#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
FMO4	2329	hgsc.bcm.edu	37	1	171303821	171303822	+	Missense_Mutation	DNP	AT	AT	GC			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	A|T	A|T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr1:171303821_171303822AT>GC	ENST00000367749.3	+	8	1429_1430	c.1099_1100AT>GC	c.(1099-1101)ATc>GCc	p.I367A		NM_002022.1	NP_002013.1	P31512	FMO4_HUMAN	flavin containing monooxygenase 4	367					drug catabolic process (GO:0042737)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	33	all_cancers(6;3.9e-08)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					GACATTAGCCATCATCGGCCTT	0.411																																					p.I367V|p.I367T	Pancreas(24;816 862 7754 7993 32832)	Atlas-SNP	.											.	FMO4	64	.	0			c.A1099G|c.T1100C						PASS	.																																			SO:0001583	missense	2329	exon8			TTAGCCATCATCG|TAGCCATCATCGG	BC002780	CCDS1295.1	1q24.3	2011-08-04			ENSG00000076258	ENSG00000076258	1.14.13.8		3772	protein-coding gene	gene with protein product		136131		FMO2		8311461	Standard	NM_002022		Approved		uc001gho.3	P31512	OTTHUMG00000035506	Exception_encountered	chr1.hg19:g.171303821_171303822delinsGC	ENSP00000356723:p.Ile367Ala	176.0|171.0	0.0	.		138.0|136.0	43.0	.	NM_002022	Q53XR0	Missense_Mutation	SNP	ENST00000367749.3	hg19	CCDS1295.1																																																																																			.	.	.	none		0.411	FMO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086223.1	NM_002022	
HEATR1	55127	hgsc.bcm.edu	37	1	236738095	236738095	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr1:236738095C>T	ENST00000366582.3	-	23	3307	c.3193G>A	c.(3193-3195)Gga>Aga	p.G1065R	HEATR1_ENST00000366581.2_Intron	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	1065					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			TTATACTTTCCCAGAGTGAGA	0.423																																					p.G1065R		Atlas-SNP	.											.	HEATR1	197	.	0			c.G3193A						PASS	.						72.0	72.0	72.0					1																	236738095		2203	4300	6503	SO:0001583	missense	55127	exon23			ACTTTCCCAGAGT	BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.3193G>A	chr1.hg19:g.236738095C>T	ENSP00000355541:p.Gly1065Arg	117.0	0.0	.		108.0	43.0	.	NM_018072	Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	ENST00000366582.3	hg19	CCDS31066.1	.	.	.	.	.	.	.	.	.	.	C	18.60	3.659073	0.67586	.	.	ENSG00000119285	ENST00000366582	T	0.66099	-0.19	5.73	5.73	0.89815	Armadillo-type fold (2);	0.167388	0.52532	D	0.000065	T	0.65059	0.2655	M	0.62723	1.935	0.80722	D	1	P	0.42735	0.788	B	0.42495	0.389	T	0.62334	-0.6876	10	0.28530	T	0.3	.	19.904	0.97001	0.0:1.0:0.0:0.0	.	1065	Q9H583	HEAT1_HUMAN	R	1065	ENSP00000355541:G1065R	ENSP00000355541:G1065R	G	-	1	0	HEATR1	234804718	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	2.615000	0.46368	2.689000	0.91719	0.655000	0.94253	GGA	.	.	.	none		0.423	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096635.1	XM_375853	
HEATR1	55127	hgsc.bcm.edu	37	1	236749736	236749736	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr1:236749736T>C	ENST00000366582.3	-	15	1846	c.1732A>G	c.(1732-1734)Ata>Gta	p.I578V	HEATR1_ENST00000366581.2_Missense_Mutation_p.I578V	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	578					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			TCAGCGGCTATCTTAAGTACC	0.368																																					p.I578V		Atlas-SNP	.											.	HEATR1	197	.	0			c.A1732G						PASS	.																																			SO:0001583	missense	55127	exon15			CGGCTATCTTAAG	BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.1732A>G	chr1.hg19:g.236749736T>C	ENSP00000355541:p.Ile578Val	170.0	0.0	.		156.0	50.0	.	NM_018072	Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	ENST00000366582.3	hg19	CCDS31066.1	.	.	.	.	.	.	.	.	.	.	T	0.008	-1.926731	0.00493	.	.	ENSG00000119285	ENST00000366582;ENST00000366581	T;T	0.42900	0.96;0.96	5.28	-2.98	0.05513	Armadillo-like helical (1);Armadillo-type fold (1);	0.667620	0.15450	N	0.261734	T	0.13157	0.0319	N	0.03115	-0.41	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.13019	-1.0525	10	0.26408	T	0.33	.	1.7301	0.02930	0.1285:0.3195:0.2162:0.3358	.	578	Q9H583	HEAT1_HUMAN	V	578	ENSP00000355541:I578V;ENSP00000355540:I578V	ENSP00000355540:I578V	I	-	1	0	HEATR1	234816359	0.001000	0.12720	0.931000	0.37212	0.129000	0.20672	-0.294000	0.08309	-0.174000	0.10743	0.460000	0.39030	ATA	.	.	.	none		0.368	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096635.1	XM_375853	
ATRAID	51374	hgsc.bcm.edu	37	2	27440797	27440797	+	IGR	SNP	C	C	A			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr2:27440797C>A	ENST00000606999.1	+	0	956				CAD_ENST00000264705.4_Nonsense_Mutation_p.Y45*|CAD_ENST00000403525.1_Nonsense_Mutation_p.Y45*	NM_001170795.1	NP_001164266.1	Q6UW56	ARAID_HUMAN	all-trans retinoic acid-induced differentiation factor						cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)											ATCCCTCCTACAAGGCACAGA	0.572																																					p.Y45X		Atlas-SNP	.											.	CAD	199	.	0			c.C135A						PASS	.						124.0	115.0	118.0					2																	27440797		2203	4300	6503	SO:0001628	intergenic_variant	790	exon2			CTCCTACAAGGCA	BC021237	CCDS1741.1, CCDS46243.1, CCDS62877.1	2p23.3	2012-08-01	2012-07-30	2012-07-30	ENSG00000138085	ENSG00000138085			24090	protein-coding gene	gene with protein product	"""apoptosis-related protein 3"""		"""chromosome 2 open reading frame 28"""	C2orf28		17524364, 21723284	Standard	NM_016085		Approved	HSPC013, p18, APR3	uc002rjf.3	Q6UW56	OTTHUMG00000128405		chr2.hg19:g.27440797C>A		189.0	0.0	.		143.0	54.0	.	NM_004341	A8C1S2|A8K779|Q96FF6|Q96RT2|Q9Y2R7|Q9Y5L7	Nonsense_Mutation	SNP	ENST00000606999.1	hg19		.	.	.	.	.	.	.	.	.	.	C	31	5.075282	0.94000	.	.	ENSG00000084774	ENST00000264705;ENST00000403525	.	.	.	5.05	4.17	0.49024	.	0.070247	0.64402	D	0.000015	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.0623	12.2333	0.54500	0.0:0.917:0.0:0.083	.	.	.	.	X	45	.	ENSP00000264705:Y45X	Y	+	3	2	CAD	27294301	1.000000	0.71417	1.000000	0.80357	0.725000	0.41563	2.602000	0.46257	1.351000	0.45789	0.484000	0.47621	TAC	.	.	.	none		0.572	ATRAID-007	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470709.1	NM_016085	
RTN4	57142	hgsc.bcm.edu	37	2	55253513	55253514	+	Missense_Mutation	DNP	TT	TT	AG			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr2:55253513_55253514TT>AG	ENST00000337526.6	-	3	1964_1965	c.1721_1722AA>CT	c.(1720-1722)gAA>gCT	p.E574A	RTN4_ENST00000357732.4_Intron|RTN4_ENST00000405240.1_Missense_Mutation_p.E368A|RTN4_ENST00000404909.1_Missense_Mutation_p.E368A|RTN4_ENST00000394611.2_Missense_Mutation_p.E368A|RTN4_ENST00000354474.6_Missense_Mutation_p.E342A|RTN4_ENST00000317610.7_Intron|RTN4_ENST00000402434.2_Intron|RTN4_ENST00000357376.3_Missense_Mutation_p.E368A	NM_020532.4	NP_065393.1	Q9NQC3	RTN4_HUMAN	reticulon 4	574					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonal fasciculation (GO:0007413)|cardiac epithelial to mesenchymal transition (GO:0060317)|cerebral cortex radial glia guided migration (GO:0021801)|endoplasmic reticulum tubular network organization (GO:0071786)|negative regulation of axon extension (GO:0030517)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell growth (GO:0030308)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of apoptotic process (GO:0042981)|regulation of axonogenesis (GO:0050770)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of cell migration (GO:0030334)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(1)|skin(1)|stomach(1)	36						CCATTTTTGTTTCATAAGCAAT	0.416																																					p.E574D|p.E574A		Atlas-SNP	.											.	RTN4	189	.	0			c.A1722T|c.A1721C						PASS	.																																			SO:0001583	missense	57142	exon3			TTTTGTTTCATAA|TTTGTTTCATAAG	AF087901	CCDS1851.1, CCDS1852.1, CCDS42683.1, CCDS42684.1, CCDS42685.1	2p14-p13	2008-05-23			ENSG00000115310	ENSG00000115310			14085	protein-coding gene	gene with protein product		604475				10667797, 10773680	Standard	NM_020532		Approved	NSP-CL, KIAA0886, NOGO, ASY	uc002rye.3	Q9NQC3	OTTHUMG00000129337	ENST00000337526.6:c.1721_1722delinsAG	chr2.hg19:g.55253513_55253514delinsAG	ENSP00000337838:p.Glu574Ala	165.0	0.0	.		130.0|132.0	32.0|33.0	.	NM_020532	O94962|Q7L7Q5|Q7L7Q6|Q7L7Q8|Q8IUA4|Q96B16|Q9BXG5|Q9H212|Q9H3I3|Q9UQ42|Q9Y293|Q9Y2Y7|Q9Y5U6	Missense_Mutation	SNP	ENST00000337526.6	hg19	CCDS42684.1																																																																																			.	.	.	none		0.416	RTN4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251484.1		
ALMS1	7840	hgsc.bcm.edu	37	2	73680677	73680677	+	Silent	SNP	T	T	C			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr2:73680677T>C	ENST00000264448.6	+	8	7131	c.7020T>C	c.(7018-7020)aaT>aaC	p.N2340N	ALMS1_ENST00000377715.1_Silent_p.N2340N|ALMS1_ENST00000409009.1_Silent_p.N2298N	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	2340					endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						CACAGACGAATTTGAAATGCC	0.448																																					p.N2340N		Atlas-SNP	.											.	ALMS1	384	.	0			c.T7020C						PASS	.						56.0	53.0	54.0					2																	73680677		1872	4112	5984	SO:0001819	synonymous_variant	7840	exon8			GACGAATTTGAAA	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.7020T>C	chr2.hg19:g.73680677T>C		80.0	0.0	.		71.0	14.0	.	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Silent	SNP	ENST00000264448.6	hg19	CCDS42697.1																																																																																			.	.	.	none		0.448	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
SEMA4F	10505	hgsc.bcm.edu	37	2	74902749	74902749	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr2:74902749G>A	ENST00000357877.2	+	11	1619	c.1470G>A	c.(1468-1470)atG>atA	p.M490I	SEMA4F_ENST00000339773.5_Missense_Mutation_p.M335I|SEMA4F_ENST00000473350.1_3'UTR	NM_004263.3	NP_004254.2	O95754	SEM4F_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F	490	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)|negative regulation of axon extension (GO:0030517)|nervous system development (GO:0007399)|retinal ganglion cell axon guidance (GO:0031290)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor activity (GO:0004872)	p.M490I(1)		biliary_tract(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	45						TTGAGAACATGAAATTGTACC	0.512																																					p.M490I		Atlas-SNP	.											SEMA4F,rectum,carcinoma,0,1	SEMA4F	89	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1470A						PASS	.						102.0	91.0	95.0					2																	74902749		2203	4300	6503	SO:0001583	missense	10505	exon11			GAACATGAAATTG	AF038652	CCDS1955.1, CCDS62942.1, CCDS74529.1	2p13.1	2008-05-21			ENSG00000135622	ENSG00000135622		"""Semaphorins"""	10734	protein-coding gene	gene with protein product	"""m-Sema M"""	603706		SEMAM		10051670	Standard	NM_004263		Approved	SEMAW	uc002sna.2	O95754	OTTHUMG00000129952	ENST00000357877.2:c.1470G>A	chr2.hg19:g.74902749G>A	ENSP00000350547:p.Met490Ile	123.0	0.0	.		134.0	40.0	.	NM_004263	Q542Y7|Q9NS35	Missense_Mutation	SNP	ENST00000357877.2	hg19	CCDS1955.1	.	.	.	.	.	.	.	.	.	.	G	12.04	1.818592	0.32145	.	.	ENSG00000135622	ENST00000357877;ENST00000339773	T;T	0.32023	1.47;1.47	4.5	3.58	0.41010	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.129054	0.51477	D	0.000093	T	0.17916	0.0430	N	0.12887	0.27	0.34285	D	0.682588	B;B	0.14012	0.003;0.009	B;B	0.15052	0.007;0.012	T	0.15983	-1.0418	10	0.46703	T	0.11	.	12.2822	0.54771	0.0:0.1859:0.814:0.0	.	335;490	O95754-2;O95754	.;SEM4F_HUMAN	I	490;335	ENSP00000350547:M490I;ENSP00000342675:M335I	ENSP00000342675:M335I	M	+	3	0	SEMA4F	74756257	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	1.936000	0.40183	2.333000	0.79357	0.467000	0.42956	ATG	.	.	.	none		0.512	SEMA4F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252214.2	NM_004263	
TBC1D8	11138	hgsc.bcm.edu	37	2	101670697	101670697	+	Silent	SNP	G	G	A			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr2:101670697G>A	ENST00000376840.4	-	4	458	c.459C>T	c.(457-459)ttC>ttT	p.F153F	TBC1D8_ENST00000409318.1_Silent_p.F168F			O95759	TBCD8_HUMAN	TBC1 domain family, member 8 (with GRAM domain)	153	GRAM 1.				blood circulation (GO:0008015)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	32						CCGCCTCGGGGAAGTTGAACC	0.617																																					p.F153F		Atlas-SNP	.											.	TBC1D8	169	.	0			c.C459T						PASS	.						35.0	41.0	39.0					2																	101670697		2066	4231	6297	SO:0001819	synonymous_variant	11138	exon4			CTCGGGGAAGTTG	AB024057	CCDS46375.1	2q12.1	2011-11-30			ENSG00000204634	ENSG00000204634			17791	protein-coding gene	gene with protein product	"""BUB2-like protein 1"", ""vascular Rab-GAP/TBC-containing protein"""					10373574	Standard	NM_001102426		Approved	HBLP1, VRP, AD3	uc010fiv.3	O95759	OTTHUMG00000153040	ENST00000376840.4:c.459C>T	chr2.hg19:g.101670697G>A		20.0	0.0	.		18.0	12.0	.	NM_001102426	A6NDL4|A8K9W1|B9A6K4|Q53SQ4|Q9UQ32	Silent	SNP	ENST00000376840.4	hg19	CCDS46375.1																																																																																			.	.	.	none		0.617	TBC1D8-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376092.1	NM_007063	
TMEM177	80775	hgsc.bcm.edu	37	2	120439354	120439354	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr2:120439354G>A	ENST00000424086.1	+	2	1398	c.925G>A	c.(925-927)Ggc>Agc	p.G309S	TMEM177_ENST00000272521.6_Missense_Mutation_p.G309S|TMEM177_ENST00000496203.1_Intron|TMEM177_ENST00000409951.1_Intron|TMEM177_ENST00000401466.1_Missense_Mutation_p.G309S	NM_001105198.1	NP_001098668.1	Q53S58	TM177_HUMAN	transmembrane protein 177	309						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	13	Colorectal(110;0.196)					GCTCAATCCGGGCCGCTCCTG	0.577																																					p.G309S		Atlas-SNP	.											.	TMEM177	26	.	0			c.G925A						PASS	.						43.0	47.0	46.0					2																	120439354		2201	4299	6500	SO:0001583	missense	80775	exon2			AATCCGGGCCGCT	BC004404	CCDS2128.1	2q14.2	2008-02-05			ENSG00000144120	ENSG00000144120			28143	protein-coding gene	gene with protein product						12477932	Standard	NM_001105198		Approved	MGC10993	uc002tmc.1	Q53S58	OTTHUMG00000153312	ENST00000424086.1:c.925G>A	chr2.hg19:g.120439354G>A	ENSP00000402661:p.Gly309Ser	139.0	0.0	.		129.0	44.0	.	NM_030577	Q9BT20	Missense_Mutation	SNP	ENST00000424086.1	hg19	CCDS2128.1	.	.	.	.	.	.	.	.	.	.	G	12.41	1.928205	0.34002	.	.	ENSG00000144120	ENST00000401466;ENST00000424086;ENST00000272521;ENST00000415646	T;T;T	0.31510	1.49;1.49;1.49	4.44	2.51	0.30379	.	0.000000	0.53938	D	0.000044	T	0.16041	0.0386	N	0.17674	0.51	0.09310	N	1	B	0.14012	0.009	B	0.15052	0.012	T	0.18085	-1.0348	10	0.25751	T	0.34	-4.387	5.7699	0.18247	0.1213:0.1952:0.6835:0.0	.	309	Q53S58	TM177_HUMAN	S	309;309;309;248	ENSP00000385966:G309S;ENSP00000402661:G309S;ENSP00000272521:G309S	ENSP00000272521:G309S	G	+	1	0	TMEM177	120155824	0.003000	0.15002	0.010000	0.14722	0.097000	0.18754	0.068000	0.14531	0.514000	0.28300	0.549000	0.68633	GGC	.	.	.	none		0.577	TMEM177-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330673.1	NM_030577	
LRP1B	53353	hgsc.bcm.edu	37	2	141819633	141819633	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr2:141819633A>T	ENST00000389484.3	-	8	2194	c.1223T>A	c.(1222-1224)aTt>aAt	p.I408N		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	408					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TCTGCCTTGAATGACAGTGTG	0.358										TSP Lung(27;0.18)																											p.I408N	Colon(99;50 2074 2507 20106)	Atlas-SNP	.											.	LRP1B	1315	.	0			c.T1223A						PASS	.						217.0	197.0	204.0					2																	141819633		2203	4300	6503	SO:0001583	missense	53353	exon8			CCTTGAATGACAG	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.1223T>A	chr2.hg19:g.141819633A>T	ENSP00000374135:p.Ile408Asn	201.0	0.0	.		212.0	76.0	.	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	hg19	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	A	14.29	2.491685	0.44249	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.91686	-2.89	5.63	4.48	0.54585	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.371653	0.26734	N	0.022764	D	0.92047	0.7480	M	0.85630	2.765	0.23260	N	0.99803	B	0.27192	0.171	B	0.28849	0.095	D	0.86417	0.1752	10	0.72032	D	0.01	.	10.4218	0.44354	0.8641:0.0:0.1359:0.0	.	408	Q9NZR2	LRP1B_HUMAN	N	408;346	ENSP00000374135:I408N	ENSP00000374135:I408N	I	-	2	0	LRP1B	141536103	1.000000	0.71417	0.763000	0.31416	0.516000	0.34256	5.279000	0.65597	1.070000	0.40811	0.533000	0.62120	ATT	.	.	.	none		0.358	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
LRP2	4036	hgsc.bcm.edu	37	2	170083080	170083080	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr2:170083080A>G	ENST00000263816.3	-	32	5531	c.5246T>C	c.(5245-5247)aTa>aCa	p.I1749T		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	1749					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CCTTACAGTTATTAAGAAAGG	0.368																																					p.I1749T		Atlas-SNP	.											.	LRP2	751	.	0			c.T5246C						PASS	.						79.0	76.0	77.0					2																	170083080		2203	4300	6503	SO:0001583	missense	4036	exon32			ACAGTTATTAAGA		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.5246T>C	chr2.hg19:g.170083080A>G	ENSP00000263816:p.Ile1749Thr	105.0	0.0	.		119.0	26.0	.	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	hg19	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	A	18.57	3.652915	0.67472	.	.	ENSG00000081479	ENST00000263816	D	0.90900	-2.75	5.83	5.83	0.93111	Six-bladed beta-propeller, TolB-like (1);	0.111411	0.64402	D	0.000005	D	0.90943	0.7153	M	0.83223	2.63	0.80722	D	1	P	0.40144	0.704	B	0.35971	0.215	D	0.92052	0.5649	10	0.87932	D	0	.	16.2041	0.82108	1.0:0.0:0.0:0.0	.	1749	P98164	LRP2_HUMAN	T	1749	ENSP00000263816:I1749T	ENSP00000263816:I1749T	I	-	2	0	LRP2	169791326	1.000000	0.71417	0.916000	0.36221	0.996000	0.88848	9.310000	0.96267	2.219000	0.72066	0.533000	0.62120	ATA	.	.	.	none		0.368	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
CUL3	8452	hgsc.bcm.edu	37	2	225422516	225422516	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr2:225422516G>A	ENST00000264414.4	-	2	462	c.124C>T	c.(124-126)Caa>Taa	p.Q42*	CUL3_ENST00000409777.1_Nonsense_Mutation_p.Q18*|CUL3_ENST00000344951.4_Intron|CUL3_ENST00000409096.1_Nonsense_Mutation_p.Q18*|CUL3_ENST00000432260.2_5'UTR	NM_003590.4	NP_003581.1	Q13618	CUL3_HUMAN	cullin 3	42					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|COPII vesicle coating (GO:0048208)|cyclin catabolic process (GO:0008054)|embryonic cleavage (GO:0040016)|ER to Golgi vesicle-mediated transport (GO:0006888)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|integrin-mediated signaling pathway (GO:0007229)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic metaphase plate congression (GO:0007080)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|stem cell division (GO:0017145)|stress fiber assembly (GO:0043149)|trophectodermal cellular morphogenesis (GO:0001831)|Wnt signaling pathway (GO:0016055)	Cul3-RING ubiquitin ligase complex (GO:0031463)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|nucleus (GO:0005634)|polar microtubule (GO:0005827)	POZ domain binding (GO:0031208)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	46		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		TGGATTTCTTGAATTGCATTT	0.333																																					p.Q48X		Atlas-SNP	.											.	CUL3	96	.	0			c.C142T						PASS	.						88.0	85.0	86.0					2																	225422516		2201	4298	6499	SO:0001587	stop_gained	8452	exon2			TTTCTTGAATTGC	U58089	CCDS2462.1, CCDS58751.1	2q36.2	2011-05-24			ENSG00000036257	ENSG00000036257			2553	protein-coding gene	gene with protein product		603136				8681378, 17192413	Standard	NM_003590		Approved		uc002vny.3	Q13618	OTTHUMG00000133167	ENST00000264414.4:c.124C>T	chr2.hg19:g.225422516G>A	ENSP00000264414:p.Gln42*	81.0	0.0	.		99.0	53.0	.	NM_001257198	A8K536|B8ZZC3|O75415|Q569L3|Q9UBI8|Q9UET7	Nonsense_Mutation	SNP	ENST00000264414.4	hg19	CCDS2462.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	41|41	8.780125|8.780125	0.98952|0.98952	.|.	.|.	ENSG00000036257|ENSG00000036257	ENST00000264414;ENST00000409096;ENST00000409777|ENST00000436172	.|.	.|.	.|.	5.85|5.85	5.85|5.85	0.93711|0.93711	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.76941	.|0.4058	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.74262	.|-0.3722	.|4	0.07030|.	T|.	0.85|.	.|.	20.1731|20.1731	0.98165|0.98165	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|L	42;18;18|62	.|.	ENSP00000264414:Q42X|.	Q|S	-|-	1|2	0|0	CUL3|CUL3	225130760|225130760	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.714000|9.714000	0.98744|0.98744	2.768000|2.768000	0.95171|0.95171	0.655000|0.655000	0.94253|0.94253	CAA|TCA	.	.	.	none		0.333	CUL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256871.2		
USP40	55230	hgsc.bcm.edu	37	2	234449396	234449396	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr2:234449396G>T	ENST00000427112.2	-	9	1114	c.1079C>A	c.(1078-1080)cCt>cAt	p.P360H	USP40_ENST00000251722.6_Missense_Mutation_p.P360H|USP40_ENST00000450966.1_Missense_Mutation_p.P372H			Q9NVE5	UBP40_HUMAN	ubiquitin specific peptidase 40	360	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)	p.P372R(2)		breast(1)|endometrium(6)|kidney(5)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0539)		Epithelial(121;1.71e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000407)|Lung(119;0.00277)|LUSC - Lung squamous cell carcinoma(224;0.00646)		CTGATCAACAGGAATTAGATT	0.378																																					p.P372H		Atlas-SNP	.											USP40_ENST00000450966,NS,carcinoma,0,4	USP40	174	.	2	Substitution - Missense(2)	lung(2)	c.C1115A						PASS	.						169.0	157.0	160.0					2																	234449396		1838	4092	5930	SO:0001583	missense	55230	exon9			TCAACAGGAATTA	AK001647	CCDS46547.1	2q37.1	2005-08-08	2005-08-08		ENSG00000085982	ENSG00000085982		"""Ubiquitin-specific peptidases"""	20069	protein-coding gene	gene with protein product		610570	"""ubiquitin specific protease 40"""			12838346	Standard	NM_018218		Approved	FLJ10785	uc010zmr.2	Q9NVE5	OTTHUMG00000153199	ENST00000427112.2:c.1079C>A	chr2.hg19:g.234449396G>T	ENSP00000387898:p.Pro360His	254.0	2.0	.		248.0	111.0	.	NM_018218	Q6NX38|Q70EL0	Missense_Mutation	SNP	ENST00000427112.2	hg19	CCDS46547.1	.	.	.	.	.	.	.	.	.	.	G	18.08	3.544257	0.65198	.	.	ENSG00000085982	ENST00000450966;ENST00000251722;ENST00000427112	T;T;T	0.05258	3.47;3.48;3.48	5.31	3.39	0.38822	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	1.336030	0.05934	U	0.635709	T	0.18718	0.0449	L	0.55481	1.735	0.30283	N	0.791122	D;D	0.57899	0.981;0.976	P;P	0.60068	0.868;0.792	T	0.07214	-1.0784	10	0.72032	D	0.01	.	9.7296	0.40352	0.0745:0.0:0.7855:0.1401	.	360;372	Q9NVE5;Q9NVE5-3	UBP40_HUMAN;.	H	372;360;360	ENSP00000415434:P372H;ENSP00000251722:P360H;ENSP00000387898:P360H	ENSP00000251722:P360H	P	-	2	0	USP40	234114135	1.000000	0.71417	0.952000	0.39060	0.980000	0.70556	2.988000	0.49386	1.373000	0.46208	0.561000	0.74099	CCT	.	.	.	none		0.378	USP40-017	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397235.1	XM_114294	
TRPM8	79054	hgsc.bcm.edu	37	2	234847784	234847784	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr2:234847784T>A	ENST00000324695.4	+	5	531	c.491T>A	c.(490-492)aTc>aAc	p.I164N	TRPM8_ENST00000355722.4_Missense_Mutation_p.I114N|TRPM8_ENST00000409625.1_Missense_Mutation_p.I87N|TRPM8_ENST00000433712.2_5'UTR	NM_024080.4	NP_076985.4	Q7Z2W7	TRPM8_HUMAN	transient receptor potential cation channel, subfamily M, member 8	164					calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|protein homotetramerization (GO:0051289)|protein homotrimerization (GO:0070207)|response to cold (GO:0009409)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(2)|lung(27)|prostate(2)|skin(7)|stomach(2)	66		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)	ATGCGCAAGATCTTCAGCCGG	0.607																																					p.I164N		Atlas-SNP	.											.	TRPM8	146	.	0			c.T491A						PASS	.						36.0	38.0	37.0					2																	234847784		2203	4300	6503	SO:0001583	missense	79054	exon5			GCAAGATCTTCAG	AC005538	CCDS33407.1	2q37	2011-12-14			ENSG00000144481	ENSG00000144481		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17961	protein-coding gene	gene with protein product		606678				16382100	Standard	NM_024080		Approved		uc002vvh.3	Q7Z2W7	OTTHUMG00000059129	ENST00000324695.4:c.491T>A	chr2.hg19:g.234847784T>A	ENSP00000323926:p.Ile164Asn	64.0	0.0	.		82.0	32.0	.	NM_024080	A0AVG2|Q3YFM7|Q6QNH9|Q8TAC3|Q8TDX8|Q9BVK1	Missense_Mutation	SNP	ENST00000324695.4	hg19	CCDS33407.1	.	.	.	.	.	.	.	.	.	.	t	21.2	4.109476	0.77096	.	.	ENSG00000144481	ENST00000324695;ENST00000355722;ENST00000409625	T;T;T	0.81163	-1.46;-1.46;-1.46	5.62	5.62	0.85841	.	0.000000	0.64402	D	0.000001	D	0.90181	0.6931	M	0.84585	2.705	0.80722	D	1	P;D	0.71674	0.567;0.998	B;D	0.74023	0.343;0.982	D	0.91731	0.5396	10	0.87932	D	0	-40.7179	14.6612	0.68873	0.0:0.0:0.0:1.0	.	114;164	Q7Z2W7-2;Q7Z2W7	.;TRPM8_HUMAN	N	164;114;87	ENSP00000323926:I164N;ENSP00000347956:I114N;ENSP00000386771:I87N	ENSP00000323926:I164N	I	+	2	0	TRPM8	234512523	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.795000	0.62489	2.154000	0.67381	0.478000	0.44815	ATC	.	.	.	none		0.607	TRPM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131005.4	NM_024080	
ATP2B2	491	hgsc.bcm.edu	37	3	10387742	10387742	+	Silent	SNP	G	G	A			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr3:10387742G>A	ENST00000352432.4	-	16	2553	c.2484C>T	c.(2482-2484)ctC>ctT	p.L828L	ATP2B2_ENST00000360273.2_Silent_p.L828L|ATP2B2_ENST00000383800.4_Silent_p.L783L|ATP2B2_ENST00000397077.1_Silent_p.L783L|ATP2B2_ENST00000343816.4_Silent_p.L814L			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	828					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						CGGCCTTCTTGAGTGCAGGCC	0.652																																					p.L828L	Ovarian(125;1619 1709 15675 19819 38835)	Atlas-SNP	.											.	ATP2B2	304	.	0			c.C2484T						PASS	.						62.0	56.0	58.0					3																	10387742		2203	4300	6503	SO:0001819	synonymous_variant	491	exon17			CTTCTTGAGTGCA	X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.2484C>T	chr3.hg19:g.10387742G>A		72.0	0.0	.		67.0	17.0	.	NM_001001331	O00766|Q12994|Q16818	Silent	SNP	ENST00000352432.4	hg19	CCDS33701.1																																																																																			.	.	.	none		0.652	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250576.2	NM_001683	
FYCO1	79443	hgsc.bcm.edu	37	3	46009968	46009968	+	Silent	SNP	C	C	T			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr3:46009968C>T	ENST00000296137.2	-	8	1063	c.858G>A	c.(856-858)gaG>gaA	p.E286E	FYCO1_ENST00000535325.1_Silent_p.E286E	NM_024513.3	NP_078789.2	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	286					plus-end-directed vesicle transport along microtubule (GO:0072383)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)			NS(4)|breast(3)|central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(17)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	54				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		GAACGTTGTCCTCCGCTGCAG	0.617																																					p.E286E		Atlas-SNP	.											.	FYCO1	115	.	0			c.G858A						PASS	.						102.0	85.0	91.0					3																	46009968		2203	4300	6503	SO:0001819	synonymous_variant	79443	exon8			GTTGTCCTCCGCT	AJ292348	CCDS2734.1	3p21.3	2008-02-05			ENSG00000163820	ENSG00000163820		"""Zinc fingers, FYVE domain containing"""	14673	protein-coding gene	gene with protein product		607182				11896456	Standard	NM_024513		Approved	FLJ13335, ZFYVE7	uc003cpb.5	Q9BQS8	OTTHUMG00000133447	ENST00000296137.2:c.858G>A	chr3.hg19:g.46009968C>T		115.0	0.0	.		91.0	20.0	.	NM_024513	B7ZKT7|Q3MJE6|Q86T41|Q86TB1|Q8TEF9|Q96IV5|Q9H8P9	Silent	SNP	ENST00000296137.2	hg19	CCDS2734.1																																																																																			.	.	.	none		0.617	FYCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257320.2	NM_024513	
CCR5	1234	hgsc.bcm.edu	37	3	46415150	46415150	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr3:46415150A>T	ENST00000292303.4	+	2	903	c.757A>T	c.(757-759)Att>Ttt	p.I253F	CCR5_ENST00000445772.1_Missense_Mutation_p.I253F|CCR5_ENST00000343801.4_Missense_Mutation_p.I253F|RP11-24F11.2_ENST00000451485.1_RNA	NM_001100168.1	NP_001093638.1	P51681	CCR5_HUMAN	chemokine (C-C motif) receptor 5 (gene/pseudogene)	253					calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|entry into host cell (GO:0030260)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|MAPK cascade (GO:0000165)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to cholesterol (GO:0070723)|signaling (GO:0023052)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|C-C chemokine binding (GO:0019957)|C-C chemokine receptor activity (GO:0016493)|chemokine (C-C motif) ligand 5 binding (GO:0071791)|chemokine receptor activity (GO:0004950)|coreceptor activity (GO:0015026)|phosphatidylinositol phospholipase C activity (GO:0004435)			central_nervous_system(1)|large_intestine(2)|lung(13)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20				BRCA - Breast invasive adenocarcinoma(193;0.00112)|KIRC - Kidney renal clear cell carcinoma(197;0.017)|Kidney(197;0.02)	Maraviroc(DB04835)	TCCCTACAACATTGTCCTTCT	0.463																																					p.I253F		Atlas-SNP	.											.	CCR5	128	.	0			c.A757T						PASS	.						227.0	243.0	237.0					3																	46415150		2203	4296	6499	SO:0001583	missense	1234	exon3			TACAACATTGTCC		CCDS2739.1	3p21	2012-08-08	2012-01-23		ENSG00000160791	ENSG00000160791		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1606	protein-coding gene	gene with protein product		601373	"""chemokine (C-C motif) receptor 5"""	CMKBR5		8639485	Standard	NM_001100168		Approved	CKR-5, CC-CKR-5, CKR5, CD195, IDDM22	uc003cpo.4	P51681	OTTHUMG00000133481	ENST00000292303.4:c.757A>T	chr3.hg19:g.46415150A>T	ENSP00000292303:p.Ile253Phe	688.0	0.0	.		556.0	164.0	.	NM_000579	O14692|O14693|O14695|O14696|O14697|O14698|O14699|O14700|O14701|O14702|O14703|O14704|O14705|O14706|O14707|O14708|O15538|Q9UPA4	Missense_Mutation	SNP	ENST00000292303.4	hg19	CCDS2739.1	.	.	.	.	.	.	.	.	.	.	A	19.96	3.923708	0.73213	.	.	ENSG00000160791	ENST00000343801;ENST00000400886;ENST00000292303;ENST00000445772	T;T;T	0.76060	-0.99;-0.99;-0.99	5.69	-3.74	0.04385	GPCR, rhodopsin-like superfamily (1);	0.268702	0.24301	U	0.039739	D	0.85128	0.5626	H	0.96691	3.865	0.49687	D	0.999818	D	0.53885	0.963	P	0.59889	0.865	D	0.83665	0.0163	10	0.87932	D	0	.	6.5629	0.22495	0.4959:0.3178:0.1864:0.0	.	253	P51681	CCR5_HUMAN	F	253;233;253;253	ENSP00000343985:I253F;ENSP00000292303:I253F;ENSP00000404881:I253F	ENSP00000292303:I253F	I	+	1	0	CCR5	46390154	0.942000	0.31987	0.996000	0.52242	0.849000	0.48306	0.234000	0.17930	-0.152000	0.11156	0.459000	0.35465	ATT	.	.	.	none		0.463	CCR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257377.2	NM_000579	
QTRTD1	79691	hgsc.bcm.edu	37	3	113798773	113798773	+	Missense_Mutation	SNP	G	G	A	rs199551955		TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr3:113798773G>A	ENST00000493014.1	+	4	517	c.449G>A	c.(448-450)cGg>cAg	p.R150Q	QTRTD1_ENST00000479882.1_Missense_Mutation_p.R133Q|QTRTD1_ENST00000485050.1_Missense_Mutation_p.R268Q|QTRTD1_ENST00000281273.4_Missense_Mutation_p.R256Q	NM_001256836.1	NP_001243765.1			queuine tRNA-ribosyltransferase domain containing 1											central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|skin(2)	10						GGTGTTAGTCGGCCAGATGAG	0.423													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19554	0.0		0.0	False		,,,				2504	0.0				p.R268Q		Atlas-SNP	.											.	QTRTD1	29	.	0			c.G803A						PASS	.						180.0	174.0	176.0					3																	113798773		2203	4300	6503	SO:0001583	missense	79691	exon7			TTAGTCGGCCAGA	AK023022	CCDS33828.1, CCDS58846.1, CCDS58845.1, CCDS58844.1	3q13.31	2010-11-16			ENSG00000151576	ENSG00000151576			25771	protein-coding gene	gene with protein product						12477932	Standard	NM_024638		Approved	FLJ12960	uc003eaz.4	Q9H974	OTTHUMG00000159336	ENST00000493014.1:c.449G>A	chr3.hg19:g.113798773G>A	ENSP00000419169:p.Arg150Gln	320.0	0.0	.		280.0	111.0	.	NM_001256835		Missense_Mutation	SNP	ENST00000493014.1	hg19	CCDS58845.1	.	.	.	.	.	.	.	.	.	.	G	10.98	1.505730	0.26949	.	.	ENSG00000151576	ENST00000485050;ENST00000281273;ENST00000479882;ENST00000493014	.	.	.	5.58	-1.43	0.08884	.	0.364818	0.28760	N	0.014230	T	0.33702	0.0872	L	0.40543	1.245	0.34875	D	0.744043	B;B	0.29590	0.25;0.015	B;B	0.20384	0.029;0.006	T	0.13098	-1.0522	9	0.44086	T	0.13	-0.6577	6.1058	0.20073	0.3234:0.0:0.4693:0.2072	.	150;256	B7Z472;Q9H974	.;QTRD1_HUMAN	Q	268;256;133;150	.	ENSP00000281273:R256Q	R	+	2	0	QTRTD1	115281463	0.996000	0.38824	0.856000	0.33681	0.200000	0.23975	1.800000	0.38833	-0.186000	0.10533	0.555000	0.69702	CGG	.	.	.	weak		0.423	QTRTD1-004	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000354711.1	NM_024638	
ZBBX	79740	hgsc.bcm.edu	37	3	167083714	167083714	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr3:167083714T>G	ENST00000392766.2	-	6	573	c.233A>C	c.(232-234)cAa>cCa	p.Q78P	ZBBX_ENST00000455345.2_Missense_Mutation_p.Q78P|ZBBX_ENST00000307529.5_Missense_Mutation_p.Q78P|ZBBX_ENST00000392767.2_Missense_Mutation_p.Q78P|ZBBX_ENST00000392764.1_Missense_Mutation_p.Q49P|ZBBX_ENST00000469220.1_Intron	NM_001199201.1|NM_024687.3	NP_001186130.1|NP_078963.2	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	78						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(9)|liver(1)|lung(38)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	70						CATATATGATTGATTGACCAA	0.289																																					p.Q78P		Atlas-SNP	.											.	ZBBX	299	.	0			c.A233C						PASS	.						116.0	108.0	111.0					3																	167083714		1824	4071	5895	SO:0001583	missense	79740	exon6			TATGATTGATTGA	AK026702	CCDS3199.2, CCDS56295.1, CCDS56296.1	3q26.1	2010-03-23			ENSG00000169064	ENSG00000169064			26245	protein-coding gene	gene with protein product						12477932	Standard	NM_024687		Approved	FLJ23049	uc011bpc.2	A8MT70	OTTHUMG00000133560	ENST00000392766.2:c.233A>C	chr3.hg19:g.167083714T>G	ENSP00000376519:p.Gln78Pro	134.0	0.0	.		108.0	39.0	.	NM_024687	A8MV69|B3KSC1|B5MDJ6|F2Z370|Q9H5T8	Missense_Mutation	SNP	ENST00000392766.2	hg19	CCDS3199.2	.	.	.	.	.	.	.	.	.	.	T	5.789	0.329827	0.10956	.	.	ENSG00000169064	ENST00000392766;ENST00000392767;ENST00000455345;ENST00000307529;ENST00000392764;ENST00000474464	T;T;T;T;T;T	0.32988	2.92;2.92;2.92;2.92;2.74;1.43	5.26	-1.63	0.08345	.	.	.	.	.	T	0.20047	0.0482	L	0.44542	1.39	0.09310	N	0.999994	B;B	0.12630	0.006;0.003	B;B	0.16289	0.015;0.004	T	0.31530	-0.9940	9	0.52906	T	0.07	-2.1505	1.0522	0.01582	0.1499:0.2902:0.1547:0.4052	.	78;78	A8MT70-2;A8MT70	.;ZBBX_HUMAN	P	78;78;78;78;49;78	ENSP00000376519:Q78P;ENSP00000376520:Q78P;ENSP00000390232:Q78P;ENSP00000305065:Q78P;ENSP00000376517:Q49P;ENSP00000419307:Q78P	ENSP00000305065:Q78P	Q	-	2	0	ZBBX	168566408	0.486000	0.25980	0.013000	0.15412	0.018000	0.09664	0.353000	0.20130	-0.448000	0.07128	-0.386000	0.06593	CAA	.	.	.	none		0.289	ZBBX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257657.3	NM_024687	
TNFSF10	8743	hgsc.bcm.edu	37	3	172224404	172224404	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr3:172224404T>A	ENST00000241261.2	-	5	846	c.724A>T	c.(724-726)Atc>Ttc	p.I242F	TNFSF10_ENST00000420541.2_3'UTR	NM_003810.3	NP_003801.1	P50591	TNF10_HUMAN	tumor necrosis factor (ligand) superfamily, member 10	242					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell-cell signaling (GO:0007267)|immune response (GO:0006955)|male gonad development (GO:0008584)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to insulin (GO:0032868)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|receptor binding (GO:0005102)			breast(2)|cervix(1)|large_intestine(1)|lung(6)|ovary(1)|skin(4)	15	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.67e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			CCTTGATAGATGGAATAGAGT	0.333																																					p.I242F		Atlas-SNP	.											.	TNFSF10	30	.	0			c.A724T						PASS	.						168.0	163.0	165.0					3																	172224404		2203	4300	6503	SO:0001583	missense	8743	exon5			GATAGATGGAATA	U37518	CCDS3219.1, CCDS54680.1	3q26	2006-09-20			ENSG00000121858	ENSG00000121858		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11925	protein-coding gene	gene with protein product		603598				8777713, 8663110	Standard	NM_003810		Approved	TRAIL, Apo-2L, TL2, CD253	uc003fid.3	P50591	OTTHUMG00000156917	ENST00000241261.2:c.724A>T	chr3.hg19:g.172224404T>A	ENSP00000241261:p.Ile242Phe	171.0	0.0	.		176.0	60.0	.	NM_003810	A1Y9B3	Missense_Mutation	SNP	ENST00000241261.2	hg19	CCDS3219.1	.	.	.	.	.	.	.	.	.	.	T	14.66	2.600378	0.46423	.	.	ENSG00000121858	ENST00000241261	D	0.95412	-3.7	5.68	4.5	0.54988	Tumour necrosis factor (3);Tumour necrosis factor-like (2);	0.323500	0.37530	N	0.002051	D	0.97604	0.9215	M	0.85373	2.75	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	D	0.97812	1.0251	10	0.72032	D	0.01	-18.1925	13.2187	0.59875	0.0:0.0:0.1329:0.8671	.	242	P50591	TNF10_HUMAN	F	242	ENSP00000241261:I242F	ENSP00000241261:I242F	I	-	1	0	TNFSF10	173707098	1.000000	0.71417	1.000000	0.80357	0.057000	0.15508	3.882000	0.56160	1.065000	0.40693	0.482000	0.46254	ATC	.	.	.	none		0.333	TNFSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346601.1		
OTOP1	133060	hgsc.bcm.edu	37	4	4199006	4199007	+	Missense_Mutation	DNP	TC	TC	CT			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	T|C	T|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr4:4199006_4199007TC>CT	ENST00000296358.4	-	5	1578_1579	c.1554_1555GA>AG	c.(1552-1557)gaGAgc>gaAGgc	p.S519G		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	519					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CCCCAGCTGCTCTCCTCCTGCT	0.564																																					p.S519G|p.E518E		Atlas-SNP	.											.	OTOP1	118	.	0			c.A1555G|c.G1554A						PASS	.																																			SO:0001583	missense	133060	exon5			AGCTGCTCTCCTC|GCTGCTCTCCTCC	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.1554_1555delinsCT	chr4.hg19:g.4199006_4199007delinsCT	ENSP00000296358:p.Ser519Gly	119.0|117.0	0.0	.		94.0|96.0	25.0|27.0	.	NM_177998	A1L476	Missense_Mutation|Silent	SNP	ENST00000296358.4	hg19	CCDS3372.1																																																																																			.	.	.	none		0.564	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
SDAD1	55153	hgsc.bcm.edu	37	4	76877179	76877179	+	Silent	SNP	C	C	T			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr4:76877179C>T	ENST00000356260.5	-	21	2083	c.1965G>A	c.(1963-1965)cgG>cgA	p.R655R	AC110615.1_ENST00000599764.1_Silent_p.Y41Y|SDAD1_ENST00000395711.4_Silent_p.R618R	NM_018115.2	NP_060585.2	Q9NVU7	SDA1_HUMAN	SDA1 domain containing 1	655					actin cytoskeleton organization (GO:0030036)|protein transport (GO:0015031)|ribosomal large subunit biogenesis (GO:0042273)|ribosomal large subunit export from nucleus (GO:0000055)	nucleolus (GO:0005730)				breast(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	19			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			TCTGGCTATACCGCATCATCA	0.393																																					p.R655R		Atlas-SNP	.											.	SDAD1	47	.	0			c.G1965A						PASS	.						242.0	227.0	232.0					4																	76877179		2203	4300	6503	SO:0001819	synonymous_variant	55153	exon21			GCTATACCGCATC	AF132198	CCDS3573.2, CCDS75147.1	4q21.21	2010-11-24			ENSG00000198301	ENSG00000198301			25537	protein-coding gene	gene with protein product						11483580	Standard	NM_001288984		Approved	FLJ10498	uc003hje.4	Q9NVU7	OTTHUMG00000130111	ENST00000356260.5:c.1965G>A	chr4.hg19:g.76877179C>T		392.0	0.0	.		311.0	101.0	.	NM_018115	Q32Q11|Q68D52|Q7Z5U4|Q9H831|Q9H9P6	Silent	SNP	ENST00000356260.5	hg19	CCDS3573.2																																																																																			.	.	.	none		0.393	SDAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252418.3	NM_018115	
ADAD1	132612	hgsc.bcm.edu	37	4	123336554	123336554	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr4:123336554A>G	ENST00000296513.2	+	11	1455	c.1270A>G	c.(1270-1272)Acc>Gcc	p.T424A	ADAD1_ENST00000388725.2_Missense_Mutation_p.T406A|ADAD1_ENST00000388724.2_Missense_Mutation_p.T413A	NM_139243.3	NP_640336.1	Q96M93	ADAD1_HUMAN	adenosine deaminase domain containing 1 (testis-specific)	424	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				multicellular organismal development (GO:0007275)|RNA processing (GO:0006396)|spermatid development (GO:0007286)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	35						TTGCAGTGATACCAGAGGCTT	0.333																																					p.T424A		Atlas-SNP	.											ADAD1,colon,carcinoma,0,1	ADAD1	94	.	0			c.A1270G						PASS	.						103.0	100.0	101.0					4																	123336554		2203	4300	6503	SO:0001583	missense	132612	exon11			AGTGATACCAGAG	AK057303	CCDS34058.1, CCDS54800.1, CCDS54801.1	4q27	2007-05-31			ENSG00000164113	ENSG00000164113			30713	protein-coding gene	gene with protein product		614130				7543294, 9541871	Standard	NM_139243		Approved	Tenr	uc003iep.3	Q96M93	OTTHUMG00000150128	ENST00000296513.2:c.1270A>G	chr4.hg19:g.123336554A>G	ENSP00000296513:p.Thr424Ala	171.0	1.0	.		125.0	10.0	.	NM_139243	A6NKN4|B7WPB0|D3DNX2|Q8IWG6|Q8NA06	Missense_Mutation	SNP	ENST00000296513.2	hg19	CCDS34058.1	.	.	.	.	.	.	.	.	.	.	A	13.21	2.169474	0.38315	.	.	ENSG00000164113	ENST00000296513;ENST00000388724;ENST00000388725	D;D;D	0.93133	-3.17;-3.17;-3.17	5.12	3.94	0.45596	Adenosine deaminase/editase (3);	0.310779	0.32987	N	0.005405	D	0.91375	0.7279	L	0.39020	1.185	0.31646	N	0.64739	P;D	0.58620	0.745;0.983	B;P	0.60286	0.382;0.872	D	0.86329	0.1697	10	0.08599	T	0.76	-14.2059	7.0801	0.25227	0.7952:0.0:0.0737:0.1312	.	413;424	Q96M93-2;Q96M93	.;ADAD1_HUMAN	A	424;413;406	ENSP00000296513:T424A;ENSP00000373376:T413A;ENSP00000373377:T406A	ENSP00000296513:T424A	T	+	1	0	ADAD1	123556004	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.208000	0.58486	0.800000	0.34041	0.528000	0.53228	ACC	.	.	.	none		0.333	ADAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316452.1	NM_139243	
PLK4	10733	hgsc.bcm.edu	37	4	128804442	128804442	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr4:128804442C>T	ENST00000270861.5	+	3	426	c.152C>T	c.(151-153)gCa>gTa	p.A51V	PLK4_ENST00000507249.1_Missense_Mutation_p.A51V|PLK4_ENST00000515069.1_Missense_Mutation_p.A51V|PLK4_ENST00000513090.1_Intron|PLK4_ENST00000514379.1_Missense_Mutation_p.A10V|PLK4_ENST00000511942.1_3'UTR	NM_014264.4	NP_055079.3	O00444	PLK4_HUMAN	polo-like kinase 4	51	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				centriole replication (GO:0007099)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of centriole replication (GO:0046601)|protein phosphorylation (GO:0006468)|trophoblast giant cell differentiation (GO:0060707)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	31						ATGTACAAAGCAGGAATGGTA	0.308																																					p.A51V	Colon(135;508 1718 19061 31832 42879)	Atlas-SNP	.											.	PLK4	65	.	0			c.C152T						PASS	.						71.0	71.0	71.0					4																	128804442		2203	4299	6502	SO:0001583	missense	10733	exon3			ACAAAGCAGGAAT	Y13115	CCDS3735.1, CCDS54803.1, CCDS54804.1	4q27-q28	2013-01-18	2010-06-24	2004-01-28	ENSG00000142731	ENSG00000142731			11397	protein-coding gene	gene with protein product		605031	"""serine/threonine kinase 18"", ""polo-like kinase 4 (Drosophila)"""	STK18			Standard	NM_014264		Approved	Sak	uc003ifo.3	O00444	OTTHUMG00000133301	ENST00000270861.5:c.152C>T	chr4.hg19:g.128804442C>T	ENSP00000270861:p.Ala51Val	53.0	0.0	.		48.0	13.0	.	NM_014264	B2RAL0|B7Z837|B7Z8G7|Q8IYF0|Q96Q95|Q9UD84|Q9UDE2	Missense_Mutation	SNP	ENST00000270861.5	hg19	CCDS3735.1	.	.	.	.	.	.	.	.	.	.	C	15.38	2.815330	0.50527	.	.	ENSG00000142731	ENST00000270861;ENST00000515069;ENST00000507249;ENST00000514379	T;T;T;T	0.65732	-0.17;-0.17;-0.17;1.83	5.39	5.39	0.77823	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.110302	0.64402	D	0.000009	T	0.49218	0.1544	L	0.36672	1.1	0.48901	D	0.999727	B	0.23128	0.08	B	0.27608	0.081	T	0.46105	-0.9215	10	0.31617	T	0.26	-8.6513	7.0116	0.24865	0.0:0.79:0.0:0.21	.	51	O00444	PLK4_HUMAN	V	51;51;51;10	ENSP00000270861:A51V;ENSP00000421774:A51V;ENSP00000423412:A51V;ENSP00000423582:A10V	ENSP00000270861:A51V	A	+	2	0	PLK4	129023892	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.422000	0.52749	2.520000	0.84964	0.655000	0.94253	GCA	.	.	.	none		0.308	PLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257095.3		
LRBA	987	hgsc.bcm.edu	37	4	151829520	151829520	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr4:151829520G>A	ENST00000357115.3	-	11	1702	c.1459C>T	c.(1459-1461)Caa>Taa	p.Q487*	LRBA_ENST00000507224.1_Nonsense_Mutation_p.Q487*|LRBA_ENST00000535741.1_Nonsense_Mutation_p.Q487*|LRBA_ENST00000510413.1_Nonsense_Mutation_p.Q487*	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	487						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					GACAAATATTGCCTGTAATCC	0.363																																					p.Q487X		Atlas-SNP	.											.	LRBA	253	.	0			c.C1459T						PASS	.						126.0	121.0	122.0					4																	151829520		2203	4300	6503	SO:0001587	stop_gained	987	exon11			AATATTGCCTGTA	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.1459C>T	chr4.hg19:g.151829520G>A	ENSP00000349629:p.Gln487*	115.0	0.0	.		93.0	31.0	.	NM_006726	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Nonsense_Mutation	SNP	ENST00000357115.3	hg19	CCDS3773.1	.	.	.	.	.	.	.	.	.	.	G	43	9.887563	0.99288	.	.	ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224	.	.	.	5.63	5.63	0.86233	.	0.000000	0.48286	U	0.000186	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	.	20.047	0.97613	0.0:0.0:1.0:0.0	.	.	.	.	X	487	.	ENSP00000349629:Q487X	Q	-	1	0	LRBA	152048970	1.000000	0.71417	1.000000	0.80357	0.838000	0.47535	9.120000	0.94369	2.802000	0.96397	0.563000	0.77884	CAA	.	.	.	none		0.363	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1		
GOLPH3	64083	hgsc.bcm.edu	37	5	32126417	32126417	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr5:32126417C>A	ENST00000265070.6	-	4	1113	c.798G>T	c.(796-798)aaG>aaT	p.K266N	GOLPH3_ENST00000512668.1_5'Flank	NM_022130.3	NP_071413.1	Q9H4A6	GOLP3_HUMAN	golgi phosphoprotein 3 (coat-protein)	266					cell adhesion molecule production (GO:0060352)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|gene expression (GO:0010467)|glycoprotein biosynthetic process (GO:0009101)|Golgi organization (GO:0007030)|Golgi to plasma membrane protein transport (GO:0043001)|Golgi vesicle budding (GO:0048194)|lamellipodium assembly (GO:0030032)|leukocyte tethering or rolling (GO:0050901)|positive regulation of protein secretion (GO:0050714)|positive regulation of TOR signaling (GO:0032008)|protein retention in Golgi apparatus (GO:0045053)|protein secretion (GO:0009306)|regulation of mitochondrion organization (GO:0010821)	cytosol (GO:0005829)|endosome (GO:0005768)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	enzyme binding (GO:0019899)|phosphatidylinositol-4-phosphate binding (GO:0070273)			kidney(2)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	11						GCCGCACTCTCTTGGTAGCCA	0.552																																					p.K266N		Atlas-SNP	.											.	GOLPH3	25	.	0			c.G798T						PASS	.						94.0	80.0	85.0					5																	32126417		2203	4300	6503	SO:0001583	missense	64083	exon4			CACTCTCTTGGTA	AK075156	CCDS3896.1	5p13.2	2008-07-18			ENSG00000113384	ENSG00000113384			15452	protein-coding gene	gene with protein product	"""golgi peripheral membrane protein 1, 34 kDa"", ""golgi protein"", ""coat-protein"", ""golgi-associated protein"""	612207				11042173, 16263763	Standard	NM_022130		Approved	GPP34, GOPP1, MIDAS	uc003jhp.1	Q9H4A6	OTTHUMG00000090679	ENST00000265070.6:c.798G>T	chr5.hg19:g.32126417C>A	ENSP00000265070:p.Lys266Asn	155.0	0.0	.		142.0	33.0	.	NM_022130	Q9UIW5	Missense_Mutation	SNP	ENST00000265070.6	hg19	CCDS3896.1	.	.	.	.	.	.	.	.	.	.	C	8.954	0.968949	0.18659	.	.	ENSG00000113384	ENST00000265070;ENST00000542582	.	.	.	6.17	4.38	0.52667	.	0.000000	0.85682	D	0.000000	T	0.63745	0.2537	L	0.60845	1.875	0.80722	D	1	D	0.63046	0.992	P	0.61328	0.887	T	0.60944	-0.7162	9	0.23302	T	0.38	.	7.4739	0.27365	0.1395:0.7289:0.0:0.1316	.	266	Q9H4A6	GOLP3_HUMAN	N	266;249	.	ENSP00000265070:K266N	K	-	3	2	GOLPH3	32162174	1.000000	0.71417	1.000000	0.80357	0.002000	0.02628	2.589000	0.46145	1.606000	0.50161	-0.182000	0.12963	AAG	.	.	.	none		0.552	GOLPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207363.2	NM_022130	
GPBP1	65056	hgsc.bcm.edu	37	5	56545332	56545332	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr5:56545332T>G	ENST00000506184.2	+	9	2006	c.901T>G	c.(901-903)Ttt>Gtt	p.F301V	GPBP1_ENST00000454432.2_Missense_Mutation_p.F321V|GPBP1_ENST00000514387.2_Missense_Mutation_p.F130V|GPBP1_ENST00000538707.1_Missense_Mutation_p.F308V|GPBP1_ENST00000424459.3_Missense_Mutation_p.F321V|GPBP1_ENST00000264779.6_Missense_Mutation_p.F308V|GPBP1_ENST00000511209.1_Missense_Mutation_p.F293V			Q86WP2	GPBP1_HUMAN	GC-rich promoter binding protein 1	301					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	19		Lung NSC(810;0.000861)|Prostate(74;0.0305)|Breast(144;0.222)		OV - Ovarian serous cystadenocarcinoma(10;7.64e-39)		GAAGAGTGAATTTTTGAAAGC	0.388																																					p.F308V		Atlas-SNP	.											.	GPBP1	51	.	0			c.T922G						PASS	.						107.0	104.0	105.0					5																	56545332		2203	4299	6502	SO:0001583	missense	65056	exon8			AGTGAATTTTTGA		CCDS34162.1, CCDS47211.1, CCDS47212.1, CCDS47212.2, CCDS56368.1	5q11.2	2008-02-05				ENSG00000062194			29520	protein-coding gene	gene with protein product		608412				12842993	Standard	NM_022913		Approved	DKFZp761C169, vasculin	uc003jrk.4	Q86WP2		ENST00000506184.2:c.901T>G	chr5.hg19:g.56545332T>G	ENSP00000421202:p.Phe301Val	95.0	0.0	.		107.0	32.0	.	NM_001127236	A6NKW3|Q6NSH6|Q9H0D4|Q9H785|Q9NSN4	Missense_Mutation	SNP	ENST00000506184.2	hg19	CCDS34162.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.987062	0.74589	.	.	ENSG00000062194	ENST00000424459;ENST00000514387;ENST00000506184;ENST00000454432;ENST00000511209;ENST00000264779;ENST00000538707	T;T;T;T;T;T;T	0.59364	1.24;0.27;1.3;1.24;1.24;1.3;1.3	6.16	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.55970	0.1954	M	0.62723	1.935	0.46701	D	0.999164	P;P;P;P	0.47545	0.897;0.728;0.728;0.728	B;B;B;B	0.42214	0.38;0.294;0.23;0.294	T	0.60632	-0.7225	10	0.87932	D	0	-10.4	11.4966	0.50413	0.1338:0.0:0.0:0.8662	.	321;308;293;301	D4PHA4;Q86WP2-2;Q86WP2-3;Q86WP2	.;.;.;GPBP1_HUMAN	V	321;130;301;321;293;308;308	ENSP00000401596:F321V;ENSP00000421709:F130V;ENSP00000421202:F301V;ENSP00000403522:F321V;ENSP00000422337:F293V;ENSP00000264779:F308V;ENSP00000440090:F308V	ENSP00000264779:F308V	F	+	1	0	GPBP1	56581089	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	5.480000	0.66820	1.110000	0.41699	0.528000	0.53228	TTT	.	.	.	none		0.388	GPBP1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000374496.1	NM_022913	
CD180	4064	hgsc.bcm.edu	37	5	66478708	66478708	+	Silent	SNP	T	T	G			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr5:66478708T>G	ENST00000256447.4	-	3	2120	c.1963A>C	c.(1963-1965)Agg>Cgg	p.R655R	CTD-2306M10.1_ENST00000602471.1_lincRNA	NM_005582.2	NP_005573.2	Q99467	CD180_HUMAN	CD180 molecule	655					B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(2)|kidney(7)|large_intestine(12)|liver(1)|lung(8)|ovary(1)|stomach(2)	34		Lung NSC(167;4.94e-05)|Prostate(74;0.00601)|Ovarian(174;0.0654)|Breast(144;0.198)|Colorectal(97;0.234)		Lung(70;0.0046)		TATTTCCACCTGAGAAGGTAT	0.373																																					p.R655R		Atlas-SNP	.											.	CD180	78	.	0			c.A1963C						PASS	.						36.0	39.0	38.0					5																	66478708		2203	4300	6503	SO:0001819	synonymous_variant	4064	exon3			TCCACCTGAGAAG	D83597	CCDS3992.1	5q12	2008-02-05	2006-03-28	2005-06-07	ENSG00000134061	ENSG00000134061		"""CD molecules"""	6726	protein-coding gene	gene with protein product		602226	"""lymphocyte antigen 64 (mouse) homolog, radioprotective, 105kD"", ""CD180 antigen"""	LY64		9763566, 8975706	Standard	NM_005582		Approved	RP105, Ly78	uc003juy.2	Q99467	OTTHUMG00000131229	ENST00000256447.4:c.1963A>C	chr5.hg19:g.66478708T>G		84.0	0.0	.		51.0	18.0	.	NM_005582	B2R7Z7|Q32MM5	Silent	SNP	ENST00000256447.4	hg19	CCDS3992.1																																																																																			.	.	.	none		0.373	CD180-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253973.2	NM_005582	
LNPEP	4012	hgsc.bcm.edu	37	5	96328816	96328816	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr5:96328816T>A	ENST00000231368.5	+	5	1921	c.1229T>A	c.(1228-1230)aTt>aAt	p.I410N	LNPEP_ENST00000395770.3_Missense_Mutation_p.I396N	NM_005575.2	NP_005566.2	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase	410					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-cell signaling (GO:0007267)|female pregnancy (GO:0007565)|membrane organization (GO:0061024)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|early endosome lumen (GO:0031905)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	34		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		TACTTTGAAATTCAGTACCCA	0.303																																					p.I410N		Atlas-SNP	.											.	LNPEP	80	.	0			c.T1229A						PASS	.						66.0	67.0	67.0					5																	96328816		2202	4299	6501	SO:0001583	missense	4012	exon5			TTGAAATTCAGTA	D50810	CCDS4087.1, CCDS43346.1	5q15	2011-07-25			ENSG00000113441	ENSG00000113441	3.4.11.3		6656	protein-coding gene	gene with protein product	"""cystinyl aminopeptidase"", ""placental leucine aminopeptidase"""	151300				8550619	Standard	NM_175920		Approved	CAP, PLAP, P-LAP	uc003kmw.1	Q9UIQ6	OTTHUMG00000128719	ENST00000231368.5:c.1229T>A	chr5.hg19:g.96328816T>A	ENSP00000231368:p.Ile410Asn	130.0	0.0	.		112.0	46.0	.	NM_005575	O00769|Q15145|Q59H76|Q9TNQ2|Q9TNQ3|Q9UIQ7	Missense_Mutation	SNP	ENST00000231368.5	hg19	CCDS4087.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.278587	0.80692	.	.	ENSG00000113441	ENST00000231368;ENST00000395770	T;T	0.03035	4.07;4.07	4.94	4.94	0.65067	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.25082	0.0609	M	0.92880	3.355	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.16100	-1.0414	10	0.87932	D	0	.	14.5573	0.68109	0.0:0.0:0.0:1.0	.	410	Q9UIQ6	LCAP_HUMAN	N	410;396	ENSP00000231368:I410N;ENSP00000379117:I396N	ENSP00000231368:I410N	I	+	2	0	LNPEP	96354572	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.757000	0.68766	1.964000	0.57103	0.455000	0.32223	ATT	.	.	.	none		0.303	LNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250624.1	NM_005575	
PCDHA9	9752	hgsc.bcm.edu	37	5	140228538	140228538	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr5:140228538C>A	ENST00000532602.1	+	1	1491	c.458C>A	c.(457-459)cCa>cAa	p.P153Q	PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA9_ENST00000378122.3_Missense_Mutation_p.P153Q|PCDHA4_ENST00000530339.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000529310.1_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	153	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCTCGGTTTCCACTAGAGGGC	0.547																																					p.P153Q	Melanoma(55;1800 1972 14909)	Atlas-SNP	.											.	PCDHA9	373	.	0			c.C458A						PASS	.						54.0	51.0	52.0					5																	140228538		2202	4292	6494	SO:0001583	missense	9752	exon1			GGTTTCCACTAGA	AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.458C>A	chr5.hg19:g.140228538C>A	ENSP00000436042:p.Pro153Gln	189.0	0.0	.		194.0	45.0	.	NM_031857	O15053|Q2M3S5	Missense_Mutation	SNP	ENST00000532602.1	hg19	CCDS54920.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.352609	0.82132	.	.	ENSG00000204961	ENST00000532602;ENST00000378122	T;T	0.48201	0.82;0.82	4.13	4.13	0.48395	Cadherin (3);Cadherin-like (1);	0.000000	0.31697	U	0.007216	T	0.67552	0.2905	M	0.83384	2.64	0.28140	N	0.929845	D;D	0.62365	0.986;0.991	D;P	0.64877	0.93;0.894	T	0.64719	-0.6341	10	0.87932	D	0	.	12.8791	0.58008	0.1634:0.8366:0.0:0.0	.	153;153	Q9Y5H5;Q9Y5H5-2	PCDA9_HUMAN;.	Q	153	ENSP00000436042:P153Q;ENSP00000367362:P153Q	ENSP00000367362:P153Q	P	+	2	0	PCDHA9	140208722	0.000000	0.05858	0.994000	0.49952	0.994000	0.84299	1.041000	0.30291	2.263000	0.75096	0.591000	0.81541	CCA	.	.	.	none		0.547	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372896.2	NM_031857	
DDX39B	7919	hgsc.bcm.edu	37	6	31507042	31507042	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr6:31507042T>C	ENST00000396172.1	-	3	851	c.221A>G	c.(220-222)gAg>gGg	p.E74G	ATP6V1G2-DDX39B_ENST00000376185.1_3'UTR|DDX39B_ENST00000458640.1_Missense_Mutation_p.E74G|DDX39B_ENST00000376177.2_Missense_Mutation_p.E74G|DDX39B_ENST00000453105.2_Intron|DDX39B_ENST00000417556.2_Missense_Mutation_p.E74G|DDX39B_ENST00000449074.2_Missense_Mutation_p.E74G|SNORD117_ENST00000364915.1_RNA|SNORD84_ENST00000584275.1_RNA|DDX39B_ENST00000415382.2_Intron|ATP6V1G2-DDX39B_ENST00000475917.1_5'Flank	NM_004640.6	NP_004631.1	Q13838	DX39B_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B	74					ATP catabolic process (GO:0006200)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|RNA secondary structure unwinding (GO:0010501)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|transcription export complex (GO:0000346)	ATP binding (GO:0005524)|ATP-dependent protein binding (GO:0043008)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)|RNA-dependent ATPase activity (GO:0008186)|U4 snRNA binding (GO:0030621)|U6 snRNA binding (GO:0017070)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19						AGGGATGCACTCATGCTGGAC	0.507																																					p.E74G		Atlas-SNP	.											.	DDX39B	38	.	0			c.A221G						PASS	.						100.0	108.0	105.0					6																	31507042		1511	2709	4220	SO:0001583	missense	7919	exon3			ATGCACTCATGCT	Z37166	CCDS4697.1	6p21.33	2011-02-09	2011-02-08	2011-02-08	ENSG00000198563	ENSG00000198563		"""DEAD-boxes"""	13917	protein-coding gene	gene with protein product	"""U2AF65-associated protein 56"""	142560	"""HLA-B associated transcript 1"""	BAT1		7601445, 2813433	Standard	NM_004640		Approved	D6S81E, UAP56	uc003ntu.3	Q13838	OTTHUMG00000031165	ENST00000396172.1:c.221A>G	chr6.hg19:g.31507042T>C	ENSP00000379475:p.Glu74Gly	146.0	0.0	.		114.0	48.0	.	NM_004640	B0S8C0|O43496|Q0EFA1|Q2L6F9|Q53GL9|Q5RJ64|Q5RJ66|Q5ST94|Q5STB4|Q5STB5|Q5STB7|Q5STB8|Q5STU4|Q5STU5|Q5STU6|Q5STU8|Q71V76	Missense_Mutation	SNP	ENST00000396172.1	hg19	CCDS4697.1	.	.	.	.	.	.	.	.	.	.	T	19.66	3.869256	0.72065	.	.	ENSG00000198563	ENST00000376177;ENST00000458640;ENST00000396172;ENST00000417556;ENST00000427214;ENST00000428098;ENST00000419338;ENST00000456662;ENST00000449074;ENST00000428450;ENST00000449757;ENST00000456976;ENST00000418897;ENST00000419020;ENST00000458215	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.52057	0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68	5.53	5.53	0.82687	DEAD-like helicase (1);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.48295	0.1492	L	0.50993	1.605	0.80722	D	1	D;D;P	0.58970	0.984;0.972;0.897	P;P;P	0.57371	0.735;0.819;0.635	T	0.54221	-0.8326	10	0.72032	D	0.01	-22.5551	13.6077	0.62056	0.0:0.0:0.0:1.0	.	94;74;74	Q59G92;Q13838;Q5STU3	.;DX39B_HUMAN;.	G	74;74;74;74;74;74;74;74;74;74;97;74;89;74;74	ENSP00000365347:E74G;ENSP00000416269:E74G;ENSP00000379475:E74G;ENSP00000412582:E74G;ENSP00000399371:E74G;ENSP00000392672:E74G;ENSP00000410313:E74G;ENSP00000416350:E74G;ENSP00000391946:E74G;ENSP00000405707:E74G;ENSP00000409426:E97G;ENSP00000393984:E74G;ENSP00000399841:E89G;ENSP00000405245:E74G	ENSP00000365347:E74G	E	-	2	0	DDX39B	31615021	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	7.568000	0.82369	2.095000	0.63458	0.460000	0.39030	GAG	.	.	.	none		0.507	DDX39B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259083.1	NM_004640	
DST	667	hgsc.bcm.edu	37	6	56347659	56347659	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr6:56347659A>G	ENST00000361203.3	-	84	20271	c.20264T>C	c.(20263-20265)tTg>tCg	p.L6755S	DST_ENST00000244364.6_Missense_Mutation_p.L4452S|DST_ENST00000446842.2_Missense_Mutation_p.L6540S|DST_ENST00000312431.6_3'UTR|DST_ENST00000370788.2_Missense_Mutation_p.L4669S|DST_ENST00000421834.2_Missense_Mutation_p.L4778S|DST_ENST00000370769.4_Missense_Mutation_p.L6866S|DST_ENST00000370754.5_Missense_Mutation_p.L7044S			Q03001	DYST_HUMAN	dystonin	6754					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CCTCTTCCCCAACTCTTTTTG	0.448																																					p.L4452S		Atlas-SNP	.											.	DST	1427	.	0			c.T13355C						PASS	.						53.0	52.0	52.0					6																	56347659		1871	4102	5973	SO:0001583	missense	667	exon70			TTCCCCAACTCTT	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.20264T>C	chr6.hg19:g.56347659A>G	ENSP00000354508:p.Leu6755Ser	79.0	0.0	.		63.0	22.0	.	NM_015548	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	hg19		.	.	.	.	.	.	.	.	.	.	A	18.68	3.676124	0.67928	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.59772	0.24;0.24;0.24;0.24;0.24;0.24;0.24	5.65	5.65	0.86999	.	0.000000	0.41396	D	0.000891	T	0.75671	0.3881	M	0.87682	2.9	0.32532	N	0.534844	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.998;0.999;0.999	T	0.81079	-0.1095	9	0.87932	D	0	.	16.1657	0.81754	1.0:0.0:0.0:0.0	.	4778;6866;7044;6864;4452	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	S	4452;7044;6866;4778;6540;4669;6755	ENSP00000244364:L4452S;ENSP00000359790:L7044S;ENSP00000359805:L6866S;ENSP00000400883:L4778S;ENSP00000393645:L6540S;ENSP00000359824:L4669S;ENSP00000354508:L6755S	ENSP00000244364:L4452S	L	-	2	0	DST	56455618	1.000000	0.71417	0.987000	0.45799	0.992000	0.81027	9.307000	0.96226	2.276000	0.75962	0.528000	0.53228	TTG	.	.	.	none		0.448	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
SLC35D3	340146	hgsc.bcm.edu	37	6	137243696	137243696	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr6:137243696G>C	ENST00000331858.4	+	1	295	c.130G>C	c.(130-132)Gtg>Ctg	p.V44L		NM_001008783.1	NP_001008783.1	Q5M8T2	S35D3_HUMAN	solute carrier family 35, member D3	44					carbohydrate transport (GO:0008643)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)	13	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000136)|OV - Ovarian serous cystadenocarcinoma(155;0.00365)		CCTGACCCTGGTGCAGTGCCT	0.677																																					p.V44L		Atlas-SNP	.											.	SLC35D3	33	.	0			c.G130C						PASS	.						41.0	37.0	38.0					6																	137243696		2202	4298	6500	SO:0001583	missense	340146	exon1			ACCCTGGTGCAGT		CCDS34544.1	6q23.2	2013-05-22			ENSG00000182747	ENSG00000182747		"""Solute carriers"""	15621	protein-coding gene	gene with protein product		612519		FRCL1			Standard	NM_001008783		Approved		uc003qhe.3	Q5M8T2	OTTHUMG00000015651	ENST00000331858.4:c.130G>C	chr6.hg19:g.137243696G>C	ENSP00000333591:p.Val44Leu	61.0	0.0	.		50.0	17.0	.	NM_001008783	B4DI58|Q5QNZ6|Q6NX71	Missense_Mutation	SNP	ENST00000331858.4	hg19	CCDS34544.1	.	.	.	.	.	.	.	.	.	.	G	6.901	0.535701	0.13188	.	.	ENSG00000182747	ENST00000331858	T	0.50277	0.75	4.53	4.53	0.55603	.	0.154256	0.43110	D	0.000610	T	0.09642	0.0237	N	0.04880	-0.145	0.43608	D	0.995972	B	0.09022	0.002	B	0.06405	0.002	T	0.16928	-1.0386	10	0.02654	T	1	-17.4101	13.2101	0.59819	0.0:0.213:0.787:0.0	.	44	Q5M8T2	S35D3_HUMAN	L	44	ENSP00000333591:V44L	ENSP00000333591:V44L	V	+	1	0	SLC35D3	137285389	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.017000	0.57167	2.074000	0.62210	0.491000	0.48974	GTG	.	.	.	none		0.677	SLC35D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042389.2	XM_294017	
TAX1BP1	8887	hgsc.bcm.edu	37	7	27856087	27856087	+	Silent	SNP	T	T	C			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr7:27856087T>C	ENST00000396319.2	+	14	1972	c.1884T>C	c.(1882-1884)aaT>aaC	p.N628N	TAX1BP1_ENST00000265393.6_Intron|TAX1BP1_ENST00000543117.1_Intron|TAX1BP1_ENST00000433216.2_Intron|TAX1BP1_ENST00000409980.1_Silent_p.N652N	NM_006024.6	NP_006015.4	Q86VP1	TAXB1_HUMAN	Tax1 (human T-cell leukemia virus type I) binding protein 1	628					apoptotic process (GO:0006915)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)	cytosol (GO:0005829)	kinase binding (GO:0019900)			breast(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(8)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31			GBM - Glioblastoma multiforme(3;0.0823)			CATTGTCAAATGCACAACCAG	0.378																																					p.N628N		Atlas-SNP	.											.	TAX1BP1	71	.	0			c.T1884C						PASS	.						160.0	156.0	157.0					7																	27856087		2203	4300	6503	SO:0001819	synonymous_variant	8887	exon14			GTCAAATGCACAA	U33821	CCDS5415.1, CCDS43561.1, CCDS56471.1	7p15	2010-08-05			ENSG00000106052	ENSG00000106052			11575	protein-coding gene	gene with protein product		605326				10435631	Standard	NM_006024		Approved	TXBP151, CALCOCO3	uc003szl.3	Q86VP1	OTTHUMG00000023377	ENST00000396319.2:c.1884T>C	chr7.hg19:g.27856087T>C		347.0	0.0	.		298.0	100.0	.	NM_006024	B4DKU7|E7ENV2|O60398|O95770|Q13311|Q9BQG5|Q9UI88	Silent	SNP	ENST00000396319.2	hg19	CCDS5415.1																																																																																			.	.	.	none		0.378	TAX1BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214142.1	NM_006024	
ZNF679	168417	hgsc.bcm.edu	37	7	63721262	63721262	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr7:63721262G>A	ENST00000421025.1	+	4	486	c.217G>A	c.(217-219)Gag>Aag	p.E73K	ZNF679_ENST00000255746.4_Missense_Mutation_p.E73K	NM_001159524.1|NM_153363.2	NP_001152996.1|NP_699194.2	Q8IYX0	ZN679_HUMAN	zinc finger protein 679	73	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|lung(11)|skin(1)|stomach(1)	18						GCAAAATAAAGAGCCTTGGAA	0.378																																					p.E73K		Atlas-SNP	.											.	ZNF679	80	.	0			c.G217A						PASS	.						121.0	109.0	113.0					7																	63721262		692	1591	2283	SO:0001583	missense	168417	exon4			AATAAAGAGCCTT	BC033523	CCDS47592.1	7q11.21	2013-01-08			ENSG00000197123	ENSG00000197123		"""Zinc fingers, C2H2-type"", ""-"""	28650	protein-coding gene	gene with protein product	"""hypothetical protein MGC42415"""					12477932	Standard	NM_153363		Approved	MGC42415	uc003tsx.3	Q8IYX0	OTTHUMG00000156486	ENST00000421025.1:c.217G>A	chr7.hg19:g.63721262G>A	ENSP00000416809:p.Glu73Lys	73.0	0.0	.		60.0	24.0	.	NM_153363		Missense_Mutation	SNP	ENST00000421025.1	hg19	CCDS47592.1	.	.	.	.	.	.	.	.	.	.	G	5.786	0.329447	0.10956	.	.	ENSG00000197123	ENST00000421025;ENST00000255746	T;T	0.07800	3.16;3.16	0.235	0.235	0.15431	Krueppel-associated box (2);	.	.	.	.	T	0.07818	0.0196	L	0.47716	1.5	0.09310	N	1	B	0.14012	0.009	B	0.15052	0.012	T	0.32241	-0.9914	8	0.46703	T	0.11	.	.	.	.	.	73	Q8IYX0	ZN679_HUMAN	K	73	ENSP00000416809:E73K;ENSP00000255746:E73K	ENSP00000255746:E73K	E	+	1	0	ZNF679	63358697	0.303000	0.24463	0.027000	0.17364	0.031000	0.12232	1.500000	0.35682	0.308000	0.22923	0.313000	0.20887	GAG	.	.	.	none		0.378	ZNF679-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344317.2	NM_153363	
AKAP9	10142	hgsc.bcm.edu	37	7	91631868	91631868	+	Silent	SNP	A	A	G			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr7:91631868A>G	ENST00000359028.2	+	9	2898	c.2673A>G	c.(2671-2673)gaA>gaG	p.E891E	AKAP9_ENST00000356239.3_Silent_p.E879E|AKAP9_ENST00000358100.2_Silent_p.E891E			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	891	Glu-rich.				G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			ATGATTTAGAAGACAGTAAAA	0.294			T	BRAF	papillary thyroid																																p.E879E		Atlas-SNP	.		Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	.	AKAP9	788	.	0			c.A2637G						PASS	.						45.0	50.0	48.0					7																	91631868		2199	4289	6488	SO:0001819	synonymous_variant	10142	exon8			TTTAGAAGACAGT	AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.2673A>G	chr7.hg19:g.91631868A>G		98.0	0.0	.		75.0	21.0	.	NM_005751	A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Silent	SNP	ENST00000359028.2	hg19																																																																																				.	.	.	none		0.294	AKAP9-202	KNOWN	basic	protein_coding	protein_coding		NM_005751	
PEX1	5189	hgsc.bcm.edu	37	7	92119227	92119227	+	Splice_Site	SNP	T	T	C			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr7:92119227T>C	ENST00000248633.4	-	22	3534		c.e22-2		PEX1_ENST00000438045.1_Splice_Site|AC007566.10_ENST00000427458.1_RNA|AC007566.10_ENST00000441539.1_RNA|PEX1_ENST00000428214.1_Splice_Site	NM_000466.2	NP_000457.1	O43933	PEX1_HUMAN	peroxisomal biogenesis factor 1						ATP catabolic process (GO:0006200)|microtubule-based peroxisome localization (GO:0060152)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			TTGTGAGCTCTGCATGGTAAA	0.393																																					.		Atlas-SNP	.											.	PEX1	102	.	0			c.3439-2A>G						PASS	.						48.0	44.0	45.0					7																	92119227		2203	4300	6503	SO:0001630	splice_region_variant	5189	exon23			GAGCTCTGCATGG	AF026086	CCDS5627.1, CCDS64710.1	7q21.2	2010-04-21	2008-08-26		ENSG00000127980	ENSG00000127980		"""ATPases / AAA-type"""	8850	protein-coding gene	gene with protein product		602136	"""peroxisome biogenesis factor 1"", ""Zellweger syndrome 1"", ""Zellweger syndrome"""	ZWS1, ZWS		9398848	Standard	NM_001282677		Approved		uc003uly.3	O43933	OTTHUMG00000023926	ENST00000248633.4:c.3439-2A>G	chr7.hg19:g.92119227T>C		63.0	0.0	.		48.0	21.0	.	NM_000466	A4D1G3|A8KA90|B4DIM7|E9PE75|Q96S71|Q96S72|Q96S73|Q99994	Splice_Site	SNP	ENST00000248633.4	hg19	CCDS5627.1	.	.	.	.	.	.	.	.	.	.	T	16.09	3.023778	0.54683	.	.	ENSG00000127980	ENST00000438045;ENST00000248633;ENST00000428214	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2209	0.65826	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	PEX1	91957163	1.000000	0.71417	0.995000	0.50966	0.747000	0.42532	6.048000	0.71046	2.230000	0.72887	0.528000	0.53228	.	.	.	.	none		0.393	PEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254066.3	NM_000466	Intron
SLC7A2	6542	hgsc.bcm.edu	37	8	17401959	17401959	+	Splice_Site	SNP	G	G	T			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr8:17401959G>T	ENST00000494857.1	+	4	594		c.e4-1		SLC7A2_ENST00000004531.10_Splice_Site|SLC7A2_ENST00000398090.3_Splice_Site|SLC7A2_ENST00000522656.1_Splice_Site|SLC7A2_ENST00000470360.1_Splice_Site	NM_001008539.3	NP_001008539.3	P52569	CTR2_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 2						amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|macrophage activation (GO:0042116)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide production involved in inflammatory response (GO:0002537)|regulation of inflammatory response (GO:0050727)|regulation of macrophage activation (GO:0043030)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	basic amino acid transmembrane transporter activity (GO:0015174)|high-affinity arginine transmembrane transporter activity (GO:0005289)|L-lysine transmembrane transporter activity (GO:0015189)|L-ornithine transmembrane transporter activity (GO:0000064)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|stomach(1)	25				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	L-Lysine(DB00123)|L-Ornithine(DB00129)	GTTTTGGGAAGGTACATCAAG	0.388																																					.		Atlas-SNP	.											.	SLC7A2	157	.	0			c.377-1G>T						PASS	.						120.0	121.0	121.0					8																	17401959		2203	4300	6503	SO:0001630	splice_region_variant	6542	exon3			TGGGAAGGTACAT	D29990	CCDS6002.2, CCDS34852.1, CCDS55203.1	8p22	2013-05-22			ENSG00000003989	ENSG00000003989		"""Solute carriers"""	11060	protein-coding gene	gene with protein product		601872		ATRC2		8954799	Standard	NM_001164771		Approved	CAT-2, HCAT2	uc011kye.2	P52569	OTTHUMG00000130819	ENST00000494857.1:c.377-1G>T	chr8.hg19:g.17401959G>T		142.0	0.0	.		127.0	41.0	.	NM_001008539	B7ZL54|O15291|O15292|Q14CQ6|Q6NSZ7|Q86TC6	Splice_Site	SNP	ENST00000494857.1	hg19	CCDS34852.1	.	.	.	.	.	.	.	.	.	.	G	17.63	3.437083	0.62955	.	.	ENSG00000003989	ENST00000494857;ENST00000522656;ENST00000470360;ENST00000004531;ENST00000398090	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8219	0.96602	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC7A2	17446335	1.000000	0.71417	1.000000	0.80357	0.574000	0.36063	9.823000	0.99369	2.767000	0.95098	0.563000	0.77884	.	.	.	.	none		0.388	SLC7A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253367.3	NM_003046	Intron
EBF2	64641	hgsc.bcm.edu	37	8	25715868	25715868	+	Silent	SNP	G	G	A			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr8:25715868G>A	ENST00000520164.1	-	14	2032	c.1495C>T	c.(1495-1497)Cta>Tta	p.L499L	EBF2_ENST00000535548.1_Silent_p.L230L|EBF2_ENST00000408929.3_Silent_p.L351L	NM_022659.3	NP_073150.2	Q9HAK2	COE2_HUMAN	early B-cell factor 2	499	Pro/Ser/Thr-rich.				adipose tissue development (GO:0060612)|brown fat cell differentiation (GO:0050873)|cell fate determination (GO:0001709)|positive regulation of chromatin binding (GO:0035563)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(3)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		GAGCCATTTAGAAATCCTGGT	0.483																																					p.L499L	Esophageal Squamous(166;1018 1046 3854 8328 13429 13634 14071 26624 32918)	Atlas-SNP	.											.	EBF2	138	.	0			c.C1495T						PASS	.						125.0	125.0	125.0					8																	25715868		1950	4140	6090	SO:0001819	synonymous_variant	64641	exon14			CATTTAGAAATCC	AK021562, AK001144	CCDS43726.1	8p21.1	2007-07-26			ENSG00000221818	ENSG00000221818			19090	protein-coding gene	gene with protein product		609934				9151732	Standard	NM_022659		Approved	FLJ11500, COE2	uc003xes.2	Q9HAK2	OTTHUMG00000163838	ENST00000520164.1:c.1495C>T	chr8.hg19:g.25715868G>A		120.0	0.0	.		74.0	24.0	.	NM_022659	A0PJM4|A6NMF7|F5H645|Q66VZ3|Q6DK36|Q6IS86|Q6ISA4	Silent	SNP	ENST00000520164.1	hg19	CCDS43726.1																																																																																			.	.	.	none		0.483	EBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375886.2	NM_022659	
PHF20L1	51105	hgsc.bcm.edu	37	8	133854952	133854952	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr8:133854952G>C	ENST00000395386.2	+	19	2879	c.2580G>C	c.(2578-2580)gaG>gaC	p.E860D	AF230666.2_ENST00000429151.1_RNA|PHF20L1_ENST00000395390.2_Missense_Mutation_p.E835D|PHF20L1_ENST00000220847.7_Missense_Mutation_p.E247D|AF230666.2_ENST00000608375.1_RNA	NM_016018.4	NP_057102.4	A8MW92	P20L1_HUMAN	PHD finger protein 20-like 1	860							zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(1)|lung(10)|ovary(2)	15	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			TAACAAGTGAGCATAGCTATC	0.398																																					p.E860D		Atlas-SNP	.											.	PHF20L1	129	.	0			c.G2580C						PASS	.						74.0	70.0	71.0					8																	133854952		1849	4099	5948	SO:0001583	missense	51105	exon19			AAGTGAGCATAGC	AF230666	CCDS6367.2, CCDS6368.1, CCDS75791.1	8q24.22	2014-03-24			ENSG00000129292	ENSG00000129292		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24280	protein-coding gene	gene with protein product	"""tudor domain containing 20B"""					10810093, 24492612	Standard	NM_016018		Approved	CGI-72, FLJ13649, MGC64923, FLJ21615, TDRD20B	uc003ytt.3	A8MW92	OTTHUMG00000148656	ENST00000395386.2:c.2580G>C	chr8.hg19:g.133854952G>C	ENSP00000378784:p.Glu860Asp	86.0	0.0	.		104.0	49.0	.	NM_016018	A8MZC9|Q86U89|Q86W43|Q96BT0|Q9H702|Q9HBK3|Q9NYR3|Q9Y381	Missense_Mutation	SNP	ENST00000395386.2	hg19	CCDS6367.2	.	.	.	.	.	.	.	.	.	.	G	19.31	3.803425	0.70682	.	.	ENSG00000129292	ENST00000395386;ENST00000220847;ENST00000395390	T;T	0.54479	0.61;0.57	5.11	1.23	0.21249	.	0.365573	0.21339	U	0.076161	T	0.66655	0.2811	M	0.76574	2.34	0.33710	D	0.6156	D;D	0.67145	0.996;0.993	D;D	0.75484	0.986;0.967	T	0.71424	-0.4597	10	0.39692	T	0.17	-4.2073	9.4695	0.38833	0.2956:0.0:0.7044:0.0	.	835;860	F8W9L8;A8MW92	.;P20L1_HUMAN	D	860;247;835	ENSP00000378784:E860D;ENSP00000378788:E835D	ENSP00000220847:E247D	E	+	3	2	PHF20L1	133924134	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.184000	0.32053	0.261000	0.21753	0.650000	0.86243	GAG	.	.	.	none		0.398	PHF20L1-008	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308949.3	NM_016018	
EPPK1	83481	hgsc.bcm.edu	37	8	144944250	144944250	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr8:144944250G>T	ENST00000525985.1	-	2	3243	c.3172C>A	c.(3172-3174)Ctc>Atc	p.L1058I				P58107	EPIPL_HUMAN	epiplakin 1	1058						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GGCATGGGGAGGTGGTGGTGG	0.622																																					p.L1058I		Atlas-SNP	.											.	EPPK1	199	.	0			c.C3172A						PASS	.						33.0	38.0	36.0					8																	144944250		2118	4239	6357	SO:0001583	missense	83481	exon1			TGGGGAGGTGGTG	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.3172C>A	chr8.hg19:g.144944250G>T	ENSP00000436337:p.Leu1058Ile	20.0	0.0	.		22.0	6.0	.	NM_031308	Q76E58|Q9NSU9	Missense_Mutation	SNP	ENST00000525985.1	hg19		.	.	.	.	.	.	.	.	.	.	G	12.43	1.936941	0.34189	.	.	ENSG00000227184	ENST00000525985	T	0.79247	-1.25	4.4	2.49	0.30216	.	.	.	.	.	T	0.61813	0.2377	L	0.31207	0.915	0.25590	N	0.98671	B	0.27700	0.186	B	0.24701	0.055	T	0.46034	-0.9220	9	0.19590	T	0.45	.	7.0089	0.24851	0.0:0.32:0.5041:0.1759	.	1058	E9PPU0	.	I	1058	ENSP00000436337:L1058I	ENSP00000436337:L1058I	L	-	1	0	EPPK1	145016238	0.002000	0.14202	0.982000	0.44146	0.140000	0.21249	-0.269000	0.08596	2.242000	0.73789	0.563000	0.77884	CTC	.	.	.	none		0.622	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
ARHGAP39	80728	hgsc.bcm.edu	37	8	145806407	145806407	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr8:145806407T>C	ENST00000276826.5	-	2	536	c.335A>G	c.(334-336)aAc>aGc	p.N112S	ARHGAP39_ENST00000540274.1_Missense_Mutation_p.N112S|ARHGAP39_ENST00000377307.2_Missense_Mutation_p.N112S			Q9C0H5	RHG39_HUMAN	Rho GTPase activating protein 39	112					axon guidance (GO:0007411)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22						GGACTCCGTGTTCTGCTTCAG	0.706																																					p.N112S		Atlas-SNP	.											.	ARHGAP39	80	.	0			c.A335G						PASS	.						14.0	15.0	15.0					8																	145806407		2190	4288	6478	SO:0001583	missense	80728	exon4			TCCGTGTTCTGCT		CCDS34971.1	8q24.3	2011-06-29			ENSG00000147799	ENSG00000147799		"""Rho GTPase activating proteins"""	29351	protein-coding gene	gene with protein product	"""RhoGAP93B homolog (Drosophila)"", ""crossGAP homolog (Drosophila)"""	615880				15755809	Standard	XM_005272344		Approved	KIAA1688, Vilse, CrGAP	uc003zds.1	Q9C0H5	OTTHUMG00000165182	ENST00000276826.5:c.335A>G	chr8.hg19:g.145806407T>C	ENSP00000276826:p.Asn112Ser	9.0	0.0	.		16.0	7.0	.	NM_025251	B4E1I1	Missense_Mutation	SNP	ENST00000276826.5	hg19		.	.	.	.	.	.	.	.	.	.	T	14.91	2.676795	0.47886	.	.	ENSG00000147799	ENST00000276826;ENST00000377307;ENST00000540274	T;T;T	0.14022	2.54;2.54;2.54	5.4	4.25	0.50352	.	0.385486	0.28865	N	0.013896	T	0.10680	0.0261	N	0.20574	0.59	0.33264	D	0.560137	B;B	0.28512	0.111;0.214	B;B	0.37239	0.074;0.244	T	0.17930	-1.0353	10	0.37606	T	0.19	-3.2953	7.9013	0.29736	0.0:0.0945:0.0:0.9055	.	112;112	Q9C0H5;Q9C0H5-2	RHG39_HUMAN;.	S	112	ENSP00000276826:N112S;ENSP00000366522:N112S;ENSP00000445075:N112S	ENSP00000276826:N112S	N	-	2	0	ARHGAP39	145777215	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	0.946000	0.29069	0.882000	0.36016	0.445000	0.29226	AAC	.	.	.	none		0.706	ARHGAP39-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382509.1		
SMC5	23137	hgsc.bcm.edu	37	9	72901129	72901129	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr9:72901129A>T	ENST00000361138.5	+	8	1053	c.995A>T	c.(994-996)aAg>aTg	p.K332M		NM_015110.3	NP_055925.2	Q8IY18	SMC5_HUMAN	structural maintenance of chromosomes 5	332					cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|mitotic nuclear division (GO:0007067)|positive regulation of maintenance of mitotic sister chromatid cohesion (GO:0034184)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|telomere maintenance via recombination (GO:0000722)	cell junction (GO:0030054)|chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(4)	35						ACAGATATTAAGGAGGCATCT	0.353																																					p.K332M		Atlas-SNP	.											.	SMC5	96	.	0			c.A995T						PASS	.						65.0	74.0	71.0					9																	72901129		2203	4300	6503	SO:0001583	missense	23137	exon8			ATATTAAGGAGGC	AB011166	CCDS6632.1	9q21.11	2008-02-05	2006-07-06	2006-07-06	ENSG00000198887	ENSG00000198887		"""Structural maintenance of chromosomes proteins"""	20465	protein-coding gene	gene with protein product		609386	"""SMC5 structural maintenance of chromosomes 5-like 1 (yeast)"""	SMC5L1		9628581	Standard	NM_015110		Approved	KIAA0594	uc004ahr.2	Q8IY18	OTTHUMG00000019992	ENST00000361138.5:c.995A>T	chr9.hg19:g.72901129A>T	ENSP00000354957:p.Lys332Met	167.0	0.0	.		104.0	37.0	.	NM_015110	A6NM81|O60335|Q05D92|Q5VZ60|Q96SB9	Missense_Mutation	SNP	ENST00000361138.5	hg19	CCDS6632.1	.	.	.	.	.	.	.	.	.	.	A	17.68	3.450498	0.63290	.	.	ENSG00000198887	ENST00000361138	T	0.20598	2.06	5.34	2.93	0.34026	RecF/RecN/SMC (1);	0.052632	0.64402	D	0.000001	T	0.37999	0.1024	M	0.66939	2.045	0.54753	D	0.999983	D	0.89917	1.0	D	0.81914	0.995	T	0.10382	-1.0632	10	0.54805	T	0.06	-18.9526	6.4737	0.22024	0.7458:0.0:0.1261:0.1282	.	332	Q8IY18	SMC5_HUMAN	M	332	ENSP00000354957:K332M	ENSP00000354957:K332M	K	+	2	0	SMC5	72090949	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	1.657000	0.37366	0.949000	0.37715	0.402000	0.26972	AAG	.	.	.	none		0.353	SMC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052603.1	NM_015110	
PAPPA	5069	hgsc.bcm.edu	37	9	118997553	118997553	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr9:118997553C>G	ENST00000328252.3	+	7	2738	c.2369C>G	c.(2368-2370)cCc>cGc	p.P790R	PAPPA_ENST00000534838.1_Intron	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	790					cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						TTCCTCTACCCCTTGGTCCCT	0.567																																					p.P790R		Atlas-SNP	.											.	PAPPA	243	.	0			c.C2369G						PASS	.						116.0	93.0	101.0					9																	118997553		2203	4300	6503	SO:0001583	missense	5069	exon7			TCTACCCCTTGGT		CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.2369C>G	chr9.hg19:g.118997553C>G	ENSP00000330658:p.Pro790Arg	110.0	0.0	.		85.0	31.0	.	NM_002581	B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	ENST00000328252.3	hg19	CCDS6813.1	.	.	.	.	.	.	.	.	.	.	C	17.67	3.446744	0.63178	.	.	ENSG00000182752	ENST00000328252;ENST00000443904	T	0.01947	4.54	6.04	6.04	0.98038	.	0.148253	0.64402	D	0.000007	T	0.14184	0.0343	M	0.74881	2.28	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.74023	0.982;0.921	T	0.00005	-1.2530	10	0.87932	D	0	-8.2519	20.5948	0.99439	0.0:1.0:0.0:0.0	.	234;790	E7EMD3;Q13219	.;PAPP1_HUMAN	R	790;234	ENSP00000330658:P790R	ENSP00000330658:P790R	P	+	2	0	PAPPA	118037374	1.000000	0.71417	0.819000	0.32651	0.753000	0.42808	7.779000	0.85648	2.873000	0.98535	0.563000	0.77884	CCC	.	.	.	none		0.567	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581	
USP54	159195	hgsc.bcm.edu	37	10	75294429	75294429	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr10:75294429G>A	ENST00000339859.4	-	11	1344	c.1244C>T	c.(1243-1245)tCt>tTt	p.S415F	USP54_ENST00000408019.1_Missense_Mutation_p.S415F|USP54_ENST00000428547.1_Missense_Mutation_p.S265F|USP54_ENST00000319786.7_Missense_Mutation_p.S415F|USP54_ENST00000394811.2_5'UTR|USP54_ENST00000497106.1_Intron			Q70EL1	UBP54_HUMAN	ubiquitin specific peptidase 54	415					ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitinyl hydrolase activity (GO:0036459)			breast(5)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)	30	Prostate(51;0.0112)					AGAATCAGAAGAGAAGTGACT	0.498																																					p.S415F	Colon(195;880 2046 8854 25025 38456)	Atlas-SNP	.											.	USP54	178	.	0			c.C1244T						PASS	.						134.0	130.0	131.0					10																	75294429		1925	4124	6049	SO:0001583	missense	159195	exon10			TCAGAAGAGAAGT	AJ583820	CCDS7329.2	10q22.3	2006-09-26	2005-08-08	2004-01-30	ENSG00000166348	ENSG00000166348		"""Ubiquitin-specific peptidases"""	23513	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 29"", ""ubiquitin specific protease 54"""	C10orf29		14715245	Standard	NM_152586		Approved	FLJ37318, bA137L10.3, bA137L10.4	uc001juo.3	Q70EL1	OTTHUMG00000018469	ENST00000339859.4:c.1244C>T	chr10.hg19:g.75294429G>A	ENSP00000345216:p.Ser415Phe	100.0	0.0	.		89.0	31.0	.	NM_152586	A1L4Q4|A3KFK3|A3KFK5|A3KFK6|A3KFK7|A6PVS4|A6PVS5|A6PVS6|A6PVS7|B3KVY1|B9ZVM1|Q5F2F4|Q6P1N6|Q6ZSP1|Q6ZSR1|Q6ZTM0|Q8N1X2	Missense_Mutation	SNP	ENST00000339859.4	hg19	CCDS7329.2	.	.	.	.	.	.	.	.	.	.	G	28.4	4.915589	0.92178	.	.	ENSG00000166348	ENST00000339859;ENST00000408019;ENST00000428547;ENST00000319786	T;T;T	0.38240	1.25;1.25;1.15	5.54	5.54	0.83059	.	0.801566	0.09945	U	0.735488	T	0.56411	0.1983	L	0.38175	1.15	0.46774	D	0.999197	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.85130	0.996;0.996;0.997	T	0.54029	-0.8354	10	0.72032	D	0.01	-5.8858	19.5024	0.95100	0.0:0.0:1.0:0.0	.	415;415;415	B7Z7X1;Q70EL1-6;Q70EL1	.;.;UBP54_HUMAN	F	415;415;265;415	ENSP00000345216:S415F;ENSP00000386080:S415F;ENSP00000408714:S265F	ENSP00000326547:S415F	S	-	2	0	USP54	74964435	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.017000	0.93651	2.607000	0.88179	0.655000	0.94253	TCT	.	.	.	none		0.498	USP54-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316563.2	NM_152586	
GBF1	8729	hgsc.bcm.edu	37	10	104130513	104130513	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr10:104130513C>A	ENST00000369983.3	+	29	3813	c.3553C>A	c.(3553-3555)Ctc>Atc	p.L1185I		NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	Q92538	GBF1_HUMAN	golgi brefeldin A resistant guanine nucleotide exchange factor 1	1185					COPI coating of Golgi vesicle (GO:0048205)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of ARF protein signal transduction (GO:0032012)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	cis-Golgi network (GO:0005801)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(14)|kidney(8)|large_intestine(15)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	71		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		TCTATACCACCTCTGTGTTCA	0.552																																					p.L1186I		Atlas-SNP	.											.	GBF1	142	.	0			c.C3556A						PASS	.						225.0	181.0	196.0					10																	104130513		2203	4300	6503	SO:0001583	missense	8729	exon29			TACCACCTCTGTG	D87435	CCDS7533.1	10q24	2010-02-12	2010-02-12		ENSG00000107862	ENSG00000107862			4181	protein-coding gene	gene with protein product		603698	"""golgi-specific brefeldin A resistance factor 1"""			9828135	Standard	NM_004193		Approved	KIAA0248, ARF1GEF	uc001kux.2	Q92538	OTTHUMG00000018955	ENST00000369983.3:c.3553C>A	chr10.hg19:g.104130513C>A	ENSP00000359000:p.Leu1185Ile	239.0	0.0	.		179.0	62.0	.	NM_001199378	Q5VXX3|Q96CK6|Q96HZ3|Q9H473	Missense_Mutation	SNP	ENST00000369983.3	hg19	CCDS7533.1	.	.	.	.	.	.	.	.	.	.	C	18.07	3.541954	0.65198	.	.	ENSG00000107862	ENST00000369983	T	0.10573	2.86	5.36	2.53	0.30540	.	0.000000	0.85682	D	0.000000	T	0.15609	0.0376	L	0.29908	0.895	0.53005	D	0.999965	D;D;D	0.63880	0.985;0.968;0.993	P;P;D	0.70016	0.614;0.53;0.967	T	0.09862	-1.0655	10	0.12766	T	0.61	-10.2271	9.4682	0.38826	0.0:0.7169:0.0:0.2831	.	1185;1185;1185	Q149P1;Q149P0;Q92538	.;.;GBF1_HUMAN	I	1185	ENSP00000359000:L1185I	ENSP00000359000:L1185I	L	+	1	0	GBF1	104120503	0.999000	0.42202	0.991000	0.47740	0.997000	0.91878	2.530000	0.45641	0.402000	0.25451	0.655000	0.94253	CTC	.	.	.	none		0.552	GBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050051.1		
CNNM2	54805	hgsc.bcm.edu	37	10	104679308	104679308	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr10:104679308G>T	ENST00000369878.4	+	1	1259	c.1071G>T	c.(1069-1071)gaG>gaT	p.E357D	CNNM2_ENST00000433628.2_Missense_Mutation_p.E357D|CNNM2_ENST00000369875.3_Missense_Mutation_p.E357D	NM_017649.4	NP_060119.3	Q9H8M5	CNNM2_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 2	357	DUF21.				magnesium ion homeostasis (GO:0010960)|magnesium ion transport (GO:0015693)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	adenyl nucleotide binding (GO:0030554)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		TCTTCGGAGAGATCGTGCCCC	0.607																																					p.E357D		Atlas-SNP	.											.	CNNM2	119	.	0			c.G1071T						PASS	.						76.0	75.0	75.0					10																	104679308		2203	4300	6503	SO:0001583	missense	54805	exon1			CGGAGAGATCGTG	AF216962	CCDS7543.1, CCDS44474.1, CCDS44475.1	10q24.32	2014-08-08	2014-08-07		ENSG00000148842	ENSG00000148842			103	protein-coding gene	gene with protein product		607803	"""cyclin M2"""	ACDP2		21393841, 24699222	Standard	NM_017649		Approved		uc001kwm.3	Q9H8M5	OTTHUMG00000018976	ENST00000369878.4:c.1071G>T	chr10.hg19:g.104679308G>T	ENSP00000358894:p.Glu357Asp	129.0	0.0	.		125.0	42.0	.	NM_199076	Q5T569|Q5T570|Q8WU59|Q9H952|Q9NRK5|Q9NXT4	Missense_Mutation	SNP	ENST00000369878.4	hg19	CCDS44474.1	.	.	.	.	.	.	.	.	.	.	G	14.63	2.594054	0.46214	.	.	ENSG00000148842	ENST00000457502;ENST00000433628;ENST00000369875;ENST00000369878;ENST00000345419;ENST00000541201	D;D;D	0.94576	-3.46;-3.46;-3.46	4.32	2.42	0.29668	Domain of unknown function DUF21 (1);	0.112531	0.64402	D	0.000007	D	0.97642	0.9227	H	0.95950	3.745	0.80722	D	1	D;D;D	0.89917	0.985;0.988;1.0	D;D;D	0.91635	0.972;0.984;0.999	D	0.96198	0.9143	10	0.87932	D	0	.	8.1171	0.30950	0.2718:0.0:0.7282:0.0	.	357;357;357	Q9H8M5-2;Q9H8M5;F5H1I3	.;CNNM2_HUMAN;.	D	357	ENSP00000392875:E357D;ENSP00000358891:E357D;ENSP00000358894:E357D	ENSP00000286899:E357D	E	+	3	2	CNNM2	104669298	1.000000	0.71417	0.998000	0.56505	0.690000	0.40134	2.046000	0.41260	0.262000	0.21774	0.561000	0.74099	GAG	.	.	.	none		0.607	CNNM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050113.3	NM_017649	
SORCS1	114815	hgsc.bcm.edu	37	10	108412294	108412294	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr10:108412294G>A	ENST00000263054.6	-	18	2328	c.2321C>T	c.(2320-2322)tCc>tTc	p.S774F	SORCS1_ENST00000344440.6_Missense_Mutation_p.S774F|SORCS1_ENST00000369698.1_Missense_Mutation_p.S309F	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	774					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		GCAATTATTGGAAACCACCTT	0.468																																					p.S774F		Atlas-SNP	.											.	SORCS1	534	.	0			c.C2321T						PASS	.						112.0	106.0	108.0					10																	108412294		2203	4300	6503	SO:0001583	missense	114815	exon18			TTATTGGAAACCA	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.2321C>T	chr10.hg19:g.108412294G>A	ENSP00000263054:p.Ser774Phe	137.0	0.0	.		116.0	37.0	.	NM_001206572	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	ENST00000263054.6	hg19	CCDS7559.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.482881	0.84747	.	.	ENSG00000108018	ENST00000369698;ENST00000263054;ENST00000344440	T;T;T	0.67523	-0.27;-0.27;-0.27	5.74	5.74	0.90152	VPS10 (1);PKD domain (1);	0.000000	0.85682	D	0.000000	T	0.81735	0.4885	M	0.75777	2.31	0.45979	D	0.998792	D;D;D;D;D	0.58620	0.972;0.983;0.983;0.972;0.983	P;D;D;P;D	0.65684	0.825;0.937;0.915;0.866;0.937	T	0.80571	-0.1323	9	.	.	.	-16.8758	19.9145	0.97053	0.0:0.0:1.0:0.0	.	774;774;774;774;774	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	F	309;774;774	ENSP00000358712:S309F;ENSP00000263054:S774F;ENSP00000345964:S774F	.	S	-	2	0	SORCS1	108402284	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.448000	0.80631	2.709000	0.92574	0.655000	0.94253	TCC	.	.	.	none		0.468	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918	
MMP21	118856	hgsc.bcm.edu	37	10	127455494	127455494	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr10:127455494T>G	ENST00000368808.3	-	7	1446	c.1447A>C	c.(1447-1449)Aat>Cat	p.N483H		NM_147191.1	NP_671724.1	Q8N119	MMP21_HUMAN	matrix metallopeptidase 21	483					hematopoietic progenitor cell differentiation (GO:0002244)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|urinary_tract(1)	16		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)			Marimastat(DB00786)	GGATAAGAATTAAGTACTCGA	0.303																																					p.N483H		Atlas-SNP	.											.	MMP21	46	.	0			c.A1447C						PASS	.						67.0	70.0	69.0					10																	127455494		2203	4300	6503	SO:0001583	missense	118856	exon7			AAGAATTAAGTAC	AF331526	CCDS7647.1	10q26.3	2008-07-28	2005-08-08		ENSG00000154485	ENSG00000154485			14357	protein-coding gene	gene with protein product		608416	"""matrix metalloproteinase 21"""			11255011	Standard	NM_147191		Approved		uc001liu.3	Q8N119	OTTHUMG00000019235	ENST00000368808.3:c.1447A>C	chr10.hg19:g.127455494T>G	ENSP00000357798:p.Asn483His	120.0	0.0	.		98.0	27.0	.	NM_147191	Q5VZP9|Q8NG02	Missense_Mutation	SNP	ENST00000368808.3	hg19	CCDS7647.1	.	.	.	.	.	.	.	.	.	.	T	16.98	3.271658	0.59649	.	.	ENSG00000154485	ENST00000368808	T	0.02446	4.29	5.95	-4.11	0.03928	Hemopexin/matrixin (2);	0.904543	0.09772	N	0.757825	T	0.02688	0.0081	N	0.19112	0.55	0.09310	N	1	P	0.40282	0.711	P	0.47528	0.549	T	0.38607	-0.9653	10	0.56958	D	0.05	-10.6851	3.1826	0.06589	0.1141:0.3438:0.3474:0.1948	.	483	Q8N119	MMP21_HUMAN	H	483	ENSP00000357798:N483H	ENSP00000357798:N483H	N	-	1	0	MMP21	127445484	0.000000	0.05858	0.000000	0.03702	0.422000	0.31414	-0.140000	0.10342	-0.647000	0.05444	-0.274000	0.10170	AAT	.	.	.	none		0.303	MMP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050928.1		
PHRF1	57661	hgsc.bcm.edu	37	11	601639	601639	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr11:601639T>C	ENST00000264555.5	+	10	1218	c.1090T>C	c.(1090-1092)Tca>Cca	p.S364P	PHRF1_ENST00000416188.2_Missense_Mutation_p.S364P|PHRF1_ENST00000533464.1_Missense_Mutation_p.S360P|PHRF1_ENST00000413872.2_Missense_Mutation_p.S363P	NM_020901.2	NP_065952.2	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	364	Arg-rich.				mRNA processing (GO:0006397)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)	RNA polymerase binding (GO:0070063)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|urinary_tract(2)	28						AAGTAAGAGCTCAGCGACAAG	0.507																																					p.S364P		Atlas-SNP	.											.	PHRF1	188	.	0			c.T1090C						PASS	.						85.0	94.0	91.0					11																	601639		1969	4145	6114	SO:0001583	missense	57661	exon10			AAGAGCTCAGCGA	BC004950	CCDS44507.1, CCDS65987.1, CCDS65988.1, CCDS65989.1	11p15.5	2014-06-13			ENSG00000070047	ENSG00000070047		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	24351	protein-coding gene	gene with protein product	"""CTD binding SR like protein rA9"", ""protein phosphatase 1, regulatory subunit 125"""	611780		RNF221			Standard	XM_005253027		Approved	KIAA1542, PPP1R125	uc010qwc.2	Q9P1Y6	OTTHUMG00000165141	ENST00000264555.5:c.1090T>C	chr11.hg19:g.601639T>C	ENSP00000264555:p.Ser364Pro	70.0	0.0	.		59.0	29.0	.	NM_020901	A6H8W1|B7ZM64|B9EGP0|C9JS82|Q6PJP2|Q8IVY2|Q8N2Y7|Q9BSM2	Missense_Mutation	SNP	ENST00000264555.5	hg19		.	.	.	.	.	.	.	.	.	.	T	13.18	2.160816	0.38119	.	.	ENSG00000070047	ENST00000264555;ENST00000413872;ENST00000416188;ENST00000533464	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	4.37	0.796	0.18648	.	0.956972	0.08463	N	0.942121	T	0.29652	0.0740	L	0.35414	1.06	0.09310	N	1	B;B;B;B	0.11235	0.002;0.004;0.004;0.002	B;B;B;B	0.14578	0.005;0.011;0.011;0.005	T	0.26155	-1.0111	10	0.33940	T	0.23	-5.4809	5.8681	0.18789	0.0:0.1006:0.4218:0.4776	.	360;363;364;364	E9PJ24;F8WEF5;Q9P1Y6-3;Q9P1Y6	.;.;.;PHRF1_HUMAN	P	364;363;364;360	ENSP00000264555:S364P;ENSP00000388589:S363P;ENSP00000410626:S364P;ENSP00000431870:S360P	ENSP00000264555:S364P	S	+	1	0	PHRF1	591639	0.001000	0.12720	0.002000	0.10522	0.005000	0.04900	0.583000	0.23849	-0.016000	0.14127	-1.252000	0.01501	TCA	.	.	.	none		0.507	PHRF1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000382133.1	NM_020901	
MRPL49	740	hgsc.bcm.edu	37	11	64888258	64888258	+	5'Flank	SNP	C	C	A	rs3202210		TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr11:64888258C>A	ENST00000279242.2	+	0	0				MRPL49_ENST00000531705.1_5'Flank|FAU_ENST00000279259.3_Nonsense_Mutation_p.E81*|FAU_ENST00000529639.1_Missense_Mutation_p.K99N|MRPL49_ENST00000534078.1_5'Flank|MRPL49_ENST00000526171.1_5'Flank|FAU_ENST00000531743.1_Missense_Mutation_p.K99N|FAU_ENST00000529259.1_3'UTR|FAU_ENST00000527548.1_Missense_Mutation_p.K99N|FAU_ENST00000525297.1_Missense_Mutation_p.K64N	NM_004927.3	NP_004918.1	Q13405	RM49_HUMAN	mitochondrial ribosomal protein L49						translation (GO:0006412)	mitochondrial ribosome (GO:0005761)	structural constituent of ribosome (GO:0003735)			endometrium(1)|ovary(1)	2						TCTTCTTCTTCTTCTTCTCCT	0.557																																					p.K99N		Atlas-SNP	.											.	FAU	17	.	0			c.G297T						PASS	.						82.0	88.0	86.0					11																	64888258		2201	4297	6498	SO:0001631	upstream_gene_variant	2197	exon5			CTTCTTCTTCTTC		CCDS8096.1	11q13.1	2012-11-14	2001-10-16	2001-10-19	ENSG00000149792	ENSG00000149792		"""Mitochondrial ribosomal proteins / large subunits"""	1176	protein-coding gene	gene with protein product	"""neighbor of FAU"", ""next to FAU"""	606866	"""chromosome 11 open reading frame 4"""	C11orf4		8786148	Standard	NM_004927		Approved	NOF, NOF1, L49mt	uc001oda.2	Q13405	OTTHUMG00000165608		chr11.hg19:g.64888258C>A	Exception_encountered	254.0	0.0	.		220.0	80.0	.	NM_001997	B2R4G6	Missense_Mutation	SNP	ENST00000279242.2	hg19	CCDS8096.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.0|21.0	4.082357|4.082357	0.76528|0.76528	.|.	.|.	ENSG00000149806|ENSG00000149806	ENST00000279259|ENST00000529639;ENST00000531743;ENST00000525297;ENST00000527548;ENST00000526555	.|T;T;T;T;T	.|0.50277	.|0.75;0.75;0.75;0.75;0.75	5.7|5.7	4.79|4.79	0.61399|0.61399	.|.	.|0.045214	.|0.85682	.|D	.|0.000000	.|T	.|0.72503	.|0.3468	M|M	0.93016|0.93016	3.37|3.37	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.79541	.|-0.1761	.|8	0.25106|0.72032	T|D	0.35|0.01	.|.	12.7196|12.7196	0.57134|0.57134	0.0:0.9196:0.0:0.0804|0.0:0.9196:0.0:0.0804	.|.	.|.	.|.	.|.	X|N	81|99;99;64;99;99	.|ENSP00000435370:K99N;ENSP00000431822:K99N;ENSP00000436110:K64N;ENSP00000434440:K99N;ENSP00000433139:K99N	ENSP00000279259:E81X|ENSP00000436110:K64N	E|K	-|-	1|3	0|2	FAU|FAU	64644834|64644834	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	2.548000|2.548000	0.45794|0.45794	1.411000|1.411000	0.46957|0.46957	0.655000|0.655000	0.94253|0.94253	GAA|AAG	.	.	.	alt		0.557	MRPL49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385293.1	NM_004927	
DPP3	10072	hgsc.bcm.edu	37	11	66260242	66260242	+	Silent	SNP	G	G	A	rs200674271		TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr11:66260242G>A	ENST00000360510.2	+	10	1109	c.1044G>A	c.(1042-1044)gcG>gcA	p.A348A	DPP3_ENST00000531863.1_Silent_p.A368A|DPP3_ENST00000530165.1_Silent_p.A318A|DPP3_ENST00000541961.1_Silent_p.A348A|DPP3_ENST00000532677.1_Silent_p.A367A|DPP3_ENST00000533799.1_3'UTR|DPP3_ENST00000453114.1_Silent_p.A348A			Q9NY33	DPP3_HUMAN	dipeptidyl-peptidase 3	348					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)	23						GGCTGGTGGCGAGCGCAGAGC	0.602																																					p.A348A		Atlas-SNP	.											.	DPP3	61	.	0			c.G1044A						PASS	.						95.0	89.0	91.0					11																	66260242		2200	4295	6495	SO:0001819	synonymous_variant	10072	exon10			GGTGGCGAGCGCA	AB017970	CCDS8141.1, CCDS58147.1	11q12-q13.1	2008-02-05	2006-01-12		ENSG00000254986	ENSG00000254986	3.4.14.4		3008	protein-coding gene	gene with protein product		606818	"""dipeptidylpeptidase III"", ""dipeptidylpeptidase 3"""			10773679	Standard	NM_005700		Approved		uc001oif.2	Q9NY33	OTTHUMG00000167143	ENST00000360510.2:c.1044G>A	chr11.hg19:g.66260242G>A		145.0	0.0	.		149.0	64.0	.	NM_130443	B2RDB5|B4DLX4|F5H8L6|O95748|Q969H2|Q9BV67|Q9HAL6	Silent	SNP	ENST00000360510.2	hg19	CCDS8141.1																																																																																			.	.	.	weak		0.602	DPP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393424.2		
DGAT2	84649	hgsc.bcm.edu	37	11	75509461	75509461	+	Silent	SNP	C	C	T			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr11:75509461C>T	ENST00000228027.7	+	7	1259	c.999C>T	c.(997-999)ccC>ccT	p.P333P	RP11-535A19.1_ENST00000534354.1_RNA|DGAT2_ENST00000376262.3_Silent_p.P290P	NM_032564.4	NP_115953.2	Q96PD7	DGAT2_HUMAN	diacylglycerol O-acyltransferase 2	333					acylglycerol acyl-chain remodeling (GO:0036155)|cellular lipid metabolic process (GO:0044255)|cellular response to oleic acid (GO:0071400)|cellular triglyceride homeostasis (GO:0035356)|cholesterol homeostasis (GO:0042632)|diacylglycerol metabolic process (GO:0046339)|fat pad development (GO:0060613)|fatty acid homeostasis (GO:0055089)|glycerol metabolic process (GO:0006071)|glycerophospholipid biosynthetic process (GO:0046474)|lipid storage (GO:0019915)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|low-density lipoprotein particle clearance (GO:0034383)|phospholipid metabolic process (GO:0006644)|regulation of plasma lipoprotein particle levels (GO:0097006)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)	2-acylglycerol O-acyltransferase activity (GO:0003846)|diacylglycerol O-acyltransferase activity (GO:0004144)|protein homodimerization activity (GO:0042803)|retinol O-fatty-acyltransferase activity (GO:0050252)			endometrium(3)|large_intestine(5)|lung(5)|prostate(2)|skin(2)	17	Ovarian(111;0.103)					ACTCCAAGCCCATCACCACTG	0.552																																					p.P333P	Melanoma(35;811 1096 8354 24009 39363)	Atlas-SNP	.											.	DGAT2	37	.	0			c.C999T						PASS	.						48.0	43.0	45.0					11																	75509461		2200	4293	6493	SO:0001819	synonymous_variant	84649	exon7			CAAGCCCATCACC		CCDS31642.1, CCDS58162.1	11q13.3	2010-06-24	2010-06-24		ENSG00000062282	ENSG00000062282			16940	protein-coding gene	gene with protein product		606983	"""diacylglycerol O-acyltransferase homolog 2 (mouse)"""			11481335, 14970677	Standard	NM_032564		Approved		uc001oxa.3	Q96PD7	OTTHUMG00000165338	ENST00000228027.7:c.999C>T	chr11.hg19:g.75509461C>T		58.0	0.0	.		51.0	17.0	.	NM_032564	A6ND76|Q5U810|Q68CL3|Q68DJ0|Q8NDB7|Q96BS0|Q9BYE5	Silent	SNP	ENST00000228027.7	hg19	CCDS31642.1																																																																																			.	.	.	none		0.552	DGAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383506.1	NM_032564	
CNTN5	53942	hgsc.bcm.edu	37	11	99690367	99690367	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr11:99690367A>C	ENST00000524871.1	+	4	438	c.148A>C	c.(148-150)Acc>Ccc	p.T50P	CNTN5_ENST00000527185.1_Missense_Mutation_p.T50P|CNTN5_ENST00000528682.1_Missense_Mutation_p.T50P|CNTN5_ENST00000279463.3_Missense_Mutation_p.T50P|CNTN5_ENST00000418526.2_Intron	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	50					cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		TGGTTCCAAAACCAGACCACG	0.423																																					p.T50P		Atlas-SNP	.											.	CNTN5	324	.	0			c.A148C						PASS	.						115.0	117.0	116.0					11																	99690367		1906	4138	6044	SO:0001583	missense	53942	exon3			TCCAAAACCAGAC	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.148A>C	chr11.hg19:g.99690367A>C	ENSP00000435637:p.Thr50Pro	164.0	0.0	.		107.0	13.0	.	NM_001243270	A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Missense_Mutation	SNP	ENST00000524871.1	hg19	CCDS53696.1	.	.	.	.	.	.	.	.	.	.	A	11.45	1.642177	0.29157	.	.	ENSG00000149972	ENST00000527185;ENST00000528682;ENST00000524871;ENST00000279463	T;T;T;T	0.56941	0.43;0.5;0.5;0.5	5.06	-2.19	0.07015	.	1.005590	0.08006	N	0.989611	T	0.28699	0.0711	N	0.14661	0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.23583	-1.0184	10	0.62326	D	0.03	.	1.2696	0.02018	0.5048:0.1176:0.1378:0.2399	.	50;50	E9PKE8;O94779	.;CNTN5_HUMAN	P	50	ENSP00000433575:T50P;ENSP00000436185:T50P;ENSP00000435637:T50P;ENSP00000279463:T50P	ENSP00000279463:T50P	T	+	1	0	CNTN5	99195577	0.217000	0.23597	0.017000	0.16124	0.764000	0.43329	0.669000	0.25142	-0.145000	0.11294	0.528000	0.53228	ACC	.	.	.	none		0.423	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361	
BCL9L	283149	hgsc.bcm.edu	37	11	118771686	118771686	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr11:118771686A>C	ENST00000334801.3	-	6	3730	c.2766T>G	c.(2764-2766)aaT>aaG	p.N922K	BCL9L_ENST00000526143.1_5'UTR	NM_182557.2	NP_872363.1	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	922	Pro-rich.				canonical Wnt signaling pathway (GO:0060070)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell morphogenesis (GO:0022604)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|transcription coactivator activity (GO:0003713)			NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	56	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		AGCCCATCTGATTAATACTGA	0.632																																					p.N922K		Atlas-SNP	.											.	BCL9L	254	.	0			c.T2766G						PASS	.						62.0	60.0	61.0					11																	118771686		2200	4295	6495	SO:0001583	missense	283149	exon6			CATCTGATTAATA	AB094091	CCDS8403.1	11q23.3	2012-06-06				ENSG00000186174			23688	protein-coding gene	gene with protein product		609004				12964048	Standard	NM_182557		Approved	DLNB11	uc001pug.3	Q86UU0		ENST00000334801.3:c.2766T>G	chr11.hg19:g.118771686A>C	ENSP00000335320:p.Asn922Lys	92.0	0.0	.		70.0	19.0	.	NM_182557	A1A4C1|Q67FY1|Q6ZWJ0|Q6ZWK2	Missense_Mutation	SNP	ENST00000334801.3	hg19	CCDS8403.1	.	.	.	.	.	.	.	.	.	.	A	12.59	1.982733	0.34942	.	.	ENSG00000186174	ENST00000334801;ENST00000526143;ENST00000525300;ENST00000392849;ENST00000431085	T	0.66280	-0.2	4.48	-0.626	0.11544	.	0.114359	0.38663	N	0.001612	T	0.39009	0.1062	N	0.19112	0.55	0.45129	D	0.998148	P;P	0.44734	0.728;0.842	B;B	0.39217	0.294;0.236	T	0.14090	-1.0485	10	0.54805	T	0.06	-7.3556	6.4799	0.22057	0.2778:0.1784:0.5439:0.0	.	917;922	Q86UU0-2;Q86UU0	.;BCL9L_HUMAN	K	922;885;215;922;922	ENSP00000335320:N922K	ENSP00000335320:N922K	N	-	3	2	BCL9L	118276896	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	1.052000	0.30429	-0.032000	0.13758	0.533000	0.62120	AAT	.	.	.	none		0.632	BCL9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389653.1	NM_182557	
OR8B8	26493	hgsc.bcm.edu	37	11	124310919	124310919	+	Silent	SNP	C	C	T			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr11:124310919C>T	ENST00000328064.2	-	1	135	c.63G>A	c.(61-63)ccG>ccA	p.P21P		NM_012378.1	NP_036510.1	Q15620	OR8B8_HUMAN	olfactory receptor, family 8, subfamily B, member 8	21					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		TCTGGACTCCCGGTTGGTCAG	0.502																																					p.P21P		Atlas-SNP	.											.	OR8B8	76	.	0			c.G63A						PASS	.						62.0	61.0	61.0					11																	124310919		2201	4299	6500	SO:0001819	synonymous_variant	26493	exon1			GACTCCCGGTTGG	AF238488	CCDS8446.1	11q24.2	2012-08-09			ENSG00000197125	ENSG00000197125		"""GPCR / Class A : Olfactory receptors"""	8477	protein-coding gene	gene with protein product						9119360	Standard	NM_012378		Approved	TPCR85	uc010sal.2	Q15620	OTTHUMG00000165917	ENST00000328064.2:c.63G>A	chr11.hg19:g.124310919C>T		113.0	0.0	.		76.0	28.0	.	NM_012378	A1L446|Q96RC8	Silent	SNP	ENST00000328064.2	hg19	CCDS8446.1																																																																																			.	.	.	none		0.502	OR8B8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387056.1	NM_012378	
C3AR1	719	hgsc.bcm.edu	37	12	8212439	8212439	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr12:8212439C>T	ENST00000307637.4	-	2	546	c.343G>A	c.(343-345)Gcc>Acc	p.A115T		NM_004054.2	NP_004045.1	Q16581	C3AR_HUMAN	complement component 3a receptor 1	115					blood circulation (GO:0008015)|chemotaxis (GO:0006935)|complement receptor mediated signaling pathway (GO:0002430)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|metabolic process (GO:0008152)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation vascular endothelial growth factor production (GO:0010575)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C3a anaphylatoxin receptor activity (GO:0004943)|complement component C3a receptor activity (GO:0004876)|G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			breast(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)	20				Kidney(36;0.0893)		AGGCTAATGGCAGTAAGCAGG	0.517																																					p.A115T		Atlas-SNP	.											.	C3AR1	61	.	0			c.G343A						PASS	.						186.0	151.0	163.0					12																	8212439		2203	4300	6503	SO:0001583	missense	719	exon2			TAATGGCAGTAAG	U28488	CCDS8588.1	12p13.31	2012-08-10				ENSG00000171860		"""Complement system"", ""GPCR / Class A : Complement component receptors"""	1319	protein-coding gene	gene with protein product		605246				8605247	Standard	NM_004054		Approved	C3AR, AZ3B	uc001qtv.1	Q16581		ENST00000307637.4:c.343G>A	chr12.hg19:g.8212439C>T	ENSP00000302079:p.Ala115Thr	73.0	0.0	.		80.0	22.0	.	NM_004054	O43771|Q92868	Missense_Mutation	SNP	ENST00000307637.4	hg19	CCDS8588.1	.	.	.	.	.	.	.	.	.	.	C	16.21	3.059489	0.55325	.	.	ENSG00000171860	ENST00000307637;ENST00000546241	T;T	0.44482	0.92;0.92	5.64	4.76	0.60689	GPCR, rhodopsin-like superfamily (1);	0.379197	0.23680	N	0.045625	T	0.39835	0.1093	L	0.54965	1.715	0.40028	D	0.975498	P	0.41475	0.751	B	0.40375	0.327	T	0.26643	-1.0097	10	0.33141	T	0.24	.	12.4036	0.55426	0.0:0.9187:0.0:0.0813	.	115	Q16581	C3AR_HUMAN	T	115	ENSP00000302079:A115T;ENSP00000444500:A115T	ENSP00000302079:A115T	A	-	1	0	C3AR1	8103706	0.993000	0.37304	0.990000	0.47175	0.984000	0.73092	3.119000	0.50422	1.388000	0.46506	0.655000	0.94253	GCC	.	.	.	none		0.517	C3AR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400254.1		
KRT77	374454	hgsc.bcm.edu	37	12	53086340	53086340	+	Missense_Mutation	SNP	A	A	C	rs200694410		TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr12:53086340A>C	ENST00000341809.3	-	7	1320	c.1292T>G	c.(1291-1293)cTg>cGg	p.L431R	KRT77_ENST00000537195.1_Missense_Mutation_p.L198R|RP11-641A6.3_ENST00000547533.1_RNA	NM_175078.2	NP_778253.2	Q7Z794	K2C1B_HUMAN	keratin 77	431	Coil 2.|Rod.					cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.Q429fs*17(1)		NS(2)|endometrium(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						GGCCTCCTCCAGGTCCTGCAG	0.622																																					p.L431R		Atlas-SNP	.											.,1	KRT77	58	.	1	Deletion - Frameshift(1)	ovary(1)	c.T1292G						PASS	.						44.0	41.0	42.0					12																	53086340		2203	4288	6491	SO:0001583	missense	374454	exon7			TCCTCCAGGTCCT	BK000975	CCDS8837.1	12q13.13	2013-06-25	2006-07-17	2006-07-17	ENSG00000189182	ENSG00000189182		"""-"", ""Intermediate filaments type II, keratins (basic)"""	20411	protein-coding gene	gene with protein product		611158	"""keratin 1B"""	KRT1B		11683385, 16831889	Standard	NM_175078		Approved		uc001saw.3	Q7Z794	OTTHUMG00000169450	ENST00000341809.3:c.1292T>G	chr12.hg19:g.53086340A>C	ENSP00000342710:p.Leu431Arg	41.0	1.0	.		44.0	4.0	.	NM_175078	Q7RTS8	Missense_Mutation	SNP	ENST00000341809.3	hg19	CCDS8837.1	.	.	.	.	.	.	.	.	.	.	A	14.48	2.548637	0.45383	.	.	ENSG00000189182	ENST00000341809;ENST00000537195	D;D	0.82803	-1.65;-1.65	4.29	3.09	0.35607	Filament (1);	.	.	.	.	D	0.92130	0.7505	M	0.93978	3.48	0.29823	N	0.830669	D	0.67145	0.996	D	0.71184	0.972	D	0.87375	0.2353	9	0.87932	D	0	.	10.047	0.42192	0.9169:0.0:0.0831:0.0	.	431	Q7Z794	K2C1B_HUMAN	R	431;198	ENSP00000342710:L431R;ENSP00000440803:L198R	ENSP00000342710:L431R	L	-	2	0	KRT77	51372607	1.000000	0.71417	0.089000	0.20774	0.137000	0.21094	7.484000	0.81180	0.576000	0.29452	0.334000	0.21626	CTG	.	.	.	weak		0.622	KRT77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404111.1	NM_175078	
ATF7	11016	hgsc.bcm.edu	37	12	53931334	53931334	+	Silent	SNP	A	A	T			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr12:53931334A>T	ENST00000548446.2	-	5	412	c.300T>A	c.(298-300)gcT>gcA	p.A100A	ATF7_ENST00000456903.4_Silent_p.A89A|ATF7_ENST00000420353.2_Silent_p.A89A|RP11-793H13.10_ENST00000591834.1_Silent_p.A89A|ATF7_ENST00000415113.1_Silent_p.A89A|ATF7_ENST00000328463.7_Silent_p.A100A			P17544	ATF7_HUMAN	activating transcription factor 7	100	Transactivation domain.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|mitogen-activated protein kinase binding (GO:0051019)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)|urinary_tract(1)	9					Pseudoephedrine(DB00852)	GCCCAGCAGCAGCCTGTTGTG	0.443																																					p.A89A		Atlas-SNP	.											.	ATF7	51	.	0			c.T267A						PASS	.						68.0	70.0	69.0					12																	53931334		1903	4133	6036	SO:0001819	synonymous_variant	11016	exon5			AGCAGCAGCCTGT	X52943	CCDS44906.1, CCDS58238.1	12q13	2013-01-10				ENSG00000170653		"""basic leucine zipper proteins"""	792	protein-coding gene	gene with protein product		606371				1694576, 11278933	Standard	NM_006856		Approved	ATFA	uc001sdz.3	P17544	OTTHUMG00000169776	ENST00000548446.2:c.300T>A	chr12.hg19:g.53931334A>T		59.0	0.0	.		49.0	16.0	.	NM_001130060	A5D6Y4|B2RMP1|B4DQL4|Q13814|Q8IVR8|Q9UD83	Silent	SNP	ENST00000548446.2	hg19																																																																																				.	.	.	none		0.443	ATF7-007	KNOWN	NMD_exception|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000406302.2	NM_001130059	
SRGAP1	57522	hgsc.bcm.edu	37	12	64521913	64521913	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr12:64521913C>A	ENST00000355086.3	+	21	3337	c.2813C>A	c.(2812-2814)tCc>tAc	p.S938Y	SRGAP1_ENST00000543397.1_Missense_Mutation_p.S875Y|SRGAP1_ENST00000357825.3_Missense_Mutation_p.S915Y	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	938					axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)	p.S938C(1)		breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		ATTAGAAGGTCCACGTCATCA	0.532																																					p.S938Y		Atlas-SNP	.											SRGAP1,NS,carcinoma,0,1	SRGAP1	146	.	1	Substitution - Missense(1)	ovary(1)	c.C2813A						PASS	.						53.0	49.0	50.0					12																	64521913		2203	4300	6503	SO:0001583	missense	57522	exon21			GAAGGTCCACGTC	AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.2813C>A	chr12.hg19:g.64521913C>A	ENSP00000347198:p.Ser938Tyr	46.0	0.0	.		43.0	12.0	.	NM_020762	Q9H8A3|Q9P2P2	Missense_Mutation	SNP	ENST00000355086.3	hg19	CCDS8967.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.781515	0.90282	.	.	ENSG00000196935	ENST00000355086;ENST00000357825;ENST00000543397	T;T;T	0.21191	3.02;2.6;2.02	5.65	5.65	0.86999	.	0.000000	0.34986	U	0.003527	T	0.42449	0.1203	L	0.58101	1.795	0.80722	D	1	D;D	0.60160	0.987;0.98	P;P	0.61592	0.851;0.891	T	0.02553	-1.1142	9	.	.	.	.	20.1057	0.97893	0.0:1.0:0.0:0.0	.	938;875	Q7Z6B7;G5EA48	SRGP1_HUMAN;.	Y	938;915;875	ENSP00000347198:S938Y;ENSP00000350480:S915Y;ENSP00000437948:S875Y	.	S	+	2	0	SRGAP1	62808180	1.000000	0.71417	1.000000	0.80357	0.723000	0.41478	7.695000	0.84257	2.827000	0.97445	0.650000	0.86243	TCC	.	.	.	none		0.532	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400896.1		
EID3	493861	hgsc.bcm.edu	37	12	104698219	104698219	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr12:104698219T>A	ENST00000527879.1	+	1	703	c.507T>A	c.(505-507)caT>caA	p.H169Q	TXNRD1_ENST00000526691.1_Intron|TXNRD1_ENST00000397736.2_Intron|TXNRD1_ENST00000526390.1_Intron|TXNRD1_ENST00000529546.1_Intron|TXNRD1_ENST00000525566.1_Intron|TXNRD1_ENST00000524698.1_Intron|TXNRD1_ENST00000378070.4_Intron|TXNRD1_ENST00000388854.3_Intron|TXNRD1_ENST00000542918.1_Intron|TXNRD1_ENST00000540716.1_Intron|TXNRD1_ENST00000503506.2_Intron|TXNRD1_ENST00000429002.2_Intron|TXNRD1_ENST00000354940.6_Intron	NM_001008394.2	NP_001008395.1			EP300 interacting inhibitor of differentiation 3											large_intestine(5)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	10						AGACATTCCATTTTGTTTTTG	0.418																																					p.H169Q		Atlas-SNP	.											.	EID3	28	.	0			c.T507A						PASS	.						188.0	184.0	185.0					12																	104698219		1919	4136	6055	SO:0001583	missense	493861	exon1			ATTCCATTTTGTT	BC027612	CCDS53822.1	12q23.3	2006-11-24				ENSG00000255150			32961	protein-coding gene	gene with protein product		612986				15987788, 15752197	Standard	NM_001008394		Approved	FLJ25832, NSMCE4B, NSE4B	uc001tkw.3	Q8N140		ENST00000527879.1:c.507T>A	chr12.hg19:g.104698219T>A	ENSP00000435619:p.His169Gln	355.0	0.0	.		282.0	113.0	.	NM_001008394		Missense_Mutation	SNP	ENST00000527879.1	hg19	CCDS53822.1	.	.	.	.	.	.	.	.	.	.	T	13.41	2.228683	0.39399	.	.	ENSG00000255150	ENST00000527879	T	0.43688	0.94	4.94	0.971	0.19698	.	.	.	.	.	T	0.53546	0.1803	M	0.72118	2.19	0.30872	N	0.732351	D	0.76494	0.999	D	0.77557	0.99	T	0.54139	-0.8338	9	0.10636	T	0.68	.	7.1994	0.25873	0.0:0.6158:0.0:0.3842	.	169	Q8N140	EID3_HUMAN	Q	169	ENSP00000435619:H169Q	ENSP00000435619:H169Q	H	+	3	2	EID3	103222349	0.586000	0.26782	0.839000	0.33178	0.046000	0.14306	-0.290000	0.08354	0.077000	0.16863	-0.375000	0.07067	CAT	.	.	.	none		0.418	EID3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387034.1	NM_001008394	
ARHGEF7	8874	hgsc.bcm.edu	37	13	111885553	111885553	+	Splice_Site	SNP	G	G	A			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr13:111885553G>A	ENST00000375741.2	+	7	985	c.735G>A	c.(733-735)gaG>gaA	p.E245E	ARHGEF7_ENST00000375736.4_Splice_Site_p.E67E|ARHGEF7_ENST00000370623.3_Splice_Site_p.E152E|ARHGEF7_ENST00000375723.1_Splice_Site_p.E67E|ARHGEF7_ENST00000218789.5_Splice_Site_p.E67E|ARHGEF7_ENST00000375739.2_Splice_Site_p.E195E|ARHGEF7_ENST00000375737.5_Splice_Site_p.E142E|ARHGEF7_ENST00000544132.1_5'UTR|ARHGEF7_ENST00000317133.5_Splice_Site_p.E224E|ARHGEF7_ENST00000426073.2_Splice_Site_p.E67E	NM_001113511.1|NM_145735.2	NP_001106983.1|NP_663788.1	Q14155	ARHG7_HUMAN	Rho guanine nucleotide exchange factor (GEF) 7	245					apoptotic signaling pathway (GO:0097190)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|hematopoietic progenitor cell differentiation (GO:0002244)|lamellipodium assembly (GO:0030032)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of GTPase activity (GO:0043547)|positive regulation of lamellipodium morphogenesis (GO:2000394)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase binding (GO:0019901)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	41	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.188)			TCATTTCAGAGAAGCCTGTGT	0.428																																					p.E245E		Atlas-SNP	.											.	ARHGEF7	157	.	0			c.G735A						PASS	.						102.0	103.0	103.0					13																	111885553		2203	4300	6503	SO:0001630	splice_region_variant	8874	exon7			TTCAGAGAAGCCT	D63476	CCDS9521.1, CCDS32009.1, CCDS45068.1, CCDS45069.1	13q33.3	2013-01-10			ENSG00000102606	ENSG00000102606		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15607	protein-coding gene	gene with protein product	"""SH3 domain-containing proline-rich protein"", ""PAK-interacting exchange factor beta"", ""rho"", ""guanine nucleotide exchange factor 7"""	605477				9207241, 9726964	Standard	NM_003899		Approved	KIAA0142, PIXB, DKFZp761K1021, Nbla10314, DKFZp686C12170, BETA-PIX, COOL1, P85SPR, P85, P85COOL1, P50BP, PAK3, P50	uc001vrs.2	Q14155	OTTHUMG00000017357	ENST00000375741.2:c.734-1G>A	chr13.hg19:g.111885553G>A		192.0	1.0	.		132.0	76.0	.	NM_001113511	B1ALK6|B1ALK8|Q3LIA4|Q5W9H0|Q6P9G3|Q6PII2|Q86W63|Q8N3M1	Silent	SNP	ENST00000375741.2	hg19	CCDS45068.1																																																																																			.	.	.	none		0.428	ARHGEF7-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_001113511	Silent
SMG1	23049	hgsc.bcm.edu	37	16	18841597	18841597	+	Missense_Mutation	SNP	C	C	T	rs371226711		TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr16:18841597C>T	ENST00000446231.2	-	52	9299	c.8887G>A	c.(8887-8889)Gca>Aca	p.A2963T	SMG1_ENST00000389467.3_Missense_Mutation_p.A2963T			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	2963					DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						CCATCGAATGCTACCAAAAGC	0.393																																					p.A2963T		Atlas-SNP	.											.	SMG1	401	.	0			c.G8887A						PASS	.						78.0	73.0	74.0					16																	18841597		1886	4116	6002	SO:0001583	missense	23049	exon52			CGAATGCTACCAA	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.8887G>A	chr16.hg19:g.18841597C>T	ENSP00000402515:p.Ala2963Thr	49.0	0.0	.		47.0	21.0	.	NM_015092	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	ENST00000446231.2	hg19	CCDS45430.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.524254	0.85600	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.01165	5.24;5.24	6.07	6.07	0.98685	.	0.000000	0.64402	D	0.000002	T	0.03783	0.0107	N	0.19112	0.55	0.54753	D	0.999988	D	0.63880	0.993	D	0.74674	0.984	T	0.61382	-0.7074	10	0.72032	D	0.01	.	20.6593	0.99626	0.0:1.0:0.0:0.0	.	2963	Q96Q15	SMG1_HUMAN	T	2963	ENSP00000402515:A2963T;ENSP00000374118:A2963T	ENSP00000374118:A2963T	A	-	1	0	SMG1	18749098	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.594000	0.82698	2.885000	0.99019	0.655000	0.94253	GCA	.	.	.	alt		0.393	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	NM_015092	
NKD1	85407	hgsc.bcm.edu	37	16	50667463	50667463	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr16:50667463C>G	ENST00000268459.3	+	10	1408	c.1184C>G	c.(1183-1185)gCc>gGc	p.A395G		NM_033119.4	NP_149110.1	Q969G9	NKD1_HUMAN	naked cuticle homolog 1 (Drosophila)	395					eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of convergent extension involved in axis elongation (GO:1901233)|positive regulation of non-canonical Wnt signaling pathway via JNK cascade (GO:1901231)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|prostate(1)|urinary_tract(2)	23		all_cancers(37;0.229)		GBM - Glioblastoma multiforme(240;0.243)		CCCTCCCTAGCCCCCCTCGGG	0.721																																					p.A395G		Atlas-SNP	.											.	NKD1	43	.	0			c.C1184G						PASS	.						9.0	12.0	11.0					16																	50667463		2160	4247	6407	SO:0001583	missense	85407	exon10			CCCTAGCCCCCCT	AF358135	CCDS10743.1	16q12.1	2013-01-10			ENSG00000140807	ENSG00000140807		"""EF-hand domain containing"""	17045	protein-coding gene	gene with protein product		607851				11356022	Standard	NM_033119		Approved		uc002egg.2	Q969G9	OTTHUMG00000133169	ENST00000268459.3:c.1184C>G	chr16.hg19:g.50667463C>G	ENSP00000268459:p.Ala395Gly	34.0	0.0	.		32.0	11.0	.	NM_033119	B2RC39|Q8WZ08	Missense_Mutation	SNP	ENST00000268459.3	hg19	CCDS10743.1	.	.	.	.	.	.	.	.	.	.	C	9.960	1.222465	0.22457	.	.	ENSG00000140807	ENST00000268459	T	0.65364	-0.15	4.05	4.05	0.47172	.	0.262951	0.37178	N	0.002203	T	0.57681	0.2070	L	0.51422	1.61	0.09310	N	0.999994	P	0.37330	0.59	B	0.40410	0.328	T	0.50792	-0.8786	10	0.21014	T	0.42	-8.4212	14.5612	0.68136	0.0:1.0:0.0:0.0	.	395	Q969G9	NKD1_HUMAN	G	395	ENSP00000268459:A395G	ENSP00000268459:A395G	A	+	2	0	NKD1	49224964	0.004000	0.15560	0.909000	0.35828	0.607000	0.37147	1.081000	0.30791	2.092000	0.63282	0.305000	0.20034	GCC	.	.	.	none		0.721	NKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256873.1		
TRPV3	162514	hgsc.bcm.edu	37	17	3458126	3458126	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr17:3458126C>T	ENST00000576742.1	-	2	340	c.19G>A	c.(19-21)Gag>Aag	p.E7K	TRPV3_ENST00000301365.4_Missense_Mutation_p.E7K|TRPV3_ENST00000572519.1_Missense_Mutation_p.E7K	NM_001258205.1|NM_145068.3	NP_001245134.1|NP_659505.1	Q8NET8	TRPV3_HUMAN	transient receptor potential cation channel, subfamily V, member 3	7					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|negative regulation of hair cycle (GO:0042636)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium channel activity (GO:0005262)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(12)|ovary(5)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	35					Menthol(DB00825)	GGCACCATCTCCTTGGGGTGG	0.622																																					p.E7K		Atlas-SNP	.											.	TRPV3	85	.	0			c.G19A						PASS	.						39.0	40.0	39.0					17																	3458126		2203	4300	6503	SO:0001583	missense	162514	exon2			CCATCTCCTTGGG	AF514998	CCDS11029.1, CCDS58500.1	17p13.3	2013-01-10			ENSG00000167723	ENSG00000167723		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18084	protein-coding gene	gene with protein product		607066				12016205, 12077606, 16382100	Standard	NM_001258205		Approved	VRL3	uc002fvr.3	Q8NET8	OTTHUMG00000090695	ENST00000576742.1:c.19G>A	chr17.hg19:g.3458126C>T	ENSP00000461518:p.Glu7Lys	73.0	0.0	.		80.0	25.0	.	NM_001258205	Q8NDW7|Q8NET9|Q8NFH2	Missense_Mutation	SNP	ENST00000576742.1	hg19	CCDS11029.1	.	.	.	.	.	.	.	.	.	.	C	19.36	3.812560	0.70912	.	.	ENSG00000167723	ENST00000381913;ENST00000301365	T	0.42131	0.98	4.79	4.79	0.61399	.	0.098779	0.43747	D	0.000525	T	0.33323	0.0859	N	0.24115	0.695	0.35360	D	0.788099	P;P;P	0.40534	0.59;0.598;0.72	B;B;B	0.41202	0.111;0.19;0.35	T	0.51988	-0.8635	10	0.87932	D	0	-16.4794	13.7071	0.62646	0.0:1.0:0.0:0.0	.	7;7;7	Q8NET8-3;Q8NET8;Q8NET8-2	.;TRPV3_HUMAN;.	K	7	ENSP00000301365:E7K	ENSP00000301365:E7K	E	-	1	0	TRPV3	3404876	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	4.073000	0.57570	2.399000	0.81585	0.462000	0.41574	GAG	.	.	.	none		0.622	TRPV3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207379.2	NM_145068	
COX10	1352	hgsc.bcm.edu	37	17	13977738	13977738	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr17:13977738A>C	ENST00000261643.3	+	2	219	c.142A>C	c.(142-144)Att>Ctt	p.I48L	COX10_ENST00000537334.1_5'UTR|COX10_ENST00000536205.1_5'UTR|COX10_ENST00000429152.2_Missense_Mutation_p.I48L	NM_001303.3	NP_001294.2	Q12887	COX10_HUMAN	cytochrome c oxidase assembly homolog 10 (yeast)	48					aerobic respiration (GO:0009060)|cellular respiration (GO:0045333)|heme a biosynthetic process (GO:0006784)|heme biosynthetic process (GO:0006783)|heme O biosynthetic process (GO:0048034)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|mitochondrial fission (GO:0000266)|porphyrin-containing compound metabolic process (GO:0006778)|respiratory chain complex IV assembly (GO:0008535)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	farnesyltranstransferase activity (GO:0004311)|protoheme IX farnesyltransferase activity (GO:0008495)			cervix(1)|endometrium(3)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14		all_lung(20;0.06)|Lung SC(565;0.168)		UCEC - Uterine corpus endometrioid carcinoma (92;0.106)		TAAGCAGTGGATTACATTTCA	0.408																																					p.I48L		Atlas-SNP	.											.	COX10	36	.	0			c.A142C						PASS	.						187.0	183.0	185.0					17																	13977738		2203	4300	6503	SO:0001583	missense	1352	exon2			CAGTGGATTACAT	U09466	CCDS11166.1	17p12	2013-05-24	2012-10-15		ENSG00000006695	ENSG00000006695		"""Mitochondrial respiratory chain complex assembly factors"""	2260	protein-coding gene	gene with protein product	"""heme A: farnesyltransferase"", ""protoheme IX farnesyltransferase, mitochondrial"", ""heme O synthase"""	602125	"""COX10 (yeast) homolog, cytochrome c oxidase assembly protein (heme A: farnesyltransferase)"", ""COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast)"""			9177788, 12928484	Standard	NM_001303		Approved		uc002gof.4	Q12887	OTTHUMG00000058814	ENST00000261643.3:c.142A>C	chr17.hg19:g.13977738A>C	ENSP00000261643:p.Ile48Leu	383.0	1.0	.		324.0	115.0	.	NM_001303	B2R6U5|B4DJ50|O15334|Q969F7	Missense_Mutation	SNP	ENST00000261643.3	hg19	CCDS11166.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.45|12.45	1.940770|1.940770	0.34283|0.34283	.|.	.|.	ENSG00000006695|ENSG00000006695	ENST00000429152|ENST00000261643	.|T	.|0.37915	.|1.17	5.03|5.03	-3.34|-3.34	0.04943|0.04943	.|.	.|0.618238	.|0.17063	.|N	.|0.188488	T|T	0.24699|0.24699	0.0599|0.0599	L|L	0.42245|0.42245	1.32|1.32	0.80722|0.80722	D|D	1|1	.|B	.|0.06786	.|0.001	.|B	.|0.08055	.|0.003	T|T	0.02037|0.02037	-1.1225|-1.1225	5|10	.|0.45353	.|T	.|0.12	-18.4175|-18.4175	8.3088|8.3088	0.32058|0.32058	0.3998:0.1258:0.4744:0.0|0.3998:0.1258:0.4744:0.0	.|.	.|48	.|Q12887	.|COX10_HUMAN	A|L	8|48	.|ENSP00000261643:I48L	.|ENSP00000261643:I48L	D|I	+|+	2|1	0|0	COX10|COX10	13918463|13918463	0.992000|0.992000	0.36948|0.36948	0.409000|0.409000	0.26459|0.26459	0.912000|0.912000	0.54170|0.54170	0.470000|0.470000	0.22084|0.22084	-0.785000|-0.785000	0.04522|0.04522	0.528000|0.528000	0.53228|0.53228	GAT|ATT	.	.	.	none		0.408	COX10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130003.1	NM_001303	
TEX19	400629	hgsc.bcm.edu	37	17	80320426	80320426	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr17:80320426C>A	ENST00000333437.4	+	2	710	c.400C>A	c.(400-402)Ctg>Atg	p.L134M		NM_207459.3	NP_997342.1	Q8NA77	TEX19_HUMAN	testis expressed 19	134					cell differentiation (GO:0030154)|meiotic nuclear division (GO:0007126)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)				breast(1)|endometrium(1)|kidney(1)|lung(2)|upper_aerodigestive_tract(1)	6						GCCCCTGGGCCTGGGCCTTGA	0.597																																					p.L134M		Atlas-SNP	.											.	TEX19	17	.	0			c.C400A						PASS	.						68.0	68.0	68.0					17																	80320426		2203	4300	6503	SO:0001583	missense	400629	exon2			CTGGGCCTGGGCC	BC016939	CCDS11809.1	17q25.3	2009-04-14			ENSG00000182459	ENSG00000182459			33802	protein-coding gene	gene with protein product		615647					Standard	NM_207459		Approved	FLJ35767	uc002keq.3	Q8NA77	OTTHUMG00000132857	ENST00000333437.4:c.400C>A	chr17.hg19:g.80320426C>A	ENSP00000331500:p.Leu134Met	178.0	0.0	.		202.0	78.0	.	NM_207459		Missense_Mutation	SNP	ENST00000333437.4	hg19	CCDS11809.1	.	.	.	.	.	.	.	.	.	.	C	8.539	0.872893	0.17322	.	.	ENSG00000182459	ENST00000333437	.	.	.	3.79	-0.753	0.11068	.	.	.	.	.	T	0.40297	0.1111	L	0.34521	1.04	0.09310	N	0.999999	D	0.76494	0.999	D	0.68943	0.961	T	0.23583	-1.0184	8	0.87932	D	0	-8.5728	4.373	0.11256	0.0:0.4173:0.3653:0.2174	.	134	Q8NA77	TEX19_HUMAN	M	134	.	ENSP00000331500:L134M	L	+	1	2	TEX19	77913715	0.093000	0.21703	0.021000	0.16686	0.007000	0.05969	0.763000	0.26517	-0.070000	0.12908	-0.251000	0.11542	CTG	.	.	.	none		0.597	TEX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256331.1	NM_207459	
PSMA8	143471	hgsc.bcm.edu	37	18	23731852	23731852	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr18:23731852A>G	ENST00000308268.6	+	3	367	c.278A>G	c.(277-279)aAc>aGc	p.N93S	PSMA8_ENST00000415576.2_Missense_Mutation_p.N87S|PSMA8_ENST00000343848.6_Missense_Mutation_p.N49S	NM_001025096.1|NM_144662.2	NP_001020267.1|NP_653263.2	Q8TAA3	PSA7L_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 8	93					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|proteasome core complex, alpha-subunit complex (GO:0019773)|spermatoproteasome complex (GO:1990111)	threonine-type endopeptidase activity (GO:0004298)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|skin(2)	16	all_cancers(21;0.000585)|Lung NSC(5;0.00148)|all_lung(6;0.0038)|Ovarian(20;0.124)		OV - Ovarian serous cystadenocarcinoma(3;0.000324)|all cancers(3;0.000954)|LUSC - Lung squamous cell carcinoma(2;0.181)			GTAGTAATAAACAGAGCCCGT	0.378																																					p.N93S		Atlas-SNP	.											.	PSMA8	36	.	0			c.A278G						PASS	.						104.0	103.0	104.0					18																	23731852		2203	4300	6503	SO:0001583	missense	143471	exon3			TAATAAACAGAGC	BC047355	CCDS32808.1, CCDS45842.1, CCDS45843.1	18q11.2	2006-12-18				ENSG00000154611		"""Proteasome (prosome, macropain) subunits"""	22985	protein-coding gene	gene with protein product							Standard	XM_005258199		Approved	MGC26605, PSMA7L	uc002kvq.3	Q8TAA3		ENST00000308268.6:c.278A>G	chr18.hg19:g.23731852A>G	ENSP00000311121:p.Asn93Ser	130.0	0.0	.		116.0	39.0	.	NM_144662	B0YJ75|Q8IVP4|Q8TA98|Q8TAA2	Missense_Mutation	SNP	ENST00000308268.6	hg19	CCDS32808.1	.	.	.	.	.	.	.	.	.	.	A	14.38	2.518879	0.44763	.	.	ENSG00000154611	ENST00000308268;ENST00000415576;ENST00000343848;ENST00000538664;ENST00000536423	T;T;T	0.21361	2.01;2.01;2.01	5.34	2.96	0.34315	.	0.096815	0.64402	N	0.000002	T	0.20251	0.0487	L	0.60012	1.86	0.44579	D	0.997548	B;B;B;B	0.30193	0.052;0.041;0.214;0.272	B;B;B;B	0.33750	0.019;0.083;0.079;0.169	T	0.03306	-1.1050	10	0.42905	T	0.14	-9.0093	6.0378	0.19718	0.7464:0.1656:0.088:0.0	.	61;93;87;49	F5GY34;Q8TAA3;Q8TAA3-5;Q8TAA3-2	.;PSA7L_HUMAN;.;.	S	93;87;49;61;49	ENSP00000311121:N93S;ENSP00000409284:N87S;ENSP00000345584:N49S	ENSP00000311121:N93S	N	+	2	0	PSMA8	21985850	1.000000	0.71417	0.988000	0.46212	0.969000	0.65631	5.075000	0.64407	0.479000	0.27511	0.533000	0.62120	AAC	.	.	.	none		0.378	PSMA8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000446255.1	NM_144662	
ZNF57	126295	hgsc.bcm.edu	37	19	2917763	2917763	+	Missense_Mutation	SNP	C	C	T	rs549800352	byFrequency	TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr19:2917763C>T	ENST00000306908.5	+	4	1292	c.1144C>T	c.(1144-1146)Cat>Tat	p.H382Y	ZNF57_ENST00000523428.1_Missense_Mutation_p.H350Y|AC006277.2_ENST00000520090.2_RNA	NM_173480.2	NP_775751.1	Q68EA5	ZNF57_HUMAN	zinc finger protein 57	382					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(5)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|GBM - Glioblastoma multiforme(1328;0.00161)|STAD - Stomach adenocarcinoma(1328;0.18)		GTTTAGAGAACATGTGAGAAT	0.448																																					p.H382Y	NSCLC(150;910 1964 4303 10464 26498)	Atlas-SNP	.											.	ZNF57	57	.	0			c.C1144T						PASS	.						90.0	82.0	84.0					19																	2917763		2203	4300	6503	SO:0001583	missense	126295	exon4			AGAGAACATGTGA	M88368	CCDS12098.1	19p13.3	2013-01-08			ENSG00000171970	ENSG00000171970		"""Zinc fingers, C2H2-type"", ""-"""	13125	protein-coding gene	gene with protein product			"""zinc finger protein 424"""	ZNF424		1505991	Standard	NM_173480		Approved		uc002lwr.3	Q68EA5	OTTHUMG00000164485	ENST00000306908.5:c.1144C>T	chr19.hg19:g.2917763C>T	ENSP00000303696:p.His382Tyr	156.0	0.0	.		134.0	52.0	.	NM_173480	Q8N6R9	Missense_Mutation	SNP	ENST00000306908.5	hg19	CCDS12098.1	.	.	.	.	.	.	.	.	.	.	C	12.93	2.084453	0.36758	.	.	ENSG00000171970	ENST00000306908;ENST00000395204;ENST00000523428	D;D	0.86769	-2.17;-2.17	2.25	2.25	0.28309	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94693	0.8288	H	0.96175	3.78	0.09310	N	0.999999	D	0.89917	1.0	D	0.69479	0.964	D	0.86081	0.1544	9	0.87932	D	0	.	10.1544	0.42814	0.0:1.0:0.0:0.0	.	382	Q68EA5	ZNF57_HUMAN	Y	382;384;350	ENSP00000303696:H382Y;ENSP00000430223:H350Y	ENSP00000303696:H382Y	H	+	1	0	ZNF57	2868763	0.980000	0.34600	0.002000	0.10522	0.002000	0.02628	2.918000	0.48829	1.259000	0.44117	0.511000	0.50034	CAT	.	.	.	none		0.448	ZNF57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378969.1	NM_173480	
ZNF846	162993	hgsc.bcm.edu	37	19	9868191	9868191	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr19:9868191A>G	ENST00000397902.2	-	6	1975	c.1562T>C	c.(1561-1563)cTt>cCt	p.L521P	ZNF846_ENST00000588267.1_Intron|ZNF846_ENST00000586293.1_3'UTR|ZNF846_ENST00000592859.1_Intron	NM_001077624.1	NP_001071092.1	Q147U1	ZN846_HUMAN	zinc finger protein 846	521					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	22						ATGTTTAGCAAGTGCTGAAGA	0.368																																					p.L521P		Atlas-SNP	.											.	ZNF846	61	.	0			c.T1562C						PASS	.						150.0	158.0	155.0					19																	9868191		2050	4222	6272	SO:0001583	missense	162993	exon6			TTAGCAAGTGCTG	AK097652	CCDS42496.1	19p13.2	2013-01-08			ENSG00000196605	ENSG00000196605		"""Zinc fingers, C2H2-type"", ""-"""	27260	protein-coding gene	gene with protein product							Standard	NM_001077624		Approved		uc002mmb.1	Q147U1		ENST00000397902.2:c.1562T>C	chr19.hg19:g.9868191A>G	ENSP00000380999:p.Leu521Pro	317.0	0.0	.		279.0	100.0	.	NM_001077624	A8K0H1|B3KUP1	Missense_Mutation	SNP	ENST00000397902.2	hg19	CCDS42496.1	.	.	.	.	.	.	.	.	.	.	.	18.50	3.637264	0.67130	.	.	ENSG00000196605	ENST00000397902	T	0.14266	2.52	1.74	1.74	0.24563	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.41119	0.1145	M	0.91717	3.235	0.21579	N	0.999631	D	0.89917	1.0	D	0.91635	0.999	T	0.09465	-1.0673	9	0.87932	D	0	.	7.5297	0.27677	1.0:0.0:0.0:0.0	.	521	Q147U1	ZN846_HUMAN	P	521	ENSP00000380999:L521P	ENSP00000380999:L521P	L	-	2	0	ZNF846	9729191	0.712000	0.27916	0.008000	0.14137	0.897000	0.52465	5.067000	0.64357	1.067000	0.40740	0.374000	0.22700	CTT	.	.	.	none		0.368	ZNF846-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450253.1	NM_001077624	
GATAD2A	54815	hgsc.bcm.edu	37	19	19603133	19603133	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr19:19603133G>T	ENST00000360315.3	+	3	600	c.288G>T	c.(286-288)agG>agT	p.R96S	GATAD2A_ENST00000429563.2_Intron|GATAD2A_ENST00000537887.1_Intron|GATAD2A_ENST00000473184.1_3'UTR|GATAD2A_ENST00000358713.3_Missense_Mutation_p.R96S|GATAD2A_ENST00000404158.1_Missense_Mutation_p.R96S|GATAD2A_ENST00000252577.5_Missense_Mutation_p.R96S	NM_017660.3	NP_060130.3	Q86YP4	P66A_HUMAN	GATA zinc finger domain containing 2A	96					anterior neuropore closure (GO:0021506)|blood vessel development (GO:0001568)|DNA methylation (GO:0006306)|embryonic body morphogenesis (GO:0010172)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|neural fold formation (GO:0001842)|programmed cell death (GO:0012501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|NuRD complex (GO:0016581)	protein binding, bridging (GO:0030674)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	13						AGTCCGAGAGGAGACCCCCCT	0.617																																					p.R96S		Atlas-SNP	.											.	GATAD2A	81	.	0			c.G288T						PASS	.						48.0	48.0	48.0					19																	19603133		1568	3582	5150	SO:0001583	missense	54815	exon3			CGAGAGGAGACCC	AL390164	CCDS12402.2	19p13.11	2013-01-25			ENSG00000167491	ENSG00000167491		"""GATA zinc finger domain containing"""	29989	protein-coding gene	gene with protein product	"""p66 alpha"""	614997				12183469	Standard	NM_017660		Approved	p66alpha	uc010xqt.2	Q86YP4	OTTHUMG00000152541	ENST00000360315.3:c.288G>T	chr19.hg19:g.19603133G>T	ENSP00000353463:p.Arg96Ser	15.0	0.0	.		17.0	9.0	.	NM_017660	B5MC40|Q7L3J2|Q96F28|Q9NPU2|Q9NXS1	Missense_Mutation	SNP	ENST00000360315.3	hg19	CCDS12402.2	.	.	.	.	.	.	.	.	.	.	G	14.79	2.640385	0.47153	.	.	ENSG00000167491	ENST00000417582;ENST00000360315;ENST00000252577;ENST00000457895;ENST00000432704;ENST00000404158;ENST00000429242;ENST00000358713	T;T;T;T;T;T;T	0.56444	0.49;0.98;1.01;0.46;0.53;0.55;0.98	5.61	5.61	0.85477	.	0.219648	0.47093	D	0.000252	T	0.48519	0.1504	L	0.38175	1.15	0.80722	D	1	B;B	0.25351	0.124;0.124	B;B	0.27500	0.08;0.074	T	0.47446	-0.9117	10	0.87932	D	0	-15.9509	18.201	0.89838	0.0:0.0:1.0:0.0	.	115;96	B5MC40;Q86YP4	.;P66A_HUMAN	S	96;96;96;96;96;115;96;96	ENSP00000403703:R96S;ENSP00000353463:R96S;ENSP00000252577:R96S;ENSP00000404212:R96S;ENSP00000390495:R96S;ENSP00000414252:R96S;ENSP00000351552:R96S	ENSP00000252577:R96S	R	+	3	2	GATAD2A	19464133	1.000000	0.71417	0.997000	0.53966	0.494000	0.33585	1.747000	0.38298	2.642000	0.89623	0.561000	0.74099	AGG	.	.	.	none		0.617	GATAD2A-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326671.4	NM_017660	
PAK4	10298	hgsc.bcm.edu	37	19	39667267	39667267	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr19:39667267G>T	ENST00000593690.1	+	9	1824	c.1397G>T	c.(1396-1398)aGc>aTc	p.S466I	PAK4_ENST00000599386.1_Missense_Mutation_p.S313I|PAK4_ENST00000358301.3_Missense_Mutation_p.S466I|PAK4_ENST00000599470.1_Missense_Mutation_p.S313I|PAK4_ENST00000435673.2_Missense_Mutation_p.S466I|PAK4_ENST00000360442.3_Missense_Mutation_p.S466I|PAK4_ENST00000321944.4_Missense_Mutation_p.S376I	NM_001014831.2	NP_001014831.1	O96013	PAK4_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 4	466	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cytoskeleton organization (GO:0007010)|signal transduction (GO:0007165)	focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)	13	all_cancers(60;1.03e-07)|all_epithelial(25;9.66e-08)|all_lung(34;1.58e-07)|Lung NSC(34;1.88e-07)|Ovarian(47;0.0454)		Epithelial(26;4.82e-25)|all cancers(26;2.94e-22)|Lung(45;0.000797)|LUSC - Lung squamous cell carcinoma(53;0.00113)			GCCCAGGTGAGCAAGGAAGTG	0.672																																					p.S466I		Atlas-SNP	.											.	PAK4	40	.	0			c.G1397T						PASS	.						134.0	138.0	136.0					19																	39667267		2203	4300	6503	SO:0001583	missense	10298	exon7			AGGTGAGCAAGGA	AJ011855	CCDS12528.1, CCDS33019.1	19p11-q11	2008-06-17	2008-06-17						16059	protein-coding gene	gene with protein product		605451	"""p21(CDKN1A)-activated kinase 4"""			9822598, 10461188	Standard	NM_001014831		Approved		uc002okn.1	O96013		ENST00000593690.1:c.1397G>T	chr19.hg19:g.39667267G>T	ENSP00000469413:p.Ser466Ile	367.0	0.0	.		225.0	94.0	.	NM_001014832	B4DGG6|Q8N4E1|Q8NCH5|Q8NDE3|Q9BU33|Q9ULS8	Missense_Mutation	SNP	ENST00000593690.1	hg19	CCDS12528.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.310361	0.81358	.	.	ENSG00000130669	ENST00000358301;ENST00000321944;ENST00000358801;ENST00000542377;ENST00000435673;ENST00000360442	T;T;T	0.65549	-0.16;-0.16;-0.16	4.87	3.79	0.43588	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.174438	0.51477	D	0.000092	T	0.62816	0.2459	L	0.35249	1.045	0.49213	D	0.999762	P;P;D	0.54964	0.927;0.946;0.969	P;P;D	0.63703	0.479;0.807;0.917	T	0.64462	-0.6402	10	0.87932	D	0	.	5.7648	0.18221	0.2083:0.0:0.7917:0.0	.	376;313;466	O96013-4;O96013-3;O96013	.;.;PAK4_HUMAN	I	466;313;270;222;466;466	ENSP00000351049:S466I;ENSP00000392753:S466I;ENSP00000353625:S466I	ENSP00000326864:S313I	S	+	2	0	PAK4	44359107	0.904000	0.30761	1.000000	0.80357	0.989000	0.77384	1.132000	0.31418	2.525000	0.85131	0.655000	0.94253	AGC	.	.	.	none		0.672	PAK4-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463823.1		
SIRPB1	10326	hgsc.bcm.edu	37	20	1551504	1551504	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr20:1551504T>A	ENST00000381605.4	-	4	1095	c.1031A>T	c.(1030-1032)tAt>tTt	p.Y344F	SIRPB1_ENST00000381603.3_Intron|SIRPB1_ENST00000262929.5_Intron|RP4-576H24.4_ENST00000564763.1_Intron	NM_006065.3	NP_006056.2	O00241	SIRB1_HUMAN	signal-regulatory protein beta 1	344	Ig-like C1-type 2.				cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				central_nervous_system(2)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	31						CTCCAGGGCATAGCTTTTGCT	0.507																																					p.Y344F		Atlas-SNP	.											.	SIRPB1	83	.	0			c.A1031T						PASS	.						191.0	178.0	183.0					20																	1551504		2203	4300	6503	SO:0001583	missense	10326	exon4			AGGGCATAGCTTT	Y10376	CCDS13019.1, CCDS42850.1, CCDS46571.1	20p13	2013-01-11			ENSG00000101307	ENSG00000101307		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15928	protein-coding gene	gene with protein product		603889				9062191, 16339511	Standard	NM_001083910		Approved	SIRP-BETA-1, CD172b	uc010gai.3	O00241	OTTHUMG00000031676	ENST00000381605.4:c.1031A>T	chr20.hg19:g.1551504T>A	ENSP00000371018:p.Tyr344Phe	274.0	0.0	.		201.0	78.0	.	NM_006065	A6NLM2|B2R8V0|Q5TFQ9|Q5TFR0|Q8TB12|Q9H1U5|Q9Y4V0	Missense_Mutation	SNP	ENST00000381605.4	hg19	CCDS13019.1	.	.	.	.	.	.	.	.	.	.	.	0.112	-1.137007	0.01742	.	.	ENSG00000101307	ENST00000381605	T	0.02015	4.5	1.96	-3.91	0.04168	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.801060	0.02558	N	0.096430	T	0.01156	0.0038	N	0.04959	-0.14	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.44907	-0.9297	10	0.10636	T	0.68	.	3.3438	0.07128	0.5823:0.1453:0.0:0.2723	.	344	O00241	SIRB1_HUMAN	F	344	ENSP00000371018:Y344F	ENSP00000371018:Y344F	Y	-	2	0	SIRPB1	1499504	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.905000	0.04075	-1.342000	0.02222	-0.728000	0.03583	TAT	.	.	.	none		0.507	SIRPB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077555.2	NM_006065	
SF3A1	10291	hgsc.bcm.edu	37	22	30737847	30737847	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr22:30737847T>A	ENST00000215793.8	-	7	1059	c.905A>T	c.(904-906)gAg>gTg	p.E302V	SF3A1_ENST00000439242.1_Missense_Mutation_p.E237V	NM_005877.4	NP_005868.1	Q15459	SF3A1_HUMAN	splicing factor 3a, subunit 1, 120kDa	302					gene expression (GO:0010467)|mRNA 3'-splice site recognition (GO:0000389)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U2-type spliceosomal complex (GO:0005684)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|urinary_tract(1)	29						CCCCAGCTCCTCTGGCGTGGT	0.547																																					p.E302V		Atlas-SNP	.											.	SF3A1	61	.	0			c.A905T						PASS	.						60.0	57.0	58.0					22																	30737847		2203	4300	6503	SO:0001583	missense	10291	exon7			AGCTCCTCTGGCG	X85237	CCDS13875.1	22q12.2	2014-09-17	2002-08-29		ENSG00000099995	ENSG00000099995			10765	protein-coding gene	gene with protein product		605595	"""splicing factor 3a, subunit 1, 120kD"""			7489498	Standard	NM_005877		Approved	SF3a120, SAP114, PRPF21, Prp21	uc003ahl.3	Q15459	OTTHUMG00000151005	ENST00000215793.8:c.905A>T	chr22.hg19:g.30737847T>A	ENSP00000215793:p.Glu302Val	113.0	0.0	.		104.0	31.0	.	NM_005877	E9PAW1	Missense_Mutation	SNP	ENST00000215793.8	hg19	CCDS13875.1	.	.	.	.	.	.	.	.	.	.	T	16.21	3.058118	0.55325	.	.	ENSG00000099995	ENST00000439242;ENST00000215793;ENST00000536049	T;T	0.34667	1.37;1.35	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.61311	0.2337	M	0.73598	2.24	0.80722	D	1	D	0.62365	0.991	D	0.76071	0.987	T	0.61987	-0.6949	10	0.48119	T	0.1	-28.8415	16.4504	0.83984	0.0:0.0:0.0:1.0	.	302	Q15459	SF3A1_HUMAN	V	237;302;199	ENSP00000390336:E237V;ENSP00000215793:E302V	ENSP00000215793:E302V	E	-	2	0	SF3A1	29067847	1.000000	0.71417	0.996000	0.52242	0.359000	0.29487	7.958000	0.87877	2.288000	0.76882	0.533000	0.62120	GAG	.	.	.	none		0.547	SF3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320916.2	NM_005877	
APOBEC3G	60489	hgsc.bcm.edu	37	22	39482535	39482535	+	Silent	SNP	C	C	G	rs138907659		TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr22:39482535C>G	ENST00000407997.3	+	6	1344	c.987C>G	c.(985-987)gcC>gcG	p.A329A	APOBEC3G_ENST00000452957.2_Silent_p.A329A	NM_021822.3	NP_068594.1	Q9HC16	ABC3G_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G	329	Necessary for homooligomerization.				base conversion or substitution editing (GO:0016553)|cytidine deamination (GO:0009972)|defense response to virus (GO:0051607)|DNA cytosine deamination (GO:0070383)|innate immune response (GO:0045087)|negative regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045869)|negative regulation of transposition (GO:0010529)|negative regulation of viral genome replication (GO:0045071)|negative regulation of viral process (GO:0048525)|positive regulation of defense response to virus by host (GO:0002230)|viral process (GO:0016032)	apolipoprotein B mRNA editing enzyme complex (GO:0030895)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|ribonucleoprotein complex (GO:0030529)	cytidine deaminase activity (GO:0004126)|deoxycytidine deaminase activity (GO:0047844)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			central_nervous_system(1)|large_intestine(4)|lung(5)|skin(1)|stomach(1)	12	Melanoma(58;0.04)					GCACCCTGGCCGAGGCTGGGG	0.522																																					p.A329A		Atlas-SNP	.											.	APOBEC3G	69	.	0			c.C987G						PASS	.						101.0	112.0	108.0					22																	39482535		2203	4300	6503	SO:0001819	synonymous_variant	60489	exon6			CCTGGCCGAGGCT	AF182420	CCDS13984.1	22q13.1-q13.2	2008-05-15			ENSG00000239713	ENSG00000239713		"""Apolipoprotein B mRNA editing enzymes"""	17357	protein-coding gene	gene with protein product		607113				11863358	Standard	NM_021822		Approved	CEM15, MDS019, dJ494G10.1, FLJ12740, bK150C2.7		Q9HC16	OTTHUMG00000151081	ENST00000407997.3:c.987C>G	chr22.hg19:g.39482535C>G		319.0	0.0	.		206.0	59.0	.	NM_021822	B2RDR9|Q45F02|Q5TF77|Q7Z2N1|Q7Z2N4|Q9H9H8	Silent	SNP	ENST00000407997.3	hg19	CCDS13984.1																																																																																			.	C|1.000;T|0.000	.	alt		0.522	APOBEC3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321219.1	NM_021822	
AGTR2	186	hgsc.bcm.edu	37	X	115303624	115303624	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chrX:115303624T>G	ENST00000371906.4	+	3	281	c.91T>G	c.(91-93)Tct>Gct	p.S31A		NM_000686.4	NP_000677.2	P50052	AGTR2_HUMAN	angiotensin II receptor, type 2	31					aldosterone secretion (GO:0035932)|angiotensin-activated signaling pathway (GO:0038166)|blood vessel remodeling (GO:0001974)|brain development (GO:0007420)|brain renin-angiotensin system (GO:0002035)|cell growth involved in cardiac muscle cell development (GO:0061049)|cell surface receptor signaling pathway (GO:0007166)|cellular response to dexamethasone stimulus (GO:0071549)|cellular sodium ion homeostasis (GO:0006883)|cerebellar cortex development (GO:0021695)|dopamine biosynthetic process (GO:0042416)|exploration behavior (GO:0035640)|extracellular negative regulation of signal transduction (GO:1900116)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell growth (GO:0030308)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of heart rate (GO:0010459)|negative regulation of icosanoid secretion (GO:0032304)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of norepinephrine secretion (GO:0010700)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasodilation (GO:0045909)|regulation of blood pressure (GO:0008217)|regulation of metanephros size (GO:0035566)|regulation of systemic arterial blood pressure by circulatory renin-angiotensin (GO:0001991)|regulation of transcription factor import into nucleus (GO:0042990)|renin-angiotensin regulation of aldosterone production (GO:0002018)|response to organonitrogen compound (GO:0010243)|vasodilation by angiotensin involved in regulation of systemic arterial blood pressure (GO:0002033)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	angiotensin type II receptor activity (GO:0004945)|peptide hormone binding (GO:0017046)|receptor antagonist activity (GO:0048019)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|skin(1)	24					Tasosartan(DB01349)	CAACAATGAGTCTACCTTGAA	0.383																																					p.S31A		Atlas-SNP	.											.	AGTR2	62	.	0			c.T91G						PASS	.						125.0	107.0	113.0					X																	115303624		2203	4300	6503	SO:0001583	missense	186	exon3			AATGAGTCTACCT	AY324607	CCDS14569.1	Xq22-q23	2012-08-08			ENSG00000180772	ENSG00000180772		"""GPCR / Class A : Angiotensin receptors"""	338	protein-coding gene	gene with protein product		300034	"""angiotensin receptor 2"""			1550596	Standard	NM_000686		Approved	AT2, MRX88	uc004eqh.4	P50052	OTTHUMG00000022243	ENST00000371906.4:c.91T>G	chrX.hg19:g.115303624T>G	ENSP00000360973:p.Ser31Ala	104.0	0.0	.		98.0	63.0	.	NM_000686	B2R9V1|Q13016|Q6FGY7	Missense_Mutation	SNP	ENST00000371906.4	hg19	CCDS14569.1	.	.	.	.	.	.	.	.	.	.	T	7.505	0.653477	0.14580	.	.	ENSG00000180772	ENST00000371906	T	0.37752	1.18	4.14	4.14	0.48551	.	0.844018	0.10647	N	0.650365	T	0.24353	0.0590	N	0.19112	0.55	0.09310	N	1	B	0.16396	0.017	B	0.14023	0.01	T	0.13019	-1.0525	10	0.39692	T	0.17	-5.3221	8.5784	0.33612	0.0:0.0:0.0:1.0	.	31	P50052	AGTR2_HUMAN	A	31	ENSP00000360973:S31A	ENSP00000360973:S31A	S	+	1	0	AGTR2	115217652	0.012000	0.17670	0.098000	0.21074	0.802000	0.45316	1.925000	0.40074	1.537000	0.49254	0.412000	0.27726	TCT	.	.	.	none		0.383	AGTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057984.1	NM_000686	
MT-ATP8	4509	hgsc.bcm.edu	37	M	8538	8538	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chrM:8538T>C	ENST00000361851.1	+	1	173	c.173T>C	c.(172-174)aTc>aCc	p.I58T	MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ATP6_ENST00000361899.2_Silent_p.N4N|MT-TG_ENST00000387429.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-TY_ENST00000387409.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-CO3_ENST00000362079.2_5'Flank|MT-TS1_ENST00000387416.2_RNA			P03928	ATP8_HUMAN	mitochondrially encoded ATP synthase 8	58					ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase complex, coupling factor F(o) (GO:0000276)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)										ATGAACGAAAATCTGTTCGCT	0.413																																					p.I58T		Atlas-SNP	.											.	.	.	.	0			c.T173C						PASS	.																																			SO:0001583	missense	0	exon1			CGAAAATCTGTTC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000228253	ENSG00000228253		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	7415	protein-coding gene	gene with protein product		516070	"""ATP synthase 8"""	MTATP8			Standard			Approved	ATP8, A6L		P03928		ENST00000361851.1:c.173T>C	chrM.hg19:g.8538T>C	ENSP00000355265:p.Ile58Thr	32.0	0.0	.		19.0	4.0	.	ENST00000361851	Q34771	Missense_Mutation	SNP	ENST00000361851.1	hg19																																																																																				.	.	.	none		0.413	MT-ATP8-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024030	
USP34	9736	hgsc.bcm.edu	37	2	61505306	61505306	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr2:61505306delT	ENST00000398571.2	-	41	5503	c.5427delA	c.(5425-5427)gaafs	p.E1809fs		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	1809					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			TTACCTGTCCTTCCCTTGAAA	0.343																																					p.G1810fs		Atlas-INDEL	.											.	USP34	334	.	0			c.5428delG						PASS	.						92.0	79.0	84.0					2																	61505306		1864	4092	5956	SO:0001589	frameshift_variant	9736	exon41			.	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.5427delA	chr2.hg19:g.61505306delT	ENSP00000381577:p.Glu1809fs	69.0	0.0	0		38.0	12.0	0.315789	NM_014709	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Frame_Shift_Del	DEL	ENST00000398571.2	hg19	CCDS42686.1																																																																																			.	.	.	none		0.343	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4		
EPHA4	2043	hgsc.bcm.edu	37	2	222365873	222365873	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr2:222365873delG	ENST00000281821.2	-	4	884	c.843delC	c.(841-843)tacfs	p.Y281fs	EPHA4_ENST00000409854.1_Frame_Shift_Del_p.Y281fs|EPHA4_ENST00000409938.1_Frame_Shift_Del_p.Y281fs|EPHA4_ENST00000392071.4_Frame_Shift_Del_p.Y230fs	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4	281	Cys-rich.				adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		AGAGAGCCTTGTAATATCCAA	0.483																																					p.K282fs		Atlas-INDEL	.											.	EPHA4	263	.	0			c.844delA						PASS	.						59.0	57.0	57.0					2																	222365873		2203	4300	6503	SO:0001589	frameshift_variant	2043	exon4			.	L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.843delC	chr2.hg19:g.222365873delG	ENSP00000281821:p.Tyr281fs	65.0	0.0	0		92.0	57.0	0.619565	NM_004438	A8K2P1|B2R601|B7Z6Q8|Q2M380	Frame_Shift_Del	DEL	ENST00000281821.2	hg19	CCDS2447.1																																																																																			.	.	.	none		0.483	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256836.3		
SYBU	55638	hgsc.bcm.edu	37	8	110587763	110587763	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr8:110587763delT	ENST00000422135.1	-	8	1879	c.1364delA	c.(1363-1365)gacfs	p.D455fs	SYBU_ENST00000399066.3_Frame_Shift_Del_p.D452fs|SYBU_ENST00000440310.1_Frame_Shift_Del_p.D455fs|SYBU_ENST00000528647.1_Frame_Shift_Del_p.D454fs|SYBU_ENST00000528331.1_Frame_Shift_Del_p.D336fs|SYBU_ENST00000533895.1_Frame_Shift_Del_p.D454fs|SYBU_ENST00000276646.9_Frame_Shift_Del_p.D455fs|SYBU_ENST00000529175.1_Frame_Shift_Del_p.D249fs|SYBU_ENST00000419099.1_Frame_Shift_Del_p.D454fs|SYBU_ENST00000529690.1_Frame_Shift_Del_p.D325fs|SYBU_ENST00000533065.1_Frame_Shift_Del_p.D336fs|SYBU_ENST00000533171.1_Frame_Shift_Del_p.D455fs|SYBU_ENST00000433638.1_Frame_Shift_Del_p.D455fs|SYBU_ENST00000424158.2_Frame_Shift_Del_p.D460fs|SYBU_ENST00000527707.1_5'Flank|SYBU_ENST00000532779.1_Frame_Shift_Del_p.D387fs|SYBU_ENST00000408889.3_Frame_Shift_Del_p.D336fs|SYBU_ENST00000408908.2_Frame_Shift_Del_p.D455fs|SYBU_ENST00000446070.2_Frame_Shift_Del_p.D454fs	NM_001099744.1	NP_001093214.1	Q9NX95	SYBU_HUMAN	syntabulin (syntaxin-interacting)	455					regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|dense body (GO:0097433)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(4)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	30						AAGCTCCAGGTCACCAGATTC	0.577																																					p.D455fs		Atlas-INDEL	.											SYBU,NS,carcinoma,0,1	SYBU	71	.	0			c.1365delC						PASS	.						133.0	137.0	136.0					8																	110587763		2102	4215	6317	SO:0001589	frameshift_variant	55638	exon8			.	AB040905	CCDS43763.1, CCDS43764.1, CCDS47912.1, CCDS55271.1	8q23.2	2010-08-27				ENSG00000147642			26011	protein-coding gene	gene with protein product	"""syntaphilin-like"""	611568				17611281, 16750881, 16157705, 15656992, 15459722	Standard	NM_001099743		Approved	FLJ20366, GOLSYN, KIAA1472, OCSYN, SNPHL	uc003ynj.4	Q9NX95		ENST00000422135.1:c.1364delA	chr8.hg19:g.110587763delT	ENSP00000407118:p.Asp455fs	109.0	0.0	0		122.0	40.0	0.327869	NM_001099752	A8K354|B3KQX3|B3KU61|Q5R1T1|Q5R1T2|Q5R1T3|Q5Y2M6|Q8ND49|Q8TCR6|Q96D80|Q9P256	Frame_Shift_Del	DEL	ENST00000422135.1	hg19	CCDS47912.1																																																																																			.	.	.	none		0.577	SYBU-204	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000385501.1	NM_017786	
DENND5B	160518	hgsc.bcm.edu	37	12	31586129	31586130	+	In_Frame_Ins	INS	-	-	GGCGAA			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr12:31586129_31586130insGGCGAA	ENST00000389082.5	-	8	2329_2330	c.2065_2066insTTCGCC	c.(2065-2067)cag>cTTCGCCag	p.688_689insLR	DENND5B_ENST00000536562.1_In_Frame_Ins_p.723_724insLR|DENND5B_ENST00000306833.6_In_Frame_Ins_p.723_724insLR|DENND5B_ENST00000354285.4_In_Frame_Ins_p.710_711insLR	NM_144973.3	NP_659410.3	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	688					positive regulation of Rab GTPase activity (GO:0032851)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						CTCAGAATGCTGGCGAAGGCGT	0.48																																					p.Q689delinsLRQ		Atlas-INDEL	.											.	DENND5B	114	.	0			c.2066_2067insTTCGCC						PASS	.																																			SO:0001652	inframe_insertion	160518	exon8			.	AF086301	CCDS44857.1	12p11.21	2012-10-03			ENSG00000170456	ENSG00000170456		"""DENN/MADD domain containing"""	28338	protein-coding gene	gene with protein product						12477932	Standard	NM_144973		Approved	MGC24039	uc001rki.1	Q6ZUT9	OTTHUMG00000169034	ENST00000389082.5:c.2060_2065dupTTCGCC	chr12.hg19:g.31586130_31586135dupGGCGAA	ENSP00000373734:p.Leu687_Arg688dup	254.0	0.0	0		188.0	25.0	0.132979	NM_144973	B5ME75|Q59FW8|Q68CZ7|Q6NUJ0|Q7Z3F9|Q8N973|Q8WUC8	In_Frame_Ins	INS	ENST00000389082.5	hg19	CCDS44857.1																																																																																			.	.	.	none		0.480	DENND5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402040.1	NM_144973	
ZNF502	91392	hgsc.bcm.edu	37	3	44762384	44762384	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr3:44762384delG	ENST00000296091.4	+	4	331	c.75delG	c.(73-75)aagfs	p.K25fs	ZNF502_ENST00000436624.2_Frame_Shift_Del_p.K25fs|ZNF502_ENST00000449836.1_Frame_Shift_Del_p.K25fs	NM_001134440.1|NM_001282880.1|NM_033210.4	NP_001127912.1|NP_001269809.1|NP_149987.2	Q8TBZ5	ZN502_HUMAN	zinc finger protein 502	25					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(4)|large_intestine(8)|lung(4)|prostate(1)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.00855)|KIRC - Kidney renal clear cell carcinoma(197;0.0471)|Kidney(197;0.0589)		ACAAGAACAAGCCTGCTCTGG	0.418																																					p.K25fs		Atlas-INDEL	.											.	ZNF502	58	.	0			c.74delA						PASS	.						59.0	63.0	61.0					3																	44762384		2203	4300	6503	SO:0001589	frameshift_variant	91392	exon4			.	AK022577	CCDS2719.1	3p21.32	2013-01-08			ENSG00000196653	ENSG00000196653		"""Zinc fingers, C2H2-type"""	23718	protein-coding gene	gene with protein product							Standard	NM_033210		Approved	FLJ14855, FLJ12515	uc003cnt.3	Q8TBZ5	OTTHUMG00000133086	ENST00000296091.4:c.75delG	chr3.hg19:g.44762384delG	ENSP00000296091:p.Lys25fs	142.0	0.0	0		115.0	33.0	0.286957	NM_033210		Frame_Shift_Del	DEL	ENST00000296091.4	hg19	CCDS2719.1																																																																																			.	.	.	none		0.418	ZNF502-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256744.4	NM_033210	
ADAMDEC1	27299	hgsc.bcm.edu	37	8	24256052	24256052	+	Frame_Shift_Del	DEL	C	C	-	rs2291576	byFrequency	TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr8:24256052delC	ENST00000256412.4	+	8	970	c.750delC	c.(748-750)aacfs	p.N250fs	RP11-624C23.1_ENST00000523578.1_RNA|ADAMDEC1_ENST00000538205.1_Frame_Shift_Del_p.N171fs|RP11-624C23.1_ENST00000519689.1_RNA|ADAMDEC1_ENST00000522298.1_Frame_Shift_Del_p.N171fs	NM_014479.3	NP_055294.1	O15204	ADEC1_HUMAN	ADAM-like, decysin 1	250	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				immune response (GO:0006955)|negative regulation of cell adhesion (GO:0007162)	extracellular region (GO:0005576)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|large_intestine(4)|skin(2)|stomach(1)	9		Prostate(55;0.0181)		Colorectal(74;0.016)|COAD - Colon adenocarcinoma(73;0.0646)|BRCA - Breast invasive adenocarcinoma(99;0.168)		ATGTGATGAACCTACTCAATG	0.338																																					p.N250fs	Ovarian(147;687 1849 3699 25981 31337)	Atlas-INDEL	.											ADAMDEC1_ENST00000256412,NS,malignant_melanoma,0,1	ADAMDEC1	69	.	0			c.749delA						PASS	.						190.0	182.0	185.0					8																	24256052		2203	4300	6503	SO:0001589	frameshift_variant	27299	exon8			.	Y13323	CCDS6044.1, CCDS55212.1	8p12	2008-08-07			ENSG00000134028	ENSG00000134028			16299	protein-coding gene	gene with protein product		606393				9271581, 12037602	Standard	NM_001145271		Approved	M12.219	uc003xdz.2	O15204	OTTHUMG00000097858	ENST00000256412.4:c.750delC	chr8.hg19:g.24256052delC	ENSP00000256412:p.Asn250fs	186.0	0.0	0		165.0	55.0	0.333333	NM_014479	B7ZAK5	Frame_Shift_Del	DEL	ENST00000256412.4	hg19	CCDS6044.1																																																																																			.	.	.	none		0.338	ADAMDEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215149.2	NM_014479	
JMJD1C	221037	hgsc.bcm.edu	37	10	64960365	64960365	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr10:64960365delA	ENST00000399262.2	-	11	5365	c.5147delT	c.(5146-5148)ttafs	p.L1716fs	JMJD1C_ENST00000399251.1_Intron|JMJD1C_ENST00000542921.1_Frame_Shift_Del_p.L1534fs|JMJD1C_ENST00000402544.1_Frame_Shift_Del_p.L1497fs	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	1716					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					GTCATCCTGTAAAAAGGATTC	0.413																																					p.L1716fs		Atlas-INDEL	.											.	JMJD1C	347	.	0			c.5148delA						PASS	.						83.0	76.0	78.0					10																	64960365		1855	4105	5960	SO:0001589	frameshift_variant	221037	exon11			.	L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.5147delT	chr10.hg19:g.64960365delA	ENSP00000382204:p.Leu1716fs	91.0	0.0	0		89.0	32.0	0.359551	NM_032776	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Frame_Shift_Del	DEL	ENST00000399262.2	hg19	CCDS41532.1																																																																																			.	.	.	none		0.413	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048249.2	NM_004241	
FAT1	2195	hgsc.bcm.edu	37	4	187540288	187540291	+	Frame_Shift_Del	DEL	TCCA	TCCA	-			TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	TCCA	TCCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr4:187540288_187540291delTCCA	ENST00000441802.2	-	10	7658_7661	c.7449_7452delTGGA	c.(7447-7452)attggafs	p.IG2483fs		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	2483	Cadherin 22. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						GCAAATTGCCTCCAATTACAGTTA	0.471										HNSCC(5;0.00058)																											p.2484_2485del	Colon(197;1040 2055 4143 4984 49344)	Atlas-INDEL	.											.	FAT1	500	.	0			c.7450_7453del						PASS	.																																			SO:0001589	frameshift_variant	2195	exon10			.	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.7449_7452delTGGA	chr4.hg19:g.187540288_187540291delTCCA	ENSP00000406229:p.Ile2483fs	443.0	0.0	0		385.0	90.0	0.233766	NM_005245		Frame_Shift_Del	DEL	ENST00000441802.2	hg19	CCDS47177.1																																																																																			.	.	.	none		0.471	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
DMTF1	9988	hgsc.bcm.edu	37	7	86802963	86802966	+	Splice_Site	DEL	AAGG	AAGG	-	rs138809401		TCGA-BQ-5885-01A-11D-1589-08	TCGA-BQ-5885-11A-01D-1589-08	AAGG	AAGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fefc32ae-2b8e-46c8-8a7b-d536f9c71568	762ffc49-9149-4ea9-9dce-33e726dee43d	g.chr7:86802963_86802966delAAGG	ENST00000394703.5	+	8	1003_1005	c.440_442delAAGG	c.(439-444)aaaggg>agg	p.KG147fs	DMTF1_ENST00000411766.2_Splice_Site_p.KG106fs|DMTF1_ENST00000331242.7_Splice_Site_p.KG147fs|DMTF1_ENST00000413276.2_Splice_Site_p.KG147fs|DMTF1_ENST00000414194.2_5'UTR|DMTF1_ENST00000394702.3_Splice_Site_p.KG147fs|DMTF1_ENST00000432937.2_Splice_Site_p.KG59fs	NM_021145.3	NP_066968.3	Q9Y222	DMTF1_HUMAN	cyclin D binding myb-like transcription factor 1	147	Interaction with CCND2. {ECO:0000250}.|Required for DNA-binding. {ECO:0000250}.|Required for transcriptional activation. {ECO:0000250}.				cell cycle (GO:0007049)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)	16	Esophageal squamous(14;0.0058)					CTGACTAATAAAGGTAAGATAACA	0.382																																					p.147_148del		Atlas-INDEL	.											.	DMTF1	48	.	0			c.439_442del						PASS	.																																			SO:0001630	splice_region_variant	9988	exon6			.	AF084530	CCDS5601.1, CCDS47633.1	7q21	2014-06-25			ENSG00000135164	ENSG00000135164			14603	protein-coding gene	gene with protein product	"""cyclin D-binding Myb-like protein"""	608491				10095122, 24958102	Standard	NR_024549		Approved	DMP1, DMTF, hDMP1, MRUL	uc003uih.3	Q9Y222	OTTHUMG00000154135	ENST00000394703.5:c.442+1AAGG>-	chr7.hg19:g.86802963_86802966delAAGG		74.0	0.0	0		53.0	12.0	0.226415	NM_001142327	B2RBE1|B4DJS5|Q05C48|Q59G79|Q6IS13|Q969T2|Q9H2Z2|Q9H2Z3	Frame_Shift_Del	DEL	ENST00000394703.5	hg19	CCDS5601.1																																																																																			.	.	.	none		0.382	DMTF1-002	KNOWN	alternative_5_UTR|non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334025.5	NM_021145	Frame_Shift_Del
