#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
KHDRBS1	10657	hgsc.bcm.edu	37	1	32508212	32508212	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr1:32508212A>G	ENST00000327300.7	+	9	1486	c.1319A>G	c.(1318-1320)tAt>tGt	p.Y440C	KHDRBS1_ENST00000492989.1_Missense_Mutation_p.Y401C|KHDRBS1_ENST00000307714.8_3'UTR	NM_006559.1	NP_006550.1			KH domain containing, RNA binding, signal transduction associated 1											endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	14		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				GAGCACCCATATGGACGTTAT	0.483																																					p.Y440C	Ovarian(173;401 1982 12359 31110 42403)	Atlas-SNP	.											.	KHDRBS1	34	.	0			c.A1319G						PASS	.						59.0	57.0	58.0					1																	32508212		2203	4300	6503	SO:0001583	missense	10657	exon9			ACCCATATGGACG	U78971	CCDS350.1, CCDS60067.1	1p32	2008-07-18			ENSG00000121774	ENSG00000121774			18116	protein-coding gene	gene with protein product	"""GAP-associated tyrosine phosphoprotein p62 (Sam68)"""	602489				1374686, 10564820	Standard	NM_006559		Approved	Sam68, p62, FLJ34027	uc001bub.4	Q07666	OTTHUMG00000003921	ENST00000327300.7:c.1319A>G	chr1.hg19:g.32508212A>G	ENSP00000313829:p.Tyr440Cys	66.0	0.0	.		58.0	13.0	.	NM_006559		Missense_Mutation	SNP	ENST00000327300.7	hg19	CCDS350.1	.	.	.	.	.	.	.	.	.	.	A	13.93	2.382684	0.42207	.	.	ENSG00000121774	ENST00000327300;ENST00000492989;ENST00000355201	T;T	0.71103	-0.54;-0.51	5.85	4.72	0.59763	.	0.057453	0.64402	D	0.000001	T	0.81735	0.4885	M	0.78456	2.415	0.80722	D	1	D;D	0.69078	0.996;0.997	P;D	0.63192	0.819;0.912	D	0.83637	0.0148	10	0.87932	D	0	.	12.1125	0.53848	0.9331:0.0:0.0668:0.0	.	440;401	Q07666;Q07666-3	KHDR1_HUMAN;.	C	440;401;416	ENSP00000313829:Y440C;ENSP00000417731:Y401C	ENSP00000313829:Y440C	Y	+	2	0	KHDRBS1	32280799	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	8.716000	0.91420	1.156000	0.42514	-0.256000	0.11100	TAT	.	.	.	none		0.483	KHDRBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011199.4	NM_006559	
TTLL7	79739	hgsc.bcm.edu	37	1	84348653	84348653	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr1:84348653T>C	ENST00000260505.8	-	20	2913	c.2536A>G	c.(2536-2538)Aat>Gat	p.N846D	TTLL7_ENST00000477524.1_5'UTR	NM_024686.4	NP_078962.4	Q6ZT98	TTLL7_HUMAN	tubulin tyrosine ligase-like family, member 7	846					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)			kidney(1)|large_intestine(8)|lung(15)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29				all cancers(265;0.0126)|Epithelial(280;0.0372)|OV - Ovarian serous cystadenocarcinoma(397;0.16)		TACCTGGAATTACCCCAGTCA	0.398																																					p.N846D		Atlas-SNP	.											.	TTLL7	93	.	0			c.A2536G						PASS	.						156.0	150.0	152.0					1																	84348653		2203	4300	6503	SO:0001583	missense	79739	exon20			TGGAATTACCCCA	AY170843	CCDS690.2	1p31.1	2013-02-14			ENSG00000137941	ENSG00000137941		"""Tubulin tyrosine ligase-like family"""	26242	protein-coding gene	gene with protein product						15890843	Standard	XM_005271208		Approved	FLJ23033	uc001djc.3	Q6ZT98	OTTHUMG00000009932	ENST00000260505.8:c.2536A>G	chr1.hg19:g.84348653T>C	ENSP00000260505:p.Asn846Asp	209.0	0.0	.		162.0	21.0	.	NM_024686	Q5TAX8|Q5TAX9|Q6P990|Q86YS1|Q9H5U4	Missense_Mutation	SNP	ENST00000260505.8	hg19	CCDS690.2	.	.	.	.	.	.	.	.	.	.	T	11.08	1.532905	0.27387	.	.	ENSG00000137941	ENST00000260505	T	0.03004	4.08	5.5	1.79	0.24919	.	0.504331	0.23351	N	0.049127	T	0.00468	0.0015	N	0.04880	-0.145	0.28908	N	0.892872	B	0.06786	0.001	B	0.04013	0.001	T	0.44711	-0.9310	10	0.12766	T	0.61	.	3.8611	0.08996	0.0:0.188:0.414:0.398	.	846	Q6ZT98	TTLL7_HUMAN	D	846	ENSP00000260505:N846D	ENSP00000260505:N846D	N	-	1	0	TTLL7	84121241	1.000000	0.71417	0.971000	0.41717	0.928000	0.56348	3.636000	0.54317	0.417000	0.25871	-0.321000	0.08615	AAT	.	.	.	none		0.398	TTLL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027498.1	NM_024686	
CFH	3075	hgsc.bcm.edu	37	1	196706023	196706023	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr1:196706023A>T	ENST00000367429.4	+	16	2723	c.2483A>T	c.(2482-2484)aAt>aTt	p.N828I		NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H	828	Sushi 14. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						ACCACACTGAATTATCGGGAT	0.333																																					p.N828I		Atlas-SNP	.											.	CFH	251	.	0			c.A2483T						PASS	.						65.0	62.0	63.0					1																	196706023		2203	4300	6503	SO:0001583	missense	3075	exon16			CACTGAATTATCG	Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.2483A>T	chr1.hg19:g.196706023A>T	ENSP00000356399:p.Asn828Ile	84.0	0.0	.		61.0	6.0	.	NM_000186	A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Missense_Mutation	SNP	ENST00000367429.4	hg19	CCDS1385.1	.	.	.	.	.	.	.	.	.	.	.	12.36	1.913921	0.33815	.	.	ENSG00000000971	ENST00000367429	T	0.65732	-0.17	5.91	3.6	0.41247	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.69735	0.3144	M	0.73372	2.23	0.80722	D	1	D	0.60160	0.987	P	0.59357	0.856	T	0.68217	-0.5467	9	0.42905	T	0.14	.	6.5067	0.22198	0.7623:0.1583:0.0794:0.0	.	828	P08603	CFAH_HUMAN	I	828	ENSP00000356399:N828I	ENSP00000356399:N828I	N	+	2	0	CFH	194972646	0.999000	0.42202	0.929000	0.37066	0.092000	0.18411	1.560000	0.36331	1.049000	0.40321	0.454000	0.30748	AAT	.	.	.	none		0.333	CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086412.2	NM_000186	
DIS3L2	129563	hgsc.bcm.edu	37	2	233075106	233075106	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr2:233075106C>G	ENST00000409307.1	+	9	1195	c.1195C>G	c.(1195-1197)Ctc>Gtc	p.L399V	DIS3L2_ENST00000273009.6_Missense_Mutation_p.L399V|DIS3L2_ENST00000325385.7_Missense_Mutation_p.L399V					DIS3 like 3'-5' exoribonuclease 2											breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(2)|urinary_tract(1)	40		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		CTGCAAGCCACTCGCTGACGG	0.512																																					p.L399V		Atlas-SNP	.											.	DIS3L2	77	.	0			c.C1195G						PASS	.						97.0	98.0	98.0					2																	233075106		2074	4234	6308	SO:0001583	missense	129563	exon10			AAGCCACTCGCTG	BC026166	CCDS42834.1, CCDS58752.1, CCDS58753.1	2q37.1	2014-09-17	2014-03-05		ENSG00000144535	ENSG00000144535			28648	protein-coding gene	gene with protein product		614184	"""family with sequence similarity 6, member A"", ""DIS3 mitotic control homolog (S. cerevisiae)-like 2"""	FAM6A		22306653, 23503588	Standard	NM_152383		Approved	FLJ36974, MGC42174	uc010fxz.3	Q8IYB7	OTTHUMG00000153385	ENST00000409307.1:c.1195C>G	chr2.hg19:g.233075106C>G	ENSP00000386799:p.Leu399Val	77.0	0.0	.		79.0	9.0	.	NM_152383		Missense_Mutation	SNP	ENST00000409307.1	hg19	CCDS42834.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.954379	0.73902	.	.	ENSG00000144535	ENST00000273009;ENST00000542873;ENST00000325385;ENST00000431466;ENST00000409307;ENST00000424049	T;T;T;T	0.37915	1.17;1.17;1.17;1.17	5.16	5.16	0.70880	Ribonuclease II/R (2);	0.000000	0.85682	D	0.000000	T	0.62159	0.2405	M	0.79693	2.465	0.80722	D	1	D	0.71674	0.998	D	0.73380	0.98	T	0.67409	-0.5678	10	0.72032	D	0.01	-16.4035	15.5539	0.76177	0.0:1.0:0.0:0.0	.	399	Q8IYB7	DI3L2_HUMAN	V	399;399;399;399;399;34	ENSP00000273009:L399V;ENSP00000315569:L399V;ENSP00000386799:L399V;ENSP00000415419:L34V	ENSP00000273009:L399V	L	+	1	0	DIS3L2	232783350	0.994000	0.37717	0.445000	0.26908	0.945000	0.59286	3.829000	0.55760	2.381000	0.81170	0.455000	0.32223	CTC	.	.	.	none		0.512	DIS3L2-015	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330988.1	NM_152383	
OTOL1	131149	hgsc.bcm.edu	37	3	161221062	161221062	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr3:161221062A>G	ENST00000327928.4	+	4	766	c.766A>G	c.(766-768)Aaa>Gaa	p.K256E		NM_001080440.1	NP_001073909.1	A6NHN0	OTOL1_HUMAN	otolin 1	256	Collagen-like 2.					collagen trimer (GO:0005581)|extracellular region (GO:0005576)				central_nervous_system(2)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|prostate(2)|skin(1)	27						AAAAGGACAGAAAGGTGAGGG	0.582																																					p.K256E		Atlas-SNP	.											.	OTOL1	63	.	0			c.A766G						PASS	.						6.0	6.0	6.0					3																	161221062		1882	4058	5940	SO:0001583	missense	131149	exon4			GGACAGAAAGGTG		CCDS46948.1	3q26.1	2011-05-19	2011-05-19			ENSG00000182447			34071	protein-coding gene	gene with protein product	"""C1q and tumor necrosis factor related protein 15"""		"""otolin 1 homolog (zebrafish)"""			17544811, 15905077	Standard	NM_001080440		Approved	C1QTNF15	uc011bpb.2	A6NHN0		ENST00000327928.4:c.766A>G	chr3.hg19:g.161221062A>G	ENSP00000330808:p.Lys256Glu	4.0	0.0	.		4.0	4.0	.	NM_001080440		Missense_Mutation	SNP	ENST00000327928.4	hg19	CCDS46948.1	.	.	.	.	.	.	.	.	.	.	A	14.65	2.600002	0.46318	.	.	ENSG00000182447	ENST00000327928	D	0.93247	-3.19	4.79	3.6	0.41247	.	0.260709	0.36519	N	0.002555	D	0.93713	0.7991	M	0.74546	2.27	0.09310	N	1	D	0.53619	0.961	P	0.52957	0.714	D	0.86251	0.1649	10	0.22109	T	0.4	.	10.4489	0.44509	0.836:0.164:0.0:0.0	.	256	A6NHN0	OTOL1_HUMAN	E	256	ENSP00000330808:K256E	ENSP00000330808:K256E	K	+	1	0	OTOL1	162703756	0.044000	0.20184	0.039000	0.18376	0.750000	0.42670	2.908000	0.48750	0.649000	0.30751	0.455000	0.32223	AAA	.	.	.	none		0.582	OTOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353184.1	NM_001080440	
WASF1	8936	hgsc.bcm.edu	37	6	110424747	110424747	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr6:110424747C>A	ENST00000392589.1	-	9	1563	c.727G>T	c.(727-729)Gtg>Ttg	p.V243L	WASF1_ENST00000392588.1_Missense_Mutation_p.V243L|WASF1_ENST00000359451.2_Missense_Mutation_p.V243L|WASF1_ENST00000392586.1_Missense_Mutation_p.V243L|WASF1_ENST00000392587.2_Missense_Mutation_p.V243L	NM_003931.2	NP_003922.1	Q92558	WASF1_HUMAN	WAS protein family, member 1	243					actin filament polymerization (GO:0030041)|cellular component movement (GO:0006928)|lamellipodium morphogenesis (GO:0072673)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|protein complex assembly (GO:0006461)|Rac protein signal transduction (GO:0016601)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|lamellipodium (GO:0030027)|mitochondrial outer membrane (GO:0005741)|SCAR complex (GO:0031209)|synapse (GO:0045202)	protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(87;1.18e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		OV - Ovarian serous cystadenocarcinoma(136;0.0364)|Epithelial(106;0.051)|all cancers(137;0.0687)		ATATGATCCACGTATGTCTGA	0.358																																					p.V243L		Atlas-SNP	.											.	WASF1	35	.	0			c.G727T						PASS	.						100.0	92.0	95.0					6																	110424747		2203	4300	6503	SO:0001583	missense	8936	exon8			GATCCACGTATGT	D87459	CCDS5080.1	6q21	2010-08-20			ENSG00000112290	ENSG00000112290		"""A-kinase anchor proteins"""	12732	protein-coding gene	gene with protein product		605035				9843499, 9889097	Standard	XM_005267204		Approved	WAVE1, SCAR1, KIAA0269, WAVE	uc003pty.1	Q92558	OTTHUMG00000015357	ENST00000392589.1:c.727G>T	chr6.hg19:g.110424747C>A	ENSP00000376368:p.Val243Leu	99.0	0.0	.		70.0	4.0	.	NM_001024935	E1P5F2|Q5SZK7	Missense_Mutation	SNP	ENST00000392589.1	hg19	CCDS5080.1	.	.	.	.	.	.	.	.	.	.	C	14.70	2.612405	0.46631	.	.	ENSG00000112290	ENST00000392586;ENST00000392587;ENST00000392589;ENST00000392588;ENST00000359451	T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97	5.51	5.51	0.81932	.	0.213000	0.48286	D	0.000185	T	0.12263	0.0298	N	0.08118	0	0.34639	D	0.720416	B	0.14012	0.009	B	0.09377	0.004	T	0.07366	-1.0776	10	0.10902	T	0.67	.	19.7791	0.96410	0.0:1.0:0.0:0.0	.	243	Q92558	WASF1_HUMAN	L	243	ENSP00000376365:V243L;ENSP00000376366:V243L;ENSP00000376368:V243L;ENSP00000376367:V243L;ENSP00000352425:V243L	ENSP00000352425:V243L	V	-	1	0	WASF1	110531440	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.456000	0.60081	2.763000	0.94921	0.650000	0.86243	GTG	.	.	.	none		0.358	WASF1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041784.3	NM_003931	
PTPRZ1	5803	hgsc.bcm.edu	37	7	121681010	121681010	+	Silent	SNP	G	G	A			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr7:121681010G>A	ENST00000393386.2	+	21	6189	c.5778G>A	c.(5776-5778)gtG>gtA	p.V1926V	PTPRZ1_ENST00000449182.1_Silent_p.V1059V	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	1926	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						GCCATGCAGTGGGGCCTGTTG	0.498																																					p.V1926V		Atlas-SNP	.											.	PTPRZ1	605	.	0			c.G5778A						PASS	.						74.0	66.0	69.0					7																	121681010		2203	4300	6503	SO:0001819	synonymous_variant	5803	exon21			TGCAGTGGGGCCT	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.5778G>A	chr7.hg19:g.121681010G>A		118.0	0.0	.		108.0	18.0	.	NM_002851	A4D0W5|C9JFM0|O76043|Q9UDR6	Silent	SNP	ENST00000393386.2	hg19	CCDS34740.1																																																																																			.	.	.	none		0.498	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851	
MTBP	27085	hgsc.bcm.edu	37	8	121518998	121518998	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr8:121518998C>T	ENST00000305949.1	+	16	1825	c.1780C>T	c.(1780-1782)Cct>Tct	p.P594S		NM_022045.4	NP_071328.2	Q96DY7	MTBP_HUMAN	MDM2 binding protein	594	Interaction with MDM2. {ECO:0000250}.				cell cycle arrest (GO:0007050)|mitotic spindle checkpoint (GO:0071174)|negative regulation of cell proliferation (GO:0008285)|protein localization to kinetochore (GO:0034501)|traversing start control point of mitotic cell cycle (GO:0007089)	chromatin (GO:0000785)|kinetochore (GO:0000776)				NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	30	Lung NSC(37;5.68e-08)|Ovarian(258;0.00769)|all_neural(195;0.0804)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00503)			CAAAGAGGGTCCTCGGGACTC	0.398																																					p.P594S		Atlas-SNP	.											.	MTBP	77	.	0			c.C1780T						PASS	.						83.0	79.0	80.0					8																	121518998		2203	4300	6503	SO:0001583	missense	27085	exon16			GAGGGTCCTCGGG		CCDS6333.1	8q24.1-q24.2	2014-03-03	2014-03-03		ENSG00000172167	ENSG00000172167			7417	protein-coding gene	gene with protein product		605927	"""MDM2 (mouse double minute 2)-binding protein, 104kD"", ""Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104kDa"""			10906133, 11060448	Standard	NM_022045		Approved		uc003ypc.2	Q96DY7	OTTHUMG00000165040	ENST00000305949.1:c.1780C>T	chr8.hg19:g.121518998C>T	ENSP00000303398:p.Pro594Ser	87.0	0.0	.		84.0	6.0	.	NM_022045	B4DUR5|Q9HA89	Missense_Mutation	SNP	ENST00000305949.1	hg19	CCDS6333.1	.	.	.	.	.	.	.	.	.	.	C	11.26	1.586138	0.28268	.	.	ENSG00000172167	ENST00000305949	.	.	.	5.44	4.55	0.56014	.	0.197586	0.44902	D	0.000417	T	0.49047	0.1534	L	0.60455	1.87	0.32183	N	0.58014	P	0.38078	0.617	B	0.33960	0.173	T	0.61978	-0.6951	9	0.46703	T	0.11	-8.4215	15.931	0.79659	0.0:0.8506:0.1494:0.0	.	594	Q96DY7	MTBP_HUMAN	S	594	.	ENSP00000303398:P594S	P	+	1	0	MTBP	121588179	1.000000	0.71417	0.997000	0.53966	0.864000	0.49448	2.735000	0.47377	1.267000	0.44247	0.563000	0.77884	CCT	.	.	.	none		0.398	MTBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381530.1	NM_022045	
CAMK1D	57118	hgsc.bcm.edu	37	10	12811756	12811756	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr10:12811756G>A	ENST00000378847.3	+	5	860	c.523G>A	c.(523-525)Gga>Aga	p.G175R	CAMK1D_ENST00000378845.1_Missense_Mutation_p.G175R	NM_153498.2	NP_705718.1	Q8IU85	KCC1D_HUMAN	calcium/calmodulin-dependent protein kinase ID	175	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				inflammatory response (GO:0006954)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis (GO:0050766)|positive regulation of respiratory burst (GO:0060267)|regulation of dendrite development (GO:0050773)|regulation of granulocyte chemotaxis (GO:0071622)	calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|stomach(1)	16				GBM - Glioblastoma multiforme(1;3.16e-05)		GGAGGGCAAAGGAGATGTGAT	0.458																																					p.G175R		Atlas-SNP	.											CAMK1D_ENST00000378847,NS,carcinoma,0,2	CAMK1D	99	.	0			c.G523A						PASS	.						177.0	140.0	153.0					10																	12811756		2203	4300	6503	SO:0001583	missense	57118	exon5			GGCAAAGGAGATG	AF286366	CCDS7091.1, CCDS7092.1	10p13	2003-11-05			ENSG00000183049	ENSG00000183049			19341	protein-coding gene	gene with protein product		607957				11050006	Standard	XM_006717481		Approved	CKLiK	uc001ilo.3	Q8IU85	OTTHUMG00000017683	ENST00000378847.3:c.523G>A	chr10.hg19:g.12811756G>A	ENSP00000368124:p.Gly175Arg	123.0	0.0	.		92.0	17.0	.	NM_153498	B0YIY0|Q9HD31	Missense_Mutation	SNP	ENST00000378847.3	hg19	CCDS7091.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.892484	0.91889	.	.	ENSG00000183049	ENST00000378847;ENST00000378845	T;T	0.65364	-0.15;-0.15	5.2	5.2	0.72013	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.115496	0.64402	D	0.000017	T	0.68796	0.3040	N	0.25060	0.705	0.80722	D	1	D;D	0.71674	0.998;0.997	D;D	0.79784	0.993;0.987	T	0.71912	-0.4449	10	0.52906	T	0.07	-14.2799	17.7041	0.88303	0.0:0.0:1.0:0.0	.	175;175	Q8IU85;Q5SQQ7	KCC1D_HUMAN;.	R	175	ENSP00000368124:G175R;ENSP00000368122:G175R	ENSP00000368122:G175R	G	+	1	0	CAMK1D	12851762	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.950000	0.87804	2.403000	0.81681	0.561000	0.74099	GGA	.	.	.	none		0.458	CAMK1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046820.1	NM_020397	
MUC5B	727897	hgsc.bcm.edu	37	11	1253260	1253260	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr11:1253260C>A	ENST00000529681.1	+	15	1771	c.1713C>A	c.(1711-1713)gaC>gaA	p.D571E	MUC5B_ENST00000447027.1_Missense_Mutation_p.D574E	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	571	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ACCAGGCTGACGACTTCACGG	0.672																																					p.D571E		Atlas-SNP	.											.	MUC5B	473	.	0			c.C1713A						PASS	.						42.0	50.0	48.0					11																	1253260		2049	4192	6241	SO:0001583	missense	727897	exon15			GGCTGACGACTTC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.1713C>A	chr11.hg19:g.1253260C>A	ENSP00000436812:p.Asp571Glu	59.0	0.0	.		43.0	4.0	.	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	hg19	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	C	10.09	1.254981	0.22965	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.65364	-0.15;-0.15	3.77	-5.54	0.02544	von Willebrand factor, type D domain (3);	.	.	.	.	D	0.83982	0.5372	H	0.98314	4.2	0.36992	D	0.894823	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.984;0.996;0.996	D	0.86512	0.1810	9	0.87932	D	0	.	12.6531	0.56772	0.0:0.2249:0.0:0.7751	.	571;1230;574	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	E	571;574;572;607	ENSP00000436812:D571E;ENSP00000415793:D574E	ENSP00000343037:D572E	D	+	3	2	MUC5B	1209836	0.027000	0.19231	0.934000	0.37439	0.455000	0.32408	-1.078000	0.03413	-1.179000	0.02737	-0.369000	0.07265	GAC	.	.	.	none		0.672	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
KCNK7	10089	hgsc.bcm.edu	37	11	65360850	65360850	+	Intron	SNP	T	T	C			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr11:65360850T>C	ENST00000340313.4	-	2	942				AP001362.1_ENST00000597463.1_5'Flank|KCNK7_ENST00000394216.2_3'UTR|KCNK7_ENST00000342202.4_Silent_p.G241G|KCNK7_ENST00000394217.2_Silent_p.G241G	NM_033347.1	NP_203133.1	Q9Y2U2	KCNK7_HUMAN	potassium channel, subfamily K, member 7						potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			endometrium(1)|liver(1)|lung(1)	3						GTGAGGTCCCTCCACCTGCAA	0.627																																					p.G241G		Atlas-SNP	.											.	KCNK7	22	.	0			c.A723G						PASS	.						82.0	83.0	82.0					11																	65360850		2201	4297	6498	SO:0001627	intron_variant	10089	exon3			GGTCCCTCCACCT	AF110522	CCDS8106.1, CCDS31608.1, CCDS41673.1	11q13	2012-03-07			ENSG00000173338	ENSG00000173338		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6282	protein-coding gene	gene with protein product		603940				10206991, 11256078, 16382106	Standard	NM_033347		Approved	K2p7.1	uc001oes.3	Q9Y2U2	OTTHUMG00000166528	ENST00000340313.4:c.718+96A>G	chr11.hg19:g.65360850T>C		107.0	0.0	.		98.0	4.0	.	NM_033348	Q3SYI2|Q9Y2U3|Q9Y2U4	Silent	SNP	ENST00000340313.4	hg19	CCDS31608.1	.	.	.	.	.	.	.	.	.	.	T	6.803	0.517237	0.13005	.	.	ENSG00000173338	ENST00000525254	.	.	.	4.14	-4.28	0.03732	.	.	.	.	.	T	0.20170	0.0485	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.29397	-1.0013	4	.	.	.	.	4.0939	0.09982	0.3119:0.4105:0.0:0.2776	.	.	.	.	G	17	.	.	R	-	1	2	KCNK7	65117426	0.000000	0.05858	0.000000	0.03702	0.048000	0.14542	-1.096000	0.03353	-0.723000	0.04915	0.459000	0.35465	AGG	.	.	.	none		0.627	KCNK7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390206.1	NM_005714	
CELA1	1990	hgsc.bcm.edu	37	12	51740415	51740415	+	Missense_Mutation	SNP	A	A	C	rs370927847|rs386762976|rs55827519	byFrequency	TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr12:51740415A>C	ENST00000293636.1	-	1	48	c.8T>G	c.(7-9)gTc>gGc	p.V3G		NM_001971.5	NP_001962.3	Q9UNI1	CELA1_HUMAN	chymotrypsin-like elastase family, member 1	3					exocrine pancreas development (GO:0031017)|inflammatory response (GO:0006954)|multicellular organism growth (GO:0035264)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas morphogenesis (GO:0061113)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)	p.V3fs*21(1)		NS(1)|breast(3)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)	15						ACCATAAAGGACCAGCATGTT	0.512																																					p.V3G		Atlas-SNP	.											.,3	CELA1	39	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.T8G						PASS	.						198.0	125.0	149.0					12																	51740415		2199	4290	6489	SO:0001583	missense	1990	exon1			TAAAGGACCAGCA		CCDS8812.1	12q13	2012-10-02	2009-05-05	2009-05-05	ENSG00000139610	ENSG00000139610			3308	protein-coding gene	gene with protein product		130120	"""elastase 1, pancreatic"""	ELA1			Standard	NM_001971		Approved		uc001ryi.1	Q9UNI1	OTTHUMG00000167523	ENST00000293636.1:c.8T>G	chr12.hg19:g.51740415A>C	ENSP00000293636:p.Val3Gly	81.0	1.0	.		80.0	4.0	.	NM_001971	Q5MLF0|Q6DJT0|Q6ISM6	Missense_Mutation	SNP	ENST00000293636.1	hg19	CCDS8812.1	.	.	.	.	.	.	.	.	.	.	-	10.50	1.368338	0.24771	.	.	ENSG00000139610	ENST00000293636	D	0.89552	-2.53	3.61	0.701	0.18104	.	0.180867	0.43747	D	0.000529	T	0.82121	0.4968	L	0.55990	1.75	0.28932	N	0.891491	B	0.27823	0.19	B	0.26517	0.07	T	0.73855	-0.3851	10	0.87932	D	0	-1.5222	3.134	0.06433	0.3198:0.0:0.4933:0.1868	.	3	Q9UNI1	CELA1_HUMAN	G	3	ENSP00000293636:V3G	ENSP00000293636:V3G	V	-	2	0	CELA1	50026682	0.009000	0.17119	0.433000	0.26760	0.045000	0.14185	0.204000	0.17335	-0.043000	0.13513	-0.633000	0.03987	GTC	.	.	.	alt		0.512	CELA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394901.1	NM_001971	
ANKRD11	29123	hgsc.bcm.edu	37	16	89345492	89345492	+	Silent	SNP	G	G	A	rs569755271		TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr16:89345492G>A	ENST00000301030.4	-	9	7918	c.7458C>T	c.(7456-7458)ctC>ctT	p.L2486L	ANKRD11_ENST00000378330.2_Silent_p.L2486L	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	2486					bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		CGGGGATGTGGAGCTTGCTGA	0.657																																					p.L2486L		Atlas-SNP	.											.	ANKRD11	195	.	0			c.C7458T						PASS	.						25.0	22.0	23.0					16																	89345492		2197	4298	6495	SO:0001819	synonymous_variant	29123	exon9			GATGTGGAGCTTG	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.7458C>T	chr16.hg19:g.89345492G>A		28.0	0.0	.		50.0	11.0	.	NM_001256183	Q6NTG1|Q6QMF8	Silent	SNP	ENST00000301030.4	hg19	CCDS32513.1																																																																																			.	.	.	none		0.657	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275	
SLFN11	91607	hgsc.bcm.edu	37	17	33679780	33679780	+	Silent	SNP	G	G	A	rs377363363		TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr17:33679780G>A	ENST00000394566.1	-	7	2573	c.2301C>T	c.(2299-2301)gcC>gcT	p.A767A	SLFN11_ENST00000308377.4_Silent_p.A767A	NM_001104587.1|NM_001104588.1|NM_001104589.1|NM_001104590.1	NP_001098057.1|NP_001098058.1|NP_001098059.1|NP_001098060.1	Q7Z7L1	SLN11_HUMAN	schlafen family member 11	767					defense response to virus (GO:0051607)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|tRNA binding (GO:0000049)			autonomic_ganglia(1)|breast(1)|kidney(3)|large_intestine(14)|lung(17)|ovary(1)|prostate(4)|skin(2)|stomach(5)|upper_aerodigestive_tract(2)	50		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GGGACCATTCGGCTTCAGGAA	0.443																																					p.A767A		Atlas-SNP	.											.	SLFN11	112	.	0			c.C2301T						PASS	.	G	,,,,	0,4406		0,0,2203	65.0	61.0	62.0		2301,2301,2301,2301,2301	1.7	0.0	17		62	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	SLFN11	NM_001104587.1,NM_001104588.1,NM_001104589.1,NM_001104590.1,NM_152270.3	,,,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,,,	767/902,767/902,767/902,767/902,767/902	33679780	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	91607	exon5			CCATTCGGCTTCA	AK074184	CCDS11294.1	17q12	2006-04-05			ENSG00000172716	ENSG00000172716			26633	protein-coding gene	gene with protein product		614953				12477932	Standard	NM_001104587		Approved	FLJ34922	uc010ctr.3	Q7Z7L1	OTTHUMG00000132948	ENST00000394566.1:c.2301C>T	chr17.hg19:g.33679780G>A		117.0	0.0	.		94.0	21.0	.	NM_152270	E1P643|Q8N3S8|Q8N762|Q8TEE0	Silent	SNP	ENST00000394566.1	hg19	CCDS11294.1																																																																																			.	.	.	weak		0.443	SLFN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256480.1	NM_152270	
PTPRM	5797	hgsc.bcm.edu	37	18	8379245	8379245	+	Silent	SNP	G	G	A			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr18:8379245G>A	ENST00000332175.8	+	26	4691	c.3654G>A	c.(3652-3654)cgG>cgA	p.R1218R	PTPRM_ENST00000400060.4_Silent_p.R1232R|PTPRM_ENST00000580170.1_Silent_p.R1231R|PTPRM_ENST00000400053.4_Silent_p.R1156R|PTPRM_ENST00000444013.1_Silent_p.R1005R	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	1218	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				AGAAAAACCGGTGCATGGACA	0.562																																					p.R1231R		Atlas-SNP	.											.	PTPRM	185	.	0			c.G3693A						PASS	.						138.0	108.0	118.0					18																	8379245		2203	4300	6503	SO:0001819	synonymous_variant	5797	exon28			AAACCGGTGCATG	X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.3654G>A	chr18.hg19:g.8379245G>A		73.0	0.0	.		107.0	22.0	.	NM_001105244	A7MBN1|D3DUH8|J3QL11	Silent	SNP	ENST00000332175.8	hg19	CCDS11840.1																																																																																			.	.	.	none		0.562	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		
PRTN3	5657	hgsc.bcm.edu	37	19	841048	841048	+	Silent	SNP	C	C	T			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr19:841048C>T	ENST00000234347.5	+	1	86	c.40C>T	c.(40-42)Ctg>Ttg	p.L14L	PRTN3_ENST00000544537.2_5'Flank	NM_002777.3	NP_002768.3	P24158	PRTN3_HUMAN	proteinase 3	14					collagen catabolic process (GO:0030574)|mature dendritic cell differentiation (GO:0097029)|negative regulation of phagocytosis (GO:0050765)|positive regulation of cell proliferation (GO:0008284)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			lung(1)|ovary(2)|urinary_tract(1)	4		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCGTCCGTGCTGCTGGCCTT	0.657																																					p.L14L		Atlas-SNP	.											.	PRTN3	9	.	0			c.C40T						PASS	.						32.0	30.0	31.0					19																	841048		2202	4300	6502	SO:0001819	synonymous_variant	5657	exon1			TCCGTGCTGCTGG		CCDS32860.1	19p13.3	2008-07-31	2008-07-31			ENSG00000196415			9495	protein-coding gene	gene with protein product	"""myeloblastin"", ""serine proteinase, neutrophil"", ""Wegener granulomatosis autoantigen"""	177020				2258701	Standard	NM_002777		Approved	PR-3, ACPA, C-ANCA, AGP7, MBT, P29	uc002lqa.1	P24158		ENST00000234347.5:c.40C>T	chr19.hg19:g.841048C>T		32.0	0.0	.		49.0	12.0	.	NM_002777	P15637|P18078|Q4VB08|Q4VB09|Q6LBM7|Q6LBN2|Q9UD25|Q9UQD8	Silent	SNP	ENST00000234347.5	hg19	CCDS32860.1																																																																																			.	.	.	none		0.657	PRTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457888.2	NM_002777	
HNRNPL	3191	hgsc.bcm.edu	37	19	39336576	39336576	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr19:39336576G>C	ENST00000221419.5	-	3	907	c.541C>G	c.(541-543)Cgc>Ggc	p.R181G	HNRNPL_ENST00000600873.1_Missense_Mutation_p.R48G|AC008982.2_ENST00000600473.1_RNA	NM_001533.2	NP_001524.2	P14866	HNRPL_HUMAN	heterogeneous nuclear ribonucleoprotein L	181					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			TCCCCAGGGCGGGAGATCTTC	0.542																																					p.R181G		Atlas-SNP	.											.	HNRNPL	67	.	0			c.C541G						PASS	.						117.0	115.0	115.0					19																	39336576		2203	4300	6503	SO:0001583	missense	3191	exon3			CAGGGCGGGAGAT	X16135	CCDS33015.1, CCDS33016.1	19q13.2	2013-06-12		2007-08-16	ENSG00000104824	ENSG00000104824		"""RNA binding motif (RRM) containing"""	5045	protein-coding gene	gene with protein product		603083		HNRPL		2687284	Standard	NM_001533		Approved		uc021uuh.1	P14866	OTTHUMG00000182612	ENST00000221419.5:c.541C>G	chr19.hg19:g.39336576G>C	ENSP00000221419:p.Arg181Gly	188.0	0.0	.		227.0	31.0	.	NM_001533	A6ND69|A6NIT8|Q9H3P3	Missense_Mutation	SNP	ENST00000221419.5	hg19	CCDS33015.1	.	.	.	.	.	.	.	.	.	.	G	16.02	3.004874	0.54254	.	.	ENSG00000104824	ENST00000221419;ENST00000388749;ENST00000388750;ENST00000423415;ENST00000536292	.	.	.	5.39	5.39	0.77823	Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	D	0.000000	T	0.69655	0.3135	M	0.74258	2.255	0.58432	D	0.999995	B	0.18461	0.028	B	0.20767	0.031	T	0.68812	-0.5310	9	0.66056	D	0.02	.	17.9088	0.88928	0.0:0.0:1.0:0.0	.	181	P14866	HNRPL_HUMAN	G	181;48;48;48;109	.	ENSP00000221419:R181G	R	-	1	0	HNRNPL	44028416	1.000000	0.71417	0.994000	0.49952	0.984000	0.73092	5.035000	0.64158	2.541000	0.85698	0.462000	0.41574	CGC	.	.	.	none		0.542	HNRNPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462670.1		
LILRA6	79168	hgsc.bcm.edu	37	19	54745734	54745734	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr19:54745734G>T	ENST00000396365.2	-	4	415	c.376C>A	c.(376-378)Ctc>Atc	p.L126I	LILRA6_ENST00000245621.5_Missense_Mutation_p.L126I|LILRA6_ENST00000440558.2_Missense_Mutation_p.L126I|LILRB3_ENST00000407860.2_Intron|LILRA6_ENST00000419410.2_Missense_Mutation_p.L126I|LILRA6_ENST00000270464.5_Missense_Mutation_p.L126I|LILRA6_ENST00000391735.3_Missense_Mutation_p.L126I	NM_024318.2	NP_077294	Q6PI73	LIRA6_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6	126					immune system process (GO:0002376)	integral component of membrane (GO:0016021)		p.L126F(2)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(20)|ovary(3)|skin(2)|urinary_tract(2)	38	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		AGGGCTGAGAGGGTGGGTTTG	0.567																																					p.L126I		Atlas-SNP	.											A2RRG4_HUMAN,NS,carcinoma,0,1	LILRA6	75	.	2	Substitution - Missense(2)	lung(2)	c.C376A						PASS	.						62.0	102.0	89.0					19																	54745734		2108	4294	6402	SO:0001583	missense	79168	exon4			CTGAGAGGGTGGG	AF041262	CCDS42610.1	19q13.4	2013-01-11	2005-05-17	2005-05-17	ENSG00000244482	ENSG00000244482		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15495	protein-coding gene	gene with protein product			"""leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 6"""	LILRB6		10941842	Standard	NM_024318		Approved	ILT8, CD85b		Q6PI73	OTTHUMG00000066635	ENST00000396365.2:c.376C>A	chr19.hg19:g.54745734G>T	ENSP00000379651:p.Leu126Ile	90.0	0.0	.		64.0	23.0	.	NM_024318		Missense_Mutation	SNP	ENST00000396365.2	hg19	CCDS42610.1	.	.	.	.	.	.	.	.	.	.	G	16.76	3.212570	0.58452	.	.	ENSG00000244482	ENST00000440558;ENST00000270464;ENST00000419410;ENST00000391735;ENST00000421123;ENST00000396365;ENST00000245621	T;T;T;T;T;T	0.01981	5.38;5.38;5.38;4.52;5.38;5.38	3.4	3.4	0.38934	Immunoglobulin-like fold (1);	0.278862	0.25747	N	0.028562	T	0.11153	0.0272	M	0.81942	2.565	0.23546	N	0.997443	D;P;D;D;D;D	0.76494	0.995;0.947;0.982;0.997;0.997;0.999	D;D;D;D;D;D	0.81914	0.986;0.959;0.949;0.987;0.995;0.995	T	0.00984	-1.1491	10	0.87932	D	0	.	10.5189	0.44907	0.0:0.0:1.0:0.0	.	126;126;126;126;126;126	C9JFH3;Q6PI73-2;Q6PI73;F8WCY4;D3YTC4;F8W6G6	.;.;LIRA6_HUMAN;.;.;.	I	126	ENSP00000390120:L126I;ENSP00000270464:L126I;ENSP00000411227:L126I;ENSP00000375615:L126I;ENSP00000379651:L126I;ENSP00000245621:L126I	ENSP00000245621:L126I	L	-	1	0	LILRA6	59437546	0.011000	0.17503	0.553000	0.28255	0.078000	0.17371	1.276000	0.33156	1.936000	0.56123	0.184000	0.17185	CTC	.	.	.	none		0.567	LILRA6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313725.1	NM_024318	
KRTAP10-3	386682	hgsc.bcm.edu	37	21	45978127	45978127	+	Missense_Mutation	SNP	C	C	T	rs369545090		TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr21:45978127C>T	ENST00000391620.1	-	1	516	c.472G>A	c.(472-474)Gtg>Atg	p.V158M	TSPEAR_ENST00000323084.4_Intron|TSPEAR_ENST00000397916.1_Intron	NM_198696.2	NP_941969.2	P60369	KR103_HUMAN	keratin associated protein 10-3	158	18 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				kidney(1)|lung(4)|prostate(1)|skin(1)	7						AGGAGGGACACGGAGGAGGAG	0.692																																					p.V158M		Atlas-SNP	.											.	KRTAP10-3	17	.	0			c.G472A						PASS	.	C	MET/VAL,	1,4405	2.1+/-5.4	0,1,2202	89.0	96.0	93.0		472,	2.6	0.6	21		93	1,8599	1.2+/-3.3	0,1,4299	no	missense,intron	TSPEAR,KRTAP10-3	NM_198696.2,NM_144991.2	21,	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging,	158/222,	45978127	2,13004	2203	4300	6503	SO:0001583	missense	386682	exon1			GGGACACGGAGGA	AJ566383	CCDS42956.1	21q22.3	2007-10-05			ENSG00000212935	ENSG00000212935		"""Keratin associated proteins"""	22968	protein-coding gene	gene with protein product				KRTAP18-3			Standard	NM_198696		Approved	KAP10.3, KAP18.3	uc002zfj.1	P60369	OTTHUMG00000057628	ENST00000391620.1:c.472G>A	chr21.hg19:g.45978127C>T	ENSP00000375478:p.Val158Met	162.0	0.0	.		152.0	31.0	.	NM_198696	A3KN67|Q70LJ4	Missense_Mutation	SNP	ENST00000391620.1	hg19	CCDS42956.1	.	.	.	.	.	.	.	.	.	.	c	3.276	-0.148013	0.06627	2.27E-4	1.16E-4	ENSG00000212935	ENST00000391620	T	0.01438	4.89	3.53	2.61	0.31194	.	.	.	.	.	T	0.05823	0.0152	M	0.84948	2.725	0.09310	N	1	D	0.59357	0.985	P	0.53593	0.73	T	0.14144	-1.0483	9	0.59425	D	0.04	.	9.6661	0.39986	0.0:0.5593:0.4407:0.0	.	158	P60369	KR103_HUMAN	M	158	ENSP00000375478:V158M	ENSP00000375478:V158M	V	-	1	0	KRTAP10-3	44802555	0.060000	0.20803	0.577000	0.28562	0.005000	0.04900	0.116000	0.15561	0.772000	0.33382	0.561000	0.74099	GTG	.	.	.	weak		0.692	KRTAP10-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128031.1		
GTSE1	51512	hgsc.bcm.edu	37	22	46724721	46724721	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chr22:46724721A>C	ENST00000454366.1	+	10	2073	c.1861A>C	c.(1861-1863)Aaa>Caa	p.K621Q		NM_016426.6	NP_057510	Q9NYZ3	GTSE1_HUMAN	G-2 and S-phase expressed 1	602					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|microtubule-based process (GO:0007017)	cytoplasmic microtubule (GO:0005881)|membrane (GO:0016020)				NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	27		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00462)		TACTTTCTCCAAAAGTACTGC	0.567																																					p.K621Q	GBM(153;542 1915 12487 29016 50495)	Atlas-SNP	.											.	GTSE1	100	.	0			c.A1861C						PASS	.						88.0	95.0	93.0					22																	46724721		2203	4300	6503	SO:0001583	missense	51512	exon10			TTCTCCAAAAGTA	AF223408	CCDS14074.2	22q13.2-q13.3	2008-06-10			ENSG00000075218	ENSG00000075218			13698	protein-coding gene	gene with protein product		607477				10974554, 10984615, 12750368	Standard	NM_016426		Approved	GTSE-1, B99	uc011aqy.2	Q9NYZ3	OTTHUMG00000150486	ENST00000454366.1:c.1861A>C	chr22.hg19:g.46724721A>C	ENSP00000415430:p.Lys621Gln	226.0	0.0	.		255.0	43.0	.	NM_016426	B0QYM3|Q20WK2|Q53GX5|Q5R3I6|Q6DHX4|Q9BRE0|Q9UGZ9|Q9Y557	Missense_Mutation	SNP	ENST00000454366.1	hg19	CCDS14074.2	.	.	.	.	.	.	.	.	.	.	A	7.057	0.565524	0.13560	.	.	ENSG00000075218	ENST00000454366;ENST00000361934	T	0.07021	3.23	4.41	-0.765	0.11023	.	0.925293	0.09363	N	0.812463	T	0.03871	0.0109	N	0.12471	0.22	0.09310	N	1	B;B	0.25312	0.123;0.123	B;B	0.21360	0.023;0.034	T	0.45687	-0.9244	10	0.25751	T	0.34	-5.7757	4.1358	0.10170	0.3102:0.4118:0.278:0.0	.	602;581	Q9NYZ3;B4DZT6	GTSE1_HUMAN;.	Q	621;581	ENSP00000415430:K621Q	ENSP00000354634:K581Q	K	+	1	0	GTSE1	45103385	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.240000	0.08952	-0.032000	0.13758	0.533000	0.62120	AAA	.	.	.	none		0.567	GTSE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318360.2	NM_016426	
MT-CO3	4514	hgsc.bcm.edu	37	M	9487	9487	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chrM:9487T>C	ENST00000362079.2	+	1	281	c.281T>C	c.(280-282)tTc>tCc	p.F94S	MT-TL2_ENST00000387456.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TH_ENST00000387441.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-ND4L_ENST00000361335.1_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TK_ENST00000387421.1_RNA|MT-TD_ENST00000387419.1_RNA			P00414	COX3_HUMAN	mitochondrially encoded cytochrome c oxidase III	94			Missing (in MT-C4D; with RM-MT). {ECO:0000269|PubMed:8630495}.		aerobic electron transport chain (GO:0019646)|cellular metabolic process (GO:0044237)|respiratory chain complex IV assembly (GO:0008535)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)			breast(1)|endometrium(10)|kidney(14)|lung(1)|urinary_tract(1)	27						AGTTTTTTTCTTCGCAGGATT	0.507																																					p.F94S		Atlas-SNP	.											.	.	.	.	0			c.T281C						PASS	.																																			SO:0001583	missense	5742	exon1			TTTTCTTCGCAGG			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198938	ENSG00000198938		"""Mitochondrial respiratory chain complex / Complex IV"""	7422	protein-coding gene	gene with protein product		516050	"""cytochrome c oxidase III"""	MTCO3			Standard			Approved	COX3, COIII, CO3		P00414		ENST00000362079.2:c.281T>C	chrM.hg19:g.9487T>C	ENSP00000354982:p.Phe94Ser	11.0	0.0	.		11.0	7.0	.	ENST00000362079	Q14Y83	Missense_Mutation	SNP	ENST00000362079.2	hg19																																																																																				.	.	.	none		0.507	MT-CO3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024032	
MT-ND4	4538	hgsc.bcm.edu	37	M	11493	11493	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chrM:11493G>A	ENST00000361381.2	+	1	734	c.734G>A	c.(733-735)cGc>cAc	p.R245H	MT-TL2_ENST00000387456.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TG_ENST00000387429.1_RNA			P03905	NU4M_HUMAN	mitochondrially encoded NADH dehydrogenase 4	245					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|prostate(1)	13						TGGTATAATACGCCTCACACT	0.478																																					p.R245H		Atlas-SNP	.											.	.	.	.	0			c.G734A						PASS	.																																			SO:0001583	missense	0	exon1			TAATACGCCTCAC			mitochondria	2014-02-03	2005-02-15	2005-02-16	ENSG00000198886	ENSG00000198886	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7459	protein-coding gene	gene with protein product	"""complex I ND4 subunit"", ""NADH-ubiquinone oxidoreductase chain 4"""	516003	"""NADH dehydrogenase 4"", ""Leber optic neuropathy"""	MTND4, LHON		8103501	Standard			Approved	ND4, NAD4		P03905		ENST00000361381.2:c.734G>A	chrM.hg19:g.11493G>A	ENSP00000354961:p.Arg245His	5.0	0.0	.		18.0	13.0	.	ENST00000361381	Q6RL39|Q6RQN9|Q8HNR8	Missense_Mutation	SNP	ENST00000361381.2	hg19																																																																																				.	.	.	none		0.478	MT-ND4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024035	
MT-ND6	4541	hgsc.bcm.edu	37	M	14466	14466	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5888-01A-11D-1589-08	TCGA-BQ-5888-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	31e068e4-adc9-4148-b785-8deb4ef1637a	2d3ada40-7a55-492a-9f70-0cfe97cc66ea	g.chrM:14466T>C	ENST00000361681.2	-	1	207	c.208A>G	c.(208-210)Act>Gct	p.T70A	MT-CYB_ENST00000361789.2_5'Flank|MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA			P03923	NU6M_HUMAN	mitochondrially encoded NADH dehydrogenase 6	70					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain (GO:0070469)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(10)|kidney(17)|urinary_tract(1)	29						CATCGCTGTAGTATATCCAAA	0.438																																					p.T70A		Atlas-SNP	.											.	.	.	.	0			c.A208G						PASS	.																																			SO:0001583	missense	0	exon1			CTGTAGTATATCC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198695	ENSG00000198695	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7462	protein-coding gene	gene with protein product	"""complex I ND6 subunit"", ""NADH-ubiquinone oxidoreductase chain 6"""	516006	"""NADH dehydrogenase 6"""	MTND6			Standard			Approved	NAD6, ND6		P03923		ENST00000361681.2:c.208A>G	chrM.hg19:g.14466T>C	ENSP00000354665:p.Thr70Ala	19.0	0.0	.		19.0	4.0	.	ENST00000361681	Q34774|Q8HG30	Missense_Mutation	SNP	ENST00000361681.2	hg19																																																																																				.	.	.	none		0.438	MT-ND6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024037	
