#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SLC6A17	388662	hgsc.bcm.edu	37	1	110709565	110709565	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr1:110709565G>A	ENST00000331565.4	+	2	499	c.14G>A	c.(13-15)aGc>aAc	p.S5N	RP5-1028L10.1_ENST00000430098.1_RNA|RP5-1028L10.1_ENST00000418579.1_RNA|RP5-1028L10.1_ENST00000443008.1_RNA	NM_001010898.2	NP_001010898.1	Q9H1V8	S6A17_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 17	5					alanine transport (GO:0032328)|glycine transport (GO:0015816)|leucine transport (GO:0015820)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)		CCGAAGAACAGCAAAGTGACC	0.577																																					p.S5N		Atlas-SNP	.											.	SLC6A17	86	.	0			c.G14A						PASS	.						54.0	49.0	51.0					1																	110709565		2203	4300	6503	SO:0001583	missense	388662	exon2			AGAACAGCAAAGT		CCDS30799.1	1p13.2	2013-07-19	2013-07-19		ENSG00000197106	ENSG00000197106		"""Solute carriers"""	31399	protein-coding gene	gene with protein product		610299	"""solute carrier family 6 (neurotransmitter transporter), member 17"", ""solute carrier family 6, member 17"""				Standard	NM_001010898		Approved		uc009wfq.3	Q9H1V8	OTTHUMG00000011761	ENST00000331565.4:c.14G>A	chr1.hg19:g.110709565G>A	ENSP00000330199:p.Ser5Asn	45.0	0.0	.		45.0	11.0	.	NM_001010898	A6NEA8|A8K1R7|B9EIR5|Q5T5Q9	Missense_Mutation	SNP	ENST00000331565.4	hg19	CCDS30799.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.201454	0.79015	.	.	ENSG00000197106	ENST00000331565;ENST00000450985	T	0.75938	-0.98	4.31	4.31	0.51392	.	0.091130	0.64402	D	0.000001	T	0.71921	0.3397	M	0.67397	2.05	0.44834	D	0.997843	P	0.42203	0.773	P	0.46208	0.507	T	0.76203	-0.3045	10	0.51188	T	0.08	.	16.9598	0.86269	0.0:0.0:1.0:0.0	.	5	Q9H1V8	S6A17_HUMAN	N	5	ENSP00000330199:S5N	ENSP00000330199:S5N	S	+	2	0	SLC6A17	110511088	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.350000	0.59392	2.221000	0.72209	0.563000	0.77884	AGC	.	.	.	none		0.577	SLC6A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032550.2	XM_371280	
ELF3	1999	hgsc.bcm.edu	37	1	201984378	201984378	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr1:201984378G>C	ENST00000359651.3	+	8	4235	c.1043G>C	c.(1042-1044)cGg>cCg	p.R348P	RP11-510N19.5_ENST00000504773.1_RNA|ELF3_ENST00000367283.3_Missense_Mutation_p.R348P|ELF3_ENST00000367284.5_Missense_Mutation_p.R348P					E74-like factor 3 (ets domain transcription factor, epithelial-specific )											breast(2)|endometrium(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	20						GTGGATGGCCGGCGACTCGTC	0.557																																					p.R348P		Atlas-SNP	.											.	ELF3	92	.	0			c.G1043C						PASS	.						84.0	86.0	85.0					1																	201984378		2203	4300	6503	SO:0001583	missense	1999	exon9			ATGGCCGGCGACT	AF016295	CCDS1419.1	1q32.2	2008-02-05			ENSG00000163435	ENSG00000163435			3318	protein-coding gene	gene with protein product		602191		ESX		9395241, 9129154	Standard	NM_001114309		Approved	EPR-1, ESE-1, ERT	uc001gxh.4	P78545	OTTHUMG00000035867	ENST00000359651.3:c.1043G>C	chr1.hg19:g.201984378G>C	ENSP00000352673:p.Arg348Pro	100.0	0.0	.		69.0	15.0	.	NM_001114309		Missense_Mutation	SNP	ENST00000359651.3	hg19	CCDS1419.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.878405	0.91740	.	.	ENSG00000163435	ENST00000359651;ENST00000367284;ENST00000367283;ENST00000310044	T;T;T	0.15372	2.43;2.43;2.43	4.61	4.61	0.57282	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (4);	0.000000	0.64402	D	0.000001	T	0.48241	0.1489	M	0.86502	2.82	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.57877	-0.7735	10	0.87932	D	0	.	16.4352	0.83873	0.0:0.0:1.0:0.0	.	348	P78545	ELF3_HUMAN	P	348;348;348;325	ENSP00000352673:R348P;ENSP00000356253:R348P;ENSP00000356252:R348P	ENSP00000311348:R325P	R	+	2	0	ELF3	200251001	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.616000	0.98359	2.421000	0.82119	0.555000	0.69702	CGG	.	.	.	none		0.557	ELF3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087360.1	NM_004433	
NID1	4811	hgsc.bcm.edu	37	1	236208870	236208870	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr1:236208870G>C	ENST00000264187.6	-	3	721	c.639C>G	c.(637-639)aaC>aaG	p.N213K	NID1_ENST00000366595.3_Missense_Mutation_p.N213K	NM_002508.2	NP_002499.2	P14543	NID1_HUMAN	nidogen 1	213	NIDO. {ECO:0000255|PROSITE- ProRule:PRU00570}.				basement membrane organization (GO:0071711)|cell-matrix adhesion (GO:0007160)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|positive regulation of cell-substrate adhesion (GO:0010811)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|cell periphery (GO:0071944)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)			breast(4)|endometrium(9)|kidney(1)|large_intestine(23)|lung(20)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(1)	66	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Urokinase(DB00013)	CAGGAACTTGGTTGTTTTCCT	0.448																																					p.N213K		Atlas-SNP	.											.	NID1	196	.	0			c.C639G						PASS	.						111.0	104.0	106.0					1																	236208870		2203	4300	6503	SO:0001583	missense	4811	exon3			AACTTGGTTGTTT	BC045606	CCDS1608.1	1q43	2011-05-08	2005-06-02	2005-06-02	ENSG00000116962	ENSG00000116962			7821	protein-coding gene	gene with protein product		131390	"""nidogen (enactin)"""	NID		2471408, 7557988	Standard	NM_002508		Approved	entactin	uc001hxo.3	P14543	OTTHUMG00000040071	ENST00000264187.6:c.639C>G	chr1.hg19:g.236208870G>C	ENSP00000264187:p.Asn213Lys	100.0	0.0	.		99.0	4.0	.	NM_002508	Q14942|Q59FL2|Q5TAF2|Q5TAF3|Q86XD7	Missense_Mutation	SNP	ENST00000264187.6	hg19	CCDS1608.1	.	.	.	.	.	.	.	.	.	.	G	3.031	-0.199616	0.06219	.	.	ENSG00000116962	ENST00000264187;ENST00000366595	T;T	0.71461	-0.57;-0.57	5.81	0.342	0.15996	Nidogen, extracellular domain (3);	1.058890	0.07141	N	0.847269	T	0.57344	0.2047	L	0.29908	0.895	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.0;0.002	T	0.46205	-0.9208	10	0.54805	T	0.06	.	6.9876	0.24737	0.0648:0.096:0.2443:0.5949	.	213;213	P14543-2;P14543	.;NID1_HUMAN	K	213	ENSP00000264187:N213K;ENSP00000355554:N213K	ENSP00000264187:N213K	N	-	3	2	NID1	234275493	0.001000	0.12720	0.035000	0.18076	0.061000	0.15899	-0.029000	0.12329	-0.172000	0.10779	0.561000	0.74099	AAC	.	.	.	none		0.448	NID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096647.2	NM_002508	
FAM161A	84140	hgsc.bcm.edu	37	2	62066806	62066806	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr2:62066806G>A	ENST00000405894.3	-	3	1434	c.1333C>T	c.(1333-1335)Cac>Tac	p.H445Y	FAM161A_ENST00000404929.1_Missense_Mutation_p.H445Y	NM_032180.2	NP_115556.2	Q3B820	F161A_HUMAN	family with sequence similarity 161, member A	445					cilium assembly (GO:0042384)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|photoreceptor connecting cilium (GO:0032391)				breast(1)|endometrium(5)|large_intestine(8)|lung(4)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						GGAGACTTGTGTTCTGAGAGG	0.408																																					p.H445Y		Atlas-SNP	.											.	FAM161A	200	.	0			c.C1333T						PASS	.						122.0	110.0	114.0					2																	62066806		1874	4103	5977	SO:0001583	missense	84140	exon3			ACTTGTGTTCTGA		CCDS42687.2, CCDS56120.1	2p15	2011-03-15			ENSG00000170264	ENSG00000170264			25808	protein-coding gene	gene with protein product		613596	"""retinitis pigmentosa 28 (autosomal recessive)"""	RP28		10507729, 20705278, 20705279	Standard	NM_032180		Approved	FLJ13305	uc002sbm.4	Q3B820	OTTHUMG00000152165	ENST00000405894.3:c.1333C>T	chr2.hg19:g.62066806G>A	ENSP00000385893:p.His445Tyr	179.0	0.0	.		170.0	52.0	.	NM_032180	B4DJV7|Q9H8R2	Missense_Mutation	SNP	ENST00000405894.3	hg19	CCDS42687.2	.	.	.	.	.	.	.	.	.	.	G	7.735	0.700095	0.15106	.	.	ENSG00000170264	ENST00000404929;ENST00000405894	T;T	0.21734	1.99;1.99	5.19	-0.0571	0.13803	.	0.977729	0.08450	N	0.943967	T	0.08980	0.0222	N	0.08118	0	0.09310	N	1	B;B	0.17268	0.003;0.021	B;B	0.17098	0.013;0.017	T	0.36841	-0.9731	10	0.28530	T	0.3	-13.5655	2.5423	0.04729	0.1324:0.2247:0.4122:0.2308	.	445;445	Q3B820;Q3B820-3	F161A_HUMAN;.	Y	445	ENSP00000385158:H445Y;ENSP00000385893:H445Y	ENSP00000385158:H445Y	H	-	1	0	FAM161A	61920310	0.001000	0.12720	0.001000	0.08648	0.044000	0.14063	0.602000	0.24134	-0.235000	0.09767	-0.185000	0.12909	CAC	.	.	.	none		0.408	FAM161A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000325537.2	NM_032180	
LMAN2L	81562	hgsc.bcm.edu	37	2	97373520	97373520	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr2:97373520T>C	ENST00000264963.4	-	7	857	c.835A>G	c.(835-837)Acc>Gcc	p.T279A	LMAN2L_ENST00000534882.1_Missense_Mutation_p.T134A|FER1L5_ENST00000457909.1_RNA|LMAN2L_ENST00000377079.4_Missense_Mutation_p.T290A|LMAN2L_ENST00000426463.2_Missense_Mutation_p.T145A|LMAN2L_ENST00000537039.1_Missense_Mutation_p.T141A	NM_030805.3	NP_110432.1	Q9H0V9	LMA2L_HUMAN	lectin, mannose-binding 2-like	279					ER to Golgi vesicle-mediated transport (GO:0006888)|protein folding (GO:0006457)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle (GO:0030134)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	mannose binding (GO:0005537)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|lung(2)|skin(1)|urinary_tract(1)	7						TCTTCTGGGGTTCTCTCCACT	0.468																																					p.T290A		Atlas-SNP	.											.	LMAN2L	27	.	0			c.A868G						PASS	.						111.0	111.0	111.0					2																	97373520		2203	4300	6503	SO:0001583	missense	81562	exon8			CTGGGGTTCTCTC	AL136617	CCDS2023.1, CCDS46365.1	2q11.1	2008-02-05			ENSG00000114988	ENSG00000114988			19263	protein-coding gene	gene with protein product		609552				12609988	Standard	NM_001142292		Approved	DKFZp564L2423, VIPL	uc002swv.3	Q9H0V9	OTTHUMG00000130453	ENST00000264963.4:c.835A>G	chr2.hg19:g.97373520T>C	ENSP00000264963:p.Thr279Ala	167.0	0.0	.		154.0	37.0	.	NM_001142292	B4DSH3|D3DXH6|Q53GV3|Q53S67|Q63HN6|Q8NBQ6|Q9BQ14	Missense_Mutation	SNP	ENST00000264963.4	hg19	CCDS2023.1	.	.	.	.	.	.	.	.	.	.	T	18.08	3.544490	0.65198	.	.	ENSG00000114988	ENST00000264963;ENST00000377079;ENST00000426463;ENST00000537039;ENST00000534882	T;T;T;T;T	0.77358	0.91;0.9;-1.09;-1.04;-1.08	5.62	5.62	0.85841	Concanavalin A-like lectin/glucanase, subgroup (1);	0.095537	0.64402	D	0.000001	T	0.69106	0.3074	L	0.46157	1.445	0.51482	D	0.999927	B;B;B;B;B	0.26081	0.141;0.031;0.141;0.004;0.065	B;B;B;B;B	0.20955	0.021;0.023;0.021;0.002;0.032	T	0.64846	-0.6311	10	0.09590	T	0.72	.	14.8095	0.69982	0.0:0.0:0.0:1.0	.	134;152;145;290;279	B4DVH1;B4DI83;B4DSH3;Q9H0V9-2;Q9H0V9	.;.;.;.;LMA2L_HUMAN	A	279;290;145;141;134	ENSP00000264963:T279A;ENSP00000366280:T290A;ENSP00000396391:T145A;ENSP00000441701:T141A;ENSP00000438501:T134A	ENSP00000264963:T279A	T	-	1	0	LMAN2L	96737247	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	5.930000	0.70104	2.129000	0.65627	0.533000	0.62120	ACC	.	.	.	none		0.468	LMAN2L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252844.1	NM_030805	
LRP2	4036	hgsc.bcm.edu	37	2	170072853	170072853	+	Silent	SNP	A	A	G			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr2:170072853A>G	ENST00000263816.3	-	35	6021	c.5736T>C	c.(5734-5736)acT>acC	p.T1912T		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	1912					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CAGTAAAGAGAGTTTTCACAG	0.502																																					p.T1912T		Atlas-SNP	.											.	LRP2	751	.	0			c.T5736C						PASS	.						150.0	136.0	141.0					2																	170072853		2203	4300	6503	SO:0001819	synonymous_variant	4036	exon35			AAAGAGAGTTTTC		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.5736T>C	chr2.hg19:g.170072853A>G		102.0	0.0	.		105.0	41.0	.	NM_004525	O00711|Q16215	Silent	SNP	ENST00000263816.3	hg19	CCDS2232.1																																																																																			.	.	.	none		0.502	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
GOLGA4	2803	hgsc.bcm.edu	37	3	37340849	37340849	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr3:37340849T>C	ENST00000361924.2	+	9	1447	c.1073T>C	c.(1072-1074)cTt>cCt	p.L358P	GOLGA4_ENST00000444882.1_Intron|GOLGA4_ENST00000435830.2_3'UTR|GOLGA4_ENST00000356847.4_Missense_Mutation_p.L380P	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4	358	Glu-rich.				Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						ATTGAACAGCTTGAACAAGAT	0.333																																					p.L380P		Atlas-SNP	.											.	GOLGA4	173	.	0			c.T1139C						PASS	.						44.0	44.0	44.0					3																	37340849		2203	4297	6500	SO:0001583	missense	2803	exon10			AACAGCTTGAACA	U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.1073T>C	chr3.hg19:g.37340849T>C	ENSP00000354486:p.Leu358Pro	72.0	0.0	.		78.0	41.0	.	NM_001172713	F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Missense_Mutation	SNP	ENST00000361924.2	hg19	CCDS2666.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.388371	0.82902	.	.	ENSG00000144674	ENST00000361924;ENST00000356847;ENST00000450863;ENST00000437131	T;T;T;T	0.34072	1.38;1.38;1.38;1.38	5.45	5.45	0.79879	.	0.000000	0.29830	N	0.011099	T	0.61825	0.2378	M	0.78637	2.42	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	T	0.64939	-0.6289	10	0.52906	T	0.07	.	15.519	0.75851	0.0:0.0:0.0:1.0	.	358;380;358	Q13439-4;F8W8Q7;Q13439	.;.;GOGA4_HUMAN	P	358;380;363;229	ENSP00000354486:L358P;ENSP00000349305:L380P;ENSP00000387633:L363P;ENSP00000405842:L229P	ENSP00000349305:L380P	L	+	2	0	GOLGA4	37315853	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.923000	0.87546	2.077000	0.62373	0.372000	0.22366	CTT	.	.	.	none		0.333	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253339.2	NM_002078	
MORC1	27136	hgsc.bcm.edu	37	3	108788509	108788509	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr3:108788509T>A	ENST00000483760.1	-	9	828	c.785A>T	c.(784-786)aAa>aTa	p.K262I	MORC1_ENST00000232603.5_Missense_Mutation_p.K262I					MORC family CW-type zinc finger 1											breast(7)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(47)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	105						GCAAAGATGTTTAGTTTTAAC	0.373																																					p.K262I		Atlas-SNP	.											.	MORC1	211	.	0			c.A785T						PASS	.						113.0	113.0	113.0					3																	108788509		2203	4300	6503	SO:0001583	missense	27136	exon9			AGATGTTTAGTTT	AF084946	CCDS2955.1	3q13	2011-10-26	2005-06-15	2005-06-15	ENSG00000114487	ENSG00000114487			7198	protein-coding gene	gene with protein product	"""cancer/testis antigen 33"""	603205	"""microrchidia (mouse) homolog"", ""microrchidia homolog (mouse)"""	MORC		10369865	Standard	NM_014429		Approved	ZCW6, CT33	uc003dxl.3	Q86VD1	OTTHUMG00000159209	ENST00000483760.1:c.785A>T	chr3.hg19:g.108788509T>A	ENSP00000417282:p.Lys262Ile	119.0	0.0	.		156.0	42.0	.	NM_014429		Missense_Mutation	SNP	ENST00000483760.1	hg19		.	.	.	.	.	.	.	.	.	.	T	20.8	4.054789	0.75960	.	.	ENSG00000114487	ENST00000232603;ENST00000483760	T;T	0.74106	-0.81;-0.81	4.84	3.68	0.42216	ATPase-like, ATP-binding domain (1);	0.128321	0.35708	N	0.003033	D	0.82365	0.5021	M	0.69185	2.1	0.46298	D	0.998976	D;P	0.89917	1.0;0.892	D;P	0.87578	0.998;0.54	T	0.81984	-0.0682	10	0.62326	D	0.03	-23.3217	8.914	0.35570	0.0:0.0897:0.0:0.9103	.	262;262	E7ERX1;Q86VD1	.;MORC1_HUMAN	I	262	ENSP00000232603:K262I;ENSP00000417282:K262I	ENSP00000232603:K262I	K	-	2	0	MORC1	110271199	1.000000	0.71417	0.933000	0.37362	0.947000	0.59692	3.950000	0.56676	0.972000	0.38314	0.482000	0.46254	AAA	.	.	.	none		0.373	MORC1-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000353844.1		
SLC30A5	64924	hgsc.bcm.edu	37	5	68399835	68399835	+	Intron	SNP	A	A	G			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr5:68399835A>G	ENST00000396591.3	+	4	883				SLC30A5_ENST00000502979.1_Missense_Mutation_p.K66R|SLC30A5_ENST00000380860.4_Missense_Mutation_p.K107R	NM_022902.4	NP_075053.2	Q8TAD4	ZNT5_HUMAN	solute carrier family 30 (zinc transporter), member 5						cellular protein metabolic process (GO:0044267)|cellular zinc ion homeostasis (GO:0006882)|cobalt ion transport (GO:0006824)|regulation of proton transport (GO:0010155)|response to zinc ion (GO:0010043)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	apical plasma membrane (GO:0016324)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Lung NSC(167;0.000986)|Prostate(74;0.00809)|Colorectal(97;0.0508)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;1.24e-56)|Epithelial(20;1.12e-52)|all cancers(19;2.63e-48)|Lung(70;0.0177)		TTTAAAGACAAAAAGTTAAAT	0.284																																					p.K107R		Atlas-SNP	.											.	SLC30A5	54	.	0			c.A320G						PASS	.						22.0	23.0	23.0					5																	68399835		2178	4287	6465	SO:0001627	intron_variant	64924	exon4			AAGACAAAAAGTT	AF212235	CCDS3996.1, CCDS34173.1, CCDS58955.1	5q13.1	2013-05-22			ENSG00000145740	ENSG00000145740		"""Solute carriers"""	19089	protein-coding gene	gene with protein product		607819				11937503, 11904301	Standard	NM_022902		Approved	ZTL1, ZnT-5, FLJ12496, FLJ12756, ZNT5, MGC5499, ZNTL1	uc003jvh.3	Q8TAD4	OTTHUMG00000131253	ENST00000396591.3:c.274-623A>G	chr5.hg19:g.68399835A>G		31.0	0.0	.		30.0	10.0	.	NM_024055	B7ZM89|Q6UX54|Q7L4M4|Q8TDG3|Q9BVY8|Q9H9H1	Missense_Mutation	SNP	ENST00000396591.3	hg19	CCDS3996.1	.	.	.	.	.	.	.	.	.	.	A	12.48	1.950224	0.34377	.	.	ENSG00000145740	ENST00000380860;ENST00000502979	.	.	.	2.74	2.74	0.32292	.	.	.	.	.	T	0.42832	0.1220	.	.	.	0.19300	N	0.99998	P	0.37398	0.593	P	0.45577	0.486	T	0.36696	-0.9737	7	0.87932	D	0	.	7.3651	0.26768	1.0:0.0:0.0:0.0	.	107	Q9BVY8	.	R	107;66	.	ENSP00000370241:K107R	K	+	2	0	SLC30A5	68435591	0.144000	0.22641	0.636000	0.29352	0.015000	0.08874	1.174000	0.31932	1.510000	0.48803	0.459000	0.35465	AAA	.	.	.	none		0.284	SLC30A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254017.2		
F2RL2	2151	hgsc.bcm.edu	37	5	75913735	75913735	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr5:75913735A>G	ENST00000296641.4	-	2	1000	c.797T>C	c.(796-798)tTg>tCg	p.L266S	IQGAP2_ENST00000274364.6_Intron|IQGAP2_ENST00000396234.3_Intron|F2RL2_ENST00000504899.1_Missense_Mutation_p.L244S|IQGAP2_ENST00000502745.1_Intron|IQGAP2_ENST00000379730.3_Intron	NM_004101.3	NP_004092.1	O00254	PAR3_HUMAN	coagulation factor II (thrombin) receptor-like 2	266					blood coagulation (GO:0007596)|metabolic process (GO:0008152)|platelet activation (GO:0030168)|response to wounding (GO:0009611)	apical plasma membrane (GO:0016324)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphatidylinositol phospholipase C activity (GO:0004435)|thrombin receptor activity (GO:0015057)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(3)	32		all_lung(232;0.000462)|Lung NSC(167;0.00124)|Prostate(461;0.00955)|Ovarian(174;0.0129)		all cancers(79;4.43e-43)		AAAGAATGCCAAGGAGATGAA	0.423																																					p.L266S		Atlas-SNP	.											.	F2RL2	57	.	0			c.T797C						PASS	.						76.0	72.0	73.0					5																	75913735		2203	4300	6503	SO:0001583	missense	2151	exon2			AATGCCAAGGAGA	U92971	CCDS4031.1, CCDS58959.1	5q13	2012-08-08			ENSG00000164220	ENSG00000164220		"""GPCR / Class A : Protease activated receptors"""	3539	protein-coding gene	gene with protein product	"""proteinase-activated receptor-3"""	601919				9087410, 9722561	Standard	NM_004101		Approved	PAR3	uc003kem.4	O00254	OTTHUMG00000102119	ENST00000296641.4:c.797T>C	chr5.hg19:g.75913735A>G	ENSP00000296641:p.Leu266Ser	45.0	0.0	.		59.0	14.0	.	NM_004101	B2R754|B4DQ13|Q52M68|Q7Z3W3	Missense_Mutation	SNP	ENST00000296641.4	hg19	CCDS4031.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.155954	0.78114	.	.	ENSG00000164220	ENST00000296641;ENST00000504899	T;T	0.70045	-0.45;-0.45	5.3	5.3	0.74995	GPCR, rhodopsin-like superfamily (1);	0.152354	0.43579	D	0.000549	T	0.76695	0.4023	L	0.56340	1.77	0.46678	D	0.999155	D	0.89917	1.0	D	0.80764	0.994	T	0.73272	-0.4035	10	0.22706	T	0.39	-8.0196	15.2748	0.73734	1.0:0.0:0.0:0.0	.	266	O00254	PAR3_HUMAN	S	266;244	ENSP00000296641:L266S;ENSP00000426703:L244S	ENSP00000296641:L266S	L	-	2	0	F2RL2	75949491	1.000000	0.71417	0.860000	0.33809	0.967000	0.64934	8.850000	0.92190	2.006000	0.58801	0.460000	0.39030	TTG	.	.	.	none		0.423	F2RL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219958.3		
BHMT	635	hgsc.bcm.edu	37	5	78415082	78415082	+	Splice_Site	SNP	T	T	C			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr5:78415082T>C	ENST00000274353.5	+	3	274	c.167T>C	c.(166-168)gTt>gCt	p.V56A	BHMT_ENST00000524080.1_Intron|DMGDH_ENST00000520388.1_Intron	NM_001713.2	NP_001704.2	Q93088	BHMT1_HUMAN	betaine--homocysteine S-methyltransferase	56	Hcy-binding. {ECO:0000255|PROSITE- ProRule:PRU00333}.				amino-acid betaine catabolic process (GO:0006579)|amino-acid betaine metabolic process (GO:0006577)|cellular nitrogen compound metabolic process (GO:0034641)|L-methionine salvage (GO:0071267)|protein methylation (GO:0006479)|regulation of homocysteine metabolic process (GO:0050666)|response to organonitrogen compound (GO:0010243)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	betaine-homocysteine S-methyltransferase activity (GO:0047150)|S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)	29		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.88e-45)|Epithelial(54;8.07e-41)|all cancers(79;3.51e-36)	L-Methionine(DB00134)	ACTCTCCCAGTTCGCCAGCTT	0.433																																					p.V56A		Atlas-SNP	.											.	BHMT	53	.	0			c.T167C						PASS	.						92.0	87.0	89.0					5																	78415082		2203	4300	6503	SO:0001630	splice_region_variant	635	exon3			TCCCAGTTCGCCA	BC012616	CCDS4046.1	5q14.1	2012-09-20	2010-04-28		ENSG00000145692	ENSG00000145692	2.1.1.5		1047	protein-coding gene	gene with protein product	"""betaine homocysteine methyltransferase"""	602888				8798461, 9281325	Standard	NM_001713		Approved	BHMT1	uc003kfu.4	Q93088	OTTHUMG00000108157	ENST00000274353.5:c.167-1T>C	chr5.hg19:g.78415082T>C		151.0	0.0	.		125.0	41.0	.	NM_001713	Q9UNI9	Missense_Mutation	SNP	ENST00000274353.5	hg19	CCDS4046.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.388243	0.82902	.	.	ENSG00000145692	ENST00000274353	T	0.45276	0.9	5.6	5.6	0.85130	Homocysteine S-methyltransferase (4);	0.000000	0.85682	D	0.000000	T	0.73249	0.3563	M	0.93678	3.445	0.80722	D	1	D	0.89917	1.0	D	0.73708	0.981	T	0.81360	-0.0968	9	.	.	.	.	16.0786	0.80985	0.0:0.0:0.0:1.0	.	56	Q93088	BHMT1_HUMAN	A	56	ENSP00000274353:V56A	.	V	+	2	0	BHMT	78450838	1.000000	0.71417	1.000000	0.80357	0.616000	0.37450	7.669000	0.83911	2.254000	0.74563	0.460000	0.39030	GTT	.	.	.	none		0.433	BHMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226961.1	NM_001713	Missense_Mutation
PCDHB3	56132	hgsc.bcm.edu	37	5	140481178	140481178	+	Silent	SNP	T	T	C			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr5:140481178T>C	ENST00000231130.2	+	1	945	c.945T>C	c.(943-945)taT>taC	p.Y315Y	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	315	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTAATAGTTATGAAGTCGACA	0.428																																					p.Y315Y		Atlas-SNP	.											.	PCDHB3	208	.	0			c.T945C						PASS	.						54.0	58.0	56.0					5																	140481178		2203	4300	6503	SO:0001819	synonymous_variant	56132	exon1			TAGTTATGAAGTC	AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.945T>C	chr5.hg19:g.140481178T>C		98.0	0.0	.		86.0	32.0	.	NM_018937	B2R8P2	Silent	SNP	ENST00000231130.2	hg19	CCDS4245.1																																																																																			.	.	.	none		0.428	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251817.2	NM_018937	
TENM2	57451	hgsc.bcm.edu	37	5	167674296	167674296	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr5:167674296C>A	ENST00000518659.1	+	27	6391	c.6352C>A	c.(6352-6354)Cgc>Agc	p.R2118S	TENM2_ENST00000545108.1_Missense_Mutation_p.R2117S|TENM2_ENST00000403607.2_Missense_Mutation_p.R1942S|TENM2_ENST00000520394.1_Missense_Mutation_p.R1879S|TENM2_ENST00000519204.1_Missense_Mutation_p.R1997S	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	2118					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										TGACCTCTACCGCTATGATGA	0.493																																					p.R2109S		Atlas-SNP	.											.	.	.	.	0			c.C6325A						PASS	.						167.0	167.0	167.0					5																	167674296		2016	4172	6188	SO:0001583	missense	57451	exon27			CTCTACCGCTATG	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.6352C>A	chr5.hg19:g.167674296C>A	ENSP00000429430:p.Arg2118Ser	182.0	0.0	.		185.0	57.0	.	NM_001122679	Q9ULU2	Missense_Mutation	SNP	ENST00000518659.1	hg19		.	.	.	.	.	.	.	.	.	.	C	18.69	3.678710	0.68042	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	D;D;D;D;D	0.89123	-1.99;-1.98;-2.09;-2.44;-2.47	5.44	5.44	0.79542	.	0.103671	0.64402	D	0.000001	D	0.93861	0.8036	M	0.71581	2.175	0.54753	D	0.999989	D;P;D	0.69078	0.974;0.899;0.997	P;B;D	0.75484	0.807;0.44;0.986	D	0.92184	0.5754	10	0.30854	T	0.27	.	19.2461	0.93902	0.0:1.0:0.0:0.0	.	2117;2118;1879	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	S	2118;2117;1997;1879;1942	ENSP00000429430:R2118S;ENSP00000438635:R2117S;ENSP00000428964:R1997S;ENSP00000427874:R1879S;ENSP00000384905:R1942S	ENSP00000384905:R1942S	R	+	1	0	ODZ2	167606874	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	3.906000	0.56340	2.560000	0.86352	0.561000	0.74099	CGC	.	.	.	none		0.493	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679	
PFN3	345456	hgsc.bcm.edu	37	5	176827191	176827191	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr5:176827191T>C	ENST00000358571.2	-	1	446	c.387A>G	c.(385-387)atA>atG	p.I129M	F12_ENST00000514943.1_5'Flank	NM_001029886.2	NP_001025057.1	P60673	PROF3_HUMAN	profilin 3	129					actin cytoskeleton organization (GO:0030036)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	lipid binding (GO:0008289)			lung(1)	1	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCAGCCCGCGTATGAGTTCGT	0.706																																					p.I129M		Atlas-SNP	.											.	PFN3	4	.	0			c.A387G						PASS	.						18.0	19.0	19.0					5																	176827191		2099	4229	6328	SO:0001583	missense	345456	exon1			CCCGCGTATGAGT	AC090063	CCDS34301.1	5q35.2	2008-08-26			ENSG00000196570	ENSG00000196570			18627	protein-coding gene	gene with protein product		612812				11867228	Standard	NM_001029886		Approved		uc003mgl.2	P60673	OTTHUMG00000163408	ENST00000358571.2:c.387A>G	chr5.hg19:g.176827191T>C	ENSP00000351379:p.Ile129Met	39.0	0.0	.		52.0	14.0	.	NM_001029886	A2RUL3	Missense_Mutation	SNP	ENST00000358571.2	hg19	CCDS34301.1	.	.	.	.	.	.	.	.	.	.	T	11.75	1.732218	0.30684	.	.	ENSG00000196570	ENST00000358571	D	0.85861	-2.04	4.76	2.91	0.33838	.	0.294068	0.29459	N	0.012099	D	0.86167	0.5868	L	0.44542	1.39	0.21652	N	0.999609	D	0.71674	0.998	D	0.79108	0.992	T	0.74847	-0.3525	10	0.39692	T	0.17	.	5.3821	0.16197	0.1086:0.0:0.6881:0.2033	.	129	P60673	PROF3_HUMAN	M	129	ENSP00000351379:I129M	ENSP00000351379:I129M	I	-	3	3	PFN3	176759797	0.015000	0.18098	0.596000	0.28811	0.168000	0.22595	-0.004000	0.12878	0.415000	0.25817	-0.724000	0.03597	ATA	.	.	.	none		0.706	PFN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373234.1	NM_001029886	
VARS2	57176	hgsc.bcm.edu	37	6	30893383	30893383	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr6:30893383G>C	ENST00000321897.5	+	27	3480	c.2848G>C	c.(2848-2850)Ggc>Cgc	p.G950R	VARS2_ENST00000542001.1_Missense_Mutation_p.G810R|VARS2_ENST00000416670.2_Missense_Mutation_p.G950R|VARS2_ENST00000541562.1_Missense_Mutation_p.G980R|VARS2_ENST00000476162.1_3'UTR			Q5ST30	SYVM_HUMAN	valyl-tRNA synthetase 2, mitochondrial	950					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(3)|prostate(3)|skin(4)|urinary_tract(1)	46						GGAGCCCCTGGGCACCCTGGG	0.647																																					p.G980R		Atlas-SNP	.											.	VARS2	60	.	0			c.G2938C						PASS	.						19.0	22.0	21.0					6																	30893383		1493	2701	4194	SO:0001583	missense	57176	exon28			CCCCTGGGCACCC	AB067472	CCDS34387.1, CCDS54980.1	6p21.33	2012-10-26	2012-10-26	2007-02-23	ENSG00000137411	ENSG00000137411	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	21642	protein-coding gene	gene with protein product	"""valine tRNA ligase 2, mitochondrial"""	612802	"""valyl-tRNA synthetase 2-like"", ""valyl-tRNA synthetase like"", ""valyl-tRNA synthetase 2, mitochondrial (putative)"""	VARS2L, VARSL		1898367, 11572484, 18400783	Standard	NM_001167734		Approved	DKFZP434L1435, KIAA1885, G7a	uc011dmz.2	Q5ST30	OTTHUMG00000031263	ENST00000321897.5:c.2848G>C	chr6.hg19:g.30893383G>C	ENSP00000316092:p.Gly950Arg	58.0	0.0	.		41.0	9.0	.	NM_001167734	A2ABL7|B4DET4|B4E3P5|F5GXJ0|F5H323|Q2M2A0|Q59FI1|Q5SQ96|Q5SS98|Q6DKJ5|Q6ZV24|Q96GN2|Q96H77|Q96Q02|Q9H6R2|Q9UFH7	Missense_Mutation	SNP	ENST00000321897.5	hg19	CCDS34387.1	.	.	.	.	.	.	.	.	.	.	G	5.589	0.293519	0.10567	.	.	ENSG00000137411	ENST00000321897;ENST00000416670;ENST00000542001;ENST00000541562	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	5.62	3.84	0.44239	Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (1);	0.708730	0.14077	N	0.342996	T	0.13628	0.0330	L	0.44542	1.39	0.30330	N	0.78675	B;B;B;B	0.29988	0.264;0.001;0.002;0.0	B;B;B;B	0.26094	0.066;0.001;0.001;0.0	T	0.15378	-1.0439	10	0.15952	T	0.53	-9.346	8.9906	0.36022	0.1719:0.0:0.8281:0.0	.	388;948;980;950	Q5ST30-2;B7ZL25;F5GXJ0;Q5ST30	.;.;.;SYVM_HUMAN	R	950;950;810;980	ENSP00000316092:G950R;ENSP00000394802:G950R;ENSP00000438200:G810R;ENSP00000441000:G980R	ENSP00000316092:G950R	G	+	1	0	VARS2	31001362	0.997000	0.39634	1.000000	0.80357	0.153000	0.21895	0.990000	0.29642	0.737000	0.32582	-0.140000	0.14226	GGC	.	.	.	none		0.647	VARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076566.2	NM_020442	
TTBK1	84630	hgsc.bcm.edu	37	6	43226956	43226956	+	Silent	SNP	C	C	G			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr6:43226956C>G	ENST00000259750.4	+	11	1280	c.1197C>G	c.(1195-1197)gtC>gtG	p.V399V	TTBK1_ENST00000304139.5_Silent_p.V348V	NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	399					substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			AGGCTGAAGTCTGGGAGGAGA	0.642																																					p.V399V		Atlas-SNP	.											.	TTBK1	124	.	0			c.C1197G						PASS	.						51.0	58.0	56.0					6																	43226956		2203	4300	6503	SO:0001819	synonymous_variant	84630	exon11			TGAAGTCTGGGAG	AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.1197C>G	chr6.hg19:g.43226956C>G		100.0	0.0	.		104.0	26.0	.	NM_032538	A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	Silent	SNP	ENST00000259750.4	hg19	CCDS34455.1																																																																																			.	.	.	none		0.642	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040584.3		
GPR110	266977	hgsc.bcm.edu	37	6	46977043	46977043	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr6:46977043G>A	ENST00000371253.2	-	11	2343	c.2128C>T	c.(2128-2130)Cct>Tct	p.P710S	GPR110_ENST00000283297.5_Missense_Mutation_p.P513S|GPR110_ENST00000449332.2_5'UTR	NM_153840.2	NP_722582.2	Q5T601	GP110_HUMAN	G protein-coupled receptor 110	710					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	29						ATAATGAGAGGGCACCCATAA	0.478																																					p.P710S		Atlas-SNP	.											.	GPR110	102	.	0			c.C2128T						PASS	.						88.0	80.0	83.0					6																	46977043		2203	4300	6503	SO:0001583	missense	266977	exon11			TGAGAGGGCACCC	AB083618	CCDS4920.1, CCDS34471.1	6p21.1	2014-08-08			ENSG00000153292	ENSG00000153292		"""-"", ""GPCR / Class B : Orphans"""	18990	protein-coding gene	gene with protein product						12435584, 14623098	Standard	XM_005249006		Approved	hGPCR36, PGR19	uc003oyt.3	Q5T601	OTTHUMG00000014795	ENST00000371253.2:c.2128C>T	chr6.hg19:g.46977043G>A	ENSP00000360299:p.Pro710Ser	54.0	0.0	.		56.0	16.0	.	NM_153840	Q5KU15|Q5T5Z9|Q5T600|Q86SM1|Q8IXE3|Q8IZF8|Q96DQ1|Q9H615	Missense_Mutation	SNP	ENST00000371253.2	hg19	CCDS34471.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.576276	0.86645	.	.	ENSG00000153292	ENST00000371253;ENST00000283297	D;D	0.84516	-1.86;-1.86	5.9	5.9	0.94986	GPCR, family 2-like (1);	0.000000	0.64402	D	0.000013	D	0.93572	0.7948	M	0.88377	2.95	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93726	0.7037	10	0.87932	D	0	-22.4263	20.2789	0.98501	0.0:0.0:1.0:0.0	.	710	Q5T601	GP110_HUMAN	S	710;513	ENSP00000360299:P710S;ENSP00000283297:P513S	ENSP00000283297:P513S	P	-	1	0	GPR110	47085002	1.000000	0.71417	0.995000	0.50966	0.855000	0.48748	9.861000	0.99562	2.788000	0.95919	0.650000	0.86243	CCT	.	.	.	none		0.478	GPR110-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040810.2	NM_153840	
TBC1D32	221322	hgsc.bcm.edu	37	6	121576521	121576521	+	Silent	SNP	T	T	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr6:121576521T>A	ENST00000398212.2	-	17	2020	c.1971A>T	c.(1969-1971)gtA>gtT	p.V657V	TBC1D32_ENST00000275159.6_Silent_p.V657V	NM_152730.4	NP_689943.4	Q96NH3	BROMI_HUMAN	TBC1 domain family, member 32	657					cilium morphogenesis (GO:0060271)|embryonic digit morphogenesis (GO:0042733)|lens development in camera-type eye (GO:0002088)|protein localization to cilium (GO:0061512)|retinal pigment epithelium development (GO:0003406)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cilium (GO:0005929)|cytoplasm (GO:0005737)	Rab GTPase activator activity (GO:0005097)										CAGAACCCTCTACTGGAGTAG	0.289																																					p.V657V		Atlas-SNP	.											.	C6orf170	146	.	0			c.A1971T						PASS	.						55.0	55.0	55.0					6																	121576521		1794	4047	5841	SO:0001819	synonymous_variant	221322	exon17			ACCCTCTACTGGA	AK055461	CCDS43501.1	6q22.31	2014-02-20	2013-07-10	2013-07-10	ENSG00000146350	ENSG00000146350			21485	protein-coding gene	gene with protein product	"""broad-minded homolog"""	615867	"""chromosome 6 open reading frame 171"", ""chromosome 6 open reading frame 170"""	C6orf171, C6orf170		20159594, 24285566	Standard	NM_152730		Approved	FLJ30899, dJ310J6.1, FLJ34235, bA57L9.1, BROMI	uc003pyo.1	Q96NH3	OTTHUMG00000015474	ENST00000398212.2:c.1971A>T	chr6.hg19:g.121576521T>A		118.0	0.0	.		116.0	43.0	.	NM_152730	Q5SZD6|Q5SZM6|Q6ZMY4|Q6ZUR7|Q8NB47	Silent	SNP	ENST00000398212.2	hg19	CCDS43501.1																																																																																			.	.	.	none		0.289	TBC1D32-005	PUTATIVE	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380937.2	NM_152730	
HIVEP2	3097	hgsc.bcm.edu	37	6	143091819	143091819	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr6:143091819T>C	ENST00000367604.1	-	4	4696	c.4057A>G	c.(4057-4059)Att>Gtt	p.I1353V	HIVEP2_ENST00000367603.2_Missense_Mutation_p.I1353V|HIVEP2_ENST00000012134.2_Missense_Mutation_p.I1353V			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	1353					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		ATCTGAGAAATGCTTGTGTAC	0.507																																					p.I1353V	Esophageal Squamous(107;843 1510 13293 16805 42198)	Atlas-SNP	.											.	HIVEP2	225	.	0			c.A4057G						PASS	.						81.0	80.0	80.0					6																	143091819		2007	4178	6185	SO:0001583	missense	3097	exon5			GAGAAATGCTTGT	M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.4057A>G	chr6.hg19:g.143091819T>C	ENSP00000356576:p.Ile1353Val	90.0	0.0	.		96.0	29.0	.	NM_006734	Q02646|Q5THT5|Q9NS05	Missense_Mutation	SNP	ENST00000367604.1	hg19	CCDS43510.1	.	.	.	.	.	.	.	.	.	.	T	9.819	1.185356	0.21870	.	.	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	T;T;T	0.02121	4.44;4.44;4.44	6.08	6.08	0.98989	.	0.046170	0.85682	D	0.000000	T	0.01092	0.0036	L	0.38953	1.18	0.46927	D	0.999254	B	0.30236	0.274	B	0.19666	0.026	T	0.62296	-0.6884	10	0.23891	T	0.37	-16.7632	16.6438	0.85155	0.0:0.0:0.0:1.0	.	1353	P31629	ZEP2_HUMAN	V	1353	ENSP00000356576:I1353V;ENSP00000356575:I1353V;ENSP00000012134:I1353V	ENSP00000012134:I1353V	I	-	1	0	HIVEP2	143133512	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.593000	0.61034	2.333000	0.79357	0.533000	0.62120	ATT	.	.	.	none		0.507	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042495.1		
CADPS2	93664	hgsc.bcm.edu	37	7	122269335	122269335	+	Silent	SNP	A	A	G			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr7:122269335A>G	ENST00000449022.2	-	4	853	c.834T>C	c.(832-834)gaT>gaC	p.D278D	CADPS2_ENST00000412584.2_Silent_p.D278D|CADPS2_ENST00000313070.7_Silent_p.D278D|CADPS2_ENST00000334010.7_Silent_p.D278D	NM_017954.10	NP_060424.9	Q86UW7	CAPS2_HUMAN	Ca++-dependent secretion activator 2	278					cellular response to starvation (GO:0009267)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasmic membrane-bounded vesicle (GO:0016023)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(2)	43						GCAGCCGGCCATCAAGTTCCC	0.358																																					p.D278D		Atlas-SNP	.											.	CADPS2	116	.	0			c.T834C						PASS	.						67.0	64.0	65.0					7																	122269335		1866	4095	5961	SO:0001819	synonymous_variant	93664	exon4			CCGGCCATCAAGT		CCDS47691.1, CCDS55158.1	7q31.32	2013-01-10	2008-08-28		ENSG00000081803	ENSG00000081803		"""Pleckstrin homology (PH) domain containing"""	16018	protein-coding gene	gene with protein product		609978	"""Ca++-dependent activator protein for secretion 2"""				Standard	NM_017954		Approved		uc010lkq.3	Q86UW7	OTTHUMG00000157093	ENST00000449022.2:c.834T>C	chr7.hg19:g.122269335A>G		35.0	0.0	.		33.0	6.0	.	NM_001167940	A4D0X3|B7ZM56|Q658Q2|Q7Z5T7|Q8IZW9|Q8N7M4|Q9H6P4|Q9HCI1|Q9NWK8	Silent	SNP	ENST00000449022.2	hg19	CCDS55158.1																																																																																			.	.	.	none		0.358	CADPS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347414.2	NM_017954	
NUP205	23165	hgsc.bcm.edu	37	7	135276257	135276257	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr7:135276257T>G	ENST00000285968.6	+	11	1559	c.1533T>G	c.(1531-1533)atT>atG	p.I511M	NUP205_ENST00000440390.2_Intron	NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	511					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						CTATTTATATTCCTTATTTGA	0.403																																					p.I511M		Atlas-SNP	.											.	NUP205	198	.	0			c.T1533G						PASS	.						122.0	115.0	117.0					7																	135276257		2203	4300	6503	SO:0001583	missense	23165	exon11			TTATATTCCTTAT	D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.1533T>G	chr7.hg19:g.135276257T>G	ENSP00000285968:p.Ile511Met	150.0	0.0	.		130.0	46.0	.	NM_015135	A6H8X3|Q86YC1	Missense_Mutation	SNP	ENST00000285968.6	hg19	CCDS34759.1	.	.	.	.	.	.	.	.	.	.	T	19.33	3.806891	0.70797	.	.	ENSG00000155561	ENST00000285968	T	0.32023	1.47	5.96	3.3	0.37823	.	0.043164	0.85682	D	0.000000	T	0.32615	0.0835	L	0.55481	1.735	0.80722	D	1	P	0.51653	0.947	P	0.50231	0.635	T	0.06427	-1.0827	10	0.46703	T	0.11	-10.0959	4.1716	0.10332	0.1437:0.2942:0.0:0.5621	.	511	Q92621	NU205_HUMAN	M	511	ENSP00000285968:I511M	ENSP00000285968:I511M	I	+	3	3	NUP205	134926797	0.999000	0.42202	1.000000	0.80357	0.999000	0.98932	0.569000	0.23638	0.394000	0.25230	0.533000	0.62120	ATT	.	.	.	none		0.403	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340358.1		
SMC2	10592	hgsc.bcm.edu	37	9	106862707	106862707	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr9:106862707T>C	ENST00000286398.7	+	7	917	c.629T>C	c.(628-630)tTa>tCa	p.L210S	SMC2_ENST00000374793.3_Missense_Mutation_p.L210S|SMC2_ENST00000374787.3_Missense_Mutation_p.L210S|SMC2_ENST00000303219.8_Missense_Mutation_p.L210S	NM_001042551.1|NM_001265602.1|NM_006444.2	NP_001036016.1|NP_001252531.1|NP_006435.2	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2	210					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(14)|ovary(5)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	48						ATTCAAAAATTAAAAGAGGTA	0.274																																					p.L210S		Atlas-SNP	.											.	SMC2	127	.	0			c.T629C						PASS	.						37.0	45.0	42.0					9																	106862707		2179	4270	6449	SO:0001583	missense	10592	exon7			AAAAATTAAAAGA	AF092563	CCDS35086.1	9q31.1	2008-05-14	2006-07-06	2006-07-06	ENSG00000136824	ENSG00000136824		"""Structural maintenance of chromosomes proteins"""	14011	protein-coding gene	gene with protein product		605576	"""SMC2 (structural maintenance of chromosomes 2, yeast)-like 1"", ""SMC2 structural maintenance of chromosomes 2-like 1 (yeast)"""	SMC2L1		9789013	Standard	NM_006444		Approved	hCAP-E, CAP-E	uc011lvl.2	O95347	OTTHUMG00000020401	ENST00000286398.7:c.629T>C	chr9.hg19:g.106862707T>C	ENSP00000286398:p.Leu210Ser	142.0	0.0	.		118.0	35.0	.	NM_006444	Q6IEE0|Q9P1P2	Missense_Mutation	SNP	ENST00000286398.7	hg19	CCDS35086.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.465044	0.84425	.	.	ENSG00000136824	ENST00000286398;ENST00000440179;ENST00000374793;ENST00000303219;ENST00000536893;ENST00000374787	T;T;T;T;T	0.11385	2.78;2.78;2.78;2.78;2.78	5.57	5.57	0.84162	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	T	0.44095	0.1277	M	0.93898	3.47	0.52501	D	0.999959	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.57940	-0.7724	10	0.87932	D	0	-5.7921	14.5587	0.68120	0.0:0.0:0.0:1.0	.	210;210;210	A8K984;O95347;Q2KQ72	.;SMC2_HUMAN;.	S	210;65;210;210;210;210	ENSP00000286398:L210S;ENSP00000414999:L65S;ENSP00000363925:L210S;ENSP00000306152:L210S;ENSP00000363919:L210S	ENSP00000286398:L210S	L	+	2	0	SMC2	105902528	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.677000	0.84024	2.109000	0.64355	0.528000	0.53228	TTA	.	.	.	none		0.274	SMC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053470.1		
PTGR1	22949	hgsc.bcm.edu	37	9	114359672	114359672	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr9:114359672T>G	ENST00000407693.2	-	2	293	c.31A>C	c.(31-33)Aag>Cag	p.K11Q	PTGR1_ENST00000538962.1_Missense_Mutation_p.K11Q|PTGR1_ENST00000238248.3_5'UTR|PTGR1_ENST00000309195.5_Missense_Mutation_p.K11Q	NM_001146108.1	NP_001139580.1	Q14914	PTGR1_HUMAN	prostaglandin reductase 1	11					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|leukotriene metabolic process (GO:0006691)|lipoxin metabolic process (GO:2001300)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	13-prostaglandin reductase activity (GO:0036132)|15-oxoprostaglandin 13-oxidase activity (GO:0047522)|2-alkenal reductase [NAD(P)] activity (GO:0032440)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(5)|lung(3)|ovary(1)	11						ACAAAGTGCTTCTTCAGGGTC	0.403																																					p.K11Q	Ovarian(200;132 2151 7551 19220 46064)	Atlas-SNP	.											.	PTGR1	23	.	0			c.A31C						PASS	.						109.0	95.0	100.0					9																	114359672		2203	4300	6503	SO:0001583	missense	22949	exon2			AGTGCTTCTTCAG	D49387	CCDS6779.1, CCDS55331.1	9q32	2008-06-04	2008-06-02	2008-06-02	ENSG00000106853	ENSG00000106853	1.3.1.74, 1.3.1.48		18429	protein-coding gene	gene with protein product	"""zinc binding alcohol dehydrogenase domain containing 3"""	601274	"""leukotriene B4 12-hydroxydehydrogenase"""	LTB4DH		8576264, 17449869	Standard	NM_001146109		Approved	ZADH3	uc004bfh.2	Q14914	OTTHUMG00000020493	ENST00000407693.2:c.31A>C	chr9.hg19:g.114359672T>G	ENSP00000385763:p.Lys11Gln	46.0	0.0	.		35.0	15.0	.	NM_001146108	A8K0N2|B4DPK3|F5GY50|Q8IYQ0|Q9H1X6	Missense_Mutation	SNP	ENST00000407693.2	hg19	CCDS6779.1	.	.	.	.	.	.	.	.	.	.	T	10.91	1.483746	0.26598	.	.	ENSG00000106853	ENST00000538962;ENST00000309195;ENST00000407693;ENST00000333580;ENST00000422125;ENST00000374313;ENST00000374308	T;T;T;T	0.51817	0.69;0.69;0.69;0.69	4.62	4.62	0.57501	GroES-like (1);	0.092047	0.85682	D	0.000000	T	0.43656	0.1257	M	0.62154	1.92	0.80722	D	1	B;B;B	0.33171	0.4;0.278;0.077	B;B;B	0.29440	0.102;0.061;0.015	T	0.46665	-0.9175	10	0.48119	T	0.1	2.0981	12.2191	0.54423	0.0:0.0:0.0:1.0	.	11;11;11	F5GY50;B4DPK3;Q14914	.;.;PTGR1_HUMAN	Q	11	ENSP00000440281:K11Q;ENSP00000311572:K11Q;ENSP00000385763:K11Q;ENSP00000395965:K11Q	ENSP00000311572:K11Q	K	-	1	0	PTGR1	113399493	1.000000	0.71417	1.000000	0.80357	0.589000	0.36550	2.756000	0.47549	2.020000	0.59435	0.374000	0.22700	AAG	.	.	.	none		0.403	PTGR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053647.2		
C10orf62	414157	hgsc.bcm.edu	37	10	99349694	99349694	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr10:99349694T>A	ENST00000370640.3	+	1	245	c.40T>A	c.(40-42)Tct>Act	p.S14T	PI4K2A_ENST00000555577.1_Intron|HOGA1_ENST00000370647.4_Intron|HOGA1_ENST00000370646.4_Intron|PI4K2A_ENST00000370649.3_Intron	NM_001009997.2	NP_001009997.2	Q5T681	CJ062_HUMAN	chromosome 10 open reading frame 62	14										endometrium(2)|kidney(1)|lung(1)	4		Colorectal(252;0.162)		Epithelial(162;9.58e-11)|all cancers(201;8.62e-09)		AAAGGAAACCTCTGAGTGTCC	0.502																																					p.S14T		Atlas-SNP	.											.	C10orf62	14	.	0			c.T40A						PASS	.						100.0	100.0	100.0					10																	99349694		2203	4300	6503	SO:0001583	missense	414157	exon1			GAAACCTCTGAGT		CCDS31261.1	10q24.2	2012-05-31			ENSG00000203942	ENSG00000203942			23294	protein-coding gene	gene with protein product							Standard	NM_001009997		Approved	bA548K23.1	uc001koa.3	Q5T681	OTTHUMG00000018858	ENST00000370640.3:c.40T>A	chr10.hg19:g.99349694T>A	ENSP00000359674:p.Ser14Thr	117.0	0.0	.		97.0	7.0	.	NM_001009997	Q49A70|Q8N3Y6	Missense_Mutation	SNP	ENST00000370640.3	hg19	CCDS31261.1	.	.	.	.	.	.	.	.	.	.	T	4.766	0.142421	0.09083	.	.	ENSG00000203942	ENST00000370640	T	0.42513	0.97	5.27	-10.5	0.00291	.	3.688920	0.00929	N	0.002686	T	0.15522	0.0374	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.18777	-1.0326	10	0.14656	T	0.56	.	1.8333	0.03134	0.3493:0.094:0.1283:0.4284	.	14	Q5T681	CJ062_HUMAN	T	14	ENSP00000359674:S14T	ENSP00000359674:S14T	S	+	1	0	C10orf62	99339684	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.585000	0.00903	-2.847000	0.00332	-1.294000	0.01345	TCT	.	.	.	none		0.502	C10orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049723.1	NM_001009997	
ST5	6764	hgsc.bcm.edu	37	11	8751785	8751785	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr11:8751785G>A	ENST00000534127.1	-	6	1437	c.1052C>T	c.(1051-1053)cCc>cTc	p.P351L	ST5_ENST00000313726.6_Missense_Mutation_p.P351L|ST5_ENST00000357665.1_Missense_Mutation_p.P351L|ST5_ENST00000530438.1_Intron|ST5_ENST00000526757.1_Intron	NM_005418.3	NP_005409.3	P78524	ST5_HUMAN	suppression of tumorigenicity 5	351	Pro-rich.				positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(13)|liver(1)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	39				Epithelial(150;2.63e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0352)		CCTCTCTGGGGGTGGGCCCGC	0.687																																					p.P351L		Atlas-SNP	.											.	ST5	85	.	0			c.C1052T						PASS	.						41.0	47.0	45.0					11																	8751785		2201	4296	6497	SO:0001583	missense	6764	exon6			TCTGGGGGTGGGC	U15131	CCDS7791.1, CCDS7792.1	11p15	2012-10-04				ENSG00000166444		"""DENN/MADD domain containing"""	11350	protein-coding gene	gene with protein product	"""DENN/MADD domain containing 2B"""	140750				1390339	Standard	NM_005418		Approved	HTS1, DENND2B, p126	uc001mgt.3	P78524		ENST00000534127.1:c.1052C>T	chr11.hg19:g.8751785G>A	ENSP00000433528:p.Pro351Leu	125.0	0.0	.		109.0	25.0	.	NM_005418	B2R6X7|B3KXQ6|P78523|Q16492|Q7KYY2|Q7KZ12|Q8NE12|Q9BQQ6	Missense_Mutation	SNP	ENST00000534127.1	hg19	CCDS7791.1	.	.	.	.	.	.	.	.	.	.	G	14.28	2.487492	0.44249	.	.	ENSG00000166444	ENST00000534127;ENST00000313726;ENST00000357665	T;T;T	0.04809	3.55;3.55;3.55	6.17	5.27	0.74061	.	0.340768	0.28409	N	0.015455	T	0.06325	0.0163	L	0.41236	1.265	0.46798	D	0.999205	B	0.06786	0.001	B	0.06405	0.002	T	0.28808	-1.0032	10	0.33940	T	0.23	-18.7575	15.9068	0.79436	0.0643:0.0:0.9357:0.0	.	351	P78524	ST5_HUMAN	L	351	ENSP00000433528:P351L;ENSP00000319678:P351L;ENSP00000350294:P351L	ENSP00000319678:P351L	P	-	2	0	ST5	8708361	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	4.667000	0.61561	1.642000	0.50584	-0.123000	0.14984	CCC	.	.	.	none		0.687	ST5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386518.1	NM_005418	
AHNAK	79026	hgsc.bcm.edu	37	11	62290316	62290316	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr11:62290316C>T	ENST00000378024.4	-	5	11847	c.11573G>A	c.(11572-11574)gGt>gAt	p.G3858D	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	3858					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				GAATTTGGGACCTTTCAACTT	0.478																																					p.G3858D		Atlas-SNP	.											.	AHNAK	532	.	0			c.G11573A						PASS	.						196.0	202.0	200.0					11																	62290316		2202	4299	6501	SO:0001583	missense	79026	exon5			TTGGGACCTTTCA	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.11573G>A	chr11.hg19:g.62290316C>T	ENSP00000367263:p.Gly3858Asp	422.0	0.0	.		412.0	35.0	.	NM_001620	A1A586	Missense_Mutation	SNP	ENST00000378024.4	hg19	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	-	12.21	1.869769	0.33069	.	.	ENSG00000124942	ENST00000378024	T	0.03496	3.91	4.51	4.51	0.55191	.	0.000000	0.42053	D	0.000767	T	0.21227	0.0511	M	0.93594	3.435	0.46678	D	0.999153	D	0.65815	0.995	P	0.61201	0.885	T	0.41106	-0.9527	10	0.15499	T	0.54	.	17.021	0.86433	0.0:1.0:0.0:0.0	.	3858	Q09666	AHNK_HUMAN	D	3858	ENSP00000367263:G3858D	ENSP00000367263:G3858D	G	-	2	0	AHNAK	62046892	0.954000	0.32549	0.066000	0.19879	0.046000	0.14306	4.583000	0.60964	2.350000	0.79820	0.543000	0.68304	GGT	.	.	.	none		0.478	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
TUT1	64852	hgsc.bcm.edu	37	11	62346405	62346405	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr11:62346405T>C	ENST00000476907.1	-	5	1479	c.788A>G	c.(787-789)gAt>gGt	p.D263G	MIR3654_ENST00000496634.2_Missense_Mutation_p.D263G|TUT1_ENST00000308436.7_Missense_Mutation_p.D301G			Q9H6E5	STPAP_HUMAN	terminal uridylyl transferase 1, U6 snRNA-specific	263	Pro-rich.				mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|snRNA processing (GO:0016180)	intercellular bridge (GO:0045171)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|mRNA 3'-UTR binding (GO:0003730)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)|RNA uridylyltransferase activity (GO:0050265)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						AGGTTGTGAATCTGGAGGGGA	0.627																																					p.D301G		Atlas-SNP	.											.	TUT1	122	.	0			c.A902G						PASS	.						38.0	45.0	43.0					11																	62346405		2202	4299	6501	SO:0001583	missense	64852	exon5			TGTGAATCTGGAG	BC005013	CCDS8021.1, CCDS8021.2	11q12.2	2014-03-05	2006-10-06	2006-10-06	ENSG00000149016	ENSG00000149016	2.7.7.52	"""RNA binding motif (RRM) containing"""	26184	protein-coding gene	gene with protein product	"""RNA uridylyltransferase"", ""U6 TUTase"", ""TUTase 6"""	610641	"""RNA binding motif protein 21"""	RBM21		16790842	Standard	NM_022830		Approved	FLJ22347, FLJ22267, FLJ21850, PAPD2, TUTase	uc001nto.2	Q9H6E5	OTTHUMG00000158564	ENST00000476907.1:c.788A>G	chr11.hg19:g.62346405T>C	ENSP00000419607:p.Asp263Gly	76.0	0.0	.		70.0	19.0	.	NM_022830	A1A527|A8K995|Q2NL65|Q7L583|Q9H6H7	Missense_Mutation	SNP	ENST00000476907.1	hg19		.	.	.	.	.	.	.	.	.	.	T	10.15	1.271130	0.23221	.	.	ENSG00000149016	ENST00000308436;ENST00000476907;ENST00000278279	T;T	0.40476	1.03;1.05	4.91	2.58	0.30949	.	0.311232	0.25590	N	0.029624	T	0.29256	0.0728	L	0.36672	1.1	0.24619	N	0.993685	B	0.12013	0.005	B	0.12156	0.007	T	0.20940	-1.0260	10	0.54805	T	0.06	1.3697	5.9223	0.19088	0.0:0.2193:0.0:0.7807	.	301	F5H0R1	.	G	301;263;124	ENSP00000308000:D301G;ENSP00000419607:D263G	ENSP00000441670:D263G	D	-	2	0	TUT1	62102981	1.000000	0.71417	0.932000	0.37286	0.144000	0.21451	1.147000	0.31602	0.370000	0.24538	0.460000	0.39030	GAT	.	.	.	none		0.627	TUT1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000351319.2	NM_022830	
ARHGEF12	23365	hgsc.bcm.edu	37	11	120336044	120336044	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr11:120336044G>T	ENST00000397843.2	+	28	2878	c.2712G>T	c.(2710-2712)aaG>aaT	p.K904N	ARHGEF12_ENST00000532993.1_Missense_Mutation_p.K801N|ARHGEF12_ENST00000356641.3_Missense_Mutation_p.K885N	NM_015313.2	NP_056128.1	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	904	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(5)|endometrium(6)|kidney(5)|large_intestine(13)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(2)	61		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		GTCAGAAAAAGGATTCTCGAT	0.393			T	MLL	AML																																p.K904N		Atlas-SNP	.		Dom	yes		11	11q23.3	23365	RHO guanine nucleotide exchange factor (GEF) 12 (LARG)		L	.	ARHGEF12	133	.	0			c.G2712T						PASS	.						94.0	89.0	91.0					11																	120336044		1863	4111	5974	SO:0001583	missense	23365	exon28			GAAAAAGGATTCT	AF180681	CCDS41727.1, CCDS55794.1	11q23.3	2011-11-16			ENSG00000196914	ENSG00000196914		"""Rho guanine nucleotide exchange factors"""	14193	protein-coding gene	gene with protein product		604763				10681437, 9205841	Standard	NM_001198665		Approved	KIAA0382, LARG	uc001pxl.2	Q9NZN5	OTTHUMG00000166143	ENST00000397843.2:c.2712G>T	chr11.hg19:g.120336044G>T	ENSP00000380942:p.Lys904Asn	118.0	0.0	.		101.0	30.0	.	NM_015313	O15086|Q6P526	Missense_Mutation	SNP	ENST00000397843.2	hg19	CCDS41727.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.000713	0.74818	.	.	ENSG00000196914	ENST00000397843;ENST00000356641;ENST00000532993	T;T;T	0.70282	-0.47;-0.47;-0.47	5.69	4.78	0.61160	Dbl homology (DH) domain (5);	0.000000	0.51477	D	0.000085	D	0.82577	0.5067	M	0.79123	2.44	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.998;0.999	D	0.83981	0.0332	10	0.66056	D	0.02	-17.5309	10.7839	0.46395	0.1444:0.0:0.8556:0.0	.	801;885;904	B4DGW2;Q9NZN5-2;Q9NZN5	.;.;ARHGC_HUMAN	N	904;885;801	ENSP00000380942:K904N;ENSP00000349056:K885N;ENSP00000432984:K801N	ENSP00000349056:K885N	K	+	3	2	ARHGEF12	119841254	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.679000	0.46909	1.424000	0.47217	0.650000	0.86243	AAG	.	.	.	none		0.393	ARHGEF12-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388052.1	NM_015313	
MCRS1	10445	hgsc.bcm.edu	37	12	49956786	49956786	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr12:49956786G>C	ENST00000550165.1	-	9	1069	c.803C>G	c.(802-804)aCa>aGa	p.T268R	MCRS1_ENST00000547182.1_5'UTR|MCRS1_ENST00000546244.1_Missense_Mutation_p.T77R|MCRS1_ENST00000357123.4_Missense_Mutation_p.T281R|MCRS1_ENST00000343810.4_Missense_Mutation_p.T268R			Q96EZ8	MCRS1_HUMAN	microspherule protein 1	268					cellular protein modification process (GO:0006464)|chromatin organization (GO:0006325)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|Ino80 complex (GO:0031011)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(11)	23						GGCGTTACCTGTCTGGTCCTC	0.587																																					p.T281R		Atlas-SNP	.											MCRS1,NS,carcinoma,0,1	MCRS1	40	.	0			c.C842G						PASS	.						45.0	36.0	39.0					12																	49956786		2203	4298	6501	SO:0001583	missense	10445	exon7			TTACCTGTCTGGT	BC011794	CCDS8787.1, CCDS31795.1, CCDS61118.1	12q13.12	2011-07-06				ENSG00000187778		"""INO80 complex subunits"""	6960	protein-coding gene	gene with protein product	"""INO80 complex subunit Q"""	609504				9765390, 9654073	Standard	NM_006337		Approved	ICP22BP, MSP58, P78, MCRS2, INO80Q	uc001rui.1	Q96EZ8		ENST00000550165.1:c.803C>G	chr12.hg19:g.49956786G>C	ENSP00000448056:p.Thr268Arg	19.0	0.0	.		28.0	2.0	.	NM_001012300	O14742|O75497|Q6VN53|Q7Z372	Missense_Mutation	SNP	ENST00000550165.1	hg19	CCDS8787.1	.	.	.	.	.	.	.	.	.	.	G	19.55	3.848843	0.71603	.	.	ENSG00000187778	ENST00000546244;ENST00000343810;ENST00000550165;ENST00000357123;ENST00000553173	.	.	.	5.64	5.64	0.86602	.	0.086145	0.85682	D	0.000000	T	0.66723	0.2818	L	0.47716	1.5	0.53005	D	0.999967	P;P;P	0.51351	0.944;0.642;0.887	P;B;P	0.56042	0.79;0.305;0.668	T	0.68372	-0.5426	9	0.72032	D	0.01	-8.7582	17.2003	0.86904	0.0:0.0:1.0:0.0	.	255;268;281	F8W126;Q96EZ8;Q96EZ8-2	.;MCRS1_HUMAN;.	R	77;268;268;281;255	.	ENSP00000345358:T268R	T	-	2	0	MCRS1	48243053	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.847000	0.69451	2.662000	0.90505	0.555000	0.69702	ACA	.	.	.	none		0.587	MCRS1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405102.1	NM_006337	
MON2	23041	hgsc.bcm.edu	37	12	62972277	62972277	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr12:62972277G>A	ENST00000393632.2	+	31	4958	c.4567G>A	c.(4567-4569)Gat>Aat	p.D1523N	MON2_ENST00000552738.1_Missense_Mutation_p.D1494N|MON2_ENST00000393630.3_Missense_Mutation_p.D1524N|MON2_ENST00000546600.1_Missense_Mutation_p.D1523N|MON2_ENST00000393629.2_Missense_Mutation_p.D1517N|MON2_ENST00000280379.6_Missense_Mutation_p.D1524N	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	1523					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		TGAAAATATTGATGTCGAGGT	0.284																																					p.D1523N		Atlas-SNP	.											.	MON2	160	.	0			c.G4567A						PASS	.						30.0	30.0	30.0					12																	62972277		2200	4284	6484	SO:0001583	missense	23041	exon31			AATATTGATGTCG		CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.4567G>A	chr12.hg19:g.62972277G>A	ENSP00000377252:p.Asp1523Asn	46.0	0.0	.		47.0	9.0	.	NM_015026	A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Missense_Mutation	SNP	ENST00000393632.2	hg19	CCDS31849.1	.	.	.	.	.	.	.	.	.	.	G	32	5.188128	0.94923	.	.	ENSG00000061987	ENST00000393632;ENST00000393630;ENST00000280379;ENST00000546600;ENST00000552738;ENST00000393629	T;T;T;T;T;T	0.61627	0.09;0.09;0.09;0.09;0.09;0.09	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.76506	0.3997	M	0.69823	2.125	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0	D;D;D;D;D	0.97110	0.993;0.997;0.982;0.992;1.0	T	0.74993	-0.3474	9	.	.	.	-19.6244	19.7297	0.96177	0.0:0.0:1.0:0.0	.	1517;1494;1523;392;1523	B9EGP5;F8VWA6;F8W1Z6;Q7Z3U7-3;Q7Z3U7-4	.;.;.;.;.	N	1523;1524;1524;1523;1494;1517	ENSP00000377252:D1523N;ENSP00000377250:D1524N;ENSP00000280379:D1524N;ENSP00000447407:D1523N;ENSP00000449215:D1494N;ENSP00000377249:D1517N	.	D	+	1	0	MON2	61258544	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	9.471000	0.97696	2.658000	0.90341	0.650000	0.86243	GAT	.	.	.	none		0.284	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406767.3	NM_015026	
NAP1L1	4673	hgsc.bcm.edu	37	12	76444427	76444427	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr12:76444427C>T	ENST00000261182.8	-	12	1429	c.943G>A	c.(943-945)Gat>Aat	p.D315N	NAP1L1_ENST00000544816.1_Missense_Mutation_p.D132N|NAP1L1_ENST00000393263.3_Missense_Mutation_p.D315N|NAP1L1_ENST00000547993.1_Missense_Mutation_p.D132N|NAP1L1_ENST00000542344.1_Missense_Mutation_p.D273N|NAP1L1_ENST00000549596.1_Missense_Mutation_p.D315N|NAP1L1_ENST00000535020.2_Missense_Mutation_p.D315N|NAP1L1_ENST00000548044.1_Missense_Mutation_p.D274N|NAP1L1_ENST00000431879.3_Missense_Mutation_p.D247N|NAP1L1_ENST00000552342.1_Missense_Mutation_p.D326N|NAP1L1_ENST00000547773.1_Missense_Mutation_p.D252N	NM_004537.4|NM_139207.2	NP_004528.1|NP_631946.1	P55209	NP1L1_HUMAN	nucleosome assembly protein 1-like 1	315					DNA replication (GO:0006260)|nucleosome assembly (GO:0006334)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|skin(1)	9		Colorectal(145;0.09)				GCTTCAGCATCATCATCCTAT	0.373																																					p.D315N		Atlas-SNP	.											.	NAP1L1	33	.	0			c.G943A						PASS	.						63.0	60.0	61.0					12																	76444427		2203	4300	6503	SO:0001583	missense	4673	exon12			CAGCATCATCATC		CCDS9013.1	12q21.1	2010-03-17			ENSG00000187109	ENSG00000187109			7637	protein-coding gene	gene with protein product		164060				8297347	Standard	NM_004537		Approved	NRP, NAP1, NAP1L, MGC8688, MGC23410	uc001sxx.2	P55209		ENST00000261182.8:c.943G>A	chr12.hg19:g.76444427C>T	ENSP00000261182:p.Asp315Asn	85.0	0.0	.		82.0	27.0	.	NM_004537	B3KNT8	Missense_Mutation	SNP	ENST00000261182.8	hg19	CCDS9013.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.682803	0.88542	.	.	ENSG00000187109	ENST00000261182;ENST00000552056;ENST00000393263;ENST00000431879;ENST00000547773;ENST00000544816;ENST00000542344;ENST00000535020;ENST00000549596;ENST00000547993;ENST00000552342;ENST00000548044	T;T;T;T;T;T;T;T;T;T;T;T	0.27720	1.65;1.65;1.65;1.65;1.65;1.65;1.65;1.65;1.65;1.65;1.65;1.65	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.45034	0.1322	M	0.68952	2.095	0.80722	D	1	B;B;B;B;B;B;B	0.34226	0.389;0.18;0.389;0.443;0.18;0.162;0.202	B;B;B;B;B;B;B	0.42163	0.274;0.378;0.274;0.196;0.285;0.135;0.196	T	0.40701	-0.9549	10	0.66056	D	0.02	.	19.7712	0.96366	0.0:1.0:0.0:0.0	.	315;273;326;315;247;252;315	F5H4R6;B7Z9C2;F8W0J6;B3KNT8;B3KV44;F8W543;P55209	.;.;.;.;.;.;NP1L1_HUMAN	N	315;309;315;247;252;132;273;315;315;132;326;274	ENSP00000261182:D315N;ENSP00000450236:D309N;ENSP00000376947:D315N;ENSP00000409795:D247N;ENSP00000448167:D252N;ENSP00000437507:D132N;ENSP00000444759:D273N;ENSP00000445008:D315N;ENSP00000447793:D315N;ENSP00000448007:D132N;ENSP00000447196:D326N;ENSP00000449649:D274N	ENSP00000261182:D315N	D	-	1	0	NAP1L1	74730694	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	2.677000	0.91161	0.585000	0.79938	GAT	.	.	.	none		0.373	NAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405850.3	NM_139207	
PTPN11	5781	hgsc.bcm.edu	37	12	112892458	112892458	+	Silent	SNP	T	T	C	rs78376169		TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr12:112892458T>C	ENST00000351677.2	+	5	814	c.616T>C	c.(616-618)Ttg>Ctg	p.L206L	PTPN11_ENST00000392597.1_Silent_p.L206L	NM_002834.3	NP_002825.3	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type 11	206	SH2 2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				abortive mitotic cell cycle (GO:0033277)|activation of MAPK activity (GO:0000187)|atrioventricular canal development (GO:0036302)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage checkpoint (GO:0000077)|ephrin receptor signaling pathway (GO:0048013)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|genitalia development (GO:0048806)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|multicellular organismal reproductive process (GO:0048609)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cortisol secretion (GO:0051463)|negative regulation of growth hormone secretion (GO:0060125)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ growth (GO:0035265)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of hormone secretion (GO:0046887)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of multicellular organism growth (GO:0040014)|regulation of protein export from nucleus (GO:0046825)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	insulin receptor binding (GO:0005158)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|SH3/SH2 adaptor activity (GO:0005070)	p.L206L(1)		NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(406)|kidney(2)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(3)|stomach(3)	451						GGTGGAAACATTGGGTACAGT	0.373			Mis		"""JMML, AML, MDS"""		Noonan Syndrome		Noonan syndrome																												p.L206L		Atlas-SNP	.		Dom	yes		12	12q24.1	5781	"""protein tyrosine phosphatase, non-receptor type 11"""	yes	L	PTPN11,NS,carcinoma,0,2	PTPN11	623	.	1	Substitution - coding silent(1)	stomach(1)	c.T616C						PASS	.						87.0	82.0	84.0					12																	112892458		2203	4300	6503	SO:0001819	synonymous_variant	5781	exon5	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	GAAACATTGGGTA	D13540	CCDS9163.1, CCDS58280.1	12q24.1	2014-09-17	2008-07-31		ENSG00000179295	ENSG00000179295		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9644	protein-coding gene	gene with protein product		176876	"""Noonan syndrome 1"""	NS1		7894486, 1280823	Standard	NM_080601		Approved	BPTP3, SH-PTP2, SHP-2, PTP2C, SHP2	uc001ttx.3	Q06124	OTTHUMG00000134334	ENST00000351677.2:c.616T>C	chr12.hg19:g.112892458T>C		63.0	0.0	.		63.0	3.0	.	NM_080601	A8K1D9|Q96HD7	Silent	SNP	ENST00000351677.2	hg19	CCDS9163.1																																																																																			.	.	.	weak		0.373	PTPN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259496.2		
HMGB1	3146	hgsc.bcm.edu	37	13	31036826	31036826	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr13:31036826G>A	ENST00000405805.1	-	4	1260	c.320C>T	c.(319-321)tCt>tTt	p.S107F	HMGB1_ENST00000399494.1_Missense_Mutation_p.S107F|HMGB1_ENST00000341423.5_Missense_Mutation_p.S107F|HMGB1_ENST00000468384.1_5'Flank|HMGB1_ENST00000399489.1_Missense_Mutation_p.S107F|HMGB1_ENST00000326004.4_Missense_Mutation_p.S107F|HMGB1_ENST00000339872.4_Missense_Mutation_p.S107F			P09429	HMGB1_HUMAN	high mobility group box 1	107					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|base-excision repair, DNA ligation (GO:0006288)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|dendritic cell chemotaxis (GO:0002407)|DNA ligation involved in DNA repair (GO:0051103)|DNA recombination (GO:0006310)|DNA topological change (GO:0006265)|inflammatory response to antigenic stimulus (GO:0002437)|innate immune response (GO:0045087)|myeloid dendritic cell activation (GO:0001773)|negative regulation of apoptotic cell clearance (GO:2000426)|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0017055)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron projection development (GO:0031175)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|V(D)J recombination (GO:0033151)	cell surface (GO:0009986)|condensed chromosome (GO:0000793)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chemoattractant activity (GO:0042056)|cytokine activity (GO:0005125)|damaged DNA binding (GO:0003684)|DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RAGE receptor binding (GO:0050786)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(1)|ovary(1)	8		Lung SC(185;0.0257)		all cancers(112;0.072)|OV - Ovarian serous cystadenocarcinoma(117;0.177)|Lung(94;0.216)|GBM - Glioblastoma multiforme(144;0.232)		GCGATACTCAGAGCAGAAGAG	0.393																																					p.S107F		Atlas-SNP	.											.	HMGB1	21	.	0			c.C320T						PASS	.						45.0	46.0	46.0					13																	31036826		2187	4290	6477	SO:0001583	missense	3146	exon4			TACTCAGAGCAGA	D63874	CCDS9335.1	13q12	2011-07-01	2011-04-05	2002-08-16	ENSG00000189403	ENSG00000189403		"""High-mobility group / Canonical"""	4983	protein-coding gene	gene with protein product	"""high mobility group box 1"", ""Sulfoglucuronyl carbohydrate binding protein"", ""Amphoterin"", ""high mobility group protein 1"""	163905	"""high-mobility group (nonhistone chromosomal) protein 1"", ""high-mobility group box 1"""	HMG1		8661151, 11279268	Standard	NM_002128		Approved	HMG3, SBP-1, DKFZp686A04236	uc001usx.3	P09429	OTTHUMG00000016670	ENST00000405805.1:c.320C>T	chr13.hg19:g.31036826G>A	ENSP00000384678:p.Ser107Phe	108.0	0.0	.		99.0	23.0	.	NM_002128	A5D8W9|Q14321|Q5T7C3|Q6IBE1	Missense_Mutation	SNP	ENST00000405805.1	hg19	CCDS9335.1	.	.	.	.	.	.	.	.	.	.	G	19.66	3.868452	0.72065	.	.	ENSG00000189403	ENST00000405805;ENST00000339872;ENST00000341423;ENST00000399489;ENST00000399494;ENST00000426225;ENST00000326004	D;D;D;D;D;D	0.98150	-4.75;-4.75;-4.75;-4.75;-4.75;-4.75	5.5	3.76	0.43208	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.000000	0.53938	D	0.000050	D	0.97977	0.9334	M	0.85373	2.75	0.80722	D	1	B;P;B;B	0.37176	0.099;0.586;0.314;0.204	B;P;P;B	0.49047	0.2;0.599;0.498;0.264	D	0.97456	1.0031	10	0.87932	D	0	.	10.4698	0.44629	0.0694:0.0:0.7963:0.1343	.	107;68;107;107	B7Z965;B3KQ05;P09429;Q5T7C4	.;.;HMGB1_HUMAN;.	F	107	ENSP00000384678:S107F;ENSP00000343040:S107F;ENSP00000345347:S107F;ENSP00000382412:S107F;ENSP00000382417:S107F;ENSP00000369904:S107F	ENSP00000369904:S107F	S	-	2	0	HMGB1	29934826	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	7.536000	0.82023	0.683000	0.31428	-0.148000	0.13756	TCT	.	.	.	none		0.393	HMGB1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000303998.2	NM_002128	
ELF1	1997	hgsc.bcm.edu	37	13	41515309	41515309	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr13:41515309G>A	ENST00000239882.3	-	8	1318	c.1004C>T	c.(1003-1005)cCa>cTa	p.P335L	ELF1_ENST00000498824.1_5'UTR|ELF1_ENST00000442101.1_Missense_Mutation_p.P311L	NM_172373.3	NP_758961.1	P32519	ELF1_HUMAN	E74-like factor 1 (ets domain transcription factor)	335					cell differentiation (GO:0030154)|negative regulation of T cell receptor signaling pathway (GO:0050860)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine production (GO:0001817)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37		Lung NSC(96;8.3e-05)|Prostate(109;0.0233)|Breast(139;0.0296)|Lung SC(185;0.0367)		all cancers(112;1.87e-08)|Epithelial(112;8.45e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000202)|GBM - Glioblastoma multiforme(144;0.00266)|BRCA - Breast invasive adenocarcinoma(63;0.072)		TTTTACCCCTGGACTTGAAGA	0.453																																					p.P335L		Atlas-SNP	.											.	ELF1	65	.	0			c.C1004T						PASS	.						131.0	134.0	133.0					13																	41515309		2203	4300	6503	SO:0001583	missense	1997	exon8			ACCCCTGGACTTG	M82882	CCDS9374.1	13q13	2008-07-18			ENSG00000120690	ENSG00000120690			3316	protein-coding gene	gene with protein product		189973				1545787	Standard	NM_001145353		Approved		uc001uxs.3	P32519	OTTHUMG00000016783	ENST00000239882.3:c.1004C>T	chr13.hg19:g.41515309G>A	ENSP00000239882:p.Pro335Leu	235.0	0.0	.		211.0	46.0	.	NM_172373	B4E2I5|E9PDQ9|Q8N6F6|Q9UDE1	Missense_Mutation	SNP	ENST00000239882.3	hg19	CCDS9374.1	.	.	.	.	.	.	.	.	.	.	G	14.19	2.460748	0.43736	.	.	ENSG00000120690	ENST00000442101;ENST00000379498;ENST00000239882	T;T	0.55413	0.52;0.52	5.47	5.47	0.80525	.	0.503265	0.21383	N	0.075437	T	0.43612	0.1255	L	0.29908	0.895	0.38663	D	0.952122	B;B	0.25235	0.059;0.121	B;B	0.18263	0.015;0.021	T	0.41752	-0.9491	10	0.54805	T	0.06	.	16.6683	0.85259	0.0:0.1294:0.8706:0.0	.	311;335	E9PDQ9;P32519	.;ELF1_HUMAN	L	311;77;335	ENSP00000405580:P311L;ENSP00000239882:P335L	ENSP00000239882:P335L	P	-	2	0	ELF1	40413309	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	4.056000	0.57448	2.729000	0.93468	0.655000	0.94253	CCA	.	.	.	none		0.453	ELF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044654.3	NM_172373	
GPHN	10243	hgsc.bcm.edu	37	14	67389425	67389425	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr14:67389425G>C	ENST00000315266.5	+	7	1620	c.499G>C	c.(499-501)Gac>Cac	p.D167H	GPHN_ENST00000544752.2_3'UTR|GPHN_ENST00000459628.1_Missense_Mutation_p.D149H|GPHN_ENST00000543237.1_Missense_Mutation_p.D180H|GPHN_ENST00000478722.1_Missense_Mutation_p.D167H|GPHN_ENST00000305960.9_Missense_Mutation_p.D136H	NM_001024218.1	NP_001019389.1	Q9NQX3	GEPH_HUMAN	gephyrin	167	Interaction with GABARAP. {ECO:0000250}.				establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycine receptor clustering (GO:0072579)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|molybdopterin adenylyltransferase activity (GO:0061598)|molybdopterin molybdotransferase activity (GO:0061599)|transferase activity (GO:0016740)			large_intestine(8)|liver(1)|ovary(2)|stomach(1)	12		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)		TCATGCCATTGACCTTTTACG	0.403			T	MLL	AL																																p.D167H		Atlas-SNP	.		Dom	yes		14	14q24	10243	gephyrin (GPH)		L	.	GPHN	79	.	0			c.G499C						PASS	.						187.0	164.0	172.0					14																	67389425		2203	4300	6503	SO:0001583	missense	10243	exon7			GCCATTGACCTTT	AB037806	CCDS9777.1, CCDS32103.1	14q23.3	2008-04-22			ENSG00000171723	ENSG00000171723			15465	protein-coding gene	gene with protein product		603930				1319186, 10325225, 18403029	Standard	XM_005267250		Approved	KIAA1385	uc001xix.3	Q9NQX3	OTTHUMG00000029785	ENST00000315266.5:c.499G>C	chr14.hg19:g.67389425G>C	ENSP00000312771:p.Asp167His	255.0	0.0	.		221.0	63.0	.	NM_001024218	Q9H4E9|Q9P2G2	Missense_Mutation	SNP	ENST00000315266.5	hg19	CCDS32103.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.999756	0.74818	.	.	ENSG00000171723	ENST00000315266;ENST00000478722;ENST00000459628;ENST00000543237;ENST00000305960;ENST00000555456	.	.	.	5.02	4.12	0.48240	Molybdopterin binding (2);	0.000000	0.85682	D	0.000000	T	0.52386	0.1731	N	0.08118	0	0.58432	D	0.999994	B;D;B;D;D	0.89917	0.343;1.0;0.047;0.999;0.999	B;D;B;D;D	0.91635	0.281;0.999;0.052;0.993;0.989	T	0.62946	-0.6746	9	0.87932	D	0	-6.4813	13.7767	0.63057	0.0761:0.0:0.9239:0.0	.	136;180;167;167;149	F8W7D6;F5H039;Q9NQX3;Q9NQX3-2;G3V582	.;.;GEPH_HUMAN;.;.	H	167;167;149;180;136;100	.	ENSP00000303019:D136H	D	+	1	0	GPHN	66459178	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.550000	0.98110	2.321000	0.78463	0.655000	0.94253	GAC	.	.	.	none		0.403	GPHN-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000074299.2	NM_020806	
ATG2B	55102	hgsc.bcm.edu	37	14	96761860	96761860	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr14:96761860A>T	ENST00000359933.4	-	35	6070	c.5177T>A	c.(5176-5178)cTt>cAt	p.L1726H	ATG2B_ENST00000261834.5_5'UTR	NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	1726					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		TTCTGCAGAAAGACTTGTGAA	0.308																																					p.L1726H		Atlas-SNP	.											.	ATG2B	169	.	0			c.T5177A						PASS	.						55.0	54.0	55.0					14																	96761860		2203	4290	6493	SO:0001583	missense	55102	exon35			GCAGAAAGACTTG	AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.5177T>A	chr14.hg19:g.96761860A>T	ENSP00000353010:p.Leu1726His	134.0	0.0	.		112.0	36.0	.	NM_018036	Q6ZRE7|Q96DQ3|Q9NW80	Missense_Mutation	SNP	ENST00000359933.4	hg19	CCDS9944.2	.	.	.	.	.	.	.	.	.	.	A	26.0	4.697600	0.88830	.	.	ENSG00000066739	ENST00000359933	T	0.13657	2.57	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.40886	0.1135	M	0.80332	2.49	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.31613	-0.9937	10	0.54805	T	0.06	.	15.8864	0.79251	1.0:0.0:0.0:0.0	.	1726	Q96BY7	ATG2B_HUMAN	H	1726	ENSP00000353010:L1726H	ENSP00000261834:L370H	L	-	2	0	ATG2B	95831613	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.539000	0.90637	2.223000	0.72356	0.454000	0.30748	CTT	.	.	.	none		0.308	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314037.1	NM_018036	
ITGAX	3687	hgsc.bcm.edu	37	16	31371300	31371300	+	Silent	SNP	G	G	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr16:31371300G>A	ENST00000268296.4	+	7	742	c.621G>A	c.(619-621)agG>agA	p.R207R	ITGAX_ENST00000562522.1_Silent_p.R207R	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	207	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						AGGAATTCAGGCGCAGCTCAA	0.522																																					p.R207R		Atlas-SNP	.											.	ITGAX	198	.	0			c.G621A						PASS	.						103.0	105.0	104.0					16																	31371300		2197	4300	6497	SO:0001819	synonymous_variant	3687	exon7			ATTCAGGCGCAGC	BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.621G>A	chr16.hg19:g.31371300G>A		136.0	0.0	.		223.0	108.0	.	NM_000887	Q8IVA6	Silent	SNP	ENST00000268296.4	hg19	CCDS10711.1																																																																																			.	.	.	none		0.522	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255628.2	NM_000887	
SLC13A5	284111	hgsc.bcm.edu	37	17	6606332	6606332	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr17:6606332T>G	ENST00000433363.2	-	5	906	c.673A>C	c.(673-675)Acc>Ccc	p.T225P	SLC13A5_ENST00000381074.4_Missense_Mutation_p.T182P|SLC13A5_ENST00000293800.6_Missense_Mutation_p.T208P|SLC13A5_ENST00000573648.1_Missense_Mutation_p.T225P	NM_001284510.1|NM_177550.3	NP_001271439.1|NP_808218.1	Q86YT5	S13A5_HUMAN	solute carrier family 13 (sodium-dependent citrate transporter), member 5	225					transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	citrate transmembrane transporter activity (GO:0015137)|sodium:dicarboxylate symporter activity (GO:0017153)|succinate transmembrane transporter activity (GO:0015141)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|prostate(5)|skin(3)|urinary_tract(1)	26						CCCGTCCCGGTCAGGGTGGCG	0.642																																					p.T225P		Atlas-SNP	.											.	SLC13A5	57	.	0			c.A673C						PASS	.						117.0	98.0	105.0					17																	6606332		2203	4300	6503	SO:0001583	missense	284111	exon5			TCCCGGTCAGGGT	AJ489980	CCDS11079.1, CCDS45593.1, CCDS67136.1, CCDS67137.1	17p13.1	2013-05-22			ENSG00000141485	ENSG00000141485		"""Solute carriers"""	23089	protein-coding gene	gene with protein product		608305				12445824	Standard	NM_001284510		Approved	NACT	uc002gdj.3	Q86YT5	OTTHUMG00000102052	ENST00000433363.2:c.673A>C	chr17.hg19:g.6606332T>G	ENSP00000406220:p.Thr225Pro	123.0	0.0	.		141.0	39.0	.	NM_001143838	B3KXR0|B7Z4P2|B7ZLB4|F8W7N2|Q6ZMG1	Missense_Mutation	SNP	ENST00000433363.2	hg19	CCDS11079.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.384652	0.82792	.	.	ENSG00000141485	ENST00000293800;ENST00000433363;ENST00000381074	T;T	0.11169	2.8;2.8	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.40473	0.1118	M	0.89715	3.055	0.80722	D	1	D;D;D;D;D	0.89917	0.998;0.996;0.994;0.994;1.0	D;D;D;D;D	0.97110	0.967;0.945;0.967;0.967;1.0	T	0.48364	-0.9042	10	0.87932	D	0	.	13.806	0.63233	0.0:0.0:0.0:1.0	.	225;182;182;208;225	B7ZLB4;F8W7N2;B7Z4P2;B3KXR0;Q86YT5	.;.;.;.;S13A5_HUMAN	P	225;225;182	ENSP00000406220:T225P;ENSP00000370464:T182P	ENSP00000293800:T225P	T	-	1	0	SLC13A5	6547056	1.000000	0.71417	0.991000	0.47740	0.674000	0.39518	5.844000	0.69430	2.216000	0.71823	0.459000	0.35465	ACC	.	.	.	none		0.642	SLC13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219853.2	NM_177550	
PIK3R5	23533	hgsc.bcm.edu	37	17	8812455	8812455	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr17:8812455A>G	ENST00000447110.1	-	3	264	c.140T>C	c.(139-141)cTg>cCg	p.L47P	PIK3R5_ENST00000581552.1_Missense_Mutation_p.L47P|PIK3R5_ENST00000584803.1_Missense_Mutation_p.L47P	NM_001142633.2|NM_001251851.1|NM_001251852.1|NM_001251853.1|NM_001251855.1	NP_001136105.1|NP_001238780.1|NP_001238781.1|NP_001238782.1|NP_001238784.1	Q8WYR1	PI3R5_HUMAN	phosphoinositide-3-kinase, regulatory subunit 5	47	Heterodimerization. {ECO:0000250}.			L -> Q (in Ref. 6; AAW63122). {ECO:0000305}.	blood coagulation (GO:0007596)|cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|small molecule metabolic process (GO:0044281)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|G-protein beta/gamma-subunit complex binding (GO:0031683)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(14)|prostate(3)|skin(4)|urinary_tract(1)	34						CCTGCTGACCAGCTCCTGCAG	0.597																																					p.L47P	NSCLC(18;589 615 7696 20311 50332)	Atlas-SNP	.											.	PIK3R5	79	.	0			c.T140C						PASS	.						29.0	25.0	27.0					17																	8812455		2203	4300	6503	SO:0001583	missense	23533	exon3			CTGACCAGCTCCT	AF128881	CCDS11147.1, CCDS73986.1	17p13.1	2011-10-13	2008-02-04		ENSG00000141506	ENSG00000141506			30035	protein-coding gene	gene with protein product		611317				12507995	Standard	NM_014308		Approved	P101-PI3K, p101	uc002glt.3	Q8WYR1	OTTHUMG00000108197	ENST00000447110.1:c.140T>C	chr17.hg19:g.8812455A>G	ENSP00000392812:p.Leu47Pro	36.0	0.0	.		26.0	4.0	.	NM_001142633	B0LPH4|D3DTS3|Q5G936|Q5G938|Q5G939|Q8IZ23|Q9Y2Y2	Missense_Mutation	SNP	ENST00000447110.1	hg19	CCDS11147.1	.	.	.	.	.	.	.	.	.	.	A	14.09	2.433132	0.43224	.	.	ENSG00000141506	ENST00000269300;ENST00000447110	T;T	0.80123	-1.34;-1.34	5.22	5.22	0.72569	.	0.076071	0.53938	D	0.000052	D	0.83459	0.5259	L	0.29908	0.895	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	D	0.85017	0.0909	10	0.59425	D	0.04	-7.8781	13.6276	0.62176	1.0:0.0:0.0:0.0	.	47	Q8WYR1	PI3R5_HUMAN	P	47	ENSP00000269300:L47P;ENSP00000392812:L47P	ENSP00000269300:L47P	L	-	2	0	PIK3R5	8753180	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.181000	0.77682	2.100000	0.63781	0.528000	0.53228	CTG	.	.	.	none		0.597	PIK3R5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000227003.2	NM_014308	
KIAA0100	9703	hgsc.bcm.edu	37	17	26948415	26948415	+	Splice_Site	SNP	A	A	G			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr17:26948415A>G	ENST00000528896.2	-	27	5134		c.e27+1		KIAA0100_ENST00000579924.2_5'Flank|KIAA0100_ENST00000389003.3_Splice_Site|KIAA0100_ENST00000544884.1_Splice_Site	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100							extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					GGGAGGGCTGACCTGTGGTTG	0.542																																					.		Atlas-SNP	.											.	KIAA0100	175	.	0			c.5059+2T>C						PASS	.						113.0	103.0	106.0					17																	26948415		2203	4300	6503	SO:0001630	splice_region_variant	9703	exon28			GGGCTGACCTGTG	D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.5059+1T>C	chr17.hg19:g.26948415A>G		252.0	0.0	.		283.0	62.0	.	NM_014680	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Splice_Site	SNP	ENST00000528896.2	hg19	CCDS32595.1	.	.	.	.	.	.	.	.	.	.	A	19.19	3.779355	0.70107	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896;ENST00000544884	.	.	.	5.5	5.5	0.81552	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4732	0.67531	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KIAA0100	23972542	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	8.702000	0.91338	2.211000	0.71520	0.402000	0.26972	.	.	.	.	none		0.542	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	NM_014680	Intron
HID1	283987	hgsc.bcm.edu	37	17	72954436	72954436	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr17:72954436C>G	ENST00000425042.2	-	11	1455	c.1378G>C	c.(1378-1380)Gac>Cac	p.D460H		NM_030630.2	NP_085133.1	Q8IV36	HID1_HUMAN	HID1 domain containing	460					intracellular protein transport (GO:0006886)|response to brefeldin A (GO:0031001)	cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|extracellular vesicular exosome (GO:0070062)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi medial cisterna (GO:0005797)|Golgi trans cisterna (GO:0000138)											ATGAGCAGGTCGGCGTGGGTC	0.667											OREG0024721	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D460H		Atlas-SNP	.											.	.	.	.	0			c.G1378C						PASS	.						55.0	43.0	47.0					17																	72954436		2203	4300	6503	SO:0001583	missense	283987	exon11			GCAGGTCGGCGTG		CCDS32726.1	17q25.1	2012-10-10	2012-10-10	2012-10-10	ENSG00000167861	ENSG00000167861			15736	protein-coding gene	gene with protein product	"""downregulated in multiple cancer 1"""	605752	"""chromosome 17 open reading frame 28"""	C17orf28		11281419, 21337012	Standard	NM_030630		Approved	DMC1, HID-1	uc002jmj.4	Q8IV36	OTTHUMG00000166490	ENST00000425042.2:c.1378G>C	chr17.hg19:g.72954436C>G	ENSP00000413520:p.Asp460His	28.0	0.0	.	1141	48.0	5.0	.	NM_030630	Q8N5L6|Q8TE83|Q9NT34	Missense_Mutation	SNP	ENST00000425042.2	hg19	CCDS32726.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.918325	0.92249	.	.	ENSG00000167861	ENST00000525426;ENST00000425042;ENST00000318565	.	.	.	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	D	0.86732	0.6003	M	0.93978	3.48	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90618	0.4557	9	0.87932	D	0	-29.5566	18.1326	0.89606	0.0:1.0:0.0:0.0	.	460	Q8IV36	CQ028_HUMAN	H	232;460;232	.	ENSP00000317795:D232H	D	-	1	0	C17orf28	70466031	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	7.550000	0.82173	2.284000	0.76573	0.561000	0.74099	GAC	.	.	.	none		0.667	HID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390011.2	NM_030630	
ITGB4	3691	hgsc.bcm.edu	37	17	73752809	73752809	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr17:73752809C>T	ENST00000200181.3	+	37	5109	c.4922C>T	c.(4921-4923)cCc>cTc	p.P1641L	ITGB4_ENST00000449880.2_Missense_Mutation_p.P1624L|ITGB4_ENST00000579662.1_Missense_Mutation_p.P1571L|ITGB4_ENST00000339591.3_Missense_Mutation_p.P1624L|GALK1_ENST00000225614.2_Intron|ITGB4_ENST00000450894.3_Missense_Mutation_p.P1571L	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	1641					amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			TTGAGCACTCCCAGTGCCCCA	0.667																																					p.P1641L		Atlas-SNP	.											.	ITGB4	165	.	0			c.C4922T						PASS	.						53.0	55.0	54.0					17																	73752809		2203	4299	6502	SO:0001583	missense	3691	exon37			GCACTCCCAGTGC		CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.4922C>T	chr17.hg19:g.73752809C>T	ENSP00000200181:p.Pro1641Leu	112.0	0.0	.		124.0	29.0	.	NM_000213	A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Missense_Mutation	SNP	ENST00000200181.3	hg19	CCDS11727.1	.	.	.	.	.	.	.	.	.	.	C	14.80	2.644502	0.47258	.	.	ENSG00000132470	ENST00000200181;ENST00000339591;ENST00000449880	T;T;T	0.61627	0.09;0.09;0.09	5.04	5.04	0.67666	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.82802	0.5116	M	0.93978	3.48	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.87598	0.2495	10	0.87932	D	0	.	18.7536	0.91823	0.0:1.0:0.0:0.0	.	1624;1571;1641	P16144-3;A0AVL6;P16144	.;.;ITB4_HUMAN	L	1641;1624;1624	ENSP00000200181:P1641L;ENSP00000344079:P1624L;ENSP00000400217:P1624L	ENSP00000200181:P1641L	P	+	2	0	ITGB4	71264404	1.000000	0.71417	1.000000	0.80357	0.543000	0.35085	7.776000	0.85560	2.518000	0.84900	0.462000	0.41574	CCC	.	.	.	none		0.667	ITGB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448334.1		
GADD45B	4616	hgsc.bcm.edu	37	19	2477582	2477582	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr19:2477582T>A	ENST00000215631.4	+	4	698	c.466T>A	c.(466-468)Tct>Act	p.S156T		NM_015675.3	NP_056490.2	O75293	GA45B_HUMAN	growth arrest and DNA-damage-inducible, beta	156					activation of MAPKK activity (GO:0000186)|activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of cell cycle (GO:0051726)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|lung(1)|ovary(1)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCCTACATCTCTCTTCAGGA	0.552																																					p.S156T		Atlas-SNP	.											.	GADD45B	6	.	0			c.T466A						PASS	.						39.0	40.0	40.0					19																	2477582		2203	4300	6503	SO:0001583	missense	4616	exon4			TACATCTCTCTTC	AF090950	CCDS32868.1	19p13.3	2012-10-02			ENSG00000099860	ENSG00000099860			4096	protein-coding gene	gene with protein product	"""myeloid differentiation primary response"", ""growth arrest and DNA-damage-inducible beta"""	604948		MYD118		1899477, 9827804	Standard	NM_015675		Approved	GADD45BETA, DKFZP566B133	uc002lwb.2	O75293	OTTHUMG00000180434	ENST00000215631.4:c.466T>A	chr19.hg19:g.2477582T>A	ENSP00000215631:p.Ser156Thr	27.0	0.0	.		39.0	13.0	.	NM_015675	A8KAM2|O75960|Q17R46	Missense_Mutation	SNP	ENST00000215631.4	hg19	CCDS32868.1	.	.	.	.	.	.	.	.	.	.	T	2.003	-0.428988	0.04701	.	.	ENSG00000099860	ENST00000215631	T	0.40756	1.02	4.66	-0.362	0.12560	.	0.260085	0.37012	N	0.002300	T	0.15522	0.0374	N	0.24115	0.695	0.58432	D	0.999999	B	0.29716	0.255	B	0.21917	0.037	T	0.29971	-0.9994	10	0.02654	T	1	.	1.0667	0.01612	0.1464:0.2718:0.1505:0.4313	.	156	O75293	GA45B_HUMAN	T	156	ENSP00000215631:S156T	ENSP00000215631:S156T	S	+	1	0	GADD45B	2428582	0.000000	0.05858	0.307000	0.25127	0.709000	0.40893	-1.720000	0.01871	-0.128000	0.11641	0.443000	0.29094	TCT	.	.	.	none		0.552	GADD45B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451337.1	NM_015675	
S1PR4	8698	hgsc.bcm.edu	37	19	3179456	3179456	+	Silent	SNP	C	C	T			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr19:3179456C>T	ENST00000246115.3	+	1	721	c.666C>T	c.(664-666)ctC>ctT	p.L222L	S1PR4_ENST00000591346.1_3'UTR	NM_003775.3	NP_003766.1	O95977	S1PR4_HUMAN	sphingosine-1-phosphate receptor 4	222					activation of phospholipase C activity (GO:0007202)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)|sphingosine-1-phosphate receptor activity (GO:0038036)			breast(1)|kidney(2)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	13						TCATGGGCCTCTATGGGGCCA	0.672																																					p.L222L	GBM(82;318 1638 33279 49708)	Atlas-SNP	.											.	S1PR4	31	.	0			c.C666T						PASS	.						86.0	93.0	91.0					19																	3179456		2203	4300	6503	SO:0001819	synonymous_variant	8698	exon1			GGGCCTCTATGGG	AJ000479	CCDS12105.1	19p13.3	2012-08-08	2008-04-30	2008-04-30		ENSG00000125910		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	3170	protein-coding gene	gene with protein product		603751	"""endothelial differentiation, G-protein-coupled receptor 6"", ""endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 6"""	EDG6		9790765	Standard	NM_003775		Approved		uc002lxg.3	O95977		ENST00000246115.3:c.666C>T	chr19.hg19:g.3179456C>T		245.0	0.0	.		263.0	85.0	.	NM_003775	D6W612	Silent	SNP	ENST00000246115.3	hg19	CCDS12105.1																																																																																			.	.	.	none		0.672	S1PR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452517.1	NM_003775	
ZFP14	57677	hgsc.bcm.edu	37	19	36831480	36831481	+	Missense_Mutation	DNP	GC	GC	AT			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr19:36831480_36831481GC>AT	ENST00000270001.7	-	5	1362_1363	c.1247_1248GC>AT	c.(1246-1248)aGC>aAT	p.S416N		NM_020917.2	NP_065968.1	Q9HCL3	ZFP14_HUMAN	ZFP14 zinc finger protein	416					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	26	Esophageal squamous(110;0.162)					CAATATGAATGCTCTGGTGTGA	0.416																																					p.S416S|p.S416N		Atlas-SNP	.											.	ZFP14	68	.	0			c.C1248T|c.G1247A						PASS	.																																			SO:0001583	missense	57677	exon5			ATGAATGCTCTGG|TGAATGCTCTGGT	AB046779	CCDS33002.1	19q13.13	2013-01-08	2012-11-27			ENSG00000142065		"""Zinc fingers, C2H2-type"", ""-"""	29312	protein-coding gene	gene with protein product			"""zinc finger protein 14 homolog (mouse)"""			10997877	Standard	NM_020917		Approved	KIAA1559, ZNF531	uc010eex.2	Q9HCL3		ENST00000270001.7:c.1247_1248delinsAT	chr19.hg19:g.36831480_36831481delinsAT	ENSP00000270001:p.Ser416Asn	142.0	0.0	.		163.0|164.0	53.0	.	NM_020917	A7MD23	Silent|Missense_Mutation	SNP	ENST00000270001.7	hg19	CCDS33002.1																																																																																			.	.	.	none		0.416	ZFP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452528.1	NM_020917	
BCAM	4059	hgsc.bcm.edu	37	19	45322968	45322968	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr19:45322968G>T	ENST00000270233.6	+	13	1770	c.1748G>T	c.(1747-1749)cGg>cTg	p.R583L	BCAM_ENST00000589651.1_Missense_Mutation_p.R583L	NM_001013257.2|NM_005581.4	NP_001013275.1|NP_005572.2	P50895	BCAM_HUMAN	basal cell adhesion molecule (Lutheran blood group)	583					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	laminin binding (GO:0043236)|laminin receptor activity (GO:0005055)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)				CGCCAGCGGCGGGAGAAGGGG	0.637																																					p.R583L		Atlas-SNP	.											BCAM,middle_lobe,carcinoma,0,1	BCAM	53	.	0			c.G1748T						PASS	.						14.0	17.0	16.0					19																	45322968		2183	4244	6427	SO:0001583	missense	4059	exon13			AGCGGCGGGAGAA	X83425	CCDS12644.1, CCDS42575.1	19q12-q13	2014-07-18	2006-02-23	2006-01-12		ENSG00000187244		"""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6722	protein-coding gene	gene with protein product		612773	"""Lutheran blood group (Auberger b antigen included)"", ""basal cell adhesion molecule (Lu and Au blood groups)"""	LU			Standard	NM_005581		Approved	CD239	uc002ozu.4	P50895		ENST00000270233.6:c.1748G>T	chr19.hg19:g.45322968G>T	ENSP00000270233:p.Arg583Leu	42.0	0.0	.		39.0	18.0	.	NM_001013257	A8MYF9|A9YWT5|A9YWT6|Q86VC7	Missense_Mutation	SNP	ENST00000270233.6	hg19	CCDS12644.1	.	.	.	.	.	.	.	.	.	.	.	4.697	0.129623	0.08981	.	.	ENSG00000187244	ENST00000270233;ENST00000391955	T;T	0.59772	0.24;0.34	4.08	1.68	0.24146	.	.	.	.	.	T	0.33904	0.0879	N	0.08118	0	0.09310	N	1	B	0.24092	0.097	B	0.15870	0.014	T	0.15521	-1.0434	9	0.30078	T	0.28	-5.8905	10.1318	0.42682	0.0:0.4182:0.5817:0.0	.	583	P50895	BCAM_HUMAN	L	583	ENSP00000270233:R583L;ENSP00000375817:R583L	ENSP00000270233:R583L	R	+	2	0	BCAM	50014808	0.003000	0.15002	0.037000	0.18230	0.042000	0.13812	1.344000	0.33941	0.242000	0.21303	0.531000	0.56144	CGG	.	.	.	none		0.637	BCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453220.1	NM_005581	
HRC	3270	hgsc.bcm.edu	37	19	49657763	49657763	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr19:49657763T>A	ENST00000252825.4	-	1	918	c.732A>T	c.(730-732)gaA>gaT	p.E244D	HRC_ENST00000595625.1_Missense_Mutation_p.E244D	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	244	4 X tandem repeats, acidic.|6 X approximate tandem repeats.				cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)	p.E244E(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		cgtcatcttcttcatGGCCTT	0.522																																					p.E244D	Melanoma(37;75 1097 24567 25669 30645)	Atlas-SNP	.											HRC,NS,carcinoma,0,1	HRC	85	.	1	Substitution - coding silent(1)	lung(1)	c.A732T						PASS	.						118.0	85.0	96.0					19																	49657763		2203	4300	6503	SO:0001583	missense	3270	exon1			ATCTTCTTCATGG		CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.732A>T	chr19.hg19:g.49657763T>A	ENSP00000252825:p.Glu244Asp	30.0	1.0	.		33.0	2.0	.	NM_002152	Q504Y6	Missense_Mutation	SNP	ENST00000252825.4	hg19	CCDS12759.1	.	.	.	.	.	.	.	.	.	.	t	8.405	0.842850	0.16963	.	.	ENSG00000130528	ENST00000252825;ENST00000434964	T	0.06294	3.32	3.24	2.17	0.27698	.	.	.	.	.	T	0.07593	0.0191	L	0.57536	1.79	0.09310	N	0.999998	B	0.28820	0.224	B	0.33846	0.171	T	0.37641	-0.9697	9	0.13853	T	0.58	0.3786	7.0233	0.24926	0.0:0.1288:0.0:0.8712	.	244	P23327	SRCH_HUMAN	D	244;214	ENSP00000252825:E244D	ENSP00000252825:E244D	E	-	3	2	HRC	54349575	0.001000	0.12720	0.040000	0.18447	0.049000	0.14656	0.298000	0.19120	1.251000	0.43983	0.375000	0.23000	GAA	.	.	.	none		0.522	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465649.1	NM_002152	
PTPRA	5786	hgsc.bcm.edu	37	20	3016279	3016279	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr20:3016279G>T	ENST00000216877.6	+	20	2342	c.1942G>T	c.(1942-1944)Gat>Tat	p.D648Y	PTPRA_ENST00000399903.2_Missense_Mutation_p.D657Y|PTPRA_ENST00000318266.5_Missense_Mutation_p.D648Y|PTPRA_ENST00000356147.3_Missense_Mutation_p.D648Y|PTPRA_ENST00000380393.3_Missense_Mutation_p.D657Y|PTPRA_ENST00000425918.2_Missense_Mutation_p.D668Y|PTPRA_ENST00000358719.4_Missense_Mutation_p.D513Y	NM_080840.2	NP_543030.1	P18433	PTPRA_HUMAN	protein tyrosine phosphatase, receptor type, A	657	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axon guidance (GO:0007411)|insulin receptor signaling pathway (GO:0008286)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein phosphorylation (GO:0006468)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						GTCCTATGGAGATATTACAGT	0.532																																					p.D657Y		Atlas-SNP	.											.	PTPRA	75	.	0			c.G1969T						PASS	.						106.0	94.0	98.0					20																	3016279		2203	4300	6503	SO:0001583	missense	5786	exon25			TATGGAGATATTA		CCDS13038.1, CCDS13039.1	20p13	2011-06-09			ENSG00000132670	ENSG00000132670		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9664	protein-coding gene	gene with protein product		176884		PTPRL2, PTPA		2172030, 2169617	Standard	NM_080840		Approved	LRP, HLPR, HPTPA, RPTPA	uc002whn.3	P18433	OTTHUMG00000031718	ENST00000216877.6:c.1942G>T	chr20.hg19:g.3016279G>T	ENSP00000216877:p.Asp648Tyr	40.0	0.0	.		26.0	12.0	.	NM_002836	A8K2G8|D3DVX5|Q14513|Q7Z2I2|Q96TD9	Missense_Mutation	SNP	ENST00000216877.6	hg19	CCDS13039.1	.	.	.	.	.	.	.	.	.	.	G	12.18	1.860550	0.32884	.	.	ENSG00000132670	ENST00000380393;ENST00000216877;ENST00000399903;ENST00000358719;ENST00000542217;ENST00000425918;ENST00000318266;ENST00000356147	D;D;D;D;D;D;D	0.84516	-1.86;-1.86;-1.86;-1.86;-1.86;-1.86;-1.86	5.57	5.57	0.84162	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.85682	U	0.000000	D	0.90597	0.7052	M	0.72353	2.195	0.80722	D	1	P;D;D	0.89917	0.49;1.0;1.0	B;D;D	0.91635	0.143;0.999;0.963	D	0.85912	0.1441	10	0.02654	T	1	.	19.5578	0.95358	0.0:0.0:1.0:0.0	.	668;657;648	B7Z2A4;P18433;P18433-4	.;PTPRA_HUMAN;.	Y	657;648;657;513;267;668;648;648	ENSP00000369756:D657Y;ENSP00000216877:D648Y;ENSP00000382787:D657Y;ENSP00000351559:D513Y;ENSP00000393553:D668Y;ENSP00000314568:D648Y;ENSP00000348468:D648Y	ENSP00000216877:D648Y	D	+	1	0	PTPRA	2964279	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	9.869000	0.99810	2.604000	0.88044	0.563000	0.77884	GAT	.	.	.	none		0.532	PTPRA-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077682.3		
PARD6B	84612	hgsc.bcm.edu	37	20	49366607	49366607	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr20:49366607T>C	ENST00000371610.2	+	3	944	c.701T>C	c.(700-702)aTg>aCg	p.M234T	PARD6B_ENST00000396039.1_Intron	NM_032521.2	NP_115910.1	Q9BYG5	PAR6B_HUMAN	par-6 family cell polarity regulator beta	234	Interaction with PARD3 and CDC42. {ECO:0000250}.|PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell junction assembly (GO:0034329)|cell-cell junction assembly (GO:0007043)|cell-cell junction organization (GO:0045216)|establishment or maintenance of cell polarity (GO:0007163)|protein complex assembly (GO:0006461)|regulation of cell migration (GO:0030334)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				NS(1)|breast(1)|endometrium(1)|kidney(4)|lung(3)|urinary_tract(1)	11						GTAACAGACATGATGATTGCA	0.433																																					p.M234T		Atlas-SNP	.											.	PARD6B	31	.	0			c.T701C						PASS	.						124.0	117.0	120.0					20																	49366607		2203	4300	6503	SO:0001583	missense	84612	exon3			CAGACATGATGAT	AB044555	CCDS33485.1	20q13.13	2013-08-28	2013-08-28		ENSG00000124171	ENSG00000124171			16245	protein-coding gene	gene with protein product		608975	"""par-6 (partitioning defective 6, C.elegans) homolog beta"", ""par-6 partitioning defective 6 homolog beta (C. elegans)"""			11260256	Standard	NM_032521		Approved	PAR-6B	uc002xvo.3	Q9BYG5	OTTHUMG00000032732	ENST00000371610.2:c.701T>C	chr20.hg19:g.49366607T>C	ENSP00000360672:p.Met234Thr	153.0	0.0	.		156.0	52.0	.	NM_032521	A2A2A7|Q9Y510	Missense_Mutation	SNP	ENST00000371610.2	hg19	CCDS33485.1	.	.	.	.	.	.	.	.	.	.	T	18.60	3.659758	0.67586	.	.	ENSG00000124171	ENST00000371610	T	0.27402	1.67	6.02	6.02	0.97574	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.54727	0.1876	M	0.63169	1.94	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.56456	-0.7976	10	0.87932	D	0	-60.5095	16.5446	0.84426	0.0:0.0:0.0:1.0	.	234	Q9BYG5	PAR6B_HUMAN	T	234	ENSP00000360672:M234T	ENSP00000360672:M234T	M	+	2	0	PARD6B	48800014	1.000000	0.71417	1.000000	0.80357	0.638000	0.38207	5.917000	0.69989	2.311000	0.77944	0.533000	0.62120	ATG	.	.	.	none		0.433	PARD6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079697.2	NM_032521	
EMID1	129080	hgsc.bcm.edu	37	22	29627008	29627008	+	Splice_Site	SNP	G	G	T			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr22:29627008G>T	ENST00000404820.3	+	6	592		c.e6-1		EMID1_ENST00000404755.3_Splice_Site|EMID1_ENST00000334018.6_Splice_Site|EMID1_ENST00000484039.1_Splice_Site			Q96A84	EMID1_HUMAN	EMI domain containing 1							collagen trimer (GO:0005581)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(2)|skin(3)	12						TTCCTCTTCAGATGACCATGC	0.587																																					.		Atlas-SNP	.											.	EMID1	33	.	0			c.466-1G>T						PASS	.						68.0	65.0	66.0					22																	29627008		2203	4300	6503	SO:0001630	splice_region_variant	129080	exon6			TCTTCAGATGACC	AJ416090	CCDS33630.1	22q12.2	2009-08-04			ENSG00000186998	ENSG00000186998		"""EMI domain containing"""	18036	protein-coding gene	gene with protein product	"""emilin and multimerin-domain containing protein 1"", ""putative emu1"""	608926				12221002	Standard	NM_001267895		Approved	EMU1, hEmu1, EMI5	uc003aem.4	Q96A84	OTTHUMG00000151013	ENST00000404820.3:c.466-1G>T	chr22.hg19:g.29627008G>T		85.0	0.0	.		103.0	27.0	.	NM_133455	B0QYK6|Q6ICG1|Q86SS7	Splice_Site	SNP	ENST00000404820.3	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.15|10.15	1.270790|1.270790	0.23221|0.23221	.|.	.|.	ENSG00000186998|ENSG00000186998	ENST00000334018;ENST00000429226;ENST00000404755;ENST00000404820;ENST00000430127|ENST00000433143	.|.	.|.	.|.	4.64|4.64	4.64|4.64	0.57946|0.57946	.|.	.|.	.|.	.|.	.|.	.|T	.|0.64735	.|0.2625	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.63537	.|-0.6615	.|4	.|.	.|.	.|.	.|.	13.3293|13.3293	0.60477|0.60477	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	.|I	-1|1	.|.	.|.	.|R	+|+	.|2	.|0	EMID1|EMID1	27957008|27957008	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.024000|0.024000	0.10985|0.10985	4.969000|4.969000	0.63735|0.63735	2.293000|2.293000	0.77203|0.77203	0.591000|0.591000	0.81541|0.81541	.|AGA	.	.	.	none		0.587	EMID1-002	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000321075.1	NM_133455	Intron
SBF1	6305	hgsc.bcm.edu	37	22	50885659	50885659	+	Missense_Mutation	SNP	G	G	C	rs375012426	byFrequency	TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr22:50885659G>C	ENST00000390679.3	-	40	5700	c.5516C>G	c.(5515-5517)aCg>aGg	p.T1839R	SBF1_ENST00000380817.3_Missense_Mutation_p.T1865R|SBF1_ENST00000348911.6_Missense_Mutation_p.T1840R			O95248	MTMR5_HUMAN	SET binding factor 1	1839	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cell death (GO:0008219)|positive regulation of Rab GTPase activity (GO:0032851)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(8)|large_intestine(3)|lung(18)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	43		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		AACGCGACGCGTTGTCTTCAC	0.667																																					p.T1865R		Atlas-SNP	.											.	SBF1	211	.	0			c.C5594G						PASS	.						48.0	59.0	55.0					22																	50885659		2096	4202	6298	SO:0001583	missense	6305	exon41			CGACGCGTTGTCT	U93181	CCDS14091.1, CCDS14091.2	22q13.33	2013-01-10			ENSG00000100241	ENSG00000100241		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	10542	protein-coding gene	gene with protein product	"""myotubularin related 5"", ""DENN/MADD domain containing 7A"""	603560				9537414, 9736772	Standard	NM_002972		Approved	MTMR5, DENND7A	uc003blh.3	O95248	OTTHUMG00000150204	ENST00000390679.3:c.5516C>G	chr22.hg19:g.50885659G>C	ENSP00000375097:p.Thr1839Arg	53.0	0.0	.		56.0	13.0	.	NM_002972	A6PVG9|O60228|Q5JXD8|Q5PPM2|Q96GR9|Q9UGB8	Missense_Mutation	SNP	ENST00000390679.3	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.51|17.51	3.408090|3.408090	0.62399|0.62399	.|.	.|.	ENSG00000100241|ENSG00000100241	ENST00000418590|ENST00000380817;ENST00000348911;ENST00000337034;ENST00000390679	.|T;T;T	.|0.12255	.|2.7;2.7;2.7	3.51|3.51	3.51|3.51	0.40186|0.40186	.|Pleckstrin homology-type (1);Pleckstrin homology domain (3);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.26448|0.26448	0.0646|0.0646	L|L	0.31845|0.31845	0.965|0.965	0.58432|0.58432	D|D	0.999997|0.999997	.|D;D;D	.|0.89917	.|0.959;1.0;0.979	.|P;D;D	.|0.91635	.|0.85;0.999;0.913	T|T	0.06058|0.06058	-1.0848|-1.0848	5|10	.|0.66056	.|D	.|0.02	.|.	15.1872|15.1872	0.73012|0.73012	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1839;1865;386	.|O95248;O95248-4;A6PVG7	.|MTMR5_HUMAN;.;.	K|R	386|1865;1840;1875;1839	.|ENSP00000370196:T1865R;ENSP00000252027:T1840R;ENSP00000375097:T1839R	.|ENSP00000336522:T1875R	N|T	-|-	3|2	2|0	SBF1|SBF1	49232525|49232525	0.998000|0.998000	0.40836|0.40836	0.998000|0.998000	0.56505|0.56505	0.777000|0.777000	0.43975|0.43975	2.406000|2.406000	0.44557|0.44557	1.989000|1.989000	0.58080|0.58080	0.462000|0.462000	0.41574|0.41574	AAC|ACG	.	.	.	alt		0.667	SBF1-201	KNOWN	basic	protein_coding	protein_coding			
EIF2S3	1968	hgsc.bcm.edu	37	X	24089815	24089815	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chrX:24089815C>T	ENST00000253039.4	+	10	1406	c.1153C>T	c.(1153-1155)Cgc>Tgc	p.R385C		NM_001415.3	NP_001406.1	P41091	IF2G_HUMAN	eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa	385					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(1)|cervix(1)|endometrium(4)|large_intestine(1)|lung(4)|ovary(1)	12						TCTAGGTGTACGCACTGAAGG	0.403																																					p.R385C		Atlas-SNP	.											.	EIF2S3	31	.	0			c.C1153T						PASS	.						37.0	37.0	37.0					X																	24089815		2203	4298	6501	SO:0001583	missense	1968	exon10			GGTGTACGCACTG	L19161	CCDS14210.1	Xp22.2-p22.1	2008-07-31	2002-08-29		ENSG00000130741	ENSG00000130741			3267	protein-coding gene	gene with protein product	"""eukaryotic translation initiation factor 2G"""	300161	"""eukaryotic translation initiation factor 2, subunit 3 (gamma, 52kD)"""	EIF2G		8106381, 9736774	Standard	NM_001415		Approved	EIF2gamma, EIF2	uc004dbc.3	P41091	OTTHUMG00000021262	ENST00000253039.4:c.1153C>T	chrX.hg19:g.24089815C>T	ENSP00000253039:p.Arg385Cys	68.0	0.0	.		46.0	30.0	.	NM_001415	B5BTZ4	Missense_Mutation	SNP	ENST00000253039.4	hg19	CCDS14210.1	.	.	.	.	.	.	.	.	.	.	c	27.8	4.868409	0.91587	.	.	ENSG00000130741	ENST00000253039	T	0.65549	-0.16	4.95	4.95	0.65309	Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (1);Translation initiation factor 2, gamma subunit, C-terminal (1);	0.052313	0.85682	D	0.000000	T	0.78830	0.4345	M	0.91972	3.26	0.80722	D	1	D	0.56746	0.977	P	0.52109	0.69	D	0.85370	0.1113	10	0.87932	D	0	.	17.6111	0.88053	0.0:1.0:0.0:0.0	.	385	P41091	IF2G_HUMAN	C	385	ENSP00000253039:R385C	ENSP00000253039:R385C	R	+	1	0	EIF2S3	23999736	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	7.363000	0.79516	2.175000	0.68902	0.597000	0.82753	CGC	.	.	.	none		0.403	EIF2S3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056079.1	NM_001415	
KDM6A	7403	hgsc.bcm.edu	37	X	44949021	44949021	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chrX:44949021G>A	ENST00000377967.4	+	25	3623	c.3582G>A	c.(3580-3582)tgG>tgA	p.W1194*	KDM6A_ENST00000543216.1_Nonsense_Mutation_p.W1115*|KDM6A_ENST00000382899.4_Nonsense_Mutation_p.W1201*|KDM6A_ENST00000536777.1_Nonsense_Mutation_p.W1149*	NM_021140.2	NP_066963.2	O15550	KDM6A_HUMAN	lysine (K)-specific demethylase 6A	1194	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				canonical Wnt signaling pathway (GO:0060070)|heart morphogenesis (GO:0003007)|histone H3-K4 methylation (GO:0051568)|in utero embryonic development (GO:0001701)|mesodermal cell differentiation (GO:0048333)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|regulation of gene expression (GO:0010468)|respiratory system process (GO:0003016)|somite rostral/caudal axis specification (GO:0032525)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.0?(6)|p.W1194*(1)		NS(1)|breast(7)|central_nervous_system(27)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(24)|kidney(24)|large_intestine(9)|liver(1)|lung(21)|oesophagus(11)|pancreas(2)|prostate(5)|skin(1)|soft_tissue(1)|urinary_tract(29)	170						GTTCTTGGTGGCCCAATCTTG	0.368			"""D, N, F, S"""		"""renal, oesophageal SCC, MM"""																																p.W1194X	Colon(129;1273 1667 15230 27352 52914)	Atlas-SNP	.		Rec	yes		X	Xp11.2	7403	"""lysine (K)-specific demethylase 6A, UTX"""		"""E, L"""	.	KDM6A	274	.	7	Whole gene deletion(6)|Substitution - Nonsense(1)	oesophagus(2)|breast(2)|pancreas(2)|urinary_tract(1)	c.G3582A						PASS	.						115.0	98.0	103.0					X																	44949021		2203	4300	6503	SO:0001587	stop_gained	7403	exon25			TTGGTGGCCCAAT	AF000992	CCDS14265.1	Xp11.2	2014-09-17	2009-04-17	2009-04-17	ENSG00000147050	ENSG00000147050		"""Chromatin-modifying enzymes / K-demethylases"", ""Tetratricopeptide (TTC) repeat domain containing"""	12637	protein-coding gene	gene with protein product		300128	"""ubiquitously transcribed tetratricopeptide repeat, X chromosome"""	UTX		9499428, 9381176	Standard	XM_005272655		Approved		uc004dge.4	O15550	OTTHUMG00000021402	ENST00000377967.4:c.3582G>A	chrX.hg19:g.44949021G>A	ENSP00000367203:p.Trp1194*	47.0	0.0	.		37.0	29.0	.	NM_021140	Q52LL9|Q5JVQ7	Nonsense_Mutation	SNP	ENST00000377967.4	hg19	CCDS14265.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	39|39	7.566749|7.566749	0.98361|0.98361	.|.	.|.	ENSG00000147050|ENSG00000147050	ENST00000414389;ENST00000433797|ENST00000334516;ENST00000377967;ENST00000536777;ENST00000382899;ENST00000543216	.|.	.|.	.|.	5.16|5.16	5.16|5.16	0.70880|0.70880	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.45538|.	0.1347|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.42258|.	-0.9462|.	3|.	.|0.02654	.|T	.|1	-5.5328|-5.5328	17.8727|17.8727	0.88815|0.88815	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	T|X	792;837|891;1194;1149;1201;1115	.|.	.|ENSP00000334340:W891X	A|W	+|+	1|3	0|0	KDM6A|KDM6A	44833965|44833965	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	9.358000|9.358000	0.97109|0.97109	2.153000|2.153000	0.67306|0.67306	0.468000|0.468000	0.43344|0.43344	GCC|TGG	.	.	.	none		0.368	KDM6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056324.1	NM_021140	
MT-CYB	4519	hgsc.bcm.edu	37	M	14760	14760	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chrM:14760G>A	ENST00000361789.2	+	1	14	c.14G>A	c.(13-15)cGc>cAc	p.R5H	MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TS2_ENST00000387449.1_RNA|MT-ND6_ENST00000361681.2_5'Flank|MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	5					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						GACCCCAATACGCAAAATTAA	0.423																																					p.R5H		Atlas-SNP	.											.	.	.	.	0			c.G14A						PASS	.																																			SO:0001583	missense	0	exon1			CAATACGCAAAAC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.14G>A	chrM.hg19:g.14760G>A	ENSP00000354554:p.Arg5His	37.0	0.0	.		40.0	16.0	.	ENST00000361789	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	hg19																																																																																				.	.	.	none		0.423	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
NPS	594857	hgsc.bcm.edu	37	10	129350829	129350829	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr10:129350829delT	ENST00000398023.1	+	3	216	c.196delT	c.(196-198)tttfs	p.F66fs		NM_001030013.1	NP_001025184.1	P0C0P6	NPS_HUMAN	neuropeptide S	66					neuropeptide signaling pathway (GO:0007218)|positive regulation of action potential (GO:0045760)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|visual learning (GO:0008542)	extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|lung(4)	5						GGAGAAGATGTTTGTGAAAAG	0.413																																					p.M65fs		Atlas-INDEL	.											.	NPS	14	.	0			c.195delG						PASS	.						204.0	199.0	201.0					10																	129350829		1843	4101	5944	SO:0001589	frameshift_variant	594857	exon3			.	BC148465	CCDS41577.1	10q26.2	2013-02-26			ENSG00000214285	ENSG00000214285		"""Endogenous ligands"""	33940	protein-coding gene	gene with protein product	"""prepro-neuropeptide S"""	609513				18181564, 15312648	Standard	NM_001030013		Approved		uc001ljx.1	P0C0P6		ENST00000398023.1:c.196delT	chr10.hg19:g.129350829delT	ENSP00000381105:p.Phe66fs	430.0	0.0	0		357.0	50.0	0.140056	NM_001030013		Frame_Shift_Del	DEL	ENST00000398023.1	hg19	CCDS41577.1																																																																																			.	.	.	none		0.413	NPS-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001030013	
ZNF543	125919	hgsc.bcm.edu	37	19	57839185	57839185	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr19:57839185delG	ENST00000321545.4	+	4	700	c.355delG	c.(355-357)gggfs	p.G119fs		NM_213598.3	NP_998763.2	Q08ER8	ZN543_HUMAN	zinc finger protein 543	119					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(2)|large_intestine(8)|lung(11)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	28		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		CTCCCAATTAGGGCAATCCAA	0.512																																					p.L118fs		Atlas-INDEL	.											.	ZNF543	61	.	0			c.354delA						PASS	.						64.0	67.0	66.0					19																	57839185		2203	4300	6503	SO:0001589	frameshift_variant	125919	exon4			.	AL834534	CCDS33130.1	19q13.43	2013-01-08				ENSG00000178229		"""Zinc fingers, C2H2-type"", ""-"""	25281	protein-coding gene	gene with protein product							Standard	NM_213598		Approved	DKFZp434H055	uc002qoi.2	Q08ER8		ENST00000321545.4:c.355delG	chr19.hg19:g.57839185delG	ENSP00000322545:p.Gly119fs	69.0	0.0	0		69.0	15.0	0.217391	NM_213598	Q495U9|Q495V0|Q6ZMP4|Q8NCX4	Frame_Shift_Del	DEL	ENST00000321545.4	hg19	CCDS33130.1																																																																																			.	.	.	none		0.512	ZNF543-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465780.1	XM_064865	
RGS20	8601	hgsc.bcm.edu	37	8	54764571	54764572	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	AT	AT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr8:54764571_54764572delAT	ENST00000297313.3	+	1	204_205	c.112_113delAT	c.(112-114)attfs	p.I38fs	RGS20_ENST00000344277.6_Frame_Shift_Del_p.I38fs	NM_170587.2	NP_733466.1	O76081	RGS20_HUMAN	regulator of G-protein signaling 20	38					positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(1)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(7;1.37e-06)|Epithelial(17;0.000126)|all cancers(17;0.0009)			TAATACAGACATTCACCAAATC	0.455																																					p.37_38del		Atlas-INDEL	.											.	RGS20	51	.	0			c.111_112del						PASS	.																																			SO:0001589	frameshift_variant	8601	exon1			.	AF074979	CCDS6155.1, CCDS6156.1, CCDS69482.1	8q11.23	2008-07-25	2007-08-14		ENSG00000147509	ENSG00000147509		"""Regulators of G-protein signaling"""	14600	protein-coding gene	gene with protein product		607193	"""regulator of G-protein signalling 20"""			9748279, 9748280	Standard	NM_003702		Approved	RGSZ1, ZGAP1	uc003xrp.3	O76081	OTTHUMG00000164750	ENST00000297313.3:c.112_113delAT	chr8.hg19:g.54764571_54764572delAT	ENSP00000297313:p.Ile38fs	126.0	0.0	0		119.0	38.0	0.319328	NM_170587	Q96BG9	Frame_Shift_Del	DEL	ENST00000297313.3	hg19	CCDS6155.1																																																																																			.	.	.	none		0.455	RGS20-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000380058.1		
HMGB1	3146	hgsc.bcm.edu	37	13	31036836	31036836	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr13:31036836delG	ENST00000405805.1	-	4	1250	c.310delC	c.(310-312)ctcfs	p.L104fs	HMGB1_ENST00000399494.1_Frame_Shift_Del_p.L104fs|HMGB1_ENST00000341423.5_Frame_Shift_Del_p.L104fs|HMGB1_ENST00000468384.1_5'Flank|HMGB1_ENST00000399489.1_Frame_Shift_Del_p.L104fs|HMGB1_ENST00000326004.4_Frame_Shift_Del_p.L104fs|HMGB1_ENST00000339872.4_Frame_Shift_Del_p.L104fs			P09429	HMGB1_HUMAN	high mobility group box 1	104					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|base-excision repair, DNA ligation (GO:0006288)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|dendritic cell chemotaxis (GO:0002407)|DNA ligation involved in DNA repair (GO:0051103)|DNA recombination (GO:0006310)|DNA topological change (GO:0006265)|inflammatory response to antigenic stimulus (GO:0002437)|innate immune response (GO:0045087)|myeloid dendritic cell activation (GO:0001773)|negative regulation of apoptotic cell clearance (GO:2000426)|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0017055)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron projection development (GO:0031175)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|V(D)J recombination (GO:0033151)	cell surface (GO:0009986)|condensed chromosome (GO:0000793)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chemoattractant activity (GO:0042056)|cytokine activity (GO:0005125)|damaged DNA binding (GO:0003684)|DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RAGE receptor binding (GO:0050786)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(1)|ovary(1)	8		Lung SC(185;0.0257)		all cancers(112;0.072)|OV - Ovarian serous cystadenocarcinoma(117;0.177)|Lung(94;0.216)|GBM - Glioblastoma multiforme(144;0.232)		GAGCAGAAGAGGAAGAAGGCC	0.378																																					p.L104fs		Atlas-INDEL	.											.	HMGB1	21	.	0			c.311delT						PASS	.						42.0	43.0	43.0					13																	31036836		2183	4287	6470	SO:0001589	frameshift_variant	3146	exon4			.	D63874	CCDS9335.1	13q12	2011-07-01	2011-04-05	2002-08-16	ENSG00000189403	ENSG00000189403		"""High-mobility group / Canonical"""	4983	protein-coding gene	gene with protein product	"""high mobility group box 1"", ""Sulfoglucuronyl carbohydrate binding protein"", ""Amphoterin"", ""high mobility group protein 1"""	163905	"""high-mobility group (nonhistone chromosomal) protein 1"", ""high-mobility group box 1"""	HMG1		8661151, 11279268	Standard	NM_002128		Approved	HMG3, SBP-1, DKFZp686A04236	uc001usx.3	P09429	OTTHUMG00000016670	ENST00000405805.1:c.310delC	chr13.hg19:g.31036836delG	ENSP00000384678:p.Leu104fs	102.0	0.0	0		82.0	19.0	0.231707	NM_002128	A5D8W9|Q14321|Q5T7C3|Q6IBE1	Frame_Shift_Del	DEL	ENST00000405805.1	hg19	CCDS9335.1																																																																																			.	.	.	none		0.378	HMGB1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000303998.2	NM_002128	
