	.	943	Q03188	CENPC_HUMAN	S	943	.	ENSP00000273853:R943S	R	-	3	2	CENPC1	68020921	0.998000	0.40836	0.995000	0.50966	0.790000	0.44656	0.133000	0.15912	-0.350000	0.08262	0.402000	0.26972	AGA	.	.	.	none		0.249	CENPC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362001.2		
KIAA1109	84162	hgsc.bcm.edu	37	4	123264653	123264653	+	Silent	SNP	C	C	G			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr4:123264653C>G	ENST00000264501.4	+	73	12814	c.12441C>G	c.(12439-12441)ggC>ggG	p.G4147G	KIAA1109_ENST00000388738.3_Silent_p.G4147G			Q2LD37	K1109_HUMAN	KIAA1109	4147	Ser-rich.				regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						GTTCATCTGGCTTGAGCTTCA	0.478																																					p.G4147G		Atlas-SNP	.											.	KIAA1109	424	.	0			c.C12441G						PASS	.						121.0	111.0	114.0					4																	123264653		1972	4163	6135	SO:0001819	synonymous_variant	84162	exon71			ATCTGGCTTGAGC	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.12441C>G	chr4.hg19:g.123264653C>G		111.0	0.0	.		91.0	7.0	.	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Silent	SNP	ENST00000264501.4	hg19	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.957|8.957	0.969706|0.969706	0.18659|0.18659	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000306802|ENST00000442707	.|.	.|.	.|.	5.78|5.78	-3.62|-3.62	0.04543|0.04543	.|.	.|.	.|.	.|.	.|.	T|T	0.40767|0.40767	0.1130|0.1130	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.37337|0.37337	-0.9710|-0.9710	4|4	.|.	.|.	.|.	.|.	4.0748|4.0748	0.09899|0.09899	0.0995:0.2869:0.4148:0.1987|0.0995:0.2869:0.4148:0.1987	.|.	.|.	.|.	.|.	G|V	523|93	.|.	.|.	A|L	+|+	2|1	0|0	KIAA1109|KIAA1109	123484103|123484103	0.019000|0.019000	0.18553|0.18553	0.092000|0.092000	0.20876|0.20876	0.981000|0.981000	0.71138|0.71138	-0.715000|-0.715000	0.04997|0.04997	-0.295000|-0.295000	0.08960|0.08960	0.591000|0.591000	0.81541|0.81541	GCT|CTT	.	.	.	none		0.478	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
PCDHA9	9752	hgsc.bcm.edu	37	5	140229899	140229899	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr5:140229899C>T	ENST00000532602.1	+	1	2852	c.1819C>T	c.(1819-1821)Ctt>Ttt	p.L607F	PCDHA9_ENST00000378122.3_Missense_Mutation_p.L607F|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	607	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAACGCGTGGCTTTCATACGA	0.672																																					p.L607F	Melanoma(55;1800 1972 14909)	Atlas-SNP	.											.	PCDHA9	373	.	0			c.C1819T						PASS	.						64.0	70.0	68.0					5																	140229899		2196	4268	6464	SO:0001583	missense	9752	exon1			GCGTGGCTTTCAT	AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.1819C>T	chr5.hg19:g.140229899C>T	ENSP00000436042:p.Leu607Phe	82.0	0.0	.		110.0	9.0	.	NM_031857	O15053|Q2M3S5	Missense_Mutation	SNP	ENST00000532602.1	hg19	CCDS54920.1	.	.	.	.	.	.	.	.	.	.	C	14.38	2.518012	0.44763	.	.	ENSG00000204961	ENST00000532602;ENST00000378122	T;T	0.53640	0.61;0.61	3.36	3.36	0.38483	Cadherin (4);Cadherin-like (1);	0.000000	0.26156	U	0.026019	T	0.70544	0.3236	M	0.89478	3.035	0.28601	N	0.909177	D;D	0.89917	1.0;1.0	D;D	0.91635	0.993;0.999	T	0.66756	-0.5843	10	0.87932	D	0	.	11.3375	0.49513	0.0:0.8154:0.1846:0.0	.	607;607	Q9Y5H5;Q9Y5H5-2	PCDA9_HUMAN;.	F	607	ENSP00000436042:L607F;ENSP00000367362:L607F	ENSP00000367362:L607F	L	+	1	0	PCDHA9	140210083	0.962000	0.33011	1.000000	0.80357	0.276000	0.26787	0.080000	0.14802	1.839000	0.53478	0.313000	0.20887	CTT	.	.	.	none		0.672	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372896.2	NM_031857	
KCNB2	9312	hgsc.bcm.edu	37	8	73850210	73850210	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr8:73850210G>T	ENST00000523207.1	+	3	3208	c.2620G>T	c.(2620-2622)Gtc>Ttc	p.V874F		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	874					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	TGTGAGTGAAGTCAAAAAGGA	0.493																																					p.V874F		Atlas-SNP	.											.	KCNB2	228	.	0			c.G2620T						PASS	.						94.0	91.0	92.0					8																	73850210		2203	4300	6503	SO:0001583	missense	9312	exon3			AGTGAAGTCAAAA	U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.2620G>T	chr8.hg19:g.73850210G>T	ENSP00000430846:p.Val874Phe	98.0	0.0	.		112.0	5.0	.	NM_004770	Q7Z7D0|Q9BXD3	Missense_Mutation	SNP	ENST00000523207.1	hg19	CCDS6209.1	.	.	.	.	.	.	.	.	.	.	G	8.944	0.966598	0.18659	.	.	ENSG00000182674	ENST00000523207	D	0.97303	-4.33	5.46	3.64	0.41730	.	1.710450	0.04454	U	0.373160	D	0.93805	0.8019	L	0.29908	0.895	0.23994	N	0.996234	B	0.19445	0.036	B	0.15052	0.012	D	0.85473	0.1174	10	0.45353	T	0.12	.	6.0774	0.19923	0.0712:0.1353:0.6532:0.1403	.	874	Q92953	KCNB2_HUMAN	F	874	ENSP00000430846:V874F	ENSP00000430846:V874F	V	+	1	0	KCNB2	74012764	0.805000	0.28982	0.063000	0.19743	0.690000	0.40134	1.546000	0.36179	0.841000	0.35020	0.591000	0.81541	GTC	.	.	.	none		0.493	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1	NM_004770	
TMEM2	23670	hgsc.bcm.edu	37	9	74300679	74300679	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr9:74300679G>C	ENST00000377044.4	-	23	4474	c.3935C>G	c.(3934-3936)cCa>cGa	p.P1312R	TMEM2_ENST00000377066.5_Missense_Mutation_p.P1249R|TMEM2_ENST00000396272.3_Missense_Mutation_p.P305R	NM_001135820.1|NM_013390.2	NP_001129292.1|NP_037522.1	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2	1312					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(15)|liver(1)|lung(19)|ovary(2)|prostate(5)|skin(1)|stomach(1)|urinary_tract(2)	56		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		AAGATGAGCTGGTTTGGCTAA	0.373																																					p.P1312R		Atlas-SNP	.											.	TMEM2	112	.	0			c.C3935G						PASS	.						115.0	107.0	110.0					9																	74300679		2203	4300	6503	SO:0001583	missense	23670	exon23			TGAGCTGGTTTGG		CCDS6638.1, CCDS47979.1	9q21.13	2011-07-19			ENSG00000135048	ENSG00000135048			11869	protein-coding gene	gene with protein product		605835					Standard	NM_013390		Approved		uc011lsa.1	Q9UHN6	OTTHUMG00000020000	ENST00000377044.4:c.3935C>G	chr9.hg19:g.74300679G>C	ENSP00000366243:p.Pro1312Arg	107.0	0.0	.		106.0	8.0	.	NM_013390	A6H8W9|B2RTQ6|Q5T838|Q5T839|Q5T840|Q5T841|Q8NBP6|Q9P2D5	Missense_Mutation	SNP	ENST00000377044.4	hg19	CCDS6638.1	.	.	.	.	.	.	.	.	.	.	G	18.12	3.553987	0.65425	.	.	ENSG00000135048	ENST00000377044;ENST00000377066;ENST00000396272	T;T;T	0.73469	-0.75;-0.68;2.49	5.78	5.78	0.91487	.	0.109175	0.64402	D	0.000005	T	0.78842	0.4347	M	0.61703	1.905	0.48087	D	0.999587	P;P	0.47604	0.836;0.898	B;P	0.47299	0.342;0.543	T	0.79548	-0.1758	10	0.52906	T	0.07	.	19.6126	0.95616	0.0:0.0:1.0:0.0	.	1312;1249	Q9UHN6;Q9UHN6-2	TMEM2_HUMAN;.	R	1312;1249;305	ENSP00000366243:P1312R;ENSP00000366266:P1249R;ENSP00000379569:P305R	ENSP00000366243:P1312R	P	-	2	0	TMEM2	73490499	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.685000	0.74543	2.730000	0.93505	0.650000	0.86243	CCA	.	.	.	none		0.373	TMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052618.2	NM_013390	
TDRD1	56165	hgsc.bcm.edu	37	10	115978231	115978231	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr10:115978231A>T	ENST00000369280.1	+	18	2842	c.2382A>T	c.(2380-2382)aaA>aaT	p.K794N	TDRD1_ENST00000422662.1_Missense_Mutation_p.K398N|TDRD1_ENST00000369281.2_Intron|TDRD1_ENST00000369282.1_Missense_Mutation_p.K794N|TDRD1_ENST00000251864.2_Missense_Mutation_p.K794N			Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	794	Tudor 3. {ECO:0000255|PROSITE- ProRule:PRU00211}.				DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ cell development (GO:0007281)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)	metal ion binding (GO:0046872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(5)	48		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		GACATGTTAAAGTACATTTTG	0.373																																					p.K794N		Atlas-SNP	.											.	TDRD1	126	.	0			c.A2382T						PASS	.						202.0	183.0	190.0					10																	115978231		2203	4300	6503	SO:0001583	missense	56165	exon18			TGTTAAAGTACAT	AF285606	CCDS7588.1	10q26.11	2013-01-23			ENSG00000095627	ENSG00000095627		"""Tudor domain containing"""	11712	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.1"""	605796				11279525	Standard	NM_198795		Approved	CT41.1	uc001lbg.1	Q9BXT4	OTTHUMG00000019083	ENST00000369280.1:c.2382A>T	chr10.hg19:g.115978231A>T	ENSP00000358286:p.Lys794Asn	196.0	0.0	.		195.0	13.0	.	NM_198795	A6NEN3|A6NMN2|B3KVI4|B4E2L5|D3DRC2|Q4G0Y8|Q6P518|Q9H7B3	Missense_Mutation	SNP	ENST00000369280.1	hg19		.	.	.	.	.	.	.	.	.	.	A	16.91	3.252942	0.59212	.	.	ENSG00000095627	ENST00000369282;ENST00000251864;ENST00000422662;ENST00000369280	T;T;T;T	0.10192	2.9;2.9;2.9;2.9	5.93	4.8	0.61643	Tudor subgroup (1);Maternal tudor protein (1);Tudor domain (1);	0.542996	0.21329	N	0.076323	T	0.28466	0.0704	M	0.63843	1.955	0.38193	D	0.939969	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.91635	0.95;0.998;0.999	T	0.03981	-1.0987	10	0.62326	D	0.03	-24.3657	10.4344	0.44426	0.9269:0.0:0.0731:0.0	.	398;794;794	Q9BXT4-4;Q9BXT4;Q9BXT4-3	.;TDRD1_HUMAN;.	N	794;794;398;794	ENSP00000358288:K794N;ENSP00000251864:K794N;ENSP00000402794:K398N;ENSP00000358286:K794N	ENSP00000251864:K794N	K	+	3	2	TDRD1	115968221	0.923000	0.31300	0.942000	0.38095	0.647000	0.38526	1.723000	0.38053	1.082000	0.41137	0.533000	0.62120	AAA	.	.	.	none		0.373	TDRD1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050457.2		
MMP21	118856	hgsc.bcm.edu	37	10	127459092	127459092	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr10:127459092C>T	ENST00000368808.3	-	5	1047	c.1048G>A	c.(1048-1050)Gtg>Atg	p.V350M		NM_147191.1	NP_671724.1	Q8N119	MMP21_HUMAN	matrix metallopeptidase 21	350					hematopoietic progenitor cell differentiation (GO:0002244)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|urinary_tract(1)	16		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)			Marimastat(DB00786)	CTCACCATCACCTCTCCATAT	0.413																																					p.V350M		Atlas-SNP	.											.	MMP21	46	.	0			c.G1048A						PASS	.						191.0	172.0	178.0					10																	127459092		2203	4300	6503	SO:0001583	missense	118856	exon5			CCATCACCTCTCC	AF331526	CCDS7647.1	10q26.3	2008-07-28	2005-08-08		ENSG00000154485	ENSG00000154485			14357	protein-coding gene	gene with protein product		608416	"""matrix metalloproteinase 21"""			11255011	Standard	NM_147191		Approved		uc001liu.3	Q8N119	OTTHUMG00000019235	ENST00000368808.3:c.1048G>A	chr10.hg19:g.127459092C>T	ENSP00000357798:p.Val350Met	108.0	0.0	.		148.0	8.0	.	NM_147191	Q5VZP9|Q8NG02	Missense_Mutation	SNP	ENST00000368808.3	hg19	CCDS7647.1	.	.	.	.	.	.	.	.	.	.	C	13.20	2.165493	0.38217	.	.	ENSG00000154485	ENST00000368808	T	0.20332	2.08	5.62	-0.228	0.13098	Hemopexin/matrixin (2);	0.651830	0.14795	N	0.297980	T	0.12987	0.0315	N	0.22421	0.69	0.09310	N	1	B	0.19935	0.04	B	0.15484	0.013	T	0.21793	-1.0235	10	0.59425	D	0.04	-28.7392	9.267	0.37647	0.0:0.2518:0.5805:0.1677	.	350	Q8N119	MMP21_HUMAN	M	350	ENSP00000357798:V350M	ENSP00000357798:V350M	V	-	1	0	MMP21	127449082	0.001000	0.12720	0.000000	0.03702	0.638000	0.38207	-0.056000	0.11787	-0.027000	0.13873	-0.150000	0.13652	GTG	.	.	.	none		0.413	MMP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050928.1		
DCPS	28960	hgsc.bcm.edu	37	11	126201299	126201299	+	Splice_Site	SNP	G	G	T			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr11:126201299G>T	ENST00000263579.4	+	3	705		c.e3-1		DCPS_ENST00000530860.1_3'UTR	NM_014026.3	NP_054745.1	Q96C86	DCPS_HUMAN	decapping enzyme, scavenger						cellular response to menadione (GO:0036245)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA cis splicing, via spliceosome (GO:0045292)|mRNA metabolic process (GO:0016071)|negative regulation of programmed cell death (GO:0043069)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	m7G(5')pppN diphosphatase activity (GO:0050072)|RNA 7-methylguanosine cap binding (GO:0000340)			endometrium(3)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17	all_hematologic(175;0.145)	Breast(109;0.00156)|Lung NSC(97;0.00949)|all_lung(97;0.0101)|Medulloblastoma(222;0.0425)|all_neural(223;0.0604)		BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.08)		TATCATTGCAGATGTAAAGAC	0.567																																					.		Atlas-SNP	.											.	DCPS	33	.	0			c.377-1G>T						PASS	.						137.0	131.0	133.0					11																	126201299		2201	4298	6499	SO:0001630	splice_region_variant	28960	exon3			ATTGCAGATGTAA	AF077201	CCDS8473.1	11q24	2008-02-05			ENSG00000110063	ENSG00000110063			29812	protein-coding gene	gene with protein product		610534				12198172, 14523240	Standard	NM_014026		Approved	HSPC015, HINT-5, HSL1	uc001qdp.3	Q96C86	OTTHUMG00000165829	ENST00000263579.4:c.377-1G>T	chr11.hg19:g.126201299G>T		191.0	0.0	.		200.0	12.0	.	NM_014026	Q8NHL8|Q9Y2S5	Splice_Site	SNP	ENST00000263579.4	hg19	CCDS8473.1	.	.	.	.	.	.	.	.	.	.	G	14.60	2.584618	0.46110	.	.	ENSG00000110063	ENST00000263579	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9226	0.92530	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DCPS	125706509	1.000000	0.71417	0.996000	0.52242	0.450000	0.32258	8.744000	0.91596	2.778000	0.95560	0.655000	0.94253	.	.	.	.	none		0.567	DCPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386455.1	NM_014026	Intron
KRAS	3845	hgsc.bcm.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12D	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Atlas-SNP	.		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS_ENST00000256078,NS,adenocarcinoma,0,66	KRAS	30930	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35A						PASS	.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	ACGCCACCAGCTC	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	36.0	0.0	.		40.0	13.0	.	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	hg19	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	.	.	.	weak		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
OR10AD1	121275	hgsc.bcm.edu	37	12	48596939	48596939	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr12:48596939A>G	ENST00000310248.2	-	1	231	c.137T>C	c.(136-138)aTc>aCc	p.I46T		NM_001004134.1	NP_001004134.1	Q8NGE0	O10AD_HUMAN	olfactory receptor, family 10, subfamily AD, member 1	46						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|stomach(1)|urinary_tract(1)	9						GGTGATAAAGATGATGAGGCC	0.542																																					p.I46T		Atlas-SNP	.											.	OR10AD1	24	.	0			c.T137C						PASS	.						96.0	81.0	86.0					12																	48596939		2203	4300	6503	SO:0001583	missense	121275	exon1			ATAAAGATGATGA		CCDS31787.1	12q13.11	2013-09-24	2002-11-13	2002-11-15	ENSG00000172640	ENSG00000172640		"""GPCR / Class A : Olfactory receptors"""	14819	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily AD, member 1 pseudogene"""	OR10AD1P			Standard	NM_001004134		Approved		uc001rrl.1	Q8NGE0	OTTHUMG00000168027	ENST00000310248.2:c.137T>C	chr12.hg19:g.48596939A>G	ENSP00000308689:p.Ile46Thr	45.0	0.0	.		53.0	5.0	.	NM_001004134	B9EGT9|Q6IFA8	Missense_Mutation	SNP	ENST00000310248.2	hg19	CCDS31787.1	.	.	.	.	.	.	.	.	.	.	A	15.20	2.762337	0.49468	.	.	ENSG00000172640	ENST00000310248	T	0.00531	6.76	4.97	4.97	0.65823	GPCR, rhodopsin-like superfamily (1);	0.189939	0.25929	N	0.027383	T	0.01061	0.0035	M	0.79475	2.455	0.33098	D	0.53878	D	0.59357	0.985	P	0.50537	0.643	T	0.47586	-0.9106	10	0.72032	D	0.01	-30.4283	12.9182	0.58216	1.0:0.0:0.0:0.0	.	46	Q8NGE0	O10AD_HUMAN	T	46	ENSP00000308689:I46T	ENSP00000308689:I46T	I	-	2	0	OR10AD1	46883206	0.910000	0.30920	1.000000	0.80357	0.519000	0.34347	6.493000	0.73658	2.213000	0.71641	0.533000	0.62120	ATC	.	.	.	none		0.542	OR10AD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397577.1		
STON2	85439	hgsc.bcm.edu	37	14	81862455	81862455	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr14:81862455C>G	ENST00000267540.2	-	2	356	c.156G>C	c.(154-156)gaG>gaC	p.E52D	STON2_ENST00000555447.1_Missense_Mutation_p.E52D	NM_033104.3	NP_149095.2	Q8WXE9	STON2_HUMAN	stonin 2	52					hematopoietic progenitor cell differentiation (GO:0002244)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleolus (GO:0005730)|synaptic vesicle (GO:0008021)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|pancreas(2)|prostate(1)|skin(5)	34				BRCA - Breast invasive adenocarcinoma(234;0.0348)		CCACATGGTTCTCCCCGGAGG	0.577																																					p.E52D		Atlas-SNP	.											.	STON2	94	.	0			c.G156C						PASS	.						71.0	64.0	66.0					14																	81862455		2203	4300	6503	SO:0001583	missense	85439	exon4			ATGGTTCTCCCCG	AB208948	CCDS9875.1, CCDS58332.1	14q31.1	2007-08-01				ENSG00000140022			30652	protein-coding gene	gene with protein product	"""stoned B homolog 2 (Drosophila)"""	608467				11381094, 11454741	Standard	NM_033104		Approved	STNB2, STN2	uc001xvk.2	Q8WXE9		ENST00000267540.2:c.156G>C	chr14.hg19:g.81862455C>G	ENSP00000267540:p.Glu52Asp	90.0	0.0	.		82.0	7.0	.	NM_001256430	G3V2T7|Q17R24|Q59H11|Q6NT47|Q96RI7|Q96RU6	Missense_Mutation	SNP	ENST00000267540.2	hg19	CCDS9875.1	.	.	.	.	.	.	.	.	.	.	C	15.79	2.938177	0.52972	.	.	ENSG00000140022	ENST00000555447;ENST00000546306;ENST00000267540	T;T	0.54866	0.55;0.55	5.8	1.95	0.26073	Stonin-2, N-terminal (1);	0.362161	0.29040	N	0.013335	T	0.44456	0.1294	L	0.59436	1.845	0.23309	N	0.997936	P;B;P	0.35714	0.517;0.334;0.461	B;B;B	0.36504	0.226;0.122;0.145	T	0.43702	-0.9375	10	0.87932	D	0	-12.0903	5.4312	0.16454	0.0:0.4999:0.2873:0.2127	.	52;52;52	Q8WXE9;Q17R23;G3V2T7	STON2_HUMAN;.;.	D	52;64;52	ENSP00000450857:E52D;ENSP00000267540:E52D	ENSP00000267540:E52D	E	-	3	2	STON2	80932208	0.910000	0.30920	0.991000	0.47740	0.836000	0.47400	-0.309000	0.08145	0.801000	0.34066	-0.179000	0.13096	GAG	.	.	.	none		0.577	STON2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413317.1	NM_033104	
MFAP1	4236	hgsc.bcm.edu	37	15	44109600	44109600	+	Silent	SNP	T	T	G			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr15:44109600T>G	ENST00000267812.3	-	2	358	c.126A>C	c.(124-126)ggA>ggC	p.G42G		NM_005926.2	NP_005917.2	P55081	MFAP1_HUMAN	microfibrillar-associated protein 1	42					extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|microfibril (GO:0001527)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(1)|lung(6)|skin(2)|upper_aerodigestive_tract(3)	15		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.33e-07)		CTGGCCTTTTTCCGGACACAT	0.433																																					p.G42G		Atlas-SNP	.											.	MFAP1	36	.	0			c.A126C						PASS	.						128.0	118.0	121.0					15																	44109600		2198	4298	6496	SO:0001819	synonymous_variant	4236	exon2			CCTTTTTCCGGAC		CCDS10105.1	15q15-q21	2014-05-20			ENSG00000140259	ENSG00000140259			7032	protein-coding gene	gene with protein product		600215				7835894	Standard	NM_005926		Approved		uc001zth.1	P55081	OTTHUMG00000060145	ENST00000267812.3:c.126A>C	chr15.hg19:g.44109600T>G		184.0	0.0	.		214.0	12.0	.	NM_005926	Q86TG6	Silent	SNP	ENST00000267812.3	hg19	CCDS10105.1																																																																																			.	.	.	none		0.433	MFAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133491.2	NM_005926	
RBBP8	5932	hgsc.bcm.edu	37	18	20573491	20573491	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr18:20573491C>G	ENST00000399722.2	+	11	2052	c.1701C>G	c.(1699-1701)tgC>tgG	p.C567W	RBBP8_ENST00000327155.5_Missense_Mutation_p.C567W|RBBP8_ENST00000399725.2_Missense_Mutation_p.C567W|RBBP8_ENST00000360790.5_Missense_Mutation_p.C567W	NM_203291.1	NP_976036.1	Q99708	COM1_HUMAN	retinoblastoma binding protein 8	567					blastocyst hatching (GO:0001835)|cell cycle checkpoint (GO:0000075)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|G2 DNA damage checkpoint (GO:0031572)|meiotic nuclear division (GO:0007126)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	damaged DNA binding (GO:0003684)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			central_nervous_system(1)|cervix(2)|endometrium(5)|large_intestine(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	24	all_cancers(21;4.34e-05)|all_epithelial(16;8.3e-07)|Lung NSC(20;0.0107)|Colorectal(14;0.0202)|all_lung(20;0.0291)|Ovarian(20;0.19)		OV - Ovarian serous cystadenocarcinoma(1;0.00196)			TGAATAAATGCTCTCCAGACA	0.438								Homologous recombination																													p.C567W		Atlas-SNP	.											.	RBBP8	138	.	0			c.C1701G						PASS	.						42.0	43.0	43.0					18																	20573491		2203	4300	6503	SO:0001583	missense	5932	exon11			TAAATGCTCTCCA	AF043431	CCDS11874.1, CCDS11875.1	18q11.2	2012-11-05	2001-11-28		ENSG00000101773	ENSG00000101773			9891	protein-coding gene	gene with protein product	"""CTBP-interacting protein"""	604124	"""retinoblastoma-binding protein 8"", ""Seckel syndrome 2"""	SCKL2		9721205, 17965729, 21998596	Standard	NM_002894		Approved	CtIP, RIM, COM1	uc002ktw.3	Q99708	OTTHUMG00000131769	ENST00000399722.2:c.1701C>G	chr18.hg19:g.20573491C>G	ENSP00000382628:p.Cys567Trp	105.0	0.0	.		87.0	5.0	.	NM_203292	A6NKN2|A8K8W6|E7ETY1|O75371|Q8NHQ3	Missense_Mutation	SNP	ENST00000399722.2	hg19	CCDS11875.1	.	.	.	.	.	.	.	.	.	.	C	8.135	0.783853	0.16189	.	.	ENSG00000101773	ENST00000327155;ENST00000399725;ENST00000399722;ENST00000399721;ENST00000360790	T;T;T;T;T	0.30182	1.56;1.54;1.56;1.56;1.56	5.47	-1.84	0.07809	.	0.955160	0.08781	N	0.894641	T	0.13713	0.0332	N	0.08118	0	0.80722	D	1	B;B;B	0.26845	0.161;0.161;0.05	B;B;B	0.27262	0.078;0.078;0.078	T	0.11348	-1.0591	10	0.42905	T	0.14	2.5577	4.5073	0.11894	0.398:0.2625:0.0:0.3395	.	567;567;567	E7ETY1;A6NKN2;Q99708	.;.;COM1_HUMAN	W	567	ENSP00000323050:C567W;ENSP00000382630:C567W;ENSP00000382628:C567W;ENSP00000382627:C567W;ENSP00000354024:C567W	ENSP00000323050:C567W	C	+	3	2	RBBP8	18827489	0.237000	0.23815	0.580000	0.28601	0.726000	0.41606	-0.151000	0.10175	-0.215000	0.10063	-0.150000	0.13652	TGC	.	.	.	none		0.438	RBBP8-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446387.1	NM_203291	
ZFP30	22835	hgsc.bcm.edu	37	19	38126264	38126264	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr19:38126264C>T	ENST00000351218.2	-	6	1735	c.1178G>A	c.(1177-1179)cGt>cAt	p.R393H	ZFP30_ENST00000514101.2_Missense_Mutation_p.R393H|ZFP30_ENST00000392144.1_Missense_Mutation_p.R393H|ZFP30_ENST00000589018.1_Intron	NM_014898.2	NP_055713.1	Q9Y2G7	ZFP30_HUMAN	ZFP30 zinc finger protein	393					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	21			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTCTGAGTAACGACGAAAGAA	0.408																																					p.R393H		Atlas-SNP	.											.	ZFP30	68	.	0			c.G1178A						PASS	.						69.0	72.0	71.0					19																	38126264		2203	4300	6503	SO:0001583	missense	22835	exon6			GAGTAACGACGAA	AB023178	CCDS33005.1	19q13.13	2013-01-08	2012-11-27		ENSG00000120784	ENSG00000120784		"""Zinc fingers, C2H2-type"", ""-"""	29555	protein-coding gene	gene with protein product			"""zinc finger protein 30 homolog (mouse)"""			10231032	Standard	NM_014898		Approved	ZNF745, KIAA0961	uc002ogx.1	Q9Y2G7	OTTHUMG00000048177	ENST00000351218.2:c.1178G>A	chr19.hg19:g.38126264C>T	ENSP00000343581:p.Arg393His	97.0	0.0	.		114.0	5.0	.	NM_014898	Q58EY8	Missense_Mutation	SNP	ENST00000351218.2	hg19	CCDS33005.1	.	.	.	.	.	.	.	.	.	.	C	8.628	0.893085	0.17613	.	.	ENSG00000120784	ENST00000351218;ENST00000514101;ENST00000392144;ENST00000440715	T;T;T	0.36340	1.26;1.26;1.26	3.9	2.86	0.33363	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.35262	N	0.003340	T	0.34716	0.0907	L	0.27975	0.815	0.23851	N	0.996661	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.33059	-0.9883	10	0.11485	T	0.65	.	3.6934	0.08354	0.0:0.5686:0.2232:0.2082	.	393;393	D3Y2A0;Q9Y2G7	.;ZFP30_HUMAN	H	393;393;393;308	ENSP00000343581:R393H;ENSP00000422930:R393H;ENSP00000375988:R393H	ENSP00000343581:R393H	R	-	2	0	ZFP30	42818104	0.000000	0.05858	1.000000	0.80357	0.996000	0.88848	-0.122000	0.10627	2.175000	0.68902	0.591000	0.81541	CGT	.	.	.	none		0.408	ZFP30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109601.2	NM_014898	
ARFGEF2	10564	hgsc.bcm.edu	37	20	47632919	47632919	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr20:47632919G>A	ENST00000371917.4	+	31	4282	c.4282G>A	c.(4282-4284)Gta>Ata	p.V1428I		NM_006420.2	NP_006411.2	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)	1428					endomembrane system organization (GO:0010256)|endosome organization (GO:0007032)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of tumor necrosis factor production (GO:0032760)|protein transport (GO:0015031)|receptor recycling (GO:0001881)|regulation of ARF protein signal transduction (GO:0032012)|vesicle-mediated transport (GO:0016192)	asymmetric synapse (GO:0032279)|axonemal microtubule (GO:0005879)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|recycling endosome (GO:0055037)|symmetric synapse (GO:0032280)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|GABA receptor binding (GO:0050811)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase A regulatory subunit binding (GO:0034237)			breast(7)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	63			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			TCTTTCTGATGTATTTGCACA	0.353																																					p.V1428I	Esophageal Squamous(176;1738 1974 26285 33069 35354)	Atlas-SNP	.											.	ARFGEF2	160	.	0			c.G4282A						PASS	.						208.0	185.0	193.0					20																	47632919		2203	4300	6503	SO:0001583	missense	10564	exon31			TCTGATGTATTTG	AF084521	CCDS13411.1	20q13.13	2010-08-20			ENSG00000124198	ENSG00000124198		"""A-kinase anchor proteins"""	15853	protein-coding gene	gene with protein product	"""Brefeldin A-inhibited guanine nucleotide-exchange protein 2"""	605371				10212200	Standard	NM_006420		Approved	BIG2	uc002xtx.4	Q9Y6D5	OTTHUMG00000032687	ENST00000371917.4:c.4282G>A	chr20.hg19:g.47632919G>A	ENSP00000360985:p.Val1428Ile	132.0	0.0	.		147.0	43.0	.	NM_006420	Q5TFT9|Q9NTS1	Missense_Mutation	SNP	ENST00000371917.4	hg19	CCDS13411.1	.	.	.	.	.	.	.	.	.	.	G	7.760	0.705132	0.15172	.	.	ENSG00000124198	ENST00000371917	T	0.38722	1.12	5.52	5.52	0.82312	Armadillo-like helical (1);Armadillo-type fold (1);	0.054023	0.64402	D	0.000002	T	0.11580	0.0282	N	0.00841	-1.15	0.43069	D	0.994705	B	0.02656	0.0	B	0.01281	0.0	T	0.33189	-0.9878	10	0.02654	T	1	.	7.2277	0.26024	0.206:0.0:0.794:0.0	.	1428	Q9Y6D5	BIG2_HUMAN	I	1428	ENSP00000360985:V1428I	ENSP00000360985:V1428I	V	+	1	0	ARFGEF2	47066326	1.000000	0.71417	0.997000	0.53966	0.989000	0.77384	5.353000	0.66034	2.587000	0.87381	0.591000	0.81541	GTA	.	.	.	none		0.353	ARFGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079627.1	NM_006420	
MMP11	4320	hgsc.bcm.edu	37	22	24123480	24123480	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr22:24123480G>A	ENST00000215743.3	+	6	1011	c.959G>A	c.(958-960)cGt>cAt	p.R320H		NM_005940.3	NP_005931.2	P24347	MMP11_HUMAN	matrix metallopeptidase 11 (stromelysin 3)	320					basement membrane organization (GO:0071711)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|negative regulation of fat cell differentiation (GO:0045599)|proteolysis (GO:0006508)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(2)|lung(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	27		Medulloblastoma(6;9.86e-08)|all_neural(6;0.000318)			Marimastat(DB00786)	TGGCGCCTCCGTGGGGGCCAG	0.672																																					p.R320H		Atlas-SNP	.											.	MMP11	53	.	0			c.G959A						PASS	.						41.0	43.0	43.0					22																	24123480		2203	4300	6503	SO:0001583	missense	4320	exon6			GCCTCCGTGGGGG		CCDS13816.1	22q11.23	2008-06-11	2005-08-08		ENSG00000099953	ENSG00000099953			7157	protein-coding gene	gene with protein product		185261	"""matrix metalloproteinase 11 (stromelysin 3)"""	STMY3		1639418, 7657606, 12006591	Standard	NM_005940		Approved		uc002zxx.3	P24347	OTTHUMG00000150742	ENST00000215743.3:c.959G>A	chr22.hg19:g.24123480G>A	ENSP00000215743:p.Arg320His	75.0	0.0	.		77.0	21.0	.	NM_005940	Q5FX24|Q6PEZ6|Q9UC26	Missense_Mutation	SNP	ENST00000215743.3	hg19	CCDS13816.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.546617	0.86022	.	.	ENSG00000099953	ENST00000215743	T	0.02421	4.3	4.73	4.73	0.59995	Hemopexin/matrixin (2);	0.000000	0.85682	D	0.000000	T	0.08891	0.0220	L	0.41124	1.26	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.18840	-1.0324	10	0.38643	T	0.18	.	12.7499	0.57302	0.0822:0.0:0.9178:0.0	.	320	P24347	MMP11_HUMAN	H	320	ENSP00000215743:R320H	ENSP00000215743:R320H	R	+	2	0	MMP11	22453480	0.998000	0.40836	0.968000	0.41197	0.986000	0.74619	8.987000	0.93497	2.649000	0.89929	0.650000	0.86243	CGT	.	.	.	none		0.672	MMP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319891.2	NM_005940	
CERS3	204219	hgsc.bcm.edu	37	15	101013174	101013174	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr15:101013174delC	ENST00000394113.1	-	11	1383	c.693delG	c.(691-693)gggfs	p.G231fs	CERS3_ENST00000284382.4_Frame_Shift_Del_p.G231fs|CERS3_ENST00000538112.2_Frame_Shift_Del_p.G231fs|CERS3_ENST00000560944.1_Intron			Q8IU89	CERS3_HUMAN	ceramide synthase 3	231	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				ceramide biosynthetic process (GO:0046513)|keratinocyte differentiation (GO:0030216)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										TCACGAGGGTCCCACTGCGAA	0.433																																					p.T232fs		Atlas-INDEL	.											.	.	.	.	0			c.694delA						PASS	.						118.0	101.0	107.0					15																	101013174		2203	4300	6503	SO:0001589	frameshift_variant	204219	exon10			.		CCDS10384.1	15q26.3	2012-11-19	2011-07-08	2011-07-08	ENSG00000154227	ENSG00000154227		"""Homeoboxes / CERS class"""	23752	protein-coding gene	gene with protein product		615276	"""LAG1 longevity assurance homolog 3 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 3"""	LASS3			Standard	NM_178842		Approved	MGC27091	uc002bwb.3	Q8IU89	OTTHUMG00000172568	ENST00000394113.1:c.693delG	chr15.hg19:g.101013174delC	ENSP00000377672:p.Gly231fs	147.0	0.0	0		140.0	17.0	0.121429	NM_178842	Q8NE64|Q8NEN6	Frame_Shift_Del	DEL	ENST00000394113.1	hg19	CCDS10384.1																																																																																			.	.	.	none		0.433	CERS3-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313594.4	NM_178842	
ADCY8	114	hgsc.bcm.edu	37	8	131916171	131916174	+	Frame_Shift_Del	DEL	TAAG	TAAG	-			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	TAAG	TAAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr8:131916171_131916174delTAAG	ENST00000286355.5	-	7	3847_3850	c.1755_1758delCTTA	c.(1753-1758)tacttafs	p.YL585fs	ADCY8_ENST00000377928.3_Frame_Shift_Del_p.YL585fs	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	585					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			GCTGCTTAATTAAGTAAGTTTCGA	0.49										HNSCC(32;0.087)																											p.586_587del		Atlas-INDEL	.											ADCY8,NS,carcinoma,0,1	ADCY8	291	.	0			c.1756_1759del						PASS	.																																			SO:0001589	frameshift_variant	114	exon7			.	Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.1755_1758delCTTA	chr8.hg19:g.131916175_131916178delTAAG	ENSP00000286355:p.Tyr585fs	216.0	0.0	0		214.0	22.0	0.102804	NM_001115		Frame_Shift_Del	DEL	ENST00000286355.5	hg19	CCDS6363.1																																																																																			.	.	.	none		0.490	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1		
