#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SRRM1	10250	hgsc.bcm.edu	37	1	24979017	24979017	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr1:24979017A>T	ENST00000323848.9	+	7	1133	c.818A>T	c.(817-819)aAg>aTg	p.K273M	SRRM1_ENST00000374389.4_Missense_Mutation_p.K273M|SRRM1_ENST00000447431.2_Missense_Mutation_p.K273M|SRRM1_ENST00000479034.1_3'UTR|SRRM1_ENST00000537199.1_Missense_Mutation_p.K142M	NM_005839.3	NP_005830.2	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1	273	Arg-rich.|Pro-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	36		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		GAGAAGGAGAAGACCCGACCA	0.502																																					p.K273M	Ovarian(68;897 1494 3282 17478)	Atlas-SNP	.											.	SRRM1	81	.	0			c.A818T						PASS	.						34.0	36.0	36.0					1																	24979017		2203	4300	6503	SO:0001583	missense	10250	exon7			AGGAGAAGACCCG	AF048977	CCDS255.1	1p36	2010-04-22			ENSG00000133226	ENSG00000133226			16638	protein-coding gene	gene with protein product	"""Ser/Arg-related nuclear matrix protein"", ""plenty of prolines 101-like"""	605975				9531537	Standard	NM_005839		Approved	SRM160, POP101, MGC39488	uc001bjm.3	Q8IYB3	OTTHUMG00000003320	ENST00000323848.9:c.818A>T	chr1.hg19:g.24979017A>T	ENSP00000326261:p.Lys273Met	44.0	0.0	.		25.0	7.0	.	NM_005839	O60585|Q5VVN4	Missense_Mutation	SNP	ENST00000323848.9	hg19	CCDS255.1	.	.	.	.	.	.	.	.	.	.	A	16.33	3.093181	0.56075	.	.	ENSG00000133226	ENST00000323848;ENST00000447431;ENST00000374389;ENST00000537199	T;T;T;T	0.52754	0.76;0.76;0.76;0.65	6.05	6.05	0.98169	.	0.000000	0.64402	D	0.000003	T	0.46347	0.1388	N	0.19112	0.55	0.45791	D	0.998673	D;D	0.58620	0.983;0.971	P;P	0.55824	0.785;0.615	T	0.50233	-0.8852	10	0.66056	D	0.02	-2.6317	10.596	0.45338	0.9281:0.0:0.0719:0.0	.	273;273	E9PCT1;Q8IYB3	.;SRRM1_HUMAN	M	273;273;273;142	ENSP00000326261:K273M;ENSP00000391430:K273M;ENSP00000363510:K273M;ENSP00000441776:K142M	ENSP00000326261:K273M	K	+	2	0	SRRM1	24851604	1.000000	0.71417	1.000000	0.80357	0.736000	0.42039	3.872000	0.56085	2.320000	0.78422	0.528000	0.53228	AAG	.	.	.	none		0.502	SRRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009292.2	NM_005839	
PEF1	553115	hgsc.bcm.edu	37	1	32100869	32100869	+	Silent	SNP	T	T	C			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr1:32100869T>C	ENST00000373703.4	-	2	301	c.279A>G	c.(277-279)ccA>ccG	p.P93P	PEF1_ENST00000440872.2_Silent_p.P93P|PEF1_ENST00000492061.1_5'UTR	NM_012392.3	NP_036524.1	Q9UBV8	PEF1_HUMAN	penta-EF-hand domain containing 1	93	9 X 9 AA approximate tandem repeat of [AP]-P-G-G-P-Y-G-G-P-P.				proteolysis (GO:0006508)|response to calcium ion (GO:0051592)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|poly(A) RNA binding (GO:0044822)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(2)|upper_aerodigestive_tract(1)	7		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)|all_neural(195;0.186)		STAD - Stomach adenocarcinoma(196;0.0546)		AACTTGGAGGTGGCTGACCAT	0.587																																					p.P93P		Atlas-SNP	.											.	PEF1	20	.	0			c.A279G						PASS	.						49.0	51.0	50.0					1																	32100869		2203	4300	6503	SO:0001819	synonymous_variant	553115	exon2			TGGAGGTGGCTGA		CCDS345.1	1p34	2013-01-10			ENSG00000162517	ENSG00000162517		"""EF-hand domain containing"""	30009	protein-coding gene	gene with protein product	"""peflin"""	610033				10486255, 11883899	Standard	NM_012392		Approved	PEF1A	uc001bth.2	Q9UBV8	OTTHUMG00000003877	ENST00000373703.4:c.279A>G	chr1.hg19:g.32100869T>C		126.0	0.0	.		93.0	21.0	.	NM_012392		Silent	SNP	ENST00000373703.4	hg19	CCDS345.1																																																																																			.	.	.	none		0.587	PEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011046.1	NM_012392	
SIPA1L2	57568	hgsc.bcm.edu	37	1	232650793	232650793	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr1:232650793A>C	ENST00000366630.1	-	2	651	c.293T>G	c.(292-294)cTg>cGg	p.L98R	SIPA1L2_ENST00000262861.4_Missense_Mutation_p.L98R			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	98					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				GCTTTCCCACAGTGCCTTGCA	0.517																																					p.L98R		Atlas-SNP	.											.	SIPA1L2	218	.	0			c.T293G						PASS	.						156.0	154.0	155.0					1																	232650793		2020	4187	6207	SO:0001583	missense	57568	exon1			TCCCACAGTGCCT	AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.293T>G	chr1.hg19:g.232650793A>C	ENSP00000355589:p.Leu98Arg	224.0	0.0	.		177.0	39.0	.	NM_020808	Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Missense_Mutation	SNP	ENST00000366630.1	hg19	CCDS41474.1	.	.	.	.	.	.	.	.	.	.	A	0.689	-0.795281	0.02862	.	.	ENSG00000116991	ENST00000366630;ENST00000262861	T;T	0.78816	-1.21;-1.21	5.19	4.02	0.46733	.	0.630597	0.14001	N	0.348152	T	0.50171	0.1600	N	0.08118	0	0.09310	N	1	P	0.39216	0.664	B	0.32289	0.143	T	0.35325	-0.9793	10	0.14252	T	0.57	-9.9849	5.5611	0.17144	0.6384:0.0:0.3616:0.0	.	98	Q9P2F8	SI1L2_HUMAN	R	98	ENSP00000355589:L98R;ENSP00000262861:L98R	ENSP00000262861:L98R	L	-	2	0	SIPA1L2	230717416	0.005000	0.15991	0.062000	0.19696	0.262000	0.26303	1.251000	0.32862	0.942000	0.37525	0.528000	0.53228	CTG	.	.	.	none		0.517	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092318.1	XM_045839	
SOS1	6654	hgsc.bcm.edu	37	2	39285904	39285904	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr2:39285904C>T	ENST00000426016.1	-	4	341	c.255G>A	c.(253-255)tgG>tgA	p.W85*	SOS1_ENST00000395038.2_Nonsense_Mutation_p.W85*|SOS1_ENST00000428721.2_Nonsense_Mutation_p.W28*|SOS1_ENST00000402219.2_Nonsense_Mutation_p.W85*			Q07889	SOS1_HUMAN	son of sevenless homolog 1 (Drosophila)	85					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|Ras protein signal transduction (GO:0007265)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	DNA binding (GO:0003677)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(29)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	75		all_hematologic(82;0.21)				CAGCTATTGCCCATTTATCAA	0.338									Noonan syndrome																												p.W85X		Atlas-SNP	.											.	SOS1	134	.	0			c.G255A						PASS	.						75.0	76.0	76.0					2																	39285904		2202	4300	6502	SO:0001587	stop_gained	6654	exon3	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	TATTGCCCATTTA	L13857	CCDS1802.1	2p21	2014-09-17	2002-11-05		ENSG00000115904	ENSG00000115904		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11187	protein-coding gene	gene with protein product		182530	"""gingival fibromatosis, hereditary, 1"""	GINGF		8276400, 10995566	Standard	NM_005633		Approved	HGF, GF1	uc002rrk.4	Q07889	OTTHUMG00000102109	ENST00000426016.1:c.255G>A	chr2.hg19:g.39285904C>T	ENSP00000387784:p.Trp85*	156.0	0.0	.		109.0	33.0	.	NM_005633	A8K2G3|B4DXG2	Nonsense_Mutation	SNP	ENST00000426016.1	hg19	CCDS1802.1	.	.	.	.	.	.	.	.	.	.	C	29.4	5.005675	0.93287	.	.	ENSG00000115904	ENST00000426016;ENST00000402219;ENST00000395038;ENST00000263879;ENST00000428721;ENST00000451331	.	.	.	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.9598	0.97242	0.0:1.0:0.0:0.0	.	.	.	.	X	85;85;85;85;28;28	.	ENSP00000263879:W85X	W	-	3	0	SOS1	39139408	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.711000	0.84669	2.716000	0.92895	0.655000	0.94253	TGG	.	.	.	none		0.338	SOS1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219948.3	NM_005633	
TANC1	85461	hgsc.bcm.edu	37	2	160086335	160086335	+	Silent	SNP	C	C	A			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr2:160086335C>A	ENST00000263635.6	+	27	4635	c.4398C>A	c.(4396-4398)ccC>ccA	p.P1466P	TANC1_ENST00000454300.1_Silent_p.P1360P	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	1466					dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						AAACTTCTCCCCAGGAAGAAT	0.517																																					p.P1466P		Atlas-SNP	.											TANC1,NS,neuroblastoma,0,1	TANC1	157	.	0			c.C4398A						PASS	.						94.0	104.0	101.0					2																	160086335		1964	4133	6097	SO:0001819	synonymous_variant	85461	exon27			TTCTCCCCAGGAA	AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.4398C>A	chr2.hg19:g.160086335C>A		146.0	1.0	.		144.0	36.0	.	NM_033394	C9JD88|Q49AI8	Silent	SNP	ENST00000263635.6	hg19	CCDS42766.1																																																																																			.	.	.	none		0.517	TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333135.1		
IRS1	3667	hgsc.bcm.edu	37	2	227662872	227662872	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr2:227662872C>T	ENST00000305123.5	-	1	1603	c.583G>A	c.(583-585)Gtg>Atg	p.V195M	IRS1_ENST00000498335.1_5'Flank|RP11-395N3.2_ENST00000607970.1_lincRNA	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	195	IRS-type PTB. {ECO:0000255|PROSITE- ProRule:PRU00389}.				cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		TTCAGCTTCACGAAGCTGATG	0.567											OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V195M		Atlas-SNP	.											.	IRS1	141	.	0			c.G583A						PASS	.						57.0	55.0	56.0					2																	227662872		2203	4300	6503	SO:0001583	missense	3667	exon1			GCTTCACGAAGCT		CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.583G>A	chr2.hg19:g.227662872C>T	ENSP00000304895:p.Val195Met	86.0	0.0	.	2321	93.0	23.0	.	NM_005544		Missense_Mutation	SNP	ENST00000305123.5	hg19	CCDS2463.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.366266	0.82463	.	.	ENSG00000169047	ENST00000305123	T	0.74526	-0.85	5.79	5.79	0.91817	Pleckstrin homology-type (1);Insulin receptor substrate-1, PTB (4);	0.000000	0.64402	D	0.000017	D	0.87661	0.6233	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87579	0.2483	10	0.56958	D	0.05	-29.8384	20.0212	0.97504	0.0:1.0:0.0:0.0	.	195	P35568	IRS1_HUMAN	M	195	ENSP00000304895:V195M	ENSP00000304895:V195M	V	-	1	0	IRS1	227371116	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.735000	0.93741	0.561000	0.74099	GTG	.	.	.	none		0.567	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256886.3	NM_005544	
SFMBT1	51460	hgsc.bcm.edu	37	3	52939193	52939193	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr3:52939193C>A	ENST00000394752.3	-	21	2942	c.2560G>T	c.(2560-2562)Gag>Tag	p.E854*	SFMBT1_ENST00000358080.2_Nonsense_Mutation_p.E854*|SFMBT1_ENST00000394750.1_Nonsense_Mutation_p.E854*|SFMBT1_ENST00000296295.6_Nonsense_Mutation_p.E811*	NM_016329.3	NP_057413.2	Q9UHJ3	SMBT1_HUMAN	Scm-like with four mbt domains 1	854	SAM.				cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|negative regulation of muscle organ development (GO:0048635)|negative regulation of transcription, DNA-templated (GO:0045892)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	24				BRCA - Breast invasive adenocarcinoma(193;9.91e-05)|Kidney(197;0.000644)|KIRC - Kidney renal clear cell carcinoma(197;0.000792)|OV - Ovarian serous cystadenocarcinoma(275;0.113)		TTGATCCTCTCTATGTGATGG	0.458																																					p.E854X		Atlas-SNP	.											.	SFMBT1	53	.	0			c.G2560T						PASS	.						122.0	110.0	114.0					3																	52939193		2203	4300	6503	SO:0001587	stop_gained	51460	exon21			TCCTCTCTATGTG	AF168132	CCDS2867.1	3p21.31	2013-01-10			ENSG00000163935	ENSG00000163935		"""Sterile alpha motif (SAM) domain containing"""	20255	protein-coding gene	gene with protein product		607319				10661410	Standard	NM_016329		Approved	RU1, DKFZp434L243, SFMBT	uc003dgh.3	Q9UHJ3	OTTHUMG00000159052	ENST00000394752.3:c.2560G>T	chr3.hg19:g.52939193C>A	ENSP00000378235:p.Glu854*	153.0	0.0	.		118.0	5.0	.	NM_016329	Q402F7|Q96C73|Q9Y4Q9	Nonsense_Mutation	SNP	ENST00000394752.3	hg19	CCDS2867.1	.	.	.	.	.	.	.	.	.	.	C	44	10.576888	0.99431	.	.	ENSG00000163935	ENST00000394752;ENST00000358080;ENST00000296295;ENST00000394750	.	.	.	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	.	.	.	X	854;854;811;854	.	ENSP00000296295:E811X	E	-	1	0	SFMBT1	52914233	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.818000	0.86416	2.937000	0.99478	0.650000	0.86243	GAG	.	.	.	none		0.458	SFMBT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353040.3	NM_016329	
ZNF717	100131827	hgsc.bcm.edu	37	3	75790798	75790798	+	De_novo_Start_OutOfFrame	SNP	G	G	A			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr3:75790798G>A	ENST00000478296.1	-	0	273				ZNF717_ENST00000400845.3_Silent_p.D42D|ZNF717_ENST00000422325.1_Silent_p.D49D|ZNF717_ENST00000477374.1_Silent_p.D49D|ZNF717_ENST00000491507.1_5'UTR			Q9BY31	ZN717_HUMAN	zinc finger protein 717						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(6)|endometrium(3)|lung(2)|ovary(1)|stomach(7)	19						CCAGCATCACGTCCCTGTACA	0.502																																					p.D49D		Atlas-SNP	.											ZNF717,NS,carcinoma,0,2	ZNF717	160	.	0			c.C147T						PASS	.						18.0	14.0	15.0					3																	75790798		450	1250	1700			100131827	exon3			CATCACGTCCCTG	AF226994		3p12.3	2013-01-08			ENSG00000227124	ENSG00000227124		"""Zinc fingers, C2H2-type"", ""-"""	29448	protein-coding gene	gene with protein product			"""zinc finger protein 838"""	ZNF838			Standard	NM_001128223		Approved	X17	uc011bgi.2	Q9BY31	OTTHUMG00000158965	ENST00000478296.1:c.-4C>T	chr3.hg19:g.75790798G>A		14.0	1.0	.		20.0	9.0	.	NM_001128223		Silent	SNP	ENST00000478296.1	hg19																																																																																				.	.	.	none		0.502	ZNF717-002	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000352764.2	NM_001128223	
CPNE4	131034	hgsc.bcm.edu	37	3	131254172	131254172	+	Splice_Site	SNP	G	G	A			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr3:131254172G>A	ENST00000512055.1	-	20	3667	c.1541C>T	c.(1540-1542)gCa>gTa	p.A514V	CPNE4_ENST00000502818.1_Splice_Site_p.A532V|CPNE4_ENST00000511604.1_Splice_Site_p.A514V|CPNE4_ENST00000429747.1_Splice_Site_p.A514V|CPNE4_ENST00000503204.1_5'UTR|CPNE4_ENST00000512332.1_Splice_Site_p.A532V			Q96A23	CPNE4_HUMAN	copine IV	514						extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|liver(1)|lung(16)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	39						AGCTGGAGATGCCTGCAGGGA	0.453																																					p.A514V		Atlas-SNP	.											.	CPNE4	112	.	0			c.C1541T						PASS	.						97.0	91.0	93.0					3																	131254172		2203	4300	6503	SO:0001630	splice_region_variant	131034	exon16			GGAGATGCCTGCA	H29499	CCDS3072.1, CCDS75010.1	3q22.1	2014-09-04			ENSG00000196353	ENSG00000196353			2317	protein-coding gene	gene with protein product	"""copine 8"""	604208				9430674, 12670487	Standard	XM_005247107		Approved	COPN4, CPN4	uc003eok.3	Q96A23	OTTHUMG00000159631	ENST00000512055.1:c.1540-1C>T	chr3.hg19:g.131254172G>A		124.0	0.0	.		114.0	25.0	.	NM_130808	D3DNC5|Q8TEX1	Missense_Mutation	SNP	ENST00000512055.1	hg19	CCDS3072.1	.	.	.	.	.	.	.	.	.	.	G	19.12	3.766296	0.69878	.	.	ENSG00000196353	ENST00000512055;ENST00000429747;ENST00000512332;ENST00000511604;ENST00000502818	T;T;T;T;T	0.54866	0.55;0.55;0.55;0.55;0.55	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.70996	0.3288	M	0.76838	2.35	0.80722	D	1	P;B	0.44627	0.839;0.361	P;B	0.56563	0.801;0.134	T	0.72050	-0.4407	10	0.48119	T	0.1	-15.9346	18.8677	0.92300	0.0:0.0:1.0:0.0	.	532;514	Q96A23-2;Q96A23	.;CPNE4_HUMAN	V	514;514;532;514;532	ENSP00000421705:A514V;ENSP00000411904:A514V;ENSP00000424853:A532V;ENSP00000423811:A514V;ENSP00000421646:A532V	ENSP00000411904:A514V	A	-	2	0	CPNE4	132736862	1.000000	0.71417	0.998000	0.56505	0.601000	0.36947	9.476000	0.97823	2.460000	0.83146	0.557000	0.71058	GCA	.	.	.	none		0.453	CPNE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356583.4	NM_130808	Missense_Mutation
TIFA	92610	hgsc.bcm.edu	37	4	113199250	113199250	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr4:113199250T>G	ENST00000361717.3	-	2	604	c.323A>C	c.(322-324)aAa>aCa	p.K108T	TIFA_ENST00000500655.2_Missense_Mutation_p.K108T	NM_052864.2	NP_443096.1	Q96CG3	TIFA_HUMAN	TRAF-interacting protein with forkhead-associated domain	108					I-kappaB kinase/NF-kappaB signaling (GO:0007249)					breast(2)|endometrium(1)|large_intestine(1)|lung(1)|skin(1)	6		Ovarian(17;0.0443)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00172)		CAGGTCCATTTTATTTAGGTA	0.388																																					p.K108T		Atlas-SNP	.											.	TIFA	15	.	0			c.A323C						PASS	.						45.0	42.0	43.0					4																	113199250		2203	4300	6503	SO:0001583	missense	92610	exon2			TCCATTTTATTTA	BC008294	CCDS34051.1	4q25	2008-03-17				ENSG00000145365			19075	protein-coding gene	gene with protein product	"""TRAF2 binding protein"", ""TRAF6 binding protein"""	609028				1179819	Standard	NM_052864		Approved	MGC20791, T2BP, T6BP, TIFAA	uc003ial.3	Q96CG3		ENST00000361717.3:c.323A>C	chr4.hg19:g.113199250T>G	ENSP00000354911:p.Lys108Thr	86.0	0.0	.		56.0	16.0	.	NM_052864		Missense_Mutation	SNP	ENST00000361717.3	hg19	CCDS34051.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.382639	0.82792	.	.	ENSG00000145365	ENST00000361717;ENST00000500655	D;D	0.86694	-2.16;-2.16	5.79	5.79	0.91817	Forkhead-associated (FHA) domain (2);	0.092657	0.64402	D	0.000001	D	0.92916	0.7746	M	0.71581	2.175	0.50813	D	0.999896	D	0.89917	1.0	D	0.91635	0.999	D	0.93532	0.6870	10	0.72032	D	0.01	-34.6044	16.1303	0.81428	0.0:0.0:0.0:1.0	.	108	Q96CG3	TIFA_HUMAN	T	108	ENSP00000354911:K108T;ENSP00000424231:K108T	ENSP00000354911:K108T	K	-	2	0	TIFA	113418699	1.000000	0.71417	0.077000	0.20336	0.992000	0.81027	3.462000	0.53042	2.218000	0.71995	0.533000	0.62120	AAA	.	.	.	none		0.388	TIFA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363647.2	NM_052864	
METTL14	57721	hgsc.bcm.edu	37	4	119631350	119631350	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr4:119631350T>A	ENST00000388822.5	+	11	1431	c.1264T>A	c.(1264-1266)Tct>Act	p.S422T	METTL14_ENST00000506780.1_Missense_Mutation_p.S384T			Q9HCE5	MET14_HUMAN	methyltransferase like 14	422	Gly-rich.				mRNA destabilization (GO:0061157)|mRNA methylation (GO:0080009)|stem cell maintenance (GO:0019827)	MIS complex (GO:0036396)|nucleus (GO:0005634)	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity (GO:0016422)|RNA binding (GO:0003723)			endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|stomach(1)	16						AGGTGGAACTTCTGCTGGCCG	0.527																																					p.S422T		Atlas-SNP	.											.	METTL14	41	.	0			c.T1264A						PASS	.						56.0	58.0	58.0					4																	119631350		2203	4300	6503	SO:0001583	missense	57721	exon11			GGAACTTCTGCTG	AB046847	CCDS34053.1	4q26	2009-02-24			ENSG00000145388	ENSG00000145388			29330	protein-coding gene	gene with protein product						10997877	Standard	NM_020961		Approved	KIAA1627	uc003icf.3	Q9HCE5	OTTHUMG00000161167	ENST00000388822.5:c.1264T>A	chr4.hg19:g.119631350T>A	ENSP00000373474:p.Ser422Thr	88.0	0.0	.		93.0	16.0	.	NM_020961	A6NIG1|Q969V2	Missense_Mutation	SNP	ENST00000388822.5	hg19	CCDS34053.1	.	.	.	.	.	.	.	.	.	.	T	14.22	2.469312	0.43839	.	.	ENSG00000145388	ENST00000388822;ENST00000506780	.	.	.	5.62	4.42	0.53409	.	0.215770	0.49305	D	0.000149	T	0.30448	0.0765	N	0.14661	0.345	0.38962	D	0.958572	B;B	0.29037	0.231;0.139	B;B	0.19946	0.027;0.027	T	0.11916	-1.0568	9	0.08381	T	0.77	-2.7465	12.8488	0.57846	0.0:0.0:0.1363:0.8637	.	384;422	D6RBL4;Q9HCE5	.;MTL14_HUMAN	T	422;384	.	ENSP00000373474:S422T	S	+	1	0	METTL14	119850798	1.000000	0.71417	0.961000	0.40146	0.958000	0.62258	4.909000	0.63314	0.937000	0.37394	0.528000	0.53228	TCT	.	.	.	none		0.527	METTL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364034.3	NM_020961	
KIAA1109	84162	hgsc.bcm.edu	37	4	123161284	123161284	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr4:123161284G>C	ENST00000264501.4	+	29	4820	c.4447G>C	c.(4447-4449)Gaa>Caa	p.E1483Q	KIAA1109_ENST00000455637.1_Missense_Mutation_p.E1483Q|KIAA1109_ENST00000388738.3_Missense_Mutation_p.E1483Q			Q2LD37	K1109_HUMAN	KIAA1109	1483					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						ATATATTGTAGAAGGTGAGAA	0.398																																					p.E1483Q		Atlas-SNP	.											.	KIAA1109	424	.	0			c.G4447C						PASS	.						118.0	113.0	114.0					4																	123161284		1871	4109	5980	SO:0001583	missense	84162	exon27			ATTGTAGAAGGTG	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.4447G>C	chr4.hg19:g.123161284G>C	ENSP00000264501:p.Glu1483Gln	117.0	0.0	.		103.0	23.0	.	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	hg19	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.16|17.16	3.318796|3.318796	0.60524|0.60524	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000455637|ENST00000446180	T;T;T|.	0.24908|.	2.42;2.42;1.83|.	5.91|5.91	5.91|5.91	0.95273|0.95273	.|.	0.000000|.	0.44285|.	U|.	0.000466|.	T|.	0.57125|.	0.2032|.	N|N	0.24115|0.24115	0.695|0.695	0.49798|0.49798	D|D	0.999822|0.999822	B;B|.	0.32245|.	0.361;0.247|.	B;B|.	0.42343|.	0.384;0.214|.	T|.	0.49184|.	-0.8966|.	10|.	0.66056|.	D|.	0.02|.	.|.	20.2885|20.2885	0.98538|0.98538	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1482;1483|.	Q2LD37-2;Q2LD37|.	.;K1109_HUMAN|.	Q|Y	1483|55	ENSP00000264501:E1483Q;ENSP00000373390:E1483Q;ENSP00000389925:E1483Q|.	ENSP00000264501:E1483Q|.	E|X	+|+	1|3	0|2	KIAA1109|KIAA1109	123380734|123380734	1.000000|1.000000	0.71417|0.71417	0.874000|0.874000	0.34290|0.34290	0.951000|0.951000	0.60555|0.60555	8.632000|8.632000	0.90995|0.90995	2.791000|2.791000	0.96007|0.96007	0.650000|0.650000	0.86243|0.86243	GAA|TAG	.	.	.	none		0.398	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
ARHGAP26	23092	hgsc.bcm.edu	37	5	142283206	142283206	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr5:142283206G>C	ENST00000274498.4	+	8	1182	c.804G>C	c.(802-804)atG>atC	p.M268I	ARHGAP26_ENST00000378004.3_Missense_Mutation_p.M268I	NM_015071.4	NP_055886.1	Q9UNA1	RHG26_HUMAN	Rho GTPase activating protein 26	268	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|filopodium assembly (GO:0046847)|nervous system development (GO:0007399)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(7)|ovary(1)	25		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCTACACCATGGAGGGATACC	0.473																																					p.M268I		Atlas-SNP	.											.	ARHGAP26	57	.	0			c.G804C						PASS	.						97.0	84.0	88.0					5																	142283206		2203	4300	6503	SO:0001583	missense	23092	exon8			CACCATGGAGGGA	AB014521	CCDS4277.1, CCDS47297.1	5q31	2011-06-29			ENSG00000145819	ENSG00000145819		"""Rho GTPase activating proteins"""	17073	protein-coding gene	gene with protein product	"""GTPase regulator associated with the focal adhesion kinase pp125"""	605370				9858476, 8649427	Standard	NM_001135608		Approved	GRAF, KIAA0621, OPHN1L, OPHN1L1	uc011dbj.2	Q9UNA1	OTTHUMG00000059705	ENST00000274498.4:c.804G>C	chr5.hg19:g.142283206G>C	ENSP00000274498:p.Met268Ile	60.0	0.0	.		54.0	11.0	.	NM_015071	O75117|Q5D035|Q9BYS6|Q9BYS7|Q9UJ00	Missense_Mutation	SNP	ENST00000274498.4	hg19	CCDS4277.1	.	.	.	.	.	.	.	.	.	.	G	12.71	2.018359	0.35606	.	.	ENSG00000145819	ENST00000274498;ENST00000378004	T;T	0.04317	3.65;3.65	5.49	5.49	0.81192	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	T	0.09379	0.0231	L	0.38953	1.18	0.80722	D	1	P;P	0.37548	0.481;0.599	B;P	0.46076	0.186;0.503	T	0.39231	-0.9624	10	0.25751	T	0.34	.	19.3843	0.94550	0.0:0.0:1.0:0.0	.	268;268	Q9UNA1;Q9UNA1-2	RHG26_HUMAN;.	I	268	ENSP00000274498:M268I;ENSP00000367243:M268I	ENSP00000274498:M268I	M	+	3	0	ARHGAP26	142263390	1.000000	0.71417	1.000000	0.80357	0.801000	0.45260	6.162000	0.71874	2.574000	0.86865	0.563000	0.77884	ATG	.	.	.	none		0.473	ARHGAP26-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000132744.3	NM_015071	
GABRB2	2561	hgsc.bcm.edu	37	5	160753381	160753381	+	Silent	SNP	C	C	G			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr5:160753381C>G	ENST00000393959.1	-	9	1184	c.1185G>C	c.(1183-1185)ctG>ctC	p.L395L	GABRB2_ENST00000517547.1_Intron|GABRB2_ENST00000274547.2_Silent_p.L395L|GABRB2_ENST00000517901.1_Intron|GABRB2_ENST00000353437.6_Intron|GABRB2_ENST00000520240.1_Intron			P47870	GBRB2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 2	395					cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|GABA-A receptor activity (GO:0004890)|inhibitory extracellular ligand-gated ion channel activity (GO:0005237)	p.L395L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(9)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	26	Renal(175;0.00259)	Medulloblastoma(196;0.021)|all_neural(177;0.0463)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Fospropofol(DB06716)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TAACCGTATACAGAGAGAAAT	0.388																																					p.L395L		Atlas-SNP	.											GABRB2_ENST00000274547,NS,carcinoma,0,1	GABRB2	161	.	1	Substitution - coding silent(1)	endometrium(1)	c.G1185C						PASS	.						110.0	107.0	108.0					5																	160753381		2203	4299	6502	SO:0001819	synonymous_variant	2561	exon10			CGTATACAGAGAG		CCDS4354.1, CCDS4355.1	5q34	2012-06-22			ENSG00000145864	ENSG00000145864		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4082	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 2"""	600232				7851879	Standard	NM_000813		Approved		uc003lys.1	P47870	OTTHUMG00000130349	ENST00000393959.1:c.1185G>C	chr5.hg19:g.160753381C>G		143.0	0.0	.		122.0	5.0	.	NM_021911	A8K115|A8K1A0|D1LYT0|D1LYT1|Q16323|Q4FZB2	Silent	SNP	ENST00000393959.1	hg19	CCDS4355.1																																																																																			.	.	.	none		0.388	GABRB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252704.1		
DOCK2	1794	hgsc.bcm.edu	37	5	169477372	169477372	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr5:169477372G>C	ENST00000256935.8	+	41	4264	c.4184G>C	c.(4183-4185)gGa>gCa	p.G1395A	DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000540750.1_Missense_Mutation_p.G456A|DOCK2_ENST00000520908.1_Missense_Mutation_p.G887A	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1395	DHR-2.|Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TCTGCCCCGGGAGATGATGTG	0.562																																					p.G1395A		Atlas-SNP	.											.	DOCK2	389	.	0			c.G4184C						PASS	.						119.0	111.0	114.0					5																	169477372		2203	4300	6503	SO:0001583	missense	1794	exon41			CCCCGGGAGATGA	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.4184G>C	chr5.hg19:g.169477372G>C	ENSP00000256935:p.Gly1395Ala	148.0	0.0	.		137.0	32.0	.	NM_004946	Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	hg19	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	G	14.85	2.658712	0.47467	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.08896	3.7;3.33;3.04	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.27313	0.0670	M	0.63428	1.95	0.58432	D	0.999999	D;D	0.71674	0.998;0.994	D;P	0.72075	0.976;0.839	T	0.00320	-1.1820	10	0.30854	T	0.27	.	19.427	0.94746	0.0:0.0:1.0:0.0	.	887;1395	E7ERW7;Q92608	.;DOCK2_HUMAN	A	1395;887;456	ENSP00000256935:G1395A;ENSP00000429283:G887A;ENSP00000438827:G456A	ENSP00000256935:G1395A	G	+	2	0	DOCK2	169409950	1.000000	0.71417	0.332000	0.25469	0.198000	0.23893	7.884000	0.87274	2.603000	0.88011	0.655000	0.94253	GGA	.	.	.	none		0.562	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
F12	2161	hgsc.bcm.edu	37	5	176831305	176831305	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr5:176831305G>A	ENST00000253496.3	-	9	958	c.910C>T	c.(910-912)Ccg>Tcg	p.P304S	F12_ENST00000514943.1_5'Flank	NM_000505.3	NP_000496.2	P00748	FA12_HUMAN	coagulation factor XII (Hageman factor)	304	Pro-rich.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|Factor XII activation (GO:0002542)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|plasma kallikrein-kinin cascade (GO:0002353)|positive regulation of blood coagulation (GO:0030194)|positive regulation of fibrinolysis (GO:0051919)|positive regulation of plasminogen activation (GO:0010756)|protein autoprocessing (GO:0016540)|protein processing (GO:0016485)|response to misfolded protein (GO:0051788)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	misfolded protein binding (GO:0051787)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	12	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Ethanolamine Oleate(DB06689)	ACCGGGGTCGGAGGCGCCGCC	0.701									Hereditary Angioedema		OREG0017088	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P304S		Atlas-SNP	.											.	F12	35	.	0			c.C910T						PASS	.						16.0	21.0	19.0					5																	176831305		2200	4295	6495	SO:0001583	missense	2161	exon9	Familial Cancer Database	HAE, type I-III, Hereditary Angioneurotic Edema, HANE,	GGGTCGGAGGCGC	M31315	CCDS34302.1	5q35.3	2014-09-17			ENSG00000131187	ENSG00000131187	3.4.21.38		3530	protein-coding gene	gene with protein product		610619					Standard	NM_000505		Approved		uc003mgo.4	P00748	OTTHUMG00000163403	ENST00000253496.3:c.910C>T	chr5.hg19:g.176831305G>A	ENSP00000253496:p.Pro304Ser	38.0	0.0	.	1934	30.0	7.0	.	NM_000505	P78339	Missense_Mutation	SNP	ENST00000253496.3	hg19	CCDS34302.1	.	.	.	.	.	.	.	.	.	.	G	12.87	2.068656	0.36470	.	.	ENSG00000131187	ENST00000253496	T	0.62364	0.03	3.94	1.0	0.19881	Kringle-like fold (1);	0.463200	0.16155	N	0.227071	T	0.32912	0.0845	N	0.14661	0.345	0.19300	N	0.999975	B	0.34103	0.437	B	0.27500	0.08	T	0.22103	-1.0226	10	0.09084	T	0.74	.	6.3798	0.21527	0.0:0.1784:0.4636:0.358	.	304	P00748	FA12_HUMAN	S	304	ENSP00000253496:P304S	ENSP00000253496:P304S	P	-	1	0	F12	176763911	0.000000	0.05858	0.000000	0.03702	0.121000	0.20230	-0.786000	0.04623	0.206000	0.20587	0.561000	0.74099	CCG	.	.	.	none		0.701	F12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373217.1		
BRD2	6046	hgsc.bcm.edu	37	6	32945545	32945545	+	Missense_Mutation	SNP	G	G	T	rs55650066		TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr6:32945545G>T	ENST00000374825.4	+	9	3042	c.1341G>T	c.(1339-1341)gaG>gaT	p.E447D	BRD2_ENST00000395287.1_Missense_Mutation_p.E447D|BRD2_ENST00000374831.4_Missense_Mutation_p.E447D|BRD2_ENST00000443797.2_Missense_Mutation_p.E327D|BRD2_ENST00000395289.2_Missense_Mutation_p.E447D|BRD2_ENST00000449085.2_Missense_Mutation_p.E400D	NM_005104.3	NP_005095.1	P25440	BRD2_HUMAN	bromodomain containing 2	447					chromatin modification (GO:0016568)|nucleosome assembly (GO:0006334)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(3)|stomach(2)	5						ATGTATTTGAGTTCCGTTATG	0.468																																					p.E447D		Atlas-SNP	.											.	BRD2	70	.	0			c.G1341T						PASS	.						124.0	138.0	133.0					6																	32945545		1510	2709	4219	SO:0001583	missense	6046	exon9			ATTTGAGTTCCGT	X96670	CCDS4762.1, CCDS56420.1, CCDS56421.1	6p21.3	2010-12-23	2002-01-14		ENSG00000204256	ENSG00000204256			1103	protein-coding gene	gene with protein product		601540	"""bromodomain-containing 2"""			1352711, 8781126	Standard	NM_005104		Approved	KIAA9001, RING3, D6S113E, NAT, FSRG1	uc021ywf.1	P25440	OTTHUMG00000031241	ENST00000374825.4:c.1341G>T	chr6.hg19:g.32945545G>T	ENSP00000363958:p.Glu447Asp	143.0	0.0	.		108.0	5.0	.	NM_005104	A2AAU0|B0S7P0|B1AZT1|O00699|O00700|Q15310|Q5STC9|Q63HQ9|Q658Y7|Q6P3U2|Q969U4	Missense_Mutation	SNP	ENST00000374825.4	hg19	CCDS4762.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.69|19.69	3.874670|3.874670	0.72180|0.72180	.|.	.|.	ENSG00000204256|ENSG00000204256	ENST00000374825;ENST00000374831;ENST00000395289;ENST00000443797;ENST00000395287;ENST00000449085|ENST00000449025	T;T;T;T;T;T|.	0.20332|.	2.08;2.08;2.08;2.08;2.08;2.08|.	5.63|5.63	4.76|4.76	0.60689|0.60689	Bromodomain (3);|.	0.000000|.	0.51477|.	D|.	0.000096|.	T|T	0.74176|0.74176	0.3682|0.3682	M|M	0.89968|0.89968	3.075|3.075	0.58432|0.58432	D|D	0.999999|0.999999	D;D|.	0.71674|.	0.998;0.985|.	P;P|.	0.62382|.	0.901;0.842|.	T|T	0.79883|0.79883	-0.1615|-0.1615	10|5	0.44086|.	T|.	0.13|.	-29.6263|-29.6263	12.3553|12.3553	0.55171|0.55171	0.0804:0.0:0.9196:0.0|0.0804:0.0:0.9196:0.0	.|.	447;447|.	A2AAU0;P25440|.	.;BRD2_HUMAN|.	D|I	447;447;447;327;447;400|453	ENSP00000363958:E447D;ENSP00000363964:E447D;ENSP00000378704:E447D;ENSP00000413495:E327D;ENSP00000378702:E447D;ENSP00000409145:E400D|.	ENSP00000363958:E447D|.	E|S	+|+	3|2	2|0	BRD2|BRD2	33053523|33053523	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.362000|3.362000	0.52314|0.52314	1.619000|1.619000	0.50296|0.50296	0.643000|0.643000	0.83706|0.83706	GAG|AGT	.	.	.	alt		0.468	BRD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076503.2		
EEF1A1	1915	hgsc.bcm.edu	37	6	74229620	74229620	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr6:74229620T>C	ENST00000316292.9	-	1	1121	c.130A>G	c.(130-132)Aag>Gag	p.K44E	EEF1A1_ENST00000491404.1_5'Flank|EEF1A1_ENST00000309268.6_Missense_Mutation_p.K44E|EEF1A1_ENST00000331523.2_Missense_Mutation_p.K44E	NM_001402.5	NP_001393.1	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha 1	44	tr-type G.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation elongation factor activity (GO:0003746)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|prostate(2)|skin(3)	18						GCAGCCTCCTTCTCAAATTTT	0.423																																					p.K44E		Atlas-SNP	.											.	EEF1A1	56	.	0			c.A130G						PASS	.						127.0	129.0	128.0					6																	74229620		2203	4300	6503	SO:0001583	missense	1915	exon2			CCTCCTTCTCAAA	BC019669	CCDS4980.1	6q14.1	2010-06-30	2004-11-19		ENSG00000156508	ENSG00000156508			3189	protein-coding gene	gene with protein product		130590	"""leukocyte receptor cluster (LRC) member 7"""	EF1A, EEF1A, LENG7		8812466, 10941842	Standard	NM_001402		Approved	EE1A1	uc003phj.3	P68104	OTTHUMG00000015031	ENST00000316292.9:c.130A>G	chr6.hg19:g.74229620T>C	ENSP00000339063:p.Lys44Glu	185.0	0.0	.		162.0	13.0	.	NM_001402	P04719|P04720|Q6IQ15	Missense_Mutation	SNP	ENST00000316292.9	hg19	CCDS4980.1	.	.	.	.	.	.	.	.	.	.	T	13.92	2.380554	0.42207	.	.	ENSG00000156508	ENST00000316292;ENST00000358190;ENST00000309268;ENST00000331523;ENST00000391977;ENST00000456206;ENST00000356303;ENST00000455918	T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91	4.15	4.15	0.48705	Protein synthesis factor, GTP-binding (2);	0.000000	0.85682	U	0.000000	T	0.23965	0.0580	L	0.39326	1.205	0.80722	D	1	B;B;B;B;B	0.14012	0.002;0.009;0.009;0.009;0.009	B;B;B;B;B	0.26416	0.013;0.069;0.069;0.069;0.069	T	0.21999	-1.0229	10	0.87932	D	0	.	13.6597	0.62359	0.0:0.0:0.0:1.0	.	44;44;44;44;44	A6PW80;P68104;Q53HR5;Q6IPS9;Q5VTE0	.;EF1A1_HUMAN;.;.;EF1A3_HUMAN	E	44	ENSP00000339063:K44E;ENSP00000339053:K44E;ENSP00000330054:K44E;ENSP00000348651:K44E;ENSP00000392366:K44E	ENSP00000339053:K44E	K	-	1	0	EEF1A1	74286341	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	7.669000	0.83911	1.874000	0.54306	0.454000	0.30748	AAG	.	.	.	weak		0.423	EEF1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041210.2	NM_001402	
ZNF292	23036	hgsc.bcm.edu	37	6	87964665	87964665	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr6:87964665T>C	ENST00000369577.3	+	8	1361	c.1318T>C	c.(1318-1320)Tgg>Cgg	p.W440R	ZNF292_ENST00000339907.4_Missense_Mutation_p.W435R	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	440						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		GAAAACTCAATGGCCCTTTGA	0.378																																					p.W440R		Atlas-SNP	.											.	ZNF292	479	.	0			c.T1318C						PASS	.						75.0	69.0	71.0					6																	87964665		1844	4086	5930	SO:0001583	missense	23036	exon8			ACTCAATGGCCCT	AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.1318T>C	chr6.hg19:g.87964665T>C	ENSP00000358590:p.Trp440Arg	53.0	0.0	.		38.0	5.0	.	NM_015021	Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Missense_Mutation	SNP	ENST00000369577.3	hg19	CCDS47457.1	.	.	.	.	.	.	.	.	.	.	T	16.87	3.241783	0.58995	.	.	ENSG00000188994	ENST00000369577;ENST00000339907	T;T	0.39787	1.06;1.06	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.58424	0.2121	M	0.72894	2.215	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	T	0.63435	-0.6638	10	0.87932	D	0	.	16.6245	0.84952	0.0:0.0:0.0:1.0	.	440	O60281	ZN292_HUMAN	R	440;435	ENSP00000358590:W440R;ENSP00000342847:W435R	ENSP00000342847:W435R	W	+	1	0	ZNF292	88021384	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	8.040000	0.89188	2.323000	0.78572	0.528000	0.53228	TGG	.	.	.	none		0.378	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376192.2	NM_015021	
ANKIB1	54467	hgsc.bcm.edu	37	7	92019370	92019370	+	Silent	SNP	T	T	C			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr7:92019370T>C	ENST00000265742.3	+	15	2368	c.1992T>C	c.(1990-1992)taT>taC	p.Y664Y		NM_019004.1	NP_061877.1	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1	664							zinc ion binding (GO:0008270)			cervix(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(19)|skin(1)	41	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			AGTGTTCTTATCCATATGGAT	0.333																																					p.Y664Y		Atlas-SNP	.											.	ANKIB1	92	.	0			c.T1992C						PASS	.						107.0	102.0	103.0					7																	92019370		1828	4082	5910	SO:0001819	synonymous_variant	54467	exon15			TTCTTATCCATAT	AB037807	CCDS47639.1	7q21.3	2013-01-10			ENSG00000001629	ENSG00000001629		"""Ankyrin repeat domain containing"""	22215	protein-coding gene	gene with protein product							Standard	NM_019004		Approved	DKFZP434A0225, KIAA1386	uc003ulw.2	Q9P2G1	OTTHUMG00000155859	ENST00000265742.3:c.1992T>C	chr7.hg19:g.92019370T>C		109.0	0.0	.		120.0	29.0	.	NM_019004	Q6GMS4|Q6P3S9|Q9NTD7|Q9NW49	Silent	SNP	ENST00000265742.3	hg19	CCDS47639.1																																																																																			.	.	.	none		0.333	ANKIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342018.1		
SLC26A5	375611	hgsc.bcm.edu	37	7	103019735	103019735	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr7:103019735A>C	ENST00000306312.3	-	16	1893	c.1632T>G	c.(1630-1632)atT>atG	p.I544M	SLC26A5_ENST00000393723.1_Missense_Mutation_p.I512M|SLC26A5_ENST00000356767.4_Intron|SLC26A5_ENST00000393735.2_Intron|SLC26A5_ENST00000393727.1_Missense_Mutation_p.I544M|SLC26A5_ENST00000354356.4_De_novo_Start_InFrame|SLC26A5_ENST00000393730.1_Missense_Mutation_p.I512M|SLC26A5_ENST00000393729.1_Missense_Mutation_p.I507M|SLC26A5_ENST00000432958.2_Missense_Mutation_p.I512M|SLC26A5_ENST00000339444.6_Missense_Mutation_p.I544M	NM_198999.2	NP_945350.1	P58743	S26A5_HUMAN	solute carrier family 26 (anion exchanger), member 5	544	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.				regulation of cell shape (GO:0008360)|regulation of membrane potential (GO:0042391)|sensory perception of sound (GO:0007605)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)	secondary active sulfate transmembrane transporter activity (GO:0008271)			endometrium(5)|kidney(2)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)	43						TTGCATAGTAAATTGGTGCAT	0.318																																					p.I544M		Atlas-SNP	.											.	SLC26A5	231	.	0			c.T1632G						PASS	.						112.0	107.0	109.0					7																	103019735		2203	4299	6502	SO:0001583	missense	375611	exon16			ATAGTAAATTGGT	AC005064	CCDS5733.1, CCDS43630.1, CCDS55150.1, CCDS5732.1, CCDS43629.1	7q22	2013-07-18	2013-07-18	2005-09-13	ENSG00000170615	ENSG00000170615		"""Solute carriers"""	9359	protein-coding gene	gene with protein product	"""deafness, neurosensory, autosomal recessive, 61"""	604943	"""prestin (motor protein)"""	PRES		10821263	Standard	NM_206883		Approved	DFNB61	uc003vbz.3	P58743	OTTHUMG00000149911	ENST00000306312.3:c.1632T>G	chr7.hg19:g.103019735A>C	ENSP00000304783:p.Ile544Met	113.0	0.0	.		100.0	34.0	.	NM_206883	Q496J2|Q7Z7F3|Q86UF8|Q86UF9|Q86UG0	Missense_Mutation	SNP	ENST00000306312.3	hg19	CCDS5733.1	.	.	.	.	.	.	.	.	.	.	A	16.19	3.052577	0.55218	.	.	ENSG00000170615	ENST00000339444;ENST00000306312;ENST00000393730;ENST00000432958;ENST00000393729;ENST00000393727;ENST00000393723	D;D;D;D;D;D;D	0.94862	-3.54;-3.54;-3.54;-3.54;-3.54;-3.54;-3.54	6.13	4.99	0.66335	Sulphate transporter/antisigma-factor antagonist STAS (4);	0.151455	0.56097	D	0.000021	D	0.96288	0.8789	M	0.82056	2.57	0.80722	D	1	P;D;D	0.67145	0.645;0.996;0.995	P;D;D	0.67382	0.643;0.951;0.918	D	0.95580	0.8645	10	0.49607	T	0.09	.	8.2331	0.31610	0.8582:0.0:0.1418:0.0	.	544;512;544	P58743;Q496J2;P58743-2	S26A5_HUMAN;.;.	M	544;544;512;512;507;544;512	ENSP00000342396:I544M;ENSP00000304783:I544M;ENSP00000377331:I512M;ENSP00000389733:I512M;ENSP00000377330:I507M;ENSP00000377328:I544M;ENSP00000377324:I512M	ENSP00000304783:I544M	I	-	3	3	SLC26A5	102806971	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.023000	0.30065	2.364000	0.80123	0.524000	0.50904	ATT	.	.	.	none		0.318	SLC26A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313860.1	NM_198999	
UBE3C	9690	hgsc.bcm.edu	37	7	157046775	157046775	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr7:157046775A>G	ENST00000348165.5	+	20	3182	c.2822A>G	c.(2821-2823)cAg>cGg	p.Q941R		NM_014671.2	NP_055486.2	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	941	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(2)|endometrium(3)|kidney(16)|large_intestine(13)|lung(25)|ovary(2)|prostate(1)|urinary_tract(1)	63		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		GCTTTCCGCCAGGGCCTTGCC	0.567																																					p.Q941R		Atlas-SNP	.											.	UBE3C	124	.	0			c.A2822G						PASS	.						56.0	53.0	54.0					7																	157046775		2203	4300	6503	SO:0001583	missense	9690	exon20			TCCGCCAGGGCCT	AK127280	CCDS34789.1	7q36.3	2004-05-04			ENSG00000009335	ENSG00000009335			16803	protein-coding gene	gene with protein product		614454				7584026, 11278995	Standard	NM_014671		Approved	KIAA0010, KIAA10	uc010lqs.3	Q15386	OTTHUMG00000157239	ENST00000348165.5:c.2822A>G	chr7.hg19:g.157046775A>G	ENSP00000309198:p.Gln941Arg	59.0	0.0	.		60.0	21.0	.	NM_014671	A4D235|A6NCP3|Q8TC15|Q96CR4|Q9UDU3	Missense_Mutation	SNP	ENST00000348165.5	hg19	CCDS34789.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.268398	0.80469	.	.	ENSG00000009335	ENST00000348165	T	0.56103	0.48	5.31	5.31	0.75309	HECT (4);	0.000000	0.85682	D	0.000000	T	0.45115	0.1326	N	0.20610	0.595	0.80722	D	1	B;P	0.38677	0.437;0.642	P;P	0.48334	0.475;0.574	T	0.30357	-0.9981	10	0.05833	T	0.94	.	15.5565	0.76200	1.0:0.0:0.0:0.0	.	941;794	Q15386;B4DHJ9	UBE3C_HUMAN;.	R	941	ENSP00000309198:Q941R	ENSP00000309198:Q941R	Q	+	2	0	UBE3C	156739536	1.000000	0.71417	0.996000	0.52242	0.769000	0.43574	8.946000	0.92992	2.143000	0.66587	0.533000	0.62120	CAG	.	.	.	none		0.567	UBE3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348108.1	NM_014671	
PDLIM2	64236	hgsc.bcm.edu	37	8	22452077	22452077	+	IGR	SNP	C	C	T			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr8:22452077C>T	ENST00000397760.4	+	0	1837				AC037459.4_ENST00000430850.2_Intron|PDLIM2_ENST00000265810.4_Missense_Mutation_p.S339L			Q96JY6	PDLI2_HUMAN	PDZ and LIM domain 2 (mystique)							actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(1)	9		Prostate(55;0.0421)|Breast(100;0.102)|all_epithelial(46;0.142)		BRCA - Breast invasive adenocarcinoma(99;0.00579)|Colorectal(74;0.0152)|COAD - Colon adenocarcinoma(73;0.0626)		ATGAGATTGTCACTGGAAGCT	0.527																																					p.S339L		Atlas-SNP	.											.	PDLIM2	42	.	0			c.C1016T						PASS	.						167.0	167.0	167.0					8																	22452077		2203	4300	6503	SO:0001628	intergenic_variant	64236	exon10			GATTGTCACTGGA	AY007729	CCDS34860.1, CCDS6032.1, CCDS34861.1, CCDS6032.2	8p21.3	2012-06-27			ENSG00000120913	ENSG00000120913			13992	protein-coding gene	gene with protein product		609722					Standard	NM_021630		Approved		uc003xby.4	Q96JY6	OTTHUMG00000164270		chr8.hg19:g.22452077C>T		193.0	0.0	.		167.0	11.0	.	NM_176871	D3DSR5|J3KNH4|Q7Z584|Q86WM8|Q8WZ29|Q9H4L9|Q9H7I2	Missense_Mutation	SNP	ENST00000397760.4	hg19		.	.	.	.	.	.	.	.	.	.	C	13.63	2.293984	0.40594	.	.	ENSG00000120913	ENST00000265810	T	0.13538	2.58	1.84	0.907	0.19321	.	.	.	.	.	T	0.08582	0.0213	.	.	.	0.09310	N	0.999999	B	0.23185	0.081	B	0.15052	0.012	T	0.31971	-0.9924	8	0.49607	T	0.09	.	3.5437	0.07820	0.0:0.7384:0.0:0.2616	.	339	Q96JY6-3	.	L	339	ENSP00000265810:S339L	ENSP00000265810:S339L	S	+	2	0	PDLIM2	22508022	0.004000	0.15560	0.006000	0.13384	0.019000	0.09904	0.023000	0.13533	0.318000	0.23185	0.491000	0.48974	TCA	.	.	.	none		0.527	PDLIM2-202	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000334167.1		
SLC7A13	157724	hgsc.bcm.edu	37	8	87226722	87226722	+	Nonsense_Mutation	SNP	T	T	A			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr8:87226722T>A	ENST00000297524.3	-	4	1436	c.1333A>T	c.(1333-1335)Aga>Tga	p.R445*	SLC7A13_ENST00000419776.2_3'UTR|CTD-3118D11.3_ENST00000523112.1_RNA	NM_138817.2	NP_620172.2	Q8TCU3	S7A13_HUMAN	solute carrier family 7 (anionic amino acid transporter), member 13	445						integral component of membrane (GO:0016021)	amino acid transmembrane transporter activity (GO:0015171)	p.R445*(1)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	45						CAAGCCAATCTTATTTTAAAA	0.348																																					p.R445X		Atlas-SNP	.											SLC7A13,colon,carcinoma,0,1	SLC7A13	97	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.A1333T						PASS	.						56.0	61.0	60.0					8																	87226722		2203	4300	6503	SO:0001587	stop_gained	157724	exon4			CCAATCTTATTTT	AJ417661	CCDS34917.1	8q21.3	2013-07-15	2011-07-12		ENSG00000164893	ENSG00000164893		"""Solute carriers"""	23092	protein-coding gene	gene with protein product						11907033, 11943479	Standard	XM_005250804		Approved	AGT-1, XAT2	uc003ydq.1	Q8TCU3	OTTHUMG00000163663	ENST00000297524.3:c.1333A>T	chr8.hg19:g.87226722T>A	ENSP00000297524:p.Arg445*	72.0	0.0	.		53.0	17.0	.	NM_138817	Q05C37|Q08AH9|Q96N84	Nonsense_Mutation	SNP	ENST00000297524.3	hg19	CCDS34917.1	.	.	.	.	.	.	.	.	.	.	T	12.75	2.030925	0.35797	.	.	ENSG00000164893	ENST00000297524	.	.	.	4.13	-0.155	0.13395	.	0.844613	0.10208	N	0.702444	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	.	5.8345	0.18599	0.0:0.1058:0.4904:0.4039	.	.	.	.	X	445	.	ENSP00000297524:R445X	R	-	1	2	SLC7A13	87295838	0.001000	0.12720	0.000000	0.03702	0.068000	0.16541	1.079000	0.30766	0.195000	0.20347	0.533000	0.62120	AGA	.	.	.	none		0.348	SLC7A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374704.1	NM_138817	
ZHX2	22882	hgsc.bcm.edu	37	8	123965936	123965936	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr8:123965936A>C	ENST00000314393.4	+	3	3021	c.2186A>C	c.(2185-2187)cAa>cCa	p.Q729P		NM_014943.3	NP_055758.1	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	729					mRNA catabolic process (GO:0006402)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	45	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			GTGGTTCCACAATATTACAAG	0.527																																					p.Q729P	Esophageal Squamous(94;1056 1388 11767 13799 49639)	Atlas-SNP	.											.	ZHX2	106	.	0			c.A2186C						PASS	.						96.0	101.0	100.0					8																	123965936		2203	4300	6503	SO:0001583	missense	22882	exon3			TTCCACAATATTA	AB020661	CCDS6336.1	8q24.13	2012-03-09	2004-01-23		ENSG00000178764	ENSG00000178764		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	18513	protein-coding gene	gene with protein product		609185	"""zinc-fingers and homeoboxes 2"""			10048485, 12741956	Standard	XM_005250837		Approved	KIAA0854	uc003ypk.1	Q9Y6X8	OTTHUMG00000165077	ENST00000314393.4:c.2186A>C	chr8.hg19:g.123965936A>C	ENSP00000314709:p.Gln729Pro	128.0	0.0	.		107.0	27.0	.	NM_014943		Missense_Mutation	SNP	ENST00000314393.4	hg19	CCDS6336.1	.	.	.	.	.	.	.	.	.	.	A	4.171	0.030196	0.08101	.	.	ENSG00000178764	ENST00000314393	T	0.18502	2.21	5.94	0.233	0.15386	.	0.814635	0.11109	N	0.598853	T	0.09202	0.0227	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.33085	-0.9882	10	0.36615	T	0.2	-0.5406	4.2111	0.10512	0.4285:0.383:0.0659:0.1227	.	729	Q9Y6X8	ZHX2_HUMAN	P	729	ENSP00000314709:Q729P	ENSP00000314709:Q729P	Q	+	2	0	ZHX2	124035117	0.000000	0.05858	0.002000	0.10522	0.014000	0.08584	0.379000	0.20585	0.099000	0.17552	-0.466000	0.05196	CAA	.	.	.	none		0.527	ZHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381709.1	NM_014943	
EPC1	80314	hgsc.bcm.edu	37	10	32582651	32582651	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr10:32582651C>A	ENST00000263062.8	-	3	597	c.328G>T	c.(328-330)Gct>Tct	p.A110S	EPC1_ENST00000375110.2_Missense_Mutation_p.A60S|EPC1_ENST00000319778.6_Missense_Mutation_p.A110S	NM_025209.2	NP_079485.1	Q9H2F5	EPC1_HUMAN	enhancer of polycomb homolog 1 (Drosophila)	110					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(5)|urinary_tract(1)	24		Prostate(175;0.0199)				GGCTGTTCAGCATCCAAACTA	0.368																																					p.A110S		Atlas-SNP	.											.	EPC1	74	.	0			c.G328T						PASS	.						51.0	46.0	48.0					10																	32582651		2203	4300	6503	SO:0001583	missense	80314	exon3			GTTCAGCATCCAA	AF277374	CCDS7172.1, CCDS60511.1, CCDS73083.1	10p11	2005-12-12			ENSG00000120616	ENSG00000120616			19876	protein-coding gene	gene with protein product		610999				10976108	Standard	NM_025209		Approved	Epl1	uc001iwg.2	Q9H2F5	OTTHUMG00000017925	ENST00000263062.8:c.328G>T	chr10.hg19:g.32582651C>A	ENSP00000263062:p.Ala110Ser	54.0	0.0	.		37.0	11.0	.	NM_025209	B4DSC3|D3DRX7|Q5VW54|Q5VW56|Q5VW58|Q8NAQ4|Q8NE21|Q96LF4|Q96RR6|Q9H7T7	Missense_Mutation	SNP	ENST00000263062.8	hg19	CCDS7172.1	.	.	.	.	.	.	.	.	.	.	C	10.97	1.501195	0.26861	.	.	ENSG00000120616	ENST00000375110;ENST00000319778;ENST00000263062	T;T;T	0.40476	1.03;1.03;1.03	5.67	4.76	0.60689	Enhancer of polycomb-like, N-terminal (1);	0.091656	0.85682	D	0.000000	T	0.17959	0.0431	N	0.04508	-0.205	0.42849	D	0.994075	B;P;B;B	0.39022	0.073;0.655;0.02;0.073	B;B;B;B	0.30855	0.105;0.121;0.037;0.105	T	0.09509	-1.0671	10	0.10902	T	0.67	-6.3339	14.4806	0.67579	0.0:0.9292:0.0:0.0708	.	110;60;110;110	B8XCX7;Q9H2F5-3;Q9H2F5-2;Q9H2F5	.;.;.;EPC1_HUMAN	S	60;110;110	ENSP00000364251:A60S;ENSP00000318559:A110S;ENSP00000263062:A110S	ENSP00000263062:A110S	A	-	1	0	EPC1	32622657	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.957000	0.56730	1.389000	0.46526	0.467000	0.42956	GCT	.	.	.	none		0.368	EPC1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047484.1		
ZNF33B	7582	hgsc.bcm.edu	37	10	43088537	43088537	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr10:43088537T>G	ENST00000359467.3	-	5	1975	c.1861A>C	c.(1861-1863)Aag>Cag	p.K621Q	ZNF33B_ENST00000486187.1_RNA	NM_006955.1	NP_008886.1	Q06732	ZN33B_HUMAN	zinc finger protein 33B	621					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(15)|skin(1)|stomach(1)	29						AGTTGTGACTTCTGGCAGAAG	0.363																																					p.K621Q	Melanoma(137;1247 1767 16772 25727 43810)	Atlas-SNP	.											.	ZNF33B	78	.	0			c.A1861C						PASS	.						96.0	96.0	96.0					10																	43088537		2203	4300	6503	SO:0001583	missense	7582	exon5			GTGACTTCTGGCA	X68688, AJ491697	CCDS7198.1	10q11.2	2013-01-08	2005-03-18		ENSG00000196693	ENSG00000196693		"""Zinc fingers, C2H2-type"", ""-"""	13097	protein-coding gene	gene with protein product		194522	"""zinc finger protein 33b (KOX 31)"", ""zinc finger protein 11B"""	ZNF11B		2014798	Standard	NM_006955		Approved	KOX31, KOX2	uc001jaf.1	Q06732	OTTHUMG00000018014	ENST00000359467.3:c.1861A>C	chr10.hg19:g.43088537T>G	ENSP00000352444:p.Lys621Gln	205.0	0.0	.		183.0	42.0	.	NM_006955	Q06731|Q32MA2|Q86XY8|Q8NDW3	Missense_Mutation	SNP	ENST00000359467.3	hg19	CCDS7198.1	.	.	.	.	.	.	.	.	.	.	T	9.434	1.086178	0.20390	.	.	ENSG00000196693	ENST00000359467;ENST00000395836	T	0.01015	5.44	2.58	2.58	0.30949	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.35646	N	0.003071	T	0.02807	0.0084	L	0.56124	1.755	0.09310	N	1	D	0.71674	0.998	D	0.68621	0.959	T	0.40021	-0.9585	10	0.38643	T	0.18	.	9.025	0.36224	0.0:0.0:0.0:1.0	.	621	Q06732	ZN33B_HUMAN	Q	621;587	ENSP00000352444:K621Q	ENSP00000352444:K621Q	K	-	1	0	ZNF33B	42408543	0.000000	0.05858	1.000000	0.80357	0.991000	0.79684	0.848000	0.27710	1.446000	0.47643	0.336000	0.21669	AAG	.	.	.	none		0.363	ZNF33B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_006955	
SLC39A5	283375	hgsc.bcm.edu	37	12	56630209	56630209	+	Silent	SNP	C	C	G	rs139155884	byFrequency	TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr12:56630209C>G	ENST00000266980.4	+	7	1268	c.975C>G	c.(973-975)ctC>ctG	p.L325L	ANKRD52_ENST00000548241.1_5'Flank|SLC39A5_ENST00000454355.2_Silent_p.L325L	NM_001135195.1	NP_001128667.1	Q6ZMH5	S39A5_HUMAN	solute carrier family 39 (zinc transporter), member 5	325					cellular response to zinc ion starvation (GO:0034224)|G1 to G0 transition involved in cell differentiation (GO:0070315)|neural precursor cell proliferation (GO:0061351)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)			NS(1)|cervix(6)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						GAAGGAATCTCGAAACACGCA	0.557																																					p.L325L		Atlas-SNP	.											.	SLC39A5	52	.	0			c.C975G						PASS	.						134.0	129.0	131.0					12																	56630209		2203	4300	6503	SO:0001819	synonymous_variant	283375	exon9			GAATCTCGAAACA		CCDS8912.2	12q13.3	2013-07-17	2013-07-17		ENSG00000139540	ENSG00000139540		"""Solute carriers"""	20502	protein-coding gene	gene with protein product		608730	"""solute carrier family 39 (metal ion transporter), member 5"""				Standard	NM_173596		Approved		uc010sqj.2	Q6ZMH5	OTTHUMG00000156962	ENST00000266980.4:c.975C>G	chr12.hg19:g.56630209C>G		86.0	0.0	.		100.0	27.0	.	NM_173596	B2R808|Q8N6Y3	Silent	SNP	ENST00000266980.4	hg19	CCDS8912.2																																																																																			.	C|0.999;T|0.001	.	alt		0.557	SLC39A5-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346834.1	NM_173596	
STAT2	6773	hgsc.bcm.edu	37	12	56742947	56742947	+	Splice_Site	SNP	C	C	T			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr12:56742947C>T	ENST00000314128.4	-	16	1463	c.1440G>A	c.(1438-1440)caG>caA	p.Q480Q	STAT2_ENST00000557235.1_Splice_Site_p.Q476Q|STAT2_ENST00000556539.1_5'UTR|STAT2_ENST00000418572.2_Intron			P52630	STAT2_HUMAN	signal transducer and activator of transcription 2, 113kDa	480					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|skin(3)	31						ACTCCCCTACCTGAAGGTTTG	0.562																																					p.Q480Q		Atlas-SNP	.											.	STAT2	70	.	0			c.G1440A						PASS	.						93.0	93.0	93.0					12																	56742947		2203	4300	6503	SO:0001630	splice_region_variant	6773	exon16			CCCTACCTGAAGG	BC051284	CCDS8917.1, CCDS55836.1	12q13.2	2013-02-14	2002-08-29			ENSG00000170581		"""SH2 domain containing"""	11363	protein-coding gene	gene with protein product		600556	"""signal transducer and activator of transcription 2, 113kD"""			7885841	Standard	NM_005419		Approved	STAT113	uc001slc.3	P52630		ENST00000314128.4:c.1440+1G>A	chr12.hg19:g.56742947C>T		165.0	0.0	.		160.0	41.0	.	NM_005419	B4DLC7|G3V2M6|Q16430|Q16431|Q9UDL4	Silent	SNP	ENST00000314128.4	hg19	CCDS8917.1																																																																																			.	.	.	none		0.562	STAT2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410277.1	NM_005419	Silent
FREM2	341640	hgsc.bcm.edu	37	13	39265553	39265553	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr13:39265553A>G	ENST00000280481.7	+	1	4288	c.4072A>G	c.(4072-4074)Act>Gct	p.T1358A		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	1358					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		ACGAAAACCTACTGGTGCCTT	0.383																																					p.T1358A		Atlas-SNP	.											.	FREM2	385	.	0			c.A4072G						PASS	.						64.0	65.0	64.0					13																	39265553		2203	4300	6503	SO:0001583	missense	341640	exon1			AAACCTACTGGTG	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.4072A>G	chr13.hg19:g.39265553A>G	ENSP00000280481:p.Thr1358Ala	97.0	0.0	.		98.0	23.0	.	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	hg19	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	A	0.011	-1.720360	0.00700	.	.	ENSG00000150893	ENST00000280481	T	0.40756	1.02	5.81	-0.554	0.11811	.	1.289890	0.04720	N	0.419174	T	0.13927	0.0337	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.19063	-1.0317	10	0.08837	T	0.75	.	1.7548	0.02980	0.3096:0.2411:0.3249:0.1243	.	1358	Q5SZK8	FREM2_HUMAN	A	1358	ENSP00000280481:T1358A	ENSP00000280481:T1358A	T	+	1	0	FREM2	38163553	0.000000	0.05858	0.001000	0.08648	0.731000	0.41821	0.004000	0.13106	0.122000	0.18314	0.533000	0.62120	ACT	.	.	.	none		0.383	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
MLNR	2862	hgsc.bcm.edu	37	13	49796387	49796387	+	Silent	SNP	C	C	G			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr13:49796387C>G	ENST00000218721.1	+	2	1113	c.1113C>G	c.(1111-1113)ctC>ctG	p.L371L	MLNR_ENST00000398307.1_3'UTR	NM_001507.1	NP_001498.1	O43193	MTLR_HUMAN	motilin receptor	371					digestion (GO:0007586)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|growth hormone-releasing hormone receptor activity (GO:0016520)			endometrium(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)	14		all_lung(13;8.31e-06)|Lung NSC(96;0.000251)|Breast(56;0.0008)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;6.1e-09)		AACTGCTGCTCGCAAGGAAGT	0.547																																					p.L371L		Atlas-SNP	.											MLNR,NS,carcinoma,0,1	MLNR	26	.	0			c.C1113G						PASS	.						81.0	81.0	81.0					13																	49796387		2203	4300	6503	SO:0001819	synonymous_variant	2862	exon2			GCTGCTCGCAAGG	AF034632	CCDS9414.1	13q14-q21	2012-08-08	2004-05-27	2004-05-28	ENSG00000102539	ENSG00000102539		"""GPCR / Class A : Motilin receptors"""	4495	protein-coding gene	gene with protein product		602885	"""G protein-coupled receptor 38"""	GPR38		9441746	Standard	NM_001507		Approved		uc010tgj.2	O43193	OTTHUMG00000016909	ENST00000218721.1:c.1113C>G	chr13.hg19:g.49796387C>G		119.0	1.0	.		85.0	24.0	.	NM_001507		Silent	SNP	ENST00000218721.1	hg19	CCDS9414.1																																																																																			.	.	.	none		0.547	MLNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044897.1	NM_001507	
TSC2	7249	hgsc.bcm.edu	37	16	2122849	2122849	+	Splice_Site	SNP	G	G	A	rs45517218		TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr16:2122849G>A	ENST00000219476.3	+	21	2850		c.e21-1		TSC2_ENST00000353929.4_Splice_Site|TSC2_ENST00000568454.1_Splice_Site|TSC2_ENST00000439673.2_Splice_Site|TSC2_ENST00000350773.4_Splice_Site|TSC2_ENST00000382538.6_Splice_Site|TSC2_ENST00000401874.2_Splice_Site	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2						acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				TTGGTCATCAGCTTTCAGGCC	0.627			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												.		Atlas-SNP	.	yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	TSC2_ENST00000219476,colon,carcinoma,0,2	TSC2	364	.	0			c.2221-1G>A						PASS	.						53.0	58.0	56.0					16																	2122849		2198	4300	6498	SO:0001630	splice_region_variant	7249	exon21	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	TCATCAGCTTTCA	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.2221-1G>A	chr16.hg19:g.2122849G>A		102.0	0.0	.		60.0	29.0	.	NM_000548	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Splice_Site	SNP	ENST00000219476.3	hg19	CCDS10458.1	.	.	.	.	.	.	.	.	.	.	G	13.55	2.269512	0.40095	.	.	ENSG00000103197	ENST00000219476;ENST00000401874;ENST00000353929;ENST00000439673;ENST00000382538;ENST00000350773	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3044	0.94155	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TSC2	2062850	1.000000	0.71417	0.996000	0.52242	0.714000	0.41099	7.284000	0.78650	2.551000	0.86045	0.655000	0.94253	.	.	.	.	alt		0.627	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250657.2	NM_000548	Intron
NLRC3	197358	hgsc.bcm.edu	37	16	3598164	3598164	+	RNA	SNP	T	T	C			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr16:3598164T>C	ENST00000301749.7	-	0	3147				NLRC3_ENST00000603507.1_RNA|LA16c-390H2.4_ENST00000573820.1_RNA|NLRC3_ENST00000419350.2_RNA|NLRC3_ENST00000448023.2_RNA|NLRC3_ENST00000359128.5_RNA	NM_178844.2	NP_849172.2	Q7RTR2	NLRC3_HUMAN	NLR family, CARD domain containing 3						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of protein ubiquitination (GO:0031396)|response to lipopolysaccharide (GO:0032496)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(16)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						TGTTGAGCTGTAGTGCTTGTC	0.587																																					p.L914L		Atlas-SNP	.											.	NLRC3	103	.	0			c.A2742G						PASS	.						33.0	35.0	34.0					16																	3598164		1962	4132	6094			197358	exon16			GAGCTGTAGTGCT	BK001112	CCDS73817.1	16p13.3	2014-03-25			ENSG00000167984	ENSG00000167984		"""Nucleotide-binding domain and leucine rich repeat containing"""	29889	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 3"", ""NOD-like receptor C3"""	615648				15705585, 12766759	Standard	NM_178844		Approved	CLR16.2, FLJ00348, NOD3	uc010btn.3	Q7RTR2	OTTHUMG00000177561		chr16.hg19:g.3598164T>C		10.0	0.0	.		9.0	8.0	.	NM_178844	Q5EY36|Q8NF48|Q8NI01|Q8NI02|Q8TEL3	Silent	SNP	ENST00000301749.7	hg19																																																																																				.	.	.	none		0.587	NLRC3-201	KNOWN	basic|appris_principal	protein_coding	polymorphic_pseudogene		NM_178844	
NOS2	4843	hgsc.bcm.edu	37	17	26107895	26107895	+	Missense_Mutation	SNP	C	C	A	rs200678947		TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr17:26107895C>A	ENST00000313735.6	-	9	1135	c.902G>T	c.(901-903)cGc>cTc	p.R301L		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	301					arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	CACATCGAAGCGGCCGTACTT	0.627																																					p.R301L		Atlas-SNP	.											NOS2,NS,carcinoma,0,1	NOS2	113	.	0			c.G902T						PASS	.						58.0	54.0	56.0					17																	26107895		2203	4300	6503	SO:0001583	missense	4843	exon9			TCGAAGCGGCCGT	U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.902G>T	chr17.hg19:g.26107895C>A	ENSP00000327251:p.Arg301Leu	65.0	0.0	.		66.0	3.0	.	NM_000625	A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Missense_Mutation	SNP	ENST00000313735.6	hg19	CCDS11223.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.545019	0.86022	.	.	ENSG00000007171	ENST00000313735;ENST00000302153	T	0.23147	1.92	5.33	5.33	0.75918	Nitric oxide synthase, oxygenase domain (2);	0.000000	0.85682	D	0.000000	T	0.30947	0.0781	M	0.70903	2.155	0.80722	D	1	P;B	0.35628	0.513;0.012	B;B	0.30251	0.113;0.015	T	0.17745	-1.0359	10	0.56958	D	0.05	.	18.0142	0.89233	0.0:1.0:0.0:0.0	.	301;301	F8WEM3;P35228	.;NOS2_HUMAN	L	301	ENSP00000327251:R301L	ENSP00000305638:R301L	R	-	2	0	NOS2	23132022	1.000000	0.71417	1.000000	0.80357	0.373000	0.29922	4.831000	0.62752	2.465000	0.83290	0.655000	0.94253	CGC	.	.	.	alt		0.627	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255597.1	NM_000625	
SLC38A10	124565	hgsc.bcm.edu	37	17	79220316	79220316	+	Silent	SNP	C	C	T			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr17:79220316C>T	ENST00000374759.3	-	16	2783	c.2400G>A	c.(2398-2400)caG>caA	p.Q800Q		NM_001037984.1	NP_001033073.1	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10	800					amino acid transport (GO:0006865)|bone development (GO:0060348)|sodium ion transport (GO:0006814)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			CCAGGGAGCGCTGGTTAAGGT	0.682																																					p.Q800Q		Atlas-SNP	.											.	SLC38A10	133	.	0			c.G2400A						PASS	.						18.0	20.0	19.0					17																	79220316		1869	4067	5936	SO:0001819	synonymous_variant	124565	exon16			GGAGCGCTGGTTA	BC014642	CCDS11780.1, CCDS42397.1	17q25.3	2013-05-22			ENSG00000157637	ENSG00000157637		"""Solute carriers"""	28237	protein-coding gene	gene with protein product							Standard	XM_005257019		Approved	MGC15523, PP1744	uc002jzz.1	Q9HBR0	OTTHUMG00000168049	ENST00000374759.3:c.2400G>A	chr17.hg19:g.79220316C>T		53.0	0.0	.		45.0	13.0	.	NM_001037984	Q6ZRC5|Q8NA99|Q96C66	Silent	SNP	ENST00000374759.3	hg19	CCDS42397.1																																																																																			.	.	.	none		0.682	SLC38A10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397747.1	NM_138570	
ZNF532	55205	hgsc.bcm.edu	37	18	56587630	56587630	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr18:56587630C>T	ENST00000336078.4	+	4	2887	c.2111C>T	c.(2110-2112)aCt>aTt	p.T704I	ZNF532_ENST00000591230.1_Missense_Mutation_p.T704I|ZNF532_ENST00000589288.1_Missense_Mutation_p.T704I|ZNF532_ENST00000591083.1_Missense_Mutation_p.T704I|ZNF532_ENST00000591808.1_Missense_Mutation_p.T704I	NM_018181.4	NP_060651.2	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	704					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(14)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(4)|urinary_tract(1)	52						TCAACTTCCACTCTTCAGAGC	0.473																																					p.T704I		Atlas-SNP	.											.	ZNF532	108	.	0			c.C2111T						PASS	.						63.0	67.0	65.0					18																	56587630		2203	4300	6503	SO:0001583	missense	55205	exon4			CTTCCACTCTTCA	AB046849	CCDS11969.1	18q21.32	2005-08-22			ENSG00000074657	ENSG00000074657		"""Zinc fingers, C2H2-type"""	30940	protein-coding gene	gene with protein product						10997877	Standard	XM_005266723		Approved	FLJ10697	uc002lho.3	Q9HCE3	OTTHUMG00000132759	ENST00000336078.4:c.2111C>T	chr18.hg19:g.56587630C>T	ENSP00000338217:p.Thr704Ile	74.0	0.0	.		80.0	18.0	.	NM_018181	Q4G0V6|Q7L7Z7|Q96QR7|Q9NVJ6	Missense_Mutation	SNP	ENST00000336078.4	hg19	CCDS11969.1	.	.	.	.	.	.	.	.	.	.	c	2.772	-0.255447	0.05829	.	.	ENSG00000074657	ENST00000336078	T	0.32515	1.45	5.43	4.55	0.56014	.	0.394325	0.27526	N	0.018974	T	0.17023	0.0409	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.13845	-1.0494	10	0.35671	T	0.21	-5.4027	8.1333	0.31039	0.0:0.7358:0.1536:0.1107	.	704	Q9HCE3	ZN532_HUMAN	I	704	ENSP00000338217:T704I	ENSP00000338217:T704I	T	+	2	0	ZNF532	54738610	0.026000	0.19158	0.014000	0.15608	0.567000	0.35839	2.740000	0.47418	1.298000	0.44778	0.544000	0.68410	ACT	.	.	.	none		0.473	ZNF532-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256130.1	NM_018181	
ZNF57	126295	hgsc.bcm.edu	37	19	2916127	2916127	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr19:2916127A>C	ENST00000306908.5	+	3	330	c.182A>C	c.(181-183)tAc>tCc	p.Y61S	ZNF57_ENST00000523428.1_Missense_Mutation_p.Y29S|AC006277.2_ENST00000520090.2_RNA	NM_173480.2	NP_775751.1	Q68EA5	ZNF57_HUMAN	zinc finger protein 57	61	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(5)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|GBM - Glioblastoma multiforme(1328;0.00161)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGGATATGTACGGGCAAGAA	0.363																																					p.Y61S	NSCLC(150;910 1964 4303 10464 26498)	Atlas-SNP	.											.	ZNF57	57	.	0			c.A182C						PASS	.						125.0	111.0	116.0					19																	2916127		2203	4300	6503	SO:0001583	missense	126295	exon3			ATATGTACGGGCA	M88368	CCDS12098.1	19p13.3	2013-01-08			ENSG00000171970	ENSG00000171970		"""Zinc fingers, C2H2-type"", ""-"""	13125	protein-coding gene	gene with protein product			"""zinc finger protein 424"""	ZNF424		1505991	Standard	NM_173480		Approved		uc002lwr.3	Q68EA5	OTTHUMG00000164485	ENST00000306908.5:c.182A>C	chr19.hg19:g.2916127A>C	ENSP00000303696:p.Tyr61Ser	113.0	0.0	.		96.0	4.0	.	NM_173480	Q8N6R9	Missense_Mutation	SNP	ENST00000306908.5	hg19	CCDS12098.1	.	.	.	.	.	.	.	.	.	.	A	6.519	0.463953	0.12402	.	.	ENSG00000171970	ENST00000306908;ENST00000395204;ENST00000522294;ENST00000523428	T;T;T	0.05258	3.58;6.04;3.47	1.38	1.38	0.22167	Krueppel-associated box (2);	.	.	.	.	T	0.02610	0.0079	N	0.12569	0.235	0.09310	N	1	B	0.33494	0.414	B	0.18263	0.021	T	0.45041	-0.9288	9	0.20519	T	0.43	.	4.9023	0.13781	1.0:0.0:0.0:0.0	.	61	Q68EA5	ZNF57_HUMAN	S	61;61;29;29	ENSP00000303696:Y61S;ENSP00000430905:Y29S;ENSP00000430223:Y29S	ENSP00000303696:Y61S	Y	+	2	0	ZNF57	2867127	0.000000	0.05858	0.001000	0.08648	0.026000	0.11368	-1.333000	0.02667	0.877000	0.35895	0.486000	0.48141	TAC	.	.	.	none		0.363	ZNF57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378969.1	NM_173480	
HNRNPUL1	11100	hgsc.bcm.edu	37	19	41800265	41800265	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr19:41800265C>G	ENST00000392006.3	+	9	1462	c.1289C>G	c.(1288-1290)cCt>cGt	p.P430R	HNRNPUL1_ENST00000593587.1_Missense_Mutation_p.P330R|HNRNPUL1_ENST00000602130.1_Missense_Mutation_p.P430R|HNRNPUL1_ENST00000595018.1_Missense_Mutation_p.P330R|HNRNPUL1_ENST00000378215.4_Missense_Mutation_p.P316R|HNRNPUL1_ENST00000352456.3_Missense_Mutation_p.P330R|HNRNPUL1_ENST00000263367.3_Missense_Mutation_p.P341R	NM_007040.3	NP_008971.2	Q9BUJ2	HNRL1_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 1	430	Necessary for interaction with TP53.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	29						GTGGGCCTGCCTGCTGCTGGC	0.537																																					p.P430R		Atlas-SNP	.											.	HNRNPUL1	73	.	0			c.C1289G						PASS	.						166.0	120.0	135.0					19																	41800265		2203	4300	6503	SO:0001583	missense	11100	exon9			GCCTGCCTGCTGC	AJ007509	CCDS12576.1, CCDS12577.1	19q13.2	2013-06-12		2008-04-18	ENSG00000105323	ENSG00000105323			17011	protein-coding gene	gene with protein product	"""E1B 55kDa associated protein 5"""	605800		HNRPUL1		9733834, 12489984	Standard	XM_005258459		Approved	E1B-AP5, E1BAP5, FLJ12944	uc002oqb.4	Q9BUJ2	OTTHUMG00000182740	ENST00000392006.3:c.1289C>G	chr19.hg19:g.41800265C>G	ENSP00000375863:p.Pro430Arg	89.0	0.0	.		69.0	15.0	.	NM_007040	B3KMW7|O76022|Q6ZSZ0|Q7L8P4|Q8N6Z4|Q96G37|Q9HAL3|Q9UG75	Missense_Mutation	SNP	ENST00000392006.3	hg19	CCDS12576.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.717475	0.89205	.	.	ENSG00000105323	ENST00000352456;ENST00000392006;ENST00000378215;ENST00000263367	T;T;T;T	0.54479	0.57;0.57;0.57;0.57	5.46	5.46	0.80206	.	0.105015	0.64402	D	0.000003	T	0.78685	0.4322	M	0.90425	3.115	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.973;1.0;1.0	D;D;D;P;D;D	0.97110	0.999;0.999;0.999;0.816;1.0;0.999	T	0.82489	-0.0432	10	0.87932	D	0	-7.8178	18.2528	0.90009	0.0:1.0:0.0:0.0	.	341;330;430;316;430;330	B7Z4B8;A8K3W4;Q9BUJ2-2;Q9BUJ2-3;Q9BUJ2;Q9BUJ2-4	.;.;.;.;HNRL1_HUMAN;.	R	330;430;316;341	ENSP00000340857:P330R;ENSP00000375863:P430R;ENSP00000367460:P316R;ENSP00000263367:P341R	ENSP00000263367:P341R	P	+	2	0	HNRNPUL1	46492105	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.557000	0.82243	2.840000	0.97914	0.655000	0.94253	CCT	.	.	.	none		0.537	HNRNPUL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463406.1	NM_144732, NM_007040	
ZFP64	55734	hgsc.bcm.edu	37	20	50769885	50769885	+	Silent	SNP	C	C	T			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr20:50769885C>T	ENST00000216923.4	-	6	1195	c.846G>A	c.(844-846)tcG>tcA	p.S282S	ZFP64_ENST00000477786.1_Intron|ZFP64_ENST00000361387.2_Intron|ZFP64_ENST00000371518.2_Intron|ZFP64_ENST00000371515.4_Silent_p.S280S|ZFP64_ENST00000346617.4_Silent_p.S228S	NM_018197.2|NM_199426.1	NP_060667.2|NP_955458.1	Q9NPA5	ZF64A_HUMAN	ZFP64 zinc finger protein	282					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(5)|large_intestine(8)|lung(11)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	33						GCTTCTCCCCCGAGTGCACCC	0.552																																					p.S282S		Atlas-SNP	.											.	ZFP64	240	.	0			c.G846A						PASS	.						80.0	72.0	75.0					20																	50769885		2203	4300	6503	SO:0001819	synonymous_variant	55734	exon6			CTCCCCCGAGTGC	AK001596	CCDS13439.1, CCDS13440.1, CCDS13441.1, CCDS13442.1	20q13.11-q13.13	2013-01-08	2012-11-27		ENSG00000020256	ENSG00000020256		"""Zinc fingers, C2H2-type"""	15940	protein-coding gene	gene with protein product			"""zinc finger protein 338"", ""zinc finger protein 64 homolog (mouse)"", ""zinc finger protein 64"""	ZNF338		9034307	Standard	NM_199427		Approved	FLJ10734, dJ831D17.1, FLJ12628, dJ548G19.1	uc002xwl.3	Q9NPA5	OTTHUMG00000032756	ENST00000216923.4:c.846G>A	chr20.hg19:g.50769885C>T		75.0	0.0	.		46.0	16.0	.	NM_018197	Q9NTS7|Q9NVH4	Silent	SNP	ENST00000216923.4	hg19	CCDS13440.1																																																																																			.	.	.	none		0.552	ZFP64-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079744.1	NM_018197	
DENR	8562	hgsc.bcm.edu	37	12	123253468	123253468	+	Splice_Site	DEL	G	G	-			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr12:123253468delG	ENST00000280557.6	+	7	738	c.552delG	c.(550-552)gag>ga	p.E184fs	DENR_ENST00000455982.2_Intron|Y_RNA_ENST00000384187.1_RNA	NM_003677.3	NP_003668.2	O43583	DENR_HUMAN	density-regulated protein	184					formation of translation preinitiation complex (GO:0001731)|IRES-dependent translational initiation (GO:0002192)|ribosome disassembly (GO:0032790)		translation initiation factor activity (GO:0003743)			kidney(1)|large_intestine(1)|urinary_tract(1)	3	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.28e-05)|Epithelial(86;6.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.199)		AATGGCCAGAGGTGAGTGCAT	0.363																																					p.E184fs		Atlas-INDEL	.											.	DENR	8	.	0			c.551delA						PASS	.						70.0	67.0	68.0					12																	123253468		1874	4097	5971	SO:0001630	splice_region_variant	8562	exon7			.	AF038554	CCDS45003.1	12q24.31	1999-06-17			ENSG00000139726	ENSG00000139726			2769	protein-coding gene	gene with protein product		604550				9628587	Standard	NM_003677		Approved	DRP, DRP1, SMAP-3	uc001uda.3	O43583	OTTHUMG00000168844	ENST00000280557.6:c.552+1G>-	chr12.hg19:g.123253468delG		60.0	0.0	0		54.0	16.0	0.296296	NM_003677	Q9H3U6|Q9UKZ0	Frame_Shift_Del	DEL	ENST00000280557.6	hg19	CCDS45003.1																																																																																			.	.	.	none		0.363	DENR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401336.1	NM_003677	Frame_Shift_Del
IFIT5	24138	hgsc.bcm.edu	37	10	91178386	91178387	+	Frame_Shift_Ins	INS	-	-	GCTC			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr10:91178386_91178387insGCTC	ENST00000371795.4	+	2	1643_1644	c.1430_1431insGCTC	c.(1429-1434)gagctcfs	p.-478fs	IFIT5_ENST00000416601.1_Frame_Shift_Ins_p.-430fs	NM_012420.2	NP_036552.1	Q13325	IFIT5_HUMAN	interferon-induced protein with tetratricopeptide repeats 5						defense response to virus (GO:0051607)|innate immune response (GO:0045087)	actin cytoskeleton (GO:0015629)|apical part of cell (GO:0045177)|ruffle membrane (GO:0032587)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)|tRNA binding (GO:0000049)			endometrium(1)|large_intestine(4)|lung(4)	9						GCTCTCTGTGAGCTCCGACTTT	0.371																																					p.E477fs		Atlas-INDEL	.											.	IFIT5	32	.	0			c.1430_1431insGCTC						PASS	.																																			SO:0001589	frameshift_variant	24138	exon2			.	U34605	CCDS7403.1	10q23.31	2013-01-10			ENSG00000152778	ENSG00000152778		"""Tetratricopeptide (TTC) repeat domain containing"""	13328	protein-coding gene	gene with protein product	"""retinoic acid- and interferon-inducible protein (58kD)"""					9398535	Standard	NM_012420		Approved	RI58	uc010qnh.2	Q13325	OTTHUMG00000018713	ENST00000371795.4:c.1431_1434dupGCTC	chr10.hg19:g.91178387_91178390dupGCTC	ENSP00000360860:p.Leu478fs	127.0	0.0	0		113.0	11.0	0.0973451	NM_012420	B2R5X9|B4DDV1|Q5T7I9|Q6IAX3	Frame_Shift_Ins	INS	ENST00000371795.4	hg19	CCDS7403.1																																																																																			.	.	.	none		0.371	IFIT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049303.1	NM_012420	
ZNF318	24149	hgsc.bcm.edu	37	6	43333130	43333130	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr6:43333130delT	ENST00000361428.2	-	2	525	c.448delA	c.(448-450)atcfs	p.I150fs	ZNF318_ENST00000318149.3_Frame_Shift_Del_p.I150fs	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	150					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			CCAACAGTGATCCTTAAGCTC	0.473																																					p.I150fs		Atlas-INDEL	.											.	ZNF318	175	.	0			c.449delT						PASS	.						104.0	99.0	101.0					6																	43333130		2203	4300	6503	SO:0001589	frameshift_variant	24149	exon2			.	AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.448delA	chr6.hg19:g.43333130delT	ENSP00000354964:p.Ile150fs	85.0	0.0	0		73.0	25.0	0.342466	NM_014345	O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Frame_Shift_Del	DEL	ENST00000361428.2	hg19	CCDS4895.2																																																																																			.	.	.	none		0.473	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040601.2	NM_014345	
